WO2012022734A2 - Anti-icam-1 antibodies and methods of use - Google Patents

Anti-icam-1 antibodies and methods of use

Info

Publication number
WO2012022734A2
WO2012022734A2 PCT/EP2011/064067 EP2011064067W WO2012022734A2 WO 2012022734 A2 WO2012022734 A2 WO 2012022734A2 EP 2011064067 W EP2011064067 W EP 2011064067W WO 2012022734 A2 WO2012022734 A2 WO 2012022734A2
Authority
WO
Grant status
Application
Patent type
Prior art keywords
amino
acid
antibody
icam
sequence
Prior art date
Application number
PCT/EP2011/064067
Other languages
French (fr)
Other versions
WO2012022734A3 (en )
Inventor
Sara Dodd
David Christopher Lowe
Philip Arthur Newton
Martin Douglas Strain
Katherine Ann Vousden
Edward Wells
Original Assignee
Medimmune Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2821Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against ICAM molecules, e.g. CD50, CD54, CD102
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
    • Y02A50/38Medical treatment of vector-borne diseases characterised by the agent
    • Y02A50/408Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa
    • Y02A50/411Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa of the genus Plasmodium, i.e. Malaria
    • Y02A50/412Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa of the genus Plasmodium, i.e. Malaria the medicinal preparation containing antigens or antibodies, e.g. vaccines, antisera

Abstract

Provided are anti-ICAM-1 antibodies or antibody fragments and methods of using them. In certain embodiments, anti-ICAM-1 antibodies or antibody fragments of the invention inhibit binding of human ICAM-1 to human rhinovirus, and do not substantially inhibit binding of human ICAM-1 to LFA1.

Description

Anti-ICAM-1 Antibodies and Methods of Use

1. Cross Reference to Related Applications

This application claims priority to U.S. Provisional Application No.: 61/373,978 filed August 16, 2010 is incorporated by reference in its entirety for all purposes. 2. Reference to a Sequence Listing

This application incorporates by reference a Sequence Listing submitted with this application as text file MED0569PCT_SL.txt created on August 1, 2011 and having a size of 196,608 bytes.

3. Field of the Invention

The present invention relates to anti-ICAM- 1 antibodies or antibody fragments and methods of using them.

4. Background of the Invention

Intercellular adhesion molecule 1 (ICAM-1) is an Ig-like cell adhesion molecule. ICAM-1 binds integrins promoting cell-cell adhesion. In humans ICAM-1 is also a receptor for the major group of Human Rhinoviruses (HRV) and for several of the human Coxsackie A viruses (CV-A). In addition, ICAM-1 is one of the endothelial adhesion molecules that bind Plasmodium falciparum-mfected erythrocytes.

Rhinoviruses cause the common cold. Some people get complications from a cold. A cold can sometimes lead to acute bronchitis, croup, pneumonia, sinusitis, or strep throat. People with chronic lung diseases like asthma and Chronic Obstructive Pulmonary Disease (COPD), are especially vulnerable to complications. This is often termed COPD

exacerbation, and can be extremely serious for suffers of COPD or others with already impaired respiratory function.

COPD is a major cause of disability, and it's the fourth leading cause of death in the United States. More than 12 million people are currently diagnosed with COPD. An additional 12 million likely have the disease and don't even know it. COPD blocks airflow and makes it increasingly difficult for a sufferer to breathe. COPD is caused by damage to the airways that eventually interferes with the exchange of oxygen and carbon dioxide in the lungs. COPD includes chronic obstructive bronchitis and emphysema and often both. There are few treatments for the common cold, and the risks associated with infection are very significant for suffers of COPD or others who have impaired respiratory function.

5. Summary of the Invention

There is a need for treatments and preventatives for rhinovirus infections and the ensuing complications - complications which are particularly dangerous for sufferers of COPD and others who have impaired respiratory function. One class of agents are agents that prevent or decrease the likelihood that rhinovirus can effectively enter and infect cells by, for example, agents that bind specifically to IC AM- 1 and prevent rhinoviral binding to ICAM- 1. Of particular interest are agents that do this without interfering with or otherwise affecting the other normal functions of ICAM-1, such as the roles of ICAM-1 in cell adhesion and immune function. Moreover, ICAM-1 plays an important role in the normal immune response, and thus there is a need for compositions and methods that can be used to prevent ICAM-1 mediated viral entry into cells without inhibiting the normal functions of ICAM-1 in immunity.

The present invention relates to anti-ICAM-1 antibodies or antibody fragments and methods of using them. In certain embodiments, anti-ICAM-1 antibodies or antibody fragments of the invention inhibit binding of human ICAM-1 to human rhinovirus, and do not substantially inhibit binding of human ICAM-1 to LFA1. In certain aspects, the invention provides nucleic acids encoding the anti-ICAM- 1 antibodies of the invention. In certain aspects, the invention provides methods for producing anti-ICAM-1 antibodies of the invention. In certain aspects, the invention provides methods of treating or preventing rhinovirus infection in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of an anti-ICAM- 1 antibody of the invention.

6. Brief Description of the Figures

Figures 1A and IB show representative plots of the inhibitory activity of several

ICAM-1 specific clones isolated from a phage display library (ICM 10064, 10088, 10098, and 10103), an irrelevant control (CAT002) and the commercially available anti-ICAM-1 murine antibody 15.2 (Calbiochem) in the human ICAM-1:HRV binding assay (Panel A) and the ICAM-1:LFA-1 binding assay (Panel B). Clones ICM10098 and 10103 as well as the 15.2 antibody show at least partial inhibition of HRV:ICAM-1 binding and full inhibition of LFA- 1:ICAM-1 binding. Clones ICM10064 and 10088 completely inhibit HRV binding and have minimal inhibitory activity on LFA-1:ICAM-1 binding. Figures 2A and 2B show representative plots of the inhibitory activity of several ICAM-1 specific clones isolated from a phage display library (ICM 10064, 10088, 10098, and 10103), an irrelevant control (COLIN IgG2) and the commercially available anti-ICAM-1 murine antibody 14C11, R&D Systems in the HeLa-OHIO CPE assay for HRV- 16 (Panel A) and HRV-14 (Panel B) serotypes. The data from these studies are summarized in Table 2.

Figure 3 shows representative plots of the inhibitory activity of clones ICM10064, 10088, 10098, and 10103, an irrelevant control (COLIN), commercially available anti- ICAM-1 murine antibodies 14C11, and 15.2 and hlA2 IgG2 in the Jurkat Adhesion Assay. The data from these studies are summarized in Table 2.

Figures 4A and 4B show the specificity ELISA results for representative anti-ICAM-1 antibodies binding to a panel of ICAM- 1 related molecules. The binding specificity of the parental antibodies ICM 10064 and ICM 10088 (at 33.3 nM IgG) is shown in Panel A, and the optimized germlined version of Icmo0191 (at 33.3 nM IgG) is shown in Panel B. These binding data show that both parental ICM10064 and ICM 10088 human antibodies and the optimized germlined antibodies derived from the ICM 10064 line are specific for human ICAM-1 domain 1 and do not bind ICAM from mouse or cynomolgus monkey.

Figure 5 shows a schematic of the ICAM-1 structure and the interaction of ICAM- 1 domain 3 with Mac- 1 and the interactions of ICAM- 1 domain 1 with HRV and LFA- 1.

Plasmodium falciparum-infected erythrocytes also interact with ICAM-1 domain 1 at a region that overlaps with the HRV interaction region. Also indicated with brackets are the putative interactions of ICAM-1 with clones ICM10098, ICM10103, ICM10064, ICM10088 and the commercial antibodies RRl/1 and hlA2 IgG2 based on their binding and functional activities including HRV/LFA-1 inhibition, and cross-reactivity with non-human primate (NHPX) ICAM-1.

Figure 6 provides alignments of the amino acid sequences of the CDR3 randomized light chains for the selected antibodies from the ICM 10064 lineage. The heavy chain for each clone is the wildtype ICM10064 (see Figure 8A). These antibodies constitute Panel 1A. The sequences shown are represented by SEQ ID NOs: 7, 77, 87, 97, 117 and 107, respectively.

Figures 7A and 7B provide alignments of the amino acid sequences of the CDR3 randomized heavy (A) and light (B) chains for the selected antibodies from the ICM 10088 lineage. These antibodies constitute Panel IB. The sequences shown in (A) are represented by SEQ ID NOs: 22, 32, 42, 62, 52, 122, 132, 142, 152 and 162, respectively. The sequences shown in (B) are represented by SEQ ID NOs: 27, 37, 47, 67, 57, 127, 137, 147, 157 and 167, respectively.

Figures 8A and 8B provide alignments of the heavy (A) and light (B) chain amino acid sequences of selected antibodies from the first and second generation ribosome display libraries from the ICM 10064 lineage. These antibodies constitute Panel 2. The sequences shown in (A) are represented by SEQ ID NOs: 2, 172, 182, 202, 212, 222, 232, 242, 262, 272, 282 and 302, respectively. The sequences shown in (B) are represented by SEQ ID NOs:7, 177, 187, 207, 217, 227, 237, 247, 267, 277, 287 and 307, respectively.

Figures 9A and 9B provide alignments of the germlined/N95aS heavy (A) and light (B) chain amino acid sequences of the parent ICM 10064 antibody and the antibodies from the second generation ribosome display library from the ICM10064 lineage. The sequences shown in (A) are represented by SEQ ID NOs: 2, 12, 192, 252, 292 and 312, respectively. The sequences shown in (B) are represented by SEQ ID NOs:7, 17, 197, 257, 297 and 317, respectively.

Figures 10A-G show that systemic anti-ICAM-1 antibody prevents HRV-16 induced inflammation. Mice were dosed intravenously with 14C11 24 hours prior to intranasal infection with 3.2xl07 HRV16/mouse (n=9 for tg- group; n=6 for tg+ groups). Total BAL cells (A), macrophages (B), lymphocytes (C) and neutrophils (D) were assessed with differentially stained cytospins day 2 after infection. Expression of proinflammatory cytokines 1FNX3 (E), IP- 10 (F) and I-TAC (G) was determined in BAL supernatant by quantitative ELISA 2 days after infection. Data are expressed as mean (+ SEM). Significance was assessed by One-way ANOVA test with Bonferroni's Multiple Comparison test as post- test. **p<0.01 and ***p<0.001 vs. HRV16 infected wild type mice; *p<0.05, mp<0.0l and # p<0.001 vs. HRV16 infected huICAM-1 Tg mice; p<0.05, p<0.01 and § p<0.001 versus isotype control dosed HRV16 infected huICAM-1 Tg mice. Data are representative of 2 independent experiments.

Figures 11A-G show that topical anti-ICAM-1 antibody similarly prevents HRV-16 induced inflammation. Groups of 7 mice were dosed intranasally with 14C11 2 hours prior to intranasal infection with 6.5xl06 HRV16/mouse. Total BAL cells (A), macrophages (B), lymphocytes (C) and neutrophils (D) were assessed with differentially stained cytospins day 2 after infection. Expression of proinflammatory cytokines IFN 3 (E), IP- 10 (F) and I-TAC (G) was determined in BAL supernatant by quantitative ELISA 2 days after infection. Data are expressed as mean (+ SEM). Significance was assessed by One-way ANOVA test with Bonferroni's Multiple Comparison test as post-test. ***p<0.001 vs. HRV16 infected wild type mice; #p<0.05, *p<0.01 and "p^.OOl vs. HRV16 infected huICAM-1 Tg mice;

p<0.05, p<0.01 and §p<0.001 versus isotype control dosed HRV16 infected huICAM-1 Tg mice. Data are representative of 3 independent experiments.

Figures 12A-I show that anti-ICAM-1 antibody suppressed HRV-16 infection over a period of 7 days. Mice were dosed intranasally with 14C11 2 hours prior to intranasal infection with 6.5xl06 HRV16/mouse. Total BAL cells (A), macrophages (B), lymphocytes (C) and neutrophils (D) were assessed with differentially stained cytospins days 2, 4 and 7 after infection. Expression of proinflammatory cytokines ΙΡΝλ3 (E), IP- 10 (F) and I-TAC (G) was determined in BAL supernatant by quantitative ELISA 2, 4 and 7 days after infection. HRV16 specific IgGl (H) and IgG2a (I) were determined in sera by ELISA on day 7 after infection. Data are expressed as mean (+ SEM). Significance was assessed by Three- way analysis of variance. **p<0.01 and ***p<0.001 vs. HRV16 infected wild type mice; #p<0.05, *p<0.01 and ***p<0.001 vs. HRV16 infected huICAM-1 Tg mice. Data are from 2 independent experiments with n=8 mice per group.

Figures 13A-G Anti-ICAM-1 antibody also prevents HRV-14 induced inflammation Groups of 6 mice were dosed intranasally with 14C11 2 hours prior to intranasal infection with 3.2xl06 HRV14/mouse. Total BAL cells (A), macrophages (B), lymphocytes (C) and neutrophils (D) were assessed with differentially stained cytospins day 2 after infection. Expression of proinflammatory cytokines IFN 3 (E), IP-10 (F) and I-TAC (G) was determined in BAL supernatant by quantitative ELISA 2 days after infection. Data are expressed as mean (+ SEM). Significance was assessed by One-way ANOVA test with Bonferroni's Multiple Comparison test as post-test. ***p<0.001 vs. HRV14 infected wild type mice; **p<0.01 and "p-cO.OOl vs. HRV14 infected huICAM-1 Tg mice; p<0.001 versus isotype control dosed HRV14 infected huICAM-1 Tg mice.

Figures 14A-G Anti-ICAM-1 antibody has no effect on minor serotype HRV-1B infection. Mice were dosed intravenously with 14C11 24 hours prior to intranasal infection with lxlO7 HRVlB/mouse, lxlO7 UV-inactivated HRVlB/mouse (UV) or 2xl06HRV16/mouse (n=4 for tg- UV, tg- IB, tg+ 16 iso and tg+ 16 14C11 groups; n=6 for tg+ UV, tg+ IB, tg+ IB iso and tg+ IB 14C11 groups). Total BAL cells (A), macrophages (B), lymphocytes (C) and neutrophils (D) were assessed with differentially stained cytospins 1 day after infection. Expression of proinflammatory cytokines IFN 3 (E), IP-10 (F) and I-TAC (G) was determined in BAL supernatant by quantitative ELISA 1 day after infection. Additionally, total BAL cells (H), macrophages (I), lymphocytes (J) and neutrophils (K) were assessed with differentially stained cytospins on day 4 after infection. Data are expressed as mean (+ SEM). Significance was assessed by One-way ANOVA test with Bonferroni's Multiple Comparison test as post-test. *p<0.05 and ***p<0.001 vs. UV-RV1B in wild type mice; #p<0.05, *p<0.01 and vs. UV-RV1B in huICAM-1 Tg mice; p<0.05 and

§§§p<0.001 vs. isotype treated HRV16 infected huICAM-1 Tg mice. Data are representative of 2 independent experiments.

Figures 15A-G Anti-ICAM-1 antibody has no effect on LPS-induced inflammation. Groups of 7 mice were dosed intravenously with 14C11 24 hours prior to intranasal infection with 1 μg LPS/mouse. Total BAL cells (A), macrophages (B), lymphocytes (C) and neutrophils (D) were assessed with differentially stained cytospins 1 day after infection. Expression of proinflammatory cytokines IL-Ιβ (E), IL-6 (F) and KC (G) was determined in BAL supernatant by quantitative ELISA 1 day after infection. Data are expressed as mean (± SEM). Significance was assessed by One-way ANOVA test with Bonferroni's Multiple Comparison test as post-test. ***p<0.001 vs. untreated huICAM-1 Tg mice. Data are representative of 2 independent experiments.

Figure 16 provides a schematic of the assay developed for detecting the interaction of live virus with a host cell protein. The method may be used as shown here for screening molecules that inhibit the interaction of HRV with ICAM. Fluorescence resonance energy transfer (FRET) occurs between the donor (europium cryptate labeled ICAM-Fc), and the acceptor fluorophore (IC AM-D 1/5-FLAG in complex with anti-FLAG XL665), when both fluorophores are in close proximity on the surface of a live HRV. The presence of an inhibitor of the ICAM- 1/HRV interaction such as an anti-ICAM scFv will reduce the FRET signal. 7. Detailed Description

(i) Introduction

The present invention provides antibodies, including human, humanized and/or chimeric forms, as well as fragments, derivatives/conjugates and compositions thereof that bind to ICAM-1. The anti-ICAM-1 antibodies and antibody fragments of this disclosure are also herein referred to as antibodies of the invention.

The present anti-ICAM-1 antibodies and antibody fragments of this disclosure are useful for diagnosing and/or preventing and/or treating and/or alleviating one or more symptoms of HRV infection and/or a disease exacerbated by Human Rhinoviruses (HRV) infection such as a chronic lung disease, e.g., COPD or asthma.

ICAM-1 also known as CD54 is an Ig-like cell adhesion molecule. ICAM-1 is an endothelial- and leukocyte-associated transmembrane protein known for its important role in stabilizing cell-cell interactions and facilitating leukocyte endothelial transmigration. The presence of heavy glycosylation and other structural characteristics of ICAM-1 provide binding sites on ICAM-1 for numerous ligands. ICAM-1 possesses binding sites for a number of immune-associated ligands such as, Macrophage Adhesion Ligand- 1 (Mac-1), Leukocyte Function Associated Antigen- 1 (LFA- 1), and Fibrinogen. These three proteins are generally expressed on endothelial cells and leukocytes, and they bind to ICAM-1 to facilitate transmigration of leukocytes across vascular endothelia in processes such as extravasation and the inflammatory response. Via interaction with these proteins, ICAM-1 plays a role in proper functioning of the normal immune system.

In humans, ICAM-1 is also a receptor for the major group of HRV and for the Coxsackie A viruses (CV-A), and the interaction between ICAM-1 and these viruses promotes viral entry into various cell types. Rhinovirus attachment is confined to the BC, CD, DE, and FG loops of the amino-terminal Ig-like domain (Dl) at the end of ICAM-1 that is distal to the cellular membrane. There are extensive charge interactions between ICAM- 1 and HRV, which are mostly conserved in both major and minor receptor groups of rhinoviruses. In addition, the binding site for Plasmodium falciparum-infected erythrocytes is located in domain Dl and partially overlaps the HRV-binding site. Specific amino acids known to be involved in HRV, LFA, and Plasmodium falciparum-infected erythrocytes binding to ICAM-1 are shown in Figure 4 of Bella et al., PNAS, 95(8): 4140-4145 (1998), incorporated by reference herein in its entirety.

HRV infection causes neutrophil influx with increased inflammatory cytokines. Host inflammatory responses, particularly IL-8, play key roles in pathogenesis of common cold symptoms. In patients with chronic lung diseases this can lead to exacerbation of the symptoms of the underlying respiratory condition. Symptoms of viral infection precede two thirds of COPD exacerbations. 40% of hospitalized acute exacerbation patients have HRV present in nasal and/or sputum samples. Thus, preventing HRV infection among patients with COPD or other significant respiratory conditions represents an important intervention that could significantly reduce the risk of COPD exacerbation and significantly improve the health of patients with COPD and other serious respiratory conditions. Thus, the present compositions and methods can be useful in treating and preventing COPD exacerbation by preventing or decreasing HRV infection - particularly in patients with COPD and other respiratory conditions.

It would be advantageous for preventing or inhibiting HRV infection to develop an inhibitor that specifically inhibits HRV binding to ICAM- 1 (thus preventing HRV entry into these cells) but which has little or no effect on the normal functions of ICAM- 1 , such as LFA binding. Such inhibitors could be used to block HRV infection without interfering with the normal and advantageous role of ICAM-1 in the immune system. However, given that the binding sites on ICAM-1 for both LFA-1 and HRV are close together on the Dl domain, it was not clear, a priori, that such a specific inhibitor capable of disrupting HRV/ICAM-1 binding without substantially interfering with LFAl/ICAM-1 binding could be generated or that such antibodies would also inhibit the entry of HRV and CV-A. The present disclosure is based on the identification and characterization of antibodies including panels of human antibodies having these unique and advantageous features. These antibodies are described in detail herein. In addition, the antibodies of the invention are expected to block the binding of Plasmodium falciparum-inf ected erythrocytes to endothelial cells.

As used herein, the terms "antibody" and "antibodies", also known as

immunoglobulins, encompass monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies formed from at least two different epitope binding fragments (e.g., bispecific antibodies), human antibodies, chimeric antibodies (including, for example, humanized antibodies), camelised antibodies, antibody fragments that exhibit the desired biological activity (e.g. the antigen binding portion) including: single- chain Fvs (scFv), single-chain antibodies, single domain antibodies, domain antibodies, Fab fragments, F(ab')2 fragments, disulfide-linked Fvs (dsFv), and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), intrabodies, and epitope-binding fragments of any of the above. In particular, antibodies include

immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, i.e., molecules that contain at least one antigen-binding site. Immunoglobulin molecules can be of any isotype (e.g., IgG, IgE, IgM, IgD, IgA and IgY), subisotype (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or allotype (e.g., Gm, e.g., Glm(f, z, a or x), G2m(n), G3m(g, b, or c), Am, Em, and Km (1, 2 or 3)). Antibodies may be derived from any mammal, including, but not limited to, humans, monkeys, pigs, horses, rabbits, dogs, cats, mice, etc., or other animals such as birds (e.g. chickens).

Native antibodies are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies between the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (VH) followed by a number of constant domains (CH). Each light chain has a variable domain at one end (VL) and a constant domain (CL) at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain. Light chains are classified as either lambda chains or kappa chains based on the amino acid sequence of the light chain constant region. The variable domain of a kappa light chain may also be denoted herein as VK. In the context of the present invention, the term "chimeric antibody" generically refers to an antibody composed of portions derived from at least two different animal species, regardless of the contribution of each portion in the overall molecule.

The antibodies of the invention include full length or intact antibody, antibody fragments, native sequence antibody or amino acid variants, human, humanized, post- translationally modified, chimeric or fusion antibodies, immunoconjugates, and functional fragments thereof. The antibodies can be modified in the Fc region to provide desired effector functions or serum half-life. As discussed in more detail in the sections below, with the appropriate Fc regions, the naked antibody bound on the cell surface can have enhanced cytotoxicity, e.g., via antibody-dependent cellular cytotoxicity (ADCC) or by recruiting complement in complement dependent cytotoxicity (CDC), or by recruiting nonspecific cytotoxic cells that express one or more effector ligands that recognize bound antibody on a target cell and subsequently cause phagocytosis of the target cell in antibody dependent cell- mediated phagocytosis (ADCP), or some other mechanism. Alternatively, where it is desirable to eliminate or reduce effector function, so as to minimize side effects or therapeutic complications, certain other Fc regions may be used. The Fc region of the antibodies of the invention can be modified to increase the binding affinity for FcRn and thus increase serum half-life. Alternatively, the Fc region can be conjugated to PEG or albumin to increase the serum half-life, or some other conjugation that results in the desired effect.

In certain embodiments, the antibody competes for binding or bind substantially to, the same epitope as the antibodies of the invention. Antibodies having one or more biological characteristics (e.g., potency, ICAM-1 affinity, effector function, ortholog binding affinity, neutralization, etc.) of the present anti-ICAM- 1 antibodies of the invention are also contemplated, e.g., an anti-ICAM- 1 antibody which has the biological characteristics of a monoclonal antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297.

The invention provides a composition comprising an anti-ICAM- 1 antibody of the invention and a carrier. For the purposes of treating and/or preventing disease associated with or exacerbated by HRV (e.g. HRV-14, HRV- 16) or CV-A (e.g. CV-A21, CV-A16), or Plasmodium falciparum compositions can be administered to the patient in need of such treatment, wherein the composition can comprise one or more anti-ICAM- 1 antibodies present as an immunoconjugate or as the naked antibody. In a further embodiment, the compositions can comprise these antibodies in combination with other therapeutic agents such as bronchodilators, such as ipratropium, tiotropium, salmeterol, or formoterol, steroids and antibiotics. In certain embodiments, the compositions can comprise these antibodies in combination with surgery such as lung volume reduction surgery or lung transplantation. In certain embodiments, the compositions can comprise these antibodies in combination with therapy such as oxygen therapy, pulmonary rehabilitation or smoking cessation.

The invention also provides formulations comprising an anti-ICAM- 1 antibody of the invention and a carrier. In one embodiment, the formulation is a therapeutic formulation comprising a pharmaceutically acceptable carrier.

In certain embodiments the invention provides methods useful for treating an HRV and/or CV-A, and/or Plasmodium falciparum associated or exacerbated disease /condition and/or preventing and/or alleviating one or more symptoms of such a disease/condition in a mammal, comprising administering a therapeutically effective amount of the anti-ICAM- 1 antibody to the mammal. The antibody therapeutic compositions can be administered short term (acute) or chronic, or intermittently as directed by physician. By way of example, the antibodies of the present disclosure can be used to help treat or prevent COPD exacerbation or the exacerbation of other respiratory conditions. Such respiratory conditions are exacerbated by rhinovirus infection. The antibodies of the present disclosure can be used to help treat or prevent malaria caused by Plasmodium falciparum infection.

In certain embodiments the invention also provides articles of manufacture comprising at least an anti-ICAM- 1 antibody, such as sterile dosage forms and kits. The kits containing anti-ICAM- 1 antibodies find use e.g., for ICAM- 1 cell killing assays, for purification or immunoprecipitation of ICAM-1 from cells. For example, for isolation and purification of ICAM-1, the kit can contain an anti-ICAM-1 antibody coupled to beads (e.g., sepharose beads). Kits can be provided which contain the antibodies for detection and quantitation of ICAM-1 in vitro, e.g. in an ELISA or a Western blot. Such antibody useful for detection may be provided with a label such as a fluorescent or radiolabel.

(ii) Terminology

Before describing the present invention in detail, it is to be understood that this invention is not limited to specific compositions or process steps, as such may vary. It must be noted that, as used in this specification and the appended claims, the singular form "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this invention.

Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

The numbering of amino acids in the variable domain, complementarity determining region (CDRs) and framework regions (FR), of an antibody follow, unless otherwise indicated, the Kabat index as set forth in Kabat et al. Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991). Using this numbering system, the actual linear amino acid sequence may contain fewer or additional amino acids corresponding to a shortening of, or insertion into, a FR or CDR of the variable domain. For example, a heavy chain variable domain may include a single amino acid insertion (residue 52a according to Kabat) after residue 52 of H2 and inserted residues (e.g. residues 82a, 82b, and 82c, etc according to Kabat) after heavy chain FR residue 82. The Kabat numbering of residues may be determined for a given antibody by alignment at regions of homology of the sequence of the antibody with a "standard" Kabat numbered sequence. Maximal alignment of framework residues frequently requires the insertion of "spacer" residues in the numbering system, to be used for the Fv region. In addition, the identity of certain individual residues at any given Kabat site number may vary from antibody chain to antibody chain due to interspecies or allelic divergence. The constant region of the heavy chain of IgG may be divided into four smaller domains, CHI , hinge, CH2 and CH3. As used herein "Fc region" and similar terms encompass at least the CH2 and CH3 domain and may further comprise a portion of the hinge region and may include the entire hinge region. It will be understood that the numbering of the Fc amino acid residues is that of the EU index as in Kabat et al. (Ibid). The "EU index as set forth in Kabat" refers to the EU index numbering of the human IgGl Kabat antibody, while the "Kabat index as set forth in Kabat" refers to the Kabat index numbering of the IgGl Kabat antibody. Polymorphisms have been observed at a number of immunoglobulin positions (see, e.g., Kimm et al., 2001, J Mol Evol 53 : 1-9), and thus slight differences between the presented sequence and sequences in the prior art may exist.

(iii) Anti-ICAM-1 Antibodies

In a first aspect, the invention provides purified or isolated antibodies or antibody fragments that immuno specifically bind to human ICAM-1 (and optionally ICAM- 1 from one or more other species). Such antibodies or antibody fragments are human or chimeric antibodies that inhibit binding of human ICAM- 1 to human rhinovirus, but do not substantially inhibit binding of human ICAM- 1 to LFA1. Further, these antibodies or antibody fragments comprise one or more characteristics selected from the group consisting of:

(a) immunospecifically binds to human ICAM- 1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM- 1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC- 1 ;

(d) can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM- 1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody having the VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. In certain embodiments, the antibody or antibody fragment has at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or has all ten of features (a)-(j) detailed above. It is understood that such antibodies or antibody fragment comprise at least one or more of the foregoing characteristics, but may possess other features.

In certain embodiments, the antibody or antibody fragment is a human antibody or antibody fragment. In certain embodiments, the antibody or antibody fragment is purified. In certain embodiments, the antibody or antibody fragment is isolated.

In certain embodiments, the antibody or antibody fragment does not substantially inhibit binding of human ICAM-1 to LFA1. By "does not substantially inhibit binding" is meant that the antibody or antibody fragment inhibits binding, as measured by an in vitro or in vivo binding assay, of human ICAM-1 to LFA1 (and/or MAC- 1, when specified) by less than 50% in comparison to the binding of human ICAM-1 to LFA1 (and/or MAC-1) when measured in the same assay and under the same conditions in the absence of the antibody or antibody fragment. In certain embodiments, "does not substantially inhibit binding" refers to inhibition of less than about 45%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 18%, less than about 15%, less than about 10%, less than about 8%, less than about 5%, or less than about 3% 2%, or about 1%. In a specific embodiment, the antibody or antibody fragment inhibits binding of human ICAM-1 to LFA1 by less than 30-50% as measured by an in vitro binding assay disclosed in Example 11 infra.

In certain embodiments, the antibody or antibody fragment immuno specific ally binds to human ICAM-1 with a KD of less than 250 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins. In certain embodiments, the KD under these conditions is less than 200, less than 150, less than 125, less than 100, less than 75, or less than 70 nanomolar. In certain embodiments, the KD under these conditions is less than 60, less than 50, less than 40, less than 30, less than 25, less than 20, less than 15, less than 10 nanomolar, or less than 9, 8, 7, 6, 5, 4, 3, 2, or 1 nanomolar.

In certain embodiments, antibody or antibody fragment immunospecifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of less than 5 nanomolar, as assessed using DELFIA-based detection. In certain embodiments, the KD under these conditions is less than 2 nanomolar, less than 1 nanomolar, less than 750 picomolar, less than 600 picomolar, less than 500 picomolar, less than 400 picomolar, less than 300 picomolar, less than 250 picomolar, or less than 200 picomolar. In certain embodiments, the KD under these conditions is less than 150 picomolar, less than 100 picomolar, less than 75 picomolar, or less than 50 picomolar. In certain embodiments, the KD under these conditions is approximately 50-200 picomolar, approximately 100-400 picomolar, approximately 200-400 picomolar, approximately 200-500 picomolar (as assessed using .DELFIA-based detection).

In certain embodiments, the antibody or antibody fragment does not substantially inhibit binding of human ICAM-1 to MAC-1. By "does not substantially inhibit binding" is meant that the antibody or antibody fragment inhibits binding, as measured by an in vitro or in vivo binding assay, of human ICAM-1 to MAC1 (and/or LFAl, when specified) by less than 50% in comparison to the binding of human ICAM-1 to MAC1 (and/or LFA-1) when measured in the same assay and under the same conditions. In certain embodiments, "does not substantially inhibit binding" refers to inhibition of less than about 45%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 18%, less than about 15%, less than about 10%, less than about 8%, less than about 5%, or less than about 3% 2%, or about 1%.

In certain embodiments, the antibody or antibody fragment binds to the same or substantially the same epitope as an antibody having the VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. An antibody that binds to substantially the same epitope as a reference antibody will, in this case, maintain the primary functional characteristic of inhibiting binding of human ICAM-1 to rhinovirus, but not substantially inhibiting the binding of human ICAM-1 to LFAl. Further, such an antibody is capable of competing with the reference antibody for binding to human IC AM- 1 - indicating that the two antibodies bind specifically to overlapping epitopes..

It should be understood that the foregoing functional characteristics may also be used to describe antibodies of the invention that are additionally described using structural criteria, such as the amino acid sequence of one or more CDR or the amino acid sequence of the VH and/or VL domain. The invention contemplates antibodies and antibody fragments that bind immuno specifically to human ICAM-1 (and optionally ICAM-1 from one or more other species) and inhibit the binding of human ICAM-1 to human rhinovirus, but which antibodies do not substantially inhibit the binding of human ICAM-1 to LFAl and/or MAC-1. Any such antibodies of the invention can be further described using any one or more (and in any combination) of the functional and structural features described herein. Moreover, any of the antibodies or antibody fragments of the invention, whether defined functional, structural, or using a combination of functional and structural features, can be used in any of the methods describes herein. By way of example, antibodies and antibody fragments of the invention can be used diagnostically to detect ICAM-1 expression in vitro or in vivo. By way of further example, antibodies and antibody fragments of the invention can be used to inhibit human rhinovirus infection and to help treat or prevent exacerbation of respiratory conditions in susceptible patients.

Provided herein are numerous examples of anti-ICAM- 1 antibodies and antibody fragments having the functional features described above. In particular are anti-ICAM- 1 antibodies have the VH and VL regions of the antibodies referred to herein as "ICM 10064", "ICM10064fgl", "Icmo0014", "Icmo0015", "Icmo0016", "IcmoOOlV, "Icmo0018", "Icmo0069", "Icmo0070", "Icmo0070_SGR", "Icmo0072", "Icmo0075", "Icmo0079", "Icmo0181", "Icmo0183", "Icmo0183fgl", "Icmo0188", "Icmo0189", "Icmo0191", "Icmo0191fgl", "Icmo0194", "Icmo0194fgi", "ICM10088", "ICM10088fgl", "Icmo0004", "Icmo0008", "Icmo0007", "Icmo0059", "Icmo0060", "Icmo0061", "Icmo0066", "and Icmo0068", each having the VH and VL SEQ ID NOs. as provided in Table 8 and/or represented in Figures 6-9.

In another aspect, the invention provides purified or isolated anti-ICAM- 1 antibodies and antibody fragments that are further characterized based on consensus sequences that described the various examples of antibodies provided herein. Such antibodies, described using one or more consensus sequences (e.g., a consensus sequence defining one or more CDRs and/or VH and/or VL domains) can also be described using any one or more of the functional features of the antibodies of the invention described above or below. Further, such antibodies and antibody fragments can be used in any of the methods described herein.

In one embodiment, the invention provides a purified or isolated human or chimeric antibody or antibody fragment. The antibody or antibody fragment comprises at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1. The human or chimeric antibody or antibody fragment comprises:

a VH CDR1 having the amino acid sequence SGYFWG;

a VH CDR2 having the amino acid sequence S IYQS GS T Y YNPS LKX 1 , wherein

X1 is a neutral or basic amino acid residue; and

a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^TJY, wherein X1 is a neutral amino acid residue;

X2 is a neutral amino acid residue.

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR2 having the amino acid sequence S IYQS GSTY YNPS LKX1, wherein

X1 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Arg, Lys, and His.

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y, wherein

X1 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, and Leu;

X is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, and Trp.

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR1 having the amino acid sequence SGYFWG;

a VH CDR2 having the amino acid sequence S IYQS GS T Y YNPS LKX 1 , wherein

XI is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Arg, Lys, and His; and

a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y, wherein

X1 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, and Leu;

X2 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, and Trp.

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR1 having the amino acid sequence SGYFWG;

a VH CDR2 having the amino acid sequence S IYQS GSTY YNPS LKX1, wherein

X1 is an amino acid selected from the group consisting of Ser, Asn, and Arg; and

a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y, wherein X1 is an amino acid selected from the group consisting of Ser and Gly;

X2 is an amino acid selected from the group consisting of Leu and Phe.

In certain embodiments, the antibody or antibody fragment comprises:

a VL CDR1 having the amino acid sequence SGSSSNIGX1X2TVN, wherein

X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, and He;

X is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala,

Val, Leu, He, Asn, and Gin;

a VL CDR2 having the amino acid sequence NNDX^PS, wherein

X1 is an amino acid selected from the group consisting of Lys, Arg, His, Gin, and Asn; and a VL CDR3 having the amino acid sequence X1X2X3DX4X5LX6GRV, wherein

X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;

X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, and He;

X is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, and Trp;

X4 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;

X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala,

Val, Leu, He, Asn, Gin, Arg, Lys, and His;

X6 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, and Gin.

In certain embodiments, the antibody or antibody fragment comprises:

a VL CDRl having the amino acid sequence SGSSSNIGX^TVN, wherein

XI is an amino acid selected from the group consisting of Gly and Ser; X2 is an amino acid selected from the group consisting of Ser and Asn; a VL CDR2 having the amino acid sequence NNDXXRPS, wherein

X1 is an amino acid selected from the group consisting of Arg and Gin; and a VL CDR3 having the amino acid sequence X1X2X3DX4X5LX6GRV, wherein

X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;

X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, and He;

X3 is Trp;

X4 is Asp;

X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Arg, Lys, and His;

X6 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, and Gin.

In certain embodiments, the antibody or antibody fragment comprises:

a VL CDRl having the amino acid sequence SGSSSNIGX1X2TVN, wherein

X1 is an amino acid selected from the group consisting of Gly and Ser;

X2 is an amino acid selected from the group consisting of Ser and Asn; a VL CDR2 having the amino acid sequence NNDX^PS, wherein

X1 is an amino acid selected from the group consisting of Arg and Gin; and a VL CDR3 having the amino acid sequence X1X2X3DX4X5LX6GRV, wherein

X1 is an amino acid selected from the group consisting of Ala and Glu;

X2 is an amino acid selected from the group consisting of Ser and Thr;

X3 is Trp;

X4 is Asp;

X5 is an amino acid selected from the group consisting of Ser, Gly, Asn, and Arg;

X6 is an amino acid selected from the group consisting of Ser and Asn.

Combinations of any of the foregoing or following are also contemplated, as are combinations of any of these structural/sequence features with any of the functional features described herein.

Also contemplated, is a purified or isolated human or chimeric antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL). The antibody or antibody fragment immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and comprising:

a VL CDR1 having the amino acid sequence SGSSSNIGX1X2TVN, wherein

X1 is a neutral amino acid residue;

X is a neutral amino acid residue;

a VL CDR2 having the amino acid sequence NNDX^PS, wherein

XI is a neutral or basic amino acid residue; and

a VL CDR3 having the amino acid sequence X1X2X3DX4X5LX6GRV, wherein

X1 is a neutral or acidic amino acid residue;

X2 is a neutral amino acid residue;

X is a neutral amino acid residue;

X4 is a neutral or acidic amino acid residue;

X5 is a neutral or basic amino acid residue;

X6 is a neutral amino acid residue.

In certain embodiments, the antibody or antibody fragment comprises

a VL CDR 1 having the amino acid sequence SGSSSNIGX1X2TVN, wherein

XI is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, and He; X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, and Gin.

In certain embodiments, the antibody or antibody fragment comprises

a VL CDR2 having the amino acid sequence NNDX^PS, wherein

X1 is an amino acid selected from the group consisting of Lys, Arg, His, Gin, and Asn.

In certain embodiments, the antibody or antibody fragment comprises

a VL CDR3 having the amino acid sequence X1X2X3DX4X5LX6GRV, wherein

X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;

X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala,

Val, Leu, and He;

X3 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, and Trp;

X4 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala,

Val, Leu, He, Glu, Gin, Asp, and Asn;

X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Arg, Lys, and His;

X6 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, and Gin.

In certain embodiments, the antibody or antibody fragment comprises:

a VL CDR 1 having the amino acid sequence SGSSSNIGX1X2TVN, wherein

X1 is an amino acid selected from the group consisting of Gly and Ser;

X is an amino acid selected from the group consisting of Ser and Asn.

In certain embodiments, the antibody or antibody fragment comprises:

a VL CDR2 having the amino acid sequence NNDX^PS, wherein

XI is an amino acid selected from the group consisting of Arg and Gin. In certain embodiments, the antibody or antibody fragment comprises:

a VL CDR3 having the amino acid sequence X1X2X3DX4X5LX6GRV, wherein

X1 is an amino acid selected from the group consisting of Ala and Glu;

X2 is an amino acid selected from the group consisting of Ser and Thr;

X3 is an amino acid selected from the group consisting of Phe and Trp;

X4 is an amino acid selected from the group consisting of Thr and Asp; X5 is an amino acid selected from the group consisting of Ser, Gly, Asn, and Arg;

X6 is an amino acid selected from the group consisting of Ser and Asn.

In certain embodiments, antibody or antibody fragment comprises:

a VH CDR1 having the amino acid sequence SGYFWG;

a VH CDR2 having the amino acid sequence S IYQS GS T Y YNPS LKX 1 , wherein

X1 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala,

Val, Leu, He, Asn, Gin, Arg, Lys, and His; and

a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y, wherein

X1 is an amino acid selected from the group consisting of He, Ser, Thr, Gly,

Ala, Val, and Leu;

X2 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, and Trp.

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR2 having the amino acid sequence S IYQS GS T Y YNPS LKX 1 , wherein

X1 is an amino acid selected from the group consisting of Ser, Asn, and Arg. In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y, wherein X1 is an amino acid selected from the group consisting of Ser and Gly;

X2 is an amino acid selected from the group consisting of Leu and Phe.

Also provided, a purified or isolated human or chimeric antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL). The antibody or antibody fragment immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and comprises:

a VH CDR1 having the amino acid sequence SGYFWG;

a VH CDR2 having the amino acid sequence S IYQS GSTY YNPS LKX1, wherein

X1 is a neutral or basic amino acid residue;

a VH CDR3 having the amino acid sequence DGYCSGGX1CYPX2DY, wherein

X1 is a neutral amino acid residue;

X is a neutral amino acid residue;

a VL CDR1 having the amino acid sequence SGSSSNIGX1X2TVN, wherein

XI is a neutral amino acid residue;

X is a neutral amino acid residue;

a VL CDR2 having the amino acid sequence NNDX^PS, wherein X is a neutral or basic amino acid residue; and

a VL CDR3 having the amino acid sequence X1X2X3DX4X5LX6GRV, wherein

XI is a neutral or acidic amino acid residue;

X2 is a neutral amino acid residue;

X3 is a neutral amino acid residue;

X4 is a neutral or acidic amino acid residue;

X5 is a neutral or basic amino acid residue;

X6 is a neutral amino acid residue.

In certain embodiments, the antibody or antibody fragment comprises

a VH CDR1 having the amino acid sequence SGYFWG;

a VH CDR2 having the amino acid sequence S IYQS GS T Y YNPS LK 1 , wherein

X1 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala,

Val, Leu, He, Asn, Gin, Arg, Lys, and His;

a VH CDR3 having the amino acid sequence DGYCSGGX1CYPX2DY, wherein

X1 is an amino acid selected from the group consisting of He, Ser, Thr, Gly,

Ala, Val, and Leu;

X2 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, Trp;

a VL CDR1 having the amino acid sequence SGSSSNIGX1X2TVN, wherein

X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, and He;

X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, and Gin;

a VL CDR2 having the amino acid sequence NNDX^PS, wherein

X1 is an amino acid selected from the group consisting of Lys, Arg, His, Gin, and Asn; and

a VL CDR3 having the amino acid sequence X1X X3DX4X5LX6GRV, wherein

X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;

X is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, and He;

X3 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, and Trp; X4 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;

X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Arg, Lys, and His;

X6 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala,

Val, Leu, He, Asn, and Gin.

Combinations of any of the foregoing or following are also contemplated, as are

combinations of any of these structural/sequence features with any of the functional features described herein. Particular examples of antibodies having these features are provided in Table 8 and/or represented in Figures 6-9, particularly for antibodies related to the ICM 10064 parent antibody.

In another aspect, the invention provides further examples of antibodies described based on consensus sequences. Particular examples of antibodies having the

structural/sequence features described below are provided in Table 8 and/or in Figures 6-9, particularly for antibodies related to the ICM10088 parent antibody. For example, the invention provides a purified or isolated human or chimeric antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL). The antibody or antibody fragment immuno specific ally binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and comprises:

a VH CDR1 having the amino acid sequence SYATN;

a VH CDR2 having the amino acid sequence WISAAX^ITNYGQKFQG, wherein

X1 is a neutral amino acid residue;

a VH CDR3 having the amino acid sequence TPFSENX1GX2X3X4X5MDV, wherein X1 is a basic or neutral amino acid residue;

X2 is a neutral amino acid residue;

X is a neutral amino acid residue;

X4 is an acidic or neutral amino acid residue;

X5 is a neutral amino acid residue.

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR2 having the amino acid sequence WISAAX^ITNYGQKFQG, wherein

XI is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, and Gin.

In certain embodiments, the antibody or antibody fragment comprises: a VH CDR2 having the amino acid sequence WIS A ANGITN YGQKFQG .

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR3 having the amino acid sequence TPFSENX1GX2X3X4X5MDV, wherein

X1 is a an amino acid selected from the group consisting of Ala, Arg, Lys, His,

Ser, Thr, Gly, Val, Leu, and lie;

X is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe;

X3 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Gin, and Asn;

X4 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Asp, Glu, Gin, and Asn;

X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala,

Val, Leu, He, Trp, Tyr, and Phe.

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR1 having the amino acid sequence SYATN;

a VH CDR2 having the amino acid sequence WISAAX^ITNYGQKFQG, wherein

XI is a an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, and Gin; and

a VH CDR3 having the amino acid sequence TPFSENX 1GX X3X4X MDV, wherein X1 is a an amino acid selected from the group consisting of Ala, Arg, Lys, His, Ser, Thr, Gly, Val, Leu, and He;

X2 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe;

X is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Gin, and Asn;

X4 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Asp, Glu, Gin, and Asn;

X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala,

Val, Leu, He, Trp, Tyr, and Phe.

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR1 having the amino acid sequence SYATN;

a VH CDR2 having the amino acid sequence WISAAX^ITNYGQKFQG, wherein

XI is an amino acid selected from Asn and Ser; and

a VH CDR3 having the amino acid sequence TPFSENX 1GX2X3X4X5MDV, wherein X is an amino acid selected from the group consisting of Ala and Arg;

X2 is an amino acid selected from the group consisting of Leu, Tyr, and Phe;

X is an amino acid selected from the group consisting of Tyr, Phe, and Gin;

X4 is an amino acid selected from the group consisting of Tyr and Glu;

X5 is an amino acid selected from the group consisting of Tyr and Phe.

In certain embodiments, the antibody or antibody fragment comprises:

a VL CDR1 having the amino acid sequence S GS GS NIGS NT VN ;

a VL CDR2 having the amino acid sequence NNGQRPS ; and

a VL CDR3 having the amino acid sequence ASWODXlX2X3X4X5X6, wherein X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala,

Val, Leu, He, Met, Arg, His, and Lys;

X is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, Gin, Asp, and Glu;

X3 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, Trp, Asn, and Gin;

X4 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;

X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Tyr, Trp, Phe, Arg, His, and Lys;

X6 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala,

Val, Leu, He, Asn, Gin, Glu, Asp, Arg, His, and Lys.

In certain embodiments, the antibody or antibody fragment comprises:

a VL CDR1 having the amino acid sequence S GS GS NIGS NT VN ;

a VL CDR2 having the amino acid sequence NNGQRPS ; and

a VL CDR3 having the amino acid sequence ASWDDX^x x^6, wherein

XI is an amino acid selected from the group consisting of Ser, Leu, Met, Arg, and His;

X2 is an amino acid selected from the group consisting of Ser, Thr, Leu, Asn, and Asp;

X is an amino acid selected from the group consisting of Leu, Trp, and Asn;

X4 is an amino acid selected from the group consisting of Gly, Ser, Asp, and Asn;

X5 is an amino acid selected from the group consisting of Phe, Arg, and His; X6 is an amino acid selected from the group consisting of Val, Leu, Glu, and Arg.

Also provided, a purified or isolated human or chimeric antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL). The antibody or antibody fragment immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM- 1 to LFA1, and comprises:

a VH CDR1 having the amino acid sequence SYATN;

a VH CDR2 having the amino acid sequence WISAAX^ITNYGQKFQG, wherein X1 is a neutral amino acid residue;

a VH CDR3 having the amino acid sequence TPFSENX'GX^x MDV, wherein X1 is a basic or neutral amino acid residue;

X2 is a neutral amino acid residue;

X3 is a neutral amino acid residue;

X4 is an acidic or neutral amino acid residue;

X5 is a neutral amino acid residue;

a VL CDR1 having the amino acid sequence SGSGSNIGSNTVN;

a VL CDR2 having the amino acid sequence NNGQRPS; and

a VL CDR3 having the amino acid sequence ASWDDX^^X^X6, wherein

X1 is a neutral or basic amino acid residue;

X is a neutral or acidic amino acid residue;

X3 is a neutral amino acid residue;

X4 is a neutral or acidic amino acid residue;

X5 is a neutral or basic amino acid residue;

X6 is any amino acid residue.

In certain embodiments, antibody or antibody fragment comprises

a VH CDR1 having the amino acid sequence SYATN;

a VH CDR2 having the amino acid sequence WISAAX^ITNYGQKFQG, wherein

XI is an amino acid sequence from the group consisting of Ser. Thr, Leu, He, Val, Gly, Asn, and Gin;

a VH CDR3 having the amino acid sequence TPFSENX1GX2X3X4X5MDV, wherein X1 is a an amino acid selected from the group consisting of Ala, Arg, Lys, His, Ser, Thr, Gly, Val, Leu, and lie; X2 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe;

X is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Gin, and Asn;

X4 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala,

Val, Leu, He, Trp, Tyr, Phe, Asp, Glu, Gin, and Asn;

X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala,

Val, Leu, He, Trp, Tyr, and Phe;

a VL CDR1 having the amino acid sequence S GS GS NIGS NT VN ;

a VL CDR2 having the amino acid sequence NNGQRPS; and

a VL CDR3 having the amino acid sequence ASWDDX^x x^6, wherein

XI is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Met, Arg, His, and Lys;

X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, Gin, Asp, and Glu;

X3 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, Trp, Asn, and Gin;

X4 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;

X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala,

Val, Leu, He, Tyr, Trp, Phe, Arg, His, and Lys;

X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Glu, Asp, Arg, His, and Lys.

Also provided, a purified or isolated human or chimeric antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL). The antibody or antibody fragment immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and comprises:

a VL CDR1 having the amino acid sequence S GS GS NIGS NT VN ;

a VL CDR2 having the amino acid sequence NNGQRPS ; and

a VL CDR3 having the amino acid sequence ASWDDX^x x^6, wherein

X1 is a neutral or basic amino acid residue;

X is a neutral or acidic amino acid residue;

X3 is a neutral amino acid residue; X4 is a neutral or acidic amino acid residue;

X5 is a neutral or basic amino acid residue;

X6 is any amino acid residue.

In certain embodiments, the antibody or antibody fragment comprises

a VL CDR3 having the amino acid sequence ASWDDX^x x^6, wherein

X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Met, Arg, His, and Lys;

X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, Gin, Asp, and Glu;

X3 is an amino acid selected from the group consisting of He, Ser, Thr, Gly,

Ala, Val, Leu, Phe, Tyr, Trp, Asn, and Gin;

X4 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;

X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Phe, Tyr, Trp, Arg, Lys, and His;

X6 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, Gin, Asp, Glu, Arg, Lys, and His.

In certain embodiments, the antibody or antibody fragment comprises

a VL CDR3 having the amino acid sequence ASWDDX^x x^6, wherein X1 is an amino acid selected from the group consisting of Ser, Leu, Met, Arg, and His;

X2 is an amino acid selected from the group consisting of Ser, Thr, Leu, Asn, and Asp;

X is an amino acid selected from the group consisting of Leu, Trp, and Asn; X4 is an amino acid selected from the group consisting of Gly, Ser, Asp, and

Asn;

X5 is an amino acid selected from the group consisting of Phe, Arg, and His; X5 is an amino acid selected from the group consisting of Val, Leu, Glu, and Arg.

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR1 having the amino acid sequence SYATN;

a VH CDR2 having the amino acid sequence WISAAX^ITNYGQKFQG, wherein

XI is a neutral amino acid residue; and

a VH CDR3 having the amino acid sequence TPFSENX^X^X^MDV, wherein X is a basic or neutral amino acid residue;

2

X is a neutral amino acid residue;

X is a neutral amino acid residue;

X4 is an acidic or neutral amino acid residue;

X5 is a neutral amino acid residue.

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR1 having the amino acid sequence SYATN;

a VH CDR2 having the amino acid sequence WISAANGITNYGQKFQG; and a VH CDR3 having the amino acid sequence TPFSENX'GX^X^MDV, wherein X1 is a basic or neutral amino acid residue;

X is a neutral amino acid residue;

X is a neutral amino acid residue;

X4 is an acidic or neutral amino acid residue;

X5 is a neutral amino acid residue.

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR1 having the amino acid sequence SYATN;

a VH CDR2 having the amino acid sequence WISAAX'GITNYGQKFQG, wherein

XI is an amino acid selected from the group consisting of Ala, Ser, Thr, Val, Gly, Leu, He, Asn, and Gin; and

a VH CDR3 having the amino acid sequence TPFSENX'GX^X^MDV, wherein

X1 is a an amino acid selected from the group consisting of Ala, Arg, Lys, His, Ser, Thr, Gly, Val, Leu, and lie;

X is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe;

X3 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala,

Val, Leu, He, Trp, Tyr, Phe, Gin, and Asn;

X4 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Asp, Glu, Gin, and Asn;

X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe.

In certain embodiments, the antibody or antibody fragment comprises:

a VH CDR1 having the amino acid sequence SYATN;

a VH CDR2 having the amino acid sequence WISAAX'GITNYGQKFQG, wherein

XI is an amino acid selected from the group consisting of Ser and Asn; and a VH CDR3 having the amino acid sequence TPFSENX^X^X^MDV, wherein X1 is a an amino acid selected from the group consisting of Ala and Arg; X is an amino acid selected from the group consisting of Leu, Tyr, and Phe; X3 is an amino acid selected from the group consisting of Tyr, Phe, and Gin; X4 is an amino acid selected from the group consisting of Tyr and Glu;

X5 is an amino acid selected from the group consisting of Tyr and Phe.

Combinations of any of the foregoing or following are also contemplated, as are

combinations of any of these structural/sequence features with any of the functional features described herein. Particular examples of antibodies having these features are provided in Table 8 and/or Figures 6-9, particularly for antibodies related to the ICM10088 parent antibody.

In certain embodiments, the anti-ICAM- 1 antibodies are isolated and/or purified and/or pyrogen free antibodies. The term "purified" as used herein, refers to other molecules, e.g. polypeptide, nucleic acid molecule that have been identified and separated and/or recovered from a component of its natural environment. Thus, in one embodiment the antibodies of the invention are purified antibodies wherein they have been separated from one or more components of their natural environment. The term "isolated antibody" as used herein refers to an antibody which is substantially free of other antibody molecules having different antigenic specificities (e.g., an isolated antibody that specifically binds to ICAM-1 is substantially free of antibodies that specifically bind antigens other than ICAM-1; however a bi- or multi- specific antibody molecule is an isolated antibody when substantially free of other antibody molecules). Thus, in one embodiment the antibodies of the invention are isolated antibodies wherein they have been separated from antibodies with a different specificity. Typically an isolated antibody is a monoclonal antibody. An isolated antibody that specifically binds to an epitope, isoform or variant of human ICAM-1 may, however, have cross-reactivity to other related antigens, e.g., from other species (e.g., ICAM-1 species homologs). Moreover, an isolated antibody of the invention may be substantially free of one or more other cellular materials and/or chemicals and is herein referred to as an isolated and purified antibody. In one embodiment of the invention, a combination of "isolated" monoclonal antibodies relates to antibodies having different specificities and being combined in a well defined composition. Methods of production and purification/isolation of the anti- ICAM- 1 antibodies are described below in more detail. This definition similarly applies to antibody fragments. In certain embodiments, an antibody of the invention may be a humanized antibody, a chimeric antibody or a human antibody. The isolated antibodies and antibody fragments of the present invention comprise antibody amino acid sequences disclosed herein encoded by any suitable polynucleotide, or any isolated or formulated antibody. In one embodiment, the anti-ICAM- 1 antibody binds human ICAM-1 and, thereby partially or substantially alters at least one biological activity of the ICAM-1 (e.g. receptor binding, catalytic activity, etc). The anti-ICAM- 1 antibodies of the invention immunospecifically bind at least one specified epitope specific to the ICAM-1 protein, peptide, subunit, fragment, portion or any combination thereof and do not specifically bind to other polypeptides. The at least one epitope can comprise at least one antibody binding region that comprises at least one portion of the ICAM-1 protein. The term "epitope" as used herein refers to a protein determinant capable of binding to an antibody. Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural

characteristics, as well as specific charge characteristics. Conformational and non- conformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.

In certain embodiments, the epitope is comprised of at least one extracellular, soluble, hydrophilic, external or cytoplasmic portion of human ICAM-1. The at least one specified epitope can comprise any combination of at least one amino acid sequence of at least 3 amino acid residues to the entire specified portion of contiguous amino acids of SEQ ID NO:481 and/or Genbank Accession Number: P05362. In one embodiment, the epitope is at least 4 amino acid residues, at least 5 amino acid residues, at least 6 amino acid residues, at least 7 amino acid residues, at least 8 amino acid residues or at least 9 amino acid residues to the entire specified portion of contiguous amino acids of the (SEQ ID NO:481 and/or Genbank Accession Number: P05362). In certain embodiments, the epitope can comprise any combination of at least one amino acid sequence of at least 3 amino acid residues to the entire specified portion of contiguous amino acids of SEQ ID NO:482. Specific amino acids known to be involved in HRV binding to ICAM-1 are shown in Figure 4 of Bella et al., PNAS, 95(8): 4140-4145 (1998), incorporated by reference herein in its entirety. In certain embodiments, the epitope is at least 4 amino acid residues, at least 5 amino acid residues, at least 6 amino acid residues, at least 7 amino acid residues, at least 8 amino acid residues or at least 9 amino acid residues to the entire specified portion of contiguous amino acids of the known HRV binding region specified in Bella et al. In certain embodiments, the epitope can comprise any combination of at least one amino acid sequence of at least 3 amino acid residues to the entire specified portion of contiguous amino acids of the known HRV binding regions specified in Bella et al.. In certain embodiments, an anti-ICAM antibody or antibody fragment of the present invention binds immunospecifically to human ICAM-1 and also binds immunospecifically to ICAM- 1 from one or more mouse, rat, and cynomolgous monkey. In other embodiments, an anti-ICAM antibody or antibody fragment of the present invention binds immunospecifically to human ICAM-1 but does not bind immunospecifically to mouse and/or rat ICAM- 1. In other embodiments, an anti-ICAM antibody or antibody fragment of the present invention binds immunospecifically to human IC AM- 1 but does not bind immunospecifically to cynomolgous ICAM-1.

Thus, in a specific embodiment the isolated/purified anti-ICAM- 1 antibodies of the invention immunospecifically bind to ICAM-1 having the amino acid sequence according to SEQ ID. NO. 481. In certain embodiments, the anti-ICAM- 1 antibodies of the invention also bind ICAM- 1 homologs or orthologs from different species. The species cross-reactive characteristics of the present antibodies are described below in more detail. The foregoing description applies equally to antibodies and antibody fragments of the invention. In certain embodiments, an antibody of the invention may be a humanized antibody, a chimeric antibody or a human antibody. In certain embodiments, the antibody or antibody fragment is a human antibody or antibody fragment that binds immunospecifically to human ICAM-1 (and optionally IC AM- 1 from one or more additional species) and inhibits binding of ICAM- 1 to human rhinovirus, but which antibody or antibody fragment does not substantially inhibit binding of human ICAM-1 to LFA-1 and/or MAC-1. Thus, in certain embodiments, the epitope specifically bound by the anti-ICAM- 1 antibody or antibody fragment is such that an antibody or antibody fragment binding said antibody is capable of having the foregoing characteristics.

(a) Variable Regions

As used herein, the term "parent antibody" refers to an antibody which is encoded by an amino acid sequence used for the preparation of the variant or derivative, defined herein. The parent polypeptide may comprise a native antibody sequence (z. e. , a naturally occurring, including a naturally occurring allelic variant) or an antibody sequence with pre-existing amino acid sequence modifications (such as other insertions, deletions and/or substitutions) of a naturally occurring sequence. The parent antibody may be a humanized antibody, a chimeric antibody or a human antibody. In a specific embodiment, the anti-ICAM- 1 antibodies are variants of the parent antibody. As used herein, the term "variant" refers to an anti-ICAM- 1 antibody, which differs in amino acid sequence from a "parent" anti-ICAM- 1 antibody amino acid sequence by virtue of addition, deletion and/or substitution of one or more amino acid residue(s) in the parent antibody sequence. Such variants of the parental antibody retain the ability of the parent antibody to immunospecifically bind human ICAM- 1. However, in certain embodiments, the variants are improved in some manner relative to the parent antibody. For example, the variant antibodies may bind human ICAM-1 with higher affinity, may cross-react with ICAM-1 from one or more non-human animal, or may show even lower activity versus a binding site for LFA-1 and/or MAC-1.

The antigen-binding portion of an antibody comprises one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., ICAM-1). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed within the term "antigen- binding portion" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., (1989) Nature 341:544-546), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR). Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single chain antibodies are also intended to be encompassed within the term "antigen-binding portion" of an antibody. These antibody fragments are obtained using conventional techniques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies. Antigen-binding portions can be produced by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact immunoglobulins .

The present anti-ICAM-1 antibodies comprise at least one antigen binding domain. In one embodiment, the anti-IC AM- 1 antibodies comprise a VH having the amino acid sequence of SEQ ID NO.2. In another embodiment, the anti-ICAM-1 antibodies comprise a VL having the amino acid sequence of SEQ ID NO. 7. In yet another embodiment, the anti- ICAM-1 antibodies comprise a VH having the amino acid sequence of SEQ ID NO. 2 and a VL having the amino acid sequence of SEQ ID NO. 7. See Table 8 for a representation of VH and VL sequences encompassed in the present invention which can be present in any combination to form a present anti-ICAM-1 antibody. In certain embodiments, an anti- ICAM- 1 antibody of the invention comprises a combination of any of the VH and VL sequences according to Table 8, where in the antibody inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA and/or MAC-1. In one embodiment, the VH is selected from (SEQ ID NO: 12, 22, 32, 42, 52, 62, 72, 82, 92, 102, 112, 122, 132, 142, 152, 162, 172, 182, 192, 202, 212, 222, 232, 242, 252, 262, 272, 282, 292, 302 and 312). In another embodiment, the VL is selected from (SEQ ID NO: 17. 27, 37, 47, 57, 67, 77, 87, 97, 107, 117, 127, 137, 147, 157, 167, 177, 187, 197, 207, 217, 227, 237, 247, 257, 267, 277, 287, 297, 307 and 317). In certain

embodiments, the anti-ICAM-1 antibodies are human or chimeric antibodies or antibody fragments. In certain embodiments, the anti-ICAM-1 antibodies are human antibodies or antibody fragments. In certain embodiments, the anti-ICAM-1 antibodies are human or chimeric antibodies or antibody fragments that immunospecifically bind to human ICAM-1 and inhibit binding of human ICAM-1 to human rhinovirus, but do not substantially inhibit binding of human ICAM-1 to LFA and/or MAC-1.

In certain embodiments, the purified anti-ICAM-1 antibodies comprise a VH and/or VL that has a given percent identify to at least one of the VH and/or VL sequences disclosed in Table 8. As used herein, the term "percent (%) sequence identity", also including

"homology" is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical with the amino acid residues or nucleotides in the reference sequences, such as parent antibody sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Optimal alignment of the sequences for comparison may be produced, besides manually, by means of the local homology algorithm of Smith and Waterman, 1981, Ads App. Math. 2, 482, by means of the local homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, by means of the similarity search method of Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 85, 2444, or by means of computer programs which use these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.).

