Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
  • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
  • A61P31/14—Antivirals for RNA viruses
  • A61P31/18—Antivirals for RNA viruses for HIV
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
  • C12Q1/44—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving esterase
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6869—Methods for sequencing
  • C12Q1/6874—Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation

Definitions

• Site-specific endonucleases theoretically allow for the targeted manipulation of a single site within a genome, and are useful in the context of gene targeting as well as for therapeutic applications.
• site-specific endonucleases for example, zinc-finger nucleases (ZFNs)
• ZFNs zinc-finger nucleases
• NCT00842634 two ZFNs have recently entered clinical trials: one, CCR5-2246, targeting a human CCR-5 allele as part of an anti-HIV therapeutic approach
• NCTO 1044654 NCTO 1252641
• VF24684 targeting the human VEGF-A promoter as part of an anti-cancer therapeutic approach
• This invention is at least partly based on the recognition that the reported toxicity of some engineered site-specific endonucleases is based on off-target DNA cleavage, rather than on off-target binding alone.
• Information about the specificity of site-specific nucleases to date has been based on the assumptions that (i) dimeric nucleases cleave DNA with the same sequence specificity with which isolated monomelic domains bind DNA; and that (ii) the binding of one domain does not influence the binding of the other domain in a given dimeric nuclease.
• No study to date has reported a method for determining the broad DNA cleavage specificity of active, dimeric site-specific nucleases. Such a method would not only be useful in determining the DNA cleavage specificity of nucleases but would also find use in evaluating the cleavage specificity of other DNA cleaving agents, such as small molecules that cleave DNA.
• This invention addresses the shortcomings of previous attempts to evaluate and characterize the sequence specificity of site-specific nucleases, and in particular of nucleases that dimerize or multimenze in order to cleave their target sequence.
• Some aspects of this invention provide an in vitro selection method to broadly examine the cleavage specificity of active nucleases.
• the invention provide methods of identifying suitable nuclease target sites that are sufficiently different from any other site within a genome to achieve specific cleavage by a given nuclease without any or at least minimal off- target cleavage.
• the invention provide methods of evaluating, selecting, and/or designing site specific nucleases with enhanced, specificity as compared to current nucleases.
• compositions and kits useful in the practice of the inventive methods are also provided.
• the provided methods, compositions and kits are also useful in the evaluation, design, and selection of other nucleic acid (e.g., DNA) cleaving agents as would be appreciated by one of skill in the art.
• the invention provides nucleases and other nucleic acid cleaving agents designed or selected using the provided system. Isolated ZFNs and TALENs designed, evaluated, or selected according to methods provided herein and pharmaceutical compositions comprising such nucleases are also provided.
• Some aspects of this invention provide a method for identifying a target site of a nuclease.
• the method comprises (a) providing a nuclease that cuts a double-stranded nucleic acid target site and creates a 5' overhang, wherein the target site comprises a [left-half site]-[spacer sequence]-[right-half site] (LSR) structure, and the nuclease cuts the target site within the spacer sequence.
• LSR right-half site
• the method comprises (b) contacting the nuclease with a library of candidate nucleic acid molecules, wherein each nucleic acid molecule comprises a concatemer of a sequence comprising a candidate nuclease target site and a constant insert sequence, under conditions suitable for the nuclease to cut a candidate nucleic acid molecule comprising a target site of the nuclease.
• the method comprises (c) filling in the 5' overhangs of a nucleic acid molecule that has been cut twice by the nuclease and comprises a constant insert sequence flanked by a left half-site and cut spacer sequence on one side, and a right half-site and cut spacer sequence on the other side, thereby creating blunt ends.
• the method comprises (d) identifying the nuclease target site cut by the nuclease by determining the sequence of the left-half site, the right-half-site, and/or the spacer sequence of the nucleic acid molecule of step (c).
• determining the sequence of step (d) comprises ligating sequencing adapters to the blunt ends of the nucleic acid molecule of step (c) and amplifying and/or sequencing the nucleic acid molecule.
• the method comprises amplifying the nucleic acid molecule after ligation of the sequencing adapters via PCR.
• the method further comprises a step of enriching the nucleic acid molecules of step (c) or step (d) for molecules comprising a single constant insert sequence.
• the step of enriching comprises a size fractionation.
• the size fractionation is done by gel purification.
• the method further comprises discarding any sequences determined in step (d) if the nucleic acid molecule did not comprise a complementary pair of filled-in 5' overhangs. In some embodiments, the method further comprises compiling a plurality of nuclease target sites identified in step (d), thereby generating a nuclease target site profile. In some embodiments, the nuclease is a therapeutic nuclease which cuts a specific nuclease target site in a gene associated with a disease.
• the method further comprises determining a maximum concentration of the therapeutic nuclease at which the therapeutic nuclease cuts the specific nuclease target site, and does not cut more than 10, more than 5, more than 4, more than 3, more than 2, more than 1 , or no additional nuclease target sites. In some embodiments, the method further comprises administering the therapeutic nuclease to a subject in an amount effective to generate a final concentration equal or lower than the maximum concentration. In some embodiments, the nuclease comprises an unspecific nucleic acid cleavage domain. In some embodiments, the nuclease comprises a Fokl cleavage domain.
• the nuclease comprises a nucleic acid cleavage ⁇ domain that cleaves a target sequence upon cleavage domain dimerization. In some embodiments, the nuclease comprises a binding domain that specifically binds a nucleic acid sequence. In some embodiments, the binding domain comprises a zinc finger. In some embodiments, the binding domain comprises at least 2, at least 3, at least 4, or at least 5 zinc fingers. In some embodiments, the nuclease is a Zinc Finger Nuclease. In some
• the binding domain comprises a Transcriptional Activator-Like Element.
• the nuclease is a Transcriptional Activator-Like Element Nuclease (TALEN).
• TALEN Transcriptional Activator-Like Element Nuclease
• the nuclease comprises an organic compound.
• the nuclease comprises an enediyne.
• the nuclease is an antibiotic.
• the compound is dynemicin, neocarzinostatin,
• the nuclease is a homing endonuclease.
• a library of nucleic acid molecules comprises a plurality of nucleic acid molecules, wherein each nucleic acid molecule comprises a concatemer of a candidate nuclease target site and a constant insert sequence spacer sequence.
• the candidate nuclease target site comprises a [left-half site]-[spacer sequence] -[right-half site] (LSR) structure.
• LSR right-half site
• the left-half site and/or the right-half site is between 10-18 nucleotides long.
• the library comprises candidate nuclease target sites that can be cleaved by a nuclease comprising a Fokl cleavage domain.
• the library comprises candidate nuclease target sites that can be cleaved by a Zinc Finger Nuclease (ZFN), a Transcription Activator-Like Effector Nuclease (TALEN), a homing endonuclease, an organic compound nuclease, an enediyne, an antibiotic nuclease, dynemicin, neocarzinostatin, calicheamicin, esperamicin, and/or
• ZFN Zinc Finger Nuclease
• TALEN Transcription Activator-Like Effector Nuclease
• a homing endonuclease an organic compound nuclease, an enediyne, an antibiotic nuclease, dynemicin, neocarzin
• the library comprises at least 10 , at least 10 , at least 10 , at least 10 8 , at least 10 9 , at least 10 10 , at least 10", or at least 10 12 different candidate nuclease target sites.
• the library comprises nucleic acid molecules of a molecular weight of at least 5 kDa, at least 6 kDa, at least 7 kDa, at least 8 kDa, at least 9 kDa, at least 10 kDa, at least 12 kDa, or at least 15kDa.
• the candidate nuclease target sites comprise a partially randomized left-half site, a partially randomized right-half site, and/or a partially randomized spacer sequence.
• the library is templated on a known target site of a nuclease of interest.
• the nuclease of interest is a ZFN, a TALEN, a homing endonuclease, an organic compound nuclease, an enediyne, an antibiotic nuclease, dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin, or a derivative thereof.
• partial randomized sites differ from the consensus site by more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, or more than 30% on average, distributed binomially. In some embodiments, partial randomized sites differ from the consensus site by no more than 10%, no more than 15%, no more than 20%, no more than 25%, nor more than 30%, no more than 40%, or no more than 50% on average, distributed binomially. In some embodiments, the candidate nuclease target sites comprise a randomized spacer sequence.
• Some aspects of this invention provide methods of selecting a nuclease based on an evaluation of cleavage specificity.
• a method of selecting a nuclease that specifically cuts a consensus target site from a plurality of nucleases comprises (a) providing a plurality of candidate nucleases that cut the same consensus sequence; (b) for each of the candidate nucleases of step (a), identifying a nuclease target site cleaved by the candidate nuclease that differ from the consensus target site; and (c) selecting a nuclease based on the nuclease target site(s) identified in step (b).
• the nuclease selected in step (c) is the nuclease that cleaves the consensus target site with the highest specificity. In some embodiments, the nuclease that cleaves the consensus target site with the highest specificity is the candidate nuclease that cleaves the lowest number of target sites that differ from the consensus site. In some embodiments, the candidate nuclease that cleaves the consensus target site with the highest specificity is the candidate nuclease that cleaves the lowest number of target sites that are different from the consensus site in the context of a target genome. In some
• the candidate nuclease selected in step (c) is a nuclease that does not cleave any target site other than the consensus target site. In some embodiments, the candidate nuclease selected in step (c) is a nuclease that does not cleave any target site other than the consensus target site within the genome of a subject at a therapeutically effective concentration of the nuclease. In some embodiments, the method further comprises contacting a genome with the nuclease selected in step (c).
• the genome is a vertebrate, mammalian, human, non-human primate, rodent, mouse rat, hamster, goat, sheep, cattle, dog, cat, reptile, amphibian, fish, nematode, insect, or fly genome.
• the genome is within a living cell
• the genome is within a subject.
• the consensus target site is within an allele that is associated with a disease or disorder.
• cleavage of the consensus target site results in treatment or prevention of the disease or disorder.
• cleavage of the consensus target site results in the alleviation of a symptom of the disease or disorder.
• the disease is HIV/AIDS, or a proliferative disease.
• the allele is a CCR5 or VEGFA allele.
• Some aspects of this invention provide a method for selecting a nuclease target site within a genome.
• the method comprises (a) identifying a candidate nuclease target site; and (b) using a general purpose computer, comparing the candidate nuclease target site to other sequences within the genome, wherein if the candidate nuclease target site differs from any other sequence within the genome by at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides, selecting the candidate nuclease site.
• the candidate nuclease target site comprises a [left-half site]-[spacer sequence]-[right-half site] (LSR) structure.
• the left-half site and/or the right-half site is 10-18 nucleotides long. In some embodiments, the spacer is 10-24 nucleotides long. In some embodiments, the method further comprises designing and/or generating a nuclease targeting the candidate nuclease site selected in step (b). In some embodiments, designing and/or generating is done by recombinant technology. In some embodiments, designing and/or generating comprises designing a binding domain that specifically binds the selected candidate target site, or a half-site thereof. In some embodiments, designing and/or generating comprises conjugating the binding domain with a nucleic acid cleavage domain.
• the nucleic acid cleavage domain is a non-specific cleavage domain and/or wherein the nucleic acid cleavage domain must dimerize or multimerize in order to cut a nucleic acid.
• the nucleic acid cleavage domain comprises a Fokl cleavage domain.
• the method further comprises isolating the nuclease.
• the nuclease is a Zinc Finger Nuclease (ZFN) or a Transcription Activator-Like Effector Nuclease (TALEN), a homing endonuclease, or is or comprises an organic compound nuclease, an enediyne, an antibiotic nuclease, dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin, or a derivative thereof.
• the candidate target site is within a genomic sequence the cleavage of which is known to be associated with an alleviation of a symptom of a disease or disorder.
• the disease is HIV/AIDS, or a proliferative disease.
• the genomic sequence is a CCR5 or VEGFA sequence.
• an isolated nuclease is provided that has been engineered to cleave a target site within a genome, wherein the nuclease has been selected according to any of the selection methods described herein.
• an isolated nuclease is provided that cuts a target site selected according to any of the methods described herein.
• an isolated nuclease is provided that is designed or engineered according to any of the concepts or parameters described herein.
• the nuclease is a Zinc Finger Nuclease (ZFN) or a Transcription Activator-Like Effector Nuclease (TALEN), a homing endonuclease, or is or comprises an organic compound nuclease, an enediyne, an antibiotic nuclease, dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin, or a derivative thereof.
• ZFN Zinc Finger Nuclease
• TALEN Transcription Activator-Like Effector Nuclease
• a homing endonuclease or is or comprises an organic compound nuclease, an enediyne, an antibiotic nuclease, dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin, or a derivative thereof.
• kits comprising nucleases and nuclease compositions.
• a kit is provided that comprises an isolated nuclease described herein.
