WO2017223107A1

WO2017223107A1 - Genome modifying enzyme therapy for diseases modulated by senescent cells

Info

Publication number: WO2017223107A1
Application number: PCT/US2017/038369
Authority: WO
Inventors: Robert O'brien; Remi-Martin LABERGE; Nathaniel David
Original assignee: Unity Biotechnology, Inc.
Priority date: 2016-06-20
Filing date: 2017-06-20
Publication date: 2017-12-28

Abstract

This invention provides technology and medicaments for treating senescent associated conditions by genome modification. Senescent cells are contacted with a genome modifying enzyme ― either an isolated enzyme complex or a nucleic acid vector encoding it. Suitable gene modifying enzymes include zinc finger (ZF) proteins, transcription activator like effector (TALE) proteins, and endonucleases such as Cas9 associated with a guide nucleic acid that targets a target sequence. Suitable objectives include upregulation of pro apoptotic proteins such as BIM, down-regulation or disruption of anti-apoptotic proteins such as Bcl xL and Bcl w, and down-regulation or disruption of essential pro-survival transcription factors such as FOXO4. The therapy induces a metabolic process that kills or reduces activity of the senescent cells, thereby alleviating clinical presentations that are caused by such cells.

Description

GENOME MODIFYING ENZYME THERAPY FOR DISEASES MODULATED BY

SENESCENT CELLS

RELATED APPLICATION

[0001] This application claims the benefit of priority of U.S. provisional patent application 62/352, 167 (N. David, Unity Biotechnology) filed on June 20, 2016. The priority application is hereby incorporated herein by reference in its entirety for all purposes.

FIELD OF THE INVENTION

[0002] The invention relates generally to the preparation and use of pharmaceutical agents for treatment of senescence-associated conditions. In particular, biological agents are provided that induce killing or reduce the activity of senescent cells by genome modification.

BACKGROUND

[0003] Aging is a risk factor for most chronic diseases, disabilities, and declining health.

Senescent cells, which are cells in replicative arrest, accumulate as an individual ages and can contribute partially or significantly to cell and tissue deterioration that underlies aging and age related diseases. Cells can also become senescent after exposure to an environmental, chemical, or biological insult or as a result of a disease.

[0004] Because senescent cells are believed to contribute to a variety of age-related

pathologies, there is currently a need for new modalities to treat senescence-associated diseases.

SUMMARY OF THE INVENTION

[0005] This invention provides a method for selectively killing or reducing activity of a senescent cell by contacting the cell with a genome modifying enzyme, thereby inducing a metabolic process that kills or reduces activity of the senescent cell. The invention also provides methods, pharmaceutical compositions, and other products and techniques for treating senescence associated disorders. A medicament containing a genome modifying enzyme or a nucleic acid vector that encodes a genome modifying enzyme is administered to the subject being treated, thereby killing or reducing activity of senescent cells that are mediating the disorder.

[0006] Gene modifying enzymes suitable for use according to this inveniton include zinc finger (ZF) proteins, transcription activator like effector (TALE) proteins, and endonucleases such as Cas9 associated with a guide nucleic acid that targets a target sequence. Therapeutic genome modifications that can be induced for the purpose of senescent cell killing according to this invention include upregulation of pro-apoptotic proteins such as BEVI, down-regulation or disruption of anti-apoptotic proteins such as Bcl-xL and Bcl-w, and down-regulation or disruption of essential pro-survival transcription factors such as FOX04.

[0007] Certain features of the invention are referred to in the appended claims. Other features are referred to in the description provided in the next section. Features described in this disclosure and their equivalents can be selected for use in a product or method according to this invention in any operable combination.

DRAWINGS

[0008] FIGS. 1 A and IB show target sequences and short hairpin RNA sequences used to validate targets for gene modification.

[0009] FIG. 2 graphically provides proof of concept for this invention. The data show that knockdown of the anti-apoptosis factor Bcl-xL with various short hairpin RNA (shRNA) sequences leads to specific killing of senescent cells. Assays of this kind can be used for selection of targets and optimization of effector sequences for gene modification therapy according to this invention.

DETAILED DESCRIPTION

[0010] Clearance of senescent cells from specific tissues in several senescent-related diseases is believed to confer phenotypic benefits and improve clinical presentation. This disclosure provides products and methods that are designed for genome modification in vivo, whereby gene expression is modified specifically in senescent cells. The products include purified

recombinant proteins or riboprotein complexes, or nucleic acid vectors encoding them that are capable of specific killing of senescent cells for therapeutic benefit.

Modes of eliminating or modifying senescent cells

[0011] Senescent cells can be modulated in a manner that causes them to be eliminated or have reduced activity, for example, by one or more of the following modes:

• upregulation of endogenous pro-apoptotic proteins, such as BEVI (Bcl-2-like protein 11) and p53;

• down-regulation or disruption of anti-apoptotic proteins such as Bcl-xL and Bcl-w;

• down-regulation or disruption of other proteins that prevent activation of other

pathways leading to cell elimination, such as MDM2 (which inhibits cell death from caspase-independent podoptosis); • down-regulation or disruption of essential pro-survival transcription factors, such as FOX04 (the transcription factor Forkhead box protein 04); or

• expression of a recombinantly introduced gene that promotes apoptosis or otherwise leads to elimination of senescent cells.

[0012] Therapeutic mechanisms by which expression of specific genes or loci can be modulated in senescent cells include

• zinc finger (ZF) proteins;

• transcription activator like effector (TALE) proteins; and

• riboprotein complexes such as an endonuclease (e.g. cas9) associated with a guide RNA that targets a target sequence.

Genome targets

[0013] Genomic modification according to this invention is typically configured for specific effector proteins to specific loci in the genome of senescent cells. This promotes elimination of senescent cells or otherwise impairs their contribution to the pathophysiology of the condition being treated.

[0014] Locus-specific genomic modification is designed to eliminate or modulate expression of an endogenous gene (positively or negatively), or to introduce a new gene. DNA/chromatin modifying enzyme domains suitable for use in this invention include the following:

• Nuclease domains (FOK1 or endogenous Cas9/Cfpl activity) to cut the genome and disrupt gene expression via non-homologous end joining (NHEJ) resulting in point or frame shift mutations. In the case of Zinc Finger Nucleases (ZFNs) or TALE Nucleases (TALENs), this requires use of two proteins to target two sequences separated by 4-7 base pairs to enable dimerization of the FOK1 nuclease domain which results in nuclease activity;

• Transcriptional activation domains (VP 16 or VP64) to recruit transcriptional

machinery and chromatin modifying enzymes (for example, histone

acetyltransferases, TET family of DNA demethylases) to a locus to be activated;

• Transcriptional repressor domains (KRAB) to recruit chromatin modifying proteins (Histone Deacetylases HDACs, DNA methyltransferases) repress a locus to be silenced; and

• Epigenetic modifiers (TET, DNMT, HAT or HDAC domains) to directly modify the genomic locus of interest. Form of therapeutic agents

[0015] A therapeutic agent according to this invention can be in the form of a recombinant virus (such as an adenovirus or lentivirus vector) or naked DNA encoding the protein and sequences to target and modulate the locus of interest. Alternatively, it can be in the form of a recombinant protein or riboprotein complex containing a cell penetrating peptide domain and a nuclear localization signal ( LS) peptide.

[0016] Preparation and formulation of vectors and biologicals as medicaments for human therapy is accomplished by standard techniques, outlined in standard reference materials such as the Advanced Textbook on Gene Transfer, D Scherman ed., Imperial College Press 2014;

Translating Gene Therapy to the Clinic, J. Laurence and M. Franklin, eds., Academic Press 2014; Biological Drug Products, W. Wang and M. Singh, eds., Wiley 2013; and the current edition of Remington: The Science and Practice of Pharmacy .

Cell specificity

[0017] A therapeutic agent according to this invention is typically designed to eliminate or affect expression specifically in senescent cells, in comparison with non-senescent cells in or around the same tissue, and in comparison with other tissues. The specificity can be provided by placing expression of a therapeutic gene under control of a gene regulatory element that is specific for senescent cells (such as a pl6 or p21 promoter, or an artificial 5x FkB binding element), and/or for a particular tissue type (such as those available from InvivoGen, San Diego, California). Exemplary is the 2.7 kb proximal segment of the pl6 promoter

(US 20140189897 Al).