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VH amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 2. In a further embodiment, the anti-IC AM- 1 antibody comprising a VH amino acid sequence with a given percent identify to SEQ ID NO: 2 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-ICAM-1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 2. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VL amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 7. In a further

embodiment, the anti-IC AM- 1 antibody comprising a VL amino acid sequence with a given percent identify to SEQ ID NO: 7 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-ICAM- 1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 7. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment a purified antibody of the invention immunospecifically binds ICAM- 1 and comprises a heavy chain variable domain having at least 90% identity to the amino acid of SEQ ID NO:2 and comprises a light chain variable domain having at least 90% identity to the amino acid sequence of SEQ ID NO:7, wherein said antibody

immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, and wherein said antibody is a human or chimeric antibody that does not substantially inhibit binding of human ICAM-1 to LFA1. In certain embodiments, the anti- ICAM- 1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 2. In certain embodiments, the anti-ICAM- 1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 7. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-ICAM- 1 antibodies comprise a VH amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 12. In a further embodiment, the anti-IC AM- 1 antibody comprising a VH amino acid sequence with a given percent identify to SEQ ID NO: 12 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-IC AM- 1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 12. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VL amino acid sequence having at 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 17. In a further embodiment, the anti-IC AM- 1 antibody comprising a VL amino acid sequence with a given percent identify to SEQ ID NO: 17 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection; (b) immuno specifically binds to human ICAM-1 with an affinity ( D) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-ICAM-1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 17. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment a purified antibody of the invention immunospecifically binds ICAM- 1 and comprises a heavy chain variable domain having at least 90% identity to the amino acid of SEQ ID NO: 12 and comprises a light chain variable domain having at least 90% identity to the amino acid sequence of SEQ ID NO: 17, wherein said antibody immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, and wherein said antibody is a human or chimeric antibody that does not substantially inhibit binding of human ICAM-1 to LFA1. In certain embodiments, the anti- ICAM-1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 12. In certain embodiments, the anti-ICAM-1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 17. In certain embodiments, the substitutions are conservative amino acid substitutions. In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VH amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 22. In a further embodiment, the anti-IC AM- 1 antibody comprising a VH amino acid sequence with a given percent identify to SEQ ID NO: 22 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a

VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-ICAM-1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 22. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VL amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 27. In a further embodiment, the anti-IC AM- 1 antibody comprising a VL amino acid sequence with a given percent identify to SEQ ID NO: 27 has one or more characteristics (described in more detail below) selected from the group consisting of: (a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-ICAM-1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 27. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment a purified antibody of the invention immunospecifically binds ICAM- 1 and comprises a heavy chain variable domain having at least 90% identity to the amino acid of SEQ ID NO:22 and comprises a light chain variable domain having at least 90% identity to the amino acid sequence of SEQ ID NO:27, wherein said antibody immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, and wherein said antibody is a human or chimeric antibody that does not substantially inhibit binding of human ICAM- 1 to LFA1. In certain embodiments, the anti- ICAM-1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO:22. In certain embodiments, the anti-ICAM- 1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 27. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VH amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 32. In a further embodiment, the anti-IC AM- 1 antibody comprising a VH amino acid sequence with a given percent identify to SEQ ID NO: 32 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-IC AM- 1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 32. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VL amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 37. In a further embodiment, the anti-IC AM- 1 antibody comprising a VL amino acid sequence with a given percent identify to SEQ ID NO: 37 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-ICAM-1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 37. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment a purified antibody of the invention immunospecifically binds ICAM- 1 and comprises a heavy chain variable domain having at least 90% identity to the amino acid of SEQ ID NO:32 and comprises a light chain variable domain having at least 90% identity to the amino acid sequence of SEQ ID NO:37, wherein said antibody immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, and wherein said antibody is a human or chimeric antibody that does not substantially inhibit binding of human ICAM-1 to LFA1. In certain embodiments, the anti- ICAM-1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 32. In certain embodiments, the anti-ICAM-1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 37. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VH amino acid sequence having at 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 242. In a further

embodiment, the anti-IC AM- 1 antibody comprising a VH amino acid sequence with a given percent identify to SEQ ID NO: 242 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-ICAM-1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 242. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VL amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 247. In a further embodiment, the anti-IC AM- 1 antibody comprising a VL amino acid sequence with a given percent identify to SEQ ID NO: 247 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-ICAM-1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 247. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment a purified antibody of the invention immunospecifically binds ICAM- 1 and comprises a heavy chain variable domain having at least 90% identity to the amino acid of SEQ ID NO:242 and comprises a light chain variable domain having at least 90% identity to the amino acid sequence of SEQ ID NO:247, wherein said antibody immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, and wherein said antibody is a human or chimeric antibody that does not substantially inhibit binding of human ICAM- 1 to LFA1. In certain embodiments, the anti- ICAM-1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 242. In certain embodiments, the anti-IC AM- 1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 247. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VH amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 252. In a further embodiment, the anti-IC AM- 1 antibody comprising a VH amino acid sequence with a given percent identify to SEQ ID NO: 252 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity ( D) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-IC AM- 1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 252. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VL amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 257. In a further embodiment, the anti-IC AM- 1 antibody comprising a VL amino acid sequence with a given percent identify to SEQ ID NO: 257 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-IC AM- 1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 257. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment a purified antibody of the invention immunospecifically binds ICAM- 1 and comprises a heavy chain variable domain having at least 90% identity to the amino acid of SEQ ID NO:252 and comprises a light chain variable domain having at least 90% identity to the amino acid sequence of SEQ ID NO:257, wherein said antibody immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, and wherein said antibody is a human or chimeric antibody that does not substantially inhibit binding of human ICAM- 1 to LFA1. In certain embodiments, the anti- ICAM-1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 252. In certain embodiments, the anti-IC AM- 1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 257. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VH amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 282. In a further embodiment, the anti-IC AM- 1 antibody comprising a VH amino acid sequence with a given percent identify to SEQ ID NO: 282 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a

VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-IC AM- 1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 282. In certain embodiments, the substitutions are conservative amino acid substitutions. In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VL amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 287. In a further embodiment, the anti-IC AM- 1 antibody comprising a VL amino acid sequence with a given percent identify to SEQ ID NO: 287 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a

VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-ICAM-1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 287. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment a purified antibody of the invention immunospecifically binds ICAM- 1 and comprises a heavy chain variable domain having at least 90% identity to the amino acid of SEQ ID NO:282 and comprises a light chain variable domain having at least 90% identity to the amino acid sequence of SEQ ID NO:287, wherein said antibody immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, and wherein said antibody is a human or chimeric antibody that does not substantially inhibit binding of human ICAM- 1 to LFA1. In certain embodiments, the anti- ICAM-1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 282. In certain embodiments, the anti-IC AM- 1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 287. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VH amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 292. In a further embodiment, the anti-IC AM- 1 antibody comprising a VH amino acid sequence with a given percent identify to SEQ ID NO: 292 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-IC AM- 1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 292. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VL amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 297. In a further embodiment, the anti-IC AM- 1 antibody comprising a VL amino acid sequence with a given percent identify to SEQ ID NO: 297 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-IC AM- 1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 297. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment a purified antibody of the invention immunospecifically binds ICAM- 1 and comprises a heavy chain variable domain having at least 90% identity to the amino acid of SEQ ID NO:292 and comprises a light chain variable domain having at least 90% identity to the amino acid sequence of SEQ ID NO:297, wherein said antibody immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, and wherein said antibody is a human or chimeric antibody that does not substantially inhibit binding of human ICAM- 1 to LFA1. In certain embodiments, the anti- ICAM-1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 292. In certain embodiments, the anti-ICAM-1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 297. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-ICAM-1 antibodies comprise a VH amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 302. In a further embodiment, the anti-IC AM- 1 antibody comprising a VH amino acid sequence with a given percent identify to SEQ ID NO: 302 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics. In certain embodiments, the anti-ICAM- 1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 302. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-ICAM- 1 antibodies comprise a VL amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 307. In a further embodiment, the anti-ICAM- 1 antibody comprising a VL amino acid sequence with a given percent identify to SEQ ID NO: 307 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity ( D) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-ICAM- 1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 307. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment a purified antibody of the invention immunospecifically binds ICAM- 1 and comprises a heavy chain variable domain having at least 90% identity to the amino acid of SEQ ID NO:302 and comprises a light chain variable domain having at least 90% identity to the amino acid sequence of SEQ ID NO:307, wherein said antibody immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, and wherein said antibody is a human or chimeric antibody that does not substantially inhibit binding of human ICAM-1 to LFA1. In certain embodiments, the anti- ICAM-1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 302. In certain embodiments, the anti-IC AM- 1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 307. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-IC AM- 1 antibodies comprise a VH amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 312. In a further embodiment, the anti-IC AM- 1 antibody comprising a VH amino acid sequence with a given percent identify to SEQ ID NO: 312 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-ICAM- 1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 312. In certain embodiments, the substitutions are conservative amino acid substitutions.

In a specific embodiment, the anti-ICAM- 1 antibodies comprise a VL amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 317. In a further embodiment, the anti-ICAM- 1 antibody comprising a VL amino acid sequence with a given percent identify to SEQ ID NO: 317 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the anti-ICAM- 1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 317. In certain embodiments, the substitutions are conservative amino acid substitutions. In a specific embodiment a purified antibody of the invention immunospecifically binds ICAM- 1 and comprises a heavy chain variable domain having at least 90% identity to the amino acid of SEQ ID NO:312 and comprises a light chain variable domain having at least 90% identity to the amino acid sequence of SEQ ID NO:317, wherein said antibody immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, and wherein said antibody is a human or chimeric antibody that does not substantially inhibit binding of human ICAM-1 to LFA1. In certain embodiments, the anti- ICAM-1 antibodies comprise a heavy chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 312. In certain embodiments, the anti-ICAM-1 antibodies comprise a light chain variable domain having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid residue substitutions relative to SEQ ID NO: 317. In certain embodiments, the substitutions are conservative amino acid substitutions.

In certain embodiments, an anti-ICAM-1 antibody or antibody fragment of the invention comprises heavy and light chain variable domains that are in accordance with the ICM10064 and/or ICM10088 antibody family consensus sequences, SEQ ID NO: 321-322 and 323-324, respectively. In certain embodiments, an anti-ICAM-1 antibody or antibody fragment of the invention comprises: a VH comprising the amino acid sequence of SEQ ID NO: 321 and a VL comprising the amino acid sequence of SEQ ID NO: 322. In certain embodiments, an anti-ICAM-1 antibody or antibody fragment of the invention comprises: a VH comprising the amino acid sequence of SEQ ID NO: 323 and a VL comprising the amino acid sequence of SEQ ID NO: 324. In certain embodiments, an anti-ICAM-1 antibody or antibody fragment of the invention comprises: a VH comprising the amino acid sequence of SEQ ID NO: 321 and a VL comprising the amino acid sequence of SEQ ID NO: 324. In certain embodiments, an anti-ICAM- 1 antibody or antibody fragment of the invention comprises: a VH comprising the amino acid sequence of SEQ ID NO: 323 and a VL comprising the amino acid sequence of SEQ ID NO: 322. In certain embodiments, said antibody or antibody fragment immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1. In certain embodiments, said antibody or antibody fragment is a human or chimeric antibody or antibody fragment. In certain embodiments, said antibody or antibody fragment has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immuno specifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

For any of the foregoing, the invention contemplates that such variable domains may themselves be used as the anti-ICAM- 1 antibodies in the form of an antibody fragment. However, it is also contemplated, for any of the foregoing, that such variable domains, provided in any combination, may be present as part of a larger antibody, such as an antibody comprising an Fc region.

The foregoing description applies equally to antibodies and antibody fragments of the invention. Moreover, the invention contemplates antibodies and antibody fragments having any combination of the structural and/or functional features described herein. Further, the various VH and VL domains described above can be described with other features of the invention described herein. Any such anti-ICAM- 1 antibodies and antibody fragments can be used in any of the methods described herein, such as in a method for preventing HRV infection of a cell and/or in a method of preventing or treating exacerbation of symptoms of COPD or other respiratory condition. Additionally, or optionally, Any such anti-ICAM- 1 antibodies and antibody fragments can be used in any of the methods described herein, such as in a method for preventing CV-A infection of a cell and/or preventing adhesion of Plasmodium falciparum infected erythrocytes to the vascular endothelium and/or in a method of preventing or treating exacerbation of symptoms of CV-A infection and/or preventing or treating exacerbation of symptoms mediated by adhesion of Plasmodium falciparum infected erythrocytes to the vascular endothelium.

Note that certain of the VH and VL domains provided in the sequence listing may correspond to the same amino acid sequence. They are provided separately to illustrate the experimental results, as well as the relationships among certain antibodies identified.

However, when a sequence identifier is used to describe the sequence of a particular antibody, it should be understood, unless otherwise specified, to refer to the underlying sequence itself without requiring or assuming a source of that sequence. (b) Complementarity Determining Regions (CDRs)

While the variable domain (VH and VL) comprises the antigen-binding region; the variability is not evenly distributed through the variable domains of antibodies. It is concentrated in segments called Complementarity Determining Regions (CDRs), both in the light chain (VL or VK) and the heavy chain (VH) variable domains. The more highly conserved portions of the variable domains are called the framework regions (FR). The variable domains of native heavy and light chains each comprise four FR, largely adopting a β-sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the β-sheet structure. The CDRs in each chain are held together in close proximity by the FR and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see, Kabat et al., Supra). The three CDRs of the heavy chain are designated CDR-H1, CDR-H2, and CDR-H3, and the three CDRs of the light chain are designated CDR-Ll, CDR-L2, and CDR-L3. The Kabat numbering system is used herein. As such, CDR-H1 begins at approximately amino acid 31 (i.e., approximately 9 residues after the first cysteine residue), includes approximately 5-7 amino acids, and ends at the next tyrosine residue. CDR-H2 begins at the fifteenth residue after the end of CDR- Hl, includes approximately 16-19 amino acids, and ends at the next arginine or lysine residue. CDR-H3 begins at approximately the thirty third amino acid residue after the end of CDR-H2; includes 3-25 amino acids; and ends at the sequence W-G-X-G, where X is any amino acid. CDR-Ll begins at approximately residue 24 (i.e., following a cysteine residue); includes approximately 10- 17 residues; and ends at the next tyrosine residue. CDR-L2 begins at approximately the sixteenth residue after the end of CDR-Ll and includes approximately 7 residues. CDR-L3 begins at approximately the thirty third residue after the end of CDR-L2; includes approximately 7-11 residues and ends at the sequence F-G-X-G, where X is any amino acid. Note that CDRs vary considerably from antibody to antibody (and by definition will not exhibit homology with the Kabat consensus sequences).

The present anti-IC AM- 1 antibodies and antibody fragments comprise at least one antigen binding domain that comprises at least one complementarity determining region (CDRl, CDR2 and CDR3). In one embodiment, the anti-ICAM-1 antibodies comprise a VH that comprises at least one VH CDR (e.g., CDR-H1, CDR-H2 or CDR-H3). In another embodiment, the anti-IC AM- 1 antibodies comprise a VL that comprises at least one VL CDR (e.g., CDR-L1, CDR-L2 or CDR-L3).

In certain embodiments, an anti-ICAM-1 antibody or antibody fragment of the invention comprises a combination of any CDR-H1 sequence of Table 8, any CDR-H2 sequence of Table 8, any CDR-H3 sequence of Table 8, any CDR-L1 sequence of Table 8, any CDR-L2 sequence of Table 8 and any CDR-L3 sequence of Table 8, where in the antibody inhibits binding of human ICAM-1 to rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA and/or MAC-1. See e.g., Table 8 and/or Figures 6-9 for a representation of VH CDRl, VH CDR2, VH CDR3, VL CDRl, VL CDR2 and VL CDR3 sequences encompassed by the present invention which can be present in any combination to form a present anti-ICAM-1 antibody. In one embodiment, the VH CDRl is selected from (SEQ ID NO: 3, 13, 23, 33, 43, 53, 63, 73, 83, 93, 103, 113, 123, 133, 143, 153, 163, 173, 183, 193, 203, 213, 223, 233, 243, 253, 263, 273, 283, 293, 303 and 313), the VH CDR2 is selected from (SEQ ID NO: 4, 14, 24, 34, 44, 54, 64, 74, 84, 94, 104, 114, 124, 134, 144,

154, 164, 174, 184, 194, 204, 214, 224, 234, 244, 254, 264, 274, 284, 294, 304 and 314) and the VH CDR3 is selected from (SEQ ID NO: 5, 15, 25, 35, 45, 55, 65, 75, 85, 95, 105, 115, 125, 135, 145, 155, 165, 175, 185, 195, 205, 215, 225, 235, 245, 255, 265, 275, 285, 295, 305 and 315). In another embodiment, VL CDRl is selected from (SEQ ID NO: 8, 18, 28, 38, 48, 58, 68, 78, 88, 98, 108, 118, 128, 138, 148, 158, 168, 178, 188, 198, 208, 218, 228, 238, 248, 258, 268, 278, 288, 298, 308 and 318), the VL CDR2 is selected from (SEQ ID NO: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99, 109, 119, 129, 139, 149, 159, 169, 179, 189, 199, 209, 219, 229, 239, 249, 259, 269, 279, 289, 299, 309 and 319) and the VL CDR3 is selected from (SEQ ID NO: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, and 320).

In certain embodiments, an anti-ICAM-1 antibody of the invention comprises a VH and a VL region, wherein the CDR-H1, CDR-H2 CDR-H3, CDR-L1, CDR-L2 and CDR-L3 have the amino acid sequence of an antibody selected from the group of antibodies consisting of: ICM10064, ICM10064fgl, IcmoOOH, Icmo0015, Icmo0016, Icmo0017, Icmo0018, Icmo0069, Icmo0070, Icmo0070_SGR, Icmo0072, Icmo0075, Icmo0079, Icmo0181, Icmo0183, Icmo0183fgl, Icmo0188, Icmo0189, Icmo0191, Icmo0191fgl, Icmo0194, Icmo0194fgl, ICM10088, ICM10088fgl, Icmo0004, Icmo0008, Icmo0007, Icmo0059, Icmo0060, Icmo0061, Icmo0066, and Icmo0068, having the SEQ ID NOs. as provided for in Table 8 and/or represented in Figures 6-9. In certain embodiments, said antibody is an antibody fragment. In certain embodiments, said antibody is a human, humanized or chimeric antibody.

In certain embodiments, the anti-ICAM- 1 antibodies comprise a VH CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 3, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 4 and a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, or 5 amino acid residue substitutions relative to SEQ ID NO: 5. In another embodiment, the anti-ICAM- 1 antibodies comprise a VL CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 8, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 9 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, or 5 amino acid residue substitutions relative to SEQ ID NO: 10. In certain embodiments, the anti-ICAM- 1 antibodies comprise a VH CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 3, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 4, a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 5, a VL CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 8, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 9 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 10. In a specific embodiment, the anti-ICAM- 1 antibody comprises (a) a VH CDRl having the amino acid sequence of SEQ ID NO: 3; (b) a VH CDR2 having the amino acid sequence of SEQ ID NO: 4; (c) a VH CDR3 having the amino acid sequence of SEQ ID NO: 5; (d) a VL CDRl having the amino acid sequence of SEQ ID NO: 8; (e) a VL CDR2 having the amino acid sequence of SEQ ID NO: 9; and (f) a VL CDR3 having the amino acid sequence of SEQ ID NO: 10. In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises (a) a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 3; (b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 4; (c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 5; (d) a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 8; (e) a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 9; and (f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, or 5 amino acid residue substitutions relative to SEQ ID NO: 10 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

It is well known in the art that VH CDR3 and VL CDR3 domains play an important role in the binding specificity/affinity of an antibody for an antigen (Xu and Davis, Immunity, 13: 37-45, 2000). Accordingly, in one embodiment the anti-ICAM-1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 5. In another embodiment, the anti-ICAM- 1 antibodies comprise a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 10. In yet another embodiment, the anti-ICAM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 5 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 10. The remaining portions of the anti-ICAM-1 antibodies (e.g. CDRl, CDR2, VH, VL, etc.) may comprise specific sequences disclosed herein or known sequences provided the anti-ICAM-1 antibodies

immuno specifically bind to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1 and/or MAC-1.

In certain embodiments, the anti-ICAM-1 antibodies comprise a VH CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 13, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 14 and a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, or 5 amino acid residue substitutions relative to SEQ ID NO: 15. In another embodiment, the anti-ICAM-1 antibodies comprise a VL CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 18, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 19 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 20.

In certain embodiments, the anti-ICAM-1 antibodies comprise a VH CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 13, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 14, a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 15, a VL CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 18, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 19 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 20. In a specific embodiment, the anti-IC AM- 1 antibody comprises (a) a VH CDR1 having the amino acid sequence of SEQ ID NO: 13; (b) a VH CDR2 having the amino acid sequence of SEQ ID NO: 14; (c) a VH CDR3 having the amino acid sequence of SEQ ID NO: 15; (d) a VL CDR1 having the amino acid sequence of SEQ ID NO: 18; (e) a VL CDR2 having the amino acid sequence of SEQ ID NO: 19; and (f) a VL CDR3 having the amino acid sequence of SEQ ID NO: 20.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises (a) a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 13; (b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 14; (c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 15; (d) a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 18; (e) a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 19; and (f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 20 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity ( D) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

It is well known in the art that VH CDR3 and VL CDR3 domains play an important role in the binding specificity/affinity of an antibody for an antigen (Xu and Davis, Immunity, 13: 37-45, 2000). Accordingly, in one embodiment the anti-ICAM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 15. In another embodiment, the anti-ICAM- 1 antibodies comprise a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 20. In yet another embodiment, the anti-ICAM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 15 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 20. The remaining portions of the anti-ICAM-1 antibodies (e.g. CDRl, CDR2, VH, VL, etc.) may comprise specific sequences disclosed herein or known sequences provided the anti-ICAM-1 antibodies

immuno specifically bind to ICAM-1.

In certain embodiments, the anti-ICAM-1 antibodies comprise a VH CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 23, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 24 and a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 25. In another embodiment, the anti-ICAM-1 antibodies comprise a VL CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 28, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 29 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 30.

In certain embodiments, the anti-ICAM-1 antibodies comprise a VH CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 23, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 24, a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 25, a VL CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 28, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 29 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 30 In a specific embodiment, the anti-IC AM- 1 antibody comprises (a) a VH CDR1 having the amino acid sequence of SEQ ID NO: 23; (b) a VH CDR2 having the amino acid sequence of SEQ ID NO: 24; (c) a VH CDR3 having the amino acid sequence of SEQ ID NO: 25; (d) a VL CDR1 having the amino acid sequence of SEQ ID NO: 28; (e) a VL CDR2 having the amino acid sequence of SEQ ID NO: 29; and (f) a VL CDR3 having the amino acid sequence of SEQ ID NO: 30.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises (a) a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 23; (b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 24; (c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 25; (d) a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 28; (e) a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 29; and (f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 30 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1; (i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

It is well known in the art that VH CDR3 and VL CDR3 domains play an important role in the binding specificity/affinity of an antibody for an antigen (Xu and Davis, Immunity, 13: 37-45, 2000). Accordingly, in one embodiment the anti-ICAM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 25. In another embodiment, the anti-ICAM- 1 antibodies comprise a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 30. In yet another embodiment, the anti-ICAM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 25 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 30. The remaining portions of the anti-ICAM-1 antibodies (e.g. CDR1, CDR2, VH, VL, etc.) may comprise specific sequences disclosed herein or known sequences provided the anti-ICAM-1 antibodies

immunospecifically bind to ICAM-1.

In certain embodiments, the anti-ICAM-1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 33, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 34 and a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 35. In another embodiment, the anti-ICAM-1 antibodies comprise a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 38, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 39 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 40.

In certain embodiments, the anti-ICAM-1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 33, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 34, a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 35, a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 38, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 39 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 40.

In a specific embodiment, the anti-IC AM- 1 antibody comprises (a) a VH CDR1 having the amino acid sequence of SEQ ID NO: 33; (b) a VH CDR2 having the amino acid sequence of SEQ ID NO: 34; (c) a VH CDR3 having the amino acid sequence of SEQ ID NO: 35; (d) a VL CDR1 having the amino acid sequence of SEQ ID NO: 38; (e) a VL CDR2 having the amino acid sequence of SEQ ID NO: 39; and (f) a VL CDR3 having the amino acid sequence of SEQ ID NO: 40.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises (a) a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 33; (b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 34; (c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 35; (d) a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 38; (e) a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 39; and (f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 40 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM; (e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

It is well known in the art that VH CDR3 and VL CDR3 domains play an important role in the binding specificity/affinity of an antibody for an antigen (Xu and Davis, Immunity, 13: 37-45, 2000). Accordingly, in one embodiment the anti-ICAM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 35. In another embodiment, the anti-ICAM- 1 antibodies comprise a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 40. In yet another embodiment, the anti-ICAM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 35 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 40. The remaining portions of the anti-ICAM-1 antibodies (e.g. CDR1, CDR2, VH, VL, etc.) may comprise specific sequences disclosed herein or known sequences provided the anti-ICAM-1 antibodies

immunospecifically bind to ICAM- 1.

In certain embodiments, the anti-ICAM-1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 243, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 244 and a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 245. In another embodiment, the anti-ICAM-1 antibodies comprise a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 248, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 249 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 250.

In certain embodiments, the anti-ICAM- 1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 243, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 244, a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 245, a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 248, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 249 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 250.

In a specific embodiment, the anti-ICAM- 1 antibody comprises (a) a VH CDR1 having the amino acid sequence of SEQ ID NO: 243; (b) a VH CDR2 having the amino acid sequence of SEQ ID NO: 244; (c) a VH CDR3 having the amino acid sequence of SEQ ID NO: 245; (d) a VL CDR1 having the amino acid sequence of SEQ ID NO: 248; (e) a VL CDR2 having the amino acid sequence of SEQ ID NO: 249; and (f) a VL CDR3 having the amino acid sequence of SEQ ID NO: 250.

In a further embodiment, the antibody of the invention immunospecifically binds

ICAM-1 and comprises (a) a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 243; (b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 244; (c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 245; (d) a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 248; (e) a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 249; and (f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 250 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection; (b) immuno specifically binds to human ICAM-1 with an affinity ( D) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

It is well known in the art that VH CDR3 and VL CDR3 domains play an important role in the binding specificity/affinity of an antibody for an antigen (Xu and Davis, Immunity, 13: 37-45, 2000). Accordingly, in one embodiment the anti-ICAM-1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 245. In another embodiment, the anti-ICAM-1 antibodies comprise a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ K) NO: 250. In yet another embodiment, the anti-IC AM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 245 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 250. The remaining portions of the anti-ICAM-1 antibodies (e.g. CDR1, CDR2, VH, VL, etc.) may comprise specific sequences disclosed herein or known sequences provided the anti-ICAM-1 antibodies immunospecifically bind to ICAM- 1.

In certain embodiments, the anti-ICAM-1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 253, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 254 and a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 255. In another embodiment, the anti-IC AM- 1 antibodies comprise a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 258, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 259 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 260.

In certain embodiments, the anti-IC AM- 1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 253, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 254, a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 255, a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 258, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 259 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 260.

In a specific embodiment, the anti-IC AM- 1 antibody comprises (a) a VH CDR1 having the amino acid sequence of SEQ ID NO: 253; (b) a VH CDR2 having the amino acid sequence of SEQ ID NO: 254; (c) a VH CDR3 having the amino acid sequence of SEQ ID NO: 255; (d) a VL CDR1 having the amino acid sequence of SEQ ID NO: 258; (e) a VL CDR2 having the amino acid sequence of SEQ ID NO: 259; and (f) a VL CDR3 having the amino acid sequence of SEQ ID NO: 260.

In a further embodiment, the antibody of the invention immunospecifically binds

ICAM-1 and comprises (a) a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 253; (b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 254; (c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 255; (d) a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 258; (e) a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 259; and (f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 260 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

It is well known in the art that VH CDR3 and VL CDR3 domains play an important role in the binding specificity/affinity of an antibody for an antigen (Xu and Davis, Immunity, 13: 37-45, 2000). Accordingly, in one embodiment the anti-ICAM-1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 255. In another embodiment, the anti-ICAM-1 antibodies comprise a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 260. In yet another embodiment, the anti-IC AM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 255 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 260. The remaining portions of the anti-ICAM- 1 antibodies (e.g. CDR1, CDR2, VH, VL, etc.) may comprise specific sequences disclosed herein or known sequences provided the anti-ICAM- 1 antibodies immuno specifically bind to ICAM-1.

In certain embodiments, the anti-ICAM- 1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 283, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 284 and a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 285. In another embodiment, the anti-ICAM- 1 antibodies comprise a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 288, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 289 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 290.

In certain embodiments, the anti-ICAM- 1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 283, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 284, a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 285, a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 288, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 289 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 290.

In a specific embodiment, the anti-ICAM- 1 antibody comprises (a) a VH CDR1 having the amino acid sequence of SEQ ID NO: 283; (b) a VH CDR2 having the amino acid sequence of SEQ ID NO: 284; (c) a VH CDR3 having the amino acid sequence of SEQ ID NO: 285; (d) a VL CDR1 having the amino acid sequence of SEQ ID NO: 288; (e) a VL CDR2 having the amino acid sequence of SEQ ID NO: 289; and (f) a VL CDR3 having the amino acid sequence of SEQ ID NO: 290.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises (a) a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 283; (b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 284; (c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 285; (d) a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 288; (e) a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 289; and (f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 290 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

It is well known in the art that VH CDR3 and VL CDR3 domains play an important role in the binding specificity/affinity of an antibody for an antigen (Xu and Davis, Immunity, 13: 37-45, 2000). Accordingly, in one embodiment the anti-ICAM-1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 285. In another embodiment, the anti-ICAM-1 antibodies comprise a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 290. In yet another embodiment, the anti-IC AM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 285 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 290. The remaining portions of the anti-ICAM-1 antibodies (e.g. CDR1, CDR2, VH, VL, etc.) may comprise specific sequences disclosed herein or known sequences provided the anti-ICAM-1 antibodies immuno specifically bind to ICAM-1.

In certain embodiments, the anti-ICAM-1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 293, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 294 and a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 295. In another embodiment, the anti-ICAM-1 antibodies comprise a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 298, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 299 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 300.

In certain embodiments, the anti-ICAM-1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 293, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 294, a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 295, a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 298, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 299 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 300.

In a specific embodiment, the anti-ICAM-1 antibody comprises (a) a VH CDR1 having the amino acid sequence of SEQ ID NO: 293; (b) a VH CDR2 having the amino acid sequence of SEQ ID NO: 294; (c) a VH CDR3 having the amino acid sequence of SEQ ID NO: 295; (d) a VL CDR1 having the amino acid sequence of SEQ ID NO: 298; (e) a VL CDR2 having the amino acid sequence of SEQ ID NO: 299; and (f) a VL CDR3 having the amino acid sequence of SEQ ID NO: 300.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises (a) a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 293; (b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 294; (c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 295; (d) a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 298; (e) a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 299; and (f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 300 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics. It is well known in the art that VH CDR3 and VL CDR3 domains play an important role in the binding specificity/affinity of an antibody for an antigen (Xu and Davis, Immunity, 13: 37-45, 2000). Accordingly, in one embodiment the anti-ICAM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 295. In another embodiment, the anti-ICAM- 1 antibodies comprise a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 300. In yet another embodiment, the anti-ICAM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 295 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 300. The remaining portions of the anti-ICAM- 1 antibodies (e.g. CDR1, CDR2, VH, VL, etc.) may comprise specific sequences disclosed herein or known sequences provided the anti-ICAM- 1 antibodies immuno specifically bind to ICAM-1.

In certain embodiments, the anti-ICAM- 1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 303, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 304 and a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 305. In another embodiment, the anti-ICAM-1 antibodies comprise a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 308, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 309 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 310.

In certain embodiments, the anti-ICAM-1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 303, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 304, a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 305, a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 308, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 309 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 310.

In a specific embodiment, the anti-IC AM- 1 antibody comprises (a) a VH CDR1 having the amino acid sequence of SEQ ID NO: 303; (b) a VH CDR2 having the amino acid sequence of SEQ ID NO: 304; (c) a VH CDR3 having the amino acid sequence of SEQ ID NO: 305; (d) a VL CDR1 having the amino acid sequence of SEQ ID NO: 308; (e) a VL CDR2 having the amino acid sequence of SEQ ID NO: 309; and (f) a VL CDR3 having the amino acid sequence of SEQ ID NO: 310.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises (a) a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 303; (b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 304; (c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 305; (d) a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 308; (e) a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 309; and (f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 310 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It is well known in the art that VH CDR3 and VL CDR3 domains play an important role in the binding specificity/affinity of an antibody for an antigen (Xu and Davis, Immunity, 13: 37-45, 2000). Accordingly, in one embodiment the anti-ICAM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO:305. In another embodiment, the anti-ICAM- 1 antibodies comprise a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 310. In yet another embodiment, the anti-ICAM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 305 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 310. The remaining portions of the anti-ICAM- 1 antibodies (e.g. CDR1, CDR2, VH, VL, etc.) may comprise specific sequences disclosed herein or known sequences provided the anti-ICAM- 1 antibodies immuno specifically bind to ICAM-1.

In certain embodiments, the anti-ICAM- 1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 313, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 314 and a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 315. In another embodiment, the anti-ICAM-1 antibodies comprise a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 318, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 319 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 320.

In certain embodiments, the anti-ICAM-1 antibodies comprise a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 313, a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 314, a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 315, a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 318, a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 319 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 320.

In a specific embodiment, the anti-IC AM- 1 antibody comprises (a) a VH CDR1 having the amino acid sequence of SEQ ID NO: 313; (b) a VH CDR2 having the amino acid sequence of SEQ ID NO: 314; (c) a VH CDR3 having the amino acid sequence of SEQ ID NO: 315; (d) a VL CDR1 having the amino acid sequence of SEQ ID NO: 318; (e) a VL CDR2 having the amino acid sequence of SEQ ID NO: 319; and (f) a VL CDR3 having the amino acid sequence of SEQ ID NO: 320.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises (a) a VH CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 313; (b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 314; (c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 315; (d) a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 318; (e) a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 31 ; and (f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 320 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1; (i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

It is well known in the art that VH CDR3 and VL CDR3 domains play an important role in the binding specificity/affinity of an antibody for an antigen (Xu and Davis, Immunity, 13: 37-45, 2000). Accordingly, in one embodiment the anti-ICAM- 1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 315. In another embodiment, the anti-ICAM-1 antibodies comprise a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 320. In yet another embodiment, the anti-ICAM-1 antibodies comprise a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 315 and a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 320. The remaining portions of the anti-ICAM-1 antibodies (e.g. CDRl, CDR2, VH, VL, etc.) may comprise specific sequences disclosed herein or known sequences provided the anti-ICAM-1 antibodies immunospecifically bind to ICAM-1.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises (a) a VH CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 3; (b) a VH CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 4; (c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4 or 5 amino acid residue substitutions relative to SEQ ID NO: 5; (d) a VL CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 8; (e) a VL CDR2 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 9; and (f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, or 5 amino acid residue substitutions relative to SEQ ID NO: 10 has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immuno specifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a

VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In a further embodiment, the antibody of the invention is a humanized antibody that immunospecifically binds ICAM-1 and comprises a VH CDRl, VH CDR2, VH CDR3, VH CDRl, VL CDR2, VL CDR3 each having an amino acid sequence identical to or comprising

1, 2, or 3 amino acid residue substitutions relative to the antibody 14C11 (Cat. # MAB720,

R&D Systems, MN, USA) and has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1; (i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as the 14C11 antibody. In a specific embodiment, the antibody of the invention is a humanized antibody that

immunospecifically binds ICAM-1 and comprises a VH CDRl, VH CDR2, VH CDR3, VH CDRl, VL CDR2, VL CDR3 each having an amino acid sequence identical to corresponding CDR of the antibody 14C11 (Cat. # MAB720, R&D Systems, MN, USA); and has one or more of the characteristics (a) - (j). It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

The invention contemplates antibodies and antibody fragments having any combination of the foregoing VH and VL CDRs with or without amino acid substitutions. For example, antibodies comprising: a VH CDRl having a sequence identical to SEQ ID NO: 3, a VH CDR2 having an amino acid sequence comprising one amino acid substitution relative to SEQ ID NO: 4, a VH CDR3 having an amino acid sequence comprising one amino acid substitution relative to SEQ ID NO: 5. By way of further example, antibodies comprising: a VL CDRl having an amino acid sequence identical to SEQ ID NO: 8, a VL CDR2 having an amino acid sequence comprising two substitutions relative to SEQ ID NO: 9, and a VL CDR3 having an amino acid sequence comprising three substitutions relative to SEQ ID NO: 10. All other combinations are similarly contemplated. In certain

embodiments, the antibodies or antibody fragments are human or chimeric antibodies that immunospecifically bind to human ICAM-1 and inhibit binding of human ICAM-1 to rhinovirus, but do not substantially inhibit the binding of human ICAM-1 to LFA and/or MAC- 1. The foregoing description of the VH and VL CDRs is intended to refer to all possible combinations. Thus, for example, description of a VH CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid substitutions relative to SEQ ID NO: 3 refers to any of the following embodiments: a VH CDRl having an amino acid sequence identical to SEQ ID NO: 3; a VH CDRl having an amino acid sequence identical to or comprising 1 amino acid residue substitution relative to SEQ ID NO: 3; a VH CDR 1 having an amino acid sequence comprising 1 amino acid residue substitution relative to SEQ ID NO: 3; a VH CDRl having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 3; a VH CDRl having an amino acid sequence comprising 2 amino acid substitutions relative to SEQ ID NO:3; a VH CDRl having an amino acid sequence comprising 3 amino acid residue substitutions relative to SEQ ID NO: 3; etc.

The present invention encompasses anti-IC AM- 1 antibodies comprising amino acids in a sequence that is substantially the same as an amino acid sequence described herein. Amino acid sequences that are substantially the same as the sequences described herein include sequences comprising conservative amino acid substitutions, as well as amino acid deletions and/or insertions. A conservative amino acid substitution refers to the replacement of a first amino acid by a second amino acid that has chemical and/or physical properties (e.g., charge, structure, polarity, hydrophobicity/hydrophilicity) that are similar to those of the first amino acid. Conservative substitutions include replacement of one amino acid by another within the following groups: lysine (K), arginine (R) and histidine (H); aspartate (D) and glutamate (E); asparagine (N), glutamine (Q), serine (S), threonine (T), tyrosine (Y), K, R, H, D and E; alanine (A), valine (V), leucine (L), isoleucine (I), proline (P), phenylalanine (F), tryptophan (W), methionine (M), cysteine (C) and glycine (G); F, W and Y; C, S and T. Similarly contemplated is replacing a basic amino acid with another basic amino acid (e.g., replacement among Lys, Arg, His), replacing an acidic amino acid with another acidic amino acid (e.g., replacement among Asp and Glu), replacing a neutral amino acid with another neutral amino acid (e.g., replacement among Ala, Gly, Ser, Met, Thr, Leu, He, Asn, Gin, Phe, Cys, Pro, Trp, Tyr, Val).

The foregoing applies equally to anti-ICAM antibodies and antibody fragments of the invention. Antibodies and antibody fragments having any one or more of the foregoing functional and structural characteristics are contemplated.

(c) Framework regions

The variable domains of the heavy and light chains each comprise four framework regions (FR1, FR2, FR3, FR4), which are the more highly conserved portions of the variable domains. The four FRs of the heavy chain are designated FR-H1, FR-H2, FR-H3 and FR- H4, and the four FRs of the light chain are designated FR-L1, FR-L2, FR-L3 and FR-L4. The Kabat numbering system is used herein, See Table 1, Kabat et al., Supra. As such, FR-H1 begins at position 1 and ends at approximately amino acid 30, FR-H2 is approximately from amino acid 36 to 49, FR-H3 is approximately from amino acid 66 to 94 and FR-H4 is approximately amino acid 103 to 113. FR-L1 begins at amino acid 1 and ends at

approximately amino acid 23, FR-L2 is approximately from amino acid 35 to 49, FR-L3 is approximately from amino acid 57 to 88 and FR-L4 is approximately from amino acid 98 to 107. In certain embodiments the framework regions may contain substitutions according to the Kabat numbering system, e.g., insertion at 106A in FR-L1. In addition to naturally occurring substitutions, one or more alterations (e.g., substitutions) of FR residues may also be introduced in an anti-ICAM- 1 antibody. In certain embodiments, these result in an improvement or optimization in the binding affinity of the antibody for ICAM- 1. Examples of framework region residues to modify include those which non-covalently bind antigen directly (Amit et al, Science, 233:747-753 (1986)); interact with/effect the conformation of a CDR (Chothia et al, J. Mol. Biol, 196:901-917 (1987)); and/or participate in the VL-VH interface (US Patent No. 5,225,539).

In another embodiment the FR may comprise one or more amino acid changes for the purposes of "germlining". For example, the amino acid sequences of selected antibody heavy and light chains are compared to germline heavy and light chain amino acid sequences and where certain framework residues of the selected VL and/or VH chains differ from the germline configuration (e.g., as a result of somatic mutation of the immunoglobulin genes used to prepare the phage library), it may be desirable to "backmutate" the altered framework residues of the selected antibodies to the germline configuration (i.e., change the framework amino acid sequences of the selected antibodies so that they are the same as the germline framework amino acid sequences). Such "backmutation" (or "germlining") of framework residues can be accomplished by standard molecular biology methods for introducing specific mutations (e.g., site-directed mutagenesis; PCR-mediated mutagenesis, and the like). In one embodiment, the variable light and/or heavy chain framework residues are backmutated. In another embodiment, the variable heavy chain of an antibody of the invention is

backmutated. In another embodiment, the variable heavy chain of an antibody of the invention comprises at least one, at least two, at least three, at least four or more

backmutations.

In certain embodiments, the VH of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of SEQ ID NO: 325, 326, 327 and/or 328, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VH FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO:325, 326, 327 and/or 328. In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO: 325, 326, 327 and/or 328. In particular FR1, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO: 325, 326, 327 and/or 328.

In certain embodiments, the VL of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of the FR of VL SEQ ID NO:329, 330, 331 and/or 332, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VL FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO:329, 330, 331 and/or 332.

In certain embodiments, the anti-ICAM-1 antibodies may comprise a VL FR (FR1,

FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:329, 330, 331 and/or 332. In particular FR1, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:329, 330, 331 and/or 332.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:325, 326, 327 and/or 328 and/or VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:329, 330, 331 and/or 332 wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM- 1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the VH of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of SEQ ID NO:333, 334, 335 and/or 336, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VH FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO:333, 334, 335 and/or 336.

In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:333, 334, 335 and/or 336. In particular FR1, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:333, 334, 335 and/or 336.

In certain embodiments, the VL of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of the FR of VL SEQ ID NO:337, 338, 339 and/or 340, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VL FR amino acid sequence (FRl, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO:337, 338, 339 and/or 340. In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:337, 338, 339 and/or 340. In particular FR1, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:337, 338, 339 and/or 340.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:333, 334, 335 and/or 336 and/or VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:337, 338, 339 and/or 340 wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the VH of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of SEQ ID NO:341, 342, 343 and/or 344, that is from about 90% to about 100%. In one embodiment, the anti-IC AM- 1 antibodies comprise a VH FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO:341, 342, 343 and/or 344.

In certain embodiments, the anti-IC AM- 1 antibodies may comprise a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:341, 342, 343 and/or 344. In particular FR1, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:341, 342, 343 and/or 344.

In certain embodiments, the VL of an anti-ICAM-1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of the FR of VL SEQ ID NO:345, 346, 347 and/or 348, that is from about 90% to about 100%. In one embodiment, the anti-ICAM-1 antibodies comprise a VL FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO:345, 346, 347 and/or 348.

In certain embodiments, the anti-ICAM-1 antibodies may comprise a VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:345, 346, 347 and/or 348. In particular FR1, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:345, 346, 347 and/or 348.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:341, 342, 343 and/or 344 and/or VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:345, 346, 347 and/or 348 wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of: (a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the VH of an anti-ICAM-1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of SEQ ID NO:349, 350, 351 and/or 352, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VH FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO:349, 350, 351 and/or 352.

In certain embodiments, the anti-ICAM-1 antibodies may comprise a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:349, 350, 351 and/or 352. In particular FR1, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:349, 350, 351 and/or 352.

In certain embodiments, the VL of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of the FR of VL SEQ ID NO:353, 354, 355 and/or 356, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VL FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO:353, 354, 355 and/or 356.

In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:353, 354, 355 and/or 356. In particular FR1, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:353, 354, 355 and/or 356.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:349, 350, 351 and/or 352 and/or VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:353, 354, 355 and/or 356 wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and (j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the VH of an anti-ICAM-1 antibody of the invention may comprise FRl, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FRl of antibody X as compared to FRl of antibody Y) of SEQ ID NO:397, 398, 399, and/or 400, that is from about 90% to about 100%. In one embodiment, the anti-ICAM-1 antibodies comprise a VH FR amino acid sequence (FRl, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO:397, 398, 399, and/or 400.

In certain embodiments, the anti-ICAM-1 antibodies may comprise a VH FR (FRl, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:397, 398, 399, and/or 400. In particular FRl, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FRl, FR2, FR3 or FR4 of VH SEQ ID NO:397, 398, 399, and/or 400.

In certain embodiments, the VL of an anti-ICAM- 1 antibody of the invention may comprise FRl, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FRl of antibody X as compared to FRl of antibody Y) of the FR of VL SEQ ID NO:401, 402, 403, and/or 404, that is from about 90% to about 100%. In one embodiment, the anti-ICAM-1 antibodies comprise a VL FR amino acid sequence (FRl, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO:401, 402, 403, and/or 404.

In certain embodiments, the anti-ICAM-1 antibodies may comprise a VL FR (FRl, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:401, 402, 403, and/or 404. In particular FRl, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FRl, FR2, FR3 or FR4 of VH SEQ ID NO:401, 402, 403, and/or 404. In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:397, 398, 399, and/or 400 and/or VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:401, 402, 403, and/or 404 wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the VH of an anti-ICAM-1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of SEQ ID NO:405, 406, 407 and/or 408, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VH FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO:405, 406, 407 and/or 408. In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:405, 406, 407 and/or 408. In particular FR1, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:405, 406, 407 and/or 408.

In certain embodiments, the VL of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of the FR of VL SEQ ID NO:409, 410, 411 and/or 412, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VL FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO:409, 410, 411 and/or 412.

In certain embodiments, the anti-ICAM-1 antibodies may comprise a VL FR (FR1,

FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:409, 410, 411 and/or 412. In particular FR1, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:409, 410, 411 and/or 412.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:405, 406, 407 and/or 408 and/or VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:409, 410, 411 and/or 412 wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM- 1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the VH of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of SEQ ID NO: 413, 414, 415, and or 416, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VH FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO:413, 414, 415, and or 416.

In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO: 413, 414, 415, and or 416. In particular FR1, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO: 413, 414, 415, and or 416.

In certain embodiments, the VL of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of the FR of VL SEQ ID NO:417, 418, 419, and/or 420, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VL FR amino acid sequence (FRl, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO:417, 418, 419, and/or 420. In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO: 417, 418, 419, and/or 420. In particular FR1, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO: 417, 418, 419, and/or 420.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO: 413, 414, 415, and or 416 and/or VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO: 417, 418, 419, and/or 420wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the VH of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of SEQ ID NO:421, 422, 423, and/or 424, that is from about 90% to about 100%. In one embodiment, the anti-IC AM- 1 antibodies comprise a VH FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO: 421, 422, 423, and/or 424.

In certain embodiments, the anti-IC AM- 1 antibodies may comprise a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO: 421, 422, 423, and/or 424. In particular FR1, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO: 421, 422, 423, and/or 424.

In certain embodiments, the VL of an anti-ICAM-1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of the FR of VL SEQ ID NO:425, 426, 427, and/or 428, that is from about 90% to about 100%. In one embodiment, the anti-ICAM-1 antibodies comprise a VL FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO: 425, 426, 427, and/or 428.

In certain embodiments, the anti-ICAM-1 antibodies may comprise a VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO: 425, 426, 427, and/or 428. In particular FR1, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO: 425, 426, 427, and/or 428.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO: 421, 422, 423, and/or 424and/or VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO: 425, 426, 427, and/or 428wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of: (a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the VH of an anti-ICAM-1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of SEQ ID NO:429, 430, 431 and/or 432, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VH FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO:429, 430, 431 and/or 432.

In certain embodiments, the anti-ICAM-1 antibodies may comprise a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:429, 430, 431 and/or 432. In particular FR1, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:429, 430, 431 and/or 432.

In certain embodiments, the VL of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of the FR of VL SEQ ID NO:433, 434, 435 and/or 436, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VL FR amino acid sequence (FRl, FR2, FR3 and/or FR4) having at 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO:433, 434, 435 and/or 436.

In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VL FR (FRl, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:433, 434, 435 and/or 436. In particular FRl, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FRl, FR2, FR3 or FR4 of VH SEQ ID NO:433, 434, 435 and/or 436.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FRl, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:429, 430, 431 and/or 432 and/or VL FR (FRl, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:433, 434, 435 and/or 436 wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and (j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the VH of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of SEQ ID NO:437, 438, 439 and/or 440, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VH FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO:437, 438, 439 and/or 440.

In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:437, 438, 439 and/or 440. In particular FR1, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:437, 438, 439 and/or 440.

In certain embodiments, the VL of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of the FR of VL SEQ ID NO:441, 442, 443 and/or 444, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VL FR amino acid sequence (FRl, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO:441, 442, 443 and/or 444.

In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VL FR (FRl, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:441, 442, 443 and/or 444. In particular FRl, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FRl, FR2, FR3 or FR4 of VH SEQ ID NO:441, 442, 443 and/or 444. In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:437, 438, 439 and/or 440 and/or VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:441, 442, 443 and/or 444 wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the VH of an anti-ICAM-1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of SEQ ID NO:445, 446, 447 and/or 448, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VH FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO:445, 446, 447 and/or 448. In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:445, 446, 447 and/or 448. In particular FR1, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:445, 446, 447 and/or 448.

In certain embodiments, the VL of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of the FR of VL SEQ ID NO:449, 450, 451 and/or 452, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VL FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO:449, 450, 451 and/or 452.

In certain embodiments, the anti-ICAM-1 antibodies may comprise a VL FR (FR1,

FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:449, 450, 451 and/or 452. In particular FR1, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:449, 450, 451 and/or 452.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:445, 446, 447 and/or 448 and/or VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:449, 450, 451 and/or 452 wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM- 1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the VH of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of SEQ ID NO:453, 454, 455 and/or 456, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VH FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO:453, 454, 455 and/or 456.

In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:453, 454, 455 and/or 456. In particular FR1, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:453, 454, 455 and/or 456.

In certain embodiments, the VL of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of the FR of VL SEQ ID NO:457, 458, 459 and/or 460, that is from about 90% to about 100%. In one embodiment, the anti-ICAM- 1 antibodies comprise a VL FR amino acid sequence (FRl, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO:457, 458, 459 and/or 460. In certain embodiments, the anti-ICAM- 1 antibodies may comprise a VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:457, 458, 459 and/or 460. In particular FR1, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:457, 458, 459 and/or 460.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:453, 454, 455 and/or 456 and/or VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:457, 458, 459 and/or 460 wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

In certain embodiments, the VH of an anti-ICAM- 1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of SEQ ID NO:461, 462, 463 and/or 464, that is from about 90% to about 100%. In one embodiment, the anti-IC AM- 1 antibodies comprise a VH FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VH SEQ ID NO:461, 462, 463 and/or 464.

In certain embodiments, the anti-IC AM- 1 antibodies may comprise a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:461, 462, 463 and/or 464. In particular FR1, FR2, FR3 or FR4 of the VH may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:461, 462, 463 and/or 464.

In certain embodiments, the VL of an anti-ICAM-1 antibody of the invention may comprise FR1, FR2, FR3 and/or FR4 that has an amino acid sequence identity with the corresponding framework regions (i.e., FR1 of antibody X as compared to FR1 of antibody Y) of the FR of VL SEQ ID NO:465, 466, 467 and/or 468, that is from about 90% to about 100%. In one embodiment, the anti-ICAM-1 antibodies comprise a VL FR amino acid sequence (FR1, FR2, FR3 and/or FR4) having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% sequence identity with the corresponding FR of VL SEQ ID NO:465, 466, 467 and/or 468.

In certain embodiments, the anti-ICAM-1 antibodies may comprise a VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:465, 466, 467 and/or 468. In particular FR1, FR2, FR3 or FR4 of the VL may each have an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR1, FR2, FR3 or FR4 of VH SEQ ID NO:465, 466, 467 and/or 468.

In a further embodiment, the antibody of the invention immunospecifically binds ICAM-1 and comprises a VH FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1, 2 or 3 amino acid substitutions relative to the corresponding FR of VH SEQ ID NO:461, 462, 463 and/or 464 and/or VL FR (FR1, FR2, FR3 and/or FR4) having an amino acid sequence identical to or comprising 1 , 2 or 3 amino acid substitutions relative to the corresponding FR of VL SEQ ID NO:465, 466, 467 and/or 468 wherein the antibody has one or more characteristics (described in more detail below) selected from the group consisting of: (a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;

(d) can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

The foregoing applies equally to antibodies and antibody fragments of the present invention. Moreover, the invention contemplates antibodies and antibody fragments having any one or more of the functional and structural properties described in the applications, and further comprising any combination of VH FR1, FR2, FR3, and FR4 regions described herein. Moreover, the invention contemplates antibodies and antibody fragments having any one or more of the functional and structural properties described in the applications, and further comprising any combination of VL FR1, FR2, FR3, and FR4 regions described herein, as well as antibodies and antibody fragments having any combination of VH FR1, FR2, FR3, FR4 regions, and VL FR1, FR2, FR3, and FR4 regions. Moreover, the invention contemplates antibodies and antibody fragments having comprising any combination of VL FR1, FR2, FR3, and FR4 regions described herein, as well as antibodies and antibody fragments having any combination of VH FR1, FR2, FR3, FR4 regions, and VL FR1, FR2, FR3, and FR4 regions, where in the antibody inhibits binding of human ICAM- 1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA and/or MAC- 1. In certain embodiments, said antibody is a human, humanized or chimeric antibody. The foregoing description applies equally to antibodies and antibody fragments of the invention. Moreover, the invention contemplates antibodies and antibody fragments having any combination of the structural and/or functional features described herein. Further, the various CDR and FR domains (CDRs 1-3 of the VH domain, CDRs 1-3 of the VL domain, FRs 1-4 of the VH domain, FRs 1-4 of the VL domain) described above can be defined with other features of the invention described herein. Any such anti-IC AM- 1 antibodies and antibody fragments can be used in any of the methods described herein, such as in a method for preventing HRV infection of a cell and/or in a method of preventing or treating exacerbation of symptoms of COPD or other respiratory condition. Additionally, or optionally, Any such anti-ICAM- 1 antibodies and antibody fragments can be used in any of the methods described herein, such as in a method for preventing CV-A infection of a cell and/or preventing adhesion of Plasmodium falciparum infected erythrocytes to the vascular endothelium and/or in a method of preventing or treating exacerbation of symptoms of CV-A infection and/or preventing or treating exacerbation of symptoms mediated by adhesion of Plasmodium falciparum infected erythrocytes to the vascular endothelium.

Note that certain of the CDR and FR regions provided in the sequence listing may correspond to the same amino acid sequence (e.g., VH CDR2 from two different antibodies identified in the examples may have the same sequence). They are provided separately to illustrate the experimental results, as well as the relationships among certain antibodies identified. However, when a sequence identifier is used to describe the sequence of a particular antibody, it should be understood, unless otherwise specified, to refer to the underlying sequence itself without requiring or assuming a source of that sequence.

(d) Nucleotide Sequences encoding anti-ICAM-1 antibodies

In addition to the amino acid sequences described above, the invention further provides nucleotide sequences corresponding to the amino acid sequences and encoding for the human, humanized and/or chimeric antibodies of the invention. In one embodiment, the invention provides polynucleotides comprising a nucleotide sequence encoding an anti- ICAM- 1 antibody described herein or fragments thereof. These include, but are not limited to, nucleotide sequences that code for the above referenced amino acid sequences. Thus, the present invention also provides polynucleotide sequences encoding VH and VL domain regions including CDRs and FRs of antibodies described herein as well as expression vectors for their efficient expression in cells (e.g. mammalian cells). Methods of making the anti- ICAM-1 antibodies using polynucleotides are described below in more detail. The foregoing polynucleotides encode anti-ICAM 1 antibodies have the structural and/or functional features described herein. For example, such antibodies bind immunospecifically to human ICAM- 1 and inhibit binding of human ICAM-1 to human rhinovirus, but do not substantially inhibit binding of human ICAM- 1 to LFA- 1 and/or MAC- 1.

The invention also encompasses polynucleotides that hybridize under stringent or lower stringency hybridization conditions, e.g., as defined herein, to polynucleotides that encode an antibody of the invention described herein that binds to ICAM-1. The term "stringency" as used herein refers to experimental conditions (e.g. temperature and salt concentration) of a hybridization experiment to denote the degree of homology between the probe and the filter bound nucleic acid; the higher the stringency, the higher percent homology between the probe and filter bound nucleic acid.

Stringent hybridization conditions include, but are not limited to, hybridization to filter-bound DNA in 6X sodium chloride/sodium citrate (SSC) at about 45°C followed by one or more washes in 0.2X SSC/0.1% SDS at about 50-65°C, highly stringent conditions such as hybridization to filter-bound DNA in 6X SSC at about 45°C followed by one or more washes in 0.1X SSC/0.2% SDS at about 65°C, or any other stringent hybridization conditions known to those skilled in the art (see, for example, Ausubel, F.M. et al., eds. 1989 Current Protocols in Molecular Biology, vol. 1, Green Publishing Associates, Inc. and John Wiley and Sons, Inc., NY at pages 6.3.1 to 6.3.6 and 2.10.3).

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 1. In another embodiment, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM- 1 antibody VL that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO:6.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 1. In one embodiment, the anti-ICAM-1 antibodies have a VH nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 1.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VL at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO:6. In one embodiment, the anti-ICAM-1 antibodies have a VL nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO:6.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 11. In another embodiment, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM- 1 antibody VL that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 16.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 11. In one embodiment, the anti-ICAM-1 antibodies have a VH nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 11.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VL at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 16. In one embodiment, the anti-ICAM-1 antibodies have a VL nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 16.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 21. In another embodiment, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM- 1 antibody VL that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO:26.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 21. In one embodiment, the anti-ICAM-1 antibodies have a VH nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 21. In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VL at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO:26. In one embodiment, the anti-ICAM-1 antibodies have a VL nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO:26.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 31. In another embodiment, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM- 1 antibody VL that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO:36.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 31. In one embodiment, the anti-ICAM-1 antibodies have a VH nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 31.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VL at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO:36. In one embodiment, the anti-ICAM-1 antibodies have a VL nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO:36.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 241. In another embodiment, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM- 1 antibody VL that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO:246.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 241. In one embodiment, the anti-ICAM-1 antibodies have a VH nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 241.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VL at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO:246. In one embodiment, the anti-ICAM-1 antibodies have a VL nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO:246.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 251. In another embodiment, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM- 1 antibody VL that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO:256.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 251. In one embodiment, the anti-ICAM-1 antibodies have a VH nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 251.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VL at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO:256. In one embodiment, the anti-ICAM-1 antibodies have a VL nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO:256.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 281. In another embodiment, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM- 1 antibody VL that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO:286.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 281. In one embodiment, the anti-ICAM-1 antibodies have a VH nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 281.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VL at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO:286. In one embodiment, the anti-ICAM-1 antibodies have a VL nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO:286.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 291. In another embodiment, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VL that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO:296.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 291. In one embodiment, the anti-ICAM- 1 antibodies have a VH nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 291.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VL at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO:296. In one embodiment, the anti-ICAM-1 antibodies have a VL nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO:296.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 301. In another embodiment, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM- 1 antibody VL that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO:306. In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 301. In one embodiment, the anti-ICAM- 1 antibodies have a VH nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 301.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VL at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO:306. In one embodiment, the anti-ICAM-1 antibodies have a VL nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO:306.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 311. In another embodiment, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM- 1 antibody VL that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO:316.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VH at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 311. In one embodiment, the anti-ICAM- 1 antibodies have a VH nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO: 311.

In certain embodiments, the polynucleotide sequences of the invention may also comprise a nucleotide sequence encoding an anti-ICAM-1 antibody VL at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or having about 100% identity to the nucleotide sequence of SEQ ID NO:316. In one embodiment, the anti-ICAM-1 antibodies have a VL nucleotide sequence having at least, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having about 100% identity to the nucleotide sequence of SEQ ID NO:316.

Substantially identical sequences may be polymorphic sequences, i.e., alternative sequences or alleles in a population. An allelic difference may be as small as one base pair. Substantially identical sequences may also comprise mutagenized sequences, including sequences comprising silent mutations. A mutation may comprise one or more residue changes, a deletion of one or more residues, or an insertion of one or more additional residues.

The polynucleotides may be obtained, and the nucleotide sequence of the

polynucleotides determined, by any method known in the art. For example, if the nucleotide sequence of the antibody is known, a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.

A polynucleotide encoding an antibody may also be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably polyA+RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody ) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR may then be cloned into replicable cloning vectors using any method well known in the art.

Once the nucleotide sequence and corresponding amino acid sequence of the antibody is determined, the nucleotide sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY), to generate antibodies having a different amino acid sequence, for example to create amino acid substitutions, deletions, and/or insertions.

Biological characteristics of the anti-ICAM-1 antibodies An antibody having a biological characteristic of a designated antibody is one which possesses one or more of the biological characteristics of that antibody which distinguish it from other antibodies that bind to the same antigen, ICAM-1. As used here, "biological characteristics" of an antibody refers to any one of biochemical, binding and functional characteristics, which are used to select antibodies for therapeutic, research, and diagnostic uses described below. For example, anti-ICAM- 1 antibodies may be the same or different with respect to epitope binding, targeting, affinity, neutralizing, internalizing, depletion, and cytotoxic properties of the antibody.

The biochemical characteristics of the antibodies of the invention include, but are not limited to, isoelectric point (pi) and melting temperature (Tm). The binding characteristics of the antibodies of the invention include, but are not limited to, binding specificity, dissociation constant (KD), or its inverse, association constant (KA), or its component kon or k0ff rates, epitope, ability to distinguish between various forms and/or preparations of ICAM-1 (e.g., recombinant, native, acetylated) and ability to bind soluble and/or immobilized antigen. The functional characteristics of the antibodies of the present invention include, but are not limited to; inhibition of HRV binding to ICAM- 1 without affecting LFA- 1 binding to ICAM- 1 or other normal functions of ICAM-1, neutralization/inhibition of CV-A infection, neutralization/inhibition of HRV infection, neutralization/inhibition of adhesion of

Plasmodium falciparum infected erythrocytes to the endothelium and protection in one or more ICAM-1 -related diseases or disorders. Described herein are the antibodies of the invention and their respective characteristics along with methods for the modification and fine tuning of those characteristics. Methods for measuring the characteristics of the antibodies are well known in the art, some of which are detailed below.

(a) Biochemical Characteristics

Antibodies like all polypeptides have an Isoelectric Point (pi), which is generally defined as the pH at which a polypeptide carries no net charge. It is known in the art that protein solubility is typically lowest when the pH of the solution is equal to the isoelectric point (pi) of the protein. As used herein the pi value is defined as the pi of the predominant charge form. The pi of a protein may be determined by a variety of methods including but not limited to, isoelectric focusing and various computer algorithms (see, e.g. , Bjellqvist et ah , 1993, Electrophoresis 14: 1023). In addition, the thermal melting temperatures (Tm) of the Fab domain of an antibody, can be a good indicator of the thermal stability of an antibody and may further provide an indication of the shelf-life. A lower Tm indicates more aggregation/less stability, whereas a higher Tm indicates less aggregation/ more stability. Thus, in certain embodiments antibodies having higher Tm are preferable. Tm of a protein domain (e.g., a Fab domain) can be measured using any standard method known in the art, for example, by differential scanning calorimetry (see, e.g., Vermeer et al., 2000, Biophys. J. 78:394-404; Vermeer et al., 2000, Biophys. J. 79: 2150-2154).

Accordingly, in certain embodiments the present invention includes anti-ICAM- 1 antibodies of the invention that have certain preferred biochemical characteristics such as a particular isoelectric point (pi) or melting temperature (Tm).

More specifically, in one embodiment, the anti-ICAM- 1 antibodies of the present invention have a pi ranging from 5.5 to 9.5. In still another specific embodiment, the anti- ICAM-1 antibodies of the present invention have a pi that ranges from about 5.5 to about 6.0, or about 6.0 to about 6.5, or about 6.5 to about 7.0, or about 7.0 to about 7.5, or about 7.5 to about 8.0, or about 8.0 to about 8.5, or about 8.5 to about 9.0, or about 9.0 to about 9.5. In other specific embodiments, the anti-ICAM- 1 antibodies of the present invention have a pi that ranges from 5.5-6.0, or 6.0 to 6.5, or 6.5 to 7.0, or 7.0-7.5, or 7.5-8.0, or 8.0-8.5, or 8.5- 9.0, or 9.0-9.5. Even more specifically, the anti-ICAM- 1 antibodies of the present invention have a pi of at least 5.5, or at least 6.0, or at least 6.3, or at least 6.5, or at least 6.7, or at least 6.9, or at least 7.1, or at least 7.3, or at least 7.5, or at least 7.7, or at least 7.9, or at least 8.1, or at least 8.3, or at least 8.5, or at least 8.7, or at least 8.9, or at least 9.1, or at least 9.3, or at least 9.5. In other specific embodiments, the anti-ICAM- 1 antibodies of the present invention have a pi of at least about 5.5, or at least about 6.0, or at least about 6.3, or at least about 6.5, or at least about 6.7, or at least about 6.9, or at least about 7.1, or at least about 7.3, or at least about 7.5, or at least about 7.7, or at least about 7.9, or at least about 8.1, or at least about 8.3, or at least about 8.5, or at least about 8.7, or at least about 8.9, or at least about 9.1, or at least about 9.3, or at least about 9.5.