• the kit further comprises a nucleic acid comprising a target site of the isolated nuclease.
• the kit comprises an excipient and instructions for contacting the nuclease with the excipient to generate a composition suitable for contacting a nucleic acid with the nuclease.
• the nucleic acid is a genome or part of a genome.
• the genome is within a cell.
• the excipient is a pharmaceutically acceptable excipient.
• compositions comprising a nuclease or a nucleic acid encoding a nuclease as described herein.
• pharmaceutical composition for administration to a subject is provided.
• the composition comprises an isolated nuclease described herein or a nucleic acid encoding such a nuclease and a pharmaceutically acceptable excipient.
• FIG. 1 In vitro selection for ZFN-mediated cleavage.
• Pre-selection library members are concatemers (represented by arrows) of identical ZFN target sites lacking 5' phosphates.
• ZFN cleavage reveals a 5' phosphate, which is required for sequencing adapter ligation.
• the only sequences that can be amplified by PCR using primers complementary to the adapters are sequences that have been cleaved twice and have adapters on both ends. DNA cleaved at adjacent sites are purified by gel electrophoresis and sequenced.
• a computational screening step after sequencing ensures that the filled-in spacer sequences (S and S') are complementary and therefore from the same molecule.
• VF2468 ZFNs The heat maps show specificity scores compiled from all sequences identified in selections for cleavage of 14 nM of DNA library with (a) 2 nM CCR5-224 or (b) 1 nM VF2468.
• the target DNA sequence is shown below each half-site.
• Black boxes indicate target base pairs. Specificity scores were calculated by dividing the change in frequency of each base pair at each position in the post-selection DNA pool compared to the pre-selection pool by the maximal possible change in frequency from pre-selection library to post-selection library of each base pair at each position. Blue boxes indicate enrichment for a base pair at a given position, white boxes indicate no enrichment, and red boxes indicate enrichment against a base pair at a given position.
• FIG. 3 Evidence for a compensation model of ZFN target site recognition.
• the heat maps show the changes in specificity score upon mutation at the black-boxed positions in selections with (a) 2 nM CCR5-224 or (b) 1 nM VF2468. Each row corresponds to a different mutant position (explained graphically in Fig. 12). Sites are listed in their genomic orientation; the (+) half-site of CCR5-224 and the (+) half-site of VF2468 are therefore listed as reverse complements of the sequences found in Figure 2. Shades of blue indicate increased specificity score (more stringency) when the black boxed position is mutated and shades of red indicate decreased specificity score (less stringency).
• FIG. 4 ZFNs can cleave a large fraction of target sites with three or fewer mutations in vitro.
• the percentages of the sequences with one, two, or three mutations that are enriched for in vitro cleavage (enrichment factor > 1) by the (a) CCR5-224 ZFN and (b) VF2468 ZFN are shown.
• Enrichment factors are calculated for each sequence identified in the selection by dividing the observed frequency of that sequence in the post- selection sequenced library by the frequency of that sequence in the pre-selection library.
• Figure 5 In vitro synthesis of target site library.
• Library members consist of a partially randomized left-half site (L), a fully randomized 4-7 nucleotide spacer sequence (S), and a partially randomized right-half site (R).
• Library members present on DNA primers were incorporated into a linear -545 base pair double-stranded DNA by PCR.
• a primer with a library member L S R
• L*S*R* a different library member
• T4 DNA polymerase removed mismatched library members and replaced them with complementary, matched library members (L'S'R').
• L'S'R' complementary, matched library members
• the library DNA was subjected to blunt-end ligation, resulting in a mixture of linear and circular monomelic and multimeric species. Circular monomers were purified by gel electrophoresis and concatenated through rolling-circle amplification with ⁇ 29 DNA polymerase.
• CCR5-224 and VF2468 are shown (a) for the ZFN samples used in the in vitro selection, and (b) for quantification, (c) Known quantities of N-terminal FLAG-tagged bacterial alkaline phosphatase (FLAG-BAP) were used to generate a standard curve for ZFN quantification. Diamonds represent the intensities of FLAG-BAP standards from the Western blot shown in (b), plus signs represent the intensities of bands of ZFNs, and the line shows the best-fit curve of FLAG-BAP standards that was used to quantify ZFNs. (d) Gels are shown of activity assays of CCR5-224 and VF2468 on an 8 nM linear substrate containing one target cleavage site.
• the ZFNs were each incubated with their respective substrate for 4 hours at 37°C. DNA in the "+ lysate" lane was incubated with an amount of in vitro transcription/translation mixture equivalent to that used in the 2.5 nM ZFN reaction. ZFN-mediated cleavage results in two linear fragments approximately 700 bp and300 bp in length. 2 nM CCR5-224 and 1 nM VF2468 were the amounts required for 50% cleavage of the linear substrate.
• FIG. 7 Library cleavage with ZFNs. Cleavage of 1 ⁇ g of concatemeric libraries of CCR5-224 (a) or VF2468(b) target sites are shown with varying amounts CCR5- 224 or VF2468, respectively.
• the lane labeled "+lysate” refers to pre-selection concatemeric library incubated with the volume of in vitro transcription/translation mixture contained in the samples containing 4 nM CCR5-224 or 4 nM ofVF2468. Uncut DNA, which would be observed in the "+ lysate" lane, is of. length >12 kb and is lost upon purification due to its size and therefore is not present on the gel.
• the lane labeled "+PvuI" is a digest of the preselection library at Pvul sites introduced adjacent to library members.
• the laddering on the gels results from cleavage of pre-selection DNA concatemers at more than one site. There is a dose dependent increase in the amount of the bottom band, which corresponds to cleavage at two adjacent library sites in the same pre-selection DNA molecule.
• This bottom band of DNA was enriched by PCR and gel purification before sequencing.
• FIG. 9 Cleavage efficiency of individual sequences is related to selection stringency.
• In vitro DNA digests were performed on sequences identified in selections of varying stringencies (marked with 'X's).
• 2 nM CCR5-224 (a) or 1 nM VF2468 (b) was incubated with 8 nM of linear substrate containing the sequence shown.
• the 1 kb linear substrate contained a single cleavage site with the spacer sequence found in the genomic target of CCR5-224 ("CTGAT") or VF2468 (“TCGAA”) and the indicated (+) and (-) half-sites. Mutant base pairs are represented with lowercase letters.
• CCR5-224 sites and VF2468 sites that were identified in the highest stringency selections are cleaved most efficiently, while sites that were identified only in the lowest stringency selections (4 nM ZFN) are cleaved least efficiently.
• VF2468 ZFNs The heat maps show specificity scores for the cleavage of 14 nM of total DNA library with varying amounts of (a) CCR5-224 or (b) VF2468.
• the target DNA sequence is shown below each half-site.
• Black boxes indicate target base pairs. Specificity scores were calculated by dividing the change in frequency of each base pair at each position in the post-selection DNA pool compared to the pre-selection pool by the maximal possible change in frequency of each base pair at each position. Blue boxes indicate specificity for a base pair at a given position, white boxes indicate no specificity, and red boxes indicate specificity against a base pair at a given position.
• Specificity scores were calculated by dividing the change in frequency of each base pair at each position in the post-selection DNA pool compared to the pre-selection pool by the maximal possible change in frequency of each base pair at each position.
• Blue boxes indicate specificity for a base pair at a given position
• white boxes indicate no specificity
• red boxes indicate specificity against a base pair at a given position.
• FIG. 12 Data processing steps used to create mutation compensation difference maps. The steps to create each line of the difference map in Figure 3 are shown for the example of a mutation at position (-)A3.
• Heat maps of the type described in Fig. 11 are condensed into one line to show only the specificity scores for intended target site nucleotides (in black outlined boxes in Fig. 11).
• the condensed heat maps are then compared to a condensed heat map corresponding to the unfiltered baseline profile from Figure 2, to create a condensed difference heat map that shows the relative effect of mutation at the position specified by the white box with black outline on the specificity score profile.
• (+) half-site difference map is reversed to match the orientation of the (+) half-site as it is found in the genome rather than as it is recognized by the zinc finger domain of the ZFN.
• FIG. 14 ZFN cleavage occurs at characteristic locations in the DNA target site.
• the plots show the locations of cleavage sites identified in the in vitro selections with (a) 4 nM CCR5-224 or (b) 4 nM VF2468.
• the cleavage site locations show similar patterns for both ZFNs except in the case of five-base pair spacers with four-base overhangs.
• the titles refer to the spacer length/overhang length combination that is plotted (e.g., a site with a six base-pair spacer and a four base overhang is referred to as "6/4").
• the black bars indicate the relative number of sequences cleaved for each combination of spacer length and overhang length.
• 'P' refers to nucleotides in the (+) target half-site
• 'M' refers to nucleotides in the (-) target half site
• 'N' refers to nucleotides in the spacer.
• FIG. 15 CCR5-224 preferentially cleaves five- and six-base pair spacers and cleaves five-base pair spacers to leave five-nucleotide overhangs.
• the heat maps show the percentage of all sequences surviving each of the four CCR5-224 in vitro selections (a-d) that have the spacer and overhang lengths shown.
• VF2468 preferentially cleaves five- and six-base pair spacers, cleaves five-base pair spacers to leave five-nucleotide overhangs, and cleaves six-base pair spacers to leave four-nucleotide overhangs.
• the heat maps show the percentage of all sequences surviving each of the four VF2468 in vitro selections (a-d) that have the spacer and overhang lengths shown.
• CCR5-224 (a-c) and VF2468 (d-f) show increased specificity for half-sites flanking four- and seven-base pair spacers than for half-sites flanking five- and six-base pair spacers.
• one half-site has a greater change in mutational tolerance than the other, and the change in mutational tolerance is concentration dependent.
• Figure 18 Model for ZFN tolerance of off-target sequences. Our results suggest that some ZFNs recognize their intended target sites (top, black DNA strands with no Xs) with more binding energy than is required for cleavage under a given set of conditions (dotted line). Sequences with one or two mutations (one or two Xs) are generally tolerated since they do not decrease the ZFN:DNA binding energy below the threshold necessary for cleavage. Some sequences with additional mutations can still be cleaved if the additional mutations occur in regions of the zinc-finger binding interface that have already been disrupted (three Xs above the dotted line), as long as optimal interactions present at other locations in the ZFN:DNA binding interface maintain binding energies above threshold values. Additional mutations that disrupt key interactions at other locations in the ZFN:DNA interface, however, result in binding energies that fall short of the cleavage threshold.
• Figure 19 Profiling The Specificity of TAL Nucleases. Selection 1 : +28 vs.
• Figure 20 Structure of TAL DNA binding domain and RVDs.
• Figure 21 Mutations in target sites from TALN selection.
• the +28 linker enriched for cleaved sequences with less mutations suggesting the +28 linker is more specific. There are significantly less mutations in the post-selected sequences compared to the pre-selection library sequences indicating a successful selection
• Figure 23 TALN Cleavage Dependence on DNA Spacer Length. There is a similar preference for cut site spacer lengths in our in vitro selection compared to previous studies. In vitro, TALN cleavage. Dependence on Linker Length & Spacer Length from Mussolino (201 1).
• Figure 24 Specificity score at individual bases.
• Figure 25 Specificity score at individual bases. There is variable specificity at each individual position again with +28 linker demonstrating significantly better specificity
• Figure 26 Compensating Difference in Specificity of TALNs Analysis.
• Figure 27 Compensating Difference in Specificity of LI 6 R 16 TALN. A single mutation in the cleavage site does not alter the distribution of other mutations suggesting that the TAL repeat domains bind independently
• Figure 35 DNA spacer profile. While the vast majority of sequences have a spacer preference, the highly mutant sequences have no significant spacer preference as might be expected from alternate frames changing the spacer length.
• Figure 36 Cleavage point profile. While the vast majority of sequences are cut in the spacer as expected, the R 16 LI 6 highly mutant sequences are not predominately cut in spacer but the L10 R10 ones are cut in the spacer possibly indicative of a frame-shifted binding site leading to productive spacer cutting.
• Figure 37 Highly Mutant Half Sites in LI 0 R10 TALN Pair. Many potential binding sites in frames outside of the intended frame have sites more similar to the intended target.
• Figure 40 Highly Mutant Half Sites in LI 6 R16 TALN Pair.
• the highly mutant sequences from LI 6 R16 cannot be explained by a frame-shift (left figure), have no DNA Spacer preference (see slide 1 1) and seem to be cutting more often outside of the DNA
• Figure 42 Compensating Difference in Specificity of LI 6 Rl 6 TALN. A single mutation in the cleavage site does not alter the distribution of other mutations suggesting that the TAL repeat domains bind independently.
• Figure 43 Enrichment of Mutations in Full, Total Target Site of TALN Pairs.
• Figure 44 TALN Off-Target Sites in the Human Genome.
