Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
  • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
  • C07K16/2833—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against MHC-molecules, e.g. HLA-molecules
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
  • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
  • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
  • C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]

Definitions

• This invention relates to altered antibodies, to pharmaceutical, therapeutic and diagnostic compositions containing said antibodies; to processes for preparing said compositions; to methods of therapy and diagnosis using said antibodies, to a method of modulating the function of cell surface associated antigens using said antibodies; to DNA sequences coding for said antibodies; to cloning and expression vectors containing DNA sequences coding for said antibodies; to host cells transformed with said vectors and to processes for preparing said antibodies.
• Complement consists of a complex series of proteins.
• the proteins of the complement system form two interrelated enzyme cascades, termed the classical and alternative pathways, providing two routes to the cleavage of C3, the central event in the complement system.
• the sequence of events comprising the classical complement pathway is recognition, enzymatic activation, and membrane attack leading to cell death.
• the recognition unit of the complement system is the C1 complex.
• the C1 complement protein complex is a unique feature of the classical complement cascade leading to C3 conversion.
• Complement fixation occurs when the C1q subcomponent binds directly to immunoglobulin antigen immune complex. Whether or not complement fixation occurs depends on a number of constraints. For example, only certain subclasses of immunoglobulin can fix complement even under optimal conditions. These are lgG1, lgG3 and IgM in man and lgG2a, lgG2b and IgM in mice.
• the C1q molecule is potentially multivalent for attachment to the complement fixation sites of immunoglobulin.
• the C H 2 domain of IgG and probably the C H 4 domain of IgM contain binding sites for C1q.
• Fc bearing cells also play a role in enhancing the effect of the immune response by binding to and opsonising, phagocytosing or killing target cells coated with antibody of the relevant class.
• Three IgG binding receptors Fc ⁇ R have been described for murine and human leukocytes.
• Fc ⁇ RI has high binding affinity for monomeric IgG
• Fc ⁇ RII and Fc ⁇ RIII have low affinity for mono IgG and interact mainly with antigen complexed IgG.
• the presence of Fc receptors confers on these immune cells the ability to mediate a number of effector mechanisms important in the effector phase of the humoral response.
• the gamma 1 isotype of human IgG like lgG3, binds to FcRI and, when complexed with its cognate antigen, activates complement and binds to FcRII and FcRIII.
• human lgG2 and lgG4 are relatively inactive isotypes; both fail to activate the classical complement pathway and lgG4 binds weakly to FcRI [Burton, D R and Woof, J M (1992) Adv. Immunol. 51, 1. Lucisano Valim, Y M and Lachmann, P J. (1991) Clin. exp. Immunol, 84, 1].
• Complement fixation could be restored to human lgG4 with just the carboxyi terminal of C H 2 from residue 292 of lgG1 and not the N- terminal half or any other domain.
• Duncan & Winter (1988) [Nature, 332, 21] identified a motif in C H 2 of Glu 318, Lys 320 and Lys 322 of the mouse lgG2b isotype. Changing any of these residues abolished C1q binding, as did the use of competitive peptides of sequences in this region.
• the C1q motif residues are also found in antibodies that do not fix complement suggesting that these residues may well be necessary but not sufficient for complement activation.
• Residues Glu 318, Lys 320 and Lys 322 are conserved in all the human IgGs, rat lgG2b and lgG2c, mouse lgG2a, lgG2b and lgG3, guinea pig lgG1 and rabbit IgG. Further experiments showed that the affinity of human C1q for mutant mouse lgG2b antibodies in which residue 235 was mutated was unaffected i.e. it was in the same range of values as that obtained with the wild type.
• the invention provides a method of treating diseases in which antibody therapy leads to undesirable toxicity due to antibody mediated complement fixation comprising administering an altered antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
• the altered antibody binds to one or more cellular Fc receptors especially FcRIII and excluding FcRI i.e. the antibody does not bind significantly to FcRI, and more preferably binding to FcRI is abolished.
• the invention provides an altered antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered, as compared to unaltered antibody.
• the invention therefore provides an altered antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody and said altered antibody binds to one or more cellular Fc receptors especially FcRIII and does not bind significantly to FcRI.
• the constant region of the antibodies to be altered according to the invention may be of animal origin and is preferably of human origin. It may also be of any isotype but is preferably human IgG and most preferably human lgG1.
• amino acid residue(s) which is altered lies within amino acid positions 231 to 239, preferably within 234 to 239. In a particularly preferred embodiment of the invention the amino acid residue(s) which is altered lies within the motif Leu 234 Leu 235 Gly 236 Gly 237 Pro 238 Ser 239.
• amino acid residue(s) which is altered is either Leu 235 and/or Gly 237.
• the term 'altered' when used in conjunction with the ability of an antibody to fix complement most usually indicates a decrease in the ability of antibody to fix complement compared to the starting antibody.
• complement fixation denotes that human complement fixation is preferably ⁇ 30%, more preferably ⁇ 20% and most preferably ⁇ 10% of the level seen with the starting wild type unaltered antibody.
• the term 'significantly' as used with respect to FcRI binding denotes that the binding of antibody to FcRI is typically ⁇ 20%, and is most preferably ⁇ 10% of that seen with unaltered antibody.
• the altered antibodies of the invention preferably bind to FcRIII as measured by their ability to mediate antibody dependent cellular cytotoxicity (ADCC) at a concentration no greater than ten times that of the wild type unaltered antibody.
• ADCC antibody dependent cellular cytotoxicity
• the proteins encoded in the Major Histocompatibility Complex region of the genome are involved in many aspects of immunological recognition. It is known that all mammals and probably all vertebrates possess basically equivalent MHC systems and that immune response genes are linked to the MHC.
• the HLA gene cluster on chromosome 6 In man the major histocompatibility complex is the HLA gene cluster on chromosome 6. The main regions are D, B, C and A. The D region contains genes for class II proteins which are involved in cooperation and interaction between cells of the immune system. Many diseases have been found to be associated with the D region of the HLA gene cluster. Studies to date have shown associations with an enormous variety of diseases, including most autoimmune diseases (see for example, European Patent No. 68790). European Patent No. 68790 suggests controlling diseases associated with a particular allele of certain regions of the MHC such as the HLA-D region in humans by selectively suppressing the immune response(s) controlled by a monoclonal antibody specific for an MHC-class II antigen.