It is possible to optimize solubility by altering the number and location of ionizable residues in the antibody to adjust the pi. For example the pi of a polypeptide can be manipulated by making the appropriate amino acid substitutions (e.g. , by substituting a charged amino acid such as a lysine, for an uncharged residue such as alanine). Without wishing to be bound by any particular theory, amino acid substitutions of an antibody that result in changes of the pi of said antibody may improve solubility and/or the stability of the antibody. One skilled in the art would understand which amino acid substitutions would be most appropriate for a particular antibody to achieve a desired pi. In one embodiment, a substitution is generated in an antibody of the invention to alter the pi. It is specifically contemplated that the substitution(s) of the Fc region that result in altered binding to FcyR (described supra) may also result in a change in the pi. In another embodiment,

substitution(s) of the Fc region are specifically chosen to effect both the desired alteration in FcyR binding and any desired change in pi.

In one embodiment, the anti-ICAM-1 antibodies of the present invention have a Tm ranging from 65°C to 120°C. In specific embodiments, the anti-ICAM-1 antibodies of the present invention have a Tm ranging from about 75°C to about 120°C, or about 75°C to about 85°C, or about 85°C to about 95°C, or about 95°C to about 105°C, or about 105°C to about 115°C, or about 115°C to about 120°C. In other specific embodiments, the ant-ICAM- 1 antibodies of the present invention have a Tm ranging from 75°C to 120°C, or 75°C to 85°C, or 85°C to 95°C, or 95°C to 105°C, or 105°C to 115°C, or 115°C to 120°C. In still other specific embodiments, the ant-ICAM-1 antibodies of the present invention have a Tm of at least about 65°C, or at least about 70°C, or at least about 75°C, or at least about 80°C, or at least about 85°C, or at least about 90°C, or at least about 95°C, or at least about 100°C, or at least about 105°C, or at least about 110°C, or at least about 115°C, or at least about 120°C. In yet other specific embodiments, the ant-IC AM- 1 antibodies of the present invention have a Tm of at least 65°C, or at least 70°C, or at least 75°C, or at least 80°C, or at least 85°C, or at least 90°C, or at least 95°C, or at least 100°C, or at least 105°C, or at least 110°C, or at least 115°C, or at least 120°C.

(b) Binding Characteristics

As described above, the anti-ICAM-1 antibodies of the invention immunospecifically bind at least one specified epitope or antigenic determinants of the ICAM- 1 protein, peptide, subunit, fragment, portion or any combination thereof either exclusively or preferentially with respect to other polypeptides. The term "epitope" or "antigenic determinant" as used herein refers to a protein determinant capable of binding to an antibody, wherein the term "binding" herein preferably relates to a specific binding. These protein determinants or epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have a specific three dimensional structural characteristics, as well as specific charge characteristics. Conformational and non- conformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents. The term "discontinuous epitope" as used herein, refers to a conformational epitope on a protein antigen which is formed from at least two separate regions in the primary sequence of the protein. In certain embodiments, the anti-ICAM- 1 antibodies immuno specifically bind to human ICAM-1 and antigenic fragments thereof. In one embodiment, the anti-ICAM- 1 antibodies immuno specifically bind to (SEQ ID NO:481. and/or Genbank Accession NO: P05362), or at least any three contiguous amino acids of SEQ ID NO: 481. In another embodiments, the epitope is at least 4 amino acid residues, at least 5 amino acid residues, at least 6 amino acid residues, at least 7 amino acid residues, at least 8 amino acid residues or at least 9 amino acid residues to the entire specified portion of contiguous amino acids of the (SEQ ID NO: 481. and/or Genbank Accession NO: P05362). In one embodiment, the anti- ICAM- 1 antibodies immunospecifically bind a ICAM-1 polypeptide or antigenic fragments thereof, having at least 80%, 85%, 90%, 95% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 481. In a further embodiment, the anti-ICAM-1 antibodies immunospecifically bind to a ICAM-1 polypeptide or antigenic fragments thereof, having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 481. In one embodiment, the anti- ICAM-1 antibodies immunospecifically bind to (SEQ ID NO:482, the Dl domain of ICAM- 1, or at least any three contiguous amino acids of SEQ ID NO: 482. In another embodiments, the epitope is at least 4 amino acid residues, at least 5 amino acid residues, at least 6 amino acid residues, at least 7 amino acid residues, at least 8 amino acid residues or at least 9 amino acid residues to the entire specified portion of contiguous amino acids of the (SEQ ID NO: 482. In one embodiment, the anti-ICAM-1 antibodies immunospecifically bind a ICAM-1 polypeptide or antigenic fragments thereof, having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or having at least 100% identity to the amino acid sequence of SEQ ID NO: 482.

In certain embodiments, the antibodies of the invention may bind epitopes conserved across species. In one embodiment, antibodies of the invention bind murine, non-human primate, rat, bovine, pig or other mammalian ICAM- 1 and antigenic fragments thereof. In one embodiment the antibodies of the invention may bind to one or more ICAM- 1 orthologs and or isoforms. In a specific embodiment, antibodies of the invention bind to ICAM-1 and antigenic fragments thereof from one or more species, including, but not limited to, mouse, rat, monkey, primate, and human. In certain embodiments, the antibodies of the invention may bind an epitope within humans across ICAM-1 homologs and/or isoforms and/or conformational variants and/or subtypes.

The interactions between antigens and antibodies are the same as for other non- covalent protein-protein interactions. In general, four types of binding interactions exist between antigens and antibodies: (i) hydrogen bonds, (ii) dispersion forces, (iii) electrostatic forces between Lewis acids and Lewis bases, and (iv) hydrophobic interactions. Hydrophobic interactions are a major driving force for the antibody- antigen interaction, and are based on repulsion of water by non-polar groups rather than attraction of molecules (Tanford, 1978). However, certain physical forces also contribute to antigen-antibody binding, for example, the fit or complimentary of epitope shapes with different antibody binding sites. Moreover, other materials and antigens may cross-react with an antibody, thereby competing for available free antibody.

Measurement of the affinity constant and specificity of binding between antigen and antibody is a pivotal element in determining the efficacy of therapeutic, diagnostic and research methods using the anti-ICAM-1 antibodies. "Binding affinity" generally refers to the strength of the sum total of the noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, "binding affinity" refers to intrinsic binding affinity which reflects a 1: 1 interaction between members of a binding pair (e.g., antibody and antigen). The affinity of a molecule X for its partner Y can generally be represented by the equilibrium dissociation constant (KD), which is calculated as the ratio koff/kon. See, e.g., Chen, Y., et al., (1999) /. Mol. Biol. 293:865-881. Affinity can be measured by common methods known in the art, including those described and exemplified herein, such as BIACORE™. Low-affinity antibodies generally bind antigen slowly and tend to dissociate readily, whereas high-affinity antibodies generally bind antigen faster and tend to remain bound longer. A variety of methods of measuring binding affinity are known in the art, any of which can be used for purposes of the present invention.

The present anti-ICAM-1 antibodies have binding affinities for a ICAM- 1 epitope that include a dissociation constant (KD) of less than lxlO_6M, lxlO_7M, lxlO_8M, lxlO_9M, lxlO"10M, lxlO_11M, or less than lxlO~12M. In one embodiment, the anti-ICAM-1

-7 -8 -8

antibodies have a KD of less than 10" M, less than 5x10" M, less than 10" M, less than 5x10" 9M, less than 10"9M, less than 5xl0"10M, less than 10"10M, less than 5xl0"nM, less than 10" nM, less than 5xl0"12M, or less than 10"12M. In certain embodiments, anti-ICAM-1 antibodies have binding affinities for a ICAM-1 epitope that include a dissociation constant ( D) of between lxl0"6M and lxl0"10M, lxlO"6M and lxlO"nM, lxlO"6M and lxlO~12M, lxlO"7M and lxl0"10M, lxlO"7M and lxlO_11M, lxlO~7M and lxlO"12M, lxl0"8M and lxl0"10M, lxl0"8M and lxl0_11M, lxl0"8M and lxlO"12M, l lxlO"9M and lxl0"10M, lxlO_9M and lxl0_11M, or between lxlO_9M and lxlO_12M. In certain embodiments, the In certain embodiments, , anti-IC AM- 1 antibodies have binding affinities for a ICAM-1 epitope that include a dissociation constant (KD) of between 5xl0_7M and lxlO_9M. KD is measured by BIACORE™ affinity data. In certain embodiments, KD is measured by cell binding.

In certain embodiments, the anti-IC AM- 1 antibodies are high-affinity antibodies. By "high- affinity antibody" is meant an antibody which binds to a ICAM-1 epitope with an affinity less than 10"8M (e.g., 10"9M, 10"10 M, etc.).

In certain embodiments, the anti-IC AM- 1 antibodies are described as having a binding affinity of a specific molarity or better. "Or better" when used herein refers to a stronger binding, represented by a smaller numerical KD value. For example, an antibody which has an affinity for an antigen of "0.6 nM or better", the antibody's affinity for the antigen is <0.6 nM, i.e. 0.59 nM, 0.58 nM, 0.57 nM etc. or any value less than 0.6 nM.

In certain embodiments the rate at which the anti- ICAM-1 antibodies dissociates from a ICAM-1 epitope may be more relevant than the value of the KD. In this instance the present anti-ICAM- 1 antibodies bind to a ICAM-1 with a k0f Of less than 5xl0~2 s"1, less than 10~2 s"1, less than 5xl0"3 s"1, less than 10"3 s"1, less than 5xl0"4 s"1, less than 10"4 s" 1, less than 5xl0~5 s"1, less than 10"5 s"1,. In certain other embodiments the rate at which the anti-ICAM-1 antibodies associate with a ICAM-1 epitope may be more relevant than the value of the KD. In this instance the present anti-ICAM-1 antibodies bind to a ICAM- 1 with a kon rate of at least 104 M'V1, at least 5xl04 at least 105 M'V1, at least at least 106MV.

Determination of binding affinity can be measured using the specific techniques described further in the Example section, See Example 11 and methods well known in the art. One such method includes measuring the disassociation constant "KD" by a radiolabeled antigen binding assay (RIA) performed with the Fab version of an antibody of interest and its antigen as described by the following assay that measures solution binding affinity of Fabs

125

for antigen by equilibrating Fab with a minimal concentration of ( I)-labeled antigen in the presence of a titration series of unlabeled antigen, then capturing bound antigen with an anti- Fab antibody-coated plate (see, e.g., Chen, et al., (1999) /. Mol. Biol. 293:865-881). To establish conditions for the assay, microtiter plates (e.g., Dynex) are coated overnight with 5 μg/ml of a capturing anti-Fab antibody (e.g., Cappel Labs) in 50 mM sodium carbonate (pH 9.6), and subsequently blocked with 2% (w/v) bovine serum albumin in PBS for two to five hours at room temperature (approximately 23° C). In a non-adsorbant plate (e.g., Nunc

125

#269620), 100 pM or 26 pM rJI]-anti gen are mixed with serial dilutions of a Fab of interest (e.g., consistent with assessment of an anti-VEGF antibody, Fab- 12, in Presta et al., (1997) Cancer Res. 57:4593-4599). The Fab of interest is then incubated overnight; however, the incubation may continue for a longer period (e.g., 65 hours) to insure that equilibrium is reached. Thereafter, the mixtures are transferred to the capture plate for incubation at room temperature (e.g., for one hour). The solution is then removed and the plate washed eight times with 0.1% Tween-20 in PBS. When the plates have dried, 150 μΐ/well of scintillant (e.g., MicroScint-20; Packard) is added, and the plates are counted on a Topcount gamma counter (e.g., Packard) for ten minutes. Concentrations of each Fab that give less than or equal to 20% of maximal binding are chosen for use in competitive binding assays.

In another instance the KD value may be measured by using surface plasmon resonance assays using, for example, a BIACORE™-2000 or a BIACORE™-3000 (BIAcore, Inc., Piscataway, N.J.) at 25° C with immobilized antigen CM5 chips at ~10 response units (RU). Briefly, carboxymethylated dextran biosensor chips (CM5, BIAcore Inc.) are activated with N-ethyl-N'-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and N- hydroxysuccinimide (NHS) according to the supplier's instructions. Antigen is diluted with 110 mM sodium acetate, pH 4.8, into 5 μg/ml (Ί3.2 uM) before injection at a flow rate of 5 μΐ/minute to achieve approximately 10 response units (RU) of coupled protein. Following the injection of antigen, IM ethanolamine is injected to block unreacted groups. For kinetics measurements, two-fold serial dilutions of Fab (0.78 nM to 500 nM) are injected in PBS with 0.05% Tween 20 (PBST) at 25° C. at a flow rate of approximately 25 μΐ/min. Association rates (kon) and dissociation rates (k0ff) are calculated using a simple one-to-one Langmuir binding model (BIACORE™ Evaluation Software version 3.2) by simultaneously fitting the association and dissociation sensorgram.

If the on-rate exceeds 106 M_1 S_1 by the surface plasmon resonance assay above, then the on-rate can be determined by using a fluorescent quenching technique that measures the increase or decrease in fluorescence emission intensity (excitation=295 nm; emission=340 nm, 16 nm band-pass) at 25° C of a 20 nM anti-antigen antibody (Fab form) in PBS, pH 7.2, in the presence of increasing concentrations of antigen as measured in a spectrometer, such as a stop-flow equipped spectrophometer (Aviv Instruments) or a 8000-series SLM-Aminco spectrophotometer (ThermoSpectronic) with a stir red cuvette. An "on-rate" or "rate of association" or "association rate" or "kon" according to this invention can also be determined with the same surface plasmon resonance technique described above using a BIACORE™- 2000 or a BIACORE™- 3000 (BIAcore, Inc., Piscataway, N.J.) as described above.

Methods and reagents suitable for determination of binding characteristics of an antibody of the present invention, or an altered/mutant derivative thereof (discussed below), are known in the art and/or are commercially available (U.S. Patent Nos. 6,849,425;

6,632,926; 6,294,391 ; 6,143,574). Moreover, equipment and software designed for such kinetic analyses are commercially available (e.g. BIACORE® A100, and BIACORE ® 2000 instruments; Biacore International AB, Uppsala, Sweden).

In one embodiment, a binding assay may be performed either as direct binding assays or as competition-binding assays. Binding can be detected using standard ELISA or standard Flow Cytometry assays. In a direct binding assay, a candidate antibody is tested for binding to ICAM-1 antigen. Competition-binding assay, on the other hand, assess the ability of a candidate antibody to compete with a known anti-ICAM- 1 antibody or other compound that binds ICAM-1. In general any method that permits the binding of an antibody with a ICAM- 1 that can be detected is encompassed with the scope of the present invention for detecting and measuring the binding characteristics of the antibodies. One of skill in the art will recognize these well known methods and for this reason are not provided in detail here. These methods are also utilized to screen a panel of antibodies for those providing the desired characteristics.

In certain embodiments an antibody of the invention immunospecifically binds to ICAM-1 and has one or more of the characteristics selected from the group consisting of:

(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity ( D) of less than 5 nanomolar, as assessed using DELFIA-based detection;

(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;

(c) does not substantially inhibit binding of a human ICAM-1 to LFA-1 and/or MAC- l ;

(d) can inhibit a cytopathic effect of human rhino virus on HeLa cells in culture with an EC50 of less than 0.35 nM;

(e) does not immunospecifically bind to human ICAM-2;

(f) does not immunospecifically bind to human ICAM-3;

(g) does not immunospecifically bind to human ICAM-5;

(h) does not immunospecifically bind to human VCAM-1 ;

(i) immunospecifically binds to human ICAM-1 comprising a K56M polymorphism; and

(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297. It should be understood that antibodies defined based on possessing any one or more of the foregoing properties possesses, at least, such one or more properties but may also possess other functional or structural characteristics.

(c) Functional Characteristics

In certain embodiments, the anti-ICAM- 1 antibodies of the invention alter the biological properties of ICAM- 1 and/or ICAM-1 expressing cells and/or cells expressing receptors for IC AM- 1. In one embodiment, the anti-ICAM- 1 antibodies of the invention neutralize a biological activity of ICAM-1, such as HRV infectivity and/or CV-A infectivity and/or adhesion of Plasmodium falciparum infected erythrocytes to the endothelium.

Neutralization assays are performed using methods known in the art using, in some circumstances, commercially available reagents or for example as performed in Assay 3,

Assay 7 or Example 12 described below. The neutralization of ICAM-1 is measured with an IC50 of lxlO"6 M or less, lxlO"7 M or less, lxlO"8 M or less, lxlO"9 M or less, lxlO"10 M or less and lxlO"11 M or less. In certain embodiments, the neutralization of ICAM-1 is measured with an IC50 of between lxlO"6 M and lxlO"9 M, lxlO"6 M and lxlO"10 M, lxlO"6 M and lxlO"11 M, lxlO"7 M and lxlO"9 M, lxlO"7 M and lxlO"10 M, lxlO"7 M and lxlO"11 M, lxlO"8 M and lxlO"9 M, lxlO"8 M and lxlO"10 M and lxlO"8 M and lxlO"11 M. In a further embodiment, the anti-ICAM- 1 antibodies neutralize at least one of chimpanzee ICAM-1, baboon ICAM- 1, marmoset ICAM-1, cynomolgus ICAM-1, rhesus ICAM- 1, rat ICAM-1, mouse ICAM- 1, pig ICAM-1 or other mammalian ICAM-1. The term "inhibitory concentration 50%" (abbreviated as "IC50") represents the concentration of an inhibitor (e.g., an anti-ICAM- 1 antibody of the invention) that is required for 50% inhibition of a given activity of the molecule the inhibitor targets (e.g., ICAM-1). It will be understood by one of ordinary skill in the art that a lower IC50 value corresponds to a more potent inhibitor.

The term "inhibition" as used herein, refers to any statistically significant decrease in biological activity, including full blocking of the activity. For example, "inhibition" can refer to a decrease of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% in biological activity. In one embodiment, the anti-ICAM- 1 antibodies are described as not inhibiting one or more biological activities of ICAM- 1, such as LFA- 1 binding and/or MAC- 1 binding. Accordingly, in certain embodiments, the anti-ICAM- 1 antibodies inhibit one or more biological activities of ICAM-1 by less than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In one embodiment, the anti-ICAM- 1 antibodies inhibit ICAM-1 binding to LFA by less than 20%, less than 30%, less than 40%, less than 50%, or less than 60%. In certain embodiments, the anti-IC AM- 1 antibodies may bind to a cell-surface antigen that may internalize, further carrying the antibodies into the cell. Once inside the cell, the antibodies may be released into the cytoplasm, targeted to a specific compartment, or recycled to the cell surface. In some embodiments, the antibodies of the invention bind to a cell-surface antigen that internalizes. In other embodiments, antibodies of the invention may be targeted to specific organelles or compartments of the cell. In yet other embodiments, the antibodies of the invention may be recycled to the cell surface or periphery after

internalization. In a specific embodiment, the antibody of the invention is specific for ICAM- 1.

In one embodiment, the anti-ICAM-1 antibodies of the invention exhibit a reduced antibody related toxicity as compared to an IC AM- 1 antibody that inhibits LFA- 1 binding. In another embodiment, the anti-IC AM- 1 antibodies of the invention exhibit toxicities that are at least 2 fold, or at least 3 fold, or at least 5 fold, or at least 7 fold, or a least 10 fold, or at least 20 fold, or at least 30 fold, or at least 40 fold, or at least 50 fold, or at least 60 fold, or at least 70 fold, or at least 80 fold, or at least 90 fold, or at least 100 fold, or at least 200 fold, or are between 2 fold and 10 fold, or between 5 fold and 50 fold, or between 25 fold and 100 fold, or between 75 fold and 200 fold, or between 100 and 200 fold, less than that of an antibody that inhibits LFA-1 binding. In another embodiment, the anti-ICAM-1 antibodies of the invention exhibit toxicities that are reduced by at least 10%, or at least 20%, or by at least 30%, or by at least 40%, or by at least 50%, or by at least 60%, or by at least 70%, or by at least 80%, or by at least 90%, or by at least 100%, or by at least 200%, or by at least 300%, or by at least 400%, or by at least 500% relative to an antibody that inhibits LFA-1 binding.

In certain embodiments, the antibodies of the invention block binding of ICAM-1 to HRV. In a specific embodiment, the antibodies of the invention block binding of ICAM-1 to HRV- 14 and HRV- 16. In certain embodiments, the antibodies of the invention block binding of ICAM-1 to CV-A. In a specific embodiment, the antibodies of the invention block binding of ICAM-1 to CV-A16 and/or CV-A16. In certain embodiments, the antibodies of the invention block binding of ICAM-1 to Plasmodium falciparum- f cted erythrocytes (PFIE).

In certain embodiments, the antibodies of the invention are human, humanized, chimeric or antibody fragments.

(v) Production of Anti-ICAM-1 Antibodies

The following describes exemplary techniques for the production of the antibodies useful in the present invention. Some of these techniques are described further in the Example section, See Example 11. The ICAM-1 antigen to be used for production of antibodies may be SEQ ID NO: 481 (human ICAM- 1) or an antigenic fragment thereof. In certain embodiments, the ICAM- 1 antigen to be used for production of antibodies may be SEQ ID NO: 482 or an antigenic fragment thereof. Alternatively, cells expressing ICAM- 1 at their cell surface or membranes prepared from such cells can be used to generate antibodies. The nucleotide and amino acid sequences of ICAM-1 are available as provided above.

ICAM- 1 can be produced recombinantly in an isolated form from, bacterial or eukaryotic cells using standard recombinant DNA methodology. ICAM-1 can be expressed as a tagged (e.g., epitope tag) or other fusion protein to facilitate isolation as well as identification in various assays. Antibodies or binding proteins that bind to various tags and fusion sequences are available as elaborated below. Other forms of ICAM-1 useful for generating antibodies will be apparent to those skilled in the art.

(a) Tags

Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol, 8:2159-2165 (1988)] ; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein Engineering, 3(6):547-553 (1990)] . The FLAG-peptide [Hopp et al., BioTechnology, 6: 1204-1210 (1988)] is recognized by an anti-FLAG M2 monoclonal antibody (Eastman Kodak Co., New Haven, Conn.).

Purification of a protein containing the FLAG peptide can be performed by immunoaffinity chromatography using an affinity matrix comprising the anti-FLAG M2 monoclonal antibody covalently attached to agarose (Eastman Kodak Co., New Haven, Conn.). Other tag polypeptides include the KT3 epitope peptide [Martin et al., Science, 255: 192-194 (1992)] ; an a-tubulin epitope peptide [Skinner et al., J. Biol. Chem., 266: 15163- 15166 (1991)] ; and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87:6393-6397 (1990)].

(b) Monoclonal Antibodies

Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma (Kohler et al., Nature, 256:495 (1975); Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981), recombinant, and phage display technologies, or a combination thereof. The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous or isolated antibodies, e.g., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site or multiple antigenic sites in the case of multispecific engineered antibodies. Furthermore, in contrast to polyclonal antibody preparations which include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against the same determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies. The modifier "monoclonal" is not to be construed as requiring production of the antibody by any particular method. Following is a description of representative methods for producing monoclonal antibodies which is not intended to be limiting and may be used to produce, for example, monoclonal mammalian, chimeric, humanized, human, domain, diabodies, vaccibodies, linear and multispecific antibodies. A. Hybridoma Techniques

Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art. In the hybridoma method, mice or other appropriate host animals, such as hamster, are immunized to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the antigen used for immunization. Alternatively, lymphocytes may be immunized in vitro, as is typically done when using hybridoma technology to produce human monoclonal antibodies.. After immunization (in vivo or in vitro), lymphocytes are isolated and then fused with a myeloma cell line using a suitable fusing agent or fusion partner, such as polyethylene glycol, to form a hybridoma cell (Goding, Monoclonal Antibodies: Principles and Practice, pp.59- 103 (Academic Press, 1986)). In certain embodiments, the selected myeloma cells are those that fuse efficiently, support stable high-level production of antibody by the selected antibody- producing cells, and are sensitive to a selective medium that selects against the unfused parental cells. In one aspect, the myeloma cell lines are murine myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse tumors available from the Salk Institute Cell Distribution Center, San Diego, Calif. USA, and SP-2 and derivatives e.g., X63-Ag8-653 cells available from the American Type Culture Collection, Rockville, Md. USA. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies (Kozbor, . Immunol, 133:3001 (1984); and Brodeur et al., Monoclonal Antibody Production Techniques and Applications , pp.51-63 (Marcel Dekker, Inc., New York, 1987)).

Once hybridoma cells that produce antibodies of the desired specificity, affinity, and/or activity are identified, the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, Supra). Suitable culture media for this purpose include, for example, D-MEM or RPMI-1640 medium. In addition, the hybridoma cells may be grown in vivo as ascites tumors in an animal e.g., by i.p. injection of the cells into mice.

The monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional antibody purification procedures such as, for example, affinity chromatography (e.g., using protein A or protein G-Sepharose) or ion-exchange chromatography, affinity tags, hydroxylapatite chromatography, gel electrophoresis, dialysis, etc. Exemplary purification methods are described in more detail below.

B. Recombinant DNA Techniques

Methods for producing and screening for specific antibodies using recombinant DNA technology are routine and well known in the art (e.g. US Patent No. 4,816,567). DNA encoding the monoclonal antibodies may be readily isolated and/or sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as E. coli cells, simian COS cells, Chinese Hamster Ovary (CHO) cells, or myeloma cells that do not otherwise produce antibody protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. Review articles on recombinant expression in bacteria of DNA encoding the antibody include Skerra et al., Curr. Opinion in Immunol, 5:256-262 (1993) and Pluckthun, Immunol. Revs., 130: 151-188 (1992). As described below for antibodies generated by phage display and humanization of antibodies, DNA or genetic material for recombinant antibodies can be obtained from source(s) other than hybridomas to generate antibodies of the invention.

Recombinant expression of an antibody or variant thereof generally requires construction of an expression vector containing a polynucleotide that encodes the antibody. The invention, thus, provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule, a heavy or light chain of an antibody, a heavy or light chain variable domain of an antibody or a portion thereof, or a heavy or light chain CDR, operably linked to a promoter. Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g. , US. Patent Nos. 5,981,216; 5,591,639; 5,658,759 and 5,122,464) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy, the entire light chain, or both the entire heavy and light chains.

Once the expression vector is transferred to a host cell by conventional techniques, the transfected cells are then cultured by conventional techniques to produce an antibody. Thus, the invention includes host cells containing a polynucleotide encoding an antibody of the invention or fragments thereof, or a heavy or light chain thereof, or portion thereof, or a single-chain antibody of the invention, operably linked to a heterologous promoter. In certain embodiments for the expression of double-chained antibodies, vectors encoding both the heavy and light chains may be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.

Mammalian cell lines available as hosts for expression of recombinant antibodies are well known in the art and include many immortalized cell lines available from the American Type Culture Collection (ATCC), including but not limited to Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), human epithelial kidney 293 cells, and a number of other cell lines. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products.

Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the antibody or portion thereof expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells include but are not limited to CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, W138, BT483, Hs578T, HTB2, BT20 and T47D, NSO (a murine myeloma cell line that does not endogenously produce any functional immunoglobulin chains), SP20, CRL7030 and HsS78Bst cells. In one embodiment, human cell lines developed by immortalizing human lymphocytes can be used to recombinantly produce monoclonal antibodies. In one embodiment, the human cell line PER.C6. (Crucell, Netherlands) can be used to

recombinantly produce monoclonal antibodies.

Additional cell lines which may be used as hosts for expression of recombinant antibodies include, but are not limited to, insect cells (e.g. Sf21/Sf9, Trichoplusia ni Bti- Tn5bl-4) or yeast cells (e.g. 5. cerevisiae, Pichia, US7326681 ; etc), plants cells

(US20080066200); and chicken cells (WO2008142124). In certain embodiments, antibodies of the invention are expressed in a cell line with stable expression of the antibody. Stable expression can be used for long-term, high-yield production of recombinant proteins. For example, cell lines which stably express the antibody molecule may be generated. Host cells can be transformed with an appropriately engineered vector comprising expression control elements (e.g. , promoter, enhancer, transcription terminators, polyadenylation sites, etc.), and a selectable marker gene.

Following the introduction of the foreign DNA, cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells that stably integrated the plasmid into their chromosomes to grow and form foci which in turn can be cloned and expanded into cell lines. Methods for producing stable cell lines with a high yield are well known in the art and reagents are generally available commercially.

In certain embodiments, antibodies of the invention are expressed in a cell line with transient expression of the antibody. Transient transfection is a process in which the nucleic acid introduced into a cell does not integrate into the genome or chromosomal DNA of that cell. It is in fact maintained as an extrachromosomal element, e.g. as an episome, in the cell. Transcription processes of the nucleic acid of the episome are not affected and a protein encoded by the nucleic acid of the episome is produced.

The cell line, either stable or transiently transfected, is maintained in cell culture medium and conditions well known in the art resulting in the expression and production of monoclonal antibodies. In certain embodiments, the mammalian cell culture media is based on commercially available media formulations, including, for example, DMEM or Ham's F12. In other embodiments, the cell culture media is modified to support increases in both cell growth and biologic protein expression. As used herein, the terms "cell culture medium," "culture medium," and "medium formulation" refer to a nutritive solution for the maintenance, growth, propagation, or expansion of cells in an artificial in vitro environment outside of a multicellular organism or tissue. Cell culture medium may be optimized for a specific cell culture use, including, for example, cell culture growth medium which is formulated to promote cellular growth, or cell culture production medium which is formulated to promote recombinant protein production. The terms nutrient, ingredient, and component are used interchangeably herein to refer to the constituents that make up a cell culture medium.

In one embodiment, the cell lines are maintained using a fed batch method. As used herein, "fed batch method," refers to a method by which a fed batch cell culture is supplied with additional nutrients after first being incubated with a basal medium. For example, a fed batch method may comprise adding supplemental media according to a determined feeding schedule within a given time period. Thus, a "fed batch cell culture" refers to a cell culture wherein the cells, typically mammalian, and culture medium are supplied to the culturing vessel initially and additional culture nutrients are fed, continuously or in discrete increments, to the culture during culturing, with or without periodic cell and/or product harvest before termination of culture.

The cell culture medium used and the nutrients contained therein are known to one of skill in the art. In one embodiment, the cell culture medium comprises a basal medium and at least one hydrolysate, e.g., soy-based, hydrolysate, a yeast-based hydrolysate, or a combination of the two types of hydrolysates resulting in a modified basal medium. In another embodiment, the additional nutrients may include only a basal medium, such as a concentrated basal medium, or may include only hydrolysates, or concentrated hydrolysates. Suitable basal media include, but are not limited to Dulbecco's Modified Eagle's Medium (DMEM), DME/F12, Minimal Essential Medium (MEM), Basal Medium Eagle (BME), RPMI 1640, F-10, F-12, a-Minimal Essential Medium (a-MEM), Glasgow's Minimal Essential Medium (G-MEM), PF CHO (see, e.g., CHO protein free medium (Sigma) or EX- CELL™ 325 PF CHO Serum-Free Medium for CHO Cells Protein-Free (SAFC Bioscience), and Iscove's Modified Dulbecco's Medium. Other examples of basal media which may be used in the invention include BME Basal Medium (Gibco-Invitrogen; see also Eagle, H (1965) Proc. Soc. Exp. Biol. Med. 89, 36); Dulbecco's Modified Eagle Medium (DMEM, powder) (Gibco-Invitrogen (# 31600); see also Dulbecco and Freeman (1959) Virology 8, 396; Smith et al. (1960) Virology 12, 185. Tissue Culture Standards Committee, In Vitro 6:2, 93); CMRL 1066 Medium (Gibco-Invitrogen (#11530); see also Parker R. C. et al (1957) Special Publications, N.Y. Academy of Sciences, 5, 303).

In certain embodiments, the basal medium may be is serum-free, meaning that the medium contains no serum (e.g., fetal bovine serum (FBS), horse serum, goat serum, or any other animal-derived serum known to one skilled in the art) or animal protein free media or chemically defined media.

The basal medium may be modified in order to remove certain non-nutritional components found in standard basal medium, such as various inorganic and organic buffers, surfactant(s), and sodium chloride. Removing such components from basal cell medium allows an increased concentration of the remaining nutritional components, and may improve overall cell growth and protein expression. In addition, omitted components may be added back into the cell culture medium containing the modified basal cell medium according to the requirements of the cell culture conditions. In certain embodiments, the cell culture medium contains a modified basal cell medium, and at least one of the following nutrients, an iron source, a recombinant growth factor; a buffer; a surfactant; an osmolarity regulator; an energy source; and non-animal hydrolysates. In addition, the modified basal cell medium may optionally contain amino acids, vitamins, or a combination of both amino acids and vitamins. In another embodiment, the modified basal medium further contains glutamine, e.g., L- glutamine, and/or methotrexate.

In certain embodiments, antibody production is conducted in large quantity by a bioreactor process using fed-batch, batch, perfusion or continuous feed bioreactor methods known in the art. Large-scale bioreactors have at least 1000 liters of capacity, preferably about 1,000 to 100,000 liters of capacity. These bioreactors may use agitator impellers to distribute oxygen and nutrients. Small scale bioreactors refers generally to cell culturing in no more than approximately 100 liters in volumetric capacity, and can range from about 1 liter to about 100 liters. Alternatively, single-use bioreactors (SUB) may be used for either large-scale or small scale culturing.

Temperature, pH, agitation, aeration and inoculum density will vary depending upon the host cells used and the recombinant protein to be expressed. For example, a recombinant protein cell culture may be maintained at a temperature between 30 and 45 degrees Celsius. The pH of the culture medium may be monitored during the culture process such that the pH stays at an optimum level, which may be for certain host cells, within a pH range of 6.0 to 8.0. An impellor driven mixing may be used for such culture methods for agitation. The rotational speed of the impellor may be approximately 50 to 200 cm/sec tip speed, but other airlift or other mixing/aeration systems known in the art may be used, depending on the type of host cell being cultured. Sufficient aeration is provided to maintain a dissolved oxygen concentration of approximately 20% to 80% air saturation in the culture, again, depending upon the selected host cell being cultured. Alternatively, a bioreactor may sparge air or oxygen directly into the culture medium. Other methods of oxygen supply exist, including bubble-free aeration systems employing hollow fiber membrane aerators.

C. Phage Display Techniques

In another embodiment, monoclonal antibodies or antibody fragments can be isolated from antibody phage libraries generated using the techniques described in McCafferty et al., Nature, 348:552-554 (1990). Clackson et al., Nature, 352:624-628 (1991) and Marks et al., J. Mol. Biol., 222:581-597 (1991). In such methods antibodies of the invention can be isolated by screening of a recombinant combinatorial antibody library, preferably a scFv phage display library, prepared using human VL and VH cDNAs prepared from mRNA derived from human lymphocytes. Methodologies for preparing and screening such libraries are known in the art. In addition to commercially available kits for generating phage display libraries (e.g., the Pharmacia Recombinant Phage Antibody System, catalog no. 27-9400-01; and the Stratagene SURFZAP™ phage display kit, catalog no. 240612), examples of methods and reagents particularly amenable for use in generating and screening antibody display libraries can be found in, for example, US Patent Nos. 6,248,516; US 6,545,142; 6,291, 158; 6,291, 1591; 6,291,160; 6,291,161 ; 6,680,192; 5,969,108; 6,172, 197; 6,806,079; 5,885,793; 6,521,404; 6,544,731 ; 6,555,313; 6,593,081; 6,582,915; 7, 195,866. Thus, these techniques are viable alternatives to traditional monoclonal antibody hybridoma techniques for generation and isolation of monoclonal antibodies.

In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In a particular embodiment, such phage can be utilized to display antigen-binding domains expressed from a repertoire or combinatorial antibody library (e.g., human or murine). Phage expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Phage used in these methods are typically filamentous phage including fd and M13 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein.

As described in the above references, after phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, humanized antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below. For example, techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments can also be employed using methods known in the art such as those disclosed in PCT publication WO 92/22324; Mullinax et ah, BioTechniques 12(6):864-869 (1992);; and Better et al, Science 240: 1041-1043 (1988).

Examples of techniques which can be used to produce single-chain Fvs and antibodies include those described in U.S. Pat. Nos. 4,946,778 and 5,258,498. Thus, techniques described above and those well known in the art can be used to generate recombinant antibodies wherein the binding domain, e.g. ScFv, was isolated from a phage display library. (c) Antibody Purification and Isolation

Once an antibody molecule has been produced by recombinant or hybridoma expression, it may be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigens Protein A or Protein G, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. Further, the antibodies of the present invention or fragments thereof may be fused to heterologous polypeptide sequences (referred to herein as "tags") described above or otherwise known in the art to facilitate purification.

When using recombinant techniques, the antibody can be produced intracellularly, in the periplasmic space, or directly secreted into the medium. If the antibody is produced intracellularly, as a first step, the particulate debris, either host cells or lysed fragments, is removed, for example, by centrifugation or ultrafiltration. Carter et ah, Bio/Technology, 10: 163-167 (1992) describe a procedure for isolating antibodies which are secreted into the periplasmic space of E. coli. Where the antibody is secreted into the medium, supernatants from such expression systems are generally first concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. A protease inhibitor such as PMSF may be included in any of the foregoing steps to inhibit proteolysis and antibiotics may be included to prevent the growth of adventitious

contaminants.

The antibody composition prepared from the cells can be purified using, for example, hydroxylapatite chromatography, hydrophobic interaction chromatography, ion exchange chromatography, gel electrophoresis, dialysis, and/or affinity chromatography either alone or in combination with other purification steps. The suitability of protein A as an affinity ligand depends on the species and isotype of any immunoglobulin Fc domain that is present in the antibody and will be understood by one of skill in the art. The matrix to which the affinity ligand is attached is most often agarose, but other matrices are available. Mechanically stable matrices such as controlled pore glass or poly(styrenedivinyl)benzene allow for faster flow rates and shorter processing times than can be achieved with agarose. Where the antibody comprises a CH3 domain, the Bakerbond ABX resin (J.T. Baker, Phillipsburg, NJ) is useful for purification. Other techniques for protein purification such as fractionation on an ion- exchange column, ethanol precipitation, Reverse Phase HPLC, chromatography on silica, chromatography on heparin, SEPHAROSE chromatography on an anion or cation exchange resin (such as a polyaspartic acid column), chromatofocusing, SDS-PAGE, and ammonium sulfate precipitation are also available depending on the antibody to be recovered.

Following any preliminary purification step(s), the mixture comprising the antibody of interest and contaminants may be subjected to low pH hydrophobic interaction

chromatography using an elution buffer at a pH between about 2.5-4.5, and performed at low salt concentrations (e.g., from about 0-0.25 M salt).

Thus, in certain embodiments is provided antibodies of the invention that are substantially purified/isolated. In one embodiment, these isolated/purified recombinantly expressed antibodies may be administered to a patient to mediate a prophylactic or therapeutic effect. In another embodiment these isolated/purified antibodies may be used to diagnose a ICAM-1 mediated disease.

(d) Humanized and Chimeric Antibodies

In certain embodiments, the antibodies of the invention are humanized antibodies, which are generated using methods well known in the art. Humanized antibodies are antibody molecules derived from a non-human species antibody (also referred to herein as a donor antibody) that bind the desired antigen having one or more complementarity determining regions (CDRs) from the non-human species and a framework region from a human immunoglobulin molecule (also referred to herein as an acceptor antibody). Often, framework residues in the human framework regions will be substituted with the

corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding and/or reduce immunogenicity. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g.,, Riechmann et ah, Nature 332:323 (1988)). In practice, and in certain embodiments, humanized antibodies are typically human antibodies in which some hypervariable region residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. In alternative embodiments, the FR residues are fully human residues.

Humanization can be essentially performed following the method of Winter and co- workers (Jones et al., Nature, 321 :522-525 (1986); Reichmann et al., Supra; Verhoeyen et al., Science, 239: 1534-1536 (1988)), by substituting hypervariable region sequences for the corresponding sequences of a human antibody. Specifically, humanized antibodies may be prepared by methods well known in the art including CDR grafting approaches (see, e.g., US Patent No. 6,548,640), veneering or resurfacing (US Patent Nos. 5,639,641 and 6,797,492; Studnicka et al, Protein Engineering 7(6):805-814 (1994); Roguska. et al, PNAS 91:969- 973 (1994)), chain shuffling strategies (see e.g., U.S. Patent No. 5,565,332; Rader et al., Proc. Natl. Acad. Sci. USA (1998) 95:8910-8915), molecular modeling strategies (U.S. Patent No. 5,639,641), and the like. These general approaches may be combined with standard mutagenesis and recombinant synthesis techniques to produce anti-IC AM- 1 antibodies with desired properties.

CDR grafting is performed by replacing one or more CDRs of an acceptor antibody (e.g., a human antibody) with one or more CDRs of a donor antibody (e.g., a non-human antibody). Acceptor antibodies may be selected based on similarity of framework residues between a candidate acceptor antibody and a donor antibody and may be further modified to introduce similar residues. Following CDR grafting, additional changes may be made in the donor and/or acceptor sequences to optimize antibody binding and functionality.

Grafting of abbreviated CDR regions is a related approach. Abbreviated CDR regions include the specificity-determining residues and adjacent amino acids, including those at positions 27d-34, 50-55 and 89-96 in the light chain, and at positions 31-35b, 50-58, and 95- 101 in the heavy chain. See (Padlan et al. (1995) FASEB J. 9: 133-9). Grafting of specificity- determining residues (SDRs) is premised on the understanding that the binding specificity and affinity of an antibody combining site is determined by the most highly variable residues within each of the CDR regions. Analysis of the three-dimensional structures of antibody- antigen complexes, combined with analysis of the available amino acid sequence data was used to model sequence variability based on structural dissimilarity of amino acid residues that occur at each position within the CDR. Minimally immunogenic polypeptide sequences consisting of contact residues, which are referred to as SDRs, are identified and grafted onto human framework regions.

Veneering or resurfacing is based on the concept of reducing potentially

immunogenic amino acid sequences in a rodent or other non-human antibody by resurfacing the solvent accessible exterior of the antibody with human amino acid sequences. Thus, veneered antibodies appear less foreign to human cells. A non-human antibody is veneered by (1) identifying exposed exterior framework region residues in the non-human antibody, which are different from those at the same positions in framework regions of a human antibody, and (2) replacing the identified residues with amino acids that typically occupy these same positions in human antibodies. By definition, humanized antibodies are chimeric antibodies. Chimeric antibodies are antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while another portion of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (e.g., Morrison et al., Proc. Natl. Acad. Sci. USA, 81 :6851-6855 (1984)). Chimeric antibodies of interest herein include "primatized" antibodies comprising variable domain antigen-binding sequences derived from a nonhuman primate (e.g. , Old World Monkey, such as baboon, rhesus or cynomolgus monkey) and human constant region sequences (U.S. Patent No. 5,693,780).

(e) Human Antibodies

As an alternative to humanization, human antibodies can be generated using methods well known in the art. Human antibodies avoid some of the problems associated with antibodies that possess murine or rat variable and/or constant regions. The presence of such murine or rat derived proteins can lead to the rapid clearance of the antibodies or can lead to the generation of an immune response against the antibody by a patient. In order to avoid the utilization of murine or rat derived antibodies, fully human antibodies can be generated through the introduction of functional human antibody loci into a rodent, other mammal or animal so that the rodent, other mammal or animal produces fully human antibodies.

For example, it is now possible to produce transgenic animals (e.g., mice) that are capable, upon immunization, of producing a full repertoire of human antibodies in the absence of endogenous immunoglobulin production. For example, it has been described that the homozygous deletion of the antibody heavy-chain joining region (½) gene in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of the human germ-line immunoglobulin gene array into such germ- line mutant mice will result in the production of human antibodies upon antigen challenge. See, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et al., Nature, 362:255-258 (1993); Bruggemann et al., Year in Immuno., 7:33 (1993); U.S. Pat. Nos.

5,545,806, 5,569,825, 5,591,669 (all of GenPharm); U.S. Pat. No. 5,545,807; and WO

97/17852. In practice, the use of XENOMOUSE® strains of mice that have been engineered to contain up to but less than 1000 kb-sized germline configured fragments of the human heavy chain locus and kappa light chain locus. See Mendez et al. Nature Genetics 15: 146-156 (1997) and Green and Jakobovits J. Exp. Med. 188:483-495 (1998). The XENOMOUSE® strains are available from Amgen, Inc. (Fremont, Calif.).

The production of the XENOMOUSE® strains of mice and antibodies produced in those mice is further discussed and delineated in U.S. Patent Nos. 6,673,986; 7,049,426; 6,833,268; 6, 162,963, 6, 150,584, 6,114,598, 6,075,181, 6,657,103; 6,713,610 and 5,939,598;

US Publication Nos. 2004/0010810; 2003/0229905; 2004/0093622; 2005/0054055;

2005/0076395; and 2006/0040363.

Essentially, XENOMOUSE® lines of mice are immunized with an antigen of interest

(e.g. ICAM- 1), lymphatic cells (such as B-cells) are recovered from the hyper-immunized mice, and the recovered lymphocytes are fused with a myeloid-type cell line to prepare immortal hybridoma cell lines using techniques described above an well known in the art.

These hybridoma cell lines are screened and selected to identify hybridoma cell lines that produced antibodies specific to the antigen of interest.

In an alternative approach, others, including GenPharm International, Inc., have utilized a "minilocus" approach. In the minilocus approach, an exogenous Ig locus is mimicked through the inclusion of pieces (individual genes) from the Ig locus. Thus, one or more VH genes, one or more DH genes, one or more JH genes, a mu constant region, and usually a second constant region (preferably a gamma constant region) are formed into a construct for insertion into an animal. This approach is described in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,625,825; 5,625,126; 5,633,425; 5,661,016; 5,770,429; 5,789,650; 5,814,318;

5,877,397; 5,874,299; 6,255,458; 5,591,669; 6,023,010; 5,612,205; 5,721,367; 5,789,215;

5,643,763; and 5,981,175.

Kirin has also demonstrated the generation of human antibodies from mice in which, through microcell fusion, large pieces of chromosomes, or entire chromosomes, have been introduced. See Patent No. 6,632,976. Additionally, KM™— mice, which are the result of cross-breeding of Kirin's Tc mice with Medarex's minilocus (Humab) mice have been generated. These mice possess the human IgH transchromosome of the Kirin mice and the kappa chain transgene of the Genpharm mice (Ishida et al., Cloning Stem Cells, (2002) 4:91-

102).

Human antibodies can also be derived by in vitro methods, including but not limited to those exemplified in Examples 1-6 and 11. Suitable examples include but are not limited to phage display (Medlmmune (formerly CAT), Morphosys, Dyax, Biosite/Medarex, Xoma, Symphogen, Alexion (formerly Proliferon), Affimed) ribosome display (Medlmmune (formerly CAT)), yeast display, and the like. The phage display technology (See e.g., US Patent No. 5,969,108) can be used to produce human antibodies and antibody fragments in vitro, from immunoglobulin variable (V) domain gene repertoires from unimmunized donors. According to this technique, antibody V domain genes are cloned in-frame into either a major or minor coat protein gene of a filamentous bacteriophage, such as Ml 3 or fd, and displayed as functional antibody fragments on the surface of the phage particle. Because the

filamentous particle contains a single-stranded DNA copy of the phage genome, selections based on the functional properties of the antibody also result in selection of the gene encoding the antibody exhibiting those properties. Thus, the phage mimics some of the properties of the B-cell. Phage display can be performed in a variety of formats, reviewed in, e.g., Johnson, Kevin S. and Chiswell, David J., Current Opinion in Structural Biology 3:564- 571 (1993). Several sources of V-gene segments can be used for phage display. Clackson et al., Nature, 352:624-628 (1991) isolated a diverse array of anti-oxazolone antibodies from a small random combinatorial library of V genes derived from the spleens of immunized mice. A repertoire of V genes from unimmunized human donors can be constructed and antibodies to a diverse array of antigens (including self-antigens) can be isolated essentially following the techniques described by Marks et al., /. Mol. Biol. 222:581-597 (1991), or Griffith et al., EMBO J. 12:725-734 (1993). See, also, U.S. Pat. Nos. 5,565,332 and 5,573,905.

As discussed above, human antibodies may also be generated by in vitro activated B cells (see U.S. Pat. Nos. 5,567,610 and 5,229,275).

Immunoglobulin genes undergo various modifications during maturation of the immune response, including recombination between V, D and J gene segments, isotype switching, and hypermutation in the variable regions. Recombination and somatic hypermutation are the foundation for generation of antibody diversity and affinity maturation, but they can also generate sequence liabilities that may make commercial production of such immunoglobulins as therapeutic agents difficult or increase the immunogenicity risk of the antibody. In general, mutations in CDR regions are likely to contribute to improved affinity and function, while mutations in framework regions may increase the risk of

immunogenicity. This risk can be reduced by reverting framework mutations to germline while ensuring that activity of the antibody is not adversely impacted. The diversification processes may also generate some structural liabilities or these structural liabilities may exist within germline sequences contributing to the heavy and light chain variable domains.

Regardless of the source, it may be desirable to remove potential structural liabilities that may result in instability, aggregation, heterogeneity of product, or increased immunogenicity. Examples of undesirable liabilities include unpaired cysteines (which may lead to disulfide bond scrambling, or variable sulfhydryl adduct formation), N-linked glycosylation sites (resulting in heterogeneity of structure and activity), as well as deamidation (e.g. NG, NS), isomerization (DG), oxidation (exposed methionine), and hydrolysis (DP) sites.

Accordingly, in order to reduce the risk of immunogenicity and improve

pharmaceutical properties of the antibodies of the invention (see Example 4), it may be desirable to revert a framework sequence to germline, revert a CDR to germline, and/or remove a structural liability.

(f) Antibody Fragments

In certain embodiments, the present antibodies are antibody fragments or antibodies comprising these fragments. The antibody fragment comprises a portion of the full length antibody, which generally is the antigen binding or variable region thereof. Examples of antibody fragments include Fab, Fab', F(ab')2, Fd and Fv fragments. Diabodies; linear antibodies (U.S. Pat. No. 5,641,870); single-chain antibody molecules; and multispecific antibodies are antibodies formed from these antibody fragments.

Traditionally, these fragments were derived via proteolytic digestion of intact antibodies using techniques well known in the art. However, these fragments can now be produced directly by recombinant host cells. Fab, Fv and scFv antibody fragments can all be expressed in and secreted from E. coli, thus allowing the facile production of large amounts of these fragments. In one embodiment, the antibody fragments can be isolated from the antibody phage libraries discussed above. Alternatively, Fab'-SH fragments can also be directly recovered from E. coli and chemically coupled to form F(ab')2 fragments (Carter et ah , Bio/Technology, 10: 163-167 (1992)). According to another approach, F(ab')2 fragments can be isolated directly from recombinant host cell culture. Other techniques for the production of antibody fragments will be apparent to the skilled practitioner. In other embodiments, the antibody of choice is a single-chain Fv fragment (scFv). In certain embodiments, the antibody is not a Fab fragment. Fv and scFv are the only species with intact combining sites that are devoid of constant regions; thus, they are suitable for reduced nonspecific binding during in vivo use. scFv fusion proteins may be constructed to yield fusion of an effector protein at either the amino or the carboxy terminus of an scFv.

In certain embodiments, the present antibodies are domain antibodies, e.g. , antibodies containing the small functional binding units of antibodies, corresponding to the variable regions of the heavy (VH) or light (VL) chains of human antibodies. Examples of domain antibodies include, but are not limited to, those available from Domantis that are specific to therapeutic targets (see, for example, WO04/058821; WO04/081026; WO04/003019;

WO03/002609; U.S. Patent Nos. 6,291,158; 6,582,915; 6,696,245; and 6,593,081).

Commercially available libraries of domain antibodies can be used to identify anti-IC AM- 1 domain antibodies. In certain embodiments, anti-IC AM- 1 antibodies comprise a ICAM-1 functional binding unit and an Fc gamma receptor functional binding unit.

In certain embodiments of the invention, the present antibodies are vaccibodies.

Vaccibodies are dimeric polypeptides. Each monomer of a vaccibody consists of a scFv with specificity for a surface molecule on APC connected through a hinge region and a C 3 domain to a second scFv. In other embodiments of the invention, vaccibodies containing as one of the scFv's an anti-ICAM-1 antibody fragment may be used to juxtapose those cells to be destroyed and an effector cell that mediates ADCC. For example, see, Bogen et al, U.S.

Patent Application Publication No. 2004/0253238.

In certain embodiments of the invention, the present antibodies are linear antibodies.

Linear antibodies comprise a pair of tandem Fd segments (VH-CHI-VH-CHI) which form a pair of antigen-binding regions. Linear antibodies can be bispecific or monospecific. See, Zapata et al, Protein Eng., 8(10): 1057-1062 (1995).

(g) Bispecific Antibodies

Bispecific antibodies are antibodies that have binding specificities for at least two different epitopes. Exemplary bispecific antibodies may bind to two different epitopes of the ICAM-1 protein. Other such antibodies may combine a ICAM-1 binding site with a binding site for another protein. Alternatively, an anti-ICAM-1 arm may be combined with an arm which binds to a triggering molecule on a leukocyte such as a T-cell receptor molecule (e.g. CD3), or Fc receptors for IgG (FcyR), such as FcyRI (CD64), FcyRII (CD32) and FcyRIII (CD16), so as to focus and localize cellular defense mechanisms to the ICAM-l-expressing cell. Bispecific antibodies may also be used to localize cytotoxic agents to cells which express ICAM-1. These antibodies possess a ICAM-1 -binding arm and an arm which binds the cytotoxic agent (e.g. saporin, anti-interferon-a, vinca alkaloid, ricin A chain, methotrexate or radioactive isotope hapten). Bispecific antibodies can be prepared as full length antibodies or antibody fragments (e.g. F(ab')2 bispecific antibodies). Methods for making bispecific antibodies are known in the art. {See, for example, Millstein et al, Nature, 305:537-539 (1983); Traunecker et al, EMBO J., 10:3655-3659 (1991); Suresh et al, Methods in

Enzymology, 121:210 (1986); Kostelny et al, J. Immunol, 148(5):1547-1553 (1992);

Hollinger et al, Proc. Natl Acad. Set USA, 90:6444-6448 (1993); Gruber et al, J. Immunol, 152:5368 (1994); U.S. Patent Nos. 4,474,893; 4,714,681 ; 4,925,648; 5,573,920; 5,601,819; 5,731, 168; 4,676,980; 5,897,861 ; 5,660,827; 5,811,267; 5,849,877; 5,948,647; 5,959,084; 6,106,833; 6, 143,873 and 4,676,980, WO 94/04690; and WO 92/20373.)

Traditional production of full length bispecific antibodies is based on the co- expression of two immunoglobulin heavy chain-light chain pairs, where the two chains have different specificities (Millstein et al., Nature, 305:537-539 (1983)). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule, which is usually done by affinity chromatography steps, is rather cumbersome, and the product yields are low. Similar procedures are disclosed in WO 93/08829, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).

According to a different approach, antibody variable domains with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences. Preferably, the fusion is with an Ig heavy chain constant domain, comprising at least part of the hinge, CH , and CH3 regions. It is preferred to have the first heavy-chain constant region (CHI) containing the site necessary for light chain bonding, present in at least one of the fusions. DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are co-transfected into a suitable host cell. This provides for greater flexibility in adjusting the mutual proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yield of the desired bispecific antibody. It is, however, possible to insert the coding sequences for two or all three polypeptide chains into a single expression vector when the expression of at least two polypeptide chains in equal ratios results in high yields or when the ratios have no significant affect on the yield of the desired chain combination.

In one embodiment of this approach, the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. This asymmetric structure may facilitate the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 121 :210 (1986). According to another approach described in U.S. Pat. No. 5,731,168, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture. The preferred interface comprises at least a part of the CH3 domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g. tyrosine or tryptophan). Compensatory "cavities" of identical or similar size to the large side chain(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e.g. alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end- products such as homodimers.

Bispecific antibodies include cross-linked or "heteroconjugate" antibodies. For example, one of the antibodies in the heteroconjugate can be coupled to avidin, the other to biotin. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Pat. No. 4,676,980), and for treatment of HIV infection (US Patent No. 5,897,861). Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Pat. No. 4,676,980, along with a number of cross-linking techniques.

Techniques for generating bispecific antibodies from antibody fragments have also been described in the literature. For example, bispecific antibodies can be prepared using chemical linkage. Brennan et al., Science, 229: 81 (1985) describe a procedure wherein intact antibodies are proteolytic ally cleaved to generate F(ab')2 fragments. These fragments are reduced in the presence of the dithiol complexing agent, sodium arsenite, to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The Fab' fragments generated are then converted to thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB derivatives is then reconverted to the Fab '-thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody. The bispecific antibodies produced can be used as agents for the selective immobilization of enzymes.

Recent progress has facilitated the direct recovery of Fab'-SH fragments from E. coli, which can be chemically coupled to form bispecific antibodies. Shalaby et al., . Exp. Med., 175: 217-225 (1992) describe the production of a fully humanized bispecific antibody F(ab')2 molecule. Each Fab' fragment was separately secreted from E. coli and subjected to directed chemical coupling in vitro to form the bispecific antibody. The bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets.

Various techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al., . Immunol, 148(5): 1547-1553 (1992). The leucine zipper peptides from the Fos and Jun proteins were linked to the Fab' portions of two different antibodies by gene fusion. The antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody

heterodimers. This method can also be utilized for the production of antibody homodimers. The "diabody" technology described by Hollinger et al., Proc. Natl. Acad. Sci USA, 90:6444- 6448 ( 1993) has provided an alternative mechanism for making bispecific antibody fragments. The fragments comprise a VH connected to a VLby a linker which is too short to allow pairing between the two domains on the same chain. Accordingly, the VH nd VL domains of one fragment are forced to pair with the complementary VL and VH domains of another fragment, thereby forming two antigen-binding sites. Another strategy for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See Gruber et al., /. Immunol, 152:5368 (1994) and US Patent Nos. 5,591,828; 4,946,778; 5,455,030; and 5,869,620.

Antibodies with more than two valencies are contemplated. For example, trispecific antibodies can be prepared, Tutt et al. /. Immunol. 147: 60 (1991), and multispecific valencies US Patent No. 5,258,498.

(h) Other Amino Acid Sequence Modifications

In addition to the above described human, humanized and/or chimeric antibodies, the present invention also encompasses further modifications and, their variants and fragments thereof, of the anti-ICAM- 1 antibodies of the invention comprising one or more amino acid residues and/or polypeptide substitutions, additions and/or deletions in the variable light (VL) domain and/or variable heavy (VH) domain and/or Fc region and post translational modifications. Included in these modifications are antibody conjugates wherein an antibody has been covalently attached to a moiety. Moieties suitable for attachment to the antibodies include but are not limited to, proteins, peptides, drugs, labels, and cytotoxins. These changes to the antibodies may be made to alter or fine tune the characteristics biochemical, binding and/or functional) of the antibodies as is appropriate for treatment and/or diagnosis of ICAM-1 mediated diseases. Methods for forming conjugates, making amino acid and/or polypeptide changes and post-translational modifications are well known in the art, some of which are detailed below. The following description is not intended to be limiting, but instead a non-limiting description of some embodiments, more of which will be obvious to one of skill in the art. It is also understood that some of the following methods were used to develop the human, humanized and/or chimeric antibody sequences described above. Any combination of deletion, insertion, and substitution is made to arrive at the final construct, provided that the final construct possesses the desired characteristics.

Amino acid changes to the antibodies necessarily results in sequences that are less than 100% identical to the above identified antibody sequences or parent antibody sequence. In certain embodiments, in this context, the antibodies many have about 75% to about 95% sequence identity to the amino acid sequence of either the heavy or light chain variable domain of an anti-ICAM- 1 antibody as described herein. Thus, in one embodiment a modified antibody may have an amino acid sequence having at least 75%, 80%, 85%, 90%, or 95% amino acid sequence identity or similarity with the amino acid sequence of either the heavy or light chain variable domain of an anti-ICAM-1 antibody as described herein. In another embodiment, an altered antibody may have an amino acid sequence having at least 75%, 80%, 85%, 90%, or 95% amino acid sequence identity or similarity with the amino acid sequence of the heavy or light chain CDR1, CDR2, or CDR3 of an anti-ICAM- 1 antibody as described herein. In another embodiment, an altered antibody may have an amino acid sequence having at least 75%, 80%, 85%, 90%, or 95% amino acid sequence identity or similarity with the amino acid sequence of the heavy or light chain FRl, FR2, FR3 or FR4 of an anti-ICAM-1 antibody as described herein.

In certain embodiments, altered antibodies are generated by one or more amino acid alterations (e.g. , substitutions, deletion and/or additions) introduced in one or more of the variable regions of the antibody. In another embodiment, the amino acid alterations are introduced in the framework regions. One or more alterations of framework region residues may result in an improvement in the binding affinity of the antibody for the antigen. This may be especially true when these changes are made to humanized antibodies wherein the framework region may be from a different species than the CDR regions. Examples of framework region residues to modify include those which non-covalently bind antigen directly (Amit et al., Science, 233:747-753 (1986)); interact with/effect the conformation of a CDR (Chothia et al., J. Mol. Biol., 196:901-917 (1987)); and/or participate in the VL-VH interface (US Patent Nos. 5,225,539 and 6,548,640). In one embodiment, from about one to about five framework residues may be altered. Sometimes, this may be sufficient to yield an antibody mutant suitable for use in preclinical trials, even where none of the hypervariable region residues have been altered. Normally, however, an altered antibody will comprise additional hypervariable region alteration(s). In certain embodiments, the hypervariable region residues may be changed randomly, especially where the starting binding affinity of an anti-ICAM-1 antibody for the antigen from the second mammalian species is such that such randomly produced antibodies can be readily screened.

One useful procedure for generating altered antibodies is called "alanine scanning mutagenesis" (Cunningham and Wells, Science, 244:1081-1085 (1989)). In this method, one or more of the hypervariable region residue(s) are replaced by alanine or polyalanine residue(s) to alter the interaction of the amino acids with the ICAM-1. Those hypervariable region residue(s) demonstrating functional sensitivity to the substitutions then are refined by introducing additional or other mutations at or for the sites of substitution. Thus, while the site for introducing an amino acid sequence variation is predetermined, the nature of the mutation per se need not be predetermined. The Ala-mutants produced this way are screened for their biological activity as described herein.

In certain embodiments the substitutional variant involves substituting one or more hypervariable region residues of a parent antibody (e.g. a humanized or human antibody). Generally, the resulting variant(s) selected for further development will have improved biological properties relative to the parent antibody from which they are generated. A convenient way for generating such substitutional variants involves affinity maturation using phage display (Hawkins et al, J. Mol. Biol, 254:889-896 (1992) and Lowman et al, Biochemistry, 30(45): 10832-10837 (1991)). Briefly, several hypervariable region sites {e.g., 6-7 sites) are mutated to generate all possible amino acid substitutions at each site. The antibody mutants thus generated are displayed in a monovalent fashion from filamentous phage particles as fusions to the gene III product of Ml 3 packaged within each particle. The phage-displayed mutants are then screened for their biological activity (e.g., binding affinity) as herein disclosed.

Mutations in antibody sequences may include substitutions, deletions, including internal deletions, additions, including additions yielding fusion proteins, or conservative substitutions of amino acid residues within and/or adjacent to the amino acid sequence, but that result in a "silent" change, in that the change produces a functionally equivalent anti- ICAM- 1 antibody. Conservative amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. For example, non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid. In addition, glycine and proline are residues that can influence chain orientation. Non- conservative substitutions will entail exchanging a member of one of these classes for a member of another class. Furthermore, if desired, non-classical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the antibody sequence. Non-classical amino acids include, but are not limited to, the D-isomers of the common amino acids, a -amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, γ- Abu, ε-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, cysteic acid, t- butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogs in general.

In another embodiment, any cysteine residue not involved in maintaining the proper conformation of the anti-IC AM- 1 antibody also may be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking.

Conversely, cysteine bond(s) may be added to the antibody to improve its stability

(particularly where the antibody is an antibody fragment such as an Fv fragment).