• Figure 45 TALN Off-Target Sites Predicted Cleavage.
• Figure 48 TALN Off-Target Sites Predicted Cleavage For Sequences (Not just Number of Mutations). Combining the regular log decrease of cleavage efficiency (enrichment) as total target site mutations increase and the enrichment at each position we should be able to predict the off-target site cleavage of any sequence.
• Figure 49 Comparing TALNs vs. ZFNs. For the most part, in the TALN selection the enrichment is dependent on the total mutations in both half sites and not on the distribution of mutations between half sites like for zinc finger nucleases (ZFN). This observation combined with the context dependent binding of ZFNs potentially make ZFN far less specific than their TAL equivalents.
• nucleic acid molecules refers to a nucleic acid molecule that contains multiple copies of the same DNA sequences linked in a series.
• a concatemer comprising ten copies of a specific sequence of nucleotides (e.g., [ ⁇ ] ⁇ ) , would comprise ten copies of the same specific sequence linked to each other in series, e.g., 5'-
• a concatemer may comprise any number of copies of the repeat unit or sequence, e.g., at least 2 copies, at least 3 copies, at least 4 copies, at least 5 copies, at least 10 copies, at least 100 copies, at least 1000 copies, etc.
• An example of a concatemer of a nucleic acid sequence comprising a nuclease target site and a constant insert sequence would be [(target site)-(constant insert sequence)] 3 oo-
• a concatemer may be a linear nucleic acid molecule, or may be circular.
• conjugating refers to an association of two entities, for example, of two molecules such as two proteins, two domains (e.g., a binding domain and a cleavage domain), or a protein and an agent, e.g., a protein binding domain and a small molecule.
• the association can be, for example, via a direct or indirect (e.g., via a linker) covalent linkage or via non-covalent interactions. In some embodiments, the association is covalent. In some embodiments, two molecules are conjugated via a linker connecting both molecules.
• the two proteins may be conjugated via a polypeptide linker, e.g., an amino acid sequence connecting the C-terminus of one protein to the N-terminus of the other protein.
• a polypeptide linker e.g., an amino acid sequence connecting the C-terminus of one protein to the N-terminus of the other protein.
• nucleic acid sequence refers to a calculated sequence representing the most frequent nucleotide residues found at each position in a plurality of similar sequences. Typically, a consensus sequence is determined by sequence alignment in which similar sequences are compared to each other and similar sequence motifs are calculated. In the context of nuclease target site sequences, a consensus sequence of a nuclease target site may, in some embodiments, be the sequence most frequently bound, or bound with the highest affinity, by a given nuclease.
• an effective amount refers to an amount of a biologically active agent that is sufficient to elicit a desired biological response.
• an effective amount of a nuclease may refer to the amount of the nuclease that is sufficient to induce cleavage of a target site specifically bound and cleaved by the nuclease.
• an agent e.g., a nuclease, a hybrid protein, or a polynucleotide, may vary depending on various factors as, for example, on the desired biological response, the specific allele, genome, target site, cell, or tissue being targeted, and the agent being used.
• enediyne refers to a class of bacterial natural products characterized by either nine- and ten-membered rings containing two triple bonds, separated by a double bond (see, e.g., K. C. Nicolaou; A. L. Smith; E. W. Yue (1993).
• homing endonuclease refers to a type of restriction enzymes typically encoded by introns or inteins Edgell DR (February 2009). "Selfish DNA: homing endonucleases find a home”. Curr Biol 19 (3): R l 15— Rl 17; Jasin M (Jun 1996). "Genetic manipulation of genomonth with rare-cutting endonucleases”. Trends Genet 12 (6): 224-8; Burt A, Koufopanou V (December 2004). "Homing endonuclease genes: the rise and fall and rise again of a selfish element". Curr Opin Genet Dev 14 (6): 609-15; the entire contents of which are incorporated herein by reference. Homing endonuclease recognition sequences are long enough to occur randomly only with a very low probability
• a library refers to a population of two or rriore different nucleic acids or proteins, respectively.
• a library of nuclease target sites comprises at least two nucleic acid molecules comprising different nuclease target sites.
• a library comprises at least 10', at least 10 2 , at least 10 3 , at least 10 4 , at least 10 5 , at least 10 6 , at least 10 7 , at least 10 8 , at least 10 9 , at least 10 10 , at least lO", at least 10 12 , at least 10 13 , at least 10 14 , or at least 10 15 different nucleic acids or proteins.
• the members of the library may comprise randomized sequences, for example, fully or partially randomized sequences.
• the library comprises nucleic acid molecules that are unrelated to each other, e.g., nucleic acids comprising fully randomized sequences.
• at least some members of the library may be related, for example, they may be variants or derivatives of a particular sequence, such as a consensus target site sequence.
• linker refers to a chemical group or a molecule linking two adjacent molecules or moieties, e.g., a binding domain and a cleavage domain of a nuclease. Typically, the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond, thus connecting the two.
• the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein).
• the linker is an organic molecule, group, polymer, or chemical moiety.
• nuclease refers to an agent, for example a protein or a small molecule, capable of cleaving a phosphodiester bond connecting nucleotide residues in a nucleic acid molecule.
• a nuclease is a protein, e.g.., an enzyme that can bind a nucleic acid molecule and cleave a phosphodiester bond connecting nucleotide residues within the nucleic acid molecule.
• a nuclease may be an endonuclease, cleaving a phosphodiester bonds within a polynucleotide chain, or an exonuclease, cleaving a phosphodiester bond at the end of the polynucleotide chain.
• a nuclease is a site-specific nuclease, binding and/or cleaving a specific phosphodiester bond within a specific nucleotide sequence, which is also referred to herein as the "recognition sequence," the "nuclease target site,” or the “target site.”
• a nuclease recognizes a single stranded target site, while in other embodiments, a nuclease recognizes a double-stranded target site, for example a double-stranded DNA target site.
• the target sites of many naturally occurring nucleases for example, many naturally occurring DNA restriction nucleases, are well known to those of skill in the art.
• a DNA nuclease such as EcoRI, Hindlll, or BamHI, recognize a palindromic, double-stranded DNA target site of 4 to 10 base pairs in length, and cut each of the two DNA strands at a specific position within the target site.
• Some endonucleases cut a double-stranded nucleic acid target site symmetrically, i.e., cutting both strands at the same position so that the ends comprise base-paired nucleotides, also referred to herein as blunt ends.
• Other endonucleases cups a double-stranded nucleic acid target sites asymmetrically, i.e., cutting each strand at a different position so that the ends comprise unpaired nucleotides.
• Unpaired nucleotides at the end of a double-stranded DNA molecule are also referred to as "overhangs,” e.g., as “5'-overhang” or as “3'-overhang,” depending on whether the unpaired nucleotide(s) form(s) the 5' or the 5' end of the respective DNA strand.
• Double-stranded DNA molecule ends ending with unpaired nucleotide(s) are also referred to as sticky ends, as they can "stick to" other double- stranded DNA molecule ends comprising complementary unpaired nucleotide(s).
• a nuclease protein typically comprises a "binding domain” that mediates the interaction of the protein with the nucleic acid substrate, and also, in some cases, specifically binds to a target site, and a "cleavage domain” that catalyzes the cleavage of the phosphodiester bond within the nucleic acid backbone.
• a nuclease protein can bind and cleave a nucleic acid molecule in a monomelic form, while, in other embodiments, a nuclease protein has to dimerize or multimerize in order to cleave a target nucleic acid molecule.
• Binding domains and cleavage domains of naturally occurring nucleases as well as modular binding domains and cleavage domains that can be fused to create nucleases binding specific target sites, are well known to those of skill in the art.
• zinc fingers or transcriptional activator like elements can be used as binding domains to specifically bind a desired target site, and fused or conjugated to a cleavage domain, for example, the cleavage domain of Fokl, to create an engineered nuclease cleaving the target site.
• nucleic acid refers to a compound comprising a nucleobase and an acidic moiety, e.g., a nucleoside, a nucleotide, or a polymer of nucleotides.
• polymeric nucleic acids e.g., nucleic acid molecules comprising three or more nucleotides are linear molecules, in which adjacent nucleotides are linked to each other via a phosphodiester linkage.
• nucleic acid refers to individual nucleic acid residues (e.g. nucleotides and/or nucleosides).
• nucleic acid refers to an oligonucleotide chain comprising three or more individual nucleotide residues.
• oligonucleotide and polynucleotide can be used interchangeably to refer to a polymer of nucleotides (e.g. , a string of at least three nucleotides).
• nucleic acid encompasses RNA as well as single and/or double-stranded DNA.
• Nucleic acids may be naturally occurring, for example, in the context of a genome, a transcript, an mRNA, tRNA, rRNA, siRNA, snRNA, a plasmid, cosmid, chromosome, chromatid, or other naturally occurring nucleic acid molecule.
• a nucleic acid molecule may be a non-naturally occurring molecule, e.g., a recombinant DNA or RNA, an artificial chromosome, an engineered genome, or fragment thereof, or a synthetic DNA, RNA, DNA/RNA hybrid, or including non-naturally occurring nucleotides or nucleosides.
• nucleic acid examples include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone.
• Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, and backbone modifications' A nucleic acid sequence is presented in the 5' to 3' direction unless otherwise indicated.
• a nucleic acid is or comprises natural nucleosides (e.g.
• nucleoside analogs e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyI-cytidine, C5-methyIcytidine, 2-aminoadenosine, 7- deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, and 2-thio
• a pharmaceutical composition refers to a composition that can be administrated to a subject in the context of treatment of a disease or disorder.
• a pharmaceutical composition comprises an active ingredient, e.g. a nuclease or a nucleic acid encoding a nuclease, and a pharmaceutically acceptable excipient.
• proliferative disease refers to any disease in which cell or tissue homeostasis is disturbed in that a cell or cell population exhibits an abnormally elevated proliferation rate.
• Proliferative diseases include hyperproliferative diseases, such as pre-neoplastic hyperplastic conditions and neoplastic diseases.
• Neoplastic diseases are characterized by an abnormal proliferation of cells and include both benign and malignant neoplasias. Malignant neoplasia is also referred to a s cancer.
• protein refers to a polymer of amino acid residues linked together by peptide (amide) bonds.
• the terms refer to a protein, peptide, or polypeptide of any size, structure, or function. Typically, a protein, peptide, or polypeptide will be at least three amino acids long.
• a protein, peptide, or polypeptide may refer to an individual protein or a collection of proteins.
• One or more of the amino acids in a protein, peptide, or polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a farnesyl group, an isofarnesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification, etc.
• a protein, peptide, or polypeptide may also be a single molecule or may be a multi-molecular complex.
• a protein, peptide, or polypeptide may be just a fragment of a naturally occurring protein or peptide.
• a protein, peptide, or polypeptide may be naturally occurring, recombinant, or synthetic, or any combination thereof.
• a protein may comprise different domains, for.example, a nucleic acid binding domain and a nucleic acid cleavage domain.
• a protein comprises a proteinaceous part, e.g., an amino acid sequence constituting a nucleic acid binding domain, and an organic compound, e.g., a compound that can act as a nucleic acid cleavage agent.
• randomized refers to a sequence or residue within a sequence that has been synthesized to incorporate a mixture of free nucleotides, for example, a mixture of all four nucleotides A, T, G, and C. Randomized residues are typically represented by the letter N within a nucleotide sequence. In some embodiments, a randomized sequence or residue is fully randomized, in which case the randomized residues are synthesized by adding equal amounts of the nucleotides to be incorporated (e.g., 25% T, 25% A, 25% G, and 25% C) during the synthesis step of the respective sequence residue.
• a randomized sequence or residue is partially randomized, in which case the randomized residues are synthesized by adding non-equal amounts of the nucleotides to be incorporated (e.g., 79% T, 7% A, 7% G, and 7% C) during the synthesis step of the respective sequence residue.
• randomization allows for the generation of sequences that are templated on a given sequence, but have incorporated mutations at a desired frequency.
• a known nuclease target site is used as a synthesis template, partial randomization in which at each step the nucleotide represented at the respective residue is added to the synthesis at 79%, and the other three nucleotides are added at 7% each, will result in a mixture of partially randomized target sites being synthesized, which still represent the consensus sequence of the original target site, but which differ from the original target site at each residue with a statistical frequency of 21 % for each residue so synthesized (distributed binomially).
• a partially randomized sequence differs from the consensus sequence by more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, or more than 30% on average, distributed binomially. In some embodiments, a partially randomized sequence differs from the consensus site by no more than 10%, no more than 15%, no more than 20%, no more than 25%, nor more than 30%, no more than 40%, or no more than 50% on average, distributed binomially.
• an organic compound contains carbon.
• An organic compound may contain multiple carbon- carbon bonds, stereocenters, and other functional groups (e.g. , amines, hydroxyl, carbonyls, or heterocyclic rings).