• the invention provides an MHC specific antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
• the invention provides an MHC specific monoclonal antibody characterised in that said antibody has been altered at position 235 of the N-terminal region of the C H 2 domain.
• the alteration in the N-terminal region of the C H 2 domain of the antibody while altering the ability to fix complement additionally inhibits the binding to FcRI receptors.
• the antibodies are preferably specific for MHC-class II antigens and due to the alteration of one or more amino acid residues in the N-terminal region of the C H 2 domain will not bind significantly to FcRI.
• the altered antibodies of the invention or for use according to the invention are directed against an MHC class II antigen characterised in that said antibody has been altered at position 235 of the N-terminal region of the C H 2 domain.
• the altered antibodies of the invention or for use according to the invention are directed against an MHC class II antigen characterised in that said antibody has been altered at position 235 of the N-terminal region of the C H 2 domain and the ability of said antibody to fix complement is altered as compared to unaltered antibody and said altered antibody binds to one or more cellular Fc receptors especially FcRIII and does not bind significantly to FcRI.
• the invention provides a method for producing an altered antibody with altered ability to fix complement comprising altering one or more amino acids in the N-terminal region of the C H 2 domain of said antibody, altering the ability of said antibody to fix complement as compared with unaltered antibody.
• the term 'altered antibody' is used to denote an antibody which differs from the wild type unaltered antibody at one or more amino acid residues in the N-terminal region of the C H 2 domain of the Fc region of the antibody.
• the alteration may for example comprise the substitution or replacement of the starting wild type antibody amino acid by another amino acid, or the deletion of an amino acid residue.
• the naturally occurring amino acid at position 235 of the N-terminal region of the C H 2 domain is a leucine residue.
• the alterations at position 235 of replacing leucine by glutamic acid or alanine have been found particularly effective at producing a potent immuno-suppressive antibody with minimal toxicity in vitro and which is tolerated in vivo.
• the alteration at position 237 of replacing glycine by alanine has been found to produce an antibody with an intermediate ability to fix human complement, i.e. the complement fixation level is approximately 15-80%, preferably 20-60%, most preferably 20-40% of that seen with the starting wild type unaltered antibody.
• residue(s) could similarly be replaced using an analogous process to that described herein, by any other amino acid residue or amino acid derivative, having for example an inappropriate functionality on its side chain. This may be achieved by for example changing the charge and/or polarity of the side chain.
• the altered antibodies of the invention may also be produced for example, by deleting residues such as 235, or by, for example, inserting a glycosylation site at a suitable position in the molecule.
• Such techniques are well known in the art, see for example the teaching of published European patent application EP-307434.
• the altered antibodies of the invention may also be produced by exchanging lower hinge regions of antibodies of different isotypes.
• a G1/G2 lower hinge exchange abolished complement fixation and is a further preferred embodiment of the invention. This is described in more detail in the accompanying examples.
• the G1/G2 lower hinge exchange results in an antibody with altered residues in the 231 to 238 region of the N-terminal region of the C H 2 domain wherein one or more residues may be altered and/or deleted.
• the antibody is a human lgG1 antibody directed against an MHC class II antigen.
• the invention provides a method of modulating the function of cell surface associated antigens avoiding complement mediated toxicity comprising administering an altered antibody wherein one or more amino acid residues in the N-terminal region of the C H 2 domain of said antibody are altered characterised in that the ability of said antibody to fix complement is altered as compared to unaltered antibody.
• said altered antibody is able to bind to one or more cellular Fc receptors especially FcRIII while binding to FcRI is significantly reduced.
• cell surface antigens include for example adhesion molecules, T-cell receptor, CD4, CD8, CD3, CD28, CD69, MHC Class I, MHC Class II and CD25.
• the invention also includes therapeutic, pharmaceutical and diagnostic compositions comprising the altered antibodies according to the invention and the uses of these products and the compositions in therapy and diagnosis.
• the invention provides a therapeutic, pharmaceutical or diagnostic composition
• a therapeutic, pharmaceutical or diagnostic composition comprising an altered antibody according to the invention, in combination with a pharmaceutically acceptable excipient, diluent or carrier.
• the invention also provides a process for the preparation of a therapeutic, pharmaceutical or diagnostic composition comprising admixing an altered antibody according to the invention together with a pharmaceutically acceptable excipient, diluent or carrier.
• the antibodies and compositions may be for administration in any appropriate form and amount according to the therapy in which they are employed.
• the altered antibodies for use in the therapeutic, diagnostic, or pharmaceutical compositions, pr for use in the method of treatment of diseases in which antibody therapy leads to undesirable toxicity due to antibody mediated complement fixation are preferably MHC specific antibodies most preferably specific for MHC Class II antigens, and most preferably have specificity for antigen ic determinants dependent on the
• the therapeutic, pharmaceutical or diagnostic composition may take any suitable form for administration, and, preferably is in a form suitable for parenteral administration e.g. by injection or infusion, for example by bolus injection or continuous infusion.
• parenteral administration e.g. by injection or infusion, for example by bolus injection or continuous infusion.
• the product may take the form of a suspension, solution or emulsion in an oily or aqueous vehicle and it may contain formulatory agents such as suspending, preservative, stabilising and/or dispersing agents.
• the antibody or composition may be in dry form, for reconstitution before use with an appropriate sterile liquid.
• the formulation may contain, in addition to the active ingredient, additives such as: starch - e.g. potato, maize or wheat starch or cellulose - or starch derivatives such as microcrystalline cellulose; silica; various sugars such as lactose; magnesium carbonate and/or calcium phosphate. It is desirable that, if the formulation is for parental administration it will be well tolerated by the patient's digestive system. To this end, it may be desirable to include in the formulation mucus formers and resins. It may also be desirable to improve tolerance by formulating the antibody or compositions in a capsule which is insoluble in the gastric juices. It may also be preferable to include the antibody or composition in a controlled release formulation.
• additives such as: starch - e.g. potato, maize or wheat starch or cellulose - or starch derivatives such as microcrystalline cellulose; silica; various sugars such as lactose; magnesium carbonate and/or calcium phosphate.
• mucus formers and resins it may also
• the formulation may contain a binding and/or lubricating agent, for example polymeric glycols, gelatins, cocoa-butter or other vegetable waxes or fats.
