Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
  • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
  • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
  • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
  • C12N9/6489—Metalloendopeptidases (3.4.24)
  • C12N9/6491—Matrix metalloproteases [MMP's], e.g. interstitial collagenase (3.4.24.7); Stromelysins (3.4.24.17; 3.2.1.22); Matrilysin (3.4.24.23)
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P11/00—Drugs for disorders of the respiratory system
  • A61P11/06—Antiasthmatics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P19/00—Drugs for skeletal disorders
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P19/00—Drugs for skeletal disorders
  • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P3/00—Drugs for disorders of the metabolism
  • A61P3/04—Anorexiants; Antiobesity agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/04—Antibacterial agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
  • A61P31/14—Antivirals for RNA viruses
  • A61P31/18—Antivirals for RNA viruses for HIV
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
  • A61P35/02—Antineoplastic agents specific for leukemia
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/02—Immunomodulators
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
  • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
  • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
  • A61P7/06—Antianaemics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
  • A61P7/08—Plasma substitutes; Perfusion solutions; Dialytics or haemodialytics; Drugs for electrolytic or acid-base disorders, e.g. hypovolemic shock
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/475—Growth factors; Growth regulators
  • C07K14/505—Erythropoietin [EPO]
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/52—Cytokines; Lymphokines; Interferons
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/52—Cytokines; Lymphokines; Interferons
  • C07K14/524—Thrombopoietin, i.e. C-MPL ligand
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/52—Cytokines; Lymphokines; Interferons
  • C07K14/525—Tumour necrosis factor [TNF]
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/52—Cytokines; Lymphokines; Interferons
  • C07K14/54—Interleukins [IL]
  • C07K14/545—IL-1
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/81—Protease inhibitors
  • C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
  • C07K14/8146—Metalloprotease (E.C. 3.4.24) inhibitors, e.g. tissue inhibitor of metallo proteinase, TIMP
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
  • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto

Definitions

• Recombinant proteins are an emerging class of therapeutic agents. Such recombinant therapeutics have engendered advances in protein formulation and chemical modification. Such modifications can protect therapeutic proteins, primarily by blocking their exposure to proteolytic enzymes. Protein modifications may also increase the therapeutic protein's stability, circulation time, and biological activity.
• a review article describing protein modification and fusion proteins is Francis (1992), Focus on Growth Factors 3:4-10 (Mediscript, London), which is hereby incorporated by reference.
• Antibodies comprise two functionally independent parts, a variable domain known as “Fab”, which binds antigen, and a constant domain known as “Fc”, which links to such effector functions as complement activation and attack by phagocytic cells.
• Fab variable domain
• Fc constant domain
• An Fc has a long serum half-life, whereas an Fab is short-lived.
• an Fc domain can provide longer half-life or incorporate such functions as Fc receptor binding, protein A binding, complement fixation and perhaps even placental transfer. Id.
• Table 1 summarizes use of Fc fusions known in the art. Table 1 — Fc fusion with therapeutic proteins
• Murine Fc ⁇ 2a IL-10 anti-inflammatory Zheng et al. (1995), J. transplant rejection Immunol. 154: 5590-600 igGi TNF receptor septic shock Fisher et al. (1996), N. Engl. J. Med. 334: 1697- 1702; Van Zee, K. et al. .1996.. J. Immunol. 156: 2221-30
• Such peptides may mimic the bioactivity of the large protein ligand ("peptide agonists") or, through competitive binding, inhibit the bioactivity of the large protein ligand ("peptide antagonists").
• Phage display peptide libraries have emerged as a powerful method in identifying such peptide agonists and antagonists. See, for example, Scott et al. (1990), Science 249: 386; Devlin etal. (1990), Science 249: 404; U.S. Pat. No. 5,223,409, issued June 29, 1993; U.S. Pat. No. 5,733,731, issued March 31, 1998; U.S. Pat. No. 5,498,530, issued March 12, 1996; U.S. Pat. No. 5,432,018, issued July 11, 1995; U.S.