• organic compounds are monomelic and have a molecular weight of less than about 1500 g/mol. In certain embodiments, the molecular weight of the small molecule is less than about 1000 g/mol or less than about 500 g/mol.
• the small molecule is a drug, for example, a drug that has already been deemed safe and effective for use in humans or animals by the appropriate governmental agency or regulatory body.
• the organic molecule is known to bind and/or cleave a nucleic acid.
• the organic compound is an enediyne.
• the organic compound is an antibiotic drug, for example, an anticancer antibiotic such as dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin, or a derivative thereof.
• the term "subject,” as used herein, refers to an individual organism, for example, an individual mammal.
• the subject is a human.
• the subject is a non-human mammal.
• the subject is a non-human primate.
• the subject is a rodent.
• the subject is a sheep, a goat, a cattle, a cat, or a dog.
• the subject is a vertebrate, an amphibian, a reptile, a fish, an insect, a fly, or a nematode.
• target nucleic acid and “target genome,” as used herein in the context of nucleases, refer to a nucleic acid molecule or a genome, respectively, that comprises at least one target site of a given nuclease.
• target site refers to a sequence within a nucleic acid molecule that is bound and cleaved by a nuclease.
• a target site may be single-stranded or double-stranded.
• a target sites typically comprises a left-half site (bound by one monomer of the nuclease), a right-half site (bound by the second monomer of the nuclease), and a spacer sequence between the half sites in which the cut is made.
• This structure ([left-half site]-[spacer sequence]-[right-half site]) is referred to herein as an LS structure.
• the left-half site and/or the right-half site is between 10- 18 nucleotides long. In some embodiments, either or both half-sites are shorter or longer. In some embodiments, the left and right half sites comprise different nucleic acid sequences.
• TALE Transcriptional Activator-Like Effector
• RVD Repeat Variable Diresidue
• the RVD motif determines binding specificity to a nucleic acid sequence, and can be engineered according to methods well known to those of skill in the art to specifically bind a desired DNA sequence (see, e.g., Miller, Jeffrey; et.al. (February 201 1 ).
• a TALE nuclease architecture for efficient genome editing Nature Biotechnology 29 (2): 143-8; Zhang, Feng; et.al. (February 201 1 ).
• Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription Nature
• TALEN Transcriptional Activator-Like Element Nuclease
• TALEN Transcriptional Activator-Like Element Nuclease
• a number of modular assembly schemes for generating engineered TALE constructs have been reported (Zhang, Feng; et.al. (February 201 1 ). "Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription". Nature Biotechnology 29 (2): 149-53; Geipier, R.; Scholze, H.; Hahn, S.; Streubel, J.; Bonas, U. ; Behrens, S.
• treatment refers to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease or disorder, or one or more symptoms thereof, as described herein.
• treatment refers to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease or disorder, or one or more symptoms thereof, as described herein.
• treatment may be administered after one or more symptoms have developed and/or after a disease has been diagnosed.
• treatment may be administered in the absence of symptoms, e.g., to prevent or delay onset of a symptom or inhibit onset or progression of a disease.
• treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and/or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example to prevent or delay their recurrence.
• Zinc finger refers to a small nucleic acid-binding protein structural motif characterized by a fold and the coordination of one or more zinc ions that stabilize the fold.
• Zinc fingers encompass a wide variety of differing protein structures (see, e.g., Klug A, Rhodes D (1987). "Zinc fingers: a novel protein fold for nucleic acid recognition”. Cold Spring Harb. Symp. Quant. Biol. 52: 473-82, the entire contents of which are incorporated herein by reference).
• Zinc fingers can be designed to bind a specific sequence of nucleotides, and zinc finger arrays comprising fusions of a series of zinc fingers, can be designed to bind virtually any desired target sequence.
• Such zinc finger arrays can form a binding domain of a protein, for example, of a nuclease, e.g., if conjugated to a nucleic acid cleavage domain.
• a nuclease e.g., if conjugated to a nucleic acid cleavage domain.
• Different type of zinc finger motifs are known to those of skill in the art, including, but not limited to, Cys 2 His 2 , Gag knuckle, Treble clef, Zinc ribbon, Zn 2 /Cys 6 , and TAZ2 domain-like motifs (see, e.g., Krishna SS, Majumdar I, Grishin NV (January 2003). "Structural classification of zinc fingers: survey and summary". Nucleic Acids Res. 31 (2): 532-50).
• a single zinc finger motif binds 3 or 4 nucleotides of a nucleic acid molecule.
• a zinc finger domain comprising 2 zinc finger motifs may bind 6-8 nucleotides
• a zinc finger domain comprising 3 zinc finger motifs may bind 9- 12 nucleotides
• a zinc finger domain comprising 4 zinc finger motifs may bind 12-16 nucleotides, and so forth.
• Any suitable protein engineering technique can be employed to alter the DNA-binding specificity of zinc fingers and/or design novel zinc finger fusions to bind virtually any desired target sequence from 3 - 30 nucleotides in length (see, e.g., Pabo CO, Peisach E, Grant RA (2001 ).
• a zinc finger nuclease typically comprises a zinc finger domain that binds a specific target site within a nucleic acid molecule, and a nucleic acid cleavage domain that cuts the nucleic acid molecule within or in proximity to the target site bound by the binding domain.
• Typical engineered zinc finger nucleases comprise a binding domain having between 3 and 6 individual zinc finger motifs and binding target sites ranging from 9 base pairs to 18 base pairs in length. Longer target sites are particularly attractive in situations where it is desired to bind and cleave a target site that is unique in a given genome.
• Zinc finger nuclease refers to a nuclease comprising a nucleic acid cleavage domain conjugated to a binding domain that comprises a zinc finger array.
• the cleavage domain is the cleavage domain of the type II restriction endonuclease Fokl.
• Zinc finger nucleases can be designed to target virtually any desired sequence in a given nucleic acid molecule for cleavage, and the possibility to the design zinc finger binding domains to bind unique sites in the context of complex genomes allows for targeted cleavage of a single genomic site in living cells, for example, to achieve a targeted genomic alteration of therapeutic value.
• Zinc finger nucleases can be generated to target a site of interest by methods well known to those of skill in the art. For example, zinc finger binding domains with a desired specificity can be designed by combining individual zinc finger motifs of known specificity.
• 2-finger modules recognizing 6-8 nucleotides are combined to generate 4-, 6-, or 8- zinc finger arrays.
• bacterial or phage display is employed to develop a zinc finger domain that recognizes a desired nucleic acid sequence, for example, a desired nuclease target site of 3-30 bp in length.
• Zinc finger nucleases in some embodiments, comprise a zinc finger binding domain and a cleavage domain fused or otherwise conjugated to each other via a linker, for example, a polypeptide linker. The length of the linker determines the distance of the cut from the nucleic acid sequence bound by the zinc finger domain.
• the cleavage domain of a zinc finger nuclease has to dimerize in order to cut a bound nucleic acid.
• the dimer is a heterodimer of two monomers, each of which comprise a different zinc finger binding domain.
• the dimer may comprise one monomer comprising zinc finger domain A conjugated to a Fokl cleavage domain, and one monomer comprising zinc finger domain B conjugated to a Fokl cleavage domain.
• zinc finger domain A binds a nucleic acid sequence on one side of the target site
• zinc finger domain B binds a nucleic acid sequence on the other side of the target site
• the dimerize Fokl domain cuts the nucleic acid in between the zinc finger domain binding sites.
• Site-specific nucleases are powerful tools for the targeted modification of a genome. Some site specific nucleases can theoretically achieve a level of specificity for a target cleavage site that would allow to target a single unique site in a genome for cleaveage without affecting any other genomic site. It has been reported that nuclease cleavage in living cells triggers a DNA repair mechanism that frequently results in a modification of the cleaved, repaired genomic sequence, for example, via homologous recombination.
• nuclease-mediated modification of disease-related sequences e.g., the CCR-5 allele in HIV/AIDS patients, or of genes necessary for tumor neovascularization, can be used in the clinical context, and two site specific nucleases are currently in clinical trials.
• off-target nuclease effects e.g., the cleavage of genomic sequences that differ from the intended target sequence by one or more nucleotides.
• Undesired side effects of off-target cleavage ranges from insertion into unwanted loci during a gene targeting event to severe complications in a clinical scenario.
• Off target cleavage of sequences encoding essential gene functions or tumor suppressor genes by an andonuclease administered to a subject may result in disease or even death of the subject. Accordingly, it is desirable to characterize the cleavage preferences of a nuclease before using it in the laboratory or the clinic in order to determine its efficacy and safety.
• nuclease cleavager properties allows for the selection of the nuclease best suited for a specific task from a group of candidate nucleases, or for the selection of evolution products obtained from existing nucleases. Such a characterization of nuclease cleavage properties may also inform the de-novo design of nucleases with enhanced properties, such as enhanced specificity or efficiency.
• cleavage specificity is a crucial feature.
• the imperfect specificity of some engineered nuclease binding domains can lead to off-target cleavage and undesired effects both in vitro and in vivo.
• Current methods of evaluating site-specific nuclease specificity including ELISA assays, microarrays, one-hybrid systems, SELEX and its variants, and Rosetta-based computational predictions, are all premised on the assumption that the binding specificity of nuclease molecules is equvalent or proportionate to their cleavage specificity.
• the methods and reagents provided herein allow for an accurate evaluation of a given nuclease's target site specificity and provide strategies for the selection of suitable unique target sites and the design of highly specific nucleases for the targeted cleavage of a single site in the context of a complex genome. Further, methods, reagents, and strategies provided herein allow those of skill to enhance the specificity and minimize the off-target effects of any given site-specific nuclease. While of particular relevance to DNA and DNA - cleaving nucleases, the inventive concepts, methods, strategies, and reagents provided herein are not limited in this respect, but can be applied to any nucleic acid:nuclease pair.
• Some aspects of this invention provide methods and reagents to determine the nucleic acid target sites cleaved by any site-specific nuclease.
• such methods comprise contacting a given nuclease with a library of target sites under conditions suitable for the nuclease to bind and cut a target site, and determining which target sites the nuclease actually cuts.
• a determination of a nuclease's target site profile based on actual cutting has the advantage over methods that rely on binding that it measures a parameter more relevant for mediating undesired off-target effects of site-specific nucleases.
• a method for identifying a target site of a nuclease comprises (a) providing a nuclease that cuts a double-stranded nucleic acid target site and creates a 5' overhang, wherein the target site comprises a [left-half site]-[spacer sequence]-[right-half site] (LSR) structure, and the nuclease cuts the target site within the spacer sequence.
• LSR right-half site
• the method comprises (b) contacting the nuclease with a library of candidate nucleic acid molecules, wherein each nucleic acid molecule comprises a concatemer of a sequence comprising a candidate nuclease target site and a constant insert sequence, under conditions suitable for the nuclease to cut a candidate nucleic acid molecule comprising a target site of the nuclease.
• the method comprises (c) filling in the 5' overhangs of a nucleic acid molecule that has been cut twice by the nuclease and comprises a constant insert sequence flanked by a left half-site and cut spacer sequence on one side, and a right half-site and cut spacer sequence on the other side, thereby creating blunt ends.
• the method comprises (d) identifying the nuclease target site cut by the nuclease by determining the sequence of the left-half site, the right-half-site, and/or the spacer sequence of the nucleic acid molecule of step (c).
• the method comprises providing a nuclease and contacting the nuclease with a library of candidate nucleic acid molecules comprising candidate target sites.
• the candidate nucleic acid molecules are double-stranded nucleic acid molecules.
• the candidate nucleic acid molecules are DNA molecules.
• the nuclease dimerizes at the target site, and the target site comprises an LSR structure ([left-half site]-[spacer sequence]-[right- half site]). In some embodiments, the nuclease cuts the target site within the spacer sequence.
• the nuclease is a nuclease that cuts a double-stranded nucleic acid target site and creates a 5' overhang.
• each nucleic acid molecule in the library comprises a concatemer of a sequence comprising a candidate nuclease target site and a constant insert sequence.
• the candidate nucleic acid molecules of the library comprise the structure Ri-[(LSR)-(constant region)]x-R2, wherein Rl and R2 are, independently, nucleic acid sequences that may comprise a fragment of the [(LSR)-(constant region)] repeat unit, and X is an integer between 2 and y.
• y is at least 10 1 , at least 10 2 , at least 10 3 , at least 10 4 , at least 10 s , at least 10 6 , at least 10 7 , at least 10 8 , at least 10 9 , at least 10 10 , at least lO 1 1 , at least 10 12 , at least 10 13 , at least 10 14 , or at least 10' 5 .
• y is less than 10 2 , less than 10 3 , less than 10 4 , less than 10 5 , less than 10 6 , less than 10 7 , less than 10 8 , less than 10 9 , less than 10 10 , less than l O 1 1 , less than 10 12 , less than 10 13 , less than 10 14 , or less than lO 15 .