• a binding and/or lubricating agent for example polymeric glycols, gelatins, cocoa-butter or other vegetable waxes or fats.
• the invention also provides methods of therapy and diagnosis comprising administering an effective amount of an altered antibody according to the invention to a human or animal subject.
• the antibodies and compositions may be for administration in any appropriate form and amount according to the therapy in which they are employed.
• the dose at which the antibody is administered depends on the nature of the condition to be treated and on whether the antibody is being. used prophylactically or to treat an existing condition.
• the dose will also be selected according to the age and conditions of the patient.
• a therapeutic dose of the antibodies according to the invention may be, for example, preferably between 0.1-25mg/kg body weight per single therapeutic dose and most preferably between 0.1-10mg/kg body weight per single therapeutic dose.
• immunological diseases which may be treated with the antibodies of the invention include for example joint disease such as ankylosing spondylitis, juvenile rheumatoid arthritis, rheumatoid arthritis; neurological disease such as multiple sclerosis; pancreatic disease such as diabetes, juvenile onset diabetes; gastrointestinal tract disease such as chronic active hepatitis, celiac disease, ulcerative colitis, Crohns disease, pernicious anaemia; skin diseases such as psoriasis; allergic diseases such as asthma and in transplantation related conditions such as graft versus host disease, and allograft rejection.
• Other diseases include those described in European Patent No. 68790.
• the altered antibodies of the invention may also be useful in the treatment of infectious diseases e.g. viral or bacterial infections and in cancer immunotherapy.
• the term 'antibody' is used to cover natural antibodies, chimeric antibodies and CDR-grafted or humanised antibodies.
• Chimeric antibodies are antibodies in which an antigen binding site comprising the complete variable domains of one antibody is linked to constant domains derived from another antibody. Methods for carrying out such chimerisation procedures are described in EP 120694 (Celltech Limited), EP 125023 (Genentech Inc and City of Hope), EP 171496 (Res. Dev. Corp. Japan), EP 173494 (Stanford University) and WO 86/01533 (Celltech Ltd).
• CDR grafted or humanised antibodies are antibody molecules having an antigen binding site derived from an immunoglobulin from a non-human species and remaining immunoglobulin-derived parts of the molecule being derived from a human immunoglobulin. Procedures for generating CDR-grafted or humanised antibodies are described in WO 91/09967 (Celltech Ltd), WO 90/07861 (Protein Design Labs. Inc) and WO 92/11383 (Celltech Ltd).
• the invention also includes DNA sequences coding for the altered antibodies according to the invention; cloning and expression vectors containing the DNA sequences, host cells transformed with the DNA sequences and processes for producing the altered antibodies according to the invention comprising expressing the DNA sequences in the transformed host cells.
• a process for producing an altered antibody of the invention comprises: a. producing in an expression vector an operon having a DNA sequence which encodes an antibody heavy or light chain.
• alteration in the N-terminal region of the C H 2 domain may be made using techniques such as site directed mutagenesis after the whole altered antibody has been expressed.
• site directed mutagenesis after the whole altered antibody has been expressed.
• DNA sequences should be expressed following the teaching described above for altered antibody.
• the DNA sequences preferably encode a humanised antibody; a CDR-grafted heavy and/or light chain or a chimeric antibody.
• the cell line may be transfected with two vectors, the first vector containing the operon encoding the light chain-derived polypeptide and the second vector containing the operon encoding the heavy chain derived polypeptide.
• the vectors are identical except in so far as the coding sequences and selectable markers are concerned so as to ensure as far as possible that each polypeptide chain is equally expressed.
• a single vector may be used, the vector including a selectable marker and the operons encoding both light chain- and heavy chain-derived polypeptides.
• the altered antibody according to the invention is preferably derived from the anti-MHC antibody L243, which has been deposited at the American
• Type Culture Collection Rockville, Maryland USA under Accession number ATCC HB55, and is most preferably a chimeric or a CDR-grafted derivative thereof.
• L243 was previously described by Lampson and Levy [J. Immunol. (1980) 125, 293].
• DNA sequences coding for the altered antibodies according to the invention may be synthed completely or in part using oligonucleotide synthesis techniques. Site-directed mutagenesis and polymerase chain reaction (PCR) techniques may be used as appropriate. See for example "PCR Technology Principles and Applications for DNA Amplification” (1989), Ed. H. A. Eriich, Stockton Press, N.Y. London.
• PCR polymerase chain reaction
• oligonucleotide directed synthesis as described by Jones et al [Nature, 321 , 522 (1986)] may be used.
• oligonucleotide directed mutagenesis may be used as described by Kramer et al [Nucleic Acid Res. 12 9441 (1984)].
• Any suitable host cell/vector system may be used for the expression of the DNA sequences coding for the altered antibody.
• Bacterial e.g. E.coli and other microbial systems may be used.
• Eucaryotic e.g. mammalian host cell expression systems may also be used such as for example COS cells and CHO cells [Bebbington, C R (1991) Methods 2, 136-145], and myeloma or hybridoma cell lines [Bebbington, C R et al (1992) Bio/Technology 10, 169-175].
• altered antibody is derived from L243 CHO based expression systems are preferably used.