• Structural analysis of protein-protein interaction may also be used to suggest peptides that mimic the binding activity of large protein ligands.
• the crystal structure may suggest the identity and relative orientation of critical residues of the large protein ligand, from which a peptide may be designed. See, e.g., Takasaki et al. (1997), Nature Biotech. 15: 1266-70.
• These analytical methods may-also.be used to , investigate the interaction between a receptor protein and peptides selected by phage display, which may suggest further modification of the peptides to increase binding affinity.
• E. coli display In another method, translation of random RNA is halted prior to ribosome release, resulting in a library of polypeptides with their associated RNA still attached.
• PAL peptidoglycan-associated lipoprotein
• ribosome display this and related methods are collectively referred to as "ribosome display.”
• Other methods employ chemical linkage of peptides to RNA; see, for example, Roberts & Szostak (1997), Proc. Natl. Acad. Sci. USA, 94: 12297- 303.
• RNA-peptide screening Chemically derived peptide libraries have been developed in which peptides are immobilized on stable, non-biological materials, such as polyethylene rods or solvent-permeable resins.
• Another chemically derived peptide library uses photolithography to scan peptides immobilized on glass slides.
• Chemical-peptide screening may be advantageous in that it allows use of D-amino acids and other unnatural analogues, as well as non-peptide elements. Both biological and chemical methods are reviewed in Wells & Lowman (1992), Curr. Opin. Biotechnol. 3: 355-62. Conceptually, one may discover peptide mimetics of any protein using phage display and the other methods mentioned above. These methods have been used for epitope mapping, for identification of critical . amino acids in protein-protein interactions, and as leads for the discovery of new therapeutic agents. E.g., Cortese et al. (1996), Curr. Opin. Biotech. 7: ⁇ 616-21. Peptide libraries are now being used most often in immunological studies, such as epitope mapping. Kreeger (1996), The Principle 10(13): 19- 20.
• G-CSF-mimetic Phvsiol. Chem. 365: 303- 11 ; Laerum eLal. (1988), Exp. Hemat. 16: 274-80 alkylene- G-CSF-mimetic Bhatnagar elal- (1996), linked dimer J. Med. Chem. 39: 3814- 9; Cuthbertson et al. (1997.. J. Med. Chem. 40: 2876-82; King et al. (1991 .. Exp. Hematol. 19:481 ; King elal. (1995), Blood 86 (Suppl. 1): 309a linear IL-1 receptor inflammatory and U.S. Pat. No. 5,608,035; autoimmune diseases U.S. Pat. No. 5,786,331 ;
• IL-1 antagonist or U.S ⁇ Pat. No. 5,880,096;
• the protein listed in this column may be bound by the associated peptide (e.g., EPO receptor, IL-1 receptor) or mimicked by the associated peptide.
• the references listed for each clarify whether the molecule is bound by or mimicked by the peptides. Proc. Natl. Acad. Sci. 93:
• PNAs 93:7381 -7386.
• C3b-antagonist Protein Sci. 7: 619-27 linear vinculin cell adhesion processes — Adey elal. (1997), cell growth, differentiation, Biochem. J. 324: 523-8 wound healing, tumor metastasis ("vinculin binding") linear C4 binding anti-thrombotic Linse elal- (1997), _L protein (C4BP) Biol. Chem. 272: 14658- 65 linear urokinase processes associated with Goodson elal- (1994), receptor urokinase interaction with Proc. Natl. Acad. Sci.
• b FTS is a thymic hormone mimicked by the molecule of this invention rather than a receptor bound by the molecule of this invention.