• the constant region in some embodiments, is of a length that allows for efficient self ligation of a single repeat unit. Suitable lengths will be apparent to those of skill in the art.
• the constant region is between 100 and 1000 base pairs long, for example, about 100 base pairs, about 200 base pairs, about 300 base pairs, about 400 base pairs, about 450 base pairs, about 500 base pairs, about 600 base pairs, about 700 base pairs, about 800 base pairs, about 900 base pairs, or about 1000 base pairs long in some embodiments, the constant region is shorter than about 100 base pairs or longer than about 1000 base pairs.
• nuclease cleavage will result in cleavage of those concatemers in the library that comprise target sites that can be bound and cleaved by the nuclease. If a given nuclease cleaves a specific target site with high efficiency, a concatemer comprising target sites will be cut multiple times, resulting in the generation of fragments comprising a single repeat unit.
• the repeat unit released from the concatemer by nuclease cleavage will be of the structure S 2 R-(constant region)-LS i , wherein S i and S 2 represent complementary spacer region fragments after being cut by the nuclease. Any repeat units released from library candidate molecules can then be isolated and/or the sequence of the LSR cleaved by the nuclease identified by sequencing the S 2 R and LSi regions of released repeat units.
• any method suitable for isolation and sequencing of the repeat units can be employed to elucidate the LSR sequence cleaved by the nuclease. For example, since the length of the constant region is known, individual released repeat units can be separated based on their size from the larger uncut library nucleic acid molecules as well as from fragments of library nucleic acid molecules that comprise multiple repeat units (indicating non-efficient targeted cleavage by the nuclease).
• Suitable methods for separating and/or isolating nucleic acid molecules based on their size include, for example, size fractionation methods, such as gel electrophoresis, density gradient centrifugation, and dialysis over a semi-permeable membrane with a suitable molecular cutoff value.
• size fractionation methods such as gel electrophoresis, density gradient centrifugation, and dialysis over a semi-permeable membrane with a suitable molecular cutoff value.
• the separated/isolated nucleic acid molecules can then be further characterized, for example, by ligating PCR and/or sequencing adapters to the cut ends and amplifying and/or sequencing the respective nucleic acids.
• such individual released repeat units may be enriched by contacting the nuclease treated library molecules with a ligase and subsequent amplification and/or sequencing based on the circularized nature of the self-ligated individual repeat units.
• the 5' overhangs of the cut nucleic acid molecules are filled in.
• Methods for filling in 5' overhangs are well known to those of skill in the art and include, for example, methods using DNA polymerase I Klenow fragment lacking exonuclease activity (Klenow (3'->5' exo-)). Filling in 5' overhangs results in the overhang- templated extension of the recessed strand, which, in turn, results in blunt ends.
• the resulting structure is a blunt- ended S 2 'R-(constant region)-LS i ', with S ⁇ ' and S 2 ' comprising blunt ends.
• PCR and/or sequencing adapters can then be added to the ends by blunt end ligation and the respective repeat units (including S 2 'R and LS i ' regions) can be sequenced. From the sequence data, the original LSR region can be deducted.
• Blunting of the overhangs created during the nuclease cleavage process also allows for distinguishing between target sites that were properly cut by the respective nuclease and target sites that were non-specifically cut e.g., based on non- nuclease effects such as physical shearing.
• Correctly cleaved nuclease target sites can be recognized by the existence of complementary S 2 'R and LS i ' regions, which comprise a duplication of the overhang nucleotides as a result of the overhang fill in, while target sites that were not cleaved by the respective nuclease are unlikely to comprise overhang nucleotide duplications.
• the method comprises identifying the nuclease target site cut by the nuclease by determining the sequence of the left-half site, the right-half-site, and/or the spacer sequence of a released individual repeat unit.
• Any suitable method for amplifying and/or sequencing can be used to identify the LSR sequence of the target site cleaved by the respective nuclease. Methods for amplifying and/or sequencing nucleic acid molecules are well known to those of skill in the art and the invention is not limited in this respect.
• the data obtained from such methods can be used to compile a list of target sites cleaved by a given nuclease, which is also referred to herein as a target site profile. If they sequencing method is used that allows for the generation of quantitative sequencing data, it is also possible to record the relative abundance of any nuclease target site detected to be cleaved by the respective nuclease.
• Target sites that are cleaved more efficiently by the nuclease will be detected more frequently in the sequencing step, while target sites that are not cleaved efficiently will only rarely release an individual repeat unit from a candidate concatemer, and thus, will only generate few, if any sequencing reads.
• Such quantitative sequencing data can be integrated into a target site profile to generate a ranked list of highly preferred and less preferred nuclease target sites.
• nuclease target site profiling can be applied to any site-specific nuclease, including, for example, ZFNs, TALENs, and homing endonucleases.
• nuclease specificity typically decreases with increasing nuclease concentration, and the methods described herein can be used to determine a concentration at which a given nuclease efficiently cuts its intended target site, but does not efficiently cut any off target sequences.
• a maximum concentration of a therapeutic nuclease is determined at which the therapeutic nuclease cuts its intended nuclease target site, but does not cut more than 10, more than 5, more than 4, more than 3, more than 2, more than 1 , or any additional nuclease target sites.
• a therapeutic nuclease is administered to a subject in an amount effective to generate a final concentration equal or lower to the maximum concentration determined as described above.
• Some embodiments of this invention provide libraries of nucleic acid molecules for nuclease target site profiling.
• a library comprises a plurality of nucleic acid molecules, each comprising a concatemer of a candidate nuclease target site and a constant insert sequence spacer sequence.
• the candidate nucleic acid molecules of the library comprise the structure R ⁇ - [(LSR)-(constant region)]x-R.2, wherein Rl and R2 are, independently, nucleic acid sequences that may comprise a fragment of the [(LSR)-(constant region)] repeat unit, and X is an integer between 2 and y.
• y is at least 10 1 , at least 10 2 , at least 10 3 , at least 10 4 , at least 10 5 , at least 10 6 , at least 10 7 , at least 10 8 , at least 10 9 , at least 10 10 , at least lO", at least 10 12 , at least 10 13 , at least 10 14 , or at least 10 15 .
• y is less than 10 2 , less than 10 3 , less than 10 4 , less than 10 5 , less than 10 6 , less than 10 7 , less than 10 8 , less than 10 9 , less than 10 10 , less than lO 1 1 , less than 10 12 , less than 10 13 , less than 10 14 , or less than 10 15 .
• the constant region in some embodiments, is of a length that allows for efficient self ligation of a single repeat unit. In some embodiments, the constant region is of a length that allows for efficient separation of single repeat units from fragments comprising two or more repeat units. In some embodiments, the concentration is over length allows for efficient sequencing of a complete repeat unit in one sequencing read.
• the constant region is between 100 and 1000 base pairs long, for example, about 100 base pairs, about 200 base pairs, about 300 base pairs, about 400 base pairs, about 450 base pairs, about 500 base pairs, about 600 base pairs, about 700 base pairs, about 800 base pairs, about 900 base pairs, or about 1000 base pairs long in some embodiments, the constant region is shorter than about 100 base pairs or longer than about 1000 base pairs.
• An LSR site typically comprises a [left-half site]-[spacer sequence]-[right-half site] structure.
• the lengths of the half-size and the spacer sequence will depend on the specific nuclease to be evaluated.
• the half-sites will be 6-30 nucleotides long, and preferably 10- 18 nucleotides long.
• each half site individually may be 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long.
• an LSR site may be longer than 30 nucleotides.
• the left half site and the right half site of an LSR are of the same length.
• a library is provided that comprises candidate nucleic acids which comprise LSRs that can be cleaved by a Fokl cleavage domain, a Zinc Finger Nuclease (ZFN), a Transcription Activator- Like Effector Nuclease (TALEN), a homing endonuclease, an organic compound nuclease, an enediyne, an antibiotic nuclease, dynemicin, neocarzinostatin, calicheamicin, esperamicin, and/or bleomycin.
• ZFN Zinc Finger Nuclease
• TALEN Transcription Activator- Like Effector Nuclease
• a homing endonuclease an organic compound nuclease, an enediyne, an antibiotic nuclease, dynemicin, neocarzinostatin, calicheamicin, esperamicin, and/or ble
• a library of candidate nucleic acid molecules comprises at least 10 5 , at least 10 6 , at least 10 7 , at least 10 8 , at least 10 9 , at least 10 10 , at least 10 n , or at least 10 12 different candidate nuclease target sites.
• the candidate nucleic acid molecules of the library are concatemers produced from a secularized templates by rolling cycle amplification.
• the library comprises nucleic acid molecules, e.g., concatemers, of a molecular weight of at least 5 kDa, at least 6 kDa, at least 7 kDa, at least 8 kDa, at least 9 kDa, at least 10 kDa, at least 12 kDa, or at least 15kDa.
• the molecular weight of the nucleic acid molecules within the library may be larger than 15 kDa.
• the library comprises nucleic acid molecules within a specific size range, for example, within a range of 5-7 kDa, 5- 10 kDa, 8- 12 kDa, 10- 15 kDa, or 12- 15 kDa, or 5-10 kDa or any possible subrange. While some methods suitable for generating nucleic acid concatemers according to some aspects of this invention result in the generation of nucleic acid molecules of greatly different molecular weights, such mixtures of nucleic acid molecules may be size fractionated to obtain a desired size distribution. Suitable methods for enriching nucleic acid molecules of a desired size or excluding nucleic acid molecules of a desired size are well known to those of skill in the art and the invention is not limited in this respect.
• a library comprising candidate nucleic acid molecules that comprise target sites with a partially randomized left-half site, a partially randomized right-half site, and/or a partially randomized spacer sequence.
• the library is provided comprising candidate nucleic acid molecules that comprise target sites with a partially randomized left half site, a fully randomized spacer sequence, and a partially randomized right half site.
• partially randomized sites differ from the consensus site by more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, or more than 30% on average, distributed binomially.
• partially randomized sites differ from the consensus site by no more than 10%, no more than 15%, no more than 20%, no more than 25%, nor more than 30%, no more than 40%, or no more than 50% on average, distributed binomially.
• partially randomized sites differ from the consensus site by more than 5%, but by no more than 10%; by more than 10%, but by no more than 20%; by more than 20%, but by no more than 25%; by more than 5%, but by no more than 20%, and so on.
• Using partially randomized nuclease target sites in the library is useful to increase the concentration of library members comprising target sites that are closely related to the consensus site, for example, that differ from the consensus sites in only one, only two, only three, only four, or only five residues.
• a given nuclease for example a given ZFN
• a library comprising partially randomized target sites can be more efficient than using libraries comprising fully randomized target sites without compromising the sensitivity in detecting any off target cleavage events for any given nuclease.
• the use of partially randomized libraries significantly reduces the cost and effort required to produce a library having a high likelihood of covering virtually all off target sites of a given nuclease.
• it may be desirable to use a fully randomized library of target sites for example, in embodiments, where the specificity of a given nuclease is to be evaluated in the context of any possible site in a given genome.
• a method comprises providing a plurality of candidate nucleases that are designed or known to cut the same consensus sequence; profiling the target sites actually cleaved by each candidate nuclease, thus detecting any cleaved off-target sites (target sites that differ from the consensus target site); and selecting a candidate nuclease based on the off-target site(s) so identified.
• this method is used to select the most specific nuclease from a group of candidate nucleases, for example, the nuclease that cleaves the consensus target site with the highest specificity, the nuclease that cleaves the lowest number of off- target sites, the nuclease that cleaves the lowest number of off-target sites in the context of a target genome, or a nuclease that does not cleave any target site other than the consensus target site. In some embodiments, this method is used to select a nuclease that does not cleave any off-target site in the context of the genome of a subject at concentration that is equal to or higher than a therapeutically effective concentration of the nuclease.
• the methods and reagents provided herein can be used, for example, to evaluate a plurality of different nucleases targeting the same intended targets site, for example, a plurality of variations of a given site-specific nuclease, for example a given zinc finger nuclease. Accordingly, such methods may be used as the selection step in evolving or designing a novel site-specific nucleases with improved specificity.
• Some embodiments of this invention provide a method for selecting a nuclease target site within a genome.
• off target sites cleaved by a given nuclease are typically highly similar to the consensus target site, e.g., differing from the consensus target site in only one, only two, only three, only four, or only five nucleotide residues.
• a nuclease target sites within the genome can be selected to increase the likelihood of a nuclease targeting this site not cleaving any off target sites within the genome.
• a method comprises identifying a candidate nuclease target site; and comparing the candidate nuclease target site to other sequences within the genome.