• Immune function/immunosuppression by antibodies may be assayed using techniques well known in the art including for example: Mixed Lymphocyte Responses and T-cell antigen recall responses to Tetanus Toxoid. These assays are described in detail in the following examples. The invention is illustrated in the following non-limiting examples and with reference to the following figures in which:
• Figure 1 shows: a map of plasmid pMR15.1
• Figure 2 shows: a map of plasmid pMR14
• Figure 3 shows: the nucieotide sequence and predicted amino acid sequence of L243 heavy chain
• Figure 4 shows: the nucieotide and amino acid sequences of
• Figure 5 shows: the nucieotide sequence and predicted amino acid sequence of L243 light chain
• Figure 6 shows: a map of plasmid pGamma 1
• Figure 7 shows: a map of plasmid pGamma 2
• Figure 8 shows: the nucieotide sequence of hinge and C H 2 region of human C-gamma 1
• FIG. 9 shows: Antigen binding potency of L243 human isotype series
• FIG. 10 shows: FcRI binding of L243 isotype series
• Figure 11 shows: human complement fixation by L243 isotype series e
• Figure 12 shows: binding of human Clq to L243 human isotype series
• Figure 13 shows: human complement fixation by L243 isotype
• Figure 14 shows: guinea pig complement fixation by L243 isotype
• Figure 15 shows: rabbit complement fixation by L243 isotype
• FIG. 16 shows: FcRIII binding of L243 isotype series by ADCC
• Figure 17 shows: L243 Isotype Series Inhibition of TT recall response
• Figure 18 shows: L243 Isotype Series Inhibition of TT recall response
• FIG. 19 shows: L243 Isotype Series Inhibition of Mixed Lymphocyte
• Figure 20 shows: L243 Isotype Series Inhibition of TT response
• FIG. 21 shows: L243 Isotype Series Inhibition of Mixed Lymphocyte
• Figure 22 shows: the nucieotide and amino acid sequence of VI region in
• Figure 23 shows: shows the nucieotide and amino acid sequence of VI region of
• Figure 24 shows: the nucieotide and amino acid sequence of Vh region of L243-gH
• Figure 25 shows: a graph of the results of a competition assay for L243 grafts vs FITC-chimeric L243
• Figure 26 shows: a graph of a Scatchard analysis for L243 gamma 4
• Figure 27 shows: a graph of FcRIII binding of chimeric, grafted
• Figure 28 shows: a graph of immunosuppressive activity of CDR grafted
• Figure 29 shows: a graph of CDR grafted L243 and grafted [L235E]
• Figure 30 shows: a graph of complement mediated cytotoxic potency of
• RNA was prepared from 3 ⁇ 10exp7 L243 hybridoma cells as described below. Cells were washed in physiological saline and dissolved in RNAzol (0.2ml per 10exp6 cells). Chloroform (0.2ml per 2ml homogenate) was added, the mixture shaken vigorously for 15 seconds and then left on ice for 15 minutes. The resulting aqueous and organic phases were separated by centrifugation for 15 minutes in an Eppendorf centrifuge and RNA precipitated from the aqueous phase by the addition of an equal volume of isopropanol. After 15 minutes on ice, the RNA was pelleted by centrifugation, washed with 70% ethanol, dried and dissolved in sterile, RNAase free water. The yield of RNA was 350 ⁇ g.
• the sequence of the first nine amino acids of the mature L243 light chain was determined to be NH2-DIQMTQSPAS.
• cDNA genes for the variable regions of L243 heavy and light chains were synthesised using reverse transcriptase to produce single stranded cDNA copies of the mRNA present in the total RNA, followed by Polymerase Chain Reaction (PCR) on the cDNAs with specific oligonucleotide primers.
• PCR Polymerase Chain Reaction
• cDNA was synthesised in a 20 ⁇ l reaction containing the following reagents: 50mM Tris-HCI PH8.3, 75mM KCI, 10mM dithiothreitol, 3mM MgC.2, 0.5mM each deoxyribonucleoside triphosphates, 20 units RNAsin, 75ng random hexanucleotide primer, 2 ⁇ g L243 RNA and 200 units Moloney Murine Leukemia Virus reverse transcriptase. After incubation at 42°C for 60 min the reaction was terminated by heating at 95°C for 5 minutes. b) PCR
• the 3' primers are shown in Table 3.
• the light chain primer spans the V - C junction of the antibody and contains a restriction site for the enzyme Spl1 to facilitate cloning of the VI PCR fragment.
• the heavy chain 3' primers are a mixture designed to span the J - C junction of the antibody.
• the first 23 nucleotides are identical to those found at the start of human C - gamma 1 , 2, 3 and 4 genes and include the Apa1 restriction site common to these human isotypes.
• the 3' region of the primers contain a mixed sequence based on those found in known mouse antibodies [Kabat E A, Wu, T.T.; Perry H M, Gottesman K S, and Foeller L; In: Sequences of
• Incubations (20 ⁇ l) for the PCR were set up as follows. Each reaction contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCt ⁇ , 50 mM KCI, 0.01% w/v gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 1 - 6 pmoles 5' primer mix (Table 4), 6 pmoles 3' primer, 1 ⁇ l cDNA and 0.25 units Taq polymerase. Reactions were incubated at 95°C for 5 minutes and then cycled through 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute. After 30 cycles, aliquots of each reaction were analysed by electrophoresis on an agarose gel.
• DNA fragments produced in reactions B2, B3 and B5 were digested with the enzymes BstB1 and Spl1, concentrated by ethanol precipitation, electrophoresed on a 1.4 % agarose gel and DNA bands in the range of 400 base pairs recovered. These were cloned by ligation into the vector pMR15.1 ( Figure 1) that had been restricted with BstB1 and Spl1 . After ligation, mixtures were transformed into E. coli LM1035 and plasmids from the resulting bacterial colonies screened for inserts by digestion with BstB1 and Spl1. Representatives with inserts from each ligation were analysed further by nucieotide sequencing.
• Plasmid DNA (pE1701 and pE1702) from two isolates containing Vh inserts from reaction B9 was sequenced using the primers R1053 (which primes in the 3' region of the HCMV promoter in pMR14) and R720 (which primes in the 5' region of human C - gamma 4 and allows sequencing through the DNA insert on pMR14).
• the determined nucieotide sequence and predicted amino acid sequence of L243 Vh in pE1702 is given in Figure 3.
• the nucieotide sequence for the Vh insert in pE1701 was found to be identical to that in pE1702 except at nucieotide 20 (A in pE1701) and nucieotide 426 (A in pE1701). These two differences are in the signal peptide and J regions of Vh respectively and indicate that the two clones examined are independent isolates arising from the use of different primers from the mixture of oligonucleotides during the PCR stage.
• clones 182 and 183 contain a VI gene that codes for a signal peptide of 20 amino acids, while the VI gene in clones 43 and 45 results from priming with a different set of oligonucleotides and has a leader sequence of only 15 amino acids.
• Clone 192 does not code for L243 VI. Instead, examination of the database of antibody sequences [Kabat, 1991] indicates that clone 192 contains the VI gene for MOPC21, a light chain synthesised by the NS1 myeloma fusion partner used in the production of the L243 hybridoma.
• Clones 182 and 183 are identical except at nucleotide 26 (T in clone 182, C in clone 183). This difference can be accounted for by the use of different primers in the PCR and indicates that clones 182 and 183 are independent isolates of the same gene.