[0018] Alternatively or in addition, the specificity of a therapeutic agent can be provided by designing the agent to target genes endogenously expressed in senescent cells that are essential for survival or function of senescent cells, but not for most other cell types (such as Bcl-xL, Bcl-w, and MDM2). For example, fusion of a therapeutic protein such as a Cas9, ZF or TALE to an MDM2 binding domain from p53 (SQETFSDLWKLLPEN) (SEQ. ID NO: 1) results in ubiquitination and degradation of these proteins in nonsenescent cells, which have active MDM2 resulting in specific delivery of intact protein to senescent cells that express the MDM2 inhibitor pl4arf and therefore lack MDM2 activity and thus do not degrade the therapeutic agent(s).

Testing for senolytic activity

[0019] Therapeutic vectors and protein complexes according to this invention can be screened for biological activity in an assay using senescent cells. Cultured cells are contacted with the compound, and the degree of cytotoxicity or inhibition of the cells is determined. The ability of the compound to kill or inhibit senescent cells can be compared with the effect of the compound on normal cells that are freely dividing at low density, and normal cells that are in a quiescent state at high density. Example 8 provides an illustration using the human lung fibroblast IMR90 cell line.

In vitro testing therapeutic proteins: viral delivery

Therapeutic nuclease proteins

[0020] (Cas9, TALE nuclease, Zinc Finger nuclease) recombinant viral vectors are generated in lentiviral, adenoviral or AAV vector systems and particles are packaged using standard methods. The respective therapeutic proteins are designed to target sequences at the locus of interest that are not found anywhere else in the genome.

[0021] For example, the sequence GGTCCAACTCCACGTATGGATCC (SEQ. ID NO:2) found at the FOX04 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this pro-survival gene product in senescent cells. In the case of Cas9, the protein is guided by a short guide RNA (sgRNA), while in the case of ZFNs or TALENs, two ZFN-FOK1/TALEN-FOK1 proteins targeting short 9-15 base sequences (in this case

GGTCCAACT and GGATCCATA) separated by 4-7 base pairs (in this case CCACG). When the therapeutic protein(s) interacts with this locus the nuclease domain(s) cut(s) the genome resulting in activation of the DNA repair machinery and Non Homologous End Joining ( HEJ) that causes mutations resulting in disruption of the ORF.

[0022] Viral particles encoding the TALENs, ZFNs or Cas9/sgRNA riboprotein complex targeting the locus of interest or a control sequence are delivered to cells in culture at an MOI of 2-5. Senescent cells have previously been irradiated with 10 Gy X-ray irradiation 7-14 days prior, while control cells have been maintained in standard culture conditions. Cells are incubated with virus for 2-3 days and survival is assessed by CellTiter-Glo® luminescent cell viability assay (Promega US, Maddison WI).

Therapeutic transcriptional activator proteins

[0023] (Nuclease deficient dCas9-VP64, TALE-VP64, Zinc Finger- VP64) recombinant viral vectors are generated in lentiviral, adenoviral or AAV vector systems and particles are packaged using standard methods. The respective therapeutic proteins are designed to target sequences at the locus of interest that are not found anywhere else in the genome.

[0024] For example, the sequence GATGTGACATTTCACGCCGCCGCC (SEQ. ID NO:3) found at the human USP7 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this de-ubiquitinating protein that regulate the pro-survival protein FOX04 in senescent cells. [0025] Viral particles encoding the TALE-VP64, ZF-VP64 or dCas9-VP64/sgRNA riboprotein complex targeting the locus of interest or a control sequence are delivered to cells in culture at an MOI of 2-5. Senescent cells have previously been irradiated with 10 Gy x-ray irradiation 7- 14 days prior, while control cells have been maintained in standard culture conditions. Cells are incubated with virus for 2-3 days and survival is assessed by CellTiter-Glo® assay.

Therapeutic transcriptional repressor proteins

[0026] (Nuclease deficient dCas9-KRAB, TALE-KRAB, Zinc Finger-KRAB) recombinant viral vectors are generated in lentiviral, adenoviral or AAV vector systems and particles are packaged using standard methods. The respective therapeutic proteins are designed to target sequences at the locus of interest that are not found anywhere else in the genome.

[0027] For example, the sequence GGTCCAACTCCACGTATGGATCC (SEQ. ID NO:2) found at the FOX04 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this pro-survival gene product in senescent cells.

[0028] Viral particles encoding the TALE-KRAB, ZF-KRAB or dCas9-KRAB/sgRNA riboprotein complex targeting the locus of interest or a control sequence are delivered to cells in culture at an MOI of 2-5. Senescent cells have previously been irradiated with 10 Gy x-ray irradiation 7-14 days prior, while control cells have been maintained in standard culture conditions. Cells are incubated with virus for 2-3 days and survival is assessed by CellTiter- Glo® assay.

In vitro testing therapeutic proteins: purified protein or riboprotein complex delivery

Therapeutic nuclease proteins

[0029] (Cas9, TALE nuclease, Zinc Finger nuclease) recombinant expression vectors are generated in E. coli, Pichia pastoris, CHO cells or other standard protein expression systems. In addition to the NLS, DNA targeting domain (or sgRNA) and nuclease domain, these therapeutic proteins also require a cell-penetrating peptide domain and a tag for purification. Proteins are overexpressed in the relevant system and purified using standard tag-based purification methods. The respective therapeutic proteins enter the cell via the CPP domain (such as TAT or 9R) and interact with target sequences at the locus of interest that are not found anywhere else in the genome.

[0030] For example, the sequence GGTCCAACTCCACGTATGGATCC (SEQ. ID NO:2) found at the human FOX04 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this pro-survival gene product in senescent cells. In the case of Cas9, the protein is guided by a short guide RNA (sgRNA), while in the case of ZFNs or TALENs, two ZFN-FOKl/TALEN-FOKl proteins targeting short 9-15 base sequences (in this case GGTCCAACT and GGATCCATA) separated by 4-7 base pairs (in this case CCACG) When the therapeutic protein(s) interacts with this locus the nuclease domain(s) cut(s) the genome resulting in activation of the DNA repair machinery and Non Homologous End Joining ( HEJ) that causes mutations resulting in disruption of the ORF.

[0031] Purified therapeutic proteins/riboprotein complexes are delivered to cells at increasing concentrations. Senescent cells have previously been irradiated with 10 Gy x-ray irradiation 7- 14 days prior, while control cells have been maintained in standard culture conditions. Cells are incubated with virus for 2-3 days and survival is assessed by CellTiter-Glo® assay.

Therapeutic transcriptional activator proteins:

[0032] (dCas9-VP64, TALE-VP64, Zinc Finger- VP64) recombinant expression vectors are generated E. coli, Pichia pastoris, CHO cells or other standard protein expression systems. In addition to the LS, DNA targeting domain (or sgRNA) and nuclease domain, these therapeutic proteins also require a cell-penetrating peptide domain and a tag for purification. Proteins are overexpressed in the relevant system and purified using standard tag-based purification methods. The respective therapeutic proteins enter the cell via the CPP domain (such as TAT or 9R) and interact with target sequences at the locus of interest that are not found anywhere else in the genome. The respective therapeutic proteins are designed to target sequences at the locus of interest that are not found anywhere else in the genome.

[0033] For example, the sequence GATGTGACATTTCACGCCGCCGCC (SEQ. ID NO:3) found at the human USP7 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this de-ubiquitinating protein that regulate the pro-survival protein FOX04 in senescent cells.

[0034] Purified therapeutic proteins/riboprotein complexes are delivered to cells at increasing concentrations. Senescent cells have previously been irradiated with 10 Gy x-ray irradiation 7- 14 days prior, while control cells have been maintained in standard culture conditions. Cells are incubated with virus for 2-3 days and survival is assessed by CellTiter-Glo® assay.

Therapeutic transcriptional repressor proteins

[0035] (dCas9-KRAB, TALE-KRAB, Zinc Finger-KRAB) recombinant expression vectors are generated in E. coli, Pichia pastoris, CHO cells or other standard protein expression systems. In addition to the NLS, DNA targeting domain (or sgRNA) and nuclease domain, these therapeutic proteins also require a cell-penetrating peptide domain and a tag for purification. Proteins are overexpressed in the relevant system and purified using standard tag-based purification methods. The respective therapeutic proteins enter the cell via the CPP domain (such as TAT or 9R) and interact with target sequences at the locus of interest that are not found anywhere else in the genome.

[0036] For example, the sequence GGTCCAACTCCACGTATGGATCC (SEQ. ID NO:2) found at the human FOX04 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this pro-survival gene product in senescent cells.

[0037] Purified therapeutic proteins/riboprotein complexes are delivered to cells at increasing concentrations. Senescent cells have previously been irradiated with 10 Gy x-ray irradiation 7- 14 days prior, while control cells have been maintained in standard culture conditions. Cells are incubated with virus for 2-3 days and survival is assessed by CellTiter-Glo® assay.