• Methods for comparing candidate nuclease target sites to other sequences within the genome are well known to those of skill in the art and include for example sequence alignment methods, for example, using a sequence alignment software or algorithm such as BLAST on a general purpose computer. A suitable unique nuclease target site can then be selected based on the results of the sequence comparison.
• the nuclease target site if the candidate nuclease target site differs from any other sequence within the genome by at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides, the nuclease target site is selected as a unique site within the genome, whereas if the site does not fulfill this criteria, the site may be discarded.
• a site-specific nuclease targeting the selected site is designed.
• a zinc finger nuclease may be designed to target any selected nuclease target site by constructing a zinc finger array binding the target site, and conjugating the zinc finger array to a DNA cleavage domain.
• nuclease designing and/or generating is done by recombinant technology. Suitable recombinant technologies are well known to those of skill in the art, and the invention is not limited in this respect.
• a site-specific nuclease designed or generated according to aspects of this invention is isolated and/or purified.
• the methods and strategies for designing site-specific nucleases according to aspects of this invention can be applied to design or generate any site-specific nuclease, including, but not limited to Zinc Finger Nucleases, Transcription Activator-Like Effector Nucleases (TALENs), homing
• Some aspects of this invention provide isolated site-specific nucleases with enhanced specificity that are designed using the methods and strategies described herein. Some embodiments, of this invention provide nucleic acids encoding such nucleases. Some embodiments of this invention provide expression constructs comprising such encoding nucleic acids. For example, in some embodiments an isolated nuclease is provided that has been engineered to cleave a desired target site within a genome, and has been evaluated according to a method provided herein to cut less than 1 , less than 2, less than 3, less than 4, less than 5, less than 6, less than 7, less than 8, less than 9 or less than 10 off-target sites at a concentration effective for the nuclease to cut its intended target site.
• an isolated nuclease is provided that has been engineered to cleave a desired unique target site that has been selected to differ from any other site within a genome by at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotide residues.
• the isolated nuclease is a Zinc Finger Nuclease (ZFN) or a Transcription Activator-Like Effector Nuclease (TALEN), a homing endonuclease, or is or comprises an organic compound nuclease, an enediyne, an antibiotic nuclease, dynemicin,
• the isolated nuclease cleaves a consensus target site within an allele that is associated with a disease or disorder. In some embodiments, the isolated nuclease cleaves a consensus target site the cleavage of which results in treatment or prevention of a disease or disorder. In some embodiments, the disease is HIV/ADDS, or a proliferative disease. In some embodiments, the allele is a CCR5 (for treating HIV/AIDS) or a VEGFA allele (for treating a proliferative disease).
• the isolated nuclease is provided as part of a pharmaceutical composition.
• a pharmaceutical composition comprising a nuclease as provided herein, or a nucleic acid encoding such a nuclease, and a pharmaceutically acceptable excipient.
• Pharmaceutical compositions may optionally comprise one or more additional therapeutically active substances.
• compositions provided herein are administered to a subject, for example, to a human subject, in order to effect a targeted genomic modification within the subject.
• cells are obtained from the subject and contacted with a nuclease or a nuclease-encoding nucleic acid ex vivo, and re-administered to the subject after the desired genomic modification has been effected or detected in the cells.
• compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation.
• Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and/or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and/or rats; and/or birds, including commercially relevant birds such as chickens, ducks, geese, and/or turkeys.
• Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into
• compositions may additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired.
• a pharmaceutically acceptable excipient includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired.
• Remington's The Science and Practice of Pharmacy 21 st Edition, A. R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference) discloses various excipients used in
• Zinc finger nucleases are enzymes engineered to recognize and cleave desired target DNA sequences.
• a ZFN monomer consists of a zinc finger DNA-binding domain fused with a non-specific Fokl restriction endonuclease cleavage domain 1 . Since the Fokl nuclease domain must dimerize and bridge two DNA half-sites to cleave DNA 2 , ZFNs are designed to recognize two unique sequences flanking a spacer sequence of variable length and to cleave only when bound as a dimer to DNA.
• ZFNs have been used for genome engineering in a variety of organisms including mammals 3"9 by stimulating either nonhomologous end joining or homologous recombination. In addition to providing powerful research tools, ZFNs also have potential as gene therapy agents. Indeed, two ZFNs have recently entered clinical trials: one as part of an anti-HIV therapeutic approach
• NCT00842634 NCTO 1044654, NCTO 1252641
• NCTO 1082926 the other to modify cells used as anticancer therapeutics
• DNA cleavage specificity is a crucial feature of ZFNs.
• the imperfect specificity of some engineered zinc fingers domains has been linked to cellular toxicity 10 and therefore determining the specificities of ZFNs is of significant interest.
• ELISA assays microarrays 12 , a bacterial one-hybrid system 13 , SELEX and its variants 14"16 , and Rosetta- based computational predictions 17 have all been used to characterize the DNA-binding specificity of monomeric zinc finger domains in isolation.
• the toxicity of ZFNs is believed to result from DNA cleavage, rather than binding alone 18 ' 19 .
• sequences that have been cleaved twice have two complementary 5' overhangs, which can be identified computationally following DNA sequencing as hallmarks of bona fide cleavage products.
• the library used in a ZFN cleavage selection would consist of every possible DNA sequence of the length recognized by the ZFN. Only one out of every 105 members of such a library, however, would contain a sequence that was within seven mutations of a 24- base pair recognition sequence. Since off-target recognition sequences most likely resemble target recognition sites, we used instead a biased library that ensures > 10-fold coverage of all half-site sequences that differ from the wild-type recognition sequences by up to seven mutations.
• Library members consist of a fully randomized base pair adjacent to the 5' end of the recognition site, two partially randomized half sites flanking a 4-, 5-, 6-, or 7-bp fully randomized spacer, and another fully randomized base pair adjacent to the 3' end of the recognition site.
• a fully randomized five-base pair tag follows each library member. This tag, along with the randomized flanking base pairs and the randomized spacer sequence, was used as a unique identifier "key" for each library member. If this unique key was associated with more than one sequence read containing identical library members, these duplicate sequencing reads likely arose during PCR amplification and were therefore treated as one data point.
• Each member of a sequence pair consisted of a fragment of the spacer, an entire half-site, an adjacent nucleotide, and constant sequence.
• One end of the spacer was generally found in one sequence and the other end in its corresponding paired sequence, with the overhang sequence present in both paired sequence reads because overhangs were blunted by extension prior to ligation of adapters.
• the spacer sequences were reconstructed by first identifying the shared overhang sequence and then any nucleotides present between the overhang sequence and the half-site sequence. Only sequences containing no ambiguous nucleotides and overhangs of at least 4 nucleotides were analyzed. Overall, this
• the pre-selection libraries for CCR5-224 and VF2468 contained means of 4.56 and 3.45 mutations per complete target site (two half-sites), respectively, while post-selection libraries exposed to the highest concentrations of ZFN used (4 nM CCR5-224 and 4 nM VF2468) had means of 2.79 and 1 .53 mutations per target site, respectively (Fig. 8). As ZFN concentration decreased, both ZFNs exhibited less tolerance for off-target sequences. At the lowest concentrations (0.5 nM CCR5-224 and 0.5 nM VF2468), cleaved sites contained an average of 1.84 and 1.10 mutations, respectively.
• the DNA-cleavage specificity profile of the dimeric CCR5-224 ZFN (Fig. 2a and Fig. 10a,b) was notably different than the DNA-binding specificity profiles of the CCR5- 224 monomers previously determined by SELEX 6 .
• some positions, such as (+)A5 and (+)T9 exhibited tolerance for off-target base pairs in our cleavage selection that were not predicted by the SELEX study.
• VF2468 which had not been previously characterized with respect to either DNA-binding or DNA-cleavage specificity, revealed two positions, (-)C5 and (+)A9, that exhibited limited sequence preference, suggesting that they were poorly recognized by the ZFNs (Fig. 2b and Fig. 10c,d).
• This compensation model for ZFN site recognition applies not only to non- ideal half-sites, but also to spacers with non-ideal lengths.
• the ZFNs cleaved at characteristic locations within the spacers (Fig. 14), and five- and six-base pair spacers were preferred over four- and seven-base pair spacers (Figs. 15 and 16):
• cleaved sites with five- or six-base pair spacers showed greater sequence tolerance at the flanking half- sites than sites with four- or seven-base pair spacers (Fig. 17). Therefore, spacer imperfections, similar to half-site mutations, lead to more stringent in vitro recognition of other regions of the DNA substrate.
• VF2468 Despite greater discrimination against single-, double-, and triple-mutant sequences by VF2468 compared to CCR5-224 (Fig. 4 and Table 3), the larger number of in vi " rro-cleavable VF2468 sites reflects the difference in the number of sites in the human genome that are three or fewer mutations away from the VF2468 target site (3,450 sites) versus those that are three or fewer mutations away from the CCR5-224 target site (eight sites) (Table 5).
• the method presented here identified hundreds of thousands of sequences that can be cleaved by two active, dimeric ZFNs, including many that are present and can be cut in the genome of human cells.
• One newly identified cleavage site for the CCR5-224 ZFN is within the promoter of the BTBD10 gene.
• BTBD10 When downregulated, BTBD10 has been associated with malignancy 21 and with pancreatic beta cell apoptosis 22 .
• BTBD10 When upregulated, BTBD10 has been shown to enhance neuronal cell growth 23 and pancreatic beta cell proliferation through phosphorylation of Akt family proteins 22,23 . This potentially important off-target cleavage site as well as seven others we observed in cells were not identified in a recent study 6 that used in vitro monomer-binding data to predict potential CCR5-224 substrates.
• ZFNs with increased specificity.
• Half or more of all potential substrates with one or two site mutations could be cleaved by ZFNs, suggesting that binding affinity between ZFN and DNA substrate is sufficiently high for cleavage to occur even with suboptimal molecular interactions at mutant positions.
• ZFNs presented with sites that have mutations in one half-site exhibited higher mutational tolerance at other positions within the mutated half-site and lower tolerance at positions in the other half-site.
• Oligonucleotides and Sequences All oligonucleotides were purchased from Integrated DNA Technologies or Invitrogen and are listed in Table 8. Primers with degenerate positions were synthesized by Integrated DNA Technologies using hand-mixed phosphoramidites containing 79% of. the indicated base and 7% of each of the other standard DNA bases. [00139] Sequences of ZFNs used in this study. DNA and protein sequences are shown for the ZFNs used in this study. The T7 promoter is underlined, and the start codon is in bold.
• Library-encoding oligonucleotides were of the form 5' backbone-PvwI site- NNNNNN-partially randomized half-site-N4_7-partially randomized half site-N-backbone 3'.
• the purified oligonucleotide mixture (approximately 10 pg) was blunted and phosphorylated with a mixture of 50 units of T4 Polynucleotide Kinase and 15 units of T4 DNA polymerase (NEB Next End Repair Enzyme Mix, NEB) in lx NEBNext End Repair Reaction Buffer (50 mM Tris-HCl, 10 mM MgCl 2 , 10 mM dithiothreitol, 1 mM ATP, 0.4 mM dATP, 0.4 mM dCTP, 0.4 mM dGTP, 0.4 mM dTTP, pH 7.5) for 1.5 hours at room temperature.
• NEB NEB Next End Repair Enzyme Mix
• the blunt- ended and phosphorylated DNA was purified with the Qiagen PCR Purification Kit according to the manufacturer's protocol, diluted to 10 ng/pL in NEB T4 DNA Ligase Buffer (50 mM Tris-HCl, 10 mM MgCl 2 , 10 mM dithiothreitol, 1 mM ATP, pH 7.5) and circularized by ligation with 200 units of T4 DNA ligase (NEB) for 15.5 hours at room temperature.
• NEB T4 DNA Ligase Buffer 50 mM Tris-HCl, 10 mM MgCl 2 , 10 mM dithiothreitol, 1 mM ATP, pH 7.5
• NEB T4 DNA ligase
• Circular monomers were gel purified on 1 % TAE-Agarose gels. 70 ng of circular monomer was used as a substrate for rolling-circle amplification at 30 °C for 20 hours in a 100 pL reaction using the Illustra TempliPhi 100 Amplification Kit (GE Healthcare). Reactions were stopped by incubation at 65 °C for 10 minutes. Target site libraries were quantified with the Quant-iT PicoGreen dsDNA Reagent (Invitrogen). Libraries with N 4 , N5, N 6 , and N7 spacer sequences between partially randomized half-sites were pooled in equimolar concentrations for both CCR5-224 and VF2468.
• Zinc finger Nuclease Expression and Characterization 3xFLAG-tagged zinc finger proteins for CCR5-224 and VF2468 were expressed as fusions to Fokl obligate heterodimers 30 in mammalian expression vectors 4 derived from pMLM290 and pMLM292. DNA and protein sequences are provided elsewhere herein. Complete vector sequences are available upon request. 2 ⁇ g of ZFN-encoding vector was transcribed and translated in vitro using the TNT Quick Coupled rabbit reticulocyte system (Promega). Zinc chloride (Sigma- Aldrich) was added at 500 ⁇ and the transcription/translation reaction was performed for 2 hours at 30 °C. Glycerol was added to a 50% final concentration.