In certain embodiments of the invention, an antibody can be modified to produce fusion proteins; i.e. , the antibody, or a fragment thereof, fused to a heterologous protein, polypeptide or peptide. In certain embodiments, the protein fused to the portion of an antibody is an enzyme component of Antibody-Directed Enzyme Prodrug Therapy (ADEPT). Examples of other proteins or polypeptides that can be engineered as a fusion protein with an antibody include, but are not limited to toxins such as ricin, abrin, ribonuclease, DNase I, Staphylococcal enterotoxin-A, pokeweed anti- viral protein, gelonin, diphtherin toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin. See, for example, Pastan et ah, Cell, 47:641 (1986), and Goldenberg et al., Cancer Journal for Clinicians, 44:43 (1994).

Enzymatically active toxins and fragments thereof which can be used include diphtheria A chain, non-binding active fragments of diphtheria toxin, exotoxin A chain (from

Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin and the tricothecenes. See, for example, WO 93/21232.

Additional fusion proteins may be generated through the techniques of gene-shuffling, motif- shuffling, exon- shuffling, and/or codon- shuffling (collectively referred to as "DNA shuffling"). DNA shuffling may be employed to alter the characteristics of the antibody or fragments thereof (e.g., an antibody or a fragment thereof with higher affinities and lower dissociation rates). See, generally, U.S. Patent Nos. 5,605,793; 5,811,238; 5,830,721;

5,834,252; and 5,837,458, and Patten et al, 1997, Curr. Opinion Biotechnol, 8:724-33 ; Harayama, 1998, Trends Biotechnol. 16(2):76-82; Hansson et al, 1999, . Mol. Biol, 287:265-76; and Lorenzo and Blasco, 1998, Biotechniques 24(2):308- 313. The antibody can further be a binding-domain immunoglobulin fusion protein as described in U.S. Publication 2003/0118592, and PCT Publication WO 02/056910.

(A) Variant Fc Regions

It is known that variants of the Fc region (e.g., amino acid substitutions and/or additions and/or deletions) enhance or diminish effector function of the antibody (See e.g., U.S. Patent Nos. 5,624,821; 5,885,573; 6,538,124; 7,317,091; 5,648,260; 6,538,124; WO 03/074679; WO 04/029207; WO 04/099249; WO 99/58572; US Publication No.

2006/0134105; 2004/0132101; 2006/0008883) and may alter the pharmacokinetic properties (e.g. half-life) of the antibody (see, U.S. patents 6,277,375 and 7,083,784). Thus, in certain embodiments, the anti-IC AM- 1 antibodies of the invention comprise an altered Fc region (also referred to herein as "variant Fc region") in which one or more alterations have been made in the Fc region in order to change functional and/or pharmacokinetic properties of the antibodies. Such alterations may result in a decrease or increase of Clq binding and complement dependent cytotoxicity (CDC) or of FcyR binding, for IgG, and antibody- dependent cellular cytotoxicity (ADCC), or antibody dependent cell-mediated phagocytosis (ADCP). The present invention encompasses the antibodies described herein with variant Fc regions wherein changes have been made to fine tune the effector function, enhancing or diminishing, providing a desired effector function. Accordingly, in one embodiment of the invention, the anti-ICAM- 1 antibodies of the invention comprise a variant Fc region (i.e., Fc regions that have been altered as discussed below). Anti-ICAM-1 antibodies of the invention comprising a variant Fc region are also referred to here as "Fc variant antibodies." As used herein native refers to the unmodified parental sequence and the antibody comprising a native Fc region is herein referred to as a "native Fc antibody". Fc variant antibodies can be generated by numerous methods well known to one skilled in the art. Non-limiting examples include, isolating antibody coding regions (e.g., from hybridoma) and making one or more desired substitutions in the Fc region of the isolated antibody coding region. Alternatively, the antigen-binding portion (e.g., variable regions) of an anti-ICAM-1 antibody may be subcloned into a vector encoding a variant Fc region. In one embodiment, the variant Fc region exhibits a similar level of inducing effector function as compared to the native Fc region. In another embodiment, the variant Fc region exhibits a higher induction of effector function as compared to the native Fc. In another embodiment, the variant Fc region exhibits lower induction of effector function as compared to the native Fc. Some specific

embodiments of variant Fc regions are detailed infra. Methods for measuring effector function are well known in the art.

The effector function of an antibody is modified through changes in the Fc region, including but not limited to, amino acid substitutions, amino acid additions, amino acid deletions and changes in post translational modifications to Fc amino acids (e.g.

glycosylation). The methods described below may be used to fine tune the effector function of a present antibody, a ratio of the binding properties of the Fc region for the FcR (e.g., affinity and specificity), resulting in a therapeutic antibody with the desired properties for a particular disease indication and taking into consideration the biology of IC AM- 1.

It is understood that the Fc region as used herein includes the polypeptides comprising the constant region of an antibody excluding the first constant region immunoglobulin domain. Thus Fc refers to the last two constant region immunoglobulin domains of IgA, IgD, and IgG, and the last three constant region immunoglobulin domains of IgE and IgM, and the flexible hinge N-terminal to these domains. For IgA and IgM Fc may include the J chain. For IgG, Fc comprises immunoglobulin domains Cgamma2 and Cgamma3 (Cj2 and Cj3) and the hinge between Cgammal (Cyl) and Cgamma2 (Cy2). Although the boundaries of the Fc region may vary, the human IgG heavy chain Fc region is usually defined to comprise residues C226 or P230 to its carboxyl-terminus, wherein the numbering is according to the EU index as set forth in Kabat. Fc may refer to this region in isolation, or this region in the context of an antibody, antibody fragment, or Fc fusion protein. Polymorphisms have been observed at a number of different Fc positions, including but not limited to positions 270, 272, 312, 315, 356, and 358 as numbered by the EU index, and thus slight differences between the presented sequence and sequences in the prior art may exist.

In one embodiment, the present invention encompasses Fc variant antibodies which have altered binding properties for an Fc ligand (e.g., an Fc receptor, Clq) relative to a native Fc antibody. Examples of binding properties include but are not limited to, binding specificity, equilibrium dissociation constant (KD), dissociation and association rates (k0 f and kon respectively), binding affinity and/or avidity. It is known in the art that the equilibrium dissociation constant (KD) is defined as kofflkon. In certain aspects, an antibody comprising an Fc variant region with a low KD may be more desirable to an antibody with a high KD.

However, in some instances the value of the kon or k0ff may be more relevant than the value of the KD. One skilled in the art can determine which kinetic parameter is most important for a given antibody application. For example, a modification that reduces binding to one or more positive regulator {e.g. , FcyRIIIA) and/or enhanced binding to an inhibitory Fc receptor {e.g. , FcyRIIB) would be suitable for reducing ADCC activity. Accordingly, the ratio of binding affinities {e.g. , the ratio of equilibrium dissociation constants (Kd)) for different receptors can indicate if the ADCC activity of an Fc variant antibody of the invention is enhanced or decreased. Additionally, a modification that reduces binding to C lq would be suitable for reducing or eliminating CDC activity.

In one embodiment, Fc variant antibodies exhibit altered binding affinity for one or more Fc receptors including, but not limited to FcRn, FcyRI (CD64) including isoforms FcyRIA, FcyRIB, and FcyRIC; FcyRII (CD32 including isoforms FcyRIIA, FcyRIIB, and FcyRIIC); and FcyRIII (CD16, including isoforms FcyRIIIA and FcyRIIIB) as compared to an native Fc antibody.

In one embodiment, an Fc variant antibody has enhanced binding to one or more Fc ligand relative to a native Fc antibody. In another embodiment, the Fc variant antibody exhibits increased or decreased affinity for an Fc ligand that is at least 2 fold, or at least 3 fold, or at least 5 fold, or at least 7 fold, or a least 10 fold, or at least 20 fold, or at least 30 fold, or at least 40 fold, or at least 50 fold, or at least 60 fold, or at least 70 fold, or at least 80 fold, or at least 90 fold, or at least 100 fold, or at least 200 fold, or is between 2 fold and 10 fold, or between 5 fold and 50 fold, or between 25 fold and 100 fold, or between 75 fold and 200 fold, or between 100 and 200 fold, more or less than a native Fc antibody. In another embodiment, Fc variant antibodies exhibit affinities for an Fc ligand that are at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5% more or less than an native Fc antibody. In certain embodiments, an Fc variant antibody has increased affinity for an Fc ligand. In other embodiments, an Fc variant antibody has decreased affinity for an Fc ligand.

In a specific embodiment, an Fc variant antibody has enhanced binding to the Fc receptor FcyRIIIA. In another specific embodiment, an Fc variant antibody has enhanced binding to the Fc receptor FcyRIIB . In a further specific embodiment, an Fc variant antibody has enhanced binding to both the Fc receptors FcyRIIIA and FcyRIIB . In certain

embodiments, Fc variant antibodies that have enhanced binding to FcyRIIIA do not have a concomitant increase in binding the FcyRIIB receptor as compared to a native Fc antibody. In a specific embodiment, an Fc variant antibody has reduced binding to the Fc receptor FcyRIIIA. In a further specific embodiment, an Fc variant antibody has reduced binding to the Fc receptor FcyRIIB . In still another specific embodiment, an Fc variant antibody exhibiting altered affinity for FcyRIIIA and/or FcyRIIB has enhanced binding to the Fc receptor FcRn. In yet another specific embodiment, an Fc variant antibody exhibiting altered affinity for FcyRIIIA and/or FcyRIIB has altered binding to Clq relative to a native Fc antibody.

In one embodiment, Fc variant antibodies exhibit affinities for FcyRIIIA receptor that are at least 2 fold, or at least 3 fold, or at least 5 fold, or at least 7 fold, or a least 10 fold, or at least 20 fold, or at least 30 fold, or at least 40 fold, or at least 50 fold, or at least 60 fold, or at least 70 fold, or at least 80 fold, or at least 90 fold, or at least 100 fold, or at least 200 fold, or are between 2 fold and 10 fold, or between 5 fold and 50 fold, or between 25 fold and 100 fold, or between 75 fold and 200 fold, or between 100 and 200 fold, more or less than an native Fc antibody. In another embodiment, Fc variant antibodies exhibit affinities for FcyRIIIA that are at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5% more or less than an native Fc antibody.

In one embodiment, Fc variant antibodies exhibit affinities for FcyRIIB receptor that are at least 2 fold, or at least 3 fold, or at least 5 fold, or at least 7 fold, or a least 10 fold, or at least 20 fold, or at least 30 fold, or at least 40 fold, or at least 50 fold, or at least 60 fold, or at least 70 fold, or at least 80 fold, or at least 90 fold, or at least 100 fold, or at least 200 fold, or are between 2 fold and 10 fold, or between 5 fold and 50 fold, or between 25 fold and 100 fold, or between 75 fold and 200 fold, or between 100 and 200 fold, more or less than an native Fc antibody. In another embodiment, Fc variant antibodies exhibit affinities for FcyRIIB that are at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5% more or less than an native Fc antibody.

In one embodiment, Fc variant antibodies exhibit increased or decreased affinities to Clq relative to a native Fc antibody. In another embodiment, Fc variant antibodies exhibit affinities for Clq receptor that are at least 2 fold, or at least 3 fold, or at least 5 fold, or at least 7 fold, or a least 10 fold, or at least 20 fold, or at least 30 fold, or at least 40 fold, or at least 50 fold, or at least 60 fold, or at least 70 fold, or at least 80 fold, or at least 90 fold, or at least 100 fold, or at least 200 fold, or are between 2 fold and 10 fold, or between 5 fold and 50 fold, or between 25 fold and 100 fold, or between 75 fold and 200 fold, or between 100 and 200 fold, more or less than an native Fc antibody. In another embodiment, Fc variant antibodies exhibit affinities for Clq that are at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5% more or less than an native Fc antibody. In still another specific embodiment, an Fc variant antibody exhibiting altered affinity for Clq has enhanced binding to the Fc receptor FcRn. In yet another specific embodiment, an Fc variant antibody exhibiting altered affinity for Clq has altered binding to FcyRIIIA and/or FcyRIIB relative to a native Fc antibody.

It is well known in the art that antibodies are capable of directing the attack and destruction of targeted antigen through multiple processes collectively known in the art as antibody effector functions. One of these processes, known as "antibody-dependent cell- mediated cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted Ig bound onto Fc receptors (FcRs) present on certain cytotoxic cells (e.g., Natural Killer (NK) cells, neutrophils, and macrophages) enables these cytotoxic effector cells to bind specifically to an antigen-bearing target cell and subsequently kill the target cell with cytotoxins.

Specific high-affinity IgG antibodies directed to the surface of target cells "arm" the cytotoxic cells and are required for such killing. Lysis of the target cell is extracellular, requires direct cell-to-cell contact, and does not involve complement. Another process encompassed by the term effector function is complement dependent cytotoxicity (hereinafter referred to as "CDC") which refers to a biochemical event of antibody-mediated target cell destruction by the complement system. The complement system is a complex system of proteins found in normal blood plasma that combines with antibodies to destroy pathogenic bacteria and other foreign cells. Still another process encompassed by the term effector function is antibody dependent cell-mediated phagocytosis (ADCP) which refers to a cell- mediated reaction wherein nonspecific cytotoxic cells that express one or more effector ligands recognize bound antibody on a target cell and subsequently cause phagocytosis of the target cell.

It is contemplated that Fc variant antibodies are characterized by in vitro functional assays for determining one or more FcyR mediated effector cell functions. In certain embodiments, Fc variant antibodies have similar binding properties and effector cell functions in in vivo models (such as those described and disclosed herein) as those in in vitro based assays. However, the present invention does not exclude Fc variant antibodies that do not exhibit the desired phenotype in in vitro based assays but do exhibit the desired phenotype in vivo.

The serum half-life of proteins comprising Fc regions may be increased by increasing the binding affinity of the Fc region for FcRn. The term "antibody half-life" as used herein means a pharmacokinetic property of an antibody that is a measure of the mean survival time of antibody molecules following their administration. Antibody half-life can be expressed as the time required to eliminate 50 percent of a known quantity of immunoglobulin from the patient' s body (or other mammal) or a specific compartment thereof, for example, as measured in serum, i.e., circulating half-life, or in other tissues. Half-life may vary from one immunoglobulin or class of immunoglobulin to another. In general, an increase in antibody half-life results in an increase in mean residence time (MRT) in circulation for the antibody administered.

The increase in half-life allows for the reduction in amount of drug given to a patient as well as reducing the frequency of administration. To increase the serum half life of the antibody, one may incorporate a salvage receptor binding epitope into the antibody

(especially an antibody fragment) as described in U.S. Pat. No. 5,739,277, for example. As used herein, the term "salvage receptor binding epitope" refers to an epitope of the Fc region of an IgG molecule (e.g., IgGl, IgG2, IgG3, or IgG4) that is responsible for increasing the in vivo serum half-life of the IgG molecule. Alternatively, antibodies of the invention with increased half-lives may be generated by modifying amino acid residues identified as involved in the interaction between the Fc and the FcRn receptor (see, for examples, US Patent Nos. 6,821,505 and 7,083,784; and WO 09/058492). In addition, the half-life of antibodies of the invention may be increase by conjugation to PEG or Albumin by techniques widely utilized in the art. In some embodiments antibodies comprising Fc variant regions of the invention have an increased half-life of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 95%, about 100%, about 125%, about 150% or more as compared to an antibody comprising a native Fc region. In some embodiments antibodies comprising Fc variant regions have an increased half-life of about 2 fold, about 3 fold, about 4 fold, about 5 fold, about 10 fold, about 20 fold, about 50 fold or more, or is between 2 fold and 10 fold, or between 5 fold and 25 fold, or between 15 fold and 50 fold, as compared to an antibody comprising a native Fc region. In one embodiment, the present invention provides Fc variants, wherein the Fc region comprises a modification (e.g., amino acid substitutions, amino acid insertions, amino acid deletions) at one or more positions selected from the group consisting of 221, 225, 228, 234, 235, 236, 237, 238, 239, 240, 241, 243, 244, 245, 247, 250, 251, 252, 254, 255, 256, 257, 262, 263, 264, 265, 266, 267, 268, 269, 279, 280, 284, 292, 296, 297, 298, 299, 305, 308, 313, 316, 318, 320, 322, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 339, 341, 343, 370, 373, 378, 392, 416, 419, 421, 428, 433, 434, 435, 436, 440, and 443 as numbered by the EU index as set forth in Kabat. Optionally, the Fc region may comprise a modification at additional and/or alternative positions known to one skilled in the art (see, e.g., U.S. Patents 5,624,821; 6,277,375; 6,737,056; 7,083,784; 7,317,091; 7,217,797; 7,276,585; 7,355,008;

2002/0147311; 2004/0002587; 2005/0215768; 2007/0135620; 2007/0224188; 2008/0089892; WO 94/29351; and WO 99/58572). Additional, useful amino acid positions and specific substitutions are exemplified in Tables 2, and 6-10 of US 6,737,056; the tables presented in Figure 41 of US 2006/024298; the tables presented in Figures 5, 12, and 15 of US

2006/235208; the tables presented in Figures 8, 9 and 10 of US 2006/0173170 and the tables presented in Figures 8-10, 13 and 14 of WO 09/058492.

In a specific embodiment, the present invention provides an Fc variant, wherein the Fc region comprises at least one substitution selected from the group consisting of 22 IK, 221Y, 225E, 225K, 225W, 228P, 234D, 234E, 234N, 234Q, 234T, 234H, 234Y, 2341, 234V, 234F, 235A, 235D, 235R, 235W, 235P, 235S, 235N, 235Q, 235T, 235H, 235Y, 2351, 235V, 235E, 235F, 236E, 237L, 237M, 237P, 239D, 239E, 239N, 239Q, 239F, 239T, 239H, 239Y, 2401, 240A, 240T, 240M, 241W, 241 L, 241Y, 241E, 241 R. 243W, 243L 243Y, 243R, 243Q, 244H, 245A, 247L, 247V, 247G, 250E, 250Q, 25 IF, 252L, 252Y, 254S, 254T, 255L, 256E, 256F, 256M, 257C, 257M, 257N, 2621, 262A, 262T, 262E, 2631, 263A, 263T, 263M, 264L, 2641, 264W, 264T, 264R, 264F, 264M, 264Y, 264E, 265A, 265G, 265N, 265Q, 265Y, 265F, 265V, 2651, 265L, 265H, 265T, 2661, 266A, 266T, 266M, 267Q, 267L, 268E, 269H, 269Y, 269F, 269R, 270E, 280A, 284M, 292P, 292L, 296E, 296Q, 296D, 296N, 296S, 296T, 296L, 2961, 296H, 296G, 297S, 297D, 297E, 298A, 298H, 2981, 298T, 298F, 2991, 299L, 299A, 299S, 299V, 299H, 299F, 299E, 3051, 308F313F, 316D, 318A, 318S, 320A, 320S, 322A, 322S, 325Q, 325L, 3251, 325D, 325E, 325 A, 325T, 325V, 325H, 326A, 326D, 326E, 326G, 326M, 326V, 327G, 327W, 327N, 327L, 328S, 328M, 328D, 328E, 328N, 328Q, 328F, 3281, 328V, 328T, 328H, 328A, 329F, 329H, 329Q, 330K, 330G, 330T, 330C, 330L, 330Y, 330V, 3301, 330F, 330R, 330H, 331G, 331A, 331L, 331M, 331F, 331W, 331K, 331Q, 331E, 331S, 331V, 3311, 331C, 331Y, 331H, 331R, 331N, 331D, 331T, 332D, 332S, 332W, 332F, 332E, 332N, 332Q, 332T, 332H, 332Y, 332A, 333A, 333D, 333G, 333Q, 333S, 333V, 334A, 334E, 334H, 334L, 334M, 334Q, 334V, 334Y, 339T, 370E, 370N, 378D, 392T, 396L, 416G, 419H, 421K, 428L, 428F, 433K, 433L, 434A, 424F, 434W, 434Y, 436H, 440Y and 443W as numbered by the EU index as set forth in Kabat. Optionally, the Fc region may comprise additional and/or alternative amino acid substitutions known to one skilled in the art including but not limited too those exemplified in Tables 2, and 6- 10 of US 6,737,056; the tables presented in Figure 41 of US 2006/024298; the tables presented in Figures 5, 12, and 15 of US 2006/235208; the tables presented in Figures 8, 9 and 10 of US 2006/0173170 and the tables presented in Figures 8, 9 and 10 of WO 09/058492.

In a specific embodiment, the present invention provides an Fc variant antibody having increased half-life, wherein the Fc region comprises at least one modification at one or more positions selected from the group consisting of 252, 254, and 256 as numbered by the EU index as set forth in Kabat. In one embodiment, the modification is at least one substitution selected from the group consisting of 252Y, 254T and 256E as numbered by the EU index as set forth in Kabat. See, U.S. Patent Number 7,083,784, incorporated herein by reference in its entirety. Fc variant antibodies having increased half-life are particularly well suited for therapeutic use where epithelial or mucocutaneous administration is desirable (see, e.g., U.S. 7,658,921). In certain embodiments, the invention provides methods for preventing and/or treating and/or preventing or treating exacerbation of symptoms of HRV and/or CV-A and/or Plasmodium falciparum infection by epithelial or mucocutaneous administration of an Fc variant antibody of the invention comprising at least one modification at one or more positions selected from the group consisting of 252, 254, and 256 as numbered by the EU index as set forth in Kabat.

In a specific embodiment, the present invention provides an Fc variant antibody having reduced effector function, wherein the Fc region comprises at least one modification (e.g., amino acid substitutions, amino acid insertions, amino acid deletions) at one or more positions selected from the group consisting of 228, 234, 235 and 331 as numbered by the EU index as set forth in Kabat. In one embodiment, the modification is at least one substitution selected from the group consisting of 228P, 234F, 235E, 235F, 235Y, and 33 IS as numbered by the EU index as set forth in Kabat. In another embodiment, the Fc variant antibody having reduced effector function further comprises at least one modification at one or more positions selected from the group consisting of 252, 254, and 256 as numbered by the EU index as set forth in Kabat. In one embodiment, the modification is at least one substitution selected from the group consisting of 252Y, 254T and 256E as numbered by the EU index as set forth in Kabat. In another specific embodiment, the present invention provides an Fc variant antibody having reduced effector function, wherein the Fc region is an IgG4 Fc region and comprises at least one modification at one or more positions selected from the group consisting of 228 and 235 as numbered by the EU index as set forth in Kabat. In still another specific embodiment, the Fc region is an IgG4 Fc region and the non-naturally occurring amino acids are selected from the group consisting of 228P, 235E, 235F and 235Y as numbered by the EU index as set forth in Kabat. In another embodiment, the Fc variant antibody having reduced effector function further comprises at least one modification at one or more positions selected from the group consisting of 252, 254, and 256 as numbered by the EU index as set forth in Kabat. In one embodiment, the modification is at least one substitution selected from the group consisting of 252Y, 254T and 256E as numbered by the EU index as set forth in Kabat.

In another specific embodiment, the present invention provides an Fc variant having enhanced effector function, wherein the Fc region comprises at least one modification at one or more positions selected from the group consisting of 239, 330 and 332 as numbered by the EU index as set forth in Kabat. In one embodiment, the modification is at least one substitution selected from the group consisting of 239D, 330L, 330Y, and 332E as numbered by the EU index as set forth in Kabat. In another embodiment, the Fc variant antibody having enhanced effector function further comprises at least one modification at one or more positions selected from the group consisting of 252, 254, and 256 as numbered by the EU index as set forth in Kabat. In one embodiment, the modification is at least one substitution selected from the group consisting of 252Y, 254T and 256E as numbered by the EU index as set forth in Kabat.

In certain embodiments the effector functions elicited by IgG antibodies strongly depend on the carbohydrate moiety linked to the Fc region of the protein (Claudia Ferrara et al., 2006, Biotechnology and Bioengineering 93:851-861). Thus, glycosylation of the Fc region can be modified to increase or decrease effector function (see for examples, Umana et al, 1999, Nat. Biotechnol 17:176-180; Davies et al., 2001, Biotechnol Bioeng 74:288-294; Shields et al, 2002, J Biol Chem 277:26733-26740; Shinkawa et al., 2003, J Biol Chem 278:3466-3473; U.S. Pat. Nos. 6,602,684; 6,946,292; 7,064,191; 7,214,775;7,393,683;

7,425,446; 7,504,256; U.S. Publication. Nos. 2003/0157108; 2003/0003097; 2009/0010921; POTILLEGENT™ technology (Biowa, Inc. Princeton, N.J.); GLYCOMAB™ glycosylation engineering technology (GLYCART biotechnology AG, Zurich, Switzerland)). Accordingly, in one embodiment the Fc regions of anti-IC AM- 1 antibodies of the invention comprise altered glycosylation of amino acid residues. In another embodiment, the altered

glycosylation of the amino acid residues results in lowered effector function. In another embodiment, the altered glycosylation of the amino acid residues results in increased effector function. In a specific embodiment, the Fc region has reduced fucosylation. In another embodiment, the Fc region is afucosylated (see for examples, U.S. Patent Application Publication No.2005/0226867). In one aspect, these antibodies with increased effector function, specifically ADCC, as generated in host cells (e.g., CHO cells, Lemna minor) engineered to produce highly defucosylated antibody with over 100-fold higher ADCC compared to antibody produced by the parental cells (Mori et al., 2004, Biotechnol Bioeng 88:901-908; Cox et al., 2006, Nat Biotechnol., 24: 1591-7).

Addition of sialic acid to the oligosaccharides on IgG molecules can enhance their anti-inflammatory activity and alters their cytotoxicity (Keneko et al., Science, 2006, 313:670-673; Scallon et al., Mol. Immuno. 2007 Mar;44(7): 1524-34). The studies referenced above demonstrate that IgG molecules with increased sialylation have anti-inflammatory properties whereas IgG molecules with reduced sialylation have increased

immuno stimulatory properties (e.g., increase ADCC activity). Therefore, an antibody can be modified with an appropriate sialylation profile for a particular therapeutic application (US Publication No. 2009/0004179 and International Publication No. WO 2007/005786).

In one embodiment, the Fc regions of antibodies of the invention comprise an altered sialylation profile compared to the native Fc region. In one embodiment, the Fc regions of antibodies of the invention comprise an increased sialylation profile compared to the native Fc region. In another embodiment, the Fc regions of antibodies of the invention comprise a decreased sialylation profile compared to the native Fc region.

In one embodiment, the Fc variants of the present invention may be combined with other known Fc variants such as those disclosed in Ghetie et al., 1997, Nat Biotech. 15:637- 40; Duncan et al, 1988, Nature 332:563-564; Lund et al., 1991, J. Immunol 147:2657-2662; Lund et al, 1992, Mol Immunol 29:53-59; Alegre et al, 1994, Transplantation 57: 1537-1543; Hutchins et al., 1995, Proc Natl. Acad Sci U S A 92: 11980-11984; lefferis et al, 1995, Immunol Lett. 44: 111-117; Lund et al., 1995, Faseb J 9: 115-119; lefferis et al, 1996, Immunol Lett 54: 101-104; Lund et al, 1996, J Immunol 157:4963-4969; Armour et al., 1999, Eur J Immunol 29:2613-2624; Idusogie et al, 2000, J Immunol 164:4178-4184; Reddy et al,

2000, / Immunol 164: 1925-1933; Xu et al., 2000, Cell Immunol 200: 16-26; Idusogie et al,

2001, J Immunol 166:2571-2575; Shields et al., 2001, J Biol Chem 276:6591-6604; lefferis et al, 2002, Immunol Lett 82:57-65; Presta et al., 2002, Biochem Soc Trans 30:487-490); U.S. Patent Nos. 5,624,821; 5,885,573; 5,677,425; 6,165,745; 6,277,375; 5,869,046; 6,121,022; 5,624,821; 5,648,260; 6,528,624; 6,194,551; 6,737,056; 7,122,637; 7,183,387; 7,332,581; 7,335,742; 7,371,826; 6,821,505; 6,180,377; 7,317,091; 7,355,008; 2004/0002587; and WO 99/58572. Other modifications and/or substitutions and/or additions and/or deletions of the Fc domain will be readily apparent to one skilled in the art.

(B) Glycosylation

In addition to the ability of glycosylation to alter the effector function of antibodies, modified glycosylation in the variable region can alter the affinity of the antibody for a target antigen. In one embodiment, the glycosylation pattern in the variable region of the present antibodies is modified. For example, an aglycoslated antibody can be made (i.e., the antibody lacks glycosylation). Glycosylation can be altered to, for example, increase the affinity of the antibody for a target antigen. Such carbohydrate modifications can be accomplished by, for example, altering one or more sites of glycosylation within the antibody sequence. For example, one or more amino acid substitutions can be made that result in elimination of one or more variable region framework glycosylation sites to thereby eliminate glycosylation at that site. Such aglycosylation may increase the affinity of the antibody for antigen. Such an approach is described in further detail in U.S. Patent Nos. 5,714,350 and 6,350,861. One or more amino acid substitutions can also be made that result in elimination of a glycosylation site present in the Fc region (e.g., Asparagine 297 of IgG). Furthermore, aglycosylated antibodies may be produced in bacterial cells which lack the necessary glycosylation machinery.

(C) Antibody Conjugates

In certain embodiments, the antibodies of the invention are conjugated or covalently attached to a substance using methods well known in the art. In one embodiment, the attached substance is a therapeutic agent, a detectable label (also referred to herein as a reporter molecule) or a solid support. Suitable substances for attachment to antibodies include, but are not limited to, an amino acid, a peptide, a protein, a polysaccharide, a nucleoside, a nucleotide, an oligonucleotide, a nucleic acid, a hapten, a drug, a hormone, a lipid, a lipid assembly, a synthetic polymer, a polymeric microparticle, a biological cell, a virus, a fluorophore, a chromophore, a dye, a toxin, a hapten, an enzyme, an antibody, an antibody fragment, a radioisotope, solid matrixes, semi-solid matrixes and combinations thereof. Methods for conjugation or covalently attaching another substance to an antibody are well known in the art.

In certain embodiments, the antibodies of the invention are conjugated to a solid support. Antibodies may be conjugated to a solid support as part of the screening and/or purification and/or manufacturing process. Alternatively antibodies of the invention may be conjugated to a solid support as part of a diagnostic method or composition. A solid support suitable for use in the present invention is typically substantially insoluble in liquid phases. A large number of supports are available and are known to one of ordinary skill in the art. Thus, solid supports include solid and semi-solid matrixes, such as aerogels and hydrogels, resins, beads, biochips (including thin film coated biochips), microfluidic chip, a silicon chip, multi-well plates (also referred to as microtitre plates or microplates), membranes, conducting and nonconducting metals, glass (including microscope slides) and magnetic supports. More specific examples of solid supports include silica gels, polymeric

membranes, particles, derivatized plastic films, glass beads, cotton, plastic beads, alumina gels, polysaccharides such as Sepharose, poly(acrylate), polystyrene, poly(acrylamide), polyol, agarose, agar, cellulose, dextran, starch, FICOLL, heparin, glycogen, amylopectin, mannan, inulin, nitrocellulose, diazocellulose, polyvinylchloride, polypropylene,

polyethylene (including poly(ethylene glycol)), nylon, latex bead, magnetic bead, paramagnetic bead, superparamagnetic bead, starch and the like.

In some embodiments, the solid support may include a reactive functional group, including, but not limited to, hydroxyl, carboxyl, amino, thiol, aldehyde, halogen, nitro, cyano, amido, urea, carbonate, carbamate, isocyanate, sulfone, sulfonate, sulfonamide, sulfoxide, etc., for attaching the antibodies of the invention.

A suitable solid phase support can be selected on the basis of desired end use and suitability for various synthetic protocols. For example, where amide bond formation is desirable to attach the antibodies of the invention to the solid support, resins generally useful in peptide synthesis may be employed, such as polystyrene (e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.), POLYHIPE™ resin (obtained from Aminotech, Canada), polyamide resin (obtained from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (TENTAGEL™, Rapp Polymere, Tubingen, Germany), poly dimethyl- acrylamide resin (available from Milligen/Biosearch, California), or PEGA beads (obtained from Polymer Laboratories).

In certain embodiments, the antibodies of the invention are conjugated to labels for purposes of diagnostics and other assays wherein the antibody and/or its associated ligand may be detected. A label conjugated to an antibody and used in the present methods and compositions described herein, is any chemical moiety, organic or inorganic, that exhibits an absorption maximum at wavelengths greater than 280 nm, and retains its spectral properties when covalently attached to an antibody. Labels include, without limitation, a chromophore, a fluorophore, a fluorescent protein, a phosphorescent dye, a tandem dye, a particle, a hapten, an enzyme and a radioisotope.

In certain embodiments, the anti-ICAM- 1 antibodies are conjugated to a fluorophore. As such, fluorophores used to label antibodies of the invention include, without limitation; a pyrene (including any of the corresponding derivative compounds disclosed in US Patent 5,132,432), an anthracene, a naphthalene, an acridine, a stilbene, an indole or benzindole, an oxazole or benzoxazole, a thiazole or benzothiazole, a 4-amino-7-nitrobenz-2-oxa-l, 3- diazole (NBD), a cyanine (including any corresponding compounds in US Patent

Nos.6,977,305 and 6,974,873), a carbocyanine (including any corresponding compounds in US Serial Nos. 09/557,275; U.S.; Patents Nos. 4,981,977; 5,268,486; 5,569,587; 5,569,766; 5,486,616; 5,627,027; 5,808,044; 5,877,310; 6,002,003; 6,004,536; 6,008,373; 6,043,025; 6,127,134; 6,130,094; 6,133,445; and publications WO 02/26891, WO 97/40104, WO 99/51702, WO 01/21624; EP 1 065 250 Al), a carbostyryl, a porphyrin, a salicylate, an anthranilate, an azulene, a perylene, a pyridine, a quinoline, a borapolyazaindacene (including any corresponding compounds disclosed in US Patent Nos. 4,774,339; 5,187,288; 5,248,782; 5,274,113; and 5,433,896), a xanthene (including any corresponding compounds disclosed in U.S. Patent No. 6,162,931; 6,130,101; 6,229,055; 6,339,392; 5,451,343; 5,227,487;

5,442,045; 5,798,276; 5,846,737; 4,945,171; US serial Nos. 09/129,015 and 09/922,333), an oxazine (including any corresponding compounds disclosed in US Patent No. 4,714,763) or a benzoxazine, a carbazine (including any corresponding compounds disclosed in US Patent No. 4,810,636), a phenalenone, a coumarin (including an corresponding compounds disclosed in US Patent Nos. 5,696,157; 5,459,276; 5,501,980 and 5,830,912), a benzofuran (including an corresponding compounds disclosed in US Patent Nos. 4,603,209 and

4,849,362) and benzphenalenone (including any corresponding compounds disclosed in US Patent No. 4,812,409) and derivatives thereof. As used herein, oxazines include resorufins (including any corresponding compounds disclosed in 5,242,805), aminooxazinones, diaminooxazines, and their benzo-substituted analogs.

In a specific embodiment, the fluorophores conjugated to the antibodies described herein include xanthene (rhodol, rhodamine, fluorescein and derivatives thereof) coumarin, cyanine, pyrene, oxazine and borapolyazaindacene. In other embodiments, such fluorophores are sulfonated xanthenes, fluorinated xanthenes, sulfonated coumarins, fluonnated coumarins and sulfonated cyanines. Also included are dyes sold under the tradenames, and generally known as, Alexa Fluor, DyLight, Cy Dyes, BODIPY, Oregon Green, Pacific Blue, IRDyes, FAM, FITC, and ROX.

The choice of the fluorophore attached to the anti-ICAM- 1 antibody will determine the absorption and fluorescence emission properties of the conjugated antibody. Physical properties of a fluorophore label that can be used for antibody and antibody bound ligands include, but are not limited to, spectral characteristics (absorption, emission and stokes shift), fluorescence intensity, lifetime, polarization and photo-bleaching rate, or combination thereof. All of these physical properties can be used to distinguish one fluorophore from another, and thereby allow for multiplexed analysis. In certain embodiments, the fluorophore has an absorption maximum at wavelengths greater than 480 nm. In other embodiments, the fluorophore absorbs at or near 488 nm to 514 nm (particularly suitable for excitation by the output of the argon-ion laser excitation source) or near 546 nm (particularly suitable for excitation by a mercury arc lamp). In other embodiment a fluorophore can emit in the NIR (near infra red region) for tissue or whole organism applications. Other desirable properties of the fluorescent label may include cell permeability and low toxicity, for example if labeling of the antibody is to be performed in a cell or an organism (e.g., a living animal).

In certain embodiments, an enzyme is a label and is conjugated to an anti-ICAM- 1 antibody. Enzymes are desirable labels because amplification of the detectable signal can be obtained resulting in increased assay sensitivity. The enzyme itself does not produce a detectable response but functions to break down a substrate when it is contacted by an appropriate substrate such that the converted substrate produces a fluorescent, colorimetric or luminescent signal. Enzymes amplify the detectable signal because one enzyme on a labeling reagent can result in multiple substrates being converted to a detectable signal. The enzyme substrate is selected to yield the preferred measurable product, e.g. colorimetric, fluorescent or chemiluminescence. Such substrates are extensively used in the art and are well known by one skilled in the art.

In one embodiment, colorimetric or fluorogenic substrate and enzyme combination uses oxidoreductases such as horseradish peroxidase and a substrate such as 3,3'- diaminobenzidine (DAB) and 3-amino-9-ethylcarbazole (AEC), which yield a distinguishing color (brown and red, respectively). Other colorimetric oxidoreductase substrates that yield detectable products include, but are not limited to: 2,2-azino-bis(3-ethylbenzothiazoline-6- sulfonic acid) (ABTS), o-phenylenediamine (OPD), 3,3',5,5'-tetramethylbenzidine (TMB), odianisidine, 5-aminosalicylic acid, 4-chloro- l-naphthol. Fluorogenic substrates include, but are not limited to, homovanillic acid or 4-hydroxy-3-methoxyphenylacetic acid, reduced phenoxazines and reduced benzothiazines, including AMPLEX® Red reagent and its variants (U.S. Pat. No. 4,384,042) and reduced dihydroxanthenes, including dihydrofluoresceins (U.S. Pat. No. 6,162,931) and dihydrorhodamines including dihydrorhodamine 123. Peroxidase substrates that are tyramides (U.S. Pat. Nos. 5,196,306; 5,583,001 and 5,731,158) represent a unique class of peroxidase substrates in that they can be intrinsically detectable before action of the enzyme but are "fixed in place" by the action of a peroxidase in the process described as tyramide signal amplification (TSA). These substrates are extensively utilized to label targets in samples that are cells, tissues or arrays for their subsequent detection by microscopy, flow cytometry, optical scanning and fluorometry.

In another embodiment, a colorimetric (and in some cases fluorogenic) substrate and enzyme combination uses a phosphatase enzyme such as an acid phosphatase, an alkaline phosphatase or a recombinant version of such a phosphatase in combination with a colorimetric substrate such as 5-bromo-6-chloro-3-indolyl phosphate (BCIP), 6-chloro-3- indolyl phosphate, 5-bromo-6-chloro-3-indolyl phosphate, p-nitrophenyl phosphate, or o- nitrophenyl phosphate or with a fluorogenic substrate such as 4-methylumbelliferyl phosphate, 6,8-difluoro-7-hydroxy-4-methylcoumarinyl phosphate (DiFMUP, U.S. Pat. No. 5,830,912) fluorescein diphosphate, 3-0-methylfluorescein phosphate, resorufin phosphate, 9H-(l,3-dichloro-9,9-dimethylacridin-2-one-7-yl) phosphate (DDAO phosphate), or ELF 97, ELF 39 or related phosphates (U.S. Pat. Nos. 5,316,906 and 5,443,986).

Glycosidases, in particular beta-galactosidase, beta-glucuronidase and beta- glucosidase, are additional suitable enzymes. Appropriate colorimetric substrates include, but are not limited to, 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside (X-gal) and similar indolyl galactosides, glucosides, and glucuronides, o-nitrophenyl beta-D- galactopyranoside (ONPG) and p-nitrophenyl beta-D-galactopyranoside. In one

embodiment, fluorogenic substrates include resorufin beta-D-galactopyranoside, fluorescein digalactoside (FDG), fluorescein diglucuronide and their structural variants (U.S. Pat. Nos. 5,208,148; 5,242,805; 5,362,628; 5,576,424 and 5,773,236), 4-methylumbelliferyl beta-D- galactopyranoside, carboxyumbelliferyl beta-D-galactopyranoside and fluorinated coumarin beta-D-galactopyranosides (U.S. Pat. No. 5,830,912).

Additional enzymes include, but are not limited to, hydrolases such as cholinesterases and peptidases, oxidases such as glucose oxidase and cytochrome oxidases, and reductases for which suitable substrates are known. Enzymes and their appropriate substrates that produce chemiluminescence are preferred for some assays. These include, but are not limited to, natural and recombinant forms of luciferases and aequorins. Chemiluminescence-producing substrates for phosphatases, glycosidases and oxidases such as those containing stable dioxetanes, luminol, isoluminol and acridinium esters are additionally useful.

In another embodiment, haptens such as biotin, are also utilized as labels. Biotin is useful because it can function in an enzyme system to further amplify the detectable signal, and it can function as a tag to be used in affinity chromatography for isolation purposes. For detection purposes, an enzyme conjugate that has affinity for biotin is used, such as avidin- HRP. Subsequently a peroxidase substrate is added to produce a detectable signal.

Haptens also include hormones, naturally occurring and synthetic drugs, pollutants, allergens, affector molecules, growth factors, chemokines, cytokines, lymphokines, amino acids, peptides, chemical intermediates, nucleotides and the like.

In certain embodiments, fluorescent proteins may be conjugated to the antibodies as a label. Examples of fluorescent proteins include green fluorescent protein (GFP) and the phycobiliproteins and the derivatives thereof. The fluorescent proteins, especially phycobiliprotein, are particularly useful for creating tandem dye labeled labeling reagents. These tandem dyes comprise a fluorescent protein and a fluorophore for the purposes of obtaining a larger stokes shift wherein the emission spectra is farther shifted from the wavelength of the fluorescent protein's absorption spectra. This is particularly advantageous for detecting a low quantity of a target in a sample wherein the emitted fluorescent light is maximally optimized, in other words little to none of the emitted light is reabsorbed by the fluorescent protein. For this to work, the fluorescent protein and fluorophore function as an energy transfer pair wherein the fluorescent protein emits at the wavelength that the fluorophore absorbs at and the fluorphore then emits at a wavelength farther from the fluorescent proteins than could have been obtained with only the fluorescent protein. A particularly useful combination is the phycobiliproteins disclosed in US Patent Nos.

4,520,110; 4,859,582; 5,055,556 and the sulforhodamine fluorophores disclosed in US Patent No. 5,798,276, or the sulfonated cyanine fluorophores disclosed in US Patent Nos. 6,977,305 and 6,974,873; or the sulfonated xanthene derivatives disclosed in US Patent No. 6,130,101 and those combinations disclosed in US Patent No. 4,542,104. Alternatively, the fluorophore functions as the energy donor and the fluorescent protein is the energy acceptor.

In certain embodiments, the label is a radioactive isotope. Examples of suitable radioactive materials include, but are not limited to, iodine (121I, 123I, 125I, 131I), carbon (14C), sulfur (35S), tritium (3H), indium (η ιΙη,' 112In, 113mln, 115mln,), technetium (99Tc, 99mTc), thallium (201Ti), gallium (68Ga, 67Ga), palladium (103Pd), molybdenum (99Mo), xenon (135Xe), fluorine (18F), 153SM, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47Sc, 186Re, 188Re,142Pr, 105 Rh and 97Ru.

(vi) Methods of Use

(a) Diagnostic Methods of Use

In certain embodiments, the anti-ICAM- 1 antibodies and compositions thereof of the invention may be used in vivo and/or in vitro for detecting ICAM-1 expression in cells and tissue or for imaging ICAM-1 expressing cells and tissues. In certain embodiments, the antibodies are human antibodies and such antibodies are used to image ICAM-1 expression in a living human patient. Given that the anti-ICAM- 1 antibodies and antibody fragments described herein immunospecifically bind to human ICAM-1 and inhibit binding of human ICAM-1 to human rhinovirus, but do not substantially inhibit binding of human ICAM-1 to LFAl and/or MAC-1, these antibodies can be used to detect or image ICAM-1 expression in a living patients without compromising the patient's normal immune function.

By way of example, diagnostic uses can be achieved, for example, by contacting a sample to be tested, optionally along with a control sample, with the antibody under conditions that allow for formation of a complex between the antibody and ICAM- 1.

Complex formation is then detected (e.g., using an ELISA or by imaging to detect a moiety attached to the antibody). When using a control sample along with the test sample, complex is detected in both samples and any statistically significant difference in the formation of complexes between the samples is indicative of the presence of ICAM-1 in the test sample.

In one embodiment, the invention provides a method of determining the presence of ICAM-1 in a sample suspected of containing ICAM-1, said method comprising exposing the sample to an anti-ICAM- 1 antibody of the invention, and determining binding of the antibody to ICAM- 1 in the sample wherein binding of the antibody to ICAM- 1 in the sample is indicative of the presence of the ICAM-1 in the sample. In one embodiment, the sample is a biological sample.

In certain embodiments, the anti-ICAM- 1 antibodies may be used to detect the overexpression or amplification of ICAM-1 using an in vivo diagnostic assay. In one embodiment, the anti-ICAM- 1 antibody is added to a sample wherein the antibody binds the ICAM-1 to be detected and is tagged with a detectable label (e.g. a radioactive isotope or a fluorescent label) and externally scanning the patient for localization of the label.

Alternatively, or additionally, FISH assays such as the INFORM™ (sold by Ventana, Ariz.) or PATHVISION™ (Vysis, 111.) may be carried out on formalin-fixed, paraffin- embedded tissue to determine the extent (if any) of ICAM-1 expression or overexpression in a sample.

(b) Therapeutic Methods of Uses

In certain aspects, the anti-ICAM-1 antibodies and compositions thereof of the invention may be administered for prevention and/or treatment of human rhinovirus infection in a subject in need thereof. The invention encompasses methods of preventing, treating, maintaining, ameliorating, or inhibiting a human rhinovirus associated or exacerbated disease/disorder/condition and/or preventing and/or alleviating one or more symptoms of the disease in a mammal, comprising administering a therapeutically effective amount of the anti-ICAM-1 antibody to the mammal. The antibody therapeutic compositions can be administered short term (acute) or chronic, or intermittently as directed by physician. In certain embodiments, the rhinovirus includes HRV14 and/or HRV16.

In certain aspects, the invention provides a method of treating and/or preventing human rhinovirus infection in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of the antibody or antibody fragment of the invention. In certain embodiments, treating or preventing human rhinovirus infection is used to treat and/or prevent exacerbation of a respiratory condition. In certain embodiments, the respiratory condition is selected from one or more members of the group consisting of chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, acute respiratory distress syndrome (ARDS), acute lung injury (ALI), asthma, emphysema, bronchitis, tuberculosis, pneumonia, lung cancer, asbestosis, and cystic fibrosis. In certain embodiments, the method is part of a therapeutic regimen for treating the respiratory disorder. In certain embodiments, the rhinovirus includes HRV14 and/or HRV16.

In certain aspects, the invention provides a method for inhibiting human rhinovirus infection of a cell expressing human ICAM-1, comprising contacting the cell with the antibody or antibody fragment of the invention to inhibit binding of human rhinovirus to human ICAM-1, thereby inhibiting human rhinovirus infection of said cell. In certain embodiments, the antibody or antibody fragment does not inhibit binding of ICAM-1 to LFA1 by greater than 60%. In certain embodiments, the rhinovirus includes HRV14 and/or HRV16.

Any of the anti-ICAM-1 antibodies and antibody fragments having any one or more of the structural and functional features described herein can be used in a method of treating a human patient.

When the antibodies are used to help treat or prevent exacerbation of a respiratory condition, the antibodies may be used alone or used as part of a therapeutic regimen specific to the particular underlying respiratory condition. For example, additional treatment modalities that can be used include, but are not limited to, oxygen therapy, steroidal therapy, smoking cessation, bronchial dilators, lung reduction surgery, and the like. Additionally or alternatively, the antibodies may be used alone or used as part of a regimen for managing or preventing rhinovirus infection. Patient with COPD and other serious respiratory conditions are at great risk of exacerbation of their symptoms if they become infected with human rhinovirus. Thus, in certain embodiments, patients at risk of exacerbation of their symptoms, for example patients at risk for COPD exacerbation, are treated with an antibody or antibody fragment of the invention to help prevent or reduce the risk of HRV infection. As a result, such prophylactic administration helps decrease the risk of exacerbation.

The invention provides a composition comprising an anti-ICAM- 1 antibody of the invention and a carrier. For the purposes of treating and/or preventing HRV associated or exacerbated disease/condition, compositions can be administered to the patient in need of such treatment, wherein the composition can comprise one or more anti-ICAM-1 antibodies present as an immunoconjugate or as the naked antibody. In a further embodiment, the compositions can comprise these antibodies in combination with other therapeutic agents such as bronchodilators, such as ipratropium, tiotropium, salmeterol, or formoterol, steroids, anti-viral agents and antibiotics. In certain embodiments, the compositions can comprise these antibodies in combination with surgery such as lung volume reduction surgery or lung transplantation. In certain embodiments, the compositions can comprise these antibodies in combination with therapy such as oxygen therapy, pulmonary rehabilitation or smoking cessation.

In certain embodiments, the compositions and/or methods of the invention may improve symptoms of a subject with a chronic lung disease such as COPD or asthma.

Without being bound by theory, by preventing rhinovirus infection, the antibodies of the invention can be used to prevent exacerbation of symptoms of a respiratory condition. Symptoms of chronic lung disease can include cough with mucus, shortness of breath (dyspnea) that may get worse with mild activity, fatigue, frequent respiratory infections, wheezing, chest tightness, irregular heart beats (arrhythmias), need for breathing machine and oxygen therapy, right- sided heart failure or cor pulmonale (heart swelling and heart failure due to chronic lung disease), frequent respiratory infections, pneumonia, pneumothorax, severe weight loss and malnutrition.

In certain embodiments, chronic lung disease is diagnosed and/or monitored before, during or after treatment, which may include preventative treatment. In certain embodiments, monitoring is continuous. In certain embodiments, monitoring occurs over regular intervals during treatment, such as hourly, daily or weekly. In certain embodiments, monitoring occurs over regular intervals after treatment, such as daily, weekly or monthly. Intervals for monitoring may be readily determined by one of skill in the art based on the severity of the condition. In certain embodiments, chronic lung disease is diagnosed and/or monitored by a pulmonary function tests such as spirometry. In certain embodiments, chronic lung disease is diagnosed and/or monitored by chest X-ray and/or a computerized tomography (CT) scan. A chest X-ray or CT scan can show emphysema, which is one of the main causes of COPD. In certain embodiments, chronic lung disease is diagnosed and/or monitored by arterial blood gas analysis. In certain embodiments, chronic lung disease is diagnosed and/or monitored by sputum examination. Additionally, asthma can be diagnosed or monitored by an exhaled nitric oxide test and/or a challenge test.

In certain embodiments, a composition or method of the invention is analyzed in an animal rhinovirus model or chronic lung disease model that is know to one of ordinary skill in the art. (e.g., Contoli et al., Contrib Microbiol. 2007;14:101-12). In certain embodiments, the animal model is a mouse model (e.g., Bartlett et al., Nat Med. 2008 Feb; 14(2): 199-204). In certain embodiments, the mouse model is selected from an elastase- and LPS-exposed mouse model (see, Sajjan et al., Am J Physiol Lung Cell Mol Physiol. 2009

Nov;297(5):L931-44).

In certain aspects, the anti-ICAM-1 antibodies and compositions thereof of the invention may be administered for prevention and/or treatment of CV-A infection in a subject in need thereof. The invention encompasses methods of preventing, treating, maintaining, ameliorating, or inhibiting a CV-A associated or exacerbated disease/disorder/condition and/or preventing and/or alleviating one or more symptoms of the disease in a mammal, comprising administering a therapeutically effective amount of the anti-IC AM- 1 antibody to the mammal. The antibody therapeutic compositions can be administered short term (acute) or chronic, or intermittently as directed by physician. In certain embodiments, the CV-A includes CV-A21 and/or CV-A 16.

In certain aspects, the anti-ICAM- 1 antibodies and compositions thereof of the invention may be administered for prevention and/or treatment of Plasmodium falciparum infection in a subject in need thereof. The invention encompasses methods of preventing, treating, maintaining, ameliorating or inhibiting a Plasmodium falciparum associated or exacerbated disease/disorder/condition and/or preventing and/or alleviating one or more symptoms of the disease in a mammal, comprising administering a therapeutically effective amount of the anti-ICAM- 1 antibody to the mammal. The antibody therapeutic compositions can be administered short term (acute) or chronic, or intermittently as directed by physician. In other aspects anti-ICAM- 1 antibodies and compositions thereof of the invention may be administered for prevention and/or inhibition of Plasmodium falciparum-iniected

erythrocytes adhering to endothelial cells in a subject in need thereof.

(vii) Pharmaceutical Formulations

This section of the specification describes various exemplary preparations and formulations comprising anti-ICAM- 1 antibodies (including antibody fragments) of the present disclosure. It should be understood that any of the anti-ICAM- 1 antibodies and antibody fragments described herein, including antibodies and antibody fragments having any one or more of the structural and functional features described in detail throughout the application, may be formulated or prepared as described below. When various formulations are described in this section as including an antibody, it is understood that such an antibody may be an antibody or an antibody fragment having any one or more of the characteristics of the anti-ICAM- 1 antibodies and antibody fragments described herein. The disclosure contemplates all combinations of any of the aspects and embodiments of the invention.

In certain embodiments, the anti-ICAM- 1 antibodies of the invention may be formulated with a pharmaceutically acceptable carrier as pharmaceutical (therapeutic) compositions, and may be administered by a variety of methods known in the art. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results. As used herein, the pharmaceutical formulations comprising the anti-ICAM- 1 antibodies are referred to as formulations of the disclosure. The term "pharmaceutically acceptable carrier" means one or more non-toxic materials that do not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable preparations may also routinely contain compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being co-mingled with the antibodies of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.

The formulations of the invention are present in a form known in the art and acceptable for therapeutic uses. In one embodiment, a formulation of the invention is a liquid formulation. In another embodiment, a formulation of the invention is a lyophilized formulation. In a further embodiment, a formulation of the invention is a reconstituted liquid formulation. In one embodiment, a formulation of the invention is a stable liquid

formulation. In one embodiment, a liquid formulation of the invention is an aqueous formulation. In another embodiment, the liquid formulation is non-aqueous. In a specific embodiment, a liquid formulation of the invention is an aqueous formulation wherein the aqueous carrier is distilled water.

The formulations of the invention comprise an anti-IC AM- 1 antibody in a

concentration resulting in a w/v appropriate for a desired dose. In certain embodiments, the anti-IC AM- 1 antibody is present in the formulation of the invention at a concentration of about lmg/ml to about 500mg/ml. In one embodiment, the concentration of anti-ICAM-1 antibody, which is included in the formulation of the invention, is at least 1 mg/ml, at least 5 mg/ml, at least 10 mg/ml, at least 15 mg/ml, at least 20 mg/ml, at least 25 mg/ml, at least 30 mg/ml, at least 35 mg/ml, at least 40 mg/ml, at least 45 mg/ml, at least 50 mg/ml, at least 55 mg/ml, at least 60 mg/ml, at least 65 mg/ml, at least 70 mg/ml, at least 75 mg/ml, at least 80 mg/ml, at least 85 mg/ml, at least 90 mg/ml, at least 95 mg/ml, at least 100 mg/ml, at least 105 mg/ml, at least 110 mg/ml, at least 115 mg/ml, at least 120 mg/ml, at least 125 mg/ml, at least 130 mg/ml, at least 135 mg/ml, at least 140 mg/ml, at least 150 mg/ml, at least 200 mg/ml, at least 250 mg/ml, or at least 300 mg/ml.

In a specific embodiment, a formulation of the invention comprises at least about 100 mg/ml of an anti-IC AM- 1 antibody of the invention. In a specific embodiment, a formulation of the invention comprises at least about 125 mg/ml of an anti-ICAM-1 antibody of the invention. In a specific embodiment, a formulation of the invention comprises at least about 130 mg/ml of an anti-IC AM- 1 antibody of the invention. In a specific embodiment, a formulation of the invention comprises at least about 150 mg/ml of an anti-IC AM- 1 antibody of the invention.

In one embodiment, the concentration of anti-IC AM- 1 antibody, which is included in the formulation of the invention, is between about 1 mg/ml and about 25 mg/ml, between about 1 mg/ml and about 200 mg/ml, between about 25 mg/ml and about 200 mg/ml, between about 50 mg/ml and about 200 mg/ml, between about 75 mg/ml and about 200 mg/ml, between about 100 mg/ml and about 200 mg/ml, between about 125 mg/ml and about 200 mg/ml, between about 150 mg/ml and about 200 mg/ml, between about 25 mg/ml and about 150 mg/ml, between about 50 mg/ml and about 150 mg/ml, between about 75 mg/ml and about 150 mg/ml, between about 100 mg/ml and about 150 mg/ml, between about 125 mg/ml and about 150 mg/ml, between about 25 mg/ml and about 125 mg/ml, between about 50 mg/ml and about 125 mg/ml, between about 75 mg/ml and about 125 mg/ml, between about 100 mg/ml and about 125 mg/ml, between about 25 mg/ml and about 100 mg/ml, between about 50 mg/ml and about 100 mg/ml, between about 75 mg/ml and about 100 mg/ml, between about 25 mg/ml and about 75 mg/ml, between about 50 mg/ml and about 75 mg/ml, or between about 25 mg/ml and about 50 mg/ml.

In a specific embodiment, a formulation of the invention comprises between about 90 mg/ml and about 110 mg/ml of an anti-IC AM- 1 antibody of the invention. In another specific embodiment, a formulation of the invention comprises between about 100 mg/ml and about 210 mg/ml of an anti-ICAM- 1 antibody of the invention.

In other certain embodiments, the formulations of the invention comprising an anti- ICAM-1 antibody may further comprise one or more active compounds as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Such additional active compound/s is/are suitably present in combination in amounts that are effective for the purpose intended.

According to certain aspects of the invention, the formulations of the invention may be prepared for storage by mixing the anti-ICAM- 1 antibody having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers, including, but not limited to buffering agents, saccharides, salts, surfactants, solubilizers, polyols, diluents, binders, stabilizers, salts, lipophilic solvents, amino acids, chelators, preservatives, or the like (Remington 's Pharmaceutical Sciences, 16th edition, Osol, A. Ed. (1999)), in the form of lyophilized formulations or aqueous solutions at a desired final concentration.

Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as histidine, phosphate, citrate, glycine, acetate and other organic acids; antioxidants including ascorbic acid and methionine;

preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol;

3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including trehalose, glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g. , Zn-protein complexes); and/or non-ionic surfactants such as TWEEN, polysorbate 80, PLURONICS™ or polyethylene glycol (PEG).

In one aspect, the buffering agent is selected from the group consisting of histidine, citrate, phosphate, glycine, and acetate. In another aspect the saccharide excipient is selected from the group consisting of trehalose, sucrose, mannitol, maltose and raffinose. In still other aspects the surfactant is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 80, and Pluronic F68. In yet other embodiments the salt is selected from the group consisting of NaCl, KC1, MgCl2, and CaCl2

The formulations of the invention may include a buffering or pH adjusting agent to provide improved pH control. In one embodiment, a formulation of the invention has a pH of between about 3.0 and about 9.0, between about 4.0 and about 8.0, between about 5.0 and about 8.0, between about 5.0 and about 7.0, between about 5.0 and about 6.5, between about 5.5 and about 8.0, between about 5.5 and about 7.0, or between about 5.5 and about 6.5. In a further embodiment, a formulation of the invention has a pH of about 3.0, about 3.5, about 4.0, about 4.5, about 5.0, about 5.1 , about 5.2, about 5.3, about 5.4, about 5.5, about 5.6, about 5.7, about 5.8, about 5.9, about 6.0, about 6.1 , about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.5, about 8.0, about 8.5, or about 9.0. In a specific embodiment, a formulation of the invention has a pH of about 6.0. One of skill in the art understands that the pH of a formulation generally should not be equal to the isoelectric point of the particular anti-ICAM- 1 antibody to be used in the formulation.

Typically, the buffering agent is a salt prepared from an organic or inorganic acid or base. Representative buffering agents include, but are not limited to, organic acid salts such as salts of citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid, or phthalic acid; Tris, tromethamine hydrochloride, or phosphate buffers. In addition, amino acid components can also function in a buffering capacity. Representative amino acid components which may be utilized in the formulations of the invention as buffering agents include, but are not limited to, glycine and histidine. In certain

embodiments, the buffering agent is selected from the group consisting of histidine, citrate, phosphate, glycine, and acetate. In a specific embodiment, the buffering agent is histidine. In another specific embodiment, the buffering agent is citrate. In yet another specific embodiment, the buffering agent is glycine. The purity of the buffering agent should be at least 98%, or at least 99%, or at least 99.5%. As used herein, the term "purity" in the context of histidine and glycine refers to chemical purity of histidine or glycine as understood in the art, e.g. , as described in The Merck Index, 13th ed., O'Neil et al. ed. (Merck & Co., 2001).

Buffering agents are typically used at concentrations between about 1 mM and about 200 mM or any range or value therein, depending on the desired ionic strength and the buffering capacity required. The usual concentrations of conventional buffering agents employed in parenteral formulations can be found in: Pharmaceutical Dosage Form:

Parenteral Medications, Volume 1, 2nd Edition, Chapter 5, p. 194, De Luca and Boylan, "Formulation of Small Volume Parenterals", Table 5: Commonly used additives in Parenteral Products. In one embodiment, the buffering agent is at a concentration of about 1 mM, or of about 5 mM, or of about 10 mM, or of about 15 mM, or of about 20 mM, or of about 25 mM, or of about 30 mM, or of about 35 mM, or of about 40 mM, or of about 45 mM, or of about 50 mM, or of about 60 mM, or of about 70 mM, or of about 80 mM, or of about 90 mM, or of about 100 mM. In one embodiment, the buffering agent is at a concentration of 1 mM, or of 5 mM, or of 10 mM, or of 15 mM, or of 20 mM, or of 25 mM, or of 30 mM, or of 35 mM, or of 40 mM, or of 45 mM, or of 50 mM, or of 60 mM, or of 70 mM, or of 80 mM, or of 90 mM, or of 100 mM. In a specific embodiment, the buffering agent is at a concentration of between about 5 mM and about 50 mM. In another specific embodiment, the buffering agent is at a concentration of between 5 mM and 20 mM.

In certain embodiments, the formulation of the invention comprises histidine as a buffering agent. In one embodiment the histadine is present in the formulation of the invention at a concentration of at least about 1 mM, at least about 5 mM, at least about 10 mM, at least about 20 mM, at least about 30 mM, at least about 40 mM, at least about 50 mM, at least about 75 mM, at least about 100 mM, at least about 150 mM, or at least about 200 mM histidine. In another embodiment, a formulation of the invention comprises between about 1 mM and about 200 mM, between about 1 mM and about 150 mM, between about 1 mM and about 100 mM, between about 1 mM and about 75 mM, between about 10 mM and about 200 mM, between about 10 mM and about 150 mM, between about 10 mM and about 100 mM, between about 10 mM and about 75 mM, between about 10 mM and about 50 mM, between about 10 mM and about 40 mM, between about 10 mM and about 30 mM, between about 20 mM and about 75 mM, between about 20 mM and about 50 mM, between about 20 mM and about 40 mM, or between about 20 mM and about 30 mM histidine. In a further embodiment of the invention comprises about 1 mM, about 5 mM, about 10 mM, about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM, about 60 mM, about 70 mM, about 80 mM, about 90 mM, about 100 mM, about 150 mM, or about 200 mM histidine. In a specific embodiment, a formulation of the invention comprises about 10 mM histidine. In another specific embodiment, a formulation of the invention comprises about 25 mM histidine. In yet another specific embodiment, a formulation of the invention comprises about 0 mM histidine.

In certain embodiments, the formulations of the invention may comprise a

carbohydrate excipient. Carbohydrate excipients can act, e.g., as viscosity enhancing agents, stabilizers, bulking agents, solubilizing agents, and/or the like. Carbohydrate excipients are generally present at between about 1% to about 99% by weight or volume. In one embodiment, the carbohydrate excipient is present at between about 0.1% to about 20%. In another embodiment, the carbohydrate excipient is present at between about 0.1% to about 15%. In a specific embodiment, the carbohydrate excipient is present at between about 0.1% to about 5%, or between about 1% to about 20%, or between about 5% to about 15%, or between about 8% to about 10%, or between about 10% and about 15%, or between about 15% and about 20%. In another specific embodiment, the carbohydrate excipient is present at between 0.1% to 20%, or between 5% to 15%, or between 8% to 10%, or between 10% and 15%, or between 15% and 20%. In still another specific embodiment, the carbohydrate excipient is present at between about 0.1% to about 5%. In still another specific embodiment, the carbohydrate excipient is present at between about 5% to about 10%. In yet another specific embodiment, the carbohydrate excipient is present at between about 15% to about 20%. In still other specific embodiments, the carbohydrate excipient is present at 1%, or at 1.5%, or at 2%, or at 2.5%, or at 3%, or at 4%, or at 5%, or at 10%, or at 15%, or at 20%.