In vivo testing of therapeutic proteins/riboprotein complexes: viral delivery

Therapeutic nuclease proteins

[0038] (Cas9, TALE nuclease, Zinc Finger nuclease) recombinant viral vectors are generated in lentiviral, adenoviral or AAV vector systems and particles are packaged using standard methods. The respective therapeutic proteins are designed to target sequences at the locus of interest that are not found anywhere else in the genome.

[0039] For example, the sequence GGGGT TC G A AGT C GGG ATC G AGG (SEQ. ID NO:4) found at the mouse FOX04 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this pro-survival gene product in senescent cells. In the case of Cas9, the protein is guided by a short guide RNA (sgRNA), while in the case of ZFNs or TALENs, two ZFN-FOKl/TALEN-FOKl proteins targeting short 9-15 base sequences (in this case GGGGTTCGA and GGATCGAGG) separated by 4-7 base pairs (in this case AGTCG). When the therapeutic protein(s) interacts with this locus the nuclease domain(s) cut(s) the genome resulting in activation of the DNA repair machinery and Non Homologous End Joining (NHEJ) that causes mutations resulting in disruption of the ORF. Senescence in mice is induced by IP administration of doxorubicin.

[0040] Viral particles encoding the TALENs, ZFNs or Cas9/sgRNA riboprotein complex targeting the locus of interest or a control sequence are delivered to target organs by direct injection. Clearance of senescent cells is assessed by qPCR for pl6 or by a pl6 reporter transgene such as INK-ATTAC or 3 MR.

Therapeutic transcriptional activator proteins

[0041] (Nuclease deficient dCas9-VP64, TALE-VP64, Zinc Finger- VP64) recombinant viral vectors are generated in lentiviral, adenoviral or AAV vector systems and particles are packaged using standard methods. The respective therapeutic proteins are designed to target sequences at the locus of interest that are not found anywhere else in the genome. [0042] For example, the sequence TTGGTGGTTCATGTCGGCCGCGG (SEQ. ID NO:5) found at the mouse USP7 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this de-ubiquitinating protein that regulate the pro-survival protein FOX04 in senescent cells. Senescence in mice is induced by IP administration of doxorubicin.

[0043] Viral particles encoding the TALE-VP64, ZF-VP64 or dCas9-VP64/sgRNA riboprotein complex targeting the locus of interest or a control sequence are delivered to target organs by direct injection. Clearance of senescent cells is assessed by qPCR for pl6 or by a pl6 reporter transgene such as INK-ATTAC or 3 MR.

Therapeutic transcriptional repressor proteins

[0044] (Nuclease deficient dCas9-KRAB, TALE-KRAB, Zinc Finger-KRAB) recombinant viral vectors are generated in lentiviral, adenoviral or AAV vector systems and particles are packaged using standard methods. The respective therapeutic proteins are designed to target sequences at the locus of interest that are not found anywhere else in the genome

[0045] For example, the sequence GGGGTTCGAAGTCGGGATCGAGG (SEQ. ID NO:4) found at the mouse FOX04 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this pro-survival gene product in senescent cells.

Senescence in mice is induced by IP administration of doxorubicin.

[0046] Viral particles encoding the TALE-KRAB, ZF-KRAB or dCas9-KRAB/sgRNA riboprotein complex targeting the locus of interest or a control sequence are delivered to target organs by direct injection. Clearance of senescent cells is assessed by qPCR for pl6 or by a pl6 reporter transgene such as F K-ATTAC or 3MR.

In vitro testing of purified therapeutic proteins: purified protein or riboprotein complex delivery Therapeutic nuclease proteins

[0047] (Cas9, TALE nuclease, Zinc Finger nuclease) recombinant expression vectors are generated in E. coli, Pichia pastoris, CHO cells or other standard protein expression systems. In addition to the NLS, DNA targeting domain (or sgRNA) and nuclease domain, these therapeutic proteins also require a cell-penetrating peptide domain and a tag for purification. Proteins are overexpressed in the relevant system and purified using standard tag-based purification methods. The respective therapeutic proteins enter the cell via the CPP domain (such as TAT or 9R) and interact with target sequences at the locus of interest that are not found anywhere else in the genome.

[0048] For example, the sequence GGTCCAACTCCACGTATGGATCC (SEQ. ID NO:2) found at the human FOX04 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this pro-survival gene product in senescent cells. In the case of Cas9, the protein is guided by a short guide RNA (sgRNA), while in the case of ZFNs or TALENs, two ZFN-FOK1/TALEN-FOK1 proteins targeting short 9-15 base sequences (in this case GGTCCAACT and GGATCCATA) separated by 4-7 base pairs (in this case CCACG). When the therapeutic protein(s) interacts with this locus the nuclease domain(s) cut(s) the genome resulting in activation of the DNA repair machinery and Non Homologous End Joining ( HEJ) that causes mutations resulting in disruption of the ORF.

[0049] Purified therapeutic proteins/riboprotein complexes are delivered to cells at increasing concentrations. Senescent cells have previously been irradiated with 10 Gy x-ray irradiation 7- 14 days prior, while control cells have been maintained in standard culture conditions. Cells are incubated with virus for 2-3 days and survival is assessed by CellTiter-Glo® assay.

Therapeutic transcriptional activator proteins

[0050] (dCas9-VP64, TALE-VP64, Zinc Finger- VP64) recombinant expression vectors are generated in E. coli, Pichia pastoris, CHO cells or other standard protein expression systems. In addition to the LS, DNA targeting domain (or sgRNA) and nuclease domain, these therapeutic proteins also require a cell-penetrating peptide domain and a tag for purification. Proteins are overexpressed in the relevant system and purified using standard tag-based purification methods. The respective therapeutic proteins enter the cell via the CPP domain (such as TAT or 9R) and interact with target sequences at the locus of interest that are not found anywhere else in the genome. The respective therapeutic proteins are designed to target sequences at the locus of interest that are not found anywhere else in the genome.

[0051] For example, the sequence GATGTGACATTTCACGCCGCCGCC (SEQ. ID NO:3) found at the human USP7 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this de-ubiquitinating protein that regulate the pro-survival protein FOX04 in senescent cells.

[0052] Purified therapeutic proteins/riboprotein complexes are delivered to cells at increasing concentrations. Senescent cells have previously been irradiated with 10 Gy x-ray irradiation 7- 14 days prior, while control cells have been maintained in standard culture conditions. Cells are incubated with virus for 2-3 days and survival is assessed by CellTiter-Glo® assay.

Therapeutic transcriptional repressor proteins

[0053] (dCas9-KRAB, TALE-KRAB, Zinc Finger-KRAB) recombinant expression vectors are generated in E. coli, Pichia pastoris, CHO cells or other standard protein expression systems. In addition to the NLS, DNA targeting domain (or sgRNA) and nuclease domain, these therapeutic proteins also require a cell-penetrating peptide domain and a tag for purification. Proteins are overexpressed in the relevant system and purified using standard tag-based purification methods. The respective therapeutic proteins enter the cell via the CPP domain (such as TAT or 9R) and interact with target sequences at the locus of interest that are not found anywhere else in the genome.

[0054] For example, the sequence GGTCCAACTCCACGTATGGATCC (SEQ. ID NO:2) found at the human FOX04 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this pro-survival gene product in senescent cells.

[0055] Purified therapeutic proteins/riboprotein complexes are delivered to cells at increasing concentrations. Senescent cells have previously been irradiated with 10 Gy x-ray irradiation 7- 14 days prior, while control cells have been maintained in standard culture conditions. Cells are incubated with virus for 2-3 days and survival is assessed by CellTiter-Glo® assay.

In vivo testing of purified therapeutic proteins: purified protein or riboprotein complex delivery Therapeutic nuclease proteins

[0056] (Cas9, TALE nuclease, Zinc Finger nuclease) recombinant expression vectors are generated in E. coli, Pichia pastoris, CHO cells or other standard protein expression systems. In addition to the NLS, DNA targeting domain (or sgRNA) and nuclease domain, these therapeutic proteins also require a cell-penetrating peptide domain and a tag for purification. Proteins are overexpressed in the relevant system and purified using standard tag-based purification methods. The respective therapeutic proteins enter the cell via the CPP domain (such as TAT or 9R) and interact with target sequences at the locus of interest that are not found anywhere else in the genome.