• the L243 Vh gene was subcloned on a HindIII - Apal fragment into pGamma 1 and pGamma 2, vectors containing the human C - gamma 1 and C - gamma 2 genes respectively ( Figures 6 and 7).
• Human Isotype mutants were subcloned on a HindIII - Apal fragment into pGamma 1 and pGamma 2, vectors containing the human C - gamma 1 and C - gamma 2 genes respectively ( Figures 6 and 7).
• PCR mutagenesis was used to change residue 235 in human C - gammal contained in the vector pGamma 1 from leucine to either glutamic acid or to alanine and to change residue 237 from glycine to alanine.
• the lower hinge region of human C-gamma 1 was also replaced by the corresponding region of human C-gamma 2.
• the following oligonucleotides were used to effect these changes: i) L235E change
• oligonucleotides used in the PCR mutagenesis are:
• R4732 and R4912 prime between nucleotides 834 and 858 and between nucleotides 1156 and 1137 respectively in human C - gamma 1 ( Figure 8).
• reactions (20 ⁇ l) were prepared containing the following reagents : 10 mM Tris - HCl pH 8.3, 1.5 mM MgCI2, 50 mM KCl, 0.01% gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 50 ng pGamma 1 DNA, 0.4 unit Taq polymerase and 6 pmoles of each of the primer.
• the following combinations of primers were used:
• Second round PCR was in a 100 ⁇ l reaction containing 10 mM Tris - HCl pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01 % gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 2 units Taq polymerase, 1/20 of each pair of DNA fragments from the first round reaction and 30 pmoles of each of R4732 and R4912.
• the reactions were extracted with phenol / chloroform (1/1) and precipitated with ethanol. Fragments were digested with Bgl11 and Sty1 , electrophoresed on a 1.4 % agarose gel and DNA bands of 250 base-pairs recovered from gel slices as previously described.
• Bgl II - Sty1 fragments were ligated in a 3 - way ligation to the 830 base-pair Sty1 - EcoRI fragment, containing the C - terminal part of the C H 2 domain and the entire CH3 domain of human C - gamma 1, and the BgIII - EcoR1 vector fragment from pGammal (see Figure 6).
• plasmid minipreps from resulting colonies were screened for the presence of the Bgl II - Sty1 fragment and representatives of each taken for nucieotide sequence analysis. From this, plasmids containing the desired sequence were identified and, for future reference, named as follows : pGammal [L235E] containing glutamic acid at residue 235,
• Antibody for biological evaluation was produced by transient expression of the appropriate heavy and light chain pairs after co-transfection into Chinese Hamster Ovary (CHO) cells using calcium phosphate precipitation.
• the calcium phosphate precipitate was prepared by mixing 1.25 ml of 0.25M CaCI2 containing 50 ⁇ g of each of heavy and light chain expression vectors with 1.25 ml of 2 ⁇ HBS (16.36 gm NaCI, 11.9 gm HEPES and 0.4 gm Na2HPO4 in 1 litre water with the pH adjusted to 7.1 with NaOH) and adding immediately into the medium on the cells.
• the samples were titrated in the microtitre wells in 2-fold dilutions to give a final volume of 0.1 ml in each well and the plates incubated at room temperature for 1 hr with shaking. After the first incubation step the plates were washed 10 times with distilled water and then incubated for 1 hr as before with 0.1 ml of a mouse monoclonal anti-human kappa (clone GD12) peroxidase conjugated antibody (The Binding Site, code MP135) at a dilution of 1 in 700 in conjugate buffer. The plate was washed again and substrate solution (0.1 ml) added to each well.
• clone GD12 mouse monoclonal anti-human kappa peroxidase conjugated antibody
• Substrate solution contained 150 ⁇ l N,N,N,N-tetramethylbe ⁇ zidine (10 mg/ml in DMSO), 150 ⁇ l hydrogen peroxide (30% solution) in 10 ml 0.1 M sodium acetate/sodium citrate, pH6.0. The plate was developed for 5 -10 minutes until the absorbance at 630nm was approximately 1.0 for the top standard. Absorbance at 630nm was measured using a plate reader and the concentration of the sample determined by comparing the titration curves with those of the standard. TABLE 1
• CH1 5'ATGAAATGCAGCTGGGTCAT(G,C)TTCTT3'
• CH2 5'ATGGGATGGAGCT(A,G)TATCAT(C,G)(C, T)TCTT3'
• CH6 5'ATGGCTGTC(C,T)T(G,A)G(G,C)GCT(G,A)CTCTTCTG3' CH7 : 5'ATGG(G,A)ATGGAGC(G,T) GG(G,A)TCTTT(A,C)TCTT3 ,
• CL1 5 ⁇ TGAAGTTGCCTGTTAGGCTGTTGGTGCT3'
• CL2 5'ATGGAG(T,A)CAGACACACTCCTG(T,C)TATGGGT3'
• CL9 5 , ATGGT(G,A)TCC(T,A)CA(G,C)CTCAGTTCCTT3
• CL10 5'ATGTATATATGTTTGTTGTCTATTTC3'
• CL11 5'ATGGAAGCCCCAGCTCAGCTTCTCTT3'
• Murine L243 (lgG2a) was labelled with fluorescein (FITC) using standard, techniques. All dilutions, manipulations and incubations were done in
• the ability of the engineered variants of L243 to bind to FcgRI was measured.
• the principle of this experiment is that antibodies will bind to cells through Fc receptors and the affinity of this interaction is determined by the subclass and hence the structure of the Fc of the antibody.
• the assay is based on the ability of the engineered antibodies to compete for binding with FITC labelled murine lgG2a to I FN ⁇ stimulated U937 cells.
• U937 myelomonocytic cells, when incubated with 500 ⁇ /ml IFN ⁇ (Genzyme UK) for 24 hours, expresses high levels of FcgRI, as assessed by CD64 binding and monomeric lgG2a binding, low levels of Fc ⁇ RII and no Fc ⁇ RIII.
• U937 cells are washed extensively in DMEM containing 25mM HEPES (Gibco UK), incubated for 2 hours at 37°C in RPMI 1640 (Gibco UK) and then washed again in DMEM containing 25mM HEPES (Gibco UK) to remove bovine IgG bound to Fc receptors.