Carbohydrate excipients suitable for use in the formulations of the invention include, but are not limited to, monosaccharides such as fructose, maltose, galactose, glucose, D- mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and the like. In one embodiment, the carbohydrate excipients for use in the present invention are selected from the group consisting of, sucrose, trehalose, lactose, mannitol, and raffinose. In a specific embodiment, the carbohydrate excipient is trehalose. In another specific embodiment, the carbohydrate excipient is mannitol. In yet another specific embodiment, the carbohydrate excipient is sucrose. In still another specific embodiment, the carbohydrate excipient is raffinose. The purity of the carbohydrate excipient should be at least 98%, or at least 99%, or at least 99.5%.

In a specific embodiment, the formaultions of the invention comprise trehalose. In one embodiment, a formulation of the invention comprises at least about 1%, at least about 2%, at least about 4%, at least about 8%, at least about 20%, at least about 30%, or at least about 40% trehalose. In another embodiment, a formulation of the invention comprises between about 1% and about 40%, between about 1% and about 30%, between about 1% and about 20%, between about 2% and about 40%, between about 2% and about 30%, between about 2% and about 20%, between about 4% and about 40%, between about 4% and about 30%, or between about 4% and about 20% trehalose. In a further embodiment, a formulation of the invention comprises about 1%, about 2%, about 4%, about 6%, about 8%, about 15%, about 20%, about 30%, or about 40% trehalose. In a specific embodiment, a formulation of the invention comprises about 4%, about 6% or about 15% trehalose.

In certain embodiments, a formulation of the invention comprises an excipient. In a specific embodiment, a formulation of the invention comprises at least one excipient selected from the group consisting of: sugar, salt, surfactant, amino acid, polyol, chelating agent, emulsifier and preservative. In one embodiment, a formulation of the invention comprises a salt. In one embodiment, a formulation of the invention comprises a salt selected from the group consisting of: NaCl, KC1, CaCl2, and MgCl2. In a specific embodiment, a formulation of the invention comprises NaCl.

In a specific embodiment, a formulation of the invention comprises at least about 10 mM, at least about 25 mM, at least about 50 mM, at least about 75 mM, at least about 80 mM, at least about 100 mM, at least about 125 mM, at least about 150 mM, at least about 175 mM, at least about 200 mM, or at least about 300 mM sodium chloride (NaCl). In a further embodiment, a formulation described herein comprises between about 10 mM and about 300 mM, between about 10 mM and about 200 mM, between about 10 mM and about 175 mM, between about 10 mM and about 150 mM, between about 25 mM and about 300 mM, between about 25 mM and about 200 mM, between about 25 mM and about 175 mM, between about 25 mM and about 150 mM, between about 50 mM and about 300 mM, between about 50 mM and about 200 mM, between about 50 mM and about 175 mM, between about 50 mM and about 150 mM, between about 75 mM and about 300 mM, between about 75 mM and about 200 mM, between about 75 mM and about 175 mM, between about 75 mM and about 150 mM, between about 100 mM and about 300 mM, between about 100 mM and about 200 mM, between about 100 mM and about 175 mM, or between about 100 mM and about 150 mM sodium chloride. In a further embodiment, a formulation of the invention comprises about 10 mM. about 25 mM, about 50 mM, about 75 mM, about 80 mM, about 100 mM, about 125 mM, about 150 mM, about 175 mM, about 200 mM, or about 300 mM sodium chloride.

In certain embodiments, a formulation of the invention comprises an amino acid. In one embodiment, a formulation of the invention comprises an amino acid salt. In one embodiment, a formulation of the invention comprises an amino acid selected from the group consisting of lysine, arginine, glycine and histidine. In one embodiment, a formulation of the invention comprises at least about ImM of an amino acid, at least about lOmM of an amino acid, at least about 25 mM of an amino acid, at least about 50 mM of an amino acid, at least about 100 mM of an amino acid, at least about 150 mM of an amino acid, at least about 200 mM of an amino acid, at least about 250 mM of an amino acid, at least about 300 mM of an amino acid, at least about 350 mM of an amino acid, or at least about 400 mM of an amino acid. In another embodiment, a formulation of the invention comprises between about 1 mM and about 100 mM, between about 10 mM and about 150 mM, between about 25 mM and about 250 mM, between about 25 mM and about 300 mM, between about 25 mM and about 350 mM, between about 25 mM and about 400 mM, between about 50 mM and about 250 mM, between about 50 mM and about 300 mM, between about 50 mM and about 350 mM, between about 50 mM and about 400 mM, between about 100 mM and about 250 mM, between about 100 mM and about 300 mM, between about 100 mM and about 400 mM, between about 150 mM and about 250 mM, between about 150 mM and about 300 mM, or between about 150 mM and about 400 mM of an amino acid. In a further embodiment, a formulation of the invention comprises about 1 mM, 1.6 mM, 25 mM, about 50 mM, about 100 mM, about 150 mM, about 200 mM, about 250 mM, about 300 mM, about 350 mM, or about 400 mM of an amino acid.

In a specific embodiment, a formulation of the invention comprises about 200 mM of arginine. In a specific embodiment, a formulation of the invention comprises about 1.6 mM of glycine. In a specific embodiment, a formulation of the invention comprises about 10 mM of histidine. In a specific embodiment, a formulation of the invention comprises about 25 mM of histidine. The formulations of the invention may comprise an amino acid alone or in combination with another amino acid.

In one embodiment, a formulation of the invention comprises trehalose and an amino acid. In one embodiment, a formulation of the invention comprises trehalose and an amino acid at a molar ratio of about 0.1 , about 0.5, about 0.75, about 1 , about 5, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 200, or about 300. In one embodiment, a formulation of the invention comprises trehalose and an amino acid at a molar ratio of about 1.5, about 1.7, about 1.8, about 1.9, about 2, about 2.1 , about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3, about 3.1 , about 3.2, about 3.3, about 3.4, about 3.5, or about 4. In a specific embodiment, a formulation of the invention comprises trehalose and an amino acid at a molar ratio of about 2.1. In a specific embodiment, a formulation of the invention comprises trehalose and an amino acid at a molar ratio of about 2.2. In a specific embodiment, a formulation of the invention comprises trehalose and an amino acid at a molar ratio of about 2.4. In a specific embodiment, a formulation of the invention comprises trehalose and an amino acid at a molar ratio of about 2.5. In a specific embodiment, a formulation of the invention comprises trehalose and an amino acid at a molar ratio of about 2.6. In a specific embodiment, a formulation of the invention comprises trehalose and an amino acid at a molar ratio of about 2.7.

The formulations of the invention may further comprise a surfactant. The term "surfactant" as used herein refers to organic substances having amphipathic structures;

namely, they are composed of groups of opposing solubility tendencies, typically an oil- soluble hydrocarbon chain and a water-soluble ionic group. Surfactants can be classified, depending on the charge of the surface- active moiety, into anionic, cationic, and nonionic surfactants. Surfactants are often used as wetting, emulsifying, solubilizing, and dispersing agents for various pharmaceutical compositions and preparations of biological materials. Pharmaceutically acceptable surfactants like polysorbates (e.g. polysorbates 20 or 80);

polyoxamers (e.g. poloxamer 188); Triton; sodium octyl glycoside; lauryl-, myristyl-, linoleyl-, or stearyl-sulfobetaine; lauryl-, myristyl-, linoleyl- or stearyl-sarcosine; linoleyl-, myristyl-, or cetyl-betaine; lauroamidopropyl-, cocamidopropyl-, linoleamidopropyl-, myristamidopropyl-, palmidopropyl-, or isostearamidopropyl-betaine (e.g.

lauroamidopropyl); myristamidopropyl-, palmidopropyl-, or isostearamidopropyl- dimethylamine; sodium methyl cocoyl-, or disodium methyl oleyl-taurate; and the MONAQUA™ series (Mona Industries, Inc., Paterson, N.J.), polyethyl glycol, polypropyl glycol, and copolymers of ethylene and propylene glycol (e.g. PLURONICS™, PF68 etc), can optionally be added to the formulations of the invention to reduce aggregation. In one embodiment, a formulation of the invention comprises Polysorbate 20, Polysorbate 40, Polysorbate 60, or Polysorbate 80. Surfactants are particularly useful if a pump or plastic container is used to administer the formulation. The presence of a pharmaceutically acceptable surfactant mitigates the propensity for the protein to aggregate. In a specific embodiment, the formulations of the invention comprise a polysorbate which is at a concentration ranging from between about 0.001 % to about 1 %, or about 0.001 % to about 0.1%, or about 0.01 % to about 0.1 %. In other specific embodiments, the formulations of the invention comprise a polysorbate which is at a concentration of 0.001 %, or 0.002%, or 0.003%, or 0.004%, or 0.005%, or 0.006%, or 0.007%, or 0.008%, or 0.009%, or 0.01%, or 0.015%, or 0.02%. In another specific embodiment, the polysorbate is polysorbate-80. In a specific embodiment, the formulations of the invention comprise a polysorbate which is at a concentration ranging from between 0.001 % to 1%, or 0.001 % to 0.1%, or 0.01 % to 0.1%. In other specific embodiments, the formulations of the invention comprise a polysorbate which is at a concentration of 0.001%, or 0.002%, or 0.003%, or 0.004%, or 0.005%, or 0.006%, or 0.007%, or 0.008%, or 0.009%, or 0.01 %, or 0.015%, or 0.02% . In another specific embodiment, the polysorbate is polysorbate-80.

In a specific embodiment, a formulation of the invention comprises at least about

0.001 %, at least about 0.002%, at least about 0.005%, at least about 0.01 %, at least about 0.02%, at least about 0.05%, at least about 0, 1 %, at least about 0.2%, or at least about 0.5% Polysorbate 80. In another embodiment, a formulation of the invention comprises between about 0.001 % and about 0.5%, between about 0.001% and about 0.2%, between about 0.001 % and about 0.1%, between about 0.001% and about 0.05%, between about 0.002% and about 0.5%, between about 0.002% and about 0.2%, between about 0.002% and about 0.1%, between about 0.002% and about 0.05%, between about 0.005% and about 0.5%, between about 0.005% and about 0.2%, between about 0.005% and about 0.1 %, between about 0.005% and about 0.05%, between about 0.01% and about 0.5%, between about 0.01% and about 0.2%, between about 0.01% and about 0.1 %, or between about 0.01% and about 0.05% Polysorbate 80. In a further embodiment, a formulation of the invention comprises about 0.001 %, about 0.002%, about 0.005%, about 0.01 %, about 0.02%, about 0.05%, about 0.1 %, about 0.2%, and about 0.5% Polysorbate 80. In a specific embodiment, a formulation of the invention comprises about 0.005% Polysorbate 80. In a specific embodiment, a formulation of the invention comprises about 0.025% Polysorbate 80. In a specific embodiment, a formulation of the invention comprises about 0.02% Polysorbate 80. In a specific embodiment, a formulation of the invention comprises about 0.1% Polysorbate 80.

In certain embodiments, the formulations of the invention may optionally further comprise other common excipients and/or additives including, but not limited to, diluents, binders, stabilizers, lipophilic solvents, preservatives, adjuvants, or the like.

Pharmaceutically acceptable excipients and/or additives may be used in the formulations of the invention. Commonly used excipients/additives, such as pharmaceutically acceptable chelators (for example, but not limited to, EDTA, DTPA or EGTA) can optionally be added to the formulations of the invention to reduce aggregation. These additives are particularly useful if a pump or plastic container is used to administer the formulation.

Preservatives, such as phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, phenylmercuric nitrite, phenoxyethanol, formaldehyde, chlorobutanol, magnesium chloride (for example, but not limited to, hexahydrate), alkylparaben (methyl, ethyl, propyl, butyl and the like), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate and thimerosal, or mixtures thereof can optionally be added to the formulations of the invention at any suitable concentration such as between about 0.001% to about 5%, or any range or value therein. The concentration of preservative used in the formulations of the invention is a concentration sufficient to yield a microbial effect. Such concentrations are dependent on the preservative selected and are readily determined by the skilled artisan.

Other contemplated excipients/additives, which may be utilized in the formulations of the invention include, for example, flavoring agents, antimicrobial agents, sweeteners, antioxidants, antistatic agents, lipids such as phospholipids or fatty acids, steroids such as cholesterol, protein excipients such as serum albumin (human serum albumin (HSA), recombinant human albumin (rHA)), gelatin, casein, salt-forming counterions such as sodium and the like. These and additional known pharmaceutical excipients and/or additives suitable for use in the formulations of the invention are known in the art, e.g., as listed in "Remington: The Science & Practice of Pharmacy", 21st ed., Lippincott Williams & Wilkins, (2005), and in the "Physician's Desk Reference", 60th ed., Medical Economics, Montvale, N.J. (2005). Pharmaceutically acceptable carriers can be routinely selected that are suitable for the mode of administration, solubility and/or stability of anti-ICAM- 1 antibody, as well known those in the art or as described herein.

It will be understood by one skilled in the art that the formulations of the invention may be isotonic with human blood, wherein the formulations of the invention have essentially the same osmotic pressure as human blood. Such isotonic formulations will generally have an osmotic pressure from about 250 mOSm to about 350 mOSm. Isotonicity can be measured by, for example, using a vapor pressure or ice-freezing type osmometer. Tonicity of a formulation is adjusted by the use of tonicity modifiers. "Tonicity modifiers" are those pharmaceutically acceptable inert substances that can be added to the formulation to provide an isotonity of the formulation. Tonicity modifiers suitable for this invention include, but are not limited to, saccharides, salts and amino acids.

In certain embodiments, the formulations of the present invention have an osmotic pressure from about 100 mOSm to about 1200 mOSm, or from about 200 mOSm to about 1000 mOSm, or from about 200 mOSm to about 800 mOSm, or from about 200 mOSm to about 600 mOSm, or from about 250 mOSm to about 500 mOSm, or from about 250 mOSm to about 400 mOSm, or from about 250 mOSm to about 350 mOSm.

The concentration of any one component or any combination of various components, of the formulations of the invention is adjusted to achieve the desired tonicity of the final formulation. For example, the ratio of the carbohydrate excipient to antibody may be adjusted according to methods known in the art (e.g. , U.S. Patent No. 6,685,940). In certain embodiments, the molar ratio of the carbohydrate excipient to antibody may be from about 100 moles to about 1000 moles of carbohydrate excipient to about 1 mole of antibody, or from about 200 moles to about 6000 moles of carbohydrate excipient to about 1 mole of antibody, or from about 100 moles to about 510 moles of carbohydrate excipient to about 1 mole of antibody, or from about 100 moles to about 600 moles of carbohydrate excipient to about 1 mole of antibody.

The desired isotonicity of the final formulation may also be achieved by adjusting the salt concentration of the formulations. Pharmaceutically acceptable salts and those suitable for this invention as tonicity modifiers include, but are not limited to, sodium chloride, sodium succinate, sodium sulfate, potassuim chloride, magnesium chloride, magnesium sulfate, and calcium chloride. In specific embodiments, formulations of the inventions comprise NaCl, MgCl2, and/or CaCl2. In one embodiment, concentration of NaCl is between about 75 mM and about 150 mM. In another embodiment, concentration of MgCl2 is between about 1 mM and about 100 mM. Pharmaceutically acceptable amino acids including those suitable for this invention as tonicity modifiers include, but are not limited to, proline, alanine, L-arginine, asparagine, L-aspartic acid, glycine, serine, lysine, and histidine.

In one embodiment the formulations of the invention are pyrogen-free formulations which are substantially free of endotoxins and/or related pyrogenic substances. Endotoxins include toxins that are confined inside a microorganism and are released only when the microorganisms are broken down or die. Pyrogenic substances also include fever-inducing, thermostable substances (glycoproteins) from the outer membrane of bacteria and other microorganisms. Both of these substances can cause fever, hypotension and shock if administered to humans. Due to the potential harmful effects, even low amounts of endotoxins must be removed from intravenously administered pharmaceutical drug solutions. The Food & Drug Administration ("FDA") has set an upper limit of 5 endotoxin units (EU) per dose per kilogram body weight in a single one hour period for intravenous drug applications (The United States Pharmacopeial Convention, Pharmacopeial Forum 26 (1):223 (2000)). When therapeutic proteins are administered in amounts of several hundred or thousand milligrams per kilogram body weight, as can be the case with antibodies, even trace amounts of harmful and dangerous endotoxin must be removed. In certain specific embodiments, the endotoxin and pyrogen levels in the composition are less then 10 EU/mg, or less then 5 EU/mg, or less then 1 EU/mg, or less then 0.1 EU/mg, or less then 0.01 EU/mg, or less then 0.001 EU/mg.

When used for in vivo administration, the formulations of the invention should be sterile. The formulations of the invention may be sterilized by various sterilization methods, including sterile filtration, radiation, etc. In one embodiment, the antibody formulation is filter-sterilized with a presterilized 0.22-micron filter. Sterile compositions for injection can be formulated according to conventional pharmaceutical practice as described in "Remington: The Science & Practice of Pharmacy", 21st ed., Lippincott Williams & Wilkins, (2005).

Formulations comprising antibodies, such as those disclosed herein, ordinarily will be stored in lyophilized form or in solution. It is contemplated that sterile compositions comprising antibodies are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having an adapter that allows retrieval of the formulation, such as a stopper pierceable by a hypodermic injection needle. In one embodiment, a composition of the invention is provided as a pre-filled syringe.

In one embodiment, a formulation of the invention is a lyophilized formulation. The term "lyophilized" or "freeze-dried" includes a state of a substance that has been subjected to a drying procedure such as lyophilization, where at least 50% of moisture has been removed.

The phrase "bulking agent" includes a compound that is pharmaceutically acceptable and that adds bulk to a lyo cake. Bulking agents known to the art include, for example, carbohydrates, including simple sugars such as dextrose, ribose, fructose and the like, alcohol sugars such as mannitol, inositol and sorbitol, disaccharides including trehalose, sucrose and lactose, naturally occurring polymers such as starch, dextrans, chitosan, hyaluronate, proteins (e.g., gelatin and serum albumin), glycogen, and synthetic monomers and polymers.

A "lyoprotectant" is a molecule which, when combined with a protein of interest (such as an anti-IC AM- 1 antibody), significantly prevents or reduces chemical and/or physical instability of the protein upon lyophilization and subsequent storage. Lyoprotectants include, but are not limited to, sugars and their corresponding sugar alchohols; an amino acid such as monosodium glutamate or histidine; a methylamine such as betaine; a lyotropic salt such as magnesium sulfate; a polyol such as trihydric or higher molecular weight sugar alcohols, e.g. glycerin, dextran, erythritol, glycerol, arabitol, xylitol, sorbitol, and mannitol; propylene glycol; polyethylene glycol; PLURONICS™; and combinations thereof.

Additional examples of lyoprotectants include, but are not limited to, glycerin and gelatin, and the sugars mellibiose, melezitose, raffinose, mannotriose and stachyose. Examples of reducing sugars include, but are not limited to, glucose, maltose, lactose, maltulose, iso- maltulose and lactulose. Examples of non-reducing sugars include, but are not limited to, non-reducing glycosides of polyhydroxy compounds selected from sugar alcohols and other straight chain polyalcohols. Examples of sugar alcohols include, but are not limited to, monoglycosides, compounds obtained by reduction of disaccharides such as lactose, maltose, lactulose and maltulose. The glycosidic side group can be either glucosidic or galactosidic. Additional examples of sugar alcohols include, but are not limited to, glucitol, maltitol, lactitol and iso-maltulose. In specific embodiments, trehalose or sucrose is used as a lyoprotectant.

The lyoprotectant is added to the pre-lyophilized formulation in a "lyoprotecting amount" which means that, following lyophilization of the protein in the presence of the lyoprotecting amount of the lyoprotectant, the protein essentially retains its physical and chemical stability and integrity upon lyophilization and storage.

In one embodiment, the molar ratio of a lyoprotectant (e.g., trehalose) and anti- ICAM-1 antibody molecules of a formulation of the invention is at least about 10, at least about 50, at least about 100, at least about 200, or at least about 300. In another embodiment, the molar ratio of a lyoprotectant (e.g., trehalose) and anti-IC AM- 1 antibody molecules of a formulation of the invention is about 1, is about 2, is about 5, is about 10, about 50, about 100, about 200, or about 300.

A "reconstituted" formulation is one which has been prepared by dissolving a lyophilized antibody formulation in a diluent such that the antibody is dispersed in the reconstituted formulation. The reconstituted formulation is suitable for administration (e.g. parenteral administration) to a patient to be treated with the anti-ICAM- 1 antibody and, in certain embodiments of the invention, may be one which is suitable for intravenous administration.

The "diluent" of interest herein is one which is pharmaceutically acceptable (safe and non-toxic for administration to a human) and is useful for the preparation of a liquid formulation, such as a formulation reconstituted after lyophilization. In some embodiments, diluents include, but are not limited to, sterile water, bacteriostatic water for injection (BWFI), a pH buffered solution (e.g. phosphate-buffered saline), sterile saline solution, Ringer's solution or dextrose solution. In an alternative embodiment, diluents can include aqueous solutions of salts and/or buffers.

In certain embodiments, a formulation of the invention is a lyophilized formulation comprising an anti-ICAM- 1 antibody of the invention, wherein at least about 90%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% of said antibody may be recovered from a vial upon shaking said vial for 4 hours at a speed of 400 shakes per minute wherein said vial is filled to half of its volume with said formulation. In another embodiment, a formulation of the invention is a lyophilized formulation comprising an anti- ICAM- 1 antibody of the invention, wherein at least about 90%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% of said antibody may be recovered from a vial upon subjecting the formulation to three freeze/thaw cycles wherein said vial is filled to half of its volume with said formulation. In a further embodiment, a formulation of the invention is a lyophilized formulation comprising an anti-ICAM- 1 antibody of the invention, wherein at least about 90%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% of said antibody may be recovered by reconstituting a lyophilized cake generated from said formulation.

In certain embodiments, a lyophilized formulation of the invention comprises anti-

ICAM- 1 antibody molecules of the invention, wherein at least about 90% , at least about 95%, at least about 97%, at least about 98%, or at least about 99% of said antibody is recovered by reconstituting said lyophilized formulation upon storage at about 40 °C for at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, or at least about 6 weeks. In one embodiment, a lyophilized formulation of the invention comprises anti-ICAM- 1 antibody molecules of the invention, wherein at least about 90% , at least about 95%, at least about 97%, at least about 98%, or at least about 99% of said antibody is recovered by reconstituting said lyophilized formulation upon storage at about 40 °C for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, or at least about 6 months.

In certain embodiments, a lyophilized formulation of the invention comprises anti- ICAM- 1 antibody molecules of the invention, wherein at least about 90% , at least about 95%, at least about 97%, at least about 98%, or at least about 99% of said antibody is recovered by reconstituting said lyophilized formulation upon storage at about 5 °C for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months. In one embodiment, a lyophilized formulation of the invention comprises anti-ICAM-1 antibody molecules of the invention, wherein at least about 90% , at least about 95%, at least about 97%, at least about 98%, or at least about 99% of said antibody is recovered by reconstituting said lyophilized formulation upon storage at about 5 °C for at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, or at least about 5 years.

In one embodiment, a reconstituted liquid formulation of the invention comprises an anti-ICAM-1 antibody of the invention at the same concentration as the pre-lyophilized liquid formulation.

In one embodiment, a reconstituted liquid formulation of the invention comprises an anti-ICAM-1 antibody of the invention at a higher concentration than the pre-lyophilized liquid formulation. In specific embodiments, a reconstituted liquid formulation of the invention comprises about 2 fold, about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold, about 15 fold, about 20 fold, about 30 fold, about 40 fold higher concentration of an anti-ICAM-1 antibody of the invention than the pre- lyophilized liquid formulation.

In another embodiment, alternatively a reconstituted liquid formulation of the invention comprises an anti-ICAM-1 antibody of the invention at a lower concentration than the pre-lyophilized liquid formulation. In specific embodiments, a reconstituted liquid formulation of the invention comprises about 2 fold, about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold, about 15 fold, about 20 fold, about 30 fold, about 40 fold lower concentration of an anti-ICAM-1 antibody of the invention than the pre-lyophilized liquid formulation.

In certain embodiments, reconstituted formulations of the invention comprise (or consists of as the aggregate fraction) a particle profile of less than about 3.4 E +5 particles/ml of diameter 2-4 μιη, less than about 4.0 E +4 particles/ml of diameter 4-10 μιη, less than about 4.2 E +3 particles/ml of diameter 10-20 μιη, less than about 5.0 E +2 particles/ml of diameter 20-30 μιιι, less than about 7.5 E +1 particles/ml of diameter 30-40 μιη, and less than about 9.4 particles/ml of diameter 40-60 μιη as determined by a particle multisizer. In certain embodiments, reconstituted formulations of the invention contain no detectable particles greater than 40 μιη, or greater than 30 μηι.

In certain embodiments, after storage for about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 12 hours, about 15 hours, about 18 hours, or about 24 hours reconstituted liquid formulations of the invention comprise (or consists of as the aggregate fraction) a particle profile of less than about 3.4 E +5 particles/ml of diameter 2-4 μιη, less than about 4.0 E +4 particles/ml of diameter 4-10 μιτι, less than about 4.2 E +3 particles/ml of diameter 10-20 μιη, less than about 5.0 E +2 particles/ml of diameter 20-30 μιτι, less than about 7.5 E +1 particles/ml of diameter 30-40 μιη, and less than about 9.4 particles/ml of diameter 40-60 μιη as determined by a particle multisizer. In certain embodiments, liquid formulations of the invention contain no detectable particles greater than 40 μιτι, or greater than 30 μιη.

In one embodiment, a pharmaceutical formulation of the invention is a stable formulation. In certain embodiments, a pharmaceutical composition of the invention is stable at 4 °C. In certain embodiments, a pharmaceutical composition of the invention is stable at room temperature.

The terms "stability" and "stable" as used herein in the context of a formulation comprising an anti-ICAM- 1 antibody of the invention refer to the resistance of the antibody in the formulation to aggregation, degradation or fragmentation under given manufacture, preparation, transportation and storage conditions. The "stable" formulations of the invention retain biological activity under given manufacture, preparation, transportation and storage conditions. The stability of the anti-ICAM- 1 antibody can be assessed by degrees of aggregation, degradation or fragmentation, as measured by HPSEC, static light scattering (SLS), Fourier Transform Infrared Spectroscopy (FTIR), circular dichroism (CD), urea unfolding techniques, intrinsic tryptophan fluorescence, differential scanning calorimetry, and/or ANS binding techniques, compared to a reference formulation. For example, a reference formulation may be a reference standard frozen at -70°C consisting of 10 mg/ml of an anti-ICAM- 1 antibody of the invention in PBS.

In specific embodiments, the pharmaceutical compositions include, but are not limited to: (a) a sterile liquid formulation comprising 100 mg/ml of antibody, 25 mM histidine, 1.6 mM glycine at pH 6.0;

(b) a sterile liquid formulation comprising 100 mg/ml of antibody and 25 mM

histidine-HCl at pH 6.0;

(c) a sterile liquid formulation comprising 25mg/ml of antibody, 20mM Citric acid, 100 mM NaCl, 1.5% mannitol, 50μ1 DTPA, and 0.02% Polysorbate 80 at pH 6.0;

(d) a sterile liquid formulation comprising 100 mg/ml of antibody, 25 mM histidine, 8% trehalose, and 0.02% Polysorbate 80 at pH 6.0;

(e) a sterile liquid formulation comprising 20 mg/ml of antibody, 10 mM Histidine, 2.35 % (w/v) Lysine-HCl, and 0.02 % Polysorbate 80 (w/v) at pH 6.0;

(f) a sterile liquid formulation comprising 5 mg/ml of antibody, lOmM Sodium

citrate buffer, NaCl (0.15M) and Tween 80 (0.02%) at pH 6.0;

(g) a sterile liquid formulation comprising 100 mg/ml of antibody, 10 mM histidine and 150 mM NaCl at pH 6.0;

(h) a sterile liquid formulation comprising 100 mg/ml of antibody, 25 mM histidine, 1.6 mM glycine, 3% mannitol at pH 6.0;

(i) a sterile liquid formulation comprising 10 mg/ml or 100 mg/ml of antibody, 10 mM histidine-HCl, 105 mM NaCl, 0.005% polysorbate 80 at pH 6.0;

(j) a sterile liquid formulation comprising 100 mg/ml of antibody, 10 mM histidine- HCl, 0.005% polysorbate 80 at pH 6.0;

(k) a sterile liquid formulation comprising 100 mg/ml of antibody, 6% trehalose, 2% arginine, 0.025% polysorbate, 10m M histidine at pH 6.0;

(1) a sterile liquid formulation comprising 100 mg/ml of antibody, 20 mM citric acid,

200 mM lysine, 15% trehalose, 0.1% polysorbate 80 at pH 6.0;

(m)a sterile liquid formulation comprising 100 mg/ml of antibody, 20 mM citric acid,

199 mM NaCl, 1.5% mannitol, 50μ1 DTPA, 0.02% polysorbate 80 at pH 6.0 The liquid formulations of the present invention exhibit stability at the temperature ranges of 38 °C to 42 °C for at least 60 days and, in some embodiments, not more than 120 days, of 20 °C to 24 °C for at least 1 year, of 2 °C to 8 °C (in particular, at 4 °C) for at least 3 years, at least 4 years, or at least 5 years and at -20 °C for at least 3 years, at least 4 years, or at least 5 years, as assessed by high performance size exclusion chromatography (HPSEC). Namely, the liquid formulations of the present invention have low to undetectable levels of aggregation and/or fragmentation, as defined herein, after the storage for the defined periods as set forth above. Preferably, no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1%, and most preferably no more than 0.5%, of anti-ICAM- 1 antibody forms an aggregate as measured by HPSEC, after the storage for the defined periods as set forth above. Furthermore, liquid formulations of the present invention exhibit almost no loss in biological activity(ies) of anti-ICAM- 1 antibodies during the prolonged storage under the condition described above, as assessed by various immunological assays including, for example, enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay to measure the ICAM-1 antigen-binding ability of anti-ICAM- 1 antibody. The liquid formulations of the present invention retain after the storage for the above-defined periods more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, more than 99%, or more than 99.5% of the initial biological activity(ies) prior to the storage.

Therapeutic compositions of the present invention may be formulated for a particular dosage. Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the anti-ICAM- 1 antibody and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an anti-ICAM- 1 antibody for the treatment of sensitivity in individuals.

Therapeutic compositions of the present invention can be formulated for particular routes of administration, such as oral, nasal, pulmonary, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the subject being treated, and the particular mode of administration. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect. By way of example, in certain embodiments, the antibodies (including antibody fragments) are formulated for intravenous administration. In certain other embodiments, the antibodies (including antibody fragments) are formulated for nasal or pulmonary delivery.

Formulations of the present invention which are suitable for topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active compound may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required (US Patent No. 7,378,110; 7,258,873; 7,135,180; US Publication No. 2004- 0042972; and 2004-0042971).

The phrases "parenteral administration" and "administered parenterally" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.

Actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

In certain embodiments, antibodies of the invention can be formulated to ensure proper distribution in vivo. For example, the blood-brain barrier (BBB) excludes many highly hydrophilic compounds. To ensure that the therapeutic compounds of the invention can cross the BBB (if desired), they can be formulated, for example, in liposomes. For methods of manufacturing liposomes, see, e.g., U.S. Pat. Nos. 4,522,811; 5,374,548;

5,399,331. The liposomes may comprise one or more moieties which are selectively transported into specific cells or organs, thus enhance targeted drug delivery (see, e.g., V. V. Ranade (1989) /. Clin. Pharmacol. 29:685). Exemplary targeting moieties include folate or biotin (see, e.g., U.S. Pat. No. 5,416,016); mannosides (Umezawa et al., (1988) Biochem. Biophys. Res. Commun. 153: 1038); antibodies (P. G. Bloeman et al. (1995) FEBS Lett.

357: 140; M. Owais et al. (1995) Antimicrob. Agents Chemother. 39: 180); surfactant protein A receptor (Briscoe et al. (1995) Am. J. Physiol. 1233: 134), different species of which may comprise the formulations of the inventions, as well as components of the invented molecules; pl20 (Schreier et al. (1994) . Biol. Chem. 269:9090); see also K. Keinanen; M. L. Laukkanen (1994) FEBS Lett. 346: 123; J. J. Killion; I. J. Fidler (1994) Immunomethods 4:273. In one embodiment of the invention, the therapeutic compounds of the invention are formulated in liposomes; in another embodiment, the liposomes include a targeting moiety. In another embodiment, the therapeutic compounds in the liposomes are delivered by bolus injection to a site proximal to the desired area, e.g., the site of inflammation or infection, or the site of a tumor. When administered in this manner, the composition must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms such as bacteria and fungi.

In certain embodiments, the therapeutic antibody compositions may be administered with medical devices known in the art. For example, in one embodiment, a therapeutic composition of the invention can be administered with a needleless hypodermic injection device, such as the devices disclosed in U.S. Pat. Nos. 5,399,163; 5,383,851; 5,312,335; 5,064,413; 4,941,880; 4,790,824; 4,596,556. Examples of well-known implants and modules useful in the present invention include: U.S. Pat. No. 4,487,603, which discloses an implantable micro-infusion pump for dispensing medication at a controlled rate; U.S. Pat. No. 4,486,194, which discloses a therapeutic device for administering medicants through the skin; U.S. Pat. No. 4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; U.S. Pat. No. 4,447,224, which discloses a variable flow implantable infusion apparatus for continuous drug delivery; U.S. Pat. No. 4,439,196, which discloses an osmotic drug delivery system having multi-chamber compartments; and U.S. Pat. No. 4,475,196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art.

The efficient dosages and the dosage regimens for the antibodies of the invention depend on the disease or condition to be treated and can be determined by the persons skilled in the art.

A "therapeutically effective dosage" for preventing HRV infection may reduce the number and/or severity of HRV infections. A "therapeutically effective dosage" for treating HRV infection may result in reduced duration and/or severity of HRV infections. Likewise, a "therapeutically effective dosage" for preventing CV-A infection may reduce the number and/or severity of CV-A infections and a "therapeutically effective dosage" for treating CV-A infection may result in reduced duration and/or severity of CV-A infections. Similarly, a "therapeutically effective dosage" for preventing/inhibiting adhesion of Plasmodium falciparum infected erythrocytes to the vascular endothelium may reduce the number and/or severity and/or duration and/or severity of Plasmodium falciparum infections. One of ordinary skill in the art would be able to determine such amounts based on such factors as the subject's size, the severity of the subject's symptoms, and the particular composition or route of administration selected.

(viii) Articles of Manufacture and Kits

This section of the specification describes various exemplary kits and packages comprising anti-ICAM- 1 antibodies (including antibody fragments) of the present disclosure. It should be understood that any of the anti-ICAM- 1 antibodies and antibody fragments described herein, including antibodies and antibody fragments having any one or more of the structural and functional features described in detail throughout the application, may be packaged, sold, and/or used as part of a kit or package, as described in this section. When various kits and packages are described in this section as including an antibody, it is understood that such an antibody may be an antibody or an antibody fragment having any one or more of the characteristics of the anti-ICAM- 1 antibodies and antibody fragments described herein. The disclosure contemplates all combinations of any of the aspects and embodiments of the invention.

The invention provides a pharmaceutical pack or kit comprising one or more containers filled with a liquid formulation or lyophilized formulation of the invention (e.g., a formulation comprising an anti-ICAM- 1 antibody or antibody fragment of the present disclosure). In one embodiment, a container filled with a liquid formulation of the invention is a pre-filled syringe. In one embodiment, the formulations of the invention comprise anti- ICAM- 1 antibodies recombinantly fused or chemically conjugated to another moiety, including but not limited to, a heterologous protein, a heterologous polypeptide, a heterologous peptide, a large molecule, a small molecule, a marker sequence, a diagnostic or detectable agent, a therapeutic moiety, a drug moiety, a radioactive metal ion, a second antibody, and a solid support. In a specific embodiment, the formulations of the invention are formulated in single dose vials as a sterile liquid. The formulations of the invention may be supplied in 3 cc USP Type I borosilicate amber vials (West Pharmaceutical Series - Part No. 6800-0675) with a target volume of 1.2 mL. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In another embodiment, a formulation of the invention may be supplied in a pre-filled syringe.

In one embodiment, a container filled with a liquid formulation of the invention is a pre-filled syringe. Any pre-filled syringe known to one of skill in the art may be used in combination with a liquid formulation of the invention. Pre-filled syringes that may be used are described in, for example, but not limited to, PCT Publications WO05032627,

WO08094984, W09945985, WO03077976, US Patents US6792743, US5607400,

US5893842, US7081107, US7041087, US5989227, US6807797, US6142976, US5899889, US Patent Publications US20070161961A1, US20050075611A1, US 20070092487A1, US20040267194A1, US20060129108A1. Pre-filled syringes may be made of various materials. In one embodiment a pre-filled syringe is a glass syringe. In another embodiment a pre-filled syringe is a plastic syringe. One of skill in the art understands that the nature and/or quality of the materials used for manufacturing the syringe may influence the stability of a protein formulation stored in the syringe. For example, it is understood that silicon based lubricants deposited on the inside surface of the syringe chamber may affect particle formation in the protein formulation. In one embodiment, a pre-filled syringe comprises a silicone based lubricant. In one embodiment, a pre-filled syringe comprises baked on silicone. In another embodiment, a pre-filled syringe is free from silicone based lubricants. One of skill in the art also understands that small amounts of contaminating elements leaching into the formulation from the syringe barrel, syringe tip cap, plunger or stopper may also influence stability of the formulation. For example, it is understood that tungsten introduced during the manufacturing process may adversely affect formulation stability. In one embodiment, a pre-filled syringe may comprise tungsten at a level above 500 ppb. In another embodiment, a pre-filled syringe is a low tungsten syringe. In another embodiment, a pre-filled syringe may comprise tungsten at a level between about 500 ppb and about 10 ppb, between about 400 ppb and about 10 ppb, between about 300 ppb and about 10 ppb, between about 200 ppb and about 10 ppb, between about 100 ppb and about 10 ppb, between about 50 ppb and about 10 ppb, between about 25 ppb and about 10 ppb.

In certain embodiments, kits comprising anti-ICAM- 1 antibodies are also provided that are useful for various purposes, e.g., research and diagnostic including for purification or immunoprecipitation of ICAM-1 from cells, detection of ICAM-1, etc. For isolation and purification of ICAM-1, the kit may contain an anti-IC AM- 1 antibody coupled to beads (e.g., sepharose beads). Kits may be provided which contain the antibodies for detection and quantitation of ICAM-1 in vitro, e.g. in an ELISA or a Western blot. As with the article of manufacture, the kit comprises a container and a label or package insert on or associated with the container. The container holds a composition comprising at least one anti-IC AM- 1 antibody of the invention. Additional containers may be included that contain, e.g., diluents and buffers, control antibodies. The label or package insert may provide a description of the composition as well as instructions for the intended in vitro or diagnostic use.

The present invention also encompasses a finished packaged and labeled

pharmaceutical product. This article of manufacture includes the appropriate unit dosage form in an appropriate vessel or container such as a glass vial, pre-filled syringe or other container that is hermetically sealed. In one embodiment, the unit dosage form is provided as a sterile particulate free solution comprising an anti-IC AM- 1 antibody that is suitable for parenteral administration. In another embodiment, the unit dosage form is provided as a sterile lyophilized powder comprising an anti-IC AM- 1 antibody that is suitable for reconstitution.

In one embodiment, the unit dosage form is suitable for intravenous, intramuscular, intranasal, oral, topical or subcutaneous delivery. Thus, the invention encompasses sterile solutions suitable for each delivery route. The invention further encompasses sterile lyophilized powders that are suitable for reconstitution.

As with any pharmaceutical product, the packaging material and container are designed to protect the stability of the product during storage and shipment. Further, the products of the invention include instructions for use or other informational material that advise the physician, technician or patient on how to appropriately prevent or treat the disease or disorder in question, as well as how and how frequently to administer the pharmaceutical. In other words, the article of manufacture includes instruction means indicating or suggesting a dosing regimen including, but not limited to, actual doses, monitoring procedures, and other monitoring information.

Specifically, the invention provides an article of manufacture comprising packaging material, such as a box, bottle, tube, vial, container, pre-filled syringe, sprayer, insufflator, intravenous (i.v.) bag, envelope and the like; and at least one unit dosage form of a pharmaceutical agent contained within said packaging material, wherein said pharmaceutical agent comprises a liquid formulation containing an antibody. The packaging material includes instruction means which indicate how that said antibody can be used to prevent, treat and/or manage one or more symptoms associated with a disease or disorder.

(ix) Methods of Screening

This section of the specification described exemplary methods for detecting the interaction of a live virus with at least one host cell polypeptide. In particular, the invention provides a method for detecting the interaction of a live virus with at least one host cell polypeptide by Homogeneous Time Resolved Fluorescence (HTRF®). Such methods may be used for example to identify molecules which inhibit the interaction of a live virus with at least one host cell polypeptide. The methods provided herein satisfy a number of

requirements, such as specificity of the binding interactions detected; sensitivity of the assay even when the affinity of the live virus for the host cell polypeptide is low; use of live unlabeled virus; reproducibility of the method and enablement of a high throughput screening of candidate inhibitor molecules.

The invention provides a method for detecting the interaction of a live virus with a host cell polypeptide by Homogeneous Time-Resolved Fluorescence technique, the method comprising the steps of:

a) providing a buffer solution containing a first protein comprising a host cell polypeptide which is labeled with a first fluorescent marker and a second protein comprising a host cell polypeptide which is labeled with a second fluorescent marker, wherein the first fluorescent marker is the first partner or the second partner of paired FRET fluorescence markers and the second fluorescent marker is the second partner or the first partner of paired FRET fluorescence markers;

b) adding a live virus to the solution obtained in step a);

c) submitting the mixture obtained at step b) to a source of energy at a wavelength corresponding to the excitation wavelength of the first partner of paired FRET fluorescence markers; and

d) measuring the fluorescence signal at the emission wavelength of the second partner of paired FRET fluorescence markers.

The invention further provides a method for the screening of a candidate molecule which has the ability of inhibiting the interaction of a live virus with a host cell polypeptide by Homogeneous Time-Resolved Fluorescence, the method comprising the steps of: a) providing a buffer solution containing a first protein comprising a host cell polypeptide which is labeled with a first fluorescent marker and a second protein comprising a host cell polypeptide which is labeled with a second fluorescent marker, wherein the first fluorescent marker is the first partner or the second partner of paired FRET fluorescence markers and the second fluorescent marker is the second partner or the first partner of paired FRET fluorescence markers;

b) adding the candidate molecule to the solution obtained in step a); c) adding a live virus to the solution obtained in step b);

d) submitting the mixture obtained at step c) to a source of energy at a wavelength corresponding to the excitation wavelength of the first partner of paired FRET fluorescence markers;

e) measuring the fluorescence signal at the emission wavelength of the second partner of paired FRET fluorescence markers; and

f) comparing the fluorescence signal value obtained at step e) with the fluorescence signal value obtained when step b) is omitted to determine if the candidate compound inhibits the interaction between the first and/or second host cell protein and the live virus.

The invention further provides a method for the screening of a candidate molecule which has the ability of inhibiting the interaction of a live virus with a host cell polypeptide by Homogeneous Time-Resolved Fluorescence, the method comprising the steps of:

a) providing a buffer solution containing a first protein comprising a host cell polypeptide which is labeled with a first fluorescent marker and a second protein comprising a host cell polypeptide which is labeled with a second fluorescent marker, wherein the first fluorescent marker is the first partner or the second partner of paired FRET fluorescence markers and the second fluorescent marker is the second partner or the first partner of paired FRET fluorescence markers;

b) adding a live virus to the solution obtained in step a);

c) adding the candidate molecule to the solution obtained in step b); d) submitting the mixture obtained at step c) to a source of energy at a wavelength corresponding to the excitation wavelength of the first partner of paired FRET fluorescence markers; e) measuring the fluorescence signal at the emission wavelength of the second partner of paired FRET fluorescence markers; and

f) comparing the fluorescence signal value obtained at step e) with the fluorescence signal value obtained when step c) is omitted to determine if the candidate compound inhibits the interaction between the first and/or second host cell protein and the live virus.

According to the methods of the invention, each of the first and a second protein comprising host cell polypeptides is labeled with a fluorescent marker consisting of a donor molecule (i.e. the first partner of a paired FRET fluorescence markers) or an acceptor molecule (i.e., the second partner of paired FRET fluorescence markers). Thus, when the first fluorescent marker labeling the first protein is the donor molecule (i.e., the first partner of paired FRET fluorescence markers), the second fluorescent marker labeling the second protein is the acceptor molecule (i.e., the second partner of the paired FRET fluorescence markers). Conversely, when the first fluorescent marker labeling the first protein is the acceptor molecule (i.e., the second partner of paired FRET fluorescence markers), the second fluorescent marker labeling the second protein is the donor molecule (i.e., the first partner of the paired FRET fluorescence markers).

In one embodiment, the first fluorescent marker is the first partner and the second fluorescent marker is the second partner of paired FRET fluorescent markers. In another embodiment, the first fluorescent marker is the second partner and the second fluorescent marker is the first partner of paired FRET fluorescent markers. Every paired FRET fluorescence markers known in the art may be used for performing the screening method of the invention. The choice of appropriate excitation wavelength of the first partner and wavelength to be measured for emission of the second partner is considered to be within the level of skill in the art. In a specific embodiment, the first partner of paired FRET fluorescent markers is cyan fluorescent protein and the second partner of paired FRET fluorescent markers is yellow fluorescent protein. In a specific embodiment, the first partner of paired FRET fluorescent markers is Europium cryptate and the second partner of paired FRET fluorescent markers is XL665. In the specific embodiment wherein the paired FRET fluorescent markers are respectively Europium cryptate and XL665, the source of energy is at a wavelength of between 320-337 nm, which is the excitation wavelength of Europium cryptate and the fluorescence signal is measured at 665nm, which is the emission wavelength of XL665. In certain embodiments, the fluorescence signal of the europium cryptate donor is also measured at 620 nm. It is specifically contemplated that the first and second proteins may be directly or indirectly labeled. In one embodiment, both the first and the second protein are directly labeled. In another embodiment, both the first and the second protein are indirectly labeled. In still another embodiment, the first protein is directly labeled and the second protein is indirectly labeled. In yet another embodiment, the first protein is indirectly labeled and the second protein is directly labeled. It is specifically contemplated that a protein may be directly labeled, wherein the fluorescent marker is covalently bound directly to the protein. It is further contemplated that a protein may be directly labeled wherein the protein further comprises the amino acid sequence of a fluorescent protein, for example as a fusion protein. It is further contemplated that a protein may be indirectly labeled, wherein the protein further comprises a detectable molecule (e.g. a peptide tag such as a FLAG tag) that is recognized by a labeling reagent having specific affinity for the detectable molecule, wherein the labeling reagent (e.g., an antibody that binds the peptide tag such as an anti-FLAG antibody) comprises the fluorescent marker.

In certain embodiments, the first and the second proteins comprise host cell polypeptides having different amino acid sequences. In one embodiment, the different amino acid sequences are amino acid sequences of different host cell proteins. In another embodiment, the different amino acid sequences are sequences of the same host cell protein. It is specifically contemplated that the different amino acid sequences of the same host cell protein may be over lapping or non-overlapping amino acid sequences. In other

embodiments, the first and second proteins comprise the same host cell polypeptide. In certain embodiments, the first and/or second protein consists essentially of a host cell polypeptide which may be the same or different host cell polypeptide as described herein. Any host cell polypeptide which interacts with a live virus may be utilized in the instant methods. For example, but not by way of limitation, polypeptides of an extracellular host cell protein that is a receptor for a live virus may be utilized in the instant methods. In a specific embodiment, the of the host cell polypeptides are ICAM-1 polypeptides, in particular human ICAM-1.

In certain embodiments, the live virus is an attenuated virus. In certain embodiments, the live virus is a wild type virus. It is contemplated that the live virus may be in a crude preparation or may be purified away from one or more contaminates. In one embodiment, the live virus is a human rhinovirus (HRV). In a specific embodiment, the live virus is HRV- 16. In another embodiment, the live virus is a cocksackie virus. In a specific embodiment, the live virus is CV-A21 or CV-A16. Any candidate molecule may be screened for the ability to inhibit the interaction of a live virus with a host cell polypeptide by the methods of the invention. In certain

embodiments, the candidate molecule is a small molecule, in particular compounds having molecular mass of less than 3000 Daltons, preferably less than 2000 or 1500, more preferably less than 1000, and still more preferably less than 600 Daltons. In certain embodiments, the candidate molecule is a polypeptide. In a specific embodiment, the candidate molecule is polypeptide that binds the host cell polypeptide of the first and/or second protein. In another specific embodiment, the candidate molecule is a polypeptide that binds the live virus. In certain embodiments, the candidate molecule is an antibody or antigen binding fragment thereof. In a specific embodiment, the candidate molecule is an antibody or antigen binding fragment thereof that specifically binds the host cell polypeptide of the first and/or second protein. In another specific embodiment, the candidate molecule is an antibody or antigen binding fragment thereof that specifically binds the live virus.

In certain embodiments, the methods of invention incorporate incubation steps before and/or after any of the steps disclosed herein. It will be understood by one of skill in the art that the duration of the incubation will be of sufficient duration for the binding/inhibition of binding while short enough to minimize degradation/inactivation of the reagents. It will also be understood by one of skill in the art that an incubation step is performed at a temperature which allows for the binding/inhibition of binding while minimizing degradation/inactivation of the reagents. In some embodiments the mixture is incubated after the addition of the live virus but prior to submitting the mixture to a source of energy. In other embodiments the mixture is incubated after step a) but prior to the addition of the live virus. In certain embodiments, the mixture is incubated after step a) but prior to the addition of the live virus, and the mixture is incubated again after the addition of the live virus but prior to submitting the mixture to a source of energy. In certain embodiments, the incubation is performed at a temperature of between 4°C to 40°C. In a specific embodiment, the incubations are performed at room temperature (i.e., 25°C ±5°C). In certain embodiments, the incubation is performed for at least 5 minutes but for no longer than 24 hours. In one embodiment, the incubation is performed for between 2 to 6 hours. In a specific embodiment, the incubation is performed for 4 hours. Methods of the invention comprising one or more of the above embodiments are specifically contemplated. The choice of particular embodiments disclosed herein for detection of live virus/host cell polypeptide interactions and/or the screening of candidate inhibitor molecules is considered to be within the level of skill in the art. Specific embodiments are further provided and exemplified in Assay 1 provided in Example 11, infra. 8. EXAMPLES

The examples below are given so as to illustrate the practice of this invention. They are not intended to limit or define the entire scope of this invention.

EXAMPLE 1 - Isolation and identification of anti-ICAM- 1 scFv antibodies

ScFv antibody repertoire

A large single chain Fv (scFv) human antibody library derived from bone marrow from adult naive donors and cloned into a phagemid vector based on filamentous phage Ml 3 was used for selections (1).

Selection of scFv's:

ICAM-1 -specific scFv antibodies were isolated from the phage display library in a series of repeated selection cycles on recombinant mammalian expressed human ICAM-1 (R&D Systems) essentially as previously described (2). While several antigen-specific scFv's were obtained from different variations of this protocol, the parental clones ICM10064 and ICM10088 were isolated as follows: 10 μ^Ώίύ human ICAM-1 was immobilised on MAXISORP™ plates (Nunc) and incubated with the phage display library. Unbound phage was washed away in a series of wash cycles. The phage particles retained on the antigen were eluted, infected into bacteria and rescued for the next round of selection. Two rounds of selection were performed in this way. A representative number of individual clones from the round 2 selection output were grown up in 96-well plates. ScFv's were expressed in the bacterial periplasm and screened for their inhibitory activity in both a human ICAM-1 :HRV binding assay, and a human ICAM-1 :LFA-1 binding assay (see Assays 1 and 2, respectively below).

Screening hits, i.e. scFv clones which showed an inhibitory effect on ICAM-1 :HRV- 16 interaction, but not ICAM-1 :LFA-1 interaction, as crude periplasmic extracts, were subjected to DNA sequencing (2, 3). Unique scFv's were expressed again in bacteria and purified by affinity chromatography (as described in Example 3 of WOO 1/66754), and IC50 values were determined by testing dilution series of purified scFv' s in the above assays. To this end, raw data was first converted to % HRV- 16-binding values as outlined previously before using Prism curve fitting software (GRAPHPAD™) to determine IC50 values. The most potent scFv clones were converted to whole immunoglobulin G2 (IgG2) antibody format essentially as described by Persic et al (4) with the following modifications. An OriP fragment was included in the expression vectors to facilitate use with EBNA- HEK293 cells and to allow episomal replication. The VH domain was cloned into a vector (pEU9.2) containing the human heavy chain constant domains and regulatory elements to express whole IgG2 heavy chain in mammalian cells. Similarly, the VL domain was cloned into a vector (pEU4.4) for the expression of the human light chain (lambda) constant domains and regulatory elements to express whole IgG light chain in mammalian cells. To obtain IgGs, the heavy and light chain IgG expressing vectors were transfected into EBNA-HEK293 mammalian cells. IgGs were expressed and secreted into the medium. Harvests were pooled and filtered prior to purification, then IgG was purified using Protein A chromatography. Culture supernatants were loaded on a column of appropriate size of Ceramic Protein A (BioSepra) and washed with 50 mM Tris-HCl pH 8.0, 250 mM NaCl. Bound IgG was eluted from the column using 0.1 M Sodium Citrate (pH 3.0) and neutralised by the addition of Tris- HC1 (pH 9.0). The eluted material was buffer exchanged into PBS using NaplO columns (Amersham, #17-0854-02) and the concentration of IgG was determined

spectrophotometrically using an extinction coefficient based on the amino acid sequence of the IgG (5). The purified IgG were analysed for aggregation and degradation using SEC- HPLC and by SDS-PAGE.

Several lead candidates were evaluated as IgGs in the HRV:ICAM-1 and LFA-

1 :ICAM-1 binding assays described above. As shown in Figures 1A and IB, Clones ICM 10098 and 103, as well as the commercial mouse anti human ICAM-1 antibody designated 15.2, show at least partial inhibition of HRV: ICAM-1 binding and full inhibition of LFA- 1 :ICAM- 1 binding. In contrast clones ICM10064 and 88 completely inhibit HRV binding and have minimal inhibitory activity on LFA- 1 :IC AM- 1 binding.

References referred to in Example 1.

(1) Hutchings, C, Generation of Naive Human Antibody Libraries, in Antibody Engineering, R. Kontermann and S. Dubel, Editors. 2001, Springer Laboratory Manuals, Berlin, p. 93

(2) Vaughan, T.J., et al. Nat Biotechnol, 1996. 14: p. 309

(3) Osbourn, J.K., et al. Immunotechnology, 1996. 2: p. 181

(4) Persic, L., et al. Gene, 1997. 187: p. 9

(5) Mach, H., et al. Anal Biochem, 1992. 200: p. 74 EXAMPLE 2 - Inhibitory activity of anti-ICAM- 1 antibodies in the HeLa-QHIQ CPE assay, and demonstration of specific HRV-blocking activity over LFA- 1

Purified IgGs were tested for their ability to specifically inhibit major group human rhinovirus (HRV) infection in a HeLa-OHIO cytopathic effect (CPE) assay. This procedure was based on assays reported by Charles et al (1), inhibition was achieved when an intact monolayer remained which was quantified (refer to Assay 3 below). In this assay a number of isolated clones including ICM10064, ICM10088, ICM10098, ICM10103, and several commercially available mouse anti-ICAM- 1 antibodies (14C11, R&D Systems and 8.4A6, Abeam) were tested for their ability to block HRV- 16 and/or HRV- 14 infection. In addition, an antibody designated hlA2 IgG2, comprising a variable region based on the humanized anti-ICAM- 1 1A2 scFv HscB described in Luo et al. (3) and patent WO2003035696, was also tested. Representative plots are shown in Figures 2A and 2B for HRV-16 and HRV-14 infection, respectively (data for 8.4A6 not shown in figure). The results from these studies are summarised in Table 2.

These studies show that both ICM10064 and ICM10088 inhibited HRV-16 infection in the CPE cell based assay. All raw data values were converted to percent inhibition and Prism curve fitting software (GRAPHPAD™) was used to determine IC50 values. ICM 10064 had an IC50 value of 1.32 nM (n=6), ICM10088 did not always form a complete curve but the percent inhibition was 79.5 % (n=6). The same assay was used to test the efficacy of ICM10064 and ICM10088 against HRV 14 inhibition. IC50 values of 0.65 nM (n=5) and 2.3 nM (n=4) were achieved respectively. This data suggests ICM10064 and ICM10088 inhibit, at least, two different human rhinovirus serotypes in a cell based assay.

ICAM-1 has a lymphocyte function associated antigen 1 (LFA-1) binding site involved in T-cell trafficking and migration. Several ICAM-1 antibodies including

ICM10064, ICM10088, ICM10098, ICM10103, several commercially available mouse anti- ICAM- 1 antibodies (14C11, 15.2, 8.4A6, and RRl/1) and hlA2 IgG2 were assessed for their ability to block functioning of the LFA-1 binding site using a Jurkat adhesion assay adapted from Cherry et al (2). Briefly, 96 well plates were coated with ICAM-1 -Fc to capture human Jurkat cells. If the antibodies bound to the LFA-1 binding site then cells would not adhere to the ICAM-1 -Fc and hence be washed away during the assay (see Assay 4 below for further detail). Representative plots are shown in Figure 3. In Table 2 the data is summarised. Although inhibition was not always detected, the maximum inhibition observed at 300 nM for ICM10064 was between 0-11 % and for ICM10088 was between 0-24 %. This data suggests there is minimal interference of the LFA-1 binding site with these IgGs. In contrast, ICM10098, ICM10103, hlA2 and all the commercial antibodies except 14C11 showed significant inhibition (data for 8.4A6, and RRl/1 not shown).

These results demonstrate the specific HRV blocking activity of ICM 10064 and ICM10088 over LFA-l.

References referred to in Example 2:

(1) Charles, C.H., Luo, G.X., Kohlstaedt, L.A., Moranette, I.G., Gorfain, E., Cao, L., Williams, J.H. and Fang, F. Antimicrobial agents and chemotherapy, 2003. 47: p. 15031

(2) Cherry, L., Weber, K.S.C., Klickstein, L.B.. Journal Immunology, 2001. 167: p6171

(3) Luo, G.X., Kohlstaedt, L.A., Charles, C.H., Gorfain E., Morantte, I., Williams, J.H. and Fang, F. J. Immunol. Methods, 2003. 275: p. 31

EXAMPLE 3 - Specificity of anti-IC AM- 1 antibodies to human ICAM-1 domain 1 and human ICAM-1 'Kilifi' mutant over a panel of human ICAM-1 related molecules and cynomolgus and mouse variants, as measured by IgG ELISA

The specificity of the anti-human ICAM-1 antibody molecules to various ICAM-1 species variants and other human ICAM-1 related molecules was assessed biochemically by an IgG binding ELISA (see Assay 5 below). This panel included the ICAM-1 Kilifi mutant (K56M) - a naturally occurring ICAM-1 domain 1 polymorphism present in certain African populations (1). Additionally, a chimaeric human ICAM-1 domain 1 / mouse ICAM-1 domains 2-5 molecule was included in the panel to determine domain specificity of the selected anti-IC AM- 1 antibodies.

As shown in Figure 4A, ICM10064 and ICM10088 bind only to human ICAM-1 (R&D Systems), human ICAM-1 Kilifi and the human domain 1 ICAM-1 chimaeric molecule (both Medlmmune / AstraZeneca generated). There is no binding detected to mouse or cynomolgus monkey ICAM-1 variants (R&D Systems and Medlmmune respectively), or human ICAM-1 related molecules ICAM-2, ICAM-3, ICAM-5 or VCAM-1 (all R&D Systems).

The results demonstrate the specificity of our selected antibodies for human IC AM- 1 domain 1 , which has been shown to be involved in human rhinovirus (HRV) attachment to this molecule. The lack of antibody cross-reactivity to either mouse or cynomolgus monkey ICAM-1 variants is not surprising given the low homology across key HRV-binding loops in domain 1 between these species (63% and 45% homology to human loop BC for cynomolgus monkey and mouse respectively), and the specificity both ICM10064 and ICM10088 have for inhibiting HRV attachment. Additionally, HRV is unable to bind either mouse or cynomolgus monkey ICAM-1 molecules.

We selected both ICM10064 and ICM10088 as our lead antibodies because of their ability to specifically inhibit HRV attachment to human ICAM-1 domain 1, while not inhibiting the ability of IC AM- 1 to recruit neutrophils via its interaction with LFA- 1

(Example 2). The schematic shown in Figure 5 summarizes the various characteristics of several of the antibodies analyzed in the above assays and indicates the likely location of the epitopes based on the binding and functional characteristics observed.

Potency and affinity optimisation of these lead candidates is described in subsequent examples. The complete sequence of the variable regions of ICM10064 and ICM10088 is shown in Figures 6A-B and 7A-B, respectively. The SEQ ID NOs of the variable region sequences, framework region sequences and CDR sequences of these antibodies are shown in Table 8.

References for Example 3:

(1) Fernandez-Reyes, D., et al. Hum. Mol. Genet. 2000. 6: p. 1357

EXAMPLE 4 - Germlining and stability engineering anti-ICAM-1 antibodies as IgGl TM

ICM 10064 was initially converted to IgG2 format (Example 1) as effector function is not required. However, an alternate effector-null isotype, IgGl TM (IgGl Fc sequence incorporating mutations L234F, L235E and P331S) was chosen as the final format for the affinity optimised variants from this lineage. Therefore, ICM 10064 VH nucleotide sequence was sub-cloned from the IgG2 pEU9.2 vector into IgGl TM pEU1.4 vector, essentially as described previously (Example 1). Germlining of the parental sequence was performed on the VH and VL sequences separately. The amino acid sequence of ICM 10064 VH and VL were aligned to the known human germline sequences in the VBASE database (1) and the closest germline was identified by sequence similarity. For the VH domain this was VH4-b (DP-67), for the VL domain it was Vlambdal-c (DPL-2). There were 2 changes in the framework of the VH domain and 5 in the VL domain, all of which were reverted to the closest germline sequence by standard molecular biology. Only the Vernier residues (2) were left unchanged. Additionally, a light chain Al IV mutatagenesis (Kabat numbering) was performed to remove an O-glycosylation consensus sequence at this position. The resultant ICM 10064 variant was named ICM10064fgl and was tested for potency in the HeLa-OHIO CPE assay and affinity by BIACORE™ as described in later examples. An alignment of the heavy and light chain amino acid sequences for ICM10064 and ICM10064fgl is provided in Figures 9A-B . This work was done in parallel to the optimisation work on this lineage described in Examples 5 and 6 below, such that, at the end of the optimisation phase, sequence changes incorporated into ICM10064 had been demonstrated not to adversely impact potency or affinity of the parent antibody. Similarly, germlining of ICM10088 in an IgGl TM format was also performed. The closest germline was identified as VH1-18 (DP- 14) and Vlambdal-c (DPL-2) for VH and VL sequences respectively. There were 5 changes in both VH and VL sequences reverted to the closest germline sequence by standard molecular biology techniques, again leaving the Vernier residues (2) unchanged.

Additionally, a heavy chain N54S mutation and light chain Al IV mutation (Kabat numbering) were incorporated to remove a potential deamidation site and (9-glycosylation consensus sequence at these positions respectively. The resultant ICM 10088 variant is called ICM10088fgl. An alignment of the heavy and light chain amino acid sequences for ICM10088 and ICM10088fgl is provided in Figures 7A-B.

References for Example 4:

(1) Tomlinson, I., VBASE. 1997, MRC Centre of Protein Engineering, Cambridge, UK. (2) Foote, J., et al. J Mol Biol, 1992. 224: p. 487.

EXAMPLE 5 - Isolation and identification of potency optimised anti-ICAM- 1 scFv antibodies by targeted CDR3 randomisation

ICM 10064 and ICM10088 were optimised using affinity-based phage selections.