[0057] For example, the sequence GGGGT TC G A AGT C GGG ATC G AGG (SEQ. ID NO:4) found at the mouse FOX04 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this pro-survival gene product in senescent cells. In the case of Cas9, the protein is guided by a short guide RNA (sgRNA), while in the case of ZFNs or TALENs, two ZFN-FOK1/TALEN-FOK1 proteins targeting short 9-15 base sequences (in this case GGGGTTCGA and GGATCGAGG) separated by 4-7 base pairs (in this case AGTCG). When the therapeutic protein(s) interacts with this locus the nuclease domain(s) cut(s) the genome resulting in activation of the DNA repair machinery and Non Homologous End Joining (NHEJ) that causes mutations resulting in disruption of the ORF. Senescence in mice is induced by IP administration of doxorubicin.

[0058] Purified TALEN, ZFN proteins or Cas9/sgRNA riboprotein complex targeting the locus of interest or a control sequence are delivered to target organs by direct injection. Clearance of senescent cells is assessed by qPCR for pl6 or by a pl6 reporter transgene such as INK- ATT AC or 3 MR. Therapeutic transcriptional activator proteins

[0059] (dCas9-VP64, TALE-VP64, Zinc Finger- VP64) recombinant expression vectors are generated in E. coli, Pichia pastoris, CHO cells or other standard protein expression systems. In addition to the LS, DNA targeting domain (or sgRNA) and nuclease domain, these therapeutic proteins also require a cell-penetrating peptide domain and a tag for purification. Proteins are overexpressed in the relevant system and purified using standard tag-based purification methods. The respective therapeutic proteins enter the cell via the CPP domain (such as TAT or 9R) and interact with target sequences at the locus of interest that are not found anywhere else in the genome. The respective therapeutic proteins are designed to target sequences at the locus of interest that are not found anywhere else in the genome.

[0060] For example, the sequence TTGGTGGTTCATGTCGGCCGCGG (SEQ. ID NO:5) found at the mouse USP7 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this de-ubiquitinating protein that regulate the pro-survival protein FOX04 in senescent cells. Senescence in mice is induced by IP administration of doxorubicin.

[0061] Purified TALE-VP64, ZF-VP64 protein or dCas9-VP64/sgRNA riboprotein complex targeting the locus of interest or a control sequence are delivered to target organs by direct injection. Clearance of senescent cells is assessed by qPCR for pl6 or by a pl6 reporter transgene such as INK-ATTAC or 3 MR.

Therapeutic transcriptional repressor proteins

(dCas9-KRAB, TALE-KRAB, Zinc Finger-KRAB) recombinant expression vectors are generated E. coli, Pichia pastoris, CHO cells or other standard protein expression systems. In addition to the NLS, DNA targeting domain (or sgRNA) and nuclease domain, these therapeutic proteins also require a cell-penetrating peptide domain and a tag for purification. Proteins are overexpressed in the relevant system and purified using standard tag-based purification methods. The respective therapeutic proteins enter the cell via the CPP domain (such as TAT or 9R) and interact with target sequences at the locus of interest that are not found anywhere else in the genome.

[0062] For example, the sequence GGGGT TC G A AGT C GGG ATC G AGG (SEQ. ID NO:4) found at the mouse FOX04 locus is unique in the genome and therefore allows specific targeting of the therapeutic proteins to this pro-survival gene product in senescent cells.

Senescence in mice is induced by IP administration of doxorubicin.

[0063] Purified TALE-KRAB, ZF-KRAB protein or dCas9-KRAB/sgRNA riboprotein complex targeting the locus of interest or a control sequence are delivered to target organs by direct injection. Clearance of senescent cells is assessed by qPCR for pl6 or by a pl6 reporter transgene such as INK-ATTAC or 3 MR.

Examples of commercial products

[0064] Products for clearance of senescent cells in human therapeutic applications according to this invention include the following examples:

• Purified Cas9/sgRNA riboprotein nuclease complex targeting loci essential for

survival of senescent cells such as FOX04 or p21CIP/WAF for administration to clear senescent cells in IPF

• Purified Zinc Finger nuclease proteins targeting loci essential for survival of

senescent cells such as FOX04 or p21CIP/WAF for administration to clear senescent cells in IPF

• Purified TALE nuclease proteins targeting loci essential for survival of senescent cells such as FOX04 or p21CIP/WAF for administration to clear senescent cells in IPF

• Virally encoded Cas9/sgRNA riboprotein nuclease complex targeting loci essential for survival of senescent cells such as FOX04 or p21CIP/WAF for administration to clear senescent cells in IPF

• Virally encoded Zinc Finger nuclease proteins targeting loci essential for survival of senescent cells such as FOX04 or p21CIP/WAF for administration to clear senescent cells in IPF

• Virally encoded TALE nuclease proteins targeting loci essential for survival of

• Purified dCas9/sgRNA riboprotein transcriptional repressor complex targeting loci essential for survival of senescent cells such as FOX04 or p21CIP/WAF for administration to clear senescent cells in IPF

• Purified Zinc Finger transcriptional repressor proteins targeting loci essential for survival of senescent cells such as FOX04 or p21CIP/WAF for administration to clear senescent cells in IPF

• Purified TALE transcriptional repressor proteins targeting loci essential for survival of senescent cells such as FOX04 or p21CIP/WAF for administration to clear senescent cells in IPF • Virally encoded dCas9/sgRNA riboprotein transcriptional repressor complex targeting loci essential for survival of senescent cells such as FOX04 or

p21CIP/WAF for administration to clear senescent cells in IPF

• Virally encoded Zinc Finger transcriptional repressor proteins targeting loci essential for survival of senescent cells such as FOX04 or p21CIP/WAF for administration to clear senescent cells in IPF

• Virally encoded TALE transcriptional repressor proteins targeting loci essential for survival of senescent cells such as FOX04 or p21CIP/WAF for administration to clear senescent cells in IPF

• Purified dCas9/sgRNA riboprotein transcriptional activator complex targeting loci detrimental for survival of senescent cells such as USP7 for administration to clear senescent cells in IPF

• Purified Zinc Finger transcriptional activator proteins targeting loci detrimental for survival of senescent cells such as USP7 for administration to clear senescent cells in IPF

• Purified TALE transcriptional activator proteins targeting loci detrimental for

survival of senescent cells such as USP7 for administration to clear senescent cells in IPF

• Virally encoded dCas9/sgRNA riboprotein transcriptional activator complex

targeting loci detrimental for survival of senescent cells such as USP7 for

administration to clear senescent cells in IPF

• Virally encoded Zinc Finger transcriptional activator proteins targeting loci

detrimental for survival of senescent cells such as USP7 for administration to clear senescent cells in IPF

• Virally encoded TALE transcriptional activator proteins targeting loci detrimental for survival of senescent cells such as USP7 for administration to clear senescent cells in IPF

• Virally encoded Cas9/sgRNA riboprotein nuclease complex whose expression is driven by a senescent cell specific promoter such as pl6 or p21 targeting loci essential for survival of cells such Pol2L as for administration to clear senescent cells in IPF

• Virally encoded Zinc Finger nuclease protein whose expression is driven by a

senescent cell specific promoter such as pl6 or p21 targeting loci essential for survival of cells such Pol2L as for administration to clear senescent cells in IPF • Virally encoded TALE nuclease protein whose expression is driven by a senescent cell specific promoter such as pl6 or p21 targeting loci essential for survival of cells such Pol2L as for administration to clear senescent cells in IPF

• Virally encoded dCas9-KRAB/sgRNA riboprotein transcriptional repressor complex whose expression is driven by a senescent cell specific promoter such as pl6 or p21 targeting loci essential for survival of cells such as Pol2L for administration to clear senescent cells in IPF

• Virally encoded Zinc Finger-KRAB transcriptional repressor whose expression is driven by a senescent cell specific promoter such as pl6 or p21 targeting loci essential for survival of cells such as Pol2L for administration to clear senescent cells in IPF

• Virally encoded TALE-KRAB transcriptional repressor whose expression is driven by a senescent cell specific promoter such as pl6 or p21 targeting loci essential for survival of cells such as Pol2L for administration to clear senescent cells in IPF

• Virally encoded dCas9-VP64/sgRNA riboprotein transcriptional activator complex whose expression is driven by a senescent cell specific promoter such as pl6 or p21 targeting loci pro-apoptotic genes such as BAX, BAD or BEVI for administration to clear senescent cells in IPF

• Virally encoded Zinc Finger VP64 transcriptional activator protein whose expression is driven by a senescent cell specific promoter such as pl6 or p21 targeting loci pro- apoptotic genes such as BAX, BAD or BEVI for administration to clear senescent cells in IPF

• Virally encoded TALE VP64 transcriptional activator protein whose expression is driven by a senescent cell specific promoter such as pl6 or p21 targeting loci pro- apoptotic genes such as BAX, BAD or BEVI for administration to clear senescent cells in IPF