• Serial dilutions of engineered antibodies were prepared in 50 ⁇ l in Phosphate Buffered Saline (Gibco UK) containing 0.1% sodium azide in V-bottom 96 well microtitre plates' (ICN/Flow UK) and were incubated with 5x10 4 U937 cells in 50 ⁇ l for 30min at 4°C. 50 ⁇ l of FITC labelled lgG2a antibody was then added to all wells, at a previously determined optimal concentration, for a further 90min at
• the principle of the experiment is that antibodies will mediate complement lysis of target cells bearing their cognate antigen if the Fc of the antibody is able to interact with the components of the (usually classical) complement cascade.
• the critical interaction is with the C1q molecule.
• the source of complement in these experiments is human venous blood freshly drawn into endotoxin free glass bottles which is then allowed to clot at 37°C for 1 hour. The clot is detached from the glass and then incubated at 4°C for 2 hours to allow it to retract. The clot is then removed and the serum separated from the remaining red cells by centrifugation at 1000g. Once prepared, the serum can be stored for up to one month at -20°C without noticeable deterioration of potency but is best used fresh.
• Target cells JY B lymphoblastoid cell line bearing high levels of HLA-DR
• Serial antibody dilutions are prepared in duplicate in V-bottom 96 well microtitre plates (ICN/Flow UK) in 25 ⁇ l.
• Control wells containing medium only are also prepared to establish the spontaneous release of label giving the assay background.
• Target 51 Cr labelled JY cells are added to all wells in 10 ⁇ l.
• the same number of JY cells are also added to wells containing 2% Triton ⁇ 100 in water to establish the 100% release value.
• Target cells and antibody are incubated together and, after 1 hour at room temperature, 25 ⁇ l serum as a source of complement is added to all wells (except the 100%) for a further 1 hour at room temperature.
• 100 ⁇ l of EDTA saline at 4°C is then added to stop any further cell killing, the microtitre plates are centrifuged at 200g to pellet the intact cells and 100 ⁇ l supernatant is removed and counted in a gamma counter.
• Percent cell lysis is calculated by subtracting the background from all values and then expressing them as a percentage of the adjusted maximum release. Replicates vary by less than 5%. Percent cell lysis is then plotted against antibody dilution.
• 5 ⁇ 10 4 indicator cells JY B lymphoblastoid cell line bearing high levels of HLA-DR were coated with the different engineered antibodies by incubating at saturating concentrations for 1 hour at 4°C in RB polystyrene tubes (2052 12x75mm Falcon UK). After washing, serial dilutions of FITC labelled C1q in 100 ⁇ l were added and were incubated together for a further 30 min at 4°C. After washing, binding of C1q was revealed using a Fluorescence Activated Cell Scanner (FACS Becton Dickinson). After appropriate analysis, median fluorescence intensity is plotted against C1q concentration.
• FACS Becton Dickinson Fluorescence Activated Cell Scanner
• the G1[L235E] and G1[L235A] modifications behaved differently when rabbit or guinea pig serum was used as a source of complement instead of human.
• rabbit C they caused the same level of lysis as the wild type G1.
• guinea pig they caused 40% and 49% plateau level killing, respectively, compared with 80% killing by the lgG1 wild type.
• the 235 change only affects human complement binding indicating that rabbit and guinea pig complement interact differently with human lgG1 (see Figures 13-15).
• ADCC antibody dependent cell mediated cytotoxicity
• PBMC Peripheral blood mononuclear cells
• the cells are then washed three times, to remove free radiolabel, and resuspended at 2 ⁇ 10 6 /ml.
• Serial antibody dilutions are prepared in duplicate in sterile U-bottom 96 well microtitre plates (Falcon UK) in 25 ⁇ l. Control wells containing medium only are also prepared to establish the spontaneous release of label giving the assay background.
• Target 51 Cr labelled JY cells are added to all wells in 10 ⁇ l. The same number of JY cells are also added to wells containing 2% Triton x100 in water to establish the 100% release value.
• Target cells and antibody are incubated together and, after 30min at room temperature, 25 ⁇ l effector cells are added to all wells (except the 100%) for a further 4 hours at 37°C.
• microtitre plates 100 ⁇ l of EDTA saline at 4°C is then added to stop any further cell killing, the microtitre plates are centrifuged at 200g to pellet the intact cells and 100 ⁇ l supernatant is removed and counted in a gamma counter.
• Percent cell lysis is calculated by subtracting the background from all values and then expressing them as a percentage of the adjusted maximum release. Replicates vary by less than 5%. Percent cell lysis is then plotted against antibody dilution. Results
• L243 lgG2 was unable to mediate peripheral blood mononuclear cell cytotoxicity (ADCC) of HLA-DR positive JY lymphoblastoid cells at concentrations up to 100 ⁇ /ml.
• lgG4 caused a low level of ADCC (20% maximum killing at 1 ⁇ /ml) which could be abrogated by the Leu 235 to Glu change.
• Wild type lgG1 was a potent mediator of cell killing giving 50% cell death at 5ng/ml antibody.
• Gly to Ala at 237 reduced the igG1 wild type killing to the level seen with lgG4.
• Exchanging the whole lower hinge region with the sequence found in human lgG2 gave intermediate levels of killing with 500ng/ml needed for 50% cell death.
• changes at 235 in lgG1 had minimal effect on ADCC.
• Changing the Leu 235 to Ala gave levels of killing comparable with the G1 wild type (9ng/ml for 50% cell death)) and changing the Leu 235 to Glu reduced ADCC a little (40ng/ml for 50% cell death).
• a change in the previously described C1q binding motif, from Lys to Ala at 320 had no effect on the ability of lgG1 to mediate ADCC.
• the immunosuppressive potency of engineered variants of L243 was assessed using a mixed lymphocyte reaction.
• the principle of the experiment is that when leucocytes from one individual are mixed with those of another which express different HLA alleles, they will recognise each other as foreign and will become activated. This activation is dependent, primarily, on interactions between the CD3/TcR complex on T cells and the MHC-II molecule on antigen presenting cells. Antibodies that bind to MHC-II are known to inhibit this reaction.