Large scFv libraries derived from the lead scFv sequences were created by oligonucleotide-directed mutagenesis of the variable heavy (VH) and variable light (VL) chain complementarity determining regions 3 (CDR3) using standard molecular biology techniques as described (1). The libraries were subjected to affinity-based phage display selections in order to select variants with a higher affinity to human ICAM-1 Fc. In consequence, these were expected to show an improved inhibitory activity for HRV binding to ICAM-1. The selections were performed essentially as described previously (2). In brief, the scFv-phage particles were incubated with recombinant biotinylated human IC AM- 1 Fc in solution (R&D Systems, biotinylated via free amines using EZ LINK™ Sulfo-NHS-LC- Biotin (Thermo/Pierce, product: 21335)). ScFv bound to antigen were then captured on streptavidin-coated paramagnetic beads (DYNABEADS® M-280) following manufacturer's recommendations. The selected scFv-phage particles were then rescued as described previously (3), and the selection process was repeated in the presence of decreasing concentrations of biotinylated human ICAM-1 (a typical example would be 50 nM to 20 pM over five rounds).

Crude scFv-containing periplasmic extracts were prepared of a representative number of individual scFv's from the variable heavy (VH) and variable light (VL) CDR3-targetted selection outputs and screened in an epitope competition HTRF® (Homogeneous Time- Resolved Fluorescence) assay format against their respective parent antibody (see Assay 6 below). Screen hits, i.e. scFv variants which showed a significantly improved inhibitory effect when compared to their respective parent scFv, were subjected to DNA sequencing, and unique variants from variable heavy and variable light library outputs were produced as purified scFv for further characterisation. Some scFv's were then selected and converted to IgGl TM and tested again in an effort to realise additional potency gain. No variable heavy (VH) CDR3 -randomised ICM10064 scFv's were selected by this strategy, however improved ICM10088 variants randomised in both variable heavy (VL) and variable light (VL) CDR3 sequences were obtained.

For the ICM 10088 lineage only, the separate VH and VL CDR3 -randomised selection outputs comprising of large numbers of scFv variants with the ability to inhibit in the binding of parental IgG to human ICAM- 1 were recombined to form a single library in phage display format in which clones contained randomly paired individually randomised VH and VL CDR3 sequences. Phage selections were then continued as described previously in the presence of decreasing concentrations of biotinylated human ICAM-1 Fc (100 pM to 1 pM over a further four rounds).

Crude scFv-containing periplasmic extracts were prepared of a representative number of individual scFv's from the recombined variable heavy (VH) and variable light (VL) selection outputs and screened in the epitope competition HTRF® assay against ICM10088 antibody. Screen hits, i.e. scFv variants which showed a significantly improved inhibitory effect when compared to parent scFv and leads generated pre-recombination, were subjected to DNA sequencing, and unique recombined variants were produced as purified scFv for further characterisation. The most active scFv's were then selected and converted to IgGl TM and tested again in an effort to realise additional potency gain.

Alignments of the amino acid sequences of the CDR3 randomized light chains for the selected antibodies from the ICM 10064 and ICM 10088 lineages (constituting antibody Panels 1A and IB, respectively) are shown in Figures 6 and 7B. Alignments of the amino acid sequence of the CDR randomized heavy chains for the selected antibodies from the ICM10088 lineage are shown in Figure 7A, the heavy chains for the selected antibodies from the ICM10064 lineage were identical to the parent heavy chain (see Figure 8A).

References for Example 5:

(1) Clackson, T. and Lowman, H.B. Phage Display - A Practical Approach, 2004. Oxford University Press

(2) Thompson, J. et al. J Mol Biol. 256(l):77-88, 1996

(3) Osbourn, J.K. et al. Immunotechnology, 2(3): 181-96, 1996

EXAMPLE 6 - Isolation and identification of potency optimised anti-ICAM- 1 scFv variants from an error-prone PCR library on ICM 10064

In addition to the targeted CDR3 randomisation of ICM 10064 described in Example 5, this antibody was optimised using ribosome display technology essentially as described by EP494955, US 5658754 and Hanes et al (2).

A first generation ribosome display library derived from the parent scFv construct was created by random mutagenesis using the DIVERSIFY™ PCR (polymerase chain reaction) Random Mutagenesis Kit (BD Biosciences) following the manufacturer's recommendations. The conditions for this error-prone PCR (EP) were chosen to introduce on average 8.1 nucleotide changes per 1000 basepairs (according to the manufacturer). A representative proportion of the produced variant population was used as a template for a second round of error-prone PCR, using the same conditions, for further diversification. The resulting population of randomly mutated ICM 10064 scFv's was then converted to ribosome display format and used in affinity-based ribosome display selections (2). On the DNA level, a T7 promoter was added at the 5'-end for efficient transcription to mRNA. On the mRNA level, the construct contained a prokaryotic ribo some-binding site (Shine-Dalgarno sequence). At the 3 '-end of the single chain, the stop codon was removed and a portion of M13

bacteriophage gill (gene III) was added to act as a spacer between the nascent scFv polypeptide and the ribosome (2).

The scFv's were expressed in vitro using the RIBOMAX™ Large Scale RNA

Production System (T7) (Promega) following the manufacturer's protocol and an E.coli- based prokaryotic cell-free translation system. The produced scFv antibody-ribosome- mRNA (ARM) complexes were incubated in solution with biotinylated human IC AM- 1 Fc (R&D Systems, biotinylated via free amines using EZ LINK™ Sulfo-NHS-LC-Biotin (Thermo/Pierce, product: 21335)). The specifically bound tertiary complexes (ICAM- 1:ARM) were captured on streptavidin-coated paramagnetic beads (DYNABEADS® M-280) following the manufacturer's recommendations (Dynal) whilst unbound ARMs were washed away. The mRNA encoding the bound scFv's were then recovered by reverse transcription- PCR (RT-PCR). The selection process was repeated on the obtained population for further rounds of selections with decreasing concentrations of biotinylated human ICAM- 1 (5 nM to 50 pM over 4 rounds), in order to enrich and thereby select clones with higher affinity for ICAM- 1. In consequence, these would show an improved inhibitory activity on IC AM- 1:HRV-16 binding and thus viral-blocking function. The outputs from selection rounds 3 and 4 were sub-cloned into pCantab6 (1) for bacterial expression as scFv's, and improved clones were identified as penplasmic extracts in an ICM 10064 epitope competition assay (described in Example 5).

Lead sequences from the optimisation strategy described above were converted to IgGl TM format. Additionally, a VL chain N95aS (Kabat numbering) mutation was incorporated into lead antibody Icmo0070 IgGl TM by standard molecular biology techniques to remove a potential deamidation site at this position within the VL CDR3 sequence. The resultant Icmo0070 IgGl TM variant was named Icmo0070SGR IgGl TM. IgGl TM format leads from this initial strategy were tested for potency in the HeLa-OHIO CPE assay and affinity by BIACORE™ as described in later examples (see also Tables 1 and 2).

A second-generation ribosome display library was constructed by pooling the top 5 scFv variants (designated clones Icmo0069, 70, 72, 75 and 79) from the initial strategy and introducing further sequence diversity by error-prone PCR. The second generation ribosome display library was selected essentially as described above. Biotinylated human ICAM-1 Fc concentration was decreased from 50 pM to 1 pM over three rounds. Selection outputs from Rounds 2 and 3 were sub-cloned into pCantab6, and scFv-containing periplasmic extracts were screened in the ICM10064 epitope competition as described in Example 5.

ScFv variants giving the greatest competition of ICM10064:ICAM-1 binding were again sequenced, and purified scFv's were prepared as in Example 1 for further

characterisation. The most potent scFv's from this second generation ribosome display library were converted to IgGl TM format and were tested for potency in the HeLa-OHIO CPE and Jurkat adhesion assays and affinity by BIACORE™ as described in later examples (see also Tables 1 and 2).

The antibodies isolated and subsequently engineered from the error-prone PCR libraries from ICM10064 constitute Panel 2 of optimised antibodies. Alignments of the amino acid sequences for the heavy and light chains of Panel 2 are shown in Figure 8 A-B . A panel of germlined antibody sequences from the second generation ribosome display library were created. The experiments described in Example 4 generated germlined parental (ICM10064fgl) VH and VL sequences. Differences were identified between ICM10064fgl and Icmo0183, 191 and 194 antibody CDR and Vernier sequences. These were added to the ICM10064fgl VH and VL back-bone using standard molecular biology techniques. Additionally, a VL chain N95aS (Kabat numbering) mutation was incorporated into each antibody sequence as described above for Icmo0070. The resultant engineered IgGl TM antibodies were named Icmo0183fgl, 191fgl and 194fgl. Alignments of the amino acid sequences for the heavy and light chains of the germlined/N95aS antibodies of the ICM0064 lineage are shown in Figure 9A-B.

References for Example 6:

(1) Hutchings, C, Generation of Naive Human Antibody Libraries, in Antibody Engineering, R. Kontermann and S. Dubel, Editors. 2001, Springer Laboratory Manuals, Berlin, p. 93

(2) Hanes, J., et al. Methods in Enzymology, 2000. 328: p. 404

EXAMPLE 7 - Inhibitory activity of optimised anti-IC AM- 1 antibodies in the HeLa-OHIO CPE assay, and demonstration of specific HRV-blocking activity over LFA-1

Purified IgGs from panels IB and 2 obtained from the optimisation of the parent anti- ICAM-1 antibodies were tested for their ability to specifically inhibit major group HRV infection in a HeLa-OHIO CPE assay. The protocol was unchanged to that described in

Example 2 (also see Assay 3 below). IgGs Icmo059, 60, 61, 66 and 68, from panel IB and Icmo069, 70, 72, 75, 79, 181, 183, 188, 189, 191, 70_SGR, 183fgl, 191fgl and 194 fgl from panel 2, were tested in the CPE assay.

All IgGs were tested for their ability to block HRV- 16 or HRV- 14 and in some cases both serotypes. All optimised IgGs tested were able to inhibit a major group rhinovirus with IC50 values ranging from 0.09-0.59 nM, as summarised in Table 2. Additionally, representative IgGs from Panel 2 were further tested for their ability to block major group rhinovirus serotypes HRV-14, HRV-16, HRV-41 and HRV-70, along with minor group rhinovirus serotypes HRV- lb and HRV-2 using a variation of the CPE assay that uses CELLTITER- GLO™ (Promega) as the final read-out for cell viability (all other CPE assay data described in these Examples uses Crystal Violet to quantify viable cells - see assay materials and methods). All IgGs tested were able to fully inhibit major rhinovirus serotypes, and were unable to inhibit minor rhinovirus serotypes as would be predicted for an anti- ICAM-1 antibody. Minor serotypes use the LDL receptor for viral entry. Representative IgGs from Panels IB and 2 were also tested for LFA-1 inhibition in the Jurkat adhesion assay. The protocol for this is unchanged to that described in Example 2. The data quotes the percentage inhibition achieved at 300 nM of antibody. Other than hlA2 IgG2 which had an IC50 value of 0.56 nM no other IgG tested was able to fully inhibit LFA-1 at the top concentration tested (900 nM).

EXAMPLE 8 - Inhibitory activity of optimised anti-IC AM- 1 antibodies on HRV infectivity in primary lung COPD epithelial cells

Purified IgGs from panel 2 were tested for their ability to specifically inhibit HRV- 14 infection of human primary lung epithelial cells. This assay quantifies viral RNA levels 24 hours post infection as a measure of viral infection (as detailed in Assay 7 below). Results are expressed as a relative quantification of viral RNA in the presence of IgG compared to RNA levels in control samples. Data is summarised in Table 2. All antibodies tested were able to fully inhibit viral infection, with IC50 values in the range of 70-150 pM.

EXAMPLE 9 - Specificity of optimised anti- ICAM-1 antibodies to human ICAM-1 domain 1 and human ICAM-1 'Kilifi' mutant over a panel of human ICAM-1 related molecules and cynomolgus and mouse variants, as measured by IgG ELISA

The specificity of the optimised anti-human ICAM-1 antibody molecules to various ICAM-1 species variants and other human ICAM-1 related molecules was assessed biochemically by an IgG binding ELISA (see Assay 5 below). As in Example 3, this panel included the ICAM-1 Kilifi mutant (1) and a chimaeric human ICAM-1 domain 1 / mouse ICAM-1 domains 2-5 molecule for epitope mapping.

As shown in Figure 4B, Icmo0191fgl from Panel 2 for example binds only to human ICAM-1 (R&D Systems), human ICAM-1 Kilifi and the human domain 1 ICAM-1 chimaeric molecule (both Medlmmune / AstraZeneca generated). There is no binding detected to mouse or cynomolgus monkey ICAM-1 variants (R&D Systems and Medlmmune respectively), or human ICAM-1 related molecules ICAM-3, ICAM-5 or VCAM-1 (all R&D Systems). One antibody, Icmo0183, showed minimal binding to ICAM-2 (R&D Systems) at the highest concentration tested. All the others tested showed no binding to ICAM-2.

In general, the results confirm the same specificity of all our optimised leads tested for human ICAM-1 domain 1, under the chosen assay conditions.

References for Example 9:

(1) Fernandez-Reyes, D., et al. Hum. Mol. Genet. 1997. 6: p. 1357 EXAMPLE 10 - Affinity of Lead and Panel 1 and 2 anti-IC AM- 1 antibodies for human

ICAM-1 as determined by BIACORE™ and HeLa-OHIO binding assays

The affinity of optimised anti-IC AM- 1 antibodies to human IC AM- 1 was confirmed by affinity determination. Surface plasmon resonance measurements using a BIACORE™ 2000 Biosensor (BIAcore AB) were performed essentially as described by Karlsson et al (1). In brief, Protein G was coupled to a CM5 sensorchip using an amine coupling kit (BIAcore) at a surface density of approximately 500 RU and used to capture sample antibodies (added at 0.5ug/ml). A serial dilution (between 300 nM and 4.69 nM) of human monomeric ICAM-1 (R&D Systems) in Hepes Buffered Saline/lmg bovine serum albumin was then passed over the captured antibodies on the sensorchip surface. The resulting sensorgrams were evaluated using BIA evaluation 3.1 software to provide kinetic data. Monomeric human ICAM- 1 was chosen, rather than the Fc-tagged material used in selections, so that a 1: 1 binding interaction could be modeled.

The dissociation constants (ΚΌ) for the parent leads ICM 10064 and ICM0088 IgGl-

TM under the chosen conditions were 205 nM and 627 nM respectively on human monomeric IC AM- 1. The dissociation constants for the affinity optimised variants of each ICM10064 and ICM10088 under the same conditions were between 1.7 and 9.9 nM, and between 19.6 and 261 nM respectively.

There is an approximately 10-fold difference between the BIACORE™ affinities of the antibodies on recombinant monomeric IC AM- 1 , compared to the EC50 values obtained in the HeLa-OHIO CPE assay (see Table 2, Example 7 for CPE assay data). For this reason, we obtained additional affinity measurements of the antibodies on HeLa-OHIO cells using a DELFIA-based detection of IgGs (Perkin Elmer) as described in 'Assay 8' below. In this assay, the KD (dissociation constant) was inferred from the concentration of IgG which gave 50% of maximum binding when assessed using Prism curve-fitting software

(GRAPHPAD™). By this analysis, the affinities of our optimised antibodies are all 100-400 pM, and more closely reflect the HeLa-OHIO CPE assay potency data. It is thought that ICAM-1 dimerizes on the cell surface (2), so the apparent increase in the affinity of anti- ICAM-1 antibodies to cells, compared to monomeric recombinant antigen, could be due to increased avidity of ICAM-1 in this presentation.

The BIACORE™ and cell-binding affinity data both demonstrate improvement in affinity through the optimisation process, as was predicted by the potency gains previously described (Example 7). Additionally, the tolerance of lead sequences to sequence engineering is confirmed. Full affinity data is shown in Table 1.

Table 1 - Affinities of antibody panel to recombinant monomeric ICAM-1 (n-1 to 3)

hlA2 IgG2 1.26e5 2.76e-4 2.2 0.17

14C11 ND ND ND 0.40

RRl/1 ND ND ND 0.69

References:

(1) Karlsson, R., et al. J Immunol Methods, 1991. 145: p. 229.

(2) Yang, Y., et al. Mol Cell, 2004. 14: p. 269

Table 2 - Activity of IgGs in the CPE and Jurkat adhesion assays

Icmo0070_SGR 0.20 (n=3) 0.16 (n=3) ND 4-24 (n=3)

Icmo0183fgl 0.17 (n=3) 0.18 nM (n=3) ND 19-52 (n=3)

Icmo0191fgl 0.18 (n=3) 0.19 (n=3) ND 24-46 (n=3)

Icmo0194fgl 0.18 (n=3) 0.19 (n=3) ND 16-63 (n=3) hlA2 IgG2 0.23 (n=9) 0.14 (n=4) 0.10 (n=2) 0.56 nM (n=4)

14C11 0.44 (n=16) 0.39 (n=8) 0.16 (n=2) 0-17 % (n=7)

RRl/1 0.93 (n=7) 1.20 (n=3) ND ND

EXAMPLE 11 Assays and Methods

PROTEIN MODIFICATIONS

This section details the methods used to label the various IgGs and other proteins used in the assays described below.

IgGs and proteins were biotinylated via free amines using EZ LINK™ Sulfo-NHS- LC-Biotin (Thermo/Pierce, product: 21335). The reagent was dissolved in anhydrous dimethylformamide and the PBS based protein solutions were adjusted to pH ~8 with 1 M NaHC03 in D-PBS.

Cryptate labeling for HTRF® assays was achieved using Trisbipyridine-Eu3+- Cryptate-NHS (CIS bio International, product: 65EUSABA, lot: 09). The reagent was dissolved in anhydrous dimethylformamide and the PBS based protein solutions were adjusted to pH ~8 with 1 M NaHC03 in D-PBS.

Label incorporations were assessed by MALDI-TOF mass spectrometry in all cases and unreacted reagents were cleared by buffer exchange using D-PBS equilibrated disposable Sephadex G25 columns. For biotinylations the final protein concentrations were determined by 280 nm absorbance using extinction coefficients calculated from amino acid sequences. For Cryptate labeling final protein concentration was estimated using the Bradford (Bradford, 1977) dye-binding protein assay using known concentrations of the unlabelled protein as standard.

ASSAY 1 - HRV:ICAM-1 Binding Assay

In order to screen for molecules which could inhibit the infectivity of HRV a suitable assay was needed. Although assays which rely on infection of cells with virus are known such assays were unlikely to provide the necessary tolerance or high throughput required for screening of crude, bacterial derived samples. Similarly, assays dependent on measuring the interaction of individual proteins involved in recognition of the host cell by the virus - a so called "biochemical' assay were unlikely to work as ICAM-1 is thought to bind to more than one partner on the HRV capsid. Accordingly, it was desirable to use intact unlabeled HRV in the assay. Furthermore, the assay must be sensitive enough to detect the low affinity interaction of monomelic ICAM-1 with HRV and the assay needed to be predictive of cell based infectivity assays.

The key challenge in the development of a biochemical HRV:ICAM-1 binding inhibition assay lay in the technical issues of how to detect this binding event. From a user safety perspective a homogeneous assay format was essential to reduce risk of virus aerosol formation which would otherwise occur with a heterogeneous format. Typically a homogeneous binding inhibition assay would involve biologically tagging or otherwise labelling each partner molecule in the binding pair. However, the direct labelling of the HRV is technically very challenging and carried the risk of compromising the biological relevance of the assay should the labelling have adverse effect on virus structure / conformation. We exploited the multi-valency of the ICAM-1 :HRV interaction in the assay design thus negating the need to detect the HRV directly. More specifically, since each HRV particle contains approximately 60 ICAM- 1 binding by differentially tagging or labelling two different soluble ICAM-1 reagents we were able to detect the simultaneous interaction of both of these ICAM- 1 populations with live unmodified HRV using a proximity based homogeneous assay technology. The novel high throughput assay using homogeneous time resolved fluorescence (HTRF®) assay developed is based on the inhibition of HRV 16 binding to ICAM-1. The activity of inhibitors in this assay correlates well with activity in a cell based viral infectivity assay. This assay also enables true high throughput screening for inhibitors of HRV infection and facilitates screening with crude, bacterial derived sample material. The assay, schematically presented in Figure 16, involves a HRV 16 mediated TR-FRET signal between Eu-cryptate labeled ICAM-l-Fc and ICAM-1- FlagHislO / anti-Flag-XL665. The assay uses two different labeled ICAM-1 reagents, Eu-Cryptate labeled ICAM-l-Fc (labeled as described in Protein Modifications) and ICAM-1 Dl/5 FlagHislO (FLAG). Also the novelty of this format successfully avoids the use of anti-HRV antibodies which can be limited in terms of specificity to individual serotypes and commercial availability.

The assay has been optimised for HTS of crude biological scFv peri-prep samples and IC50 profiling of purified scFv and IgG in a 384 well format. As detailed below, the order of addition minimizes exposure to and handling of the HRV.

Assay buffer - PBS containing 0.2 % BSA and 0.4 M Potassium Fluoride

Anti-Flag XL665 Soln. - reconstituted with deionised water, as detailed in the instructions supplied, to 400 μ /ητΐ (2667 nM)

Other Buffers - The reagents are diluted to the required working stock concentration (4X or 8X final) in assay buffer as shown in the table below.

Table 3. Stock concentrations required for the assays.

(a) Sample Preparation

For HTS screening, Peri-prep samples are supplied in 96 deep well plates (prepared in a 50 mM MOPS, 0.5 mM EDTA, 0.5 M sorbitol (pH 7.4) buffer).

During the lead isolation campaign, scFv's from the deep well block are transferred directly to the assay plate for the dilution required of 25 %. For example if a 25 % final sample percentage is required, 10 μΐ of scFv sample is transferred to a well containing a total assay volume of 40 μΐ. For HTS, where a prior dilution of samples is required, either Greiner 384 well polypropylene (Greiner, 781280) or Greiner 96 well polypropylene (Greiner, 650201) plates are used, depending on the level of dilution required. Depending on the required final sample concentration, more than one dilution plate maybe required.

For IC50 determinations, purified scFv's or IgGs are diluted 3-fold (15 μΐ of sample into 30 μΐ assay buffer) in assay buffer, to give 11 concentration points. 96 well Greiner polypropylene (Greiner, 650201) plates are used for dilution preparation. Generally each dilution is prepared in duplicate.

(b) Sample Addition

The samples are added to black non-binding surface 384 black clear bottom well plates (Costar 3665). Final 40 μΐ total assay volume per well. Control wells: Total Binding (TB) = 10 μΐ Anti-flag XL; 5 μΐ Eu-ICAM-l-Fc; 5 μΐ ICAM-1 Dl/5 FH; 10 μΐ HRV; 10 μΐ Assay Buffer; Non Specific Binding (NSB) = 10 μΐ Anti-flag XL; 5 μΐ Eu-ICAM-l-Fc, 15 μΐ Assay Buffer; 10 μΐ HRV.

For HTS, samples are either added directly from the 96 well sample block, for 25% final sample concentration or are added from the appropriate dilution plate for lower concentrations. For IC50 determinations, dilutions from the 96 well plate(s) are transferred to the assay plate in duplicate (if required). Samples from up to four 96 well plates may be combined into one 384 well assay plate, for example by loading them using a Z quadranting format.

1. 10 μΐ of 32 nM concentration of Anti-flag XL is added to all wells including TB + NSB wells to give final concentration of 8 nM.

2. 5 μΐ of a 16 nM concentration of Eu-ICAM-lFc is added to all wells including TB + NSB wells to give a final concentration of 2nM.

3. 5 μΐ of a 48 nM concentration of ICAM-1 Dl/5 FH is added to all wells except NSB wells to give a final concentration of 6 nM.

4. 10 μΐ peri-prep material or dilution of scFv or IgG is added to all wells exncluding TB + NSB wells. The required volume of assay buffer is added to the TB and NSB wells to adjust the assay volume to 40ul.

5. 10 μΐ of 50 % HRV is added to all wells including TB + NSB wells, to give a final dilution of 12.5 % 6. Seal all assay plates with black cover seals (Perkin Elmer cat no 6005189), making sure all wells with HRV are completely covered

7. Incubate for 4 hours at room temperature in fume hood

(c) Fluorescent measurement

The plate seals are removed and the fluorescence measured on a PerkinElmer ENVISION™ plate reader, or similar equipment, using a 320 nm excitation filter and 620nm and 665nm emission filters. Settings on ENVISION™ for HTRF® 384 well 40 μΐ 200 flashes bottom read:

Labels:

HTRF 384 well 40ul 200 flashes bottom read 3000003

Top mirror N/A

Bottom mirror LANCE Dual

Exc. filter UV2 (TRF) 320

Using of excitation filter Bottom

Ems. filter APC 665

Using of emission filter Bottom

2nd ems. filter Europium 615

Using of 2nd emission filter Bottom

Measurement height 6.2 mm

Cycle 2000

Delay 70

Number of flashes 200

Number of sequence windows

Total time of windows 550

Limits of excitation light 100%

Range of excitation light 100%

Reference AD gain of bottom

Reference signal of bottom 264292

Last edited ########

Last edited by EnVision

Factory preset No

(d) Data Analysis

i) To correct using the formula

Calculate Delta F % value using the formula

Delta F% =

V negative control HTRF Ratio J Where the negative control HTRF® ratio is the mean HTRF® ratio of the non-specific binding control wells

Calculate % Specific Binding using the formula

(Sample Delta F% - NSB Delta F%)

% specific binding - x lOO

Total binding Delta F% - NSB Delta F%) J

Where NSB Delta F% is the mean value of the non-specific binding control wells and Total binding Delta F % is the mean value of the Total binding control wells.

The screen performance parameter Z prime is calculated according to equation

(3 x SD Total binding control) + (3 x SD NSB control)

ZVrime - 1 - Absolutevalue(mean Total binding control - mean NSB control); v) HTS data may be analysed automatically according to the equations given above (i-iv). 'Hits' (samples which inhibit binding) will be identified as those showing increased inhibition when compared to an irrelevant sample, with the cut-off set empirically.

For IC50 titrations, the data is analysed according to the equations given above (i-iv). The logio cone. (M) vs. % specific binding is plotted using curve fitting performed using the 4 parameter logistic equation (sigmoidal dose response variable slope):

Y = Bottom + - (Τ°Ρ ~ Β°→

((LoglC 50-X )x HUlSlope) ~*

(ΐ + 10Λ'

X is the logarithm of concentration. Y is % specific binding. The IC50 is the sample concentration that produces 50 % inhibition of specific binding. ASSAY 2 - LFA-1: ICAM-1 Binding Assay

This homogeneous assay was developed based on the inhibition of human LFA-1 binding to human ICAM-1. This assay is based on the interaction of LFA- 1 -FlagHis9 (FH) binding to biotinylated ICAM-l-Fc in Alphascreen (Perkin Elmer) format. Bacterially expressed recombinant LFA-1 for this assay was in an Ί-domain open' conformation, generated by the introduction of pairs of cysteine residues that form disulphide bonds after refolding (1). The assay is sensitive to inhibition by neutralising scFv and is optimised for both HTS of crude scFv peri-prep samples and secondary IC50 profiling of purified scFv in

384 well formats.

Assay buffer - 2 mM Magnesium Chloride (Sigma M2670), 0.1 % BSA (Sigma A9576) Phosphate Buffered Saline (PBS; Gibco 14190).

Working solutions in Table 4 are generated from the stock solutions described above by appropriate dilution in assay buffer

Sample Preparation

For HTS screening, crude scFv peri-prep samples are supplied in 96 deep well plates

(prepared in a 50 mM MOPS, 0.5 mM EDTA, 0.5 M sorbitol (pH 7.4) buffer). During the lead isolation campaign, scFv peri-prep samples from the deep well blocks were transferred directly to the assay plate for the dilution required of 24 %. For example if a

24 % final sample percentage is required, 6 μΐ of scFv sample is transferred to a well containing a total assay volume of 25 μΐ.

For HTS, where a prior dilution of samples is required, then either Greiner 384 well polypropylene (Greiner, 781280) or Greiner 96 well polypropylene (Greiner, 650201) are used, depending on the level of dilution required. Depending on the required final sample concentration, more than one dilution plate maybe required.

For IC50 determinations the samples are diluted 3-fold (for example, 15 μΐ of sample into 30 μΐ of assay buffer), to give 11 concentration points. 96 well Greiner polypropylene (Greiner, 650201) plates are used for dilution preparation. Generally each dilution is prepared in duplicate.

(e) Sample Addition

For HTS or IC50 determination the starting concentrations of biotinylated ICAM- 1 Fc, LFA-1 FH and Alphascreen beads are different (see Table 4) though working concentrations are the same. Exact volumes of each added to the assay wells are therefore altered accordingly.

The samples are added to 384 white well assay plate (Optiplate, 6007298). Final 25 μΐ total assay volume per well. Control wells: Total Binding (TB) = 0.4nM Bio-ICAM-l-Fc; 13.3 nM LFA-1 FH; 5 or 6 μΐ of bead mix (HTS or IC50 determination respectively); up to a final well volume of 25 μΐ with assay buffer; Non Specific Binding (NSB) = 13.3 nM LFA-1 FH; 5 or 6 μΐ of bead mix (HTS or IC50 determination respectively); up to a final well volume of

25 μΐ with assay buffer.

For HTS, samples are either added directly from the 96 well sample block, for 24 % final sample concentration or are added from the appropriate dilution plate. For IC50 determinations, dilutions from the 96 well plate(s) are transferred to the assay plate in duplicate (if required). Samples from up to four 96 well plates may be combined into one 384 well assay plate, for example by loading them using a Z quadranting format. 1. Bio-ICAM- 1 -Fc is added to all wells except NSB wells to give a final concentration of 0.4 nM.

2. Test sample is added to all wells excluding TB + NSB wells as follows: 6 μΐ of peri- prep samples is added directly from the 96 well sample block for 24 % final sample concentration, or 7.5 μΐ diluted scFv or IgG is added from the dilution plates, assay buffer is added to TB and NSB wells to equalize the volume between all the wells.

3. Incubate for 30 mins @ room temperature

4. LFA-1 FH is added to all wells including TB + NSB wells to give a final

concentration of 13.3 nM.

5. 6 or 5 μΐ Alphascreen bead mix (HTS or IC50 determination respectively) is added to all wells in the dark room under a green filtered light (Roscolux Chroma green # 389) to give a final bead concentration for both assay formats of 20-60 μg/ml.

6. Seal the plates and incubate the plates for 1.5 hrs in the dark at room temperature. 7. After incubation, remove the seals quickly and fluorescence measured using a 570 nm emission filter on a PerkinElmer ENVISION™ plate reader, or similar equipment.

(f) Data analysis

Data is expressed as percentage specific binding ((Sample -NSB/Total-NSB)*100) using manual data analysis in MS Excel.

(g) IC50 determinations

The data is analysed using 4-parameter logistic equation with GRAPHPAD™ Prism version 5 (GraphPad Inc, California) to give apparent IC50 values. Y= Bottom + (Top- Bottom)/ (1+10Λ ((Log IC50-X)*HillSlope)) where X is the logarithm of concentration and Y is the % specific binding. The IC50 is the sample concentration that produces 50 % inhibition of specific binding.

Reference

1. Shimaoka, M., Lu, C, Palframan, RT., von Andrian, UH., McCormack, A., Takagi, J. and Springer. TA. Proc. Natl. Acad. Sci. USA 2001. 98: p 6009.

ASSAY 3 - HeLa-OHIO Cvtopathic Effect (CPE) Assay

Crystal violet solution (2.3 % w/v) (diluted to a Sigma HT90132 working concentration of 0.5 % w/v in deionised

water)

Formaldehyde solution, 37 % (diluted to a working Sigma F1635 concentration of 4 % in DPBS)

DPBS Invitrogen 14190-086

HRV16-, 1 ml virus + 1.5 ml media for 24 hour CPE assay (approximate final MOI 1.6 used in CPE assay)

HRV14- batch - dilute 1 ml virus + 3 ml media for 24 hour CPE assay (approximate final MOI 15.7 used in CPE assay)

HeLa Ohio- human negroid cervix carcinoma cell line. Maintained as an adherent culture in MEM supplemented with 10 % FBS and 1 % non essential amino acids.

NOTES: Viral stocks should be stored at -80 °C and viral titers should be done for every new viral batch, different serotype or different cell type. TCID50 (50 % tissue culture infective dose); MOI (multiplicity of infection). Determine appropriate MOI for 24 or 48 hour assay. Values are given above but may need to be optimized if assay conditions are varied.

(h) Sample Addition - All samples are tested in triplicate, outside wells are omitted

1. HeLa Ohio cells are seeded at 30,000 cells/well in a volume of 100 μΐ in a 96 well flat, clear bottom tissue culture plate in complete medium (MEM supplemented with 10% FCS, 1 % non-essential amino acids and Penicillin/Streptomycin) and incubated overnight at 37 °C/5 % C02, cells should be around 95-100 % confluent when used.

2. Antibodies to be tested (including positive and negative controls) are titrated using a serial dilution of 1 in 3 at 2 times concentration in a 96 well polypropylene plate (Greiner, 650201) with complete medium, allowing enough for triplicate samples.

3. Medium is removed from the HeLa Ohio cells and 30 μΐ of antibody or medium is added to the appropriate well and incubated for 30 minutes.

4. HRV is thawed and diluted in complete medium to the appropriate MOI and 30 μΐ is also added to each well (media is added to non-infected controls) and plates are incubated for 2 hours at 33 °C/5 % C02

5. Virus and antibody is aspirated from the cells and replaced with 100 μΐ of complete medium and incubated at 33 °C/5 %C02 for a further 23 hours.

6. Medium is aspirated and remaining cells are fixed with 150 μΐ of 4 % formaldehyde for approximately 10 minutes. 7. Fixative is removed and 70 μΐ of 0.5 % (w/v) crystal violet is added per well and incubated for 5-10 minutes to stain remaining cells.

8. Cells are then washed 3-5 times in 150-250 μΐ of deionised water to remove background stain. Plates are left to dry and after decontamination with Trigene and 70 % ethanol, are read at 600 nm on an ENVISION™ plate reader, or similar equipment using a protocol that takes 100 readings across each well and calculates an average.

9. Data is analysed using by normalising values to no antibody (0 % signal) and no virus (100 % signal) controls. Dose response curves are plotted for each antibody titration

ASSAY 4 - Jurkat Adhesion Assay

Assay buffer: Hanks Balanced Salt Solution (HBSS) with 1% sterile bovine serum albumin. Cell wash buffer: RPMI 1640 plus 2 mM L-glutamine

Wash buffer: 5 mM HEPES, 150 mM NaCl, 0.1 % glucose, 2 mM MgCl2, pH 7.3

Jurkat E6.1- human leukaemic T cell line. Maintained as a suspension culture in RPMI supplemented with 10% bovine calf serum.

(i) Assay

All samples tested in duplicate 1. Reconstitute ICAM-l-Fc in DPBS at 500 μg/ml and coat a 96 well black walled plate (Costar) at 10 μg/ml at a volume of 50 μΐ/well. Ensure buffer has completely coated each well and then seal the plate and incubate at 4 °C overnight.

2. Remove the ICAM-l-Fc from the plate. Block the plate with assay buffer at a volume of 250 μΐ/well for 1-2 hours at room temperature.

3. Pellet one T175 tissue culture flask of Jurkat E6.1 cells, cultured in RPMI with 10 % bovine calf serum, at 300x g for 5 minutes. The supernatant is discarded and cells are resuspended in cell wash buffer and pelleted at 300x g for 5 minutes, this step is repeated.

4. Cells are then resuspended in cell wash buffer to give approximately 5 x 106 cells/ml in a total volume of 6 ml. Calcein-AM dye is added at a final concentration of 5 μΜ and cells are incubated with the lid loose in a tissue culture incubator at 37 °C/5 % C02 for 30 minutes. After loading cells appear green.

5. Antibodies to be tested (including positive and negative controls) are titrated using a serial dilution of 1 in 3 at 4x the required concentration in a 96 well polypropylene plate (Greiner, 650201) with assay buffer, allowing enough for duplicate samples.

6. The blocking buffer is removed from the 96 well plate and then washed in HBSS (no bovine serum albumin). 50 μΐ of assay buffer is added to each well followed by 50 μΐ of each antibody titration and left to incubate for > 15 minutes at room temperature

7. PMA is diluted in assay buffer at 4x concentration 200 ng/ml (final concentration 50 ng/ml) and 50 μΐ added to the 96 well plate. A no PMA control is also included.

8. The labeled Jurkat cells are pelleted as detailed above and washed twice in assay buffer. Cells are then resuspended in approximately 7 ml of assay buffer and 50 μΐ of the suspension is added to each well to give a total volume of 200 μΐ per well.

9. The assay plate is incubated with a lid at 37 °C/5 % C02 for 3 hours

10. The contents of the plate are removed and each well is washed with 250 μΐ of wash buffer, this is repeated. A final 250 μΐ of wash buffer is added and the plates are read on the ENVISION™ plate reader (Perkin Elmer) or similar equipment using a protocol for fluorescein detection.

11. Data was analysed by normalising values to no PMA (0 % signal) and no antibody (100 % signal) controls. Dose response curves were plotted for each antibody titration.

ASSAY 5 - ICAM-1 Specificity ELISAs The IgG specificity ELISAs are performed essentially as follows, on the ICAM-1 and IC AM- 1 -related molecules listed in the table below. With the exception of the bovine insulin used as a control antigen for non-specific binding, all antigens were biotinylated according to the details in the Protein Modifications section, and all were generated using mammalian expression.

Table 5. Reagents

Streptavidin plates (Thermo Scientific AB-1226) are coated with biotinylated antigen at 1 μg/ml in PBS and incubated over night at 4°C.

Plates are washed 3x with PBS, blocked with 300 μΐ/well blocking buffer (PBS + 0.1 % BSA) for 1 hour - IgGs are diluted to appropriate concentration (100-50 nM) in blocking buffer.

Plates are washed 3x with PBS and IgGs, titrated down plate in 3-fold dilution steps in 96-well polypropylene plates (Greiner, 650201), are added (50 μΐ/well) - incubate for 1 hour.

Plates are washed 3x with PBS-Tween, detection reagents are added at 50 μΐ/well in blocking buffer - the detection reagents are: anti-human IgG light chain HRP (kappa and lambda) or anti-murine / anti-rat HRP antibody for control antibodies - 1 hour incubation.

Plates are washed 3x with PBS-Tween, TMB is added 50 μΐ/well, and the plates are left to develop, the reaction is quenched with 50 μΐ/well 0.1M H2SO4.

Plates read on an ENVISION™ plate reader, or similar equipment, at 450 nm. ASSAY 6 - Human ICAM-1 HTRF® epitope competition assay This competition assay is based on the displacement of the lead antibody clone binding to ICAM-1 by scFv/ IgGs that bind the same epitope. The assay has been optimized for high throughput screening and IC50 determination, to identify and characterise ICAM-1 neutralising single chains and IgGs.

Stock concentrations may alter depending on Batch available.

Assay buffer - PBS containing 0.2 % BSA and 0.2-0.4 M Potassium Fluoride

(j) Streptavidin XL conjugate antibody - Streptavidin XL665

(611SAXLB) is reconstituted with deionised water, as detailed in the instructions supplied, tolOOO Mg/ml (16.6 μΜ).

Other Buffers - The stock reagents are diluted to the required working stock concentration (4X final) in assay buffer as shown in the table below.

Table 6. Stock concentrations required for the assays.

(k) Sample Dilutions

Peri-prep samples are supplied in 96 deep well plates (prepared in a 50 mM MOPS, 0.5 mM EDTA, 0.5 M sorbitol (pH 7.4) buffer). During Lead Optimisation, the

concentration of crude peri-prep scFv added to the assay needs to be optimised to allow a window for detection of improved clones over the parent lead clones. This is monitored throughout the process and crude scFv concentration is reduced as more potent clones are identified. ScFv material is therefore added to the assay at a range of dilutions from 25 % final scFv percentage (where neat scFv is added to assay plate) to 0.015 % final scFv percentage during the later stages of Lead Optimisation.

For HTS screening the peri-prep scFv samples are diluted in assay buffer as required using either Greiner 384 well polypropylene (Greiner, 781280) or Greiner 96 well polypropylene (Greiner, 650201) are used, depending on the level of dilution required. ScFv from the deep well block is transferred to a 96 well plate containing an appropriate volume of assay buffer for the dilution required. For example if a 0.68 % final sample percentage is required, 5 μΐ of scFv sample is transferred to a 96 well plate containing 180 μΐ of assay buffer. Depending on the required final sample concentration, more than one dilution plate maybe required.

For IC50 determinations the purified scFv's are diluted 3-fold (40+80=120 μΐ) in assay buffer to give 11 concentration points. 96 well Greiner polypropylene (Greiner, 650201) plates are used for dilution preparation.

(1) Sample Addition

The samples are added to 384 black shallow well plate(s) (Costar 3676). Final 20 μΐ volume per well. Control wells: Total Binding (TB) = 5 μΐ assay buffer; 5 μΐ Bio- ICM10064/88; 5 μΐ Eu-ICAM-l-Fc; 5 μΐ Streptavidin XLent soln; Non Specific Binding (NSB) = 10 μΐ assay buffer; 5 μΐ Eu-ICAM-l-Fc; 5 μΐ Streptavidin XLent soln. For HTS, samples are either added directly from the 96 well sample block, for 25 % final sample concentration, or from the 96 well dilution plates for lower final concentrations. For IC50 determinations, dilutions from the 96 well plate(s) are transferred to the assay plate in duplicate. Samples from up to four 96 well plates may be combined into one 384 well assay plate, for example by loading them using a Z quadranting format.

(m) Reagent additions

1. 5 μΐ of the test solution is added to the test sample wells (excluding TB and NSB

wells)

2. 5 μΐ of Bio-ICM10064/88 solution is added to the test sample wells and the TB wells 3. 5 μΐ of Eu-cryptate ICAM-l-Fc solution is added to all the assay wells including TB and NSB wells

4. 5 μΐ of Streptavidin XLent solution is added to all the assay wells including TB and NSB wells, assay buffer is added to TB and NSB wells to adjust the assay volume to 20 μΐ.

5. The plates are sealed and incubated for 3 hours at room temperature

The plate seals are removed and the fluorescence measured on a PerkinElmer ENVISION™ plate reader, or similar equipment, using a 320 nm excitation filter and 620 nm and 665 nm emission filters. The data are analyzed using the same methods and equations (i-iv) as described above for the HRV:ICAM-1 Binding Assay (Assay 1).

ASSAY 7 - Primary Airway Epithelial Cell Infectivity Assay

This assay uses viral RNA readouts 24 hours post infection as a measure of viral infection inhibition in human primary airway epithelial cells. Cell Culture

Human primary epithelial cells were cultured in Promocell supplement for airway epithelial cell growth medium (Promocell cat no C-39160; supplements provided are BPE-26, hEGF-5, Insulin 2.5, HC-250, epinephrine-250, T3-3.35, transferring-5, RA-50).

The cells had been previously expanded and frozen down in vials at passage 6 or 7 to ensure maximal ICAM-1 expression and that the maximum number of cells for each donor was obtained. Once thawed a vial was cultured in a T225 culture flask until reaching 50 % confluency for this experiment. This took 2-3 weeks. 25 ml of new media was added to the cells every 3 days. Layout:

2 hr control plate with 8 replicates of virus no antibody and triplicates of each antibody at the top dose. 24 plates contain 6 replicates of virus no antibody, samples with virus to pool for standard curve, 7 point dose curve of each antibody in triplicate for HRV14 infection.

Day l

Epithelial cells from T225 flasks were trypsinized, resuspended and counted using the haemocytometer, then diluted to give 0.3 x 106/ml. The cells were plated in 96 well plates (Costar ,clear, flat bottomed TC treated) 0.1 ml/well. The plates were incubated overnight at 37 °C, 95 % humidity, 5 % C02.

Day 2

1. The appropriate dilutions of each antibody was prepared at 2X final concentration

2. The media was aspirated from each well.

3. 50 μΐ of the antibody (at 2X final concentration) was added to each well and

incubated at 33 °C, 90 % humidity, 5 % C02 for 60 mins.

4. An aliquot of the appropriate virus was thawed (HRV14 at nominal titer 5.9 X 105 pfu/ml). 50 μΐ of the diluted virus was added to each well and the plate incubated for 2 hours at 33 °C, 90 % humidity, 5 % C02.

5. The antibody/virus solution was aspirated from each well. The wells were washed with 100 μΐ of warmed PBS and 100 μΐ of new media was added to the 24 hr plates.

6. The plates were the incubated for 24 hours at 33 °C, 90 % humidity, 5 % C02.

7. The 2 hour controls were lysed in 250 μΐ RLT buffer containing β-mercaptoethanol (Qiagen, 74181)

Day 3

Media was aspirated from each well and samples lysed in 150 μΐ of RLT buffer containing β-mercaptoethanol and RNA was prepared using an RNAeasy 96 kit according to the manufacturers instructions (Qiagen, 74181) and stored at -20 °C until required.

RNA concentration was determined using a Ribogreen assay

(Invitrogen, R-11491). Briefly, a standard curve is generated using cone. RNA stock of same cells or the cytochrome C RNA provided at 1:2 dilution in lx TE. To a clear, flat bottomed plate add the following

Per Well: 5 μΐ RNA or standard, plus 95 μΐ Ribogreen Mix (5 μΐ 20x TE buffer, 89.75 μΐ water, 0.25 μΐ Ribogreen). Samples are incubated for 5 min in dark. The fluorescence is read on the Spectramax Gemini (21-G-3) or similar equipment. Mix for 30 sees Excitation: 500 nm, Emission: 525 nm

Viral RNA determination using TAQMAN™

HRV14 forward: 5' TCCCTCCACTAGTTTGGTCGAT 3' (SEQ ID NO:483) HRV14 reverse: 5' AAGGGCGTCCCAGCATAAG 3' (SEQ ID NO:484) HRV14 probe fam: 5' CCTAGCCTGCGTGGCGGCC 3' (SEQ ID NO:485)

Keep everything on ice including plates at all times

1. Thaw RNA at 25 °C on PCR block and place on ice. Vortex and spin down before opening to prevent contamination across wells.

2. Prepare control RNA pool of virus no antibody 24 hr cells in a standard log curve (serial dilutions fresh each time of 1:3)

3. Make up a master mix for 110 reactions for every 96 well plate (8.25 μΐ fwd primer 100 μΜ stock, 8.25 μΐ rev primer 100 μΜ stock, 2.75 μΐ probe (TAQMAN™ probe FAM labeled), 860.75 μΐ water, 1100 μΐ 2X mastermix)

Leave room for (i) std curve at least 2 rows of 8 including a blank, (ii) also have control samples/rows where no Reverse Transcriptase (RT) is added to samples, this is an added control to gauge how much DNA contamination is in the sample.

4. Place 18 μΐ of master mix to the bottom of each well.

5. Add 2 μΐ of the appropriate RNA. Make RT Mix immediately before addition: 25 μΐ RT, 225 μΐ water, 250 μΐ 2X mastermix.

6. Note which rows have no RT. Add 5 μΐ of RT Mix per well to the remaining wells.

Add it to the side of each well so there is no RNA cross contamination.

7. Place on clear cover and seal. Mix plate by vortexing, spin for 1 min on centrifuge.

Place plate on ice and put immediately onto a Stratagene MX3000 TAQMAN™ machine, or similar equipment.

8. Thermal Cycler Condition:

50 °C 95 °C 94 °C 60 °C

30 min 15 min 15 sees 1 min

40 cycles 9. Results were analysed using the Hill equation, Sigmoidal analysis software on ORIGIN™ (OriginLab). Results were presented as a relative quantification of viral RNA in experimental samples (with IgG) compared to virus alone controls. ASSAY 8 - HeLa-OHIO binding assays

Media: (DMEM +10 % FBS + Pen/Strep + 1 % NEAA)

Cells: HeLa-OHIO cells, CHO-Kl cells both cultured according to standard, published methodologies for these cell lines.

Day before the binding assay

To a T175 flask of HeLa-OHIO cells at 65-75 % confluence, add 5 ml PBS + 17 μΐ of 30 % BSA + 400 μΐ TNFa (R&D Systems) diluted to 1 μg/ml in PBS and incubate overnight.

(n) Binding Assay

(o) Cell Plating

• Check cells (HeLa-OHIO and CHO-Kl s) under microscope, then pour off media

• Add 10 mis PBS to each flask, wash then pour off

• Add 5 ml accutase and place flask at 37°C for approximately 5 mins

• Check that cells have dislodged, tap flask if necessary

• Add 10 ml media and transfer cells to falcon tube

• Spin at 300x g for 5 min, pour off supernatant

• Resuspend cells in 15 ml media and determine cell count

• Dilute cells to ~5xl05/ml and plate out 100 μΐ/well (~5xl04/well) on Costar 8805BC plates (black with flat clear bottom)

• Incubate plates at 37°C for 3-4 hours Take a sample of media for IgG/scFv titrations (~6mls per plate)

(p) ELISA

Prepare IgG/scFv titrations in media in 96-well polypropylene plates (Greiner, 650201) - two rows per sample, to be transferred to two rows on the HeLa-OHIO and CHO-K1 assay plates for duplicate data points on each. IgGs titrated from 100 nM in three-fold dilution steps - scFv from 300 nM

Wells 2-12 filled with 110 μΐ media, well 1 filled with sample at appropriate dilution in 16 μΐ media - transfer 55 μΐ from well 1 to 2, mix and repeat down to well 11 (i.e. log3 dilution series).

Wash assay plates with 3x with PBS

Transfer samples to assay plates at 50 μΐ/well, place at 37°C for 30-45 mins

Add virkon to plasticware used with media and dispose after 30 minutes

Prepare detection reagents - europium labeled anti-human IgG, anti-mouse IgG or anti-his at 100 ng/ml in detergent-free DELFIA assay buffer (diluted to IX in MilliQ water)

Wash assay plates 3x with PBS

Add 50 μΐ/well detection mix, place plates at 37°C for 30-45 min

Wash assay plates 3x with PBS, add 50 μΐ/well DELFIA enhancement solution (Perkin Elmer 4001-0010), gently shake and incubate plates at room temperature for 10 min

Read plates on PerkinElmer ENVISION™ plate reader, or similar equipment (96-well 50 μΐ/well, using a 340 nm excitation filter and 615 nm emission filters).

EXAMPLE 12 - ln-vitro and in-vivo studies of anti-IC AM- 1 antibodies

MATERIALS AND METHODS:

Viruses: Human rhinoviruses (HRVs) and Cocksackie Virus A21 (CV-A21) were grown in Ohio HeLa cells (European Collection of Cell Cultures). Viruses were obtained from the American Type Culture Collection and passaged them five times in HeLa cells before purification. The viruses were titrated on HeLa cells by standard methods and inactivated by exposure to UV light at 1,200 mJ/cm for 30 min.

In vitro assessment of anti- viral activity (Cytopathic Effect Assay): Plates were coated with HeLa HI cells and incubated overnight at 37°C, 5% C02. Anti-ICAM-1 (14C11; R&D Systems) or isotype control (Mouse IgGi; R&D Systems) were added in serial dilutions and the plate incubated for 30mins. Different HRV strains were diluted to an MOI that kills 80- 90% of viral control cells, then added to the plate. The plate was incubated further for 2h at 33°C, 5% C02, and then completely aspirated. Fresh media (DMEM +3% FCS; both Invitrogen) was added to the plate, and incubated for another 48h. CellTiter-Glo reagent (Promega) was added to the plate, incubated for lOmins and chemiluminescence read on a Microbeta Jet (Perkin Elmer).

Generation of HuICAM-1 transgenic mice: Since mouse ICAM-1 does not bind HRV, transgenic mice were generated that overexpress a chimeric form of human (D1-D2) and mouse ICAM-1 (D3-D5) under control of the CMV promoter as previously described

(Bartlett et al, 2008 Nat Med 14(2): 199-204). Briefly, an expression construct containing the CMV promoter controlled-human-mouse ICAM-1 chimera was excised from pHu/MuICAM- 11 and electroporated into HM-1 embryonic stem (ES) cells to create stable recombinant G418-resistant ES cell lines. Genomic DNA from ES cell lines was screened for

pHu/MuICAM- 1-specific sequence by PCR using the primers NS 25 (GGG CAG TCA CAG CTA AAA CCT; SEQ ID NO: 486) and NS 26 (TCC AGG GAG CAA AAC AAC TTC T; SEQ ID NO: 487). Chimeric mice were generated by C57 BL/6 J blastocyst microinjection of pHu/MuICAM-1 ES cell clones. Transmission of the Hu/MuICAM-1 transgene was confirmed by PCR analysis as described above. Positive offspring were bred onto the BALB/c background by 10 successive backcross matings of male transgenic mice to wild type BALB/c females. Genomic DNA from experimental animals were screened by PCR to identify Hu/MuICAM-1 positives and negatives, and grouped accordingly before infection. All animal work completed in accordance with UK Home Office guidelines.

Induction of HRV infection in vivo: Female huICAM-1 Tg mice and wild type (Balb/c) were anaesthetized with isoflurane, and then infected with 50ul of purified HRV. The amount of virus is stated in each figure legend. After 48hrs (HRV14 and HRV16) or 24 and 96hrs (HRV- IB), mice were euthanized, and endpoints analyzed. In order to assess the dependency of HRV infection on ICAM-1, anti-ICAM-1 antibody (14C11) or isotype control (Mouse IgGi) was given either systemically (i.v.; 2-20mg/kg 24h prior to infection) or topically (i.n.; l-100μg per mouse 2h prior to infection). In some experiments, further groups of mice were analyzed 4d and 7d post infection.LPS-induced inflammation model: Female huICAM-1 Tg mice and wild type (Balb/c) were anaesthetized with isoflurane, and then dosed with 100μg LPS (Sigma-Aldrich) intranasally. Mice were treated with anti-ICAM-1 antibody (14C11) i.v. at a dose of 20mg/kg 24h prior to LPS administration. After 24hrs, mice were euthanized, and endpoints analyzed.

Analysis of cellular inflammation: Mice were canulated via the trachea and lavaged with a volume of 1.5 ml of BAL buffer (EBSS, 55mM EDTA, 12mM lidocaine). Total BAL was separated into cell and supernatant fractions. Cells were processed by cytospin for differential staining and supernatants were stored at -80°C. Cells were re-suspended, counted and cytospins prepared and stained with xanthene and thiazine ( wik-diff stain). Slides were air- dried and differentially counted (400xmagnification) by observers blind to experimental conditions with 400 cells counted per slide.

Analysis of cytokines: Cytokines (IT AC, IP- 10, ΙΡΝ-λ3) were assessed in BAL fluid by quantitative ELISA according to manufacturers' specifications (R&D Systems).

Analysis of HRV-specific IgGs: Plates (Maxisorp, Nunc) were coated overnight with purified rhinovirus stock (2 ¾108 TCIDso/ml). Diluted serum samples were incubated for 1 h at 37 °C before detection with peroxidase-conjugated antibody to mouse IgG (Sigma).

RESULTS:

Anti-ICAM-1 is effective across multiple major serotype HRV strains in vitro: Major serotype HRVs use ICAM-1 as their entry receptor to induce viral infection. We used a cytopathic effect assay to assess the ability of an antibody against ICAM-1 (14C11) to prevent viral infection in vitro. These studies show, anti-ICAM-1 antibody was effective at inhibiting virus-induced cell death against all major group serotypes tested with IC50S ranging from 0.27nM to 4.50nM (Table 7). Anti-ICAM-1 antibody also showed efficacy against Cocksackie virus A21 (CV-A21), which has also been shown to use ICAM-1 as its entry receptor (Table 7). In contrast, this antibody had no effect at inhibiting the minor serotype HRV-25, which uses the low density lipoprotein (LDL) receptor for viral entry (Table 7).

These data indicate that IC AM- 1 blockade may be an effective strategy at inhibiting infection with major serotype HRV, and other viruses that use ICAM-1 to mediate viral entry.

Table 7 Anti-ICAM-1 antibody has anti- viral effects against multiple strains of major serotype HRV - Serial dilutions of anti-ICAM-1 antibody were used in a cytopathic effect assay to inhibit multiple strains of HRV and one strain of Cocksackie virus (CV-A21). Data is expressed as mean IC50 + SD against each strain, n>2 independent experiments for all strains except HRV- 80 which was only tested in one experiment. HRV strain Mean IC50 (nM) Std Dev (nM)

7 4.50 2.12

12 0.32 0.06

14 0.33 0.17

15 0.44 0.34

16 0.43 0.21

17 0.45 0.26

25* Unable to determine Unable to determine

27 0.27 0.04

28 0.81 0.08

32 0.47 0.27

34 0.58 0.24

36 0.58 0.32

37 0.65 0.06

38 0.48 0.35

39 0.32 0.32

41 0.78 0.11

52 0.53 0.11

60 0.45 0.25

63 3.74 2.28

65 0.43 0.32

66 0.44 0.10

75 2.47 1.15

80 0.44 Unable to determine

81 0.76 0.47

82 0.81 0.05

83 0.45 0.24

85 1.00 0.77

94 0.37 0.22

95 1.93 0.40

98 0.92 0.33

99 0.52 0.27 100 0.63 0.45

CV-A21** 2.51 2.09

HRV-25 is a minor serotype HRV which does not use ICAM-1 for entry

*CA21 is a Cocksackie virus that has been shown to use ICAM-1 for entry.

Anti-ICAM-1 prevents HRV-16 infection in vivo: The major serotype HRVs do not interact with mouse ICAM-1, and therefore wild type mice are resistant to infection with these viruses. In order to test the efficacy of anti-ICAM- 1 antibodies against HRV in vivo, transgenic mice (huICAM-1 Tg) were generated in which a chimeric form of human and mouse ICAM-1 is overexpressed. This chimeric protein contains domains 1 and 2 from human ICAM-1 in which the binding for HRV resides. HuICAM-1 Tg mice and wild type controls were infected with major group HRV-16. In order to determine whether anti-ICAM- 1 antibody pretreatment could reduce virally induced inflammation, mice were dosed systemically with anti-ICAM- 1 24h prior to virus infection. HRV-16 was unable to induce inflammation in wild type mice due to the lack of human ICAM-1 expression. However, in the HuICAM-1 Tg mice, increased numbers of leukocytes were found in the airway lumen, and differential counting revealed these increases to be due to lymphocytes and neutrophils (Figure 10A-D). Administration of anti-ICAM-1 at doses of both 2mg/kg and 20mg/kg profoundly decreased cell influx into the airway lumen compared with isotype control (Figure 10A-D).

Expression of virally-induced cytokines was also examined, with HuICAM-1 Tg showing significantly elevated levels of ΙΡΝλ3, IP- 10 and IT AC compared with wild type controls (Figure 10E-G). As with cellular inflammation, anti-ICAM-1 markedly decreased expression of these cytokines (Figure 10E-G). Taken together, these data show that anti- ICAM- 1 given prophylactically and systemically can profoundly reduce inflammation and cytokine expression induced by HRV-16.

Similarly, we wanted to establish if topical dosing of anti-ICAM-1 was also effective at preventing HRV-16 infection. Thus, huICAM-1 Tg and wild type mice were infected with HRV-16, and anti-ICAM-1 antibody was dosed intranasally 2h prior to virus infection at 1, 10 and 100μg per mouse). At the lowest dose (lμg per mouse) of anti-ICAM-1 antibody there was no effect on inflammation or cytokine expression induced by HRV-16 (Figure 11A-G). However, both 10 and 100μg dosing of anti-ICAM-1 elicited significant inhibition of the viral response, indicating that prophylactic anti-ICAM- 1 dosing is effective both topically and systemically. (Figure 11A-G). In order to establish whether anti-ICAM- 1 changes the progression of HRV-16 infection, a time course was set up, in which huICAM-1 Tg and wild type mice were subjected HRV-16 infection, and analyzed 2, 4 and 7 days after virus infection. Anti-ICAM -

1 was dosed topically at 10(^g per mouse 2h prior to infection. Significant increases in lung inflammation were seen at every time point when huICAM- 1 Tg mice were compared with wild type controls (Figure 12A-D). Expression of IFN 3 and ΓΡ-10 was increased at both 2 and 4 days but had subsided by day 7 (Figure 12E-F). ITAC levels were also elevated at day

2 but were back to control levels by day 4 (Figure 12G). Administration of anti-ICAM- 1 reduced all parameters measured and furthermore we found that one dose of the antibody was sufficient to suppress viral infection over 7 days (Figure 12A-G). In addition, we examined levels of virus-specific antibodies in the serum on day 7 following infection, and determined that anti-ICAM-1 antibody was capable of suppressing HRV-16 specific IgGi and IgG2a levels in serum (Figure 12H-I). This suggests that prophylactic treatment with anti-ICAM-1 antibody significantly reduces a virus-specific immune response.

Anti-ICAM-1 is similarly effective against HRV-14 infection: After having established that anti-ICAM-1 antibody pretreatment is effective at inhibiting HRV- 16- induced inflammation, we tested whether this antibody would show similar efficacy against another major serotype rhinovirus, HRV-14. HuICAM- lTg and wild type mice were infected with HRV-14 and received either anti-ICAM-1 antibody or isotype control 2h prior to infection via the intranasal route. HRV-14 induced similar inflammation and cytokine expression in the huICAM-1 Tg mice as seen with HRV-16 (Figure 13A-G). Importantly, anti-ICAM-1 antibody was also capable of markedly suppressing the inflammatory response to HRV-14 following topical pretreatment (Figure 13A-G). These data strongly indicate that the effects of this ICAM-1 blockade are not restricted to HRV-16 but also apply to HRV-14, and therefore may also be extrapolated to multiple major group HRV serotypes.

Anti-ICAM-1 has no effect against inflammation induced by the minor serotype HRV1B or by LPS: In order to confirm that the effects of ICAM-1 blockade were specific to the inhibition of ICAM-1 :HRV interactions, rather than effects on cell-cell interactions in the huICAM- 1 Tg mouse, we firstly examined the efficacy of anti-ICAM-1 antibody treatment in a model of HRV- IB infection, and compared it with HRV-16. This minor serotype HRV does not use ICAM-1 for viral entry and thus should be unaffected by ICAM-1 blockade. Unlike major serotype HRVs, HRV- IB is able to infect wild type mice, and therefore UV- inactivated HRV-IB was used as a control. As shown previously, HRV-16-induced inflammation was blocked by anti-ICAM- 1 antibody after systemic pretreatment (Figure 14A-K). In contrast, while HRV-IB induced robust inflammation and cytokine expression in both wild type and transgenic animals, this was unaffected by anti-ICAM- 1 antibody (Figure 14A-K).

As further confirmation that the effects of anti-ICAM- 1 antibody against HRV-14 and HRV-16 were indeed specific to ICAM-1: virus interactions, we assessed the effects of this antibody in LPS-induced inflammation. HuICAM-1 Tg mice were systemically pretreated with anti-ICAM- 1 then challenged with LPS intranasally. LPS induced cellular inflammation consisting of lymphocytes and neutrophils, and increased expression of the proinflammatory cytokines IL-Ιβ, IL-6 and KC (Figure 15A-G). These studies show that anti-ICAM- 1 antibody had no effect on any of these parameters. Taken together, these data strongly indicated that anti-ICAM- 1 blockade specifically inhibits inflammation induced specifically by major serotype HRVs.

EXAMPLE 13 - Humanization of the mouse anti-human ICAM antibody 14C11

As shown in Example 12, we have demonstrated for the first time that the mouse monoclonal antibody 14C11 has similar properties to the fully human anti-ICAM- 1 antibodies described above (see Examples 1-11). Accordingly, humanization of the 14C11 antibody could be used to generate an antibody appropriate for therapeutic use in humans. De novo protein sequencing may be used to determine the protein sequence of the variable regions of both the heavy and light chains of 14C 11 and humanized antibodies are generated using recombinant synthesis techniques (see for example, Jones et al., Nature, 321:522-525 (1986); Reichmann et al., et al, Nature 332:323 (1988); Verhoeyen et al., Science, 239: 1534- 1536 (1988); Studnicka et al, Protein Engineering 7(6):805-814 (1994); Roguska. et al, PNAS 91:969-973 (1994)), chain shuffling strategies (see for example U.S. Patent No.

5,565,332; Rader et al., Proc. Natl. Acad. Sci. USA (1998) 95:8910-8915).

De novo protein sequence analysis may be performed essentially as described by Pham et al. (Analytical Biochemistry, 2006, 352:77-86). Briefly, the 14C11 antibody and isolated Fab fragments are reduced and alkylated, the heavy and light chains are separated by protein gel electrophoresis and/or reverse-phase HPLC for further analysis. A portion of the separated chains are electroblotted to solid supports (e.g., polyvinylidene difluoride (PVDF)) membrane for N-terminal sequencing, treating with PGAP if needed to remove any pyroglutamyl blocking groups. The immobilized material is then cleaved into peptides using either chemical or protease cleavage. The resulting peptides are then subjected to additional N-terminal sequencing by Edman degradation and sequence analysis by MALDI-TOF mass spectrometry. Alternatively, a commercial vendor (e.g., Proteome Factory AG, Berline Germany) may be used to determine the protein sequence of the variable regions of 14C11.