• Purified Cas9/sgRNA riboprotein nuclease complex that is degraded in nonsenescent cells, via fusion to the MDM2 interacting domain of p53, that targets loci essential for survival of cells such Pol2L as for administration to clear senescent cells in EPF

• Purified Zinc Finger nuclease protein that is degraded in nonsenescent cells, via fusion to the MDM2 interacting domain of p53, that targets loci essential for survival of cells such Pol2L as for administration to clear senescent cells in EPF

• Purified TALE nuclease protein that is degraded in nonsenescent cells, via fusion to the MDM2 interacting domain of p53, that targets loci essential for survival of cells such Pol2L as for administration to clear senescent cells in EPF • Purified dCas9-KRAB/sgRNA riboprotein transcriptional repressor complex that is degraded in nonsenescent cells, via fusion to the MDM2 interacting domain of p53, that targets loci essential for survival of cells such Pol2L as for administration to clear senescent cells in IPF

• Purified Zinc Finger-KRAB transcriptional repressor that is degraded in

nonsenescent cells, via fusion to the MDM2 interacting domain of p53, that targets loci essential for survival of cells such Pol2L as for administration to clear senescent cells in IPF

• Purified TALE-KRAB transcriptional repressor that is degraded in nonsenescent cells, via fusion to the MDM2 interacting domain of p53, that targets loci essential for survival of cells such Pol2L as for administration to clear senescent cells in IPF

• Purified dCas9-VP64/sgRNA riboprotein transcriptional activator complex that is degraded in nonsenescent cells, via fusion to the MDM2 interacting domain of p53, targeting loci pro-apoptotic genes such as BAX, BAD or BEVI for administration to clear senescent cells in IPF

• Purified Zinc Finger VP64 transcriptional activator protein that is degraded in

nonsenescent cells, via fusion to the MDM2 interacting domain of p53, targeting loci pro-apoptotic genes such as BAX, BAD or BEVI for administration to clear senescent cells in IPF

• Purified TALE VP64 transcriptional activator protein that is degraded in

Definitions

[0065] A "genome editing enzyme" is a nuclease that is capable (in combination with protein or nucleic acid cofactors, if needed) of physically changing the sequence of part of a genome of a cell when appropriately delivered into the cell. The sequence may be changed by deletion of a sequence already present in the genome, by inserting additional sequence into the genome, by modifying one or more bases in the genome, or any combination thereof.

[0066] A "genome modifying enzyme" is an enzyme that is capable (in combination with protein or nucleic acid cofactors, if needed) of physically changing part of a genome of a cell such that the expression pattern of the cell is altered: for example, by editing the genome, by up- or down-regulating gene expression, by changing the sequence of what is transcribed from a gene. The genome modifying enzyme may be a genome editing enzyme, or it may induce epigenetic changes in the genome so as to alter expession of a target gene within the genome of the cell being modified.

[0067] The term "vector" as used in this disclosure refers to an active biopharmaceutical agent that includes a therapeutic nucleic acid (such as a recombinant gene) and a means of delivering the therapeutic agent into a target cell. The term includes but is not limited to vectors, and naked DNA vectors optionally in combination with a penetration enhancer such as Lipofectin®, and other combinations having the desired function. The vector may also have transcription and/or translation control elements that control expression of the therapeutic nucleic acid.

[0068] A "senescent cell" is generally thought to be derived from a cell type that typically replicates, but as a result of aging or other event that causes a change in cell state, can no longer replicate. It remains metabolically active and commonly adopts a senescence associated secretory phenotype (SASP). The nucleus of senescent cells is often characterized by senescence-associated heterochromatin foci and DNA segments with chromatin alterations reinforcing senescence. Without implying any limitation on the practice of what is claimed in this disclosure not explicitly stated or required, the invention is premised on the hypothesis that senescent cells cause or mediate certain conditions associated with tissue damage or aging.

[0069] A senescent cell can exhibit senescence-associated secretory phenotype (SASP or SMS), in which they can acquire the ability to secrete a variety of growth factors, cytokines, chemokines, and proteases (Coppe et al., PLoS Biol., 6:2853-2868, 2008). A subject with a senescent cell can be treated with the compositions and methods of the invention and assessed for phenotypic changes, for example, a reduction in SASP or other senescence-associated phenotype after treatment, as compared with a control subject and/or treatment with a control agent.

[0070] For the purpose of practicing certain aspects of this invention, senescent cells can be identified as expressing at least one marker selected from pi 6, senescence-associated β-galactosidase, and lipofuscin; sometimes two or three of these markers, and optionally other markers of SASP such as interleukin 6.

[0071] A "senescence associated" disease, disorder, or condition is a physiological condition that presents with by one or more symptoms or signs, wherein a subject having the condition needs or would benefit from a lessening of such symptoms or signs. The condition is senescence associated if it occurs predominantly in people over 65 years of age, or if it is caused or mediated in part by senescent cells. Lists of senescence associated disorder that can potentially be treated or managed using the methods and products taught in this disclosure include conditions described in US 2016/0339019 Al (Laberge et al.), WO 2017/008060 (Lopez -Dominguez et al.), and priority application 62/352,167 (N. David), all of which are hereby incorporated herein by reference in their entirety for all purposes, including the testing, preparation, and use of senolytic agents for different indications. Such indications include but are not limited to cardiovascular diseases and disorders associated with or caused by

atherosclerosis; idiopathic pulmonary fibrosis; chronic obstructive pulmonary disease;

osteoarthritis; senescence-associated ophthalmic diseases and disorders; and senescence- associated dermatological diseases and disorders.

[0072] Except where otherwise stated or required, other terms used in the specification have their ordinary meaning.

EXAMPLES

Example 1 : Senescent-cell specific Cas9 expression

[0073] A pl6-Cas9 vector comprising Cas9 operably-linked to the senescent cell-specific pl6^Ink4a promoter is delivered in vivo to mice. In some examples, the delivery method is targeted to senescent cells through interaction between cell-surface specific proteins on the senescent cells and affinity molecules on the delivery system, for example, the vector.

Example 2: Disrupting senolytic targets via CRISPR/Cas9

[0074] Using a delivery system, for example, a viral or nanoparticle delivery system as described herein, a guide RNA targeting Bcl-2, MDM2, or another senolytic target, and a selectable marker are delivered into the mice along with the pl6-Cas9 construct described in Example 1. Only cells expressing Cas9 (particularly senescent cells) disrupt or knock out the senolytic target targeted by the gRNA, thereby inducing senescent cell death. Mice with Bcl-2 or MDM2 knocked out are used in the phenotypic analyses described in Examples 4-7.

Example 3 : p!6-Cas9 transgenic mice

[0075] The capability of CRISPR/Cas9 to remove senescent cells in vivo is determined in transgenic pl6-Cas9 mice. The transgenic mouse comprises a pl6^Ink4a promoter operatively linked to Cas9 for detecting expression specifically in senescent cells and for selective clearance of senescent cells in these transgenic mice through the co-expression of gRNAs targeting Bcl-2, MDM2, or another senolytic target (as described in Example 2). The promoter, pl6^Ink4a, which is transcriptionally active in senescent cells but not in non-senescent cells (Wang et al., J. Biol. Chem. 276:48655-61 (2001); Baker et al., Nature 479:232-36 (2011)), is engineered into a nucleic acid construct.

[0076] The pl6^Ink4a gene promoter (approximately 100 kilobase pairs) is introduced upstream of a nucleotide sequence encoding Cas9. Alternatively, a truncated pl6^Ink4a promoter may be used (Baker et al., Nature, supra; International Application Publication No. WO 2012/177927; Wang et al., supra). Thus, the expression of Cas9 is driven by the pl6^Ink4a promoter in senescent cells only. Detectable markers, LUC and mRFP are included and permit detection of senescent cells by bioluminescence and fluorescence, respectively. The disruption of Bcl-2, MDM2, or another senolytic target via Cas9 activity permits selective killing of senescent cells. Transgenic founder animals, which have a C57B16 background, are established and bred using known procedures for introducing transgenes into animals (Baker et al., Nature 479:232-36 (2011)).

[0077] Female C57/BL6 mice are randomized into CRISPR/Cas9 treated or non-treated groups. Senescence is induced by intraperitoneal administration of doxorubicin at 10 mg/kg to the mice ten days prior to administration of the CRISPR/Cas9 system (Day -10). The CRISPR/Cas9 system is administered, either targeting Bcl-2 or MDM2. Control mice are injected with equal volumes of PBS. Luminescence imaging (Xenogen Imaging system) is performed at Day 0 as a baseline for each mouse (100% intensity).