• PBMC Peripheral blood mononuclear cells
• Serial antibody dilutions are prepared in triplicate in sterile U-bottom 96 well microtitre plates (Falcon UK) in 100 ⁇ l. Control wells containing medium only and optimal Cyclosporin (Sandimmun®, Sandoz) levels (100nM) are also prepared to establish the maximum response and maximum inhibition, respectively. Equal numbers of irradiated stimulators and responders are mixed together and 100 ⁇ l are added to each well. Wells of stimulator alone and responders alone are also set up as controls. The experiment is incubated at 37°C in 100% humidity and 5%CO 2 for 5 days. Response is measured by assessing proliferation during the last 18 hours of culture by incubation with 1 ⁇ Ci/well 3 H-Thymidine (Amersham UK), harvesting on to glass filter mattes and counting using a beta counter.
• T lymphocytes from an individual previously immunised with Tetanus Toxoid will respond to TT when re-exposed ex vivo. This activation is dependent on the interaction between the CD3/TcR complex on T ceils and the MHC-II molecule on cells which process and present the antigen. Antibodies that bind to MHC-II are known to inhibit this reaction. Lymphocytes are prepared fresh for each experiment. Human venous blood is drawn into endotoxin free tubes containing heparin. Peripheral blood mononuclear cells (PBMC) are prepared by density gradient centrifugation according to the manufacturers instructions (Pharmacia).
• PBMC Peripheral blood mononuclear cells
• PBMC peripheral blood mononuclear cells
• PBMC peripheral blood mononuclear cells
• RPMI 1640 medium Gibco UK
• 2mM Glutamine Gibco UK
• 100 ⁇ /ml/100 ⁇ g/ml Penicillin/ Streptomycin Gibco
• 10% foetal calf serum Sigma UK
• Serial antibody dilutions are prepared in triplicate in sterile U-bottom 96' well microtitre plates (Falcon UK) in 100 ⁇ l. 50 ⁇ l containing an optimal concentration of TT, previously determined by experimentation, is added to all wells. Control wells containing medium only or Cyclosporin
• Results are plotted as CPM against antibody concentration. Replicates vary by less than 10%.
• G1/G2 L hinge exchange mutant was intermediate in immuno-suppresser potency, there was no correlation between complement fixation or FcRI binding and immuno-suppression, G1 binding well to FcRI and fixing complement and G1[L235E] doing neither, but both giving good immunosuppression. But, there was good correlation with FcRIII binding. Human G1 and G1[L235E] interact with FcRIII and give good immunosuppression. The G1/G2 L hinge is intermediate in FcRIII binding and immuno-suppression. In contrast, the G237A mutation in human G1, in agreement with published observations, reduces FcRIII binding. This antibody gave poor immunosuppression. (Table 5). Table 6 shows a number of L243 isotype mutants.
• G1/G2Lh 10 500 >20/0
• L243 is a mouse monoclonal antibody raised against human MHC Class II.
• the nucieotide and amino acid sequences of L243 VI and Vh are shown in Figures 5 and 3 respectively.
• the following examples describe the humanisation of the L243 antibody (CDR grafting).
• L243-gL1 The construction of L243-gL1 is given below in detail.
• the following oligonucleotides were used in the Polymerase Chain Reactions (PCR) to introduce changes into the framework regions of the chimeric light chain: R5043 : 5 'GTAGGAGACCGGGTCACCATCACATGTCGAGCAAA3 '
• R5CH4 5 'CTGAGGAGCTTTTCCTGGTTTCTGCTGATACCATGCTAAA3 '
• R5045 5 'AAACCAGGAAAAGCTCCTCAGCTCCTGATCTTTGCTGCATC3 '
• R5046 5 'CTTCTGGCTGCAGGCTGGAGATAGTTAGGGTATACTGTGTGCC3 '
• R5047 5 'CTTCAGCCTGCAGCCAGAAGATTTTGCTACTTATTACTGTCAA3 '
• R5048 5 'GGGCCGCTACCGTACGTTTTAGTTCCACTTTGGTGCCTTGACCGAA3 '
• the reaction 100 ⁇ l, contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 1/10 of each of the three PCR fragments from the first set of reactions, 30 pmoles of R5043 and R5048 and 2.5 units Taq polymerase. Reaction temperatures were as above.
• the mixture was extracted with phenol / chloroform and then with chloroform and precipitated with ethanol. The ethanol precipitate was recovered by centrifugation, dissolved in the appropriate buffer and restricted with the enzymes BstEII and Spll.
• the resulting product was finally electrophoresed on an agarose gel and the 270 base pair DNA fragment recovered from a gel slice and ligated into the vector pMR15.1 ( Figure 1) that had previously been digested with the same enzymes.
• the ligation mixture was used to transform E. coli LM1035 and resulting colonies analysed by PCR, restriction enzyme digests and nucieotide sequencing.
• the nucieotide and amino acid sequence of the VI region of L243-gL1 is shown in Figure 22.
• L243-gL2 was constructed from L243-gL1 using PCR.
• the following oligonucleotides were used to introduce the amino acid changes : R1053 : 5 'GCTGACAGACTAACAGACTGTTCC3 '
• the reaction 100 ⁇ l, contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 1/5 of each of the PCR fragments from the first set of reactions, 30 pmoles of R1053 and R684 and 2.5 units Taq polymerase. Reaction temperatures were as above.
• the mixture was extracted with phenol / chloroform and then with chloroform and precipitated with ethanol.
• the ethanol precipitate was recovered by centrifugation, dissolved in the appropriate buffer and restricted with the enzymes BstEII and Spll.
• the resulting product was finally electrophoresed on an agarose gel and the 270 base pair DNA fragment recovered from a gel slice and ligated into the vector pMR15.1 ( Figure 1) that had previously been digested with the same enzymes.
• the ligation mixture was used to transform E. coli LM1035 and resulting colonies analysed by PCR, restriction enzyme digests and nucieotide sequencing.
• the nucleotide and amino acid sequence of the VI region of L243-gL2 is shown in Figure 23.
• L243 heavy chain was found to be most homologous to human heavy chains belonging to subgroup 1 and therefore the consensus sequence of the human subgroup 1 frameworks was chosen to accept the L243 heavy chain CDRs.
• L243 differs from the human consensus at 28 positions (underlined). After analysis of the contribution that any of these might make to antigen binding, only residues 27,67,69,71,72 and 75 were retained in the CDR grafted heavy chain, L243-gH.
• L243gH was assembled by subjecting overlapping oligonucleotides to PCR in the presence of the appropriate primers.