• VEGF antagonist cyclic MMP inflammation and Koivunen (1999), Nature autoimmune disorders; Biotech.. 17:768-774. tumor growth
• Peptides identified by peptide library screening have been regarded as "leads" in development of therapeutic agents rather than as therapeutic agents themselves. Like other proteins and peptides, they would be rapidly removed in vivo either by renal filtration, cellular clearance mechanisms in the reticuloendothelial system, or proteolytic degradation. Francis (1992), Focus on Growth Factors 3: 4-11. As a result, the art presently uses the identified peptides to validate drug targets or as scaffolds for design of organic compounds that might not have been as easily or as quickly identified through chemical library screening.
• the present invention concerns a process by which the in vivo half- life of one or more biologically active peptides is increased by fusion with a vehicle.
• pharmacologically active compounds are prepared by a process comprising: a) selecting at least one peptide that modulates the activity of a protein of interest; and b) preparing a pharmacologic agent comprising at least one vehicle covalently linked to at least one amino acid sequence of the selected peptide.
• the preferred vehicle is an Fc domain.
• the peptides screened in step (a) are preferably expressed in a phage display library.
• the vehicle and the to peptide may be linked through the N- or C-terminus of the peptide or the vehicle, as described further below. Derivatives of the above compounds (described below) are also encompassed by this invention.
• the compounds of this invention may be prepared by standard synthetic methods, recombinant DNA techniques, or any other methods of preparing peptides and fusion proteins.
• Compounds of this invention that encompass non-peptide portions may be synthesized by standard organic chemistry reactions, in addition to standard peptide chemistry reactions when applicable.
• the primary use contemplated is as therapeutic or prophylactic agents.
• the vehicle-linked peptide may have activity comparable to — or even greater than — the natural ligand mimicked by the peptide.
• certain natural ligand-based therapeutic agents might induce antibodies against the patient's own endogenous ligand; the vehicle-linked peptide avoids this pitfall by having little or typically no sequence identity with the natural ligand.
• compounds of this invention may also be useful in screening for such agents.
• an Fc-peptide e.g., Fc-SH2 domain peptide
• the vehicle, especially Fc may make insoluble peptides soluble and thus useful in a number of assays.
• the compounds of this invention may be used for therapeutic or prophylactic purposes by formulating them with appropriate pharmaceutical carrier materials and administering an effective amount to a patient, such as a human (or other mammal) in need thereof.
• Other related aspects are also included in the instant invention.
• FIG. 1 shows a schematic representation of an exemplary process of the invention.
• the vehicle is an Fc domain, which is linked to the peptide covalently by expression from a DNA construct encoding both the Fc domain and the peptide.
• the Fc domains spontaneously form a dimer in this process.
• FIG. 2 shows exemplary Fc dimers that may be derived from an IgGi antibody.
• Fc in the figure represents any of the Fc variants within the meaning of "Fc domain” herein.
• X 1 " and X 2 " represent peptides or linker-peptide combinations as defined hereinafter.
• the specific dimers are as follows:
• A, D Single disulfide-bonded dimers.
• IgGi antibodies typically have two disulfide bonds at the hinge region between the constant and variable domains.
• the Fc domain in Figures 2 A and 2 D may be formed by trimcation between the two disulfide bond sites or by substitution of a cysteinyl residue with an unreactive residue (e.g., alanyl).
• the Fc domain is linked at the amino terminus of the peptides; in 2D, at the carboxyl terminus.
• This Fc domain may be formed by truncation of the parent antibody to retain both cysteinyl residues in the Fc domain chains or by expression from a construct including a sequence encoding such an Fc domain.
• the Fc domain is linked at the amino terminus of the peptides; in 2E, at the carboxyl terminus.
• C F: Noncovalent dimers.
• This Fc domain may be formed by elimination of the cysteinyl residues by either truncation or substitution. One may desire to eliminate the cysteinyl residues to avoid impurities formed by reaction of the cysteinyl residue with cysteinyl residues of other
• ⁇ y proteins present in the host cell.
• the noncovalent bonding of the Fc domains is sufficient to hold together the dimer.
• dimers may be formed by using Fc domains derived from different types of antibodies (e.g., IgG2, IgM).