• Test substrates for CCR5-224 and VF2468 were constructed by cloning into the Hindlll Xbal sites of pUC19. PCR with primers "test fwd” and “test rev” and Taq DNA polymerase yielded a linear 1 kb DNA that could be cleaved by the appropriate ZFN into two fragments of sizes -300 bp and -700 bp. Activity profiles for the zinc finger nucleases were obtained by modifying the in vitro cleavage protocols used by Miller et al. and Cradick et al. 31 .
• reaction mixture was purified with the Qiagen PCR Purification Kit. 1/10 of the reaction mixture was visualized by gel electrophoresis on a 1 % TAE-agarose gel and staining with SYBR Gold Nucleic Acid Gel Stain (Invitrogen).
• the purified DNA was blunted with 5 units DNA Polymerase I, Large (Kienow) Fragment (NEB) in lx NEBuffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl 2 , 1 mM dithiothreitol, pH 7.9) with 500 ⁇ dNTP mix (Bio-Rad) for 30 minutes at room temperature.
• the reaction mixture was purified with the Qiagen PCR Purification Kit and incubated with 5 units of Kienow Fragment (3' exo " ) (NEB) for 30 minutes at 37 °C in lx NEBuffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl 2 , 1 mM dithiothreitol, pH 7.9) with 240 ⁇ dATP (Promega) in a 50 ⁇ , final volume. 10 mM Tris-HCl, pH 8.5 was added to a volume of 90 ⁇ - and the reaction was incubated for 20 minutes at 75 °C to inactivate the enzyme before cooling to 12 °C.
• Kienow Fragment 3' exo " )
• DNA with ligated adapters were amplified by PCR with 2 units of Phusion Hot Start II DNA Polymerase (NEB) and 10 pmol each of primers "PE1" and "PE2" in l x Phusion GC Buffer supplemented with 3% DMSO and 1.7 mM MgCl 2 .
• PCR conditions were 98 °C for 3 min, followed by cycles of 98 °C for 15 s, 60 °C for 15 s, and 72 °C for 15 s, and a final 5 min extension at 72 °C.
• the PCR was run for enough cycles (typically 20-30) to see a visible product on gel.
• the reactions were pooled in equimolar amounts and purified with the Qiagen PCR Purification Kit.
• the purified DNA was gel purified on a 1 % TAE-agarose gel, and submitted to the Harvard Medical School
• Alumina sequencing reads were analyzed using programs written in C++. Algorithms are described elsewhere herein (e.g., Protocols 1-9), and the source code is available on request. Sequences containing the same barcode on both paired sequences and no positions with a quality score of 'B' were binned by barcode. Half-site sequence, overhang and spacer sequences, and adjacent randomized positions were determined by positional relationship to constant sequences and searching for sequences similar to the designed CCR5-224 and VF2468 recognition sequences.
• Positive specificity scores reflect base pairs that appear with greater frequency in the post-selection library than in the starting library at a given position; negative specificity scores reflect base pairs that are less frequent in the post-selection library than in the starting library at a given position.
• a score of + 1 indicates an absolute preference, a score of -1 indicates an absolute intolerance, and a score of 0 indicates no preference.
• ZFNs were cloned into a CMV-driven mammalian expression vector in which both ZFN monomers were translated from the same mRNA transcript in stoichiometric quantities using a self-cleaving T2A peptide sequence similar to a previously described vector 32 .
• This vector also expresses enhanced green fluorescent protein (eGFP) from a PGK promoter downstream of the ZFN expression cassette.
• eGFP enhanced green fluorescent protein
• PCR for 37 potential CCR5-224 substrates and 97 potential VF2468 substrates was performed with Phusion DNA Polymerase (NEB) and primers "[ZFN] [#] fwd” and "[ZFN] [#] rev” (Table 9) in lx Phusion HF Buffer supplemented with 3% DMSO. Primers were designed using Primer3 33 .
• the amplified DNA was purified with the Qiagen PCR Purification Kit, eluted with 10 mM Tris-HCl, pH 8.5, and quantified by IK Chip on a LabChip GX instrument (Caliper Life Sciences) and combined into separate equimolar pools for the catalytically active and empty vector control samples.
• PCR products were not obtained for 3 CCR5 sites and 7 VF2468 sites, which excluded these samples from further analysis.
• Multiplexed Illumina library preparation was performed according to the manufacturer's specifications, except that AMPure XP beads (Agencourt) were used for purification following adapter ligation and PCR enrichment steps.
• Illumina indices 1 1 (“GGCTAC”) and 12 (“CTTGTA”) were used for ZFN-treated libraries while indices 4 (“TGACCA”) and 6 (“GCCAAT”) were used for the empty vector controls.
• Library concentrations were quantified by KAPA Library Quantification Kit for Illumina Genome Analyzer Platform (Kapa Biosystems).
• Equal amounts of the barcoded libraries derived from active- and empty vector- treated cells were diluted to 10 nM and subjected to single read sequencing on an Illumina HiSeq 2000 at the Harvard University FAS Center for Systems Biology Core facility. Sequences were analyzed using Protocol 9 for active ZFN samples and empty vector controls.
• f-values were calculated for a one-sided test of the difference in the proportions of sequences with insertions or deletions from the active ZFN sample and the empty vector control samples.
• Protocol 1 Quality score filtering and sequence binning.
• Protocol 2 Filtering by ZFN ("AAT”, “ATA “, “TAA “, “CAC")
• the overhang sequence is determined by searching for the longest reverse-complementary subsequences between the subsequences of orientation 1 and orientation 2 that start after the barcodes
• the spacer sequence is determined by concatenating the reverse complement of the subsequence in orientation 1 that is between the overhang and the half-site (if any), the overhang, and the subsequence in orientation 2 that is between the overhang and the halfsite o if there is overlap between the overhang and half-site, only the non-overlapping subsequence present in the overhang is counted as part of the spacer
• each level of the tree corresponds to a position in the sequence
• sequence pairs are encoded in the nodes and a subsequence consisting of the concatenation of the spacer sequence, flanking nucleotide sequence, and tag sequence is sorted in the tree
• each newly entered sequence is compared to all other sequences in the node to avoid duplication
• Protocol 3 Library filtering ( "TCG ”)
• Protocol 4 Sequence profiles
• Protocol 5 Genomic matches
• each post-selection sequence was compared to the set of genomic sequences within nine and six mutations of CCR5-224 and VF2468, respectively
• Protocol 6 Enrichment factors for sequences with 0, 1, 2, or 3 mutations
• Protocol 7 Filtered sequence profiles
• Protocol 8 Compensation difference map
• Protocol 9 NHEJ search
• GMRPl Glucose metabolism-related protein 1
• Selection 1 included a comparison between TALENs having a +28 vs. a +63 linker.
• Selection 2 included a comparison of TALENs of different TAL domain length.
• TAL DNA binding domains are the basis of a transformative technology to specifically modulate target DNA both in vitro and in cells.
• the designable TAL DNA binding domains have advantages in targetable sequence space and ease of construction compared to other DNA binding domains, for example, zinc fingers.
• 39/128 binding domains are comprised of repeats of a 34 amino acid domain with a highly variable di-amino acid (RVD) coding for recognition of a single base pair in the target DNA sequence (Fig. 20).
• RVD di-amino acid
• the TAL DNA binding domain (an array of repeats) can be linked to the monomer of a heterodimeric nuclease domain to form a TAL nuclease.
• two distinct TAL nucleases can bind adjacent target half sites to cleave a specific sequence resulting in genome modifications in vivo (Fig. 19 and 20).
• J66TALCCR5BJ 5 CCACGCTN(N 1 :07070779)(N2:07790707)(N 1 )(N1 )(N2)(N3:79070707)(N1)(
• J67TALCCR5BJ 6 CCACGCTN(N 1 :07070779)(N2:07790707)(N 1 )(N 1 )(N2)(N3:790707)(N1 )(
• J69TALCCR5B_18 CCACGCTN(N 1 :07070779)(N2:07790707)(N 1 )(N 1 )(N2)(N3 :79070707)(N1 )(
• J71TALCCR5B_20 CCACGCTN(N 1 :07070779)(N2: 07790707)(N 1 )(N 1 )(N2)(N3 :790707)(N 1 )(
• J73TALCCR5B_22 CCACGCTN(N 1 : 07070779)(N2: 07790707)(N 1 )(N 1 )(N2)(N3 :790707)(N 1 )(
• J75TALCCR5B_24 CCACGCTN(N 1 :07070779)(N2:07790707)(N1 )(N 1 )(N2)(N3:79070707)(N1)(
• CGTAAadapterRE TTACGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCG V GTGG
• CTCTTCCGATCTGTACT GTACTadapterRE AGTACAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCG V GTGG
• TACGAadapterRE TCGTAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCG V GTGG
• ATGCTadapterRE AGCATAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCG V GTGG
• TGCAAadapterRE TTGCAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCG V GTGG
• GCATTadapterRE AATGCAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCG V GTGG
• GACTAadapterRE TAGTCAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCG V GTGG
• CTGAAadapterRE TTCAGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCG V GTGG
• PE_TALCCR5Blib TCGGGAACGTGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGT adapter 1 CTAATCTCGTATGCCGTCTTCTGCTTG
• PE_TALCCR5Blib GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCACGTT
• PE_TALCCR5Blib TCGGGACGTAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGT adapter2 CTAATCTCGTATGCCGTCTTCTGCTTG
• PE_TALCCR5BIib TCGGGAGTACGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGT adapter3 CTAATCTCGTATGCCGTCTTCTGCTTG
• PE_T ALCCR5 B 1 i b GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGTACT
• PE_TALCCR5Blib TCGGGATACGGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGT adapter4 CTAATCTCGTATGCCGTCTTCTGCTTG
• the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc. , from one or more of the claims or from relevant portions of the description is introduced into another claim.
• any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim.
• the claims recite a composition, it is to be understood that methods of using the composition for any of the purposes disclosed herein are included, and methods of making the composition according to any of the methods of making disclosed herein or other methods known in the art are included, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
• Table 1 CCR5-224 off-target sites in the genome of human K562 cells. Lower case letters indicate mutations compared to the target site. Sites marked with an 'X' were found in the corresponding in vitro selection dataset. T refers to the total number of mutations in the site, and '(+)' and '(-)' to the number of mutations in the (+) and (-) half-sites, respectively. The sequences of the sites are listed as 5' (+) half-site/spacer/(-) half-site 3', therefore the (+) half- site is listed in the reverse sense as it is in the sequence profiles.
• K562 modification frequency is the frequency of observed sequences showing significant evidence of nonhomologous end joining repair (see Methods) in cells expressing active ZFN compared to cells expressing empty vector. Sites that did not show statistically significant evidence of modifications are listed as not detected (n.d.), and K.562 modification frequency is left blank for the three sites that were not analyzed due to non-specific PCR amplification from the genome. Table 4 shows the sequence counts and F-values for the tested sites used to determine K562 modification frequency, and Table 6 shows the modified sequences obtained for each site.
• Table 2 Sequencing statistics. The total number of interpretable sequences ("total sequences") and the number of analyzed sequences for each in vitro selection condition are shown. Analyzed sequences are non-repeated sequences containing no ambiguous nucleotides that, for post-selection sequences, contained reverse complementary overhang sequences of at least four bases, a signature used in this study as a hallmark of ZFN-mediated cleavage. "Incompatible overhangs" refer to sequences that did not contain reverse complementary overhang sequences of at least four bases.
• the high abundance of repeated sequences in the 0.5 nM, 1 nM, and 2 nM selections indicate that the number of sequencing reads obtained in those selections, before repeat sequences were removed, was larger than the number of individual DNA sequences that survived all experimental selection steps.
• Enrichment factors were calculated for each sequence identified in the selection by dividing the observed frequency of that sequence in the post-selection sequenced library by the observed frequency of that sequence in the preselection library.
• the enrichment factors for the wild-type sequence (wt EFs) calculated for each in vitro selection stringency are shown in the first row of the table.
• CCR5-224 genomic off-target sites The human genome was searched for DNA sequences surviving in vitro selection for CCR5-224 cleavage. Sites marked with an 'X' were found in the in vitro selection dataset. T' refers to the total number of mutations in the site, and '(+)' and '(-)' to the number of mutations in. the (+) and (-) half-sites, respectively. Chromosomal coordinates from build 36 of the human genome are listed. Mutation frequency for each site is the percentage of sequences with insertions or deletions (indels) in the sequenced DNA from cultured K562 cells expressing active CCR5-224.