• the following oligonucleotides. were used in the PCR: R3004 : 5 'GGGGGGAAGCTTGCCGCCACCATGG3 ' R3005 : 5 'CCCCCCGGGCCCTTTGTAGAAGCAG3 ' R4902 : 5 'GACAACAGGAGTGCACTCTCAGGTGCAGCTGGTGCAGTCTGGAGC
• CAGGGACTCGAGTGGA3 ' R4904 5 ' CCTACGTACGCAGACGACTTCAAGGGAAGATTCACATTCACACTG
• TCCCATCCACTCGAGTCCCTGTCCAG3 ' R4900 5 'TTGCACAGTAGTACACTGCTGTGTCCTCAGATCTCAGAGAAGACA GCTCCATGTATGCTGTAGATGCAGAT3 ' R4901 : 5 'CCCCCCGGGCCCTTTGTAGAAGCAGAAGACACTGTCACCAGTGTT
• the assembly reaction 50 ⁇ l, contained 10 mM Tris-HCI pH 8.3, 1.5 mM MgCI2, 50 mM KCI, 0.01% w/v gelatin, 0.25 mM each deoxyribonucleoside triphosphate, 1 pmole of each Of R4897 - R4905, 10 pmoles of each of R3004 and R3005 and 2.5 units Taq polymerase. Reactions were cycled through 94 C for 1 minute, 55 C for 1 minute and 72 C for 1 minute. After 30 cycles, the reaction was extracted with phenol/chloroform (1/1), then with chloroform and precipitated with ethanol. After centrifugation, the DNA was dissolved in the appropriate restriction buffer and digested with HindIII and ApaI.
• pMR14 contains the human gamma 4 heavy chain constant region and so the heavy chain expressed from this vector will be a gamma 4 isotype.
• the ligation mixture was used to transform E. coli LM1035 and resulting bacterial colonies screened by restriction digest and nucieotide sequence analysis. In this way, a plasmid containing the correct sequence for L243gH was identified ( Figure 24). Construction of Gamma 1 versions of chimeric and CDR grafted L243 heavy chain
• Human Gamma 1 versions of L243 heavy chains were constructed by transferring the variable regions of both the murine and the CDR grafted heavy chains as HindIII to Apal fragments into the vector pGammal ( Figure 6). This vector contains the human Gamma 1 heavy chain constant region.
• Chimeric and CDR grafted L243 was produced for biological evaluation by transient expression of heavy and light chain pairs after co-transfection into Chinese Hamster Ovary (CHO) cells using calcium phosphate precipitation as described above for production of chimeric L243.
• Antibody concentration was determined using a human Ig ELISA (see below). b) ELISA
• the samples were titrated in the microtitre wells in 2-fold dilutions to give a final volume of 0.1 ml in each well and the plates incubated at room temperature for 1 hr with shaking. After the first incubation step the plates were washed 10 times with distilled water and then incubated for 1 hr as before with 0.1 ml of a mouse monoclonal anti-human kappa (clone GD12) peroxidase conjugated antibody (The Binding Site, code MP135) at a dilution of 1 in 700 in conjugate buffer. The plate was washed again and substrate solution (0.1 ml) added to each well.
• clone GD12 mouse monoclonal anti-human kappa peroxidase conjugated antibody
• Substrate solution contained 150 ⁇ l N,N,N,N-tetramethylbenzidine (10 mg/ml in DMSO), 150 ⁇ l hydrogen peroxide (30% solution) in 10 ml 0.1 M sodium acetate/sodium citrate, pH6.0. The plate was developed for 5 -10 minutes until the absorbance at 630nm was approximately 1.0 for the top standard. Absorbance at 630nm was measured using a plate reader and the concentration of the sample determined by comparing the titration curves with those of the standard. c) Competition Assay
• the principle of this assay is that if the antigen binding region has been correctly transferred from the murine to human frameworks, then the CDR grafted antibody will compete equally well with a labelled chimeric antibody for binding to human MHC Class II. Any changes in the antigen binding potency will be revealed in this system.
• Chimeric L243 was labelled with fluorescein (FITC) using the method of Wood et al [Wood.T., Thompson, S and Goldstein, G 1965, J. Immunol 95, 225-229 and used in the competition assay described above.
• FITC fluorescein
• Figure 25 compares the ability of combinations of L243 heavy and light chains to compete with FITC-labelled chimeric L243 for binding to JY cells. All combinations were effective competitors although none of those containing CDR grafted heavy or light chains were as effective as the chimeric antibody itself. Thus, the combinations cH/gL1 , gH/cL and gH/gL1 were 89%, 78% and 64% respectively, as effective as chimeric L243 in this assay. d) Determination of Affinity constants by Scatchard Analysis
• L243 antibodies were titrated from 10 ⁇ g/ml in PBS, 5% fetal calf serum, 0.1% sodium azide in 1.5-fold dilutions (150 ⁇ l each) before incubation with 5 ⁇ 10 4 JY cells per titration point for 1 hour on ice. The cells were previously counted, washed and resuspended in the same medium as the samples. After incubation, the cells were washed with 5ml of the above medium, spun down and the supernatant discarded. Bound antibody was revealed by addition of 100 ⁇ l of a 1/100 dilution of FITC conjugated antihuman Fc monoclonal (The Binding Site; code MF001).
• the cells were then incubated for 1 hour on ice and then the excess FITC conjugate removed by washing as before.
• Cells were dispersed in 250 ⁇ l of the same buffer and the median fluorescence intensity per cell was determined in a FACScan (Becton Dickinson) and calibrated using standard beads (Flow Cytometry standards Corporation). The number of molecules of antibody bound per cell at each antibody concentration was thus established and used to generate Scatchard plots. For the purpose of calculation, it was assumed that the valency of binding of the FITC conjugate to L243 was 1:1 and that the F/P ratio was 3.36 (as given by the manufacturer).
• the principle of the experiment is that when leucocytes from one individual are mixed with those of another individual which express different HLA alleles, they will recognise each other as foreign and the lymphocytes will become activated. This activation is dependent primarily on interactions between the CD3/TcR complex on T cells and the MHC Class II molecule on antigen presenting cells. L243 is known to inhibit this reaction.

Applications Claiming Priority (9)

Publications (1)

Family

ID=27451034

Family Applications (1)

Country Status (5)

Families Citing this family (1127)