[0078] Luminescence imaging of the mice is performed on day 7, 14, 21, 28, and 35 following the initiation of CRISPR/Cas9 treatment. Reduction of luminescence (L) is calculated as: L= (Imaging post treatment)/(Baseline Imaging)%. If L is greater than or equal to 100%, the number of senescent cells is not reduced. If L is less than 100%, then the number of senescent cells is reduced. Every mouse is calculated independently, and background is subtracted from each sample. Reduced senescent cells results in a statistically significant decrease in

luminescence.

[0079] Groups of female C57/BL6 pl6-3MR are treated as described above. Three weeks after the end of treatment (day 35), the mice are sacrificed. Skin and fat biopsies are collected for RNA extraction; fat biopsies are collected for detection of senescence-associated β- galactosidase; and lungs are flash frozen in cryoprotectant OCT media for cryostat sectioning. RNA is analyzed for mRNA levels of endogenous senescence markers (p21, ρΐό¹^⁴³ (pi 6), and p53) and SASP factors (MMP-3 and IL-6) relative to actin mRNA (control for cDNA quantity) using the Roche Universal Probe Library for real-time PCR assay.

[0080] The frozen lung tissue are sectioned to 10 μΜ thickness and stained with primary rabbit polyclonal antibody against γΗ2ΑΧ (Novus Biologicals, LLC), which is a marker for double- strand breaks in cells (DNA damage). The sections are then stained with ALEXA FLUOR® dye-labeled secondary goat anti-rabbit antibody (Life Technologies) and counterstained with 4',6-diamidino-2-phenylindole (DAPI) (Life Technologies). The number of positive cells are calculated using ImageJ™ image processing program.

[0081] Upon collection, fat biopsies are immediately fixed in 4% formalin and then stained with a solution containing X-gal to detect the presence of senescence-associated β-galactosidase (β-gal). Fat biopsies are incubated overnight at 37 °C in X-gal solution and are photographed the next day. Fat biopsies from untreated animals are used as a negative control (CTRL).

Example 4: Effect of removing senescent cells in animal model of osteoarthritis

[0082] To determine the effect of removing senescent cells in an animal model of osteoarthritis, C57BL/6J mice are treated surgically to cut the anterior cruciate ligament of one rear limb and induce osteoarthritis in the joint of that limb. During week 3 and week 4 post-surgery, the mice are treated with the CRISPR/Cas9 system as described in Example 2. At the end of 4 weeks post-surgery, joints of the mice are monitored for presence of senescent cells, assessed for function, monitored for markers of inflammation, and undergo histological assessment.

[0083] Two control groups of mice are included in the study: one group comprising C57BL/6J mice that undergo a sham surgery (n = 3) (i.e., surgical procedures followed except for cutting the ACL) and intra-articular injections of vehicle parallel to the CRISPR/Cas9-treated group; and one group comprising C57BL/6J mice that undergo an ACL surgery and receive intraarticular injections of vehicle (n=5) parallel to the CRISPR/Cas9 -treated group.

[0084] RNA from the operated joints of mice from the CRISPR/Cas9 treated mice is analyzed for expression of SASP factors (MMP3, IL-6) and senescence markers (pl6). qRT-PCR is performed to detect mRNA levels. RNA from the operated joints of mice is also analyzed for expression of type 2 collagen and compared with expression of actin as a control.

[0085] Function of the limbs is assessed 4 weeks post-surgery by a weight bearing test to determine which leg the mice favors. The mice are allowed to acclimate to the chamber on at least 3 occasions prior to taking measurements. Mice are maneuvered inside the chamber to stand with 1 hind paw on each scale. The weight that is placed on each hind limb is measured over a 3 -second period. At least 3 separate measurements are made for each animal at each time point. The results are expressed as the percentage of the weight placed on the operated limb versus the contralateral unoperated limb. The function of the limbs is also assessed at 4 weeks post-surgery by hotplate analysis to show sensitivity and reaction to pain stimulus. In brief, a mouse is placed on a hotplate at 55°C. When placed on the hot surface of the plate, mice lift their paws and lick them (paw-lick response) due to attainment of pain threshold. The latency period for the hind limb response (paw-lick response) is recorded as response time.

[0086] Histopathology is performed to assess the proteoglycan layer, which is destroyed in the presence of senescent cells. Clearing of senescent cells completely abrogates this effect.

Example 5 : Effect of removing senescent cells in animal models of atherosclerosis

[0087] LDLR^_/" mice are treated with the CRISPR/Cas9 system described in Example 2 in order to assess the extent to which clearance of senescent cells from plaques reduces plaque load. Two groups of LDLR^_/" mice (10 weeks) are fed a high fat diet (HFD) (Harlan Teklad

TD.88137) having 42% calories from fat, beginning at Week 0 and throughout the study. Two groups of LDLR^_/" mice (10 weeks) are fed normal chow (-HFD). From weeks 0-2, one group of HFD mice and -HFD mice are treated with the CRISPR/Cas9 system in Example 2 in order to inducibly kill senescent cells. Vehicle is administered to one group of HFD mice and one group of -HFD mice. Groups of mice are sacrificed at 4, 8, and 12 weeks to assess presence of senescent cells in the plaques.

[0088] Plasma lipid levels are measured in LDLR^_/" mice fed a HFD and treated with the CRISPR/Cas9 system or vehicle at each time point as compared with mice fed a -HFD (n=3 per group). Plasma is collected mid-afternoon and analyzed for circulating lipids and lipoproteins. At the end of each time point, LDLR^_/" mice fed a HFD and treated with the CRISPR/Cas9 system or vehicle are sacrificed (n=3, all groups), and the aortic arches are dissected for RT- PCR analysis of SASP factors and senescent cell markers. Values are normalized to GAPDH and expressed as fold-change versus age-matched, vehicle-treated LDLR^_/" mice on a normal diet. Clearance of senescent cells reduces expression of several SASP factors and senescent cell markers, MMP3, MMP13, PAI1, p21, IGFBP2, IL-1A, and IL-1B after 1 treatment cycle.

[0089] At the end of some time points, LDLR^_/" mice fed a HFD and treated with either of the CRISPR/Cas9 systems or vehicle (n=3 for all groups) are sacrificed, and aortas are dissected and stained with Sudan IV to detect the presence of lipid. Body composition of the mice is analyzed by MRI, and circulating blood cells are counted by Hemavet. Clearance of senescent cells reduces plaques in the descending aorta.

Example 6: Effect of clearing senescent cells in pulmonary disease models

[0090] The CRISPR/Cas9 system described in Example 2 is used to assess the effect of clearance of senescence cells in the transgenic mouse strain 3MR that has bleomycin induced lung injury. In the bleomycin injury model for idiopathic pulmonary fibrosis, mice develop lung fibrosis within 7-14 days after bleomycin treatment (Limjunyawong et al., 2014, Physiological Reports 2:e00249; Daniels et al., 2004, J. Clin. Invest. 114: 1308-1316). Bleomycin is administered to anesthetized 6-8 week old 3MR mice by intratracheal aspiration (2.5 U/kg of bleomycin in 50 μΐ PBS) using a microsprayer syringe (Penn-Century, Inc.) as described in Daniels et al. (2004, J. Clin. Invest. 114: 1308-1316). Control mice are administered saline. The day following bleomycin treatment, either of the discussed CRISPR/Cas9 systems is

administered. 3MR mice are treated, followed by 5 days of rest, followed by a second treatment cycle of 5 consecutive days. Untreated mice receive an equal volume of vehicle. At 7, 14, and 21 days post-bleomycin treatment, lung function is assessed by monitoring oxygen saturation using the MouseSTAT PhysioSuite™ pulse oximeter (Kent Scientific).

[0091] Animals are anesthetized with isoflurane (1.5%) and a toe clip is applied. Mice are monitored for 30 seconds and the average peripheral capillary oxygen saturation (Sp0₂) measurement over this duration is calculated. Removal of senescent cells results in higher Sp0₂ levels. At 21 days post-bleomycin treatment, airway hyper-reactivity (AHR) of mice is examined. AHR of mice is measured by methacholine challenge while other parameters of lung function (airway mechanics, lung volume and lung compliance) are determined using a SCIREQ FlexiVent™ ventilator. While under ketamine/xylazine anesthesia and subjected to cannulation of the trachea via a tracheostomy (¹⁹Fr blunt Luer cannula), airway resistance (elastance) and compliance of mice are assessed at baseline and in response to increasing concentrations of methacholine (0 to 50 mg/mL in PBS) delivered via nebulization (AeroNeb) as described in Aravamudan et al. (Am. J. Physiol. Lung Cell. Mol. Physiol. (2012) 303 :L669-L681). Animals are maintained at 37°C, and while under muscle paralysis (pancuronium); airway function is measured by using the FlexiVent™ ventilator and lung mechanics system (SCIREQ, Montreal, Quebec, Canada), which is housed on Stabile 8.