Once the sequence of the heavy and light chain variable regions of 14C11 has been determined, humanization may be accomplished by a number of well known methods in the art. For example, the most closely related human antibody framework can be identified by sequence alignment. The 14C 11 nucleotide sequence can them be mutated such that the human amino acid sequence is encoded at framework positions that differ between the mouse and human. Mutagenesis can be performed, for example by rapid site-directed mutagenesis, using readily available commercial reagent (e.g. QuickChange® Site-Direct Mutagenesis Kit, Stratagene). Often the sequence will be mutated such that certain framework positions are maintained as donor residues to alter, preferably improve, antigen binding. These framework positions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al., U.S. Pat. No. 5,585,089; Riechmann et al., Nature 332:323 (1988)).

The reagents employed in the examples are commercially available or can be prepared using commercially available instrumentation, methods, or reagents known in the art. The foregoing examples illustrate various aspects of the invention and practice of the methods of the invention. The examples are not intended to provide an exhaustive description of the many different embodiments of the invention. Thus, although the forgoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, those of ordinary skill in the art will realize readily that many changes and modifications can be made thereto without departing from the spirit or scope of the appended claims.

1. All publications, patents and patent applications mentioned in this

specification are herein incorporated by reference into the specification to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, U.S. Provisional Patent Application No.: 61/373,978 filed August 16, 2010 is incorporated by reference in its entirety for all purposes. Table 8. SEQ ID NOs of selected antibodies

1 ICM10064 VH DNA 46 ICMO0004 VL DNA 91 Icmo0016 VH DNA

2 ICM10064 VH PRT 47 ICMO0004 VL PRT 92 Icmo0016 VH PRT

3 ICM10064 HCDR1 48 ICMO0004 LCDR1 93 Icmo0016 HCDR1

4 ICM10064 HCDR2 49 ICMO0004 LCDR2 94 Icmo0016 HCDR2

5 ICM10064 HCDR3 50 ICMO0004 LCDR3 95 Icmo0016 HCDR3

6 ICM10064 VL DNA 51 ICMO0007 VH DNA 96 Icmo0016 VL DNA

7 ICM10064 VL PRT 52 ICMO0007 VH PRT 97 Icmo0016 VL PRT

8 ICM10064 LCDR1 53 ICMO0007 HCDR1 98 Icmo0016 LCDR1

9 ICM10064 LCDR2 54 ICMO0007 HCDR2 99 Icmo0016 LCDR2

10 ICM10064 LCDR3 55 ICMO0007 HCDR3 100 Icmo0016 LCDR3

1 1 ICM10064fgl VH DNA 56 ICMO0007 VL DNA 101 Icmo0017 VH DNA

12 ICM10064fgl VH PRT 57 ICMO0007 VL PRT 102 Icmo0017 VH PRT

13 ICM10064fgl HCDR1 58 ICMO0007 LCDR1 103 Icmo0017 HCDR1

14 ICM10064fgl HCDR2 59 ICMO0007 LCDR2 104 Icmo0017 HCDR2

15 ICM10064fgl HCDR3 60 ICMO0007 LCDR3 105 Icmo0017 HCDR3

16 ICM10064fgl VL DNA 61 ICMO0008 VH DNA 106 Icmo0017 VL DNA

17 ICM10064fgl VL PRT 62 ICMO0008 VH PRT 107 Icmo0017 VL PRT

18 ICM10064fgl LCDR1 63 ICMO0008 HCDR1 108 Icmo0017 LCDR1

19 ICM10064fgl LCDR2 64 ICMO0008 HCDR2 109 Icmo0017 LCDR2

20 ICM10064fgl LCDR3 65 ICMO0008 HCDR3 1 10 Icmo0017 LCDR3

21 ICM10088 VH DNA 66 ICMO0008 VL DNA 1 1 1 Icmo0018 VH DNA

22 ICM10088 VH PRT 67 ICMO0008 VL PRT 1 12 Icmo0018 VH PRT

23 ICM10088 HCDR1 68 ICMO0008 LCDR1 1 13 Icmo0018 HCDR1

24 ICM10088 HCDR2 69 ICMO0008 LCDR2 1 14 Icmo0018 HCDR2

25 ICM10088 HCDR3 70 ICMO0008 LCDR3 1 15 Icmo0018 HCDR3

26 ICM10088 VL DNA 71 IcmoOOU VH DNA 1 16 Icmo0018 VL DNA

27 ICM10088 VL PRT 72 Icmo0014 VH PRT 1 17 Icmo0018 VL PRT

28 ICM10088 LCDR1 73 IcmoOOU HCDR1 1 18 Icmo0018 LCDR1

29 ICM10088 LCDR2 74 IcmoOOU HCDR2 1 19 Icmo0018 LCDR2

30 ICM10088 LCDR3 75 IcmoOOU HCDR3 120 Icmo0018 LCDR3

31 ICM10088fgl VH DNA 76 IcmoOOU VL DNA 121 Icmo0059 VH DNA

32 ICM10088fgl VH PRT 77 IcmoOOU VL PRT 122 Icmo0059 VH PRT

33 ICM10088fgl HCDR1 78 IcmoOOU LCDR1 123 Icmo0059 HCDR1

34 ICM10088fgl HCDR2 79 IcmoOOU LCDR2 124 Icmo0059 HCDR2

35 ICM10088fgl HCDR3 80 IcmoOOU LCDR3 125 Icmo0059 HCDR3

36 IC 10088fgl VL DNA 81 Icmo0015 VH DNA 126 Icmo0059 VL DNA 7 ICM10088fgl VL PRT 82 Icmo0015 VH PRT 127 Icmo0059 VL PRT 8 ICM10088fgl LCDR1 83 Icmo0015 HCDR1 128 Icmo0059 LCDR1

39 ICM10088fgl LCDR2 84 Icmo0015 HCDR2 129 Icmo0059 LCDR2

40 ICM10088fgl LCDR3 85 Icmo0015 HCDR3 130 Icmo0059 LCDR3

41 ICMO0004 VH DNA 86 Icmo0015 VL DNA 131 Icmo0060 VH DNA

42 ICMO0004 VH PRT 87 Icmo0015 VL PRT 132 Icmo0060 VH PRT 3 ICMO0004 HCDR1 88 Icmo0015 LCDR1 133 Icmo0060 HCDR1

44 ICMO0004 HCDR2 89 Icmo0015 LCDR2 134 Icmo0060 HCDR2

45 ICMO0004 HCDR3 90 Icmo0015 LCDR3 135 Icmo0060 HCDR3 Table 8. SEQ ID NOs of selected antibodies - continued

136 Icmo0060 VL DNA 181 Icmo0070 VH DNA

137 Icmo0060 VL PRT 182 Icmo0070 VH PRT

138 Icmo0060 LCDR1 183 Icmo0070 HCDR1

139 Icmo0060 LCDR2 184 Icmo0070 HCDR2

140 Icmo0060 LCDR3 185 Icmo0070 HCDR3

141 Icmo0061 VH DNA 186 Icmo0070 VL DNA

142 Icmo0061 VH PRT 187 Icmo0070 VL PRT

143 Icmo0061 HCDR1 188 Icmo0070 LCDR1

144 Icmo0061 HCDR2 189 Icmo0070 LCDR2

145 Icmo0061 HCDR3 190 Icmo0070 LCDR3

146 Icmo0061 VL DNA 191 Icmo0070_ SGR VH DNA

147 Icmo0061 VL PRT 192 Icmo0070_ SGR VH PRT

148 Icmo0061 LCDR1 193 Icmo0070_ _SGR HCDR1

149 Icmo0061 LCDR2 194 Icmo0070_ SGR HCDR2

150 Icmo0061 LCDR3 195 Icmo0070_ SGR HCDR3

151 Icmo0066 VH DNA 196 Icmo0070_ _SGR VL DNA

152 Icmo0066 VH PRT 197 Icmo0070_ _SGR VL PRT

153 Icmo0066 HCDR1 198 Icmo0070_ SGR LCDR1

154 Icmo0066 HCDR2 199 Icmo0070_ _SGR LCDR2

155 Icmo0066 HCDR3 200 Icmo0070_ _SGR LCDR3

156 Icmo0066 VL DNA 201 Icmo0072 VH DNA

157 Icmo0066 VL PRT 202 Icmo0072 VH PRT

158 Icmo0066 LCDR1 203 Icmo0072 HCDR1

159 Icmo0066 LCDR2 204 Icmo0072 HCDR2

160 Icmo0066 LCDR3 205 Icmo0072 HCDR3

161 Icmo0068 VH DNA 206 Icmo0072 VL DNA

162 Icmo0068 VH PRT 207 Icmo0072 VL PRT

163 Icmo0068 HCDR1 208 Icmo0072 LCDR1

164 Icmo0068 HCDR2 209 Icmo0072 LCDR2

165 Icmo0068 HCDR3 210 Icmo0072 LCDR3

166 Icmo0068 VL DNA 21 1 Icmo0075 VH DNA

167 Icmo0068 VL PRT 212 Icmo0075 VH PRT

168 Icmo0068 LCDR1 213 Icmo0075 HCDR1

169 Icmo0068 LCDR2 214 Icmo0075 HCDR2

170 Icmo0068 LCDR3 215 Icmo0075 HCDR3

171 Icmo0069 VH DNA 216 Icmo0075 VL DNA

172 Icmo0069 VH PRT 217 Icmo0075 VL PRT

173 Icmo0069 HCDR1 218 Icmo0075 LCDR1

174 Icmo0069 HCDR2 219 Icmo0075 LCDR2

175 Icmo0069 HCDR3 220 Icmo0075 LCDR3

176 Icmo0069 VL DNA 221 Icmo0079 VH DNA

177 Icmo0069 VL PRT 222 Icmo0079 VH PRT

178 Icmo0069 LCDR1 223 Icmo0079 HCDR1

179 Icmo0069 LCDR2 224 Icmo0079 HCDR2

180 Icmo0069 LCDR3 225 Icmo0079 HCDR3 Table 8. SEQ ID NOs of selected antibodies - continued

226 Icmo0079 VL DNA 271 Icmo0189 VH DNA

227 Icmo0079 VL PRT 272 Icmo0189 VH PRT

228 Icmo0079 LCDR1 273 Icmo0189 HCDR1

229 Icmo0079 LCDR2 274 Icmo0189 HCDR2

230 Icmo0079 LCDR3 275 Icmo0189 HCDR3

231 Icmo0181 VH DNA 276 Icmo0189 VL DNA

232 Icmo0181 VH PRT 277 Icmo0189 VL PRT

233 Icmo0181 HCDR1 278 Icmo0189 LCDR1

234 Icmo0181 HCDR2 279 Icmo0189 LCDR2

235 Icmo0181 HCDR3 280 Icmo0189 LCDR3

236 Icmo0181 VL DNA 281 Icmo0191 VH DNA

237 Icmo0181 VL PRT 282 Icmo0191 VH PRT

238 Icmo0181 LCDR1 283 Icmo0191 HCDR1

239 Icmo0181 LCDR2 284 Icmo0191 HCDR2

240 Icmo0181 LCDR3 285 Icmo0191 HCDR3

241 Icmo0183 VH DNA 286 Icmo0191 VL DNA

242 Icmo0183 VH PRT 287 Icmo0191 VL PRT

243 Icmo0183 HCDR1 288 Icmo0191 LCDR1

244 Icmo0183 HCDR2 289 Icmo0191 LCDR2

245 Icmo0183 HCDR3 290 Icmo0191 LCDR3

246 Icmo0183 VL DNA 291 Icmo0191 fgl VH DNA

247 Icmo0183 VL PRT 292 Icmo0191 fgl VH PRT

248 Icmo0183 LCDR1 293 Icmo0191 fgl HCDR1

249 Icmo0183 LCDR2 294 Icmo0191 fgl HCDR2

250 Icmo0183 LCDR3 295 Icmo0191 fgl HCDR3

251 Icmo0183fgl VH DNA 296 Icmo0191 fgl VL DNA

252 Icmo0183fgl VH PRT 297 Icmo0191 fgl VL PRT

253 Icmo0183fgl HCDR1 298 Icmo0191 fgl LCDR1

254 Icmo0183fgl HCDR2 299 Icmo0191 fgl LCDR2

255 Icmo0183fgl HCDR3 300 Icmo0191 fgl LCDR3

256 Icmo0183fgl VL DNA 301 Icmo0194 VH DNA

257 Icmo0183fgl VL PRT 302 Icmo0194 VH PRT

258 Icmo0183fgl LCDR1 303 Icmo0194 HCDR1

259 Icmo0183fgl LCDR2 304 Icmo0194 HCDR2

260 Icmo0183fgl LCDR3 305 Icmo0194 HCDR3

261 Icmo0188 VH DNA 306 Icmo0194 VL DNA

262 Icmo0188 VH PRT 307 Icmo0194 VL PRT

263 Icmo0188 HCDR1 308 Icmo0194 LCDR1

264 Icmo0188 HCDR2 309 Icmo0194 LCDR2

265 Icmo0188 HCDR3 310 Icmo0194 LCDR3

266 Icmo0188 VL DNA 31 1 Icmo0194fgl VH DNA

267 Icmo0188 VL PRT 312 Icmo0194fgl VH PRT

268 Icmo0188 LCDR1 313 Icmo0194fgl HCDR1

269 Icmo0188 LCDR2 314 Icmo0194fgl HCDR2

270 Icmo0188 LCDR3 315 Icmo0194fgl HCDR3 Table 8. SEQ ID NOs of selected antibodies - continued

316 Icmo0194fgl VL DNA 361 Icmo0069 LFW 1

317 Icmo0194fgl VL PRT 362 Icmo0069 LFW 2

318 Icmo0194fgl LCDR1 363 Icmo0069 LFW 3

319 Icmo0194fgl LCDR2 364 Icmo0069 LFW 4

320 Icmo0194fgl LCDR3 365 Icmo0070 HFW 1

321 ICM 10064 VH CNSUS 366 Icmo0070 HFW 2

322 ICM10064 VL CNSUS 367 Icmo0070 HFW 3

323 ICM10088 VH CNSUS 368 Icmo0070 HFW 4

324 ICM10088 VL CNSUS 369 Icmo0070 LFW 1

325 ICM10064 HFW 1 370 Icmo0070 LFW 2

326 ICM10064 HFW 2 371 Icmo0070 LFW 3

327 ICM10064 HFW 3 372 Icmo0070 LFW 4

328 ICM10064 HFW 4 373 Icmo0072 HFW 1

329 ICM10064 LFW 1 374 Icmo0072 HFW 2

330 ICM10064 LFW 2 375 Icmo0072 HFW 3

331 ICM10064 LFW 3 376 Icmo0072 HFW 4

332 ICM10064 LFW 4 377 Icmo0072 LFW 1

333 ICM10064fgl HFW 1 378 Icmo0072 LFW 2

334 ICM10064fgl HFW 2 379 Icmo0072 LFW 3

335 ICM10064fgl HFW 3 380 Icmo0072 LFW 4

336 ICM10064fgl HFW 4 381 Icmo0075 HFW 1

337 ICM10064fgl LFW 1 382 Icmo0075 HFW 2

338 ICM10064fgl LFW 2 383 Icmo0075 HFW 3

339 ICM10064fgl LFW 3 384 Icmo0075 HFW 4

340 ICM10064fgl LFW 4 385 Icmo0075 LFW 1

341 ICM10088 HFW 1 386 Icmo0075 LFW 2

342 ICM10088 HFW 2 387 Icmo0075 LFW 3

343 ICM10088 HFW 3 388 Icmo0075 LFW 4

344 ICM10088 HFW 4 389 Icmo0079 HFW 1

345 ICM10088 LFW 1 390 Icmo0079 HFW 2

346 ICM10088 LFW 2 391 Icmo0079 HFW 3

347 ICM10088 LFW 3 392 Icmo0079 HFW 4

348 ICM10088 LFW 4 393 Icmo0079 LFW 1

349 ICM10088fgl HFW 1 394 Icmo0079 LFW 2

350 ICM10088fgl HFW 2 395 Icmo0079 LFW 3

351 ICM10088fgl HFW 3 396 Icmo0079 LFW 4

352 ICM10088fgl HFW 4 397 Icmo0181 HFW 1

353 ICM10088fgl LFW 1 398 Icmo0181 HFW 2

354 ICM10088fgl LFW 2 399 Icmo0181 HFW 3

355 ICM10088fgl LFW 3 400 Icmo0181 HFW 4

356 ICM10088fgl LFW 4 401 Icmo0181 LFW 1

357 Icmo0069 HFW 1 402 Icmo0181 LFW 2

358 Icmo0069 HFW 2 403 Icmo0181 LFW 3

359 Icmo0069 HFW 3 404 Icmo0181 LFW 4

360 Icmo0069 HFW 4 405 Icmo0183 HFW 1 Table 8. SEQ ID NOs of selected antibodies - continued

406 Icmo0183 HFW 2 451 Icmo0183fgl LFW 3

407 Icmo0183 HFW 3 452 Icmo0183fgl LFW 4

408 Icmo0183 HFW 4 453 Icmo0191 fgl HFW 1

409 Icmo0183 LFW 1 454 Icmo0191 fgl HFW 2

410 Icmo0183 LFW 2 455 Icmo0191 fgl HFW 3

41 1 Icmo0183 LFW 3 456 Icmo0191 fgl HFW 4

412 Icmo0183 LFW 4 457 Icmo0191 fgl LFW 1

413 Icmo0188 HFW 1 458 Icmo0191 fgl LFW 2

414 Icmo0188 HFW 2 459 Icmo0191 fgl LFW 3

415 Icmo0188 HFW 3 460 Icmo0191 fgl LFW 4

416 Icmo0188 HFW 4 461 Icmo0194fgl HFW 1

417 Icmo0188 LFW 1 462 Icmo0194fgl HFW 2

418 Icmo0188 LFW 2 463 Icmo0194fgl HFW 3

419 Icmo0188 LFW 3 464 Icmo0194fgl HFW 4

420 Icmo0188 LFW 4 465 Icmo0194fgl LFW 1

421 Icmo0189 HFW 1 466 Icmo0194fgl LFW 2

422 Icmo0189 HFW 2 467 Icmo0194fgl LFW 3

423 Icmo0189 HFW 3 468 Icmo0194fgl LFW 4

424 Icmo0189 HFW 4 469 ICM10064 HCDR1 CNSUS

425 Icmo0189 LFW 1 470 ICM10064 HCDR2 CNSUS

426 Icmo0189 LFW 2 471 ICM10064 HCDR3 CNSUS

427 Icmo0189 LFW 3 472 ICM10064 LCDR1 CNSUS

428 Icmo0189 LFW 4 473 ICM10064 LCDR2 CNSUS

429 Icmo0191 HFW 1 474 ICM10064 LCDR3 CNSUS

430 Icmo0191 HFW 2 475 ICM10088 HCDR1 CNSUS

431 Icmo0191 HFW 3 476 ICM10088 HCDR2 CNSUS

432 Icmo0191 HFW 4 477 ICM10088 HCDR3 CNSUS

433 Icmo0191 LFW 1 478 ICM10088 LCDR1 CNSUS

434 Icmo0191 LFW 2 479 ICM10088 LCDR2 CNSUS

435 Icmo0191 LFW 3 480 ICM10088 LCDR3 CNSUS

436 Icmo0191 LFW 4 481 ICAM-1 Human

437 Icmo0194 HFW 1 482 ICAM-1 D1 domain - human

438 Icmo0194 HFW 2 483 HRV14 forward

439 Icmo0194 HFW 3 484 HRV14 reverse

440 Icmo0194 HFW 4 485 HRV14 Probe fam

441 Icmo0194 LFW 1 486 NS25 probe

442 Icmo0194 LFW 2 487 NS26 probe

443 Icmo0194 LFW 3

444 Icmo0194 LFW 4

445 Icmo0183fgl HFW 1

446 Icmo0183fgl HFW 2

447 Icmo0183fgl HFW 3

448 Icmo0183fgl HFW 4

449 Icmo0183fgl LFW 1

450 Icmo0183fgl LFW 2

Claims

We Claim:
1. A purified or isolated antibody or antibody fragment, wherein the antibody or antibody fragment immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, and wherein said antibody or antibody fragment is a human or chimeric antibody or antibody fragment that does not substantially inhibit binding of human ICAM-1 to LFAl and comprises one or more characteristics selected from the group consisting of:
(a) immunospecifically binds to human ICAM-1 expressed on HeLa-OHIO cells with an affinity (KD) of less than 5 nanomolar, as assessed using DELFIA- based detection;
(b) immunospecifically binds to human ICAM-1 with an affinity (KD) of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins;
(c) does not substantially inhibit binding of a human ICAM-1 to MAC-1;
(d) can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM;
(e) does not immunospecifically bind to human ICAM-2;
(f) does not immunospecifically bind to human ICAM-3;
(g) does not immunospecifically bind to human ICAM-5;
(h) does not immunospecifically bind to human VCAM-1;
(i) immunospecifically binds to human ICAM-1 comprising a K56M
polymorphism; and
(j) binds to the same or substantially the same epitope as an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297 .
2. The antibody or antibody fragment of claim 1, wherein the antibody or antibody fragment has at least three of characteristics (a) - (j).
3. The antibody or antibody fragment of claim 2, wherein the antibody or antibody fragment has at least five of characteristics (a) - (j).
4. The antibody or antibody fragment of claim 3, wherein the antibody or antibody fragment has at least six of characteristics (a) - (j).
5. The antibody or antibody fragment of claim 4, wherein the antibody or antibody fragment has at least eight of characteristics (a) - (j).
6. The antibody or antibody fragment of claim 5, wherein the antibody or antibody fragment has ten of characteristics (a) - (j).
7. A purified or isolated human or chimeric antibody or antibody fragment, wherein the antibody or antibody fragment immunospecifically binds to human ICAM- 1 and inhibits binding of human ICAM-1 to human rhino virus, and wherein said antibody or antibody fragment competes for binding to human IC AM- 1 with an antibody an antibody comprising a VH amino acid sequence of SEQ ID NO: 292 and a VL amino acid sequence of SEQ ID NO: 297.
8. The antibody or antibody fragment of claim 7, wherein the antibody or antibody fragment does not substantially inhibit binding of human ICAM- 1 to LFA1.
9. The antibody or antibody fragment of any of claims 1-8, wherein said antibody or antibody fragment immunospecifically binds to human ICAM- 1 with a D of less than 250 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins.
10. The antibody or antibody fragment of claim 9, wherein said antibody or antibody fragment immunospecifically binds to human ICAM-1 with a KD of less than 50 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins.
11. The antibody or antibody fragment of claim 10, wherein said antibody or antibody fragment immunospecifically binds to human ICAM-1 with a KD of less than 5 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins.
12. The antibody or antibody fragment of any of claims 1-11 , wherein said antibody or antibody fragment immunospecifically binds to human ICAM- 1 expressed on HeLA-OHIO cells with a KD of less than 5 nanomolar, as assessed using
DELFIA-based detection.
13. The antibody or antibody fragment of claim 12, wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of less than 500 picomolar, as assessed using DELFIA-based detection.
14. The antibody or antibody fragment of claim 13, wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of less than 200 nanomolar, as assessed using DELFIA-based detection.
15. The antibody or antibody fragment of claim 13 or 14, wherein said antibody or antibody fragment immunospecifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of approximately 100-400 picomolar, as assessed using DELFIA-based detection.
16. The antibody or antibody fragment of any of claims 1-15, wherein does not
substantially inhibit binding of human ICAM-1 to LFA1 comprises inhibits binding of human ICAM-1 to LFA1 by less than or equal to 20%.
17. The antibody or antibody fragment of claim 16, wherein does not substantially inhibit binding of human ICAM-1 to LFA1 comprises inhibits binding of human ICAM-1 to LFA1 by less than or equal to 10%.
18. The antibody or antibody fragment of claim 17, wherein does not substantially inhibit binding of human ICAM-1 to LFA1 comprises inhibits binding of human ICAM-1 to LFA1 by less than or equal to 5%.
19. The antibody or antibody fragment of any of claims 1-18, wherein said antibody or antibody fragment does not substantially inhibit binding of human ICAM-1 to MAC-1.
20. The antibody or antibody fragment of claim 19, wherein does not substantially inhibit binding of human ICAM- 1 to MAC- 1 comprises inhibits binding of human ICAM-1 to MAC-1 by less than or equal to 20%.
21. The antibody or antibody fragment of claim 20, wherein does not substantially inhibit binding of human ICAM- 1 to MAC- 1 comprises inhibits binding of human ICAM-1 to MAC-1 by less than or equal to 10%.
22. The antibody or antibody fragment of claim 21, wherein does not substantially inhibit binding of human ICAM- 1 to MAC- 1 comprises inhibits binding of human ICAM-1 to MAC-1 by less than or equal to 5%.
23. The antibody or antibody fragment of any of claims 1-22, wherein the antibody or antibody fragment is selected from the group consisting of: a monoclonal antibody; a single-chain Fv (scFv); an Fab fragment; an F(ab') fragment; an intrabody; and a synthetic antibody.
24. The antibody or antibody fragment of claim 23, wherein the antibody or antibody fragment is human.
25. The antibody or antibody fragment of any of claims 1-24, wherein the antibody or antibody fragment comprises:
(a) a heavy chain variable domain (VH) comprising the amino acid sequence of SEQ ID NO: 321 or 323 and
(b) a light chain variable domain (VL) comprising the amino acid sequence of SEQ ID NO: 322 or 324.
26. A purified or isolated antibody or antibody fragment comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and wherein the antibody or antibody fragment is a human or chimeric antibody or antibody fragment comprising:
a VH comprising the amino acid sequence of SEQ ID NO: 321 and
a VL comprising the amino acid sequence of SEQ ID NO: 322.
27. The antibody or antibody fragment of claim 26, wherein the antibody or antibody fragment comprises a VH having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 2, 12, 72, 82, 92, 102, 112, 172, 182, 192, 202, 212, 222, 232, 242, 252, 262, 272, 282, 292, 302, and 312.
28. The antibody or antibody fragment of claim 26or 27, wherein the antibody or antibody fragment comprises a VL having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 7, 17, 77, 87, 97, 107, 117, 177, 187, 197, 207, 217, 227, 237, 247, 257, 267, 277, 287, 297, 307, and 317.
29. A purified or isolated antibody or antibody fragment comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and wherein the antibody or antibody fragment is a human or chimeric antibody or antibody fragment comprising:
a VH comprising the amino acid sequence of SEQ ID NO: 323 and
a VL comprising the amino acid sequence of SEQ ID NO: 324.
30. The antibody or antibody fragment of claim 29, wherein the antibody or antibody fragment comprises a VH having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 22, 32, 42, 52, 62, 122, 132, 142, 152, and 162.
31. The antibody or antibody fragment of claim 29or 30, wherein the antibody or antibody fragment comprises a VL having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 27, 37, 47, 57, 67, 127, 137, 147, 157, and 167.
32. The antibody or antibody fragment of any of claims 26-31, wherein the antibody or antibody fragment further comprises a constant region.
33. The antibody or antibody fragment of claim 32, wherein the constant region is a human IgG constant region.
34. The antibody or antibody fragment of claim 33, wherein the human IgG constant region is selected from an IgGl, IgG2, or IgG4 constant region.
35. The antibody or antibody fragment of claim 34, wherein the constant region includes one or more mutations that enhance stability or decrease effector function.
36. A purified or isolated antibody or antibody fragment comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and wherein the antibody or antibody fragment is a human or chimeric antibody or antibody fragment comprising:
(a) a VH CDRl having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 3;
(b) a VH CDR2 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 4;
(c) a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 5;
(d) a VL CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 8;
(e) a VL CDR2 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 9; and
(f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, or 6 amino acid residue substitutions relative to SEQ ID NO: 10.
37. The antibody or antibody fragment of any of claims l-28and 32-35, comprising
(a) a VH CDRl having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 3;
(b) a VH CDR2 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 4;
(c) a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 5;
(d) a VL CDRl having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 8;
(e) a VL CDR2 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 9; and
(f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, or 6 amino acid residue substitutions relative to SEQ ID NO: 10.
38. A purified or isolated antibody or antibody fragment comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and wherein the antibody or antibody fragment is a human or chimeric antibody or antibody fragment comprising:
(a) a VH CDR1 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 23;
(b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 24;
(c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, or 5 amino acid residue substitutions relative to SEQ ID NO: 25;
(d) a VL CDR1 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 28;
(e) a VL CDR2 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 29; and
(f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, or 6 amino acid residue substitutions relative to SEQ ID NO: 30.
39. The antibody or antibody fragment of claim 38, comprising
(a) a VH CDR1 having an amino acid sequence identical to SEQ ID NO: 23;
(b) a VH CDR2 having an amino acid sequence identical to or comprising 1 amino acid residue substitution relative to SEQ ID NO: 24;
(c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, or 5 amino acid residue substitutions relative to SEQ ID NO: 25;
(d) a VL CDR1 having an amino acid sequence identical to SEQ ID NO: 28;
(e) a VL CDR2 having an amino acid sequence identical to SEQ ID NO: 29; and
(f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, or 6 amino acid residue substitutions relative to SEQ ID NO: 30.
40. The antibody or antibody fragment of any of claims l-25and 29-35, comprising
(a) a VH CDR1 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 23;
(b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 24;
(c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, or 5 amino acid residue substitutions relative to SEQ ID NO: 25;
(d) a VL CDR1 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 28;
(e) a VL CDR2 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 29; and
(f) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, or 6 amino acid residue substitutions relative to SEQ ID NO: 30.
41. The antibody or antibody fragment of any of claims 26-40, wherein said antibody or antibody fragment is an isolated antibody or antibody fragment.
42. The antibody or antibody fragment of any of claims 26-40, wherein said antibody or antibody fragment is a purified antibody or antibody fragment.
43. The antibody or antibody fragment of any of claims 36-42, comprising one or more amino acid substitutions, wherein each of said amino acid substitutions is a conservative substitution.
44. The antibody or antibody fragment of any of claims 26-43, wherein does not substantially inhibit binding of human ICAM-1 to LFA1 comprises inhibits binding of human ICAM-1 to LFA1 by less than or equal to 20%.
45. The antibody or antibody fragment of claim 44, wherein does not substantially inhibit binding of human ICAM-1 to LFA1 comprises inhibits binding of human ICAM-1 to LFA1 by less than or equal to 10%.
46. The antibody or antibody fragment of claim 45, wherein does not substantially inhibit binding of human ICAM-1 to LFA1 comprises inhibits binding of human ICAM-1 to LFA1 by less than or equal to 5%.
47. The antibody or antibody fragment of any of claims 26-46, wherein said antibody or antibody fragment does not substantially inhibit binding of human ICAM-1 to MAC-1.
48. The antibody or antibody fragment of claim 47, wherein does not substantially inhibit binding of human ICAM- 1 to MAC- 1 comprises inhibits binding of human ICAM-1 to MAC-1 by less than or equal to 20%.
49. The antibody or antibody fragment of claim 48, wherein does not substantially inhibit binding of human ICAM- 1 to MAC- 1 comprises inhibits binding of human ICAM-1 to MAC-1 by less than or equal to 10%.
50. The antibody or antibody fragment of claim 49, wherein does not substantially inhibit binding of human ICAM- 1 to MAC- 1 comprises inhibits binding of human ICAM-1 to MAC-1 by less than or equal to 5%.
51. The antibody or antibody fragment of any of claims 26-50, wherein said antibody or antibody fragment binds to the Dl domain on human ICAM-1.
52. The antibody or antibody fragment of any of claims 26-50, wherein said antibody or antibody fragment binds to the PFIE site on human ICAM-1.
53. The antibody or antibody fragment of any of claims 26-52, wherein said antibody or antibody fragment can inhibit a cytopathic effect of a human rhinovirus on HeLa cells in culture.
54. The antibody or antibody fragment of claim 53, wherein said human rhinovirus is HRV 14 and/or HRV16.
55. The antibody or antibody fragment of any one of claims 26-52, wherein said antibody or antibody fragment can inhibit a cytopathic effect of a human
Cocksackie A Virus on HeLa cells in culture.
56. The antibody or antibody fragment of claim 55, wherein said human Cocksackie A Virus is CV-A16 and/or CV-A21.
57. The antibody or antibody fragment of any of claims 53-54, wherein said antibody or antibody fragment can inhibit a cytopathic effect of a human rhmovirus on HeLa cells in culture with an EC50 of less than 0.35 nM.
58. The antibody or antibody fragment of claim 57, wherein said antibody or antibody fragment can inhibit a cytopathic effect of a human rhmovirus on HeLa cells in culture with an EC50 of less than 0.30 nM.
59. The antibody or antibody fragment of claim 58, wherein said antibody or antibody fragment can inhibit a cytopathic effect of a human rhmovirus on HeLa cells in culture with an EC50 of less than or equal to 0.25 nM.
60. The antibody or antibody fragment of any of claims 26-59, wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 but does not immunospecifically bind to mouse ICAM-1.
61. The antibody or antibody fragment of any of claims 26-60, wherein said antibody or antibody fragment immunospecifically binds to human ICAM-1 but does not immunospecifically bind to ICAM-1 from one or more non-human primates.
62. The antibody or antibody fragment of any of claims 26-59, wherein said antibody or antibody fragment immunospecifically binds to human ICAM-1 with an affinity at least one order of magnitude greater than its affinity for mouse ICAM- 1.
63. The antibody or antibody fragment of any of claims 26-62, wherein said antibody or antibody fragment does not immunospecifically bind to human ICAM-2.
64. The antibody or antibody fragment of any of claims 26-63, wherein said antibody or antibody fragment does not immunospecifically bind to human ICAM-3 or human ICAM-5.
65. The antibody or antibody fragment of any of claims 26-64, wherein said antibody or antibody fragment does not immunospecifically bind to human VCAM-1.
66. The antibody or antibody fragment of any of claims 26-65, wherein said antibody or antibody fragment immunospecifically binds to human ICAM-1 with a KD of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins.
67. The antibody or antibody fragment of claim 66, wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 with a KD of less than 250 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins.
68. The antibody or antibody fragment of claim 67, wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 with a KD of less than 50 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins.
69. The antibody or antibody fragment of claim 68, wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 with a KD of less than 5 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins.
70. The antibody or antibody fragment of any of claims 26-66, wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of less than 5 nanomolar, as assessed using
DELFIA-based detection.
71. The antibody or antibody fragment of claim 70, wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of less than 500 picomolar, as assessed using DELFIA-based detection.
72. The antibody or antibody fragment of claim 71, wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of less than 200 nanomolar, as assessed using DELFIA-based detection.
73. The antibody or antibody fragment of claim 71or 72, wherein said antibody or antibody fragment immunospecifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of approximately 100-400 picomolar, as assessed using DELFIA-based detection.
74. The antibody or antibody fragment of any of claims 26-73, wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 comprising a K56M polymorphism.
75. The antibody or antibody fragment of any of claims 26-74, wherein said antibody or antibody fragment is fully human.
76. The antibody or antibody fragment of any of claims 36-37and 41-75, comprising one or more amino acid substitutions, wherein said amino acid substitutions include substitutions at one or more amino acid residues selected from among the members of the group consisting of:
(a) Kabat residue 65 of the VH CDR2;
(b) Kabat residue 100b of the VH CDR3; and
(c) Kabat residue lOOf of the VH CDR3.
77. The antibody or antibody fragment of any of claims 36-37and 41-76, comprising one or more amino acid substitutions, wherein said amino acid substitutions include substitutions at one or more amino acid residues selected from among the members of the group consisting of:
(a) Kabat residue 30 of the VL CDR1 ;
(b) Kabat residue 31 of the VL CDR1 ;
(c) Kabat residue 53 of the VL CDR2;
(d) Kabat residue 89 of the VL CDR3;
(e) Kabat residue 90 of the VL CDR3;
(f) Kabat residue 91 of the VL CDR3 ;
(g) Kabat residue 93 of the VL CDR3;
(h) Kabat residue 94 of the VL CDR3; and
(i) Kabat residue 95a of the VL CDR3.
78. The antibody or antibody fragment of claim 76or 77, comprising one or more amino acid substitutions, wherein said amino acid substitutions include one or more substitutions selected from among the members of the group consisting of: (a) Asn or Arg at Kabat residue 65 of the VH CDR2; (b) Gly at abat residue 100b of the VH CDR3;
(c) Leu at Kabat residue lOOf of the VH CDR3;
(d) Gly at Kabat residue 30 of the VL CDRl;
(e) Ser at Kabat residue 31 of the VL CDRl ;
(f) Arg at Kabat residue 53 of the VL CDR2;
(g) Glu at Kabat residue 89 of the VL CDR3;
(h) Thr at Kabat residue 90 of the VL CDR3;
(i) Arg, Asn, or Gly at Kabat residue 94 of the VL CDR3; and
(j) Ser at Kabat residue 95a of the VL CDR3.
79. The antibody or antibody fragment of any of claims 36-37and 41-78, wherein the VH CDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 204, 244, and 284.
80. The antibody or antibody fragment of any of claims 36-37and 41-79, wherein the VH CDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 185, and 225.
81. The antibody or antibody fragment of any of claims 36-37and 41-80, wherein the VL CDRl comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 8, 178, and 298.
82. The antibody or antibody fragment of any of claims 36-37and 41-81, wherein the VL CDR2 comprises an amino acid sequence selected from SEQ ID NO: 9 and 319.
83. The antibody or antibody fragment of any of claims 36-37and 41-82, wherein the VL CDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 10, 80, 90, 100, 11, 120, 180, 200, 220, 230, and 320.
84. The antibody or antibody fragment of any of claims 36-37and 41-83, wherein the VH domain comprises
(a) a VH framework 1 (FW1) having an amino acid sequence selected from the group consisting of SEQ ID NO: 325, 333, 373, 389, 397, 405, and 429;
(b) a VH framework 2 (FW2) having the amino acid sequence of SEQ ID NO:
326 or 366; (c) a VH framework 3 (FW3) having an amino acid sequence selected from the group consisting of SEQ ID NO: 327, 359, 367, 375, 391, 399, 407, 415, 423, and 431 ; and
(d) a VH framework 4 (FW4) having an amino acid sequence selected from the group consisting of SEQ ID NO: 328, 336, 360, 392, 400, and 440.
85. The antibody or antibody fragment of any of claims 36-37and 41-84, wherein the VL domain comprises
(a) a VL framework 1 (FW1) having an amino acid sequence selected from the group consisting of SEQ ID NO: 329, 337, 361, 377, 385, 393, 417, and 441;
(b) a VL framework 2 (FW2) having an amino acid sequence selected from the group consisting of SEQ ID NO: 330, 338, 370, 378, 394, and 410;
(c) a VL framework 3 (FW3) having an amino acid sequence selected from the group consisting of SEQ ID NO: 331, 339, 371, 379, 435, and 451; and
(d) a VL framework 4 (FW4) having the amino acid sequence of SEQ ID NO:
332.
86. The antibody or antibody fragment of claim 84 or 85, wherein the VH domain comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 2, 12, 72, 82, 92, 102, 112, 172, 182, 192, 202, 212, 222, 232, 242, 252, 262, 272, 282, 292, 302, and 213.
87. The antibody or antibody fragment of any of claims 84-86, wherein the VL
domain comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 7, 17, 77, 87, 97, 107, 117, 177, 187, 197, 207, 217, 227, 237, 247, 257, 267, 277, 287, 297, 307, and 317.
88. The antibody or antibody fragment of any of claims 38-75, comprising one or more amino acid substitutions, wherein said amino acid substitutions include substitutions at one or more amino acid residues selected from among the members of the group consisting of:
(a) Kabat residue 100a of the VH CDR3;
(b) Kabat residue 100c of the VH CDR3;
(c) Kabat residue lOOd of the VH CDR3;
(d) Kabat residue lOOe of the VH CDR3; and (e) Kabat residue lOOf of the VH CDR3.
89. The antibody or antibody fragment of any of claims 38-75 and 88, comprising one or more amino acid substitutions, wherein said amino acid substitutions include substitutions at one or more amino acid residues selected from among the members of the group consisting of:
(a) Kabat residue 94 of the VL CDR3;
(b) Kabat residue 95 of the VL CDR3;
(c) Kabat residue 95a of the VL CDR3;
(d) Kabat residue 95b of the VL CDR3;
(e) Kabat residue 96 of the VL CDR3; and
(f) Kabat residue 97 of the VL CDR3.
90. The antibody or antibody fragment of claim 88or 89, comprising one or more amino acid substitutions, wherein the amino acid substitutions include one or more substitutions selected from among the members of the group consisting of:
(a) Ala at Kabat residue 100a of the VH CDR3;
(b) Leu or Phe at Kabat residue 100c of the VH CDR3;
(c) Gin or Phe at Kabat residue lOOd of the VH CDR3;
(d) Glu at Kabat residue lOOe of the VH CDR3;
(e) Phe at Kabat residue lOOf of the VH CDR3;
(f) Leu, Met, His, or Arg at Kabat residue 94 of the VL CDR3;
(g) Ser, Asn, The, or Asp at Kabat residue 95 of the VL CDR3;
(h) Leu or Trp at Kabat residue 95a of the VL CDR3;
(i) Asn, Asp, or Ser at Kabat residue 95b of the VL CDR3;
(j) Phe or His at Kabat residue 96 of the VL CDR3; and
(k) Arg. Leu. Glu at Kabat residue 97 of the VL CDR3.
91. The antibody or antibody fragment of any of claims 38-75 and 88-90, wherein the VH CDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 25, 155, and 165.
92. The antibody or antibody fragment of any of claims 38-75 and 88-91, wherein the VL CDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 30, 50, 60, 70, 130, 140, 150, 160, and 170.
93. The antibody or antibody fragment of any of claims 38-75 and 88-92, wherein the VH domain comprises
(a) a VH framework 1 (FWl) having the amino acid sequence of SEQ ID NO:
341 or 349;
(b) a VH framework 2 (FW2) having the amino acid sequence of SEQ ID NO:
342;
(c) a VH framework 3 (FW3) having the amino acid sequence of SEQ ID NO:
343 or 351; and
(d) a VH framework 4 (FW4) having the amino acid sequence of SEQ ID NO:
344 or 352.
94. The antibody or antibody fragment of any of claims 38-75 and 88-93, wherein the VL domain comprises
(a) a VL framework 1 (FWl) having the amino acid sequence of SEQ ID NO: 345 or 353;
(b) a VL framework 2 (FW2) having the amino acid sequence of SEQ ID NO: 346 or 354;
(c) a VL framework 3 (FW3) having the amino acid sequence of SEQ ID NO: 347 or 355; and
(d) a VL framework 4 (FW4) having the amino acid sequence of SEQ ID NO:
348.
95. The antibody or antibody fragment of claim 93 or 94, wherein the VH domain comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 22, 32, 42, 52, 62, 122, 132, 142, 152, and 162.
96. The antibody or antibody fragment of any of claims 93-95, wherein the VL
domain comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 27, 37, 47, 57, 67, 127, 137, 147, 157, and 167.
97. A purified or isolated antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFAl, and wherein the antibody or antibody fragment is a human or chimeric antibody or antibody fragment comprising:
(a) a VH CDR1 having the amino acid sequence SGYFWG;
(b) a VH CDR2 having the amino acid sequence SIYQSGSTYYNPSLKX1, wherein
X1 is a neutral or basic amino acid residue; and
(c) a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y, wherein
X1 is a neutral amino acid residue;
X2 is a neutral amino acid residue.
98. The antibody or antibody fragment of claim 97, wherein the antibody or antibody fragment comprises: a VH CDR2 having the amino acid sequence
SIYQSGSTYYNPSLKX1, wherein
X1 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Arg, Lys, and His.
99. The antibody or antibody fragment of claim 97or 98, wherein the antibody or antibody fragment comprises a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y, wherein
X1 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, and Leu;
X is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, Trp.
100. The antibody or antibody fragment of any of claims 97-99, wherein the antibody or antibody fragment comprises:
(a) a VH CDR1 having the amino acid sequence SGYFWG;
(b) a VH CDR2 having the amino acid sequence SIYQSGSTYYNPSLKX1, wherein
XI is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Arg, Lys, and His; and
(c) a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y, wherein X is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, and Leu;
X2 is an amino acid selected from the group consisting of He, Ser, Thr, Gly. Ala, Val, Leu, Phe, Tyr, Trp.
101. The antibody or antibody fragment of any of claims 97-100, wherein the antibody or antibody fragment comprises:
(a) a VH CDRl having the amino acid sequence SGYFWG;
(b) a VH CDR2 having the amino acid sequence SIYQSGSTYYNPSLKX1. wherein
XI is an amino acid selected from the group consisting of Ser, Asn, and Arg; and
(c) a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y,
wherein
X1 is an amino acid selected from the group consisting of Ser and Gly;
X2 is an amino acid selected from the group consisting of Leu and Phe.
102. The antibody or antibody fragment of any of claims 97-101, wherein the antibody or antibody fragment comprises:
(a) a VL CDRl having the amino acid sequence SGSSSNIGX^TVN, wherein X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu. and He;
X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, and Gin;
(b) a VL CDR2 having the amino acid sequence NNDX^PS, wherein
X1 is an amino acid selected from the group consisting of Lys, Arg, His, Gin, and Asn; and
(c) a VL CDR3 having the amino acid sequence X1X2X3DX4X5LX6GRV, wherein X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;
X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, and He;
X3 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe. Tyr, and Trp; X4 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;
X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Arg, Lys, and His;
X6 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, and Gin.
103. The antibody or antibody fragment of claim lOlor 102, wherein the antibody or antibody fragment comprises:
(a) a VL CDRl having the amino acid sequence SGSSSNIGX^TVN, wherein X1 is an amino acid selected from the group consisting of Gly and Ser;
X2 is an amino acid selected from the group consisting of Ser and Asn;
(b) a VL CDR2 having the amino acid sequence NNDX^PS, wherein
X1 is an amino acid selected from the group consisting of Arg and Gin; and
(c) a VL CDR3 having the amino acid sequence X^X'DX^LX'ORV, wherein X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;
X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, and He;
X3 is Tip;
X4 is Asp;
X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Arg, Lys, and His;
X6 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, and Gin.
104. The antibody or antibody fragment of any of claims 101-103, wherein the
antibody or antibody fragment comprises:
(a) a VL CDRl having the amino acid sequence SGSSSNIGX^TVN, wherein X1 is an amino acid selected from the group consisting of Gly and Ser;
X2 is an amino acid selected from the group consisting of Ser and Asn;
(b) a VL CDR2 having the amino acid sequence NNDX^PS, wherein
X1 is an amino acid selected from the group consisting of Arg and Gin; and
(c) a VL CDR3 having the amino acid sequence X1X2X3DX4X5LX6GRV, wherein X is an amino acid selected from the group consisting of Ala and Glu;
X2 is an amino acid selected from the group consisting of Ser and Thr;
X3 is Trp;
X4 is Asp;
X5 is an amino acid selected from the group consisting of Ser, Gly, Asn, and Arg;
X6 is an amino acid selected from the group consisting of Ser and Asn.
105. A purified or isolated antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and wherein the antibody or antibody fragment is a human or chimeric antibody or antibody fragment comprising:
(a) a VL CDRl having the amino acid sequence SGSSSNIGX^TVN, wherein
XI is a neutral amino acid residue;
X2 is a neutral amino acid residue;
(b) a VL CDR2 having the amino acid sequence NNDX^PS, wherein
X1 is a neutral or basic amino acid residue; and
(c) a VL CDR3 having the amino acid sequence X1X2X3DX X5LX6GRV, wherein X1 is a neutral or acidic amino acid residue;
X is a neutral amino acid residue;
X3 is a neutral amino acid residue;
X4 is a neutral or acidic amino acid residue;
X5 is a neutral or basic amino acid residue;
X6 is a neutral amino acid residue.
106. The antibody or antibody fragment of claim 105, wherein the antibody or antibody fragment comprises a VL CDR 1 having the amino acid sequence
SGSSSNIGX^TVN, wherein
XI is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, and He;
X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, and Gin.
107. The antibody or antibody fragment of claim 105 or 106, wherein the antibody or antibody fragment comprises a VL CDR2 having the amino acid sequence NNDX'RPS, wherein
X1 is an amino acid selected from the group consisting of Lys, Arg, His, Gin, and Asn.
108. The antibody or antibody fragment of any of claims 105-107, wherein the
antibody or antibody fragment comprises a VL CDR3 having the amino acid sequence X1X2X3DX4X5LX6GRV, wherein
X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;
X is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, and lie;
X3 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, and Trp;
X4 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;
X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Arg, Lys, and His;
X6 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, and Gin.
109. The antibody or antibody fragment of any of claims 105-108, wherein said
antibody or antibody fragment comprises: a VL CDR 1 having the amino acid sequence SGSSSNIGX^TVN, wherein
XI is an amino acid selected from the group consisting of Gly and Ser;
X2 is an amino acid selected from the group consisting of Ser and Asn.
110. The antibody or antibody fragment of any of claims 105-109, wherein said
antibody or antibody fragment comprises a VL CDR2 having the amino acid sequence NNDX^PS, wherein
X1 is an amino acid selected from the group consisting of Arg and Gin.
111. The antibody or antibody fragment of any of claims 105- 110, wherein said antibody or antibody fragment comprises a VL CDR3 having the amino acid sequence X1X2X3DX4X5LX6GRV, wherein
X1 is an amino acid selected from the group consisting of Ala and Glu; X2 is an amino acid selected from the group consisting of Ser and Thr;
X is an amino acid selected from the group consisting of Phe and Trp; X4 is an amino acid selected from the group consisting of Thr and Asp;
X5 is an amino acid selected from the group consisting of Ser, Gly, Asn, and Arg;
X6 is an amino acid selected from the group consisting of Ser and Asn.
112. The antibody or antibody fragment of any of claims 105- 111, wherein said
antibody or antibody fragment comprises:
(a) a VH CDRl having the amino acid sequence SGYFWG;
(b) a VH CDR2 having the amino acid sequence SIYQSGSTYYNPSLKX1, wherein
XI is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Arg, Lys, and His; and
(c) a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y, wherein
X1 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, and Leu;
X is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, Trp.
113. The antibody or antibody fragment of any of claims 105-112, wherein the
antibody or antibody fragment comprises a VH CDRl having the amino acid sequence SGYFWG.
114. The antibody or antibody fragment of any of claims 105 - 113, wherein the
antibody or antibody fragment comprises a VH CDR2 having the amino acid sequence SIYQSGSTYYNPSLKX1, wherein
XI is an amino acid selected from the group consisting of Ser, Asn, and Arg.
115. The antibody or antibody fragment of any of claims 105- 114, wherein the antibody or antibody fragment comprises a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y, wherein
X1 is an amino acid selected from the group consisting of Ser and Gly;
X2 is an amino acid selected from the group consisting of Leu and Phe.
116. A purified or isolated antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and wherein the antibody or antibody fragment is a human or chimeric antibody or antibody fragment comprising:
(a) a VH CDRl having the amino acid sequence SGYFWG;
(b) a VH CDR2 having the amino acid sequence SIYQSGSTYYNPSLKX1, wherein
X1 is a neutral or basic amino acid residue;
(c) a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y, wherein
X1 is a neutral amino acid residue;
X is a neutral amino acid residue;
(d) a VL CDRl having the amino acid sequence SGSSSNIGX^TVN, wherein
XI is a neutral amino acid residue;
X is a neutral amino acid residue;
(e) a VL CDR2 having the amino acid sequence NNDX^PS, wherein
XI is a neutral or basic amino acid residue; and
(f) a VL CDR3 having the amino acid sequence X1X2X3DX X5LX6GRV, wherein X1 is a neutral or acidic amino acid residue;
X is a neutral amino acid residue;
X is a neutral amino acid residue;
X4 is a neutral or acidic amino acid residue;
X5 is a neutral or basic amino acid residue;
X6 is a neutral amino acid residue.
117. The antibody or antibody fragment of claim 116, wherein the antibody or antibody fragment comprises
(a) a VH CDRl having the amino acid sequence SGYFWG;
(b) a VH CDR2 having the amino acid sequence SIYQSGSTYYNPSLKX1, wherein
X1 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, lie, Asn, Gin, Arg, Lys, and His;
(c) a VH CDR3 having the amino acid sequence DGYCSGGX^YPX^Y, wherein
X1 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, and Leu;
X2 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, Trp;
(d) a VL CDRl having the amino acid sequence SGSSSNIGX^TVN, wherein X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, and He;
X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, and Gin;
(e) a VL CDR2 having the amino acid sequence NNDX^PS, wherein
X1 is an amino acid selected from the group consisting of Lys, Arg, His, Gin, and Asn; and
(f) a VL CDR3 having the amino acid sequence X1X2X3DX4X5LX6GRV, wherein X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;
X is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, and He;
X3 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, and Trp;
X4 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;
X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Arg, Lys, and His;
X6 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, and Gin.
118. A purified or isolated antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFAl, and wherein the antibody or antibody fragment is a human or chimeric antibody or antibody fragment comprising:
(a) a VH CDR1 having the amino acid sequence SYATN;
(b) a VH CDR2 having the amino acid sequence WIS AAX 1 GITNYGQKFQG, wherein
X1 is a neutral amino acid residue;
(c) a VH CDR3 having the amino acid sequence TPFSENX'GX^x MDV, wherein
X1 is a basic or neutral amino acid residue;
X is a neutral amino acid residue;
X3 is a neutral amino acid residue;
X4 is an acidic or neutral amino acid residue;
X5 is a neutral amino acid residue.
119. The antibody or antibody fragment of claim 118, wherein the antibody or antibody fragment comprises a VH CDR2 having the amino acid sequence
WISAAX^ITNYGQKFQG, wherein
XI is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, and Gin.
120. The antibody or antibody fragment of claim 118, wherein the antibody or antibody fragment comprises a VH CDR2 having the amino acid sequence
WIS A ANGITN YGQKFQG .
121. The antibody or antibody fragment of any of claims 118-120, wherein the
antibody or antibody fragment comprises a VH CDR3 having the amino acid sequence TPFSENX^X^X^MDV, wherein
X1 is a an amino acid selected from the group consisting of Ala, Arg, Lys, His, Ser, Thr, Gly, Val, Leu, and He;
X2 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe;
X3 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Gin, and Asn;
X4 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Asp, Glu, Gin, and Asn;
X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe.
122. The antibody or antibody fragment of any of claims 118-121, wherein the
antibody or antibody fragment comprises:
(a) a VH CDR1 having the amino acid sequence SYATN;
(b) a VH CDR2 having the amino acid sequence WIS AAX 1 GITNYGQKFQG, wherein
X1 is a an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, and Gin; and
(c) a VH CDR3 having the amino acid sequence TPFSENX'GX^X MDV, wherein
X1 is a an amino acid selected from the group consisting of Ala, Arg, Lys, His, Ser, Thr, Gly, Val, Leu, and He;
X is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe;
X is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Gin, and Asn;
X4 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Asp, Glu, Gin, and Asn;
X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe.
123. The antibody or antibody fragment of any of claims 118-122, wherein the
antibody or antibody fragment comprises:
(a) a VH CDR1 having the amino acid sequence SYATN;
(b) a VH CDR2 having the amino acid sequence WIS AAX1 GITNYGQKFQG, wherein
XI is an amino acid selected from Asn and Ser; and (c) a VH CDR3 having the amino acid sequence TPFSENX'GX^X^MDV, wherein
X1 is an amino acid selected from the group consisting of Ala and Arg; X2 is an amino acid selected from the group consisting of Leu, Tyr, and Phe; X3 is an amino acid selected from the group consisting of Tyr, Phe, and Gin; X4 is an amino acid selected from the group consisting of Tyr and Glu; X5 is an amino acid selected from the group consisting of Tyr and Phe.
124. The antibody or antibody fragment of any of claims 118- 123, wherein the
antibody or antibody fragment comprises:
(a) a VL CDR1 having the amino acid sequence SGSGSNIGSNTVN;
(b) a VL CDR2 having the amino acid sequence NNGQRPS; and
(c) a VL CDR3 having the amino acid sequence ASWOOXlX2X3XAX5X6 , wherein
X1 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Met, Arg, His, and Lys;
X is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, Gin, Asp, and Glu;
X is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, Trp, Asn, and Gin;
X4 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;
X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Tyr, Trp, Phe, Arg, His, and Lys;
X6 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Glu, Asp, Arg, His, and Lys.
125. The antibody or antibody fragment of and of claims 118- 124, wherein the
antibody or antibody fragment comprises:
(a) a VL CDR1 having the amino acid sequence SGSGSNIGSNTVN;
(b) a VL CDR2 having the amino acid sequence NNGQRPS; and
(c) a VL CDR3 having the amino acid sequence ASWDDX^x x^6, wherein
X1 is an amino acid selected from the group consisting of Ser, Leu, Met, Arg, and His;
X2 is an amino acid selected from the group consisting of Ser, Thr, Leu, Asn, and Asp;
X3 is an amino acid selected from the group consisting of Leu, Trp, and Asn; X4 is an amino acid selected from the group consisting of Gly, Ser, Asp, and Asn;
Xs is an amino acid selected from the group consisting of Phe, Arg, and His; X6 is an amino acid selected from the group consisting of Val, Leu, Glu, and Arg.
A purified or isolated antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFAl, and wherein the antibody or antibody fragment is a human or chimeric antibody or antibody fragment comprising:
(a) a VH CDR1 having the amino acid sequence SYATN;
(b) a VH CDR2 having the amino acid sequence WIS AAX 1 GITNYGQKFQG, wherein
X1 is a neutral amino acid residue;
(c) a VH CDR3 having the amino acid sequence TPFSENX'GX^X MDV, wherein
X1 is a basic or neutral amino acid residue;
X is a neutral amino acid residue;
X is a neutral amino acid residue;
X4 is an acidic or neutral amino acid residue;
X5 is a neutral amino acid residue;
(d) a VL CDR1 having the amino acid sequence SGSGSNIGSNTVN;
(e) a VL CDR2 having the amino acid sequence NNGQRPS; and
(f) a VL CDR3 having the amino acid sequence ASWDOXlX2X3XAX5X6 ,
wherein
XI is a neutral or basic amino acid residue;
X is a neutral or acidic amino acid residue; X3 is a neutral amino acid residue;
X4 is a neutral or acidic amino acid residue;
X5 is a neutral or basic amino acid residue;
X6 is any amino acid residue. The antibody or antibody fragment of claim 126, wherein the antibody or antibody fragment comprises
(a) a VH CDR1 having the amino acid sequence SYATN;
(b) a VH CDR2 having the amino acid sequence WIS AAX 1 GITNYGQKFQG, wherein
X1 is an amino acid sequence from the group consisting of Ser, Thr, Leu, He, Val, Gly, Asn, Gin;
(c) a VH CDR3 having the amino acid sequence TPFSENX'GX^X MDV, wherein
X1 is a an amino acid selected from the group consisting of Ala, Arg, Lys, His, Ser, Thr, Gly, Val, Leu, and lie;
X is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe;
X is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Gin, and Asn;
X4 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Asp, Glu, Gin, and Asn;
X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe;
(d) a VL CDR1 having the amino acid sequence SGSGSNIGSNTVN;
(e) a VL CDR2 having the amino acid sequence NNGQRPS; and
(f) a VL CDR3 having the amino acid sequence ASWDDX^x x^6,
wherein
XI is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Met, Arg, His, and Lys;
X is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, Gin, Asp, and Glu;
X3 is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, Trp, Asn, and Gin; X4 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;
X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Tyr, Trp, Phe, Arg, His, and Lys;
X6 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Asn, Gin, Glu, Asp, Arg, His, and Lys.
128. A purified or isolated antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFAl, and wherein the antibody or antibody fragment is a human or chimeric antibody or antibody fragment comprising:
(a) a VL CDR1 having the amino acid sequence SGSGSNIGSNTVN;
(b) a VL CDR2 having the amino acid sequence NNGQRPS; and
(c) a VL CDR3 having the amino acid sequence ASWDDX^xVx^6,
wherein
X1 is a neutral or basic amino acid residue;
X is a neutral or acidic amino acid residue;
X3 is a neutral amino acid residue;
X4 is a neutral or acidic amino acid residue;
X5 is a neutral or basic amino acid residue;
X6 is any amino acid residue.
129. The antibody or antibody fragment of claim 128, wherein the antibody or antibody fragment comprises a VL CDR3 having the amino acid sequence
ASWDDX^ X^X6, wherein
XI is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Met, Arg, His, and Lys;
X2 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, Gin, Asp, and Glu;
X is an amino acid selected from the group consisting of He, Ser, Thr, Gly, Ala, Val, Leu, Phe, Tyr, Trp, Asn, and Gin; X4 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Glu, Gin, Asp, and Asn;
X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Phe, Tyr, Trp, Arg, Lys, and His;
X6 is an amino acid selected from the group consisting of Gly, Ser, Thr, Ala, Val, Leu, He, Asn, Gin, Asp, Glu, Arg, Lys, and His.
130. The antibody or antibody fragment of claim 128or 129, wherein the antibody or antibody fragment comprises a VL CDR3 having the amino acid sequence ASWDOXlX2X3X4X5X6, wherein
X1 is an amino acid selected from the group consisting of Ser, Leu, Met, Arg, and His;
X is an amino acid selected from the group consisting of Ser, Thr, Leu, Asn, and Asp;
X3 is an amino acid selected from the group consisting of Leu, Trp, and Asn; X4 is an amino acid selected from the group consisting of Gly, Ser, Asp, and Asn;
X5 is an amino acid selected from the group consisting of Phe, Arg, and His; X6 is an amino acid selected from the group consisting of Val, Leu, Glu, and Arg.
131. The antibody or antibody fragment of any of claims 128- 130, wherein said
antibody or antibody fragment comprises:
(a) a VH CDR1 having the amino acid sequence SYATN;
(b) a VH CDR2 having the amino acid sequence WIS AAX 1 GITNYGQKFQG, wherein
XI is a neutral amino acid residue; and
(c) a VH CDR3 having the amino acid sequence TPFSENX'Gx x^MDV, wherein
X1 is a basic or neutral amino acid residue;
X2 is a neutral amino acid residue;
X3 is a neutral amino acid residue;
X4 is an acidic or neutral amino acid residue;
X5 is a neutral amino acid residue.
132. The antibody or antibody fragment of any of claims 128-131, wherein said antibody or antibody fragment comprises:
(a) a VH CDR1 having the amino acid sequence SYATN;
(b) a VH CDR2 having the amino acid sequence WISAANGITNYGQKFQG; and
(c) a VH CDR3 having the amino acid sequence TPFSENX'GX^X^MDV, wherein
X1 is a basic or neutral amino acid residue;
X2 is a neutral amino acid residue;
X is a neutral amino acid residue;
X4 is an acidic or neutral amino acid residue;
X5 is a neutral amino acid residue.
133. The antibody or antibody fragment of any of claims 128-132, wherein said
antibody or antibody fragment comprises:
(a) a VH CDR1 having the amino acid sequence SYATN;
(b) a VH CDR2 having the amino acid sequence WIS AAX 1 GITNYGQKFQG, wherein
XI is an amino acid selected from the group consisting of Ala, Ser, Thr, Val, Gly, Leu, He, Asn, and Gin; and
(c) a VH CDR3 having the amino acid sequence TPFSENX'GX^X^MDV, wherein
X1 is a an amino acid selected from the group consisting of Ala, Arg, Lys, His, Ser, Thr, Gly, Val, Leu, and lie;
X2 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe;
X is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Gin, and Asn;
X4 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, Phe, Asp, Glu, Gin, and Asn;
X5 is an amino acid selected from the group consisting of Ser, Thr, Gly, Ala, Val, Leu, He, Trp, Tyr, and Phe.
134. The antibody or antibody fragment of any of claims 128-133, wherein the
antibody or antibody fragment comprises: (a) a VH CDR1 having the amino acid sequence SYATN;
(b) a VH CDR2 having the amino acid sequence WIS AAX 1 GITNYGQKFQG, wherein
X1 is an amino acid selected from the group consisting of Ser and Asn; and
(c) a VH CDR3 having the amino acid sequence TPFSENX'GX^X MDV, wherein
X1 is a an amino acid selected from the group consisting of Ala and Arg; X2 is an amino acid selected from the group consisting of Leu, Tyr, and Phe; X is an amino acid selected from the group consisting of Tyr, Phe, and Gin; X4 is an amino acid selected from the group consisting of Tyr and Glu; X5 is an amino acid selected from the group consisting of Tyr and Phe.
135. The antibody or antibody fragment of any of claims 97-134, wherein said
antibody or antibody fragment is an isolated antibody or antibody fragment.
136. The antibody or antibody fragment of any of claims 97-134, wherein said
antibody or antibody fragment is a purified antibody or antibody fragment.
137. The antibody or antibody fragment of any of claims 97-136, wherein does not substantially inhibit binding of human ICAM-1 to LFAl comprises inhibits binding of human ICAM-1 to LFAl by less than or equal to 20%.
138. The antibody or antibody fragment of claim 137, wherein does not substantially inhibit binding of human ICAM-1 to LFAl comprises inhibits binding of human ICAM-1 to LFAl by less than or equal to 10%.
139. The antibody or antibody fragment of claim 138, wherein does not substantially inhibit binding of human ICAM-1 to LFAl comprises inhibits binding of human ICAM-1 to LFAl by less than or equal to 5%.
140. The antibody or antibody fragment of any of claims 97-139, wherein said
antibody or antibody fragment does not substantially inhibit binding of human ICAM-1 to MAC- 1.
141. The antibody or antibody fragment of any of claims 97-140, wherein said
antibody or antibody fragment binds to the D 1 domain on human ICAM- 1.
142. The antibody or antibody fragment of any of claims 97-140, wherein said antibody or antibody fragment binds to the PFIE site on human ICAM-1.
143. The antibody or antibody fragment of any of claims 97-142, wherein said
antibody or antibody fragment can inhibit a cytopathic effect of a human rhinovirus on HeLa cells in culture.
144. The antibody or antibody fragment of claim 143, wherein said human rhinovirus is HRV14 and/or HRV16.
145. The antibody or antibody fragment of any of claims 97-142, wherein said
antibody or antibody fragment can inhibit a cytopathic effect of a Cocksackie A Virus on HeLa cells in culture..
146. The antibody or antibody fragment of claim 145, wherein said Cocksackie A Virus is CV-A16 and/or CV-A21.
147. The antibody or antibody fragment of any of claims 143-144, wherein said
antibody or antibody fragment can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM.
148. The antibody or antibody fragment of claim 147, wherein said antibody or
antibody fragment can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.30 nM.
149. The antibody or antibody fragment of claim 148, wherein said antibody or
antibody fragment can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than or equal to 0.25 nM.
150. The antibody or antibody fragment of any of claims 97-149, wherein said
antibody or antibody fragment immunospecifically binds to human ICAM-1 but does not immunospecifically bind to mouse ICAM-1.
151. The antibody or antibody fragment of any of claims 97-150, wherein said
antibody or antibody fragment immunospecifically binds to human ICAM-1 but does not immunospecifically bind to ICAM-1 from one or more non-human primates.
152. The antibody or antibody fragment of any of claims 97-149, wherein said
antibody or antibody fragment immunospecifically binds to human ICAM-1 with an affinity at least one order of magnitude greater than its affinity for mouse ICAM-1.
153. The antibody or antibody fragment of any of claims 97-152, wherein said
antibody or antibody fragment does not immunospecifically bind to human ICAM-2.
154. The antibody or antibody fragment of any of claims 97-153, wherein said
antibody or antibody fragment does not immunospecifically bind to human ICAM-3 or human ICAM-5.
155. The antibody or antibody fragment of any of claims 97-154, wherein said
antibody or antibody fragment does not immunospecifically bind to human VCAM-1.
156. The antibody or antibody fragment of any of claims 97-155, wherein said
antibody or antibody fragment immunospecifically binds to human ICAM-1 with a KD of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins.
157. The antibody or antibody fragment of claim 156, wherein said antibody or
antibody fragment immunospecifically binds to human ICAM-1 with a KD of less than 250 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins.
158. The antibody or antibody fragment of claim 157, wherein said antibody or
antibody fragment immunospecifically binds to human ICAM-1 with a KD of less than 50 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins.
159. The antibody or antibody fragment of claim 158, wherein said antibody or
antibody fragment immunospecifically binds to human ICAM-1 with a KD of less than 5 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins.
160. The antibody or antibody fragment of any of claims 97-156, wherein said
antibody or antibody fragment immunospecifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of less than 5 nanomolar, as assessed using DELFIA-based detection.
161. The antibody or antibody fragment of claim 160, wherein said antibody or
antibody fragment immunospecifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of less than 500 picomolar, as assessed using DELFIA-based detection.
162. The antibody or antibody fragment of claim 161, wherein said antibody or
antibody fragment immunospecifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of less than 200 nanomolar, as assessed using DELFIA-based detection.
163. The antibody or antibody fragment of claim 161or 162162, wherein said antibody or antibody fragment immunospecifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of approximately 100-400 picomolar, as assessed using DELFIA-based detection.
164. The antibody or antibody fragment of any of claims 97-163, wherein said
antibody or antibody fragment immunospecifically binds to human ICAM-1 comprising a K56M polymorphism.
165. The antibody or antibody fragment of any of claims 97-164, wherein said
antibody or antibody fragment is fully human.
166. A purified or isolated antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), wherein said antibody or antibody fragment immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFAl, and wherein the antibody or antibody fragment is a human or chimeric antibody or antibody fragment comprising:
(a) a VH CDRl having the amino acid sequence of SEQ ID NO: 3;
(b) a VH CDR2 having an amino acid sequence selected from the group
consisting of: SEQ ID NOs: 3, 204, 244, and 284;
(c) a VH CDR3 having an amino acid sequence selected from the group
consisting of: SEQ ID NOs: 5, 185, and 225;
(d) a VL CDRl having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 8, 178, and 298;
(e) a VL CDR2 having the amino acid sequence of SEQ ID NO: 9 or 319; and
(f) a VL CDR3 having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 10, 80, 90, 100, 110, 120, 180, 200, 220, 230, and 320.
167. The antibody or antibody fragment of claim 166, wherein the antibody or antibody fragment comprises:
(a) a VH framework 1 (FW1) having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 325, 333, 373, 389, 397, 405, and 429;
(b) a VH framework 2 (FW2) having the amino acid sequence of SEQ ID NO:
326 or 366;
(c) a VH framework 3 (FW3) having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 327, 359, 367, 375, 391, 399, 407, 415, 423, and 431; and
(d) a VH framework 4 (FW4) having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 328, 336, 360, 392, 400, and 440.
168. The antibody or antibody fragment of claim 166 or 167, wherein the antibody or antibody fragment comprises:
(a) a VL FW1 having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 329, 337, 361, 377, 385, 393, 417, and 441;
(b) a VL FW2 having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 330, 338, 370, 378, 394, and 410;
(c) a VL FW3 having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 331, 339, 371, 379, 435, and 451; and
(d) a VL FW4 having the amino acid sequence of SEQ ID NO: 332
169. The antibody or antibody fragment of any of claims 166-168, wherein the antibody or antibody fragment comprises a VH having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 2, 12, 72, 82, 92, 102, 112, 172, 182, 192, 202, 212, 222, 232, 242, 252, 262, 272, 282, 292, 302, and 312.
170. The antibody or antibody fragment of any of claims 166-169, wherein the
antibody or antibody fragment comprises a VL having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 7, 17, 77, 87, 97, 107, 117, 177, 187, 197, 207, 217, 227, 237, 247, 257, 267, 277, 287, 297, 307, and 317.
171. A purified or isolated antibody or antibody fragment, comprising at least one heavy chain variable domain (VH) and at least one light chain variable domain (VL), wherein said antibody or antibody fragment immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and wherein the antibody or antibody fragment is a human or chimeric antibody or antibody fragment comprising:
(a) a VH CDR1 having the amino acid sequence of SEQ ID NO: 23;
(b) a VH CDR2 having the amino acid sequence of SEQ ID NO: 24 or 34;
(c) a VH CDR3 having an amino acid sequence selected from the group
consisting of: SEQ ID NOs: 25, 155, and 165;
(d) a VL CDR1 having the amino acid sequence of SEQ ID NO: 28;
(e) a VL CDR2 having the amino acid sequence of SEQ ID NO: 29; and
(f) a VL CDR3 having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 30, 40, 50, 60, 70, 130, 140, 150, 160, and 170.
172. The antibody or antibody fragment of claim 171, wherein the antibody or antibody fragment comprises:
(a) a VH framework 1 (FW1) having the amino acid sequence of SEQ ID NO:
341 or 349;
(b) a VH framework 2 (FW2) having the amino acid sequence of SEQ ID NO:
342;
(c) a VH framework 3 (FW3) having the amino acid sequence of SEQ ID NO:
343 or 351; and
(d) a VH framework 4 (FW4) having the amino acid sequence of SEQ ID NO:
344 or 352.
173. The antibody or antibody fragment of claim 17 lor 172, wherein the antibody or antibody fragment comprises:
(a) a VL framework 1 (FWl) having the amino acid sequence of SEQ ID NO: 345 or 353;
(b) a VL framework 2 (FW2) having the amino acid sequence of SEQ ID NO: 346 or 354;
(c) a VL framework 3 (FW3) having the amino acid sequence of SEQ ID NO: 347 or 355; and
(d) a VL framework 4 (FW4) having the amino acid sequence of SEQ ID NO:
348.
174. The antibody or antibody fragment of any of claims 171-173, wherein the
antibody or antibody fragment comprises a VH having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 22, 32, 42, 52, 62, 122, 132, 142, 152, and 162.
175. The antibody or antibody fragment of any of claims 171-174, wherein the
antibody or antibody fragment comprises a VL having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 27, 37, 47, 57, 67, 127, 137, 147, 157, and 167.
176. A purified antibody or antibody fragment thereof, wherein the antibody or
antibody fragment (i) comprises at least one heavy chain variable domain (VH) comprising three CDRs and at least one light chain variable domain (VL) comprising three CDRs, (ii) immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and (iii) is a human or chimeric antibody or antibody fragment comprising:
(a) a VH CDR1 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 3;
(b) a VH CDR2 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 4; and
(c) a VH CDR3 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 5.
177. The antibody or antibody fragment of claim 176, wherein the three VH CDRs comprise:
(a) a VH CDRl having the amino acid sequence of SEQ ID NO: 3;
(b) a VH CDR2 having an amino acid sequence selected from the group
consisting of: SEQ ID NOs: 4, 204, 244, and 284; and
(c) a VH CDR3 having an amino acid sequence selected from the group
consisting of: SEQ ID NOs: 5, 185, and 225.
178. The antibody or antibody fragment of claim 176 or 177, wherein the antibody or antibody fragment comprises:
(a) a VH framework 1 (FW1) having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 325, 333, 373, 389, 397, 405, and 429;
(b) a VH framework 2 (FW2) having the amino acid sequence of SEQ ID NO:
326 or 366;
(c) a VH framework 3 (FW3) having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 327, 359, 367, 375, 391, 399, 407, 415, 423, and 431; and
(d) a VH framework 4 (FW4) having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 328, 336, 360, 392, and 440.
179. The antibody or antibody fragment of any of claims 176-178, wherein the
antibody or antibody fragment comprises: a VH having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 2, 12, 72, 82, 92, 102, 112, 172, 182, 192, 202, 212, 222, 232, 242, 252, 262, 272, 282, 292, 302, and 312.
180. A purified antibody or antibody fragment thereof, wherein the antibody or
antibody fragment (i) comprises at least one heavy chain variable domain (VH) comprising three CDRs and at least one light chain variable domain (VL) comprising three CDRs, (ii) immuno specifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and (iii) is a human or chimeric antibody or antibody fragment comprising:
(a) a VH CDRl having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 23; (b) a VH CDR2 having an amino acid sequence identical to or comprising 1 , 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 24;
(c) a VH CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, or 5 amino acid residue substitutions relative to SEQ ID NO: 25.
181. The antibody or antibody fragment of claim 180, wherein the three VH CDRs comprise:
(a) a VH CDR1 having the amino acid sequence of SEQ ID NO: 23;
(b) a VH CDR2 having the amino acid sequence of SEQ ID NO: 24 or 34; and
(c) a VH CDR3 having the amino acid sequence of SEQ ID NO: 25, 155, or 165.
182. The antibody or antibody fragment of claim 180 or 181, wherein the antibody or antibody fragment comprises:
(a) a VH framework 1 (FW1) having the amino acid sequence of SEQ ID NO:
341 or 349;
(b) a VH framework 2 (FW2) having the amino acid sequence of SEQ ID NO:
342;
(c) a VH framework 3 (FW3) having the amino acid sequence of SEQ ID NO:
343 or 351; and
(d) a VH framework 4 (FW4) having the amino acid sequence of SEQ ID NO:
344 or 352.
183. The antibody or antibody fragment of any of claims 180-182, wherein the
antibody or antibody fragment comprises a VH having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 22, 32, 142 ,152, and 162.
184. A purified antibody or antibody fragment, wherein the antibody or antibody
fragment (i) comprises at least one heavy chain variable domain (VH) comprising three CDRs and at least one light chain variable domain (VL) comprising three CDRs, (ii) immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and (iii) is a human or chimeric antibody or antibody fragment comprising:
(a) a VL CDR1 having an amino acid sequence identical to or comprising 1, 2, or 3 amino acid residue substitutions relative to SEQ ID NO: 8; (b) a VL CDR2 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 9; and
(c) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, or 6 amino acid residue substitutions relative to SEQ ID NO: 10.
185. The antibody or antibody fragment of claim 184wherein the three VL CDRs
comprise:
(a) a VL CDRl having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 8, 178, and 298;
(b) a VL CDR2 having the amino acid sequence of SEQ ID NO: 9 or 319; and
(c) a VL CDR3 having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 10, 80, 90, 100, 110, 120, 180, 200, 220, 230, and 320.
186. The antibody or antibody fragment of claim 184or 185, wherein the antibody or antibody fragment comprises:
(a) a VL framework 1 (FW1) having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 329, 337, 361, 377, 385, 393, 417, and 441;
(b) a VL framework 2 (FW2) having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 330, 338, 370, 378, 394, and 410;
(c) a VL framework 3 (FW3) having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 331, 339, 371, and 451; and
(d) a VL framework 4 (FW4) having the amino acid sequence of SEQ ID NO:
332.
187. The antibody or antibody fragment of any of claims 184-186, wherein the
antibody or antibody fragment comprises a VL having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 7, 17, 77, 87, 97, 107, 117, 177, 187, 197, 207, 217, 227, 237, 247, 257, 267, 277, 287, 297, 307, and 317.
188. A purified antibody or antibody fragment, wherein the antibody or antibody
fragment (i) comprises at least one heavy chain variable domain (VH) comprising three CDRs and at least one light chain variable domain (VL) comprising three CDRs, (ii) immunospecifically binds to human ICAM-1 and inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1, and (iii) is a human or chimeric antibody or antibody fragment comprising:
(a) a VL CDR1 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 28;
(b) a VL CDR2 having an amino acid sequence identical to or comprising 1 or 2 amino acid residue substitutions relative to SEQ ID NO: 29; and
(c) a VL CDR3 having an amino acid sequence identical to or comprising 1, 2, 3, 4, 5, or 6 amino acid residue substitutions relative to SEQ ID NO: 30.
189. The antibody or antibody fragment of claim 188, wherein the three VL CDRs comprise:
(a) a VL CDR1 having the amino acid sequence of SEQ ID NO: 28;
(b) a VL CDR2 having the amino acid sequence of SEQ ID NO: 29; and
(c) a VL CDR3 having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 30, 40, 50, 60, 70, 130, 140, 150, 160 and 170.
190. The antibody or antibody fragment of claim 188 or 189, wherein the antibody or antibody fragment comprises:
(a) a VL framework 1 (FW1) having the amino acid sequence of SEQ ID NO: 345 or 353;
(b) a VL framework 2 (FW2) having the amino acid sequence of SEQ ID NO: 346 or 354;
(c) a VL framework 3 (FW3) having the amino acid sequence of SEQ ID NO: 347 or 355; and
(d) a VL framework 4 (FW4) having the amino acid sequence of SEQ ID NO:
348.
191. The antibody or antibody fragment of any of claims 188-190, wherein the
antibody or antibody fragment comprises: a VL having an amino acid sequence selected from the group consisting of: SEQ ID NOs: 27, 37, 47, 57, 67, 127, 137, 147, 157, and 167.
192. A purified or isolated chimeric or human antibody or antibody fragment, wherein the antibody or antibody fragment immunospecifically binds to human ICAM-1, inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1 and comprises a heavy chain variable domain (VH) at least 85% identical to the amino acid sequence of SEQ ID NO: 2 and a light chain variable domain (VL) at least 85% identical to the amino acid sequence of SEQ ID NO: 7.
193. The antibody or antibody fragment of claim 192, wherein the antibody or antibody fragment comprises a VH domain comprising an amino acid sequence selected from the group consisting of: SEQ ID NOs: 2, 12, 72, 82, 92, 102, 112, 172, 182, 192, 202, 212, 222, 232, 242, 252, 262, 272, 282, 292, 302, and 312; and a VL domain comprising an amino acid sequence selected from the group consisting of: SEQ ID NOs: 7, 17, 77, 87, 97, 107, 117, 177, 187, 197, 207, 217, 227, 237, 247, 257, 267, 277, 287, 297, 307, and 317.
194. A purified or isolated chimeric or human antibody or antibody fragment, wherein the antibody or antibody fragment immunospecifically binds to human ICAM-1, inhibits binding of human ICAM-1 to human rhinovirus, but does not substantially inhibit binding of human ICAM-1 to LFA1 and comprises a heavy chain variable domain (VH) at least 90% identical to the amino acid sequence of SEQ ID NO: 22 and a light chain variable domain (VL) at least 90% identical to the amino acid sequence of SEQ ID NO: 27.
195. The antibody or antibody fragment of claim 195, wherein the antibody or antibody fragment comprises a VH domain comprising an amino acid sequence selected from the group consisting of: SEQ ID NOs: 22, 32, 142, 152, and 162; and a VL domain comprising an amino acid sequence selected from the group consisting of: SEQ ID NOs: 27, 37, 47, 57, 67, 127, 137, 147, 157, and 167.
196. The antibody or antibody fragment of any of claims 166-195, wherein said
antibody or antibody fragment is an isolated antibody or antibody fragment.
197. The antibody or antibody fragment of any of claims 166-195, wherein said
antibody or antibody fragment is a purified antibody or antibody fragment.
198. The antibody or antibody fragment of any of claims 166-197, wherein does not substantially inhibit binding of human ICAM-1 to LFA1 comprises inhibits binding of human ICAM-1 to LFA1 by less than or equal to 20%.
199. The antibody or antibody fragment of claim 198, wherein does not substantially inhibit binding of human ICAM-1 to LFAl comprises inhibits binding of human ICAM-1 to LFAl by less than or equal to 10%.
200. The antibody or antibody fragment of claim 199, wherein does not substantially inhibit binding of human ICAM-1 to LFAl comprises inhibits binding of human ICAM-1 to LFAl by less than or equal to 5%.
201. The antibody or antibody fragment of any of claims 166-200, wherein said
antibody or antibody fragment does not substantially inhibit binding of human ICAM-1 to MAC- 1.
202. The antibody or antibody fragment of any of claims 166-201, wherein said
antibody or antibody fragment binds to the D 1 domain on human ICAM- 1.
203. The antibody or antibody fragment of any of claims 166-201, wherein said
antibody or antibody fragment binds to the PFIE site on human ICAM- 1.
204. The antibody or antibody fragment of any of claims 166-203, wherein said
antibody or antibody fragment can inhibit a cytopathic effect of a human rhinovirus on HeLa cells in culture.
205. The antibody or antibody fragment of any claim 204, wherein said human
rhinovirus is HRV14 and/or HRV16.
206. The antibody or antibody fragment of any of claims 166-203, wherein said
antibody or antibody fragment can inhibit a cytopathic effect of a Cocksackie A Virus on HeLa cells in culture.
207. The antibody or antibody fragment of claim 206, wherein said Cocksackie A Virus is CV-A16 and/or CV-A21
208. The antibody or antibody fragment of any of claims 166-205, wherein said
antibody or antibody fragment can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.35 nM.
209. The antibody or antibody fragment of claim 208, wherein said antibody or antibody fragment can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than 0.30 nM.
210. The antibody or antibody fragment of claim 209, wherein said antibody or
antibody fragment can inhibit a cytopathic effect of human rhinovirus on HeLa cells in culture with an EC50 of less than or equal to 0.25 nM.
211. The antibody or antibody fragment of any of claims 166-210, wherein said
antibody or antibody fragment immunospecifically binds to human ICAM-1 but does not immunospecifically bind to mouse ICAM-1.
212. The antibody or antibody fragment of any of claims 166-211, wherein said
antibody or antibody fragment immunospecifically binds to human ICAM-1 but does not immunospecifically bind to ICAM-1 from one or more non-human primates.
213. The antibody or antibody fragment of any of claims 166-210, wherein said
antibody or antibody fragment immunospecifically binds to human ICAM-1 with an affinity at least one order of magnitude greater than its affinity for mouse ICAM-1.
214. The antibody or antibody fragment of any of claims 166-213, wherein said
antibody or antibody fragment does not immunospecifically bind to human ICAM-2.
215. The antibody or antibody fragment of any of claims 166-214, wherein said
antibody or antibody fragment does not immunospecifically bind to human ICAM-3 or human ICAM-5.
216. The antibody or antibody fragment of any of claims 166-215, wherein said
antibody or antibody fragment does not immunospecifically bind to human VCAM-1.
217. The antibody or antibody fragment of any of claims 166-216, wherein said
antibody or antibody fragment immunospecifically binds to human ICAM-1 with a KD of less than 1 micromolar, as assessed by surface plasmon resonance measurements of purified proteins.
218. The antibody or antibody fragment of claim 217, wherein said antibody or
antibody fragment immunospecifically binds to human ICAM-1 with a KD of less than 250 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins.
219. The antibody or antibody fragment of claim 218, wherein said antibody or
antibody fragment immunospecifically binds to human ICAM-1 with a KD of less than 50 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins.
220. The antibody or antibody fragment of claim 219, wherein said antibody or
antibody fragment immunospecifically binds to human ICAM-1 with a KD of less than 5 nanomolar, as assessed by surface plasmon resonance measurements of purified proteins.
221. The antibody or antibody fragment of any of claims 166-220, wherein said
antibody or antibody fragment immunospecifically binds to human ICAM- 1 expressed on HeLA-OHIO cells with a KD of less than 5 nanomolar, as assessed using DELFIA-based detection.
222. The antibody or antibody fragment of claim 221, wherein said antibody or
antibody fragment immunospecifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of less than 500 picomolar, as assessed using DELFIA-based detection.
223. The antibody or antibody fragment of claim 222, wherein said antibody or
antibody fragment immunospecifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of less than 200 nanomolar, as assessed using DELFIA-based detection.
224. The antibody or antibody fragment of claim 221 or 223, wherein said antibody or antibody fragment immunospecifically binds to human ICAM-1 expressed on HeLA-OHIO cells with a KD of approximately 100-400 picomolar, as assessed using DELFIA-based detection.
225. The antibody or antibody fragment of any of claims 166-224, wherein said antibody or antibody fragment immunospecifically binds to human ICAM-1 comprising a K56M polymorphism.
226. The antibody or antibody fragment of any of claims 166-225, wherein said
antibody or antibody fragment is fully human.
227. The antibody or antibody fragment of any of claims 1-226, wherein the antibody or antibody fragment is conjugated to a detectable substance or a therapeutic agent.
228. A sterile composition comprising the antibody or antibody fragment of any of claims 1-227.
229. A composition comprising the antibody or antibody fragment of any of claims 1- 227, formulated with a pharmaceutically acceptable carrier.
230. The composition of claim 228 or 229, wherein the composition is non-pyrogenic.
231. An isolated nucleic acid encoding the antibody or antibody fragment of any of claims 1-227.
232. The nucleic acid of claim 231, wherein said nucleic acid comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 1, 11, 21, 31, 41, 51, 61, 71, 81, 91, 101, 111, 121, 131, 141, 151, 161, 171, 181, 191, 201, 211, 221, 231, 241, 251, 261, 271, 281, 291, 301, and 311.
233. The nucleic acid of claim 231 or 232, wherein said nucleic acid comprises a
nucleotide sequence selected from the group consisting of: SEQ ID NO: 6, 16, 26, 36, 46, 56, 66, 76, 86, 96, 106, 116, 126, 136, 146, 156, 166, 176, 186, 196, 206, 216, 226, 236, 246, 256, 266, 276, 286, 296, 306, and 316.
234. A vector comprising the nucleic acid of any of claims 231-233.
235. A host cell comprising the nucleic acid of any of claims 231-233.
236. A host cell comprising the vector of claim 234.
237. A method for producing an antibody comprising culturing the host cell of claim 235 or 236 under suitable conditions and recovering said antibody.
238. A method of treating or preventing human rhinovirus infection in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of the antibody or antibody fragment of any of claims 1-227.
239. A method of treating or preventing rhinovirus infection in a subject in need
thereof, comprising administering to said subject a therapeutically effective amount of the composition of any of claims 228-230.
240. The method of claim 238 or 239, wherein treating or preventing rhinovirus
infection is used to treat or prevent exacerbation of a respiratory condition.
241. The method of claim 240, wherein the respiratory condition is selected from one or more members of the group consisting of chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, acute respiratory distress syndrome (ARDS), acute lung injury (ALI), asthma, emphysema, bronchitis, tuberculosis, pneumonia, lung cancer, asbestosis, and cystic fibrosis.
242. The method of claim 240, wherein the respiratory condition is COPD.
243. The method of claim 240, wherein the respiratory condition is asthma.
244. The method of claim 240, wherein the respiratory condition is emphysema.
245. The method of any of claims 238-244, wherein the method is part of a therapeutic regimen for treating the respiratory disorder.
246. A method for inhibiting human rhinovirus infection of a cell expressing human ICAM- 1 , comprising contacting the cell with the antibody or antibody fragment of any of claims 1-227 to inhibit binding of human rhinovirus to human ICAM-1, thereby inhibiting human rhinovirus infection of said cell.
247. A method of treating or preventing Cocksackie A Virus infection in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of the antibody or antibody fragment of any of claims 1-227.
248. A method of treating or preventing Cocksackie A Virus infection in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of the composition of any of claims 228-230.
249. A method for inhibiting Cocksackie A Virus infection of a cell expressing human ICAM- 1 , comprising contacting the cell with the antibody or antibody fragment of any of claims 1-227, thereby inhibiting Cocksackie A Virus infection of said cell.
250. A method of treating or preventing Plasmodium falciparum infection in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of the antibody or antibody fragment of any of claims 1-227.
251. A method of treating or preventing Plasmodium falciparum infection in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of the composition of any of claims 228-230.
252. A method for inhibiting the binding of a Plasmodium falciparum-infected
erythrocyte to a vascular endothelial cell expressing human ICAM-1, comprising contacting the cell with the antibody or antibody fragment of any of claims 1-227, thereby inhibiting binding of said Plasmodium falciparum-infected erythrocyte.
253. The method of any of claims 238-252, wherein the antibody or antibody fragment does not inhibit binding of fragment ICAM- 1 to LFA1 by greater than 20%.
254. A method for detecting the interaction of a live virus with a host cell polypeptide by Homogeneous Time-Resolved Fluorescence technique, the method comprising the steps of:
(a) providing a buffer solution containing a first protein comprising a host cell polypeptide which is labeled with a first fluorescent marker and a second protein comprising a host cell polypeptide which is labeled with a second fluorescent marker, wherein the first fluorescent marker is the first partner or the second partner of paired FRET fluorescence markers and the second fluorescent marker is the second partner or the first partner of paired FRET fluorescence markers;
(b) adding a live virus to the solution obtained in step a);
(c) submitting the mixture obtained at step b) to a source of energy at a
wavelength corresponding to the excitation wavelength of the first partner of paired FRET fluorescence markers; and
(d) measuring the fluorescence signal at the emission wavelength of the second partner of paired FRET fluorescence markers.
255. A method for the screening a candidate molecule for the ability to inhibit the interaction of a live virus with a host cell polypeptide by Homogeneous Time- Resolved Fluorescence, the method comprising the steps of:
(a) providing a buffer solution containing a first protein comprising a host cell polypeptide which is labeled with a first fluorescent marker and a second protein comprising a host cell polypeptide which is labeled with a second fluorescent marker, wherein the first fluorescent marker is the first partner or the second partner of paired FRET fluorescence markers and the second fluorescent marker is the second partner or the first partner of paired FRET fluorescence markers;
(b) adding the candidate molecule to the solution obtained in step a);
(c) adding a live virus to the solution obtained in step b);
(d) submitting the mixture obtained at step c) to a source of energy at a
wavelength corresponding to the excitation wavelength of the first partner of paired FRET fluorescence markers;
(e) measuring the fluorescence signal at the emission wavelength of the second partner of paired FRET fluorescence markers; and
(f) comparing the fluorescence signal value obtained at step e) with the
fluorescence signal value obtained when step b) is omitted to determine if the candidate compound inhibits the interaction between the first and/or second host cell polypeptide and the live virus.
256. The method of claim 254 or 255, wherein the live virus is a human rhinovirus or a cocksackie virus. The method of claim 254, 255 or 256, wherein the host cell polypeptides are ICAM-1.
PCT/EP2011/064067 2010-08-16 2011-08-16 Anti-icam-1 antibodies and methods of use WO2012022734A3 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US37397810 true 2010-08-16 2010-08-16
US61/373,978 2010-08-16