• Bolded red sites have significantly enriched indel percentages in the active nuclease sample compared to cells containing empty vector.
• the sequences of the sites are listed as 5' (+) halfsite/ spacer/(-) half-site 3', therefore the (+) half-site is listed in the reverse sense as it is in the sequence profiles.
• Three sites were not tested since they did not yield site-specific PCR amplification products. Indels and totals are not shown for those sites that were not tested. P-values shown are for the one-sided alternative hypothesis that the indel frequency is greater for active ZFN treated cells than for cells not expressing ZFN.
• Table 5 There are many more potential genomic VF2468 target sites than CCR5-224 target sites.
• the human genome was computationally searched for sites up to nine mutations away from the canonical CCR5-224 target site and up to six mutations away from the canonical VF2468 target site.
• the number of occurrences of sites containing five or six base pair spacers in the genome, including repeated sequences, is listed in the table.
• Table 6 Sequences of CCR5-224-mediated genomic DNA modifications identified in cultured human K562 cells. Sequences with insertions (blue) and deletions (red) identified after sequencing potential CCR5-224 off-target sites from cultured K562 cells expressing CCR5-224 are shown. The numbers of occurrences are shown to the right of each sequence. Other mutations are indicated with lowercase letters and likely reflect mutations that arose during PCR or sequencing. The unmodified site is listed under the gene name or coordinates (build 36), and the spacer sequence is underlined.
• Table 7 Potential VF2468 genomic off-target sites.
• DNA for 90 out of 97 potential VF2468 genomic target sites were amplified by PCR from cultured K562 cells expressing active VF2468 ZFN or from cells containing empty expression vector.
• Mutation frequency for each site is the percentage of sequences with insertions or deletions (indels) in the sequenced DNA from cultured K562 cells expressing active VF2468.
• Bolded red sites have significantly enriched indel percentages in the active nuclease sample compared to cells not expressing nuclease.
• the sequences of the sites are listed as 5' (+) halfsite/ spacer/(-) half-site 3', therefore the (+) half-site is listed in the reverse sense as it is in the sequence profiles.
• VF2468 7 fwd ACCATAGTCCAGCGGGGTCA VF2468 7 rev TTCTCCCCAAGGAAGGCTGA
• VF2468 8 fwd AGAAAGGGTGGTCGGGGAAG VF2468 8 rev GCCACCATGCCCAGTCTACA
• VF2468 9 fwd TTCCCATGGGGTCTCAGCTC VF2468 9 rev ATGGCCTTCCCCAACTGTGA
• VF2468 11 fwd GGCTTGAGCTGGAAGGACCA VF2468 11 rev TGGAGCAACTGAACATCTTGGG
• VF2468 13 fwd TATCCTCCCCTTTCCCCTGA VF2468 13 rev TGTTGCCAGAAGTATCAGGTCCC
• VF2468 15 fWd AGAACCCGGAATCCCTTTGC VF2468 15 rev GCAGAGAAGGCAGCAGCACA
• VF2468 19 fwd CTAGGCCTGTGGGCTGAGGA VF2468 19 rev CAAATGTTGGGGTGTGGGTG
• VF2468 20 fwd TACCTGAAACCCCTGGCCCT VF2468 20 rev CAAGCTGGATGTGGATGCAGAG
• VF2468 21 fwd CGGGGGCCTGACATTAGTGA VF2468 21 rev GCCTGAAGATGCATTTGCCC
• VF2468 22 fwd TGCATTGGCTCAAGAATTGGG VF2468 22 rev TCACACAGTGGTAATGGACAGGAA
• VF2468 24 fwd TGTTTGGGTTATGGGGGCAG VF2468 24 rev TCCAGCATCTGCTCCTGGTG
• VF2468 25 fwd AAGGAGACTTCTCAGGCCCCA VF2468 25 rev TGAAGGGAAGCCACAGCTCC
• VF2468 26 fwd CTTGGGGGCAGACAGCATCT VF2468 26 rev GCCATGGGATGGCAGTTAGG
• VF2468 27 fwd TGGCCTCAAGCAATCCTCCT VF2468 27 rev TTCCATGGCAGTGAAGGGTG
• VF2468 28 fwd CCAAAGAGCCTGGAGGAGCA VF2468 28 rev CAGAGGGTGTGGTGGTGTCG
• VF2468 29 fwd CCAGCCTGTGAAGCTGGAAGTAA VF2468 29 rev CCAGTGGGCTGAGTGGATGA
• VF2468 30 fwd CATCTGAATGCCC ATGC TGC VF2468 30 rev CCGCCACACCCATTCCTC
• VF2468 31 fwd CCTCAAAGAAACGGCTGCTGA VF2468 31 rev GCCGCTCGAAAAGAGGGAAT
• VF2468 32 fwd CGGGCTCTCCTCCTCAAAGA VF2468 32 rev GGCCCCTTGAAAAGAGGGAA
• VF2468 34 fwd CCCGCCAGACACATTCCTCT VF2468 34 rev CATCTGAATGCCCATGCTGC
• VF2468 35 fwd CCGCACCTTTTTCCTATGTGGT VF2468 35 rev TCAGATGTGCTAGGACACAGATGAC
• VF2468 37 fwd TTACACCTGCTGGCAGGCAA VF2468 37 rev GCTGGTGTGAGCAAGAGGCA
• VF2468 38 fwd TGGCCAAGCCTGCCTAACTC VF2468 38 rev TGATCAGTTAGCCCTGGGGG
• VF2468 39 fwd CCCCTTCTGCTCCTGCTTCA VF2468 39 rev CCTTCCTTGCAGCTCAAACCC
• VF2468 40 fwd TGATTTTCAGCGTGGAGGGC VF2468 40 rev ACGGCAAAGCCAGAGCAAAG
• VF2468 41 fwd AAGCTGGCAGCCACTCTTCA VF2468 41 rev TCTCAGGGCTTCTGTGTGCG
• VF2468 42 fwd TCGATTCTCCATACACCATCAAT VF2468 42 rev GCAACCAACTCCCAACAGGG
• VF2468 43 fwd AGGTCCTGGCATTGTCTGGG VF2468 43 rev TGGTTGCCTGTTTCACACCC
• VF2468 45 fwd CTGGGAGGCAGCCAGTCAAG VF2468 45 rev GCCCTGTAAGCTGAAGCTGGA
• VF2468 46 fwd CAGGTGTGCATTTTGTTGCCA VF2468 46 rev GCCTGCCAGGTATTTCCTGTGT
• VF2468 47 fwd TGGCCCTGGTCATGTGAAAA VF2468 47 rev AACTGCAAGTGGCCTCCCAG
• VF2468 48 fwd TTGATAAGGGCGGTGCCACT VF2468 48 rev TAGAGGGAGGTGCTTGCCCA
• VF2468 50 fwd ACTGCCAATGGACCCTCTCG VF2468 50 rev GAGTTGCCCAGGTCAGCCAT
• VF2468 51 fwd GGGGAGCTAGAATGGTGGGC VF2468 51 rev CAAGGTACACAGCTGCCCAGG
• VF2468 52 fwd CCCATGCTGGTCCTGCTGTT VF2468 52 rev GGAGGCTCAGCGGAGAGGAT
• VF2468 53 fwd GGGGTCACCAGGGAAGGTTT VF2468 53 rev AGTTGCGGGGAGGTGCTACA
• VF2468 56 fwd GCCAATGTGCAATCGAGACG VF2468 56 rev TGCATGCCTCTGACTGATGCT
• VF2468 58 fwd CCCAATCCAGACACCACACG VF2468 58 rev TGCAGATTTTAGGGGTTGCCA
• VF2468 59 fwd GGTGAGGAAGGATGGGGGTT VF2468 59 rev GTAGGCTCTGCCACGCCAGT
• VF2468 60 fwd TGCCCATGTTGTTGCTCCAC VF2468 60 rev GACAAGTTAGACCATCCTAGCCCTCA
• VF2468 63 fwd CCATGAGCACAATTGCCAAAA VF2468 63 rev TGAGTTATTTCGAAAGAGGAAACAGTG
• VF2468 64 fwd CTGCCAAGAACAGGAGGGGA VF2468 64 rev AGCCCATCTACCATCCAGCG
• VF2468 66 fwd ATCGGGGCAGGGCTAGAGTC VF2468 66 rev CCCCTGGCATTCCCTACACA
• VF2468 68 fwd GTTCCTCCCAGAGTGGGGCT VF2468 68 rev ACTGAGGGAGGCAGCACTGG
• VF2468 69 fwd AGGCCTGGCGGTAACCTTG VF2468 69 rev AAGCTCCAGCCCTGTACCCC
• VF2468 70 fwd GGGATCCTACAGGATGGGACAA VF2468 70 rev CAGCCCAGGACAAGGGTAGC VF2468 71 fwd GCCACCAAATGTCCACTGGTT VF2468 71 rev TTCCCCAAGCAGTCCAGCTC
• VF2468 73 fwd AATGGGGCAAAAGGCAAGAAA VF2468 73 rev CAGACCTCGTGGTGCATGTG
• VF2468 74 fwd TGGCGAGATAGGCTCTGCTACA VF2468 74 rev TGGACAGGGAATTACTCAGACCAG
• VF2468 75 fwd TGTGGGCATGAGACCACAGG VF2468 75 rev TTTGACTCCCCCGCATTGTT
• VF2468 76 fwd TCCTATTTTCAGATGCACTCGAACC VF2468 76 rev GTGCTCACTGAAGCCCACCA
• VF2468 78 fwd CCTTGCAAAGGCTTGCCTAAA VF2468 78 rev GGCAGGCACCTGTAGTCCCA
• VF2468 79 fwd TGGCTTGCAGAGGAGGTGAG VF2468 79 rev CAGGGAAGGGTGTTGGCTTG
• VF246880 fwd GCTTCAGCACATCAGTGGCG VF2468 80 rev TTCGCCCAGCTCATCAACAA
• VF246884 fwd TGTTTTCTGCAGTTTTGCAGGG VF2468 84 rev GGCTCAGGGAGTTTGAGCCA
• VF246885 fwd GCTCTGGCACCAGGCACACT VF2468 85 rev GGGAGAGAACCATGAATTTCCCA
• VF246886 fwd GCCAAACCCTTTCCAGGGAG VF2468 86 rev CCCACCCTATGCACAGAGCC
• VF246887 fwd CCTCAGCCAGTTGGAATCGG VF2468 87 rev CAACGGTTTAGTTTAGTTCCGGTTT
• VF246888 fwd TGGGTGGTGAAAATGGGGTT VF2468 88 rev GGTGGGGTATGCACTGGTCA
• VF246889 fwd GGAATGTGTGGAACTCAATTTCTTT VF2468 89 rev TTGCTTGCAGGGTGTGGAAA
• VF2468 90 fwd CCACAAGGGTCATCTGGGGA VF2468 90 rev CGGAGGCATCATCCACTGAG
• VF2468 95 fwd AGGCAATGGCACCAAAATGG VF2468 95 rev GCAGCCTTCACCATACCTGTGA
• VF2468 96 fwd TTTTGACTTTGAGAACCCCCTGA VF2468 96 rev CCTTGTCCTTTCTCAGTTAGACACA
• Oligonucleotides used in this study Oligonucleotides "[ZFN] [#] fwd/rev" were ordered from Invitrogen. All other oligonucleotides were ordered from Integrated DNA Technologies. 'N' refers to machine mixed incorporation of 'A','C','G', or 'T.' An asterisk indicates that the preceding nucleotide was incorporated as a mixture containing 79 mol % of that nucleotide and 7 mol % each of the other canonical nucleotides. "/5Phos/" denotes a 5' phosphate group installed during synthesis.
• T' refers to the total number of mutations in the site, and '(+)' and '(-)' to the number of mutations in the (+)

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Wood Science & Technology (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Molecular Biology (AREA)
• Genetics & Genomics (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• General Engineering & Computer Science (AREA)
• Microbiology (AREA)
• Biochemistry (AREA)
• Biotechnology (AREA)
• Immunology (AREA)
• Physics & Mathematics (AREA)
• Analytical Chemistry (AREA)
• Biophysics (AREA)
• Medicinal Chemistry (AREA)
• Biomedical Technology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Virology (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Pharmacology & Pharmacy (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Veterinary Medicine (AREA)
• Oncology (AREA)
• Communicable Diseases (AREA)
• Tropical Medicine & Parasitology (AREA)
• AIDS & HIV (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Enzymes And Modification Thereof (AREA)

Priority Applications (8)

Applications Claiming Priority (2)

Related Child Applications (4)

Publications (2)

Family

ID=48192977

Family Applications (1)

Country Status (6)

Cited By (48)

Families Citing this family (25)

Family Cites Families (1747)