[0092] Clearance of senescent cells in bleomycin exposed mice improves compliance and reduced lung elastance. Mice are euthanized by intraperitoneal injection of pentobarbital.

Bronchoalveolar lavage (BAL) fluids and lungs is obtained and analyzed. Hydroxyproline content of lungs is measured as described in Christensen et al. (1999, Am. J. Pathol. 155: 1773- 1779), and quantitative histopathology is performed. RNA is extracted from lung tissue to measure senescence cell markers by qRT-PCR in treated and control mice.

[0093] In a second animal model for pulmonary diseases (for example, COPD), mice are exposed to cigarette smoke. The effect of a senescent cell clearance via the CRISPR/Cas9 systems, described in Example 2 on the mice exposed to smoke is assessed by senescent cell clearance, lung function, and histopathology.

[0094] Mice are chronically exposed to cigarette smoke generated from a Teague TE-10 system, an automatically-controlled cigarette smoking machine that produces a combination of side-stream and mainstream cigarette smoke in a chamber, which is transported to a collecting and mixing chamber where varying amounts of air is mixed with the smoke mixture. The COPD protocol is adapted from the COPD core facility at Johns Hopkins University

(Rangasamy et al., 2004, J. Clin. Invest. 114: 1248-1259; Yao et al., 2012, J. Clin. Invest.

122:2032-2045). Mice receive a total of 6 hours of cigarette smoke exposure per day, 5 days a week for 6 months. Each lighted cigarette (3R4F research cigarettes containing 10.9 mg of total particulate matter (TPM), 9.4 mg of tar, and 0.726 mg of nicotine, and 11.9 mg carbon monoxide per cigarette [University of Kentucky, Lexington, KY]) is puffed for 2 seconds and once every minute for a total of 8 puffs, with the flow rate of 1.05 L/min, to provide a standard puff of 35 cm³.

[0095] The smoke machine is adjusted to produce a mixture of side stream smoke (89%) and mainstream smoke (11%) by smoldering 2 cigarettes at one time. The smoke chamber atmosphere is monitored for total suspended particulates (80-120 mg/m³) and carbon monoxide (350 ppm). Beginning at day 7, mice are treated with gRNAs targeting Bcl-2 or MDM2. An equal number of mice receive the corresponding vehicle. Additional animals that do not receive exposure to cigarette smoke are used as controls for the experiment.

[0096] After two or six months of cigarette smoke exposure, lung function is assessed by monitoring oxygen saturation using the MouseSTAT PhysioSuite™ pulse oximeter (Kent Scientific). Animals are anesthetized with isoflurane (1.5%) and the toe clip is applied. Mice are monitored for 30 seconds and the average peripheral capillary oxygen saturation (Sp0₂) measurement over this duration is calculated. Clearance of senescent cells results in increases in Sp0₂ levels in mice after 2 months of cigarette smoke exposure compared to untreated controls.

[0097] At the end of the experimental period, airway hyper-reactivity (AHR) of mice to methacholine challenge using a SCIREQ FlexiVent ventilator and lung mechanics system is examined as described above. After AHR measurement, mice are killed by intraperitoneal injection of pentobarbital for in-depth analysis of lung histopathology as previously described (Rangasamy et al., 2004, J. Clin. Invest. 114: 1248-1259). Briefly, lungs are inflated with 0.5% low-melting agarose at a constant pressure of 25 cm. Part of the lung tissue is collected for RNA extraction and qRT-PCR analysis of senescent markers. Other parts of lungs are fixed in 10%) buffered formalin and embedded in paraffin. Sections (5 μπι) are stained with hematoxylin and eosin. Mean alveolar diameter, alveolar length, and mean linear intercepts are determined by computer-assisted morphometry with Image Pro Plus software (Media Cybernetics).

Example 7: Effect of clearing senescent cells on glucose tolerance and insulin sensitivity

[0098] Groups of mice are fed a high fat diet for four months mice or a regular chow diet. Animals are then treated with the CRISPR/Cas9 systems of Example 2 (to knock out Bcl-2 or MDM2) or vehicle. A glucose bolus is given at time zero, and blood glucose is monitored at 20, 30, 60, and 120 minutes after delivering glucose to determine glucose disposal. This can also be quantified as "area under the curve" (AUC), with a higher AUC value indicating glucose intolerance. Insulin sensitivity is also determined (Insulin Tolerance Testing (ITT)). Reduction in senescent cells results in a decrease in blood glucose after the administration of glucose bolus. Senescent cell clearance improves insulin sensitivity, Changes in weight, body composition, and food intake are also monitored.

Example 8: Assay to measure senolytic activity

[0099] Human fibroblast IMR90 cells can be obtained from the American Type Culture Collection (ATCC®) with the designation CCL-186. The cells are maintained at <75% confluency in DMEM containing FBS and Pen/Strep in an atmosphere of 3% 0₂, 10% C02, and -95% humidity. The cells are divided into three groups: irradiated cells (cultured for 14 days after irradiation prior to use), proliferating normal cells (cultured at low density for one day prior to use), and quiescent cells (cultured at high density for four day prior to use).

[0100] On day 0, the irradiated cells are prepared as follows. IMR90 cells are washed, placed in T175 flasks at a density of 50,000 cells per mL, and irradiated at 10-15 Gy. Following irradiation, the cells are plated at 100 μΐ_^ in 96-well plates. On days 1, 3, 6, 10, and 13, the medium in each well is aspirated and replaced with fresh medium.

[0101] On day 10, the quiescent healthy cells are prepared as follows. FMR90 cells are washed, combined with 3 mL of TrypLE trypsin-containing reagent (Thermofisher Scientific, Waltham, Massachusetts) and cultured for 5 min until the cells have rounded up and begin to detach from the plate. Cells are dispersed, counted, and prepared in medium at a concentration of 50,000 cells per mL. 100 μΐ_^ of the cells is plated in each well of a 96-well plate. Medium is changed on day 13.

[0102] On day 13, the proliferating healthy cell population is prepared as follows. Healthy FMR90 cells are washed, combined with 3 mL of TrypLE and cultured for 5 minutes until the cells have rounded up and begin to detach from the plate. Cells are dispersed, counted, and prepared in medium at a concentration of 25,000 cells per mL. 100 μΕ of the cells is plated in each well of a 96-well plate.

[0103] On day 14, test Bcl-2 inhibitors or MDM2 inhibitors are combined with the cells as follows. A DMSO dilution series of each test compound is prepared at 200 times the final desired concentration in a 96-well PCR plate. Immediately before use, the DMSO stocks are diluted 1 :200 into prewarmed complete medium. Medium is aspirated from the cells in each well, and 100 μΕΛνεΙΙ of the compound containing medium is added.

[0104] Candidate senolytic agents for testing are cultured with the cells for 6 days, replacing the culture medium with fresh medium and the same compound concentration on day 17. Bcl-2 inhibitors like 001967 are cultured with the cells for 3 days. The assay system uses the properties of a thermostable luciferase to enable reaction conditions that generate a stable luminescent signal while simultaneously inhibiting endogenous ATPase released during cell lysis. At the end of the culture period, 100 μΐ. of CellTiter-Glo® reagent (Promega Corp., Madison, Wisconsin) is added to each of the wells. The cell plates are placed for 30 seconds on an orbital shaker, and luminescence is measured.

Example 9: In vivo testing of virally encoded therapeutic proteins for a specific disease indication

[0105] The activity of a senolytic therapeutic CRISPR riboprotein complex encoded in a viral vector in a mouse model of lung fibrosis can be tested as follows.

[0106] Mice receive a dose of 2 U/kg of bleomycin intratracheally. Lungs are collected 7, 14, 21, and 40 days after injury. Mice that do not lose weight are excluded. Detection by qPCR of markers of senescence in whole lungs indicates an upregulation of p21 mRNA expression within the first week followed by a reduced expression to levels comparable to those at baseline. The increased level of pl6 mRNA are measured at later time points.

[0107] C57B16/J mice are injured with 2 U/kg of bleomycin to promote fibrosis and a subset of mice are treated with an integration deficient lentivirus encoding a transcriptional repressor, nuclease dead CRISPR, dCas9-KRAB protein and an sgRNA targeting either the mouse FOX04 locus GGGGTTCGAAGTCGGGATCGAGG (SEQ. ID NO:4), or a scrambled sgRNA that is not found in the mouse genome.