Publications (2)

Publication Number Publication Date
WO2012022734A2 true true WO2012022734A2 (en) 2012-02-23
WO2012022734A3 true WO2012022734A3 (en) 2012-05-03

Family

ID=44582962

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/064067 WO2012022734A3 (en) 2010-08-16 2011-08-16 Anti-icam-1 antibodies and methods of use

Country Status (1)

Country Link
WO (1) WO2012022734A3 (en)

Citations (235)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6180377B2 (en)
US4384042A (en) 1980-07-30 1983-05-17 Kyowa Hakko Kogyo Co., Ltd. Method and test composition for determination of hydrogen peroxide
US4439196A (en) 1982-03-18 1984-03-27 Merck & Co., Inc. Osmotic drug delivery system
US4447233A (en) 1981-04-10 1984-05-08 Parker-Hannifin Corporation Medication infusion pump
US4447224A (en) 1982-09-20 1984-05-08 Infusaid Corporation Variable flow implantable infusion apparatus
US4474893A (en) 1981-07-01 1984-10-02 The University of Texas System Cancer Center Recombinant monoclonal antibodies
US4475196A (en) 1981-03-06 1984-10-02 Zor Clair G Instrument for locating faults in aircraft passenger reading light and attendant call control system
US4486194A (en) 1983-06-08 1984-12-04 James Ferrara Therapeutic device for administering medicaments through the skin
US4487603A (en) 1982-11-26 1984-12-11 Cordis Corporation Implantable microinfusion pump system
US4520110A (en) 1981-10-06 1985-05-28 The Board Of Trustees Of The Leland Stanford Junior University Fluorescent immunoassay employing a phycobiliprotein labeled ligand or receptor
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4542104A (en) 1983-04-06 1985-09-17 The Board Of Trustees Of The Leland Stanford Jr. Univ. Phycobiliprotein fluorescent conjugates
US4596556A (en) 1985-03-25 1986-06-24 Bioject, Inc. Hypodermic injection apparatus
US4603209A (en) 1984-09-07 1986-07-29 The Regents Of The University Of California Fluorescent indicator dyes for calcium ions
US4676980A (en) 1985-09-23 1987-06-30 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Target specific cross-linked heteroantibodies
US4714681A (en) 1981-07-01 1987-12-22 The Board Of Reagents, The University Of Texas System Cancer Center Quadroma cells and trioma cells and methods for the production of same
US4714763A (en) 1985-07-11 1987-12-22 Viomedics Inc. Novel oxazine-ureas and thiazine urea chromophors as fluorescent labels
US4774339A (en) 1987-08-10 1988-09-27 Molecular Probes, Inc. Chemically reactive dipyrrometheneboron difluoride dyes
US4790824A (en) 1987-06-19 1988-12-13 Bioject, Inc. Non-invasive hypodermic injection device
US4810636A (en) 1986-12-09 1989-03-07 Miles Inc. Chromogenic acridinone enzyme substrates
US4812409A (en) 1986-01-31 1989-03-14 Eastman Kodak Company Hydrolyzable fluorescent substrates and analytical determinations using same
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4849362A (en) 1988-05-19 1989-07-18 Smithkline Beckman Corporation Fluorescent intracellular calcium indicators
US4859582A (en) 1981-10-06 1989-08-22 The Board Of Trustees Of The Leland Stanford Jr. University Fluorescent conjugates for analysis of molecules and cells
US4925648A (en) 1988-07-29 1990-05-15 Immunomedics, Inc. Detection and treatment of infectious and inflammatory lesions
US4941880A (en) 1987-06-19 1990-07-17 Bioject, Inc. Pre-filled ampule and non-invasive hypodermic injection device assembly
US4945171A (en) 1987-08-10 1990-07-31 Molecular Probes, Inc. Xanthene dyes having a fused (C) benzo ring
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US4981977A (en) 1989-06-09 1991-01-01 Carnegie-Mellon University Intermediate for and fluorescent cyanine dyes containing carboxylic acid groups
US5055556A (en) 1981-10-06 1991-10-08 The Board Of Trustees Of The Leland Stanford Jr. Univ. Fluorescent conjugates for analysis of molecules and cells
US5064413A (en) 1989-11-09 1991-11-12 Bioject, Inc. Needleless hypodermic injection device
US5122464A (en) 1986-01-23 1992-06-16 Celltech Limited, A British Company Method for dominant selection in eucaryotic cells
US5132432A (en) 1989-09-22 1992-07-21 Molecular Probes, Inc. Chemically reactive pyrenyloxy sulfonic acid dyes
EP0494955A1 (en) 1989-10-05 1992-07-22 Optein, Inc. Cell-free synthesis and isolation of novel genes and polypeptides
WO1992020373A1 (en) 1991-05-14 1992-11-26 Repligen Corporation Heteroconjugate antibodies for treatment of hiv infection
WO1992022324A1 (en) 1991-06-14 1992-12-23 Xoma Corporation Microbially-produced antibody fragments and their conjugates
US5187288A (en) 1991-05-22 1993-02-16 Molecular Probes, Inc. Ethenyl-substituted dipyrrometheneboron difluoride dyes and their synthesis
US5196306A (en) 1989-03-29 1993-03-23 E. I. Du Pont De Nemours And Company Method for the detection or quantitation of an analyte using an analyte dependent enzyme activation system
US5208148A (en) 1990-12-07 1993-05-04 Molecular Probes, Inc. Lipophilic fluorescent glycosidase substrates
WO1993008829A1 (en) 1991-11-04 1993-05-13 The Regents Of The University Of California Compositions that mediate killing of hiv-infected cells
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US5227487A (en) 1990-04-16 1993-07-13 Molecular Probes, Inc. Certain tricyclic and pentacyclic-hetero nitrogen rhodol dyes
US5229275A (en) 1990-04-26 1993-07-20 Akzo N.V. In-vitro method for producing antigen-specific human monoclonal antibodies
US5242805A (en) 1991-08-23 1993-09-07 Molecular Probes, Inc. Long wavelength lipophilic fluorogenic glycosidase substrates
US5248782A (en) 1990-12-18 1993-09-28 Molecular Probes, Inc. Long wavelength heteroaryl-substituted dipyrrometheneboron difluoride dyes
WO1993021232A1 (en) 1992-04-10 1993-10-28 Research Development Foundation IMMUNOTOXINS DIRECTED AGAINST c-erbB-2 (HER-2/neu) RELATED SURFACE ANTIGENS
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US5268486A (en) 1986-04-18 1993-12-07 Carnegie-Mellon Unversity Method for labeling and detecting materials employing arylsulfonate cyanine dyes
US5274113A (en) 1991-11-01 1993-12-28 Molecular Probes, Inc. Long wavelength chemically reactive dipyrrometheneboron difluoride dyes and conjugates
WO1994004690A1 (en) 1992-08-17 1994-03-03 Genentech, Inc. Bispecific immunoadhesins
US5312335A (en) 1989-11-09 1994-05-17 Bioject Inc. Needleless hypodermic injection device
US5316906A (en) 1991-08-23 1994-05-31 Molecular Probes, Inc. Enzymatic analysis using substrates that yield fluorescent precipitates
US5362628A (en) 1991-08-23 1994-11-08 Molecular Probes, Inc. Fluorescent haloalkyl derivatives of reporter molecules well retained in cells
US5374548A (en) 1986-05-02 1994-12-20 Genentech, Inc. Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor
WO1994029351A2 (en) 1993-06-16 1994-12-22 Celltech Limited Antibodies
US5383851A (en) 1992-07-24 1995-01-24 Bioject Inc. Needleless hypodermic injection device
US5399331A (en) 1985-06-26 1995-03-21 The Liposome Company, Inc. Method for protein-liposome coupling
US5416016A (en) 1989-04-03 1995-05-16 Purdue Research Foundation Method for enhancing transmembrane transport of exogenous molecules
US5433896A (en) 1994-05-20 1995-07-18 Molecular Probes, Inc. Dibenzopyrrometheneboron difluoride dyes
US5451343A (en) 1991-05-20 1995-09-19 Spectra Group Limited, Inc. Fluorone and pyronin y derivatives
US5455030A (en) 1986-09-02 1995-10-03 Enzon Labs, Inc. Immunotheraphy using single chain polypeptide binding molecules
US5459276A (en) 1994-05-20 1995-10-17 Molecular Probes, Inc. Benzazolylcoumarin-based ion indicators for heavy metals
US5501980A (en) 1994-05-20 1996-03-26 Molecular Probes, Inc. Benzazolylcoumarin-based ion indicators
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5545807A (en) 1988-10-12 1996-08-13 The Babraham Institute Production of antibodies from transgenic animals
US5565332A (en) 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5567610A (en) 1986-09-04 1996-10-22 Bioinvent International Ab Method of producing human monoclonal antibodies and kit therefor
US5569587A (en) 1986-04-18 1996-10-29 Carnegie Mellon University Method for labeling and detecting materials employing luminescent arysulfonate cyanine dyes
US5569825A (en) 1990-08-29 1996-10-29 Genpharm International Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5573905A (en) 1992-03-30 1996-11-12 The Scripps Research Institute Encoded combinatorial chemical libraries
US5573920A (en) 1991-04-26 1996-11-12 Surface Active Limited Antibodies, and methods for their use
US5576424A (en) 1991-08-23 1996-11-19 Molecular Probes, Inc. Haloalkyl derivatives of reporter molecules used to analyze metabolic activity in cells
US5585089A (en) 1988-12-28 1996-12-17 Protein Design Labs, Inc. Humanized immunoglobulins
US5591828A (en) 1989-06-22 1997-01-07 Behringwerke Aktiengesellschaft Bispecific and oligospecific mono-and oligovalent receptors, the preparation and use thereof
US5591639A (en) 1987-07-23 1997-01-07 Celltech Ltd Recombinant DNA expression vectors
US5591669A (en) 1988-12-05 1997-01-07 Genpharm International, Inc. Transgenic mice depleted in a mature lymphocytic cell-type
US5601819A (en) 1988-08-11 1997-02-11 The General Hospital Corporation Bispecific antibodies for selective immune regulation and for selective immune cell binding
US5605793A (en) 1994-02-17 1997-02-25 Affymax Technologies N.V. Methods for in vitro recombination
US5607400A (en) 1995-05-19 1997-03-04 Becton, Dickinson And Company Pre-fillable syringe and stopper assembly therefor
US5612205A (en) 1990-08-29 1997-03-18 Genpharm International, Incorporated Homologous recombination in mammalian cells
US5625126A (en) 1990-08-29 1997-04-29 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5624821A (en) 1987-03-18 1997-04-29 Scotgen Biopharmaceuticals Incorporated Antibodies with altered effector functions
US5625825A (en) 1993-10-21 1997-04-29 Lsi Logic Corporation Random number generating apparatus for an interface unit of a carrier sense with multiple access and collision detect (CSMA/CD) ethernet data network
US5627027A (en) 1986-04-18 1997-05-06 Carnegie Mellon University Cyanine dyes as labeling reagents for detection of biological and other materials by luminescence methods
WO1997017852A1 (en) 1995-11-15 1997-05-22 Hoechst Schering Agrevo Gmbh Synergetic herbicidal mixtures
US5633425A (en) 1990-08-29 1997-05-27 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5639641A (en) 1992-09-09 1997-06-17 Immunogen Inc. Resurfacing of rodent antibodies
US5641870A (en) 1995-04-20 1997-06-24 Genentech, Inc. Low pH hydrophobic interaction chromatography for antibody purification
US5643763A (en) 1994-11-04 1997-07-01 Genpharm International, Inc. Method for making recombinant yeast artificial chromosomes by minimizing diploid doubling during mating
US5660827A (en) 1992-03-05 1997-08-26 Board Of Regents, The University Of Texas System Antibodies that bind to endoglin
US5661016A (en) 1990-08-29 1997-08-26 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5677425A (en) 1987-09-04 1997-10-14 Celltech Therapeutics Limited Recombinant antibody
WO1997040104A1 (en) 1996-04-19 1997-10-30 Amersham Pharmacia Biotech Uk Limited Squarate dyes and their use in fluorescent sequencing method
US5693780A (en) 1991-07-25 1997-12-02 Idec Pharmaceuticals Corporation Recombinant antibodies for human therapy
US5696157A (en) 1996-11-15 1997-12-09 Molecular Probes, Inc. Sulfonated derivatives of 7-aminocoumarin
US5714350A (en) 1992-03-09 1998-02-03 Protein Design Labs, Inc. Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region
US5731168A (en) 1995-03-01 1998-03-24 Genentech, Inc. Method for making heteromultimeric polypeptides
US5739277A (en) 1995-04-14 1998-04-14 Genentech Inc. Altered polypeptides with increased half-life
US5770429A (en) 1990-08-29 1998-06-23 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5773236A (en) 1997-04-25 1998-06-30 Molecule Probes, Inc. Assay for glutathiane transferase using polyhaloaryl-substituted reporter molecules
US5789650A (en) 1990-08-29 1998-08-04 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5789215A (en) 1991-08-20 1998-08-04 Genpharm International Gene targeting in animal cells using isogenic DNA constructs
US5798276A (en) 1995-06-07 1998-08-25 Molecular Probes, Inc. Reactive derivatives of sulforhodamine 101 with enhanced hydrolytic stability
US5808044A (en) 1993-01-22 1998-09-15 Pharmacia Biotech Inc. Indocarbocyanine and benzindocarbocyanine phosphoramidites
US5811267A (en) 1990-10-29 1998-09-22 Chiron Corporation Isolated nucleic acid molecules encoding antigen binding sites of antibody molecules specific for cancer antigens
US5814318A (en) 1990-08-29 1998-09-29 Genpharm International Inc. Transgenic non-human animals for producing heterologous antibodies
US5830912A (en) 1996-11-15 1998-11-03 Molecular Probes, Inc. Derivatives of 6,8-difluoro-7-hydroxycoumarin
US5834252A (en) 1995-04-18 1998-11-10 Glaxo Group Limited End-complementary polymerase reaction
US5837458A (en) 1994-02-17 1998-11-17 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US5846737A (en) 1996-07-26 1998-12-08 Molecular Probes, Inc. Conjugates of sulforhodamine fluorophores with enhanced fluorescence
US5849877A (en) 1990-10-29 1998-12-15 Chiron Corporation Antigen-binding sites of antibody molecules specific for cancer antigens
US5869620A (en) 1986-09-02 1999-02-09 Enzon, Inc. Multivalent antigen-binding proteins
US5869046A (en) 1995-04-14 1999-02-09 Genentech, Inc. Altered polypeptides with increased half-life
US5874299A (en) 1990-08-29 1999-02-23 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5877397A (en) 1990-08-29 1999-03-02 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5877310A (en) 1997-04-25 1999-03-02 Carnegie Mellon University Glycoconjugated fluorescent labeling reagents
US5885573A (en) 1993-06-01 1999-03-23 Arch Development Corporation Methods and materials for modulation of the immunosuppressive activity and toxicity of monoclonal antibodies
US5885793A (en) 1991-12-02 1999-03-23 Medical Research Council Production of anti-self antibodies from antibody segment repertoires and displayed on phage
US5893842A (en) 1993-02-05 1999-04-13 Becton, Dickinson And Company Syringe needle isolation device
US5897861A (en) 1989-06-29 1999-04-27 Medarex, Inc. Bispecific reagents for AIDS therapy
US5899889A (en) 1995-12-26 1999-05-04 Nissho Corporation Prefilled syringe
US5939598A (en) 1990-01-12 1999-08-17 Abgenix, Inc. Method of making transgenic mice lacking endogenous heavy chains
US5948647A (en) 1990-10-29 1999-09-07 Chiron Corporation Nucleic acids encoding antigen-binding sites specific for cancer antigens
WO1999045985A1 (en) 1998-03-13 1999-09-16 Becton Dickinson And Company Method for assembling and packaging medical devices
US5959084A (en) 1990-10-29 1999-09-28 Chiron Corporation Bispecific antibodies, methods of production and uses thereof
WO1999051702A1 (en) 1998-04-08 1999-10-14 Terpetschnig Ewald A Luminescent compounds
US5969108A (en) 1990-07-10 1999-10-19 Medical Research Council Methods for producing members of specific binding pairs
US5981175A (en) 1993-01-07 1999-11-09 Genpharm Internation, Inc. Methods for producing recombinant mammalian cells harboring a yeast artificial chromosome
US5981216A (en) 1985-04-01 1999-11-09 Alusuisse Holdings A.G. Transformed myeloma cell-line and a process for the expression of a gene coding for a eukaryotic polypeptide employing same
WO1999058572A1 (en) 1998-05-08 1999-11-18 Cambridge University Technical Services Limited Binding molecules derived from immunoglobulins which do not trigger complement mediated lysis
US5989227A (en) 1997-11-11 1999-11-23 Arzneimittel Gmbh Apotheker Vetter & Co. Prefilled syringe with sterility-preserving cap
US6002003A (en) 1998-04-14 1999-12-14 Beckman Instruments, Inc. Cyanine dye activating group with improved coupling selectivity
US6004536A (en) 1995-11-14 1999-12-21 Molecular Probes, Inc. Lipophilic cyanine dyes with enchanced aqueous solubilty
US6008373A (en) 1995-06-07 1999-12-28 Carnegie Mellon University Fluorescent labeling complexes with large stokes shift formed by coupling together cyanine and other fluorochromes capable of resonance energy transfer
US6043025A (en) 1995-04-20 2000-03-28 Carnegie Mellon University Difference gel electrophoresis using matched multiple dyes
US6075181A (en) 1990-01-12 2000-06-13 Abgenix, Inc. Human antibodies derived from immunized xenomice
US6121022A (en) 1995-04-14 2000-09-19 Genentech, Inc. Altered polypeptides with increased half-life
US6130101A (en) 1997-09-23 2000-10-10 Molecular Probes, Inc. Sulfonated xanthene derivatives
US6133445A (en) 1997-12-17 2000-10-17 Carnegie Mellon University Rigidized trimethine cyanine dyes
US6143574A (en) 1995-11-14 2000-11-07 Biacore Ab Method of determining affinity or kinetic properties in solution
US6142976A (en) 1996-12-13 2000-11-07 Nissho Corporation Prefilled syringe
US6150584A (en) 1990-01-12 2000-11-21 Abgenix, Inc. Human antibodies derived from immunized xenomice
US6162963A (en) 1990-01-12 2000-12-19 Abgenix, Inc. Generation of Xenogenetic antibodies
US6162931A (en) 1996-04-12 2000-12-19 Molecular Probes, Inc. Fluorinated xanthene derivatives
US6165745A (en) 1992-04-24 2000-12-26 Board Of Regents, The University Of Texas System Recombinant production of immunoglobulin-like domains in prokaryotic cells
EP1065250A1 (en) 1999-07-02 2001-01-03 Innosense S.r.l. New fluorescent cyanine labels containing a sulfamido linker arm
US6172197B1 (en) 1991-07-10 2001-01-09 Medical Research Council Methods for producing members of specific binding pairs
US6180377B1 (en) 1993-06-16 2001-01-30 Celltech Therapeutics Limited Humanized antibodies
US6194551B1 (en) 1998-04-02 2001-02-27 Genentech, Inc. Polypeptide variants
WO2001021624A1 (en) 1999-09-20 2001-03-29 Fuji Photo Film Co., Ltd. Compounds for fluorescence labeling
US6248516B1 (en) 1988-11-11 2001-06-19 Medical Research Council Single domain ligands, receptors comprising said ligands methods for their production, and use of said ligands and receptors
US6255458B1 (en) 1990-08-29 2001-07-03 Genpharm International High affinity human antibodies and human antibodies against digoxin
US6277375B1 (en) 1997-03-03 2001-08-21 Board Of Regents, The University Of Texas System Immunoglobulin-like domains with increased half-lives
WO2001066754A1 (en) 2000-03-03 2001-09-13 Cambridge Antibody Technology Limited Human antibodies against eotaxin and their use
US6291158B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertoire
US6291161B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertiore
US6291160B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for producing polymers having a preselected activity
US6291159B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for producing polymers having a preselected activity
US6294391B1 (en) 1996-05-23 2001-09-25 Unilever Patent Holdings B.V. Specific binding assays
US6339392B1 (en) 1999-01-13 2002-01-15 Honda Giken Kogyo Kabushiki Kaisha Gate for radar-mounted vehicle, having partition walls not grouped or detected by radar apparatus
WO2002026891A1 (en) 2000-09-29 2002-04-04 Molecular Probes, Inc. Modified carbocyanine dyes and their conjugates
WO2002056910A1 (en) 2001-01-17 2002-07-25 Trubion Pharmaceuticals, Inc. Binding domain-immunoglobulin fusion proteins
US20020147311A1 (en) 2000-02-11 2002-10-10 Gillies Stephen D. Enhancing the circulating half-life of antibody-based fusion proteins
US20030003097A1 (en) 2001-04-02 2003-01-02 Idec Pharmaceutical Corporation Recombinant antibodies coexpressed with GnTIII
WO2003002609A2 (en) 2001-06-28 2003-01-09 Domantis Limited Dual-specific ligand and its use
US6528624B1 (en) 1998-04-02 2003-03-04 Genentech, Inc. Polypeptide variants
US6548640B1 (en) 1986-03-27 2003-04-15 Btg International Limited Altered antibodies
WO2003035696A2 (en) 2001-07-19 2003-05-01 Perlan Therapeutics, Inc. Humanized antibodies against icam-1, their production and uses
US20030118592A1 (en) 2001-01-17 2003-06-26 Genecraft, Inc. Binding domain-immunoglobulin fusion proteins
US6602684B1 (en) 1998-04-20 2003-08-05 Glycart Biotechnology Ag Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity
US20030157108A1 (en) 2001-10-25 2003-08-21 Genentech, Inc. Glycoprotein compositions
WO2003074679A2 (en) 2002-03-01 2003-09-12 Xencor Antibody optimization
WO2003077976A1 (en) 2002-03-15 2003-09-25 Nippon Becton Dickinson Company, Ltd. Prefilled syringe with plunger backward movement limiting mechanism
US6632976B1 (en) 1995-08-29 2003-10-14 Kirin Beer Kabushiki Kaisha Chimeric mice that are produced by microcell mediated chromosome transfer and that retain a human antibody gene
US6632926B1 (en) 1998-11-18 2003-10-14 Genentech, Inc. Antibody variants
US6657103B1 (en) 1990-01-12 2003-12-02 Abgenix, Inc. Human antibodies derived from immunized xenomice
US20040002587A1 (en) 2002-02-20 2004-01-01 Watkins Jeffry D. Fc region variants
WO2004003019A2 (en) 2002-06-28 2004-01-08 Domantis Limited Immunoglobin single variant antigen-binding domains and dual-specific constructs
US20040010810A1 (en) 1990-01-12 2004-01-15 Abgenix, Inc. Generation of xenogeneic antibodies
US6680192B1 (en) 1989-05-16 2004-01-20 Scripps Research Institute Method for producing polymers having a preselected activity
US6685940B2 (en) 1995-07-27 2004-02-03 Genentech, Inc. Protein formulation
US6696245B2 (en) 1997-10-20 2004-02-24 Domantis Limited Methods for selecting functional polypeptides
US20040042972A1 (en) 2002-04-11 2004-03-04 Medimmune Vaccines, Inc. Spray freeze dry of compositions for intranasal administration
US20040042971A1 (en) 2002-04-11 2004-03-04 Medimmune Vaccines, Inc. Spray freeze dry of compositions for pulmonary administration
US6713610B1 (en) 1990-01-12 2004-03-30 Raju Kucherlapati Human antibodies derived from immunized xenomice
WO2004029207A2 (en) 2002-09-27 2004-04-08 Xencor Inc. Optimized fc variants and methods for their generation
US6737056B1 (en) 1999-01-15 2004-05-18 Genentech, Inc. Polypeptide variants with altered effector function
US20040132101A1 (en) 2002-09-27 2004-07-08 Xencor Optimized Fc variants and methods for their generation
WO2004058821A2 (en) 2002-12-27 2004-07-15 Domantis Limited Dual specific single domain antibodies specific for a ligand and for the receptor of the ligand
WO2004081026A2 (en) 2003-06-30 2004-09-23 Domantis Limited Polypeptides
US6797492B2 (en) 1991-05-17 2004-09-28 Merck & Co., Inc. Method for reducing the immunogenicity of antibody variable domains
US6806079B1 (en) 1990-07-10 2004-10-19 Medical Research Council Methods for producing members of specific binding pairs
US6807797B2 (en) 1997-09-23 2004-10-26 Pharmacia Ab Prefilled ampoules and manufacture thereof
US20040253238A1 (en) 2003-02-25 2004-12-16 Bjarne Bogen Modified antibody
US6833268B1 (en) 1999-06-10 2004-12-21 Abgenix, Inc. Transgenic animals for producing specific isotypes of human antibodies via non-cognate switch regions
US20040267194A1 (en) 2003-01-28 2004-12-30 Minoru Sano Prefilled syringe and production method for a barrel thereof
US6849425B1 (en) 1999-10-14 2005-02-01 Ixsys, Inc. Methods of optimizing antibody variable region binding affinity
US20050075611A1 (en) 2003-10-01 2005-04-07 Hetzler Kevin G. Low extractable, thermoplastic syringe and tip cap
US6946292B2 (en) 2000-10-06 2005-09-20 Kyowa Hakko Kogyo Co., Ltd. Cells producing antibody compositions with increased antibody dependent cytotoxic activity
US20050215768A1 (en) 2003-10-17 2005-09-29 Armour Kathryn L Polypeptides including modified constant regions
US20060008883A1 (en) 2003-12-04 2006-01-12 Xencor, Inc. Methods of generating variant proteins with increased host string content and compositions thereof
US20060024298A1 (en) 2002-09-27 2006-02-02 Xencor, Inc. Optimized Fc variants
US7041087B2 (en) 2000-04-03 2006-05-09 Astrazeneca Uk Limited Pre-filled syringe
US20060129108A1 (en) 2002-11-21 2006-06-15 Arzneimittel Gmbh Prefilled syringe
US7064191B2 (en) 2000-10-06 2006-06-20 Kyowa Hakko Kogyo Co., Ltd. Process for purifying antibody
US20060134105A1 (en) 2004-10-21 2006-06-22 Xencor, Inc. IgG immunoglobulin variants with optimized effector function
US7081107B2 (en) 2002-07-02 2006-07-25 Terumo Kabushiki Kaisha Syringe and prefilled syringe
US7083784B2 (en) 2000-12-12 2006-08-01 Medimmune, Inc. Molecules with extended half-lives, compositions and uses thereof
US20060173170A1 (en) 2004-11-12 2006-08-03 Xencor, Inc. Fc variants with altered binding to FcRn
US20060235208A1 (en) 2002-09-27 2006-10-19 Xencor, Inc. Fc variants with optimized properties
US7135180B2 (en) 2002-04-11 2006-11-14 Medimmune Vaccines, Inc. Preservation of bioactive materials by freeze dried foam
WO2007005786A2 (en) 2005-06-30 2007-01-11 Centocor, Inc. Methods and compositions with enhanced therapeutic activity
US7183387B1 (en) 1999-01-15 2007-02-27 Genentech, Inc. Polypeptide variants with altered effector function
US20070092487A1 (en) 2003-05-13 2007-04-26 Ares Trading S.A. Stabilized liquid protein formulations in pharmaceutical containers
US7214775B2 (en) 1999-04-09 2007-05-08 Kyowa Hakko Kogyo Co., Ltd. Method of modulating the activity of functional immune molecules
US7217797B2 (en) 2002-10-15 2007-05-15 Pdl Biopharma, Inc. Alteration of FcRn binding affinities or serum half-lives of antibodies by mutagenesis
US20070135620A1 (en) 2004-11-12 2007-06-14 Xencor, Inc. Fc variants with altered binding to FcRn
US20070161961A1 (en) 2006-01-12 2007-07-12 Mitsuru Hasegawa Pre-filled syringe
US7258873B2 (en) 2002-04-11 2007-08-21 Medimmune Vaccines, Inc. Preservation of bioactive materials by spray drying
US20070224188A1 (en) 2004-08-04 2007-09-27 Barrett Allan Variant Fc Regions
US7276585B2 (en) 2004-03-24 2007-10-02 Xencor, Inc. Immunoglobulin variants outside the Fc region
US7317091B2 (en) 2002-03-01 2008-01-08 Xencor, Inc. Optimized Fc variants
US7326681B2 (en) 2000-06-28 2008-02-05 Glycofi, Inc. Methods for producing modified glycoproteins
US20080066200A1 (en) 2006-01-17 2008-03-13 Biolex, Inc. Compositions and methods for humanization and optimization of n-glycans in plants
US7355008B2 (en) 2003-01-09 2008-04-08 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
US20080089892A1 (en) 2004-01-12 2008-04-17 Eli Lilly And Co. Fc Region Variants
US7371826B2 (en) 1999-01-15 2008-05-13 Genentech, Inc. Polypeptide variants with altered effector function
US7378110B2 (en) 2002-12-17 2008-05-27 Med Immune Vaccines, Inc. High pressure spray-dry of bioactive materials
WO2008094984A2 (en) 2007-01-31 2008-08-07 West Pharmaceutical Services, Inc. Automatic injection and retraction devices for use with pre-filled syringe cartridges
WO2008142124A1 (en) 2007-05-21 2008-11-27 Vivalis Recombinant protein production in avian ebx® cells
US20090004179A1 (en) 2005-11-07 2009-01-01 The Rockefeller University Polypeptides with enhanced anti-inflammatory and decreased cytotoxic properties and relating methods
US20090010921A1 (en) 2003-11-05 2009-01-08 Glycart Biotechnology Ag Antigen binding molecules with increased Fc receptor binding affinity and effector function
US7504256B1 (en) 1999-10-19 2009-03-17 Kyowa Hakko Kogyo Co., Ltd. Process for producing polypeptide
WO2009058492A2 (en) 2007-10-31 2009-05-07 Xencor, Inc Fc variants with altered binding to fcrn
US7658921B2 (en) 2000-12-12 2010-02-09 Medimmune, Llc Molecules with extended half-lives, compositions and uses thereof

Patent Citations (282)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6180377B2 (en)
US4384042A (en) 1980-07-30 1983-05-17 Kyowa Hakko Kogyo Co., Ltd. Method and test composition for determination of hydrogen peroxide
US4475196A (en) 1981-03-06 1984-10-02 Zor Clair G Instrument for locating faults in aircraft passenger reading light and attendant call control system
US4447233A (en) 1981-04-10 1984-05-08 Parker-Hannifin Corporation Medication infusion pump
US4474893A (en) 1981-07-01 1984-10-02 The University of Texas System Cancer Center Recombinant monoclonal antibodies
US4714681A (en) 1981-07-01 1987-12-22 The Board Of Reagents, The University Of Texas System Cancer Center Quadroma cells and trioma cells and methods for the production of same
US4520110A (en) 1981-10-06 1985-05-28 The Board Of Trustees Of The Leland Stanford Junior University Fluorescent immunoassay employing a phycobiliprotein labeled ligand or receptor
US4859582A (en) 1981-10-06 1989-08-22 The Board Of Trustees Of The Leland Stanford Jr. University Fluorescent conjugates for analysis of molecules and cells
US5055556A (en) 1981-10-06 1991-10-08 The Board Of Trustees Of The Leland Stanford Jr. Univ. Fluorescent conjugates for analysis of molecules and cells
US4439196A (en) 1982-03-18 1984-03-27 Merck & Co., Inc. Osmotic drug delivery system
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4447224A (en) 1982-09-20 1984-05-08 Infusaid Corporation Variable flow implantable infusion apparatus
US4487603A (en) 1982-11-26 1984-12-11 Cordis Corporation Implantable microinfusion pump system
US4542104A (en) 1983-04-06 1985-09-17 The Board Of Trustees Of The Leland Stanford Jr. Univ. Phycobiliprotein fluorescent conjugates
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4486194A (en) 1983-06-08 1984-12-04 James Ferrara Therapeutic device for administering medicaments through the skin
US4603209A (en) 1984-09-07 1986-07-29 The Regents Of The University Of California Fluorescent indicator dyes for calcium ions
US4596556A (en) 1985-03-25 1986-06-24 Bioject, Inc. Hypodermic injection apparatus
US5981216A (en) 1985-04-01 1999-11-09 Alusuisse Holdings A.G. Transformed myeloma cell-line and a process for the expression of a gene coding for a eukaryotic polypeptide employing same
US5399331A (en) 1985-06-26 1995-03-21 The Liposome Company, Inc. Method for protein-liposome coupling
US4714763A (en) 1985-07-11 1987-12-22 Viomedics Inc. Novel oxazine-ureas and thiazine urea chromophors as fluorescent labels
US4676980A (en) 1985-09-23 1987-06-30 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Target specific cross-linked heteroantibodies
US5122464A (en) 1986-01-23 1992-06-16 Celltech Limited, A British Company Method for dominant selection in eucaryotic cells
US4812409A (en) 1986-01-31 1989-03-14 Eastman Kodak Company Hydrolyzable fluorescent substrates and analytical determinations using same
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US6548640B1 (en) 1986-03-27 2003-04-15 Btg International Limited Altered antibodies
US5268486A (en) 1986-04-18 1993-12-07 Carnegie-Mellon Unversity Method for labeling and detecting materials employing arylsulfonate cyanine dyes
US5627027A (en) 1986-04-18 1997-05-06 Carnegie Mellon University Cyanine dyes as labeling reagents for detection of biological and other materials by luminescence methods
US5569587A (en) 1986-04-18 1996-10-29 Carnegie Mellon University Method for labeling and detecting materials employing luminescent arysulfonate cyanine dyes
US5569766A (en) 1986-04-18 1996-10-29 Carnegie Mellon University Method for labeling and detecting materials employing arylsulfonate cyanine dyes
US5486616A (en) 1986-04-18 1996-01-23 Carnegie Mellon University Method for labeling and detecting materials employing arylsulfonate cyanine dyes
US5374548A (en) 1986-05-02 1994-12-20 Genentech, Inc. Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor
US5869620A (en) 1986-09-02 1999-02-09 Enzon, Inc. Multivalent antigen-binding proteins
US5455030A (en) 1986-09-02 1995-10-03 Enzon Labs, Inc. Immunotheraphy using single chain polypeptide binding molecules
US5567610A (en) 1986-09-04 1996-10-22 Bioinvent International Ab Method of producing human monoclonal antibodies and kit therefor
US4810636A (en) 1986-12-09 1989-03-07 Miles Inc. Chromogenic acridinone enzyme substrates
US5648260A (en) 1987-03-18 1997-07-15 Scotgen Biopharmaceuticals Incorporated DNA encoding antibodies with altered effector functions
US5624821A (en) 1987-03-18 1997-04-29 Scotgen Biopharmaceuticals Incorporated Antibodies with altered effector functions
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US4790824A (en) 1987-06-19 1988-12-13 Bioject, Inc. Non-invasive hypodermic injection device
US4941880A (en) 1987-06-19 1990-07-17 Bioject, Inc. Pre-filled ampule and non-invasive hypodermic injection device assembly
US5658759A (en) 1987-07-23 1997-08-19 Celltech Limited Recombinant DNA expression vectors
US5591639A (en) 1987-07-23 1997-01-07 Celltech Ltd Recombinant DNA expression vectors
US4945171A (en) 1987-08-10 1990-07-31 Molecular Probes, Inc. Xanthene dyes having a fused (C) benzo ring
US4774339A (en) 1987-08-10 1988-09-27 Molecular Probes, Inc. Chemically reactive dipyrrometheneboron difluoride dyes
US5677425A (en) 1987-09-04 1997-10-14 Celltech Therapeutics Limited Recombinant antibody
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US4849362A (en) 1988-05-19 1989-07-18 Smithkline Beckman Corporation