[0108] Therapeutic and control viral particles are administered intratracheally at 3 different time points of treatment and 4 different viral titers (10⁷ IFU/mL, 10⁶ IFU/mL, 10⁵ IFU/mL, 10⁴ IFU/mL). Lungs are collected 7, 14, 21, and 40 days after injury. Efficacy is determined by: qPCR of markers of senescence (such as pl6, p21) and fibrosis (Colla2) in whole lungs IHC, picrosirius red staining and 4-hydroxyproline to assess the degree of fibrosis

Example 10: Clinical testing the activity of a purified recombinant senolytic therapeutic CRISPR riboprotein complex in human Idiopathic Pulmonary Fibrosis (TPF)

[0109] A purified transcriptional repressor, nuclease dead CRISPR, dCas9-KRAB protein containing a CPP domain and NLS is purified from a standard expression system such as CHO cells. An artificial sgRNA targeting the human FOX04 locus at site

GGTCCAACTCCACGTATGGATCC (SEQ. ID NO:2) is generated via standard

oligonucleotide synthesis. The dCas9-KRAB protein and sgRNA are combined at a 1 : 1 molar ratio and administered via nebulization using a Single Ascending Dose Phase 1 trial design. Placebo patients receive vehicle only. Administration of the therapeutic protein is escalated until max tolerated dose (MTD) or max feasible dose (MFD) is achieved. After MTD/MFD is achieved, a Multiple Ascending Dose trial is performed to assess safety and tolerability of multiple doses. [0110] After safety/tolerability is assessed as Phase 2 study is performed to determine efficacy of the molecule in delaying or preventing death or lung transplant.

Example 11 : Proof of concept

[0111] The following procedure was undertaken to demonstrate that preventing or blocking expression of genes actively expressed in senescent cells according to this invention can eliminate or reduce survival of the senescent cells.

[0112] Human lung fetal fibroblasts (FMR90) (ATCC® CCL-186™) were made senescent with 10 Gy of irradiation delivered by X-ray. Seven days after irradiation, senescent and non- senescent cells were seeded in separate wells in 96 well plates. Cells were then transduced with 1 MOI of lentivirus encoding a short hairpin RNA (shRNA) targeting the transcripts of interest. Six days after transduction, cell survival was evaluated using the CellTiter-Glo® luminescent cell viability assay from Promega Corp., Madison Wisconsin.

[0113] FIG. 1 shows survival ratio of the senescent cells compared with non-senescent cells from the same IMR90 cell line. Knockdown of Bcl-xL with various shRNA sequence resulted in specific killing of senescent cells. Bcl-w and Bcl-2 knock down led to killing of senescent cells to a lesser extent.

[0114] Other targets can be validated and target sequences can be optimized using this assay system. A gene modification enzyme or vector according to this invention can then be constructed using the optimized target sequence.

[0115] Each and every publication and patent document cited in this disclosure is hereby incorporated herein by reference in its entirety for all purposes to the same extent as if each such publication or document was specifically and individually indicated to be incorporated herein by reference.

[0116] While the invention has been described with reference to the specific examples and illustrations, changes can be made and equivalents can be substituted to adapt to a particular context or intended use as a matter of routine development and optimization and within the purview of one of ordinary skill in the art, thereby achieving benefits of the invention without departing from the scope of what is claimed.

Claims

CLAIMS The invention claimed is:

1. A method for selectively killing or modulating activity of a senescent cell, comprising contacting the senescent cell with a genome modifying enzyme, thereby inducing a metabolic process that kills or reduces activity of the senescent cell.

2. A method for treating a senescence associated disorder in a subject in need thereof, comprising administering to the subject a pharmaceutical composition that includes a nucleic acid vector that encodes a genome modifying enzyme, thereby killing or reducing activity of senescent cells that are mediating said disorder.

3. A pharmaceutical composition formulated for treating a senescence associated disorder in a subject in need thereof, comprising a recombinant genome modifying enzyme or a nucleic acid vector encoding a genome modifying enzyme.

4. A genome modifying enzyme or a nucleic acid vector encoding a genome modifying enzyme for treating a senescence associated disorder.

5. Use of a genome modifying enzyme or a nucleic acid vector encoding a genome

modifying enzyme in the manufacture of a medicament for treating a senescence associated disorder.

6. The method, composition, enzyme, or vector according to any of claims 1 to 5, wherein the gene modifying enzyme is a zinc finger (ZF) protein.

7. The method, composition, enzyme, or vector according to any of claims 1 to 5, wherein the gene modifying enzyme is a transcription activator like effector (TALE) protein.

8. The method or composition of either claim 1 or claim 2, wherein the genome modifying enzyme is a CRISPR associated protein, and the cell is contacted with both a nucleic acid vector encoding the CRISPR associated protein and a guide nucleic acid.

9. The pharmaceutical composition of claim 3, comprising a CRISPR associated protein and a guide nucleic acid.

10. A CRISPR associated protein or a vector encoding such protein in combination with a guide nucleic acid that is complementary to a gene that causes killing or reduces activity of a senescent cell, for simultaneous or sequential use in treating a senescence associated disorder.

11. The method, composition, enzyme, or vector according to any of claims 1 to 10, wherein the genome modifying enzyme causes upregulation of a pro-apoptotic protein.

12. The method, composition, enzyme, or vector according to any of claims 1 to 10, wherein the genome modifying enzyme causes upregulation of BEVI.

13. The method, composition, enzyme, or vector according to any of claims 1 to 10, wherein the genome modifying enzyme causes down-regulation or disruption of an anti-apoptotic or anti-podoptotic protein expressed in senescent cells.

14. The method, composition, enzyme, or vector according to any of claims 1 to 10, wherein the genome modifying enzyme causes down-regulation or disruption of Bcl-xL, Bcl-w, or MDM2.

15. The method, composition, enzyme, or vector according to any of claims 1 to 10, wherein the genome modifying enzyme causes down-regulation or disruption of a transcription factor that is needed for survival of senescent cells.

16. The method, composition, enzyme, or vector according to any of claims 1 to 10, wherein the genome modifying enzyme causes down-regulation or disruption of FOX04.

17. The method, composition, enzyme, or vector according to any of claims 2 to 16, wherein the senescence associated disorder is osteoarthritis.

18. The method, composition, enzyme, or vector according to any of claims 2 to 16, wherein the senescence associated disorder is atherosclerosis.

19. The method, composition, enzyme, or vector according to any of claims 2 to 16, wherein the senescence associated disorder is pulmonary fibrosis.

20. The method, composition, enzyme, or vector according to any of claims 2 to 16, wherein the senescence associated disorder is diabetes.

21. The method, composition, enzyme, or vector according to any of claims 1 to 20, wherein the genome modifying enzyme is a genome editing enzyme.

22. The method, composition, enzyme, or vector according to claim 21, wherein the genome editing enzyme causes partial or complete excision of a gene selected from Bcl-xL, Bcl-w, MDM2, and FOX04 in the senescent cell.

23. A method, composition, or vector according to any of claims 2-8 and 10-22, wherein the vector includes a sequence encoding the gene modifying enzyme under control of a promoter or other gene regulatory element that causes preferential expression of the gene modifying enzyme in certain tissue types.

24. A method, composition, or vector according to any of claims 2-8 and 10-22, wherein the vector includes a sequence encoding the gene modifying enzyme under control of a promoter or other gene regulatory element that causes preferential expression of the gene modifying enzyme in senescent cells.

25. A method, composition, or vector according to claim 24, wherein the promoter or gene regulatory element is selected from a pl6 promoter, a p20 promoter, and a 5x FkB binding element.

26. A method for treating a senescence associated disorder in a subject in need thereof

comprising administering to the subject a therapeutically effective amount of a composition comprising:

(a) a guide nucleic acid comprising a spacer region that is complementary to a target nucleic acid in a genomic region of a cell of the subject; and

(b) a polynucleotide encoding a nuclease operably linked to a senescent cell specific promoter.

27. A composition formulated for treating a senescence associated disorder comprising: a guide nucleic acid comprising a spacer region that is complementary to a target nucleic acid in a genomic region of a cell of the subject; and a polynucleotide encoding a nuclease operably linked to a senescent cell specific promoter.

28. The method or composition according to claim 26 or 27, wherein the target nucleic acid is a region of a Bcl-2 gene, a Bcl-xL gene, or an MDM 2 gene.

29. The method or composition according to any of claims 26 to 28, wherein the

endonuclease is an RNA-guided endonuclease which is a Type II or a Type V Cas protein.

30. The method or composition according to any of claims 26 to 29, wherein the

endonuclease is Cas9.