• Figure 3 shows the structure of preferred compounds of the invention that feature tandem repeats of the pharmacologically active peptide.
• Figure 3A shows a single chain molecule and may also represent the DNA construct for the molecule.
• Figure 3B shows a dimer in which the linker-peptide portion is present on only one chain of the dimer.
• Figure 3C shows a dimer having the peptide portion on both chains. The dimer of
• Figure 3C will form spontaneously in certain host cells upon expression of a DNA construct encoding the single chain shown in Figure 3A. In other host cells, the cells could be placed in conditions favoring formation of dimers or the dimers can be formed in vitro.
• Figure 4 shows exemplary nucleic acid and amino acid sequences
• Figure 5 shows a synthetic scheme for the preparation of PEGylated peptide 19 (SEQ ID NO: 3).
• Figure 6 shows a synthetic scheme for the preparation of PEGylated peptide 20 (SEQ ID NO: 4).
• Figure 7 shows the nucleotide and amino acid sequences (SEQ ID NO:
• Figure 8 shows the nucleotide and amino acid sequences (SEQ. ID.
• Figure 9 shows the nucleotide and amino acid sequences (SEQ. ID. NOS: 9 and 10, respectively) of the molecule identified as "TMP-TMP-Fc" in Example 2 hereinafter.
• Figure 10 shows the nucleotide and amino acid sequences (SEQ. ID. NOS: 11 and 12, respectively) of the molecule identified as "TMP-Fc" in Example 2 hereinafter.
• Figure 11 shows the number of platelets generated in vivo in normal female BDFl mice treated with one 100 ⁇ g/kg bolus injection of various compounds, with the terms defined as follows.
• PEG-MGDF 20 kD average molecular weight PEG attached by reductive amination to the N-terminal amino group of amino acids 1-163 of native human TPO, which is expressed in E. coli (so that it is not glycosylated);
• TMP the TPO-mimetic peptide having the amino acid sequence IEGPTLRQWLAARA (SEQ ID NO: 13);
• TMP-TMP the TPO-mimetic peptide having the amino acid sequence IEGPTLRQWLAARA-GGGGGGGG- IEGPTLRQWLAARA (SEQ ID NO: 14);
• PEG-TMP-TMP the peptide of SEQ ID NO: 14, wherein the PEG group is a 5 kD average molecular weight PEG attached as shown in Figure 6;
• Fc-TMP-TMP the compound of SEQ ID NO: 8 ( Figure 8) dimerized with an identical second monomer (i.e., Cys residues 7 and 10 are bound to the corresponding Cys residues in the second monomer to form a dimer, as shown in Figure 2); and
• TMP-TMP-Fc is the compound of SEQ ID NO: 10 ( Figure 9) dimerized in the same way as TMP-TMP-Fc except that the Fc, domain is attached at the C-terminal end rather than the N- terminal end of the TMP-TMP peptide.
• Figure 12 shows the number of platelets generated in vivo in normal BDFl mice treated with various compounds delivered via implanted osmotic pumps over a 7-day period. The compounds are as defined for Figure 7.
• Figure 13 shows the nucleotide and amino acid sequences (SEQ. ID.
• Figure 14 shows the nucleotide and amino acid sequences (SEQ ID NOS: 17 and 18, respectively) of the molecule identified as "EMP-Fc" in Example 3 hereinafter.
• Figure 15 shows the nucleotide and amino acid sequences (SEQ ID NOS:19 and 20, respectively) of the molecule identified as "EMP-EMP-Fc" in Example 3 hereinafter.
• Figure 16 shows the nucleotide and amino acid sequences (SEQ ID NOS: 21 and 22, respectively) of the molecule identified as "Fc-EMP-EMP" in Example 3 hereinafter.
• Figures 17A and 17B show the DNA sequence (SEQ ID NO: 23) inserted into pCFM1656 between the unique Aatll (position #4364 in pCFM1656) and SacII (position #4585 in pCFM1656) restriction sites to form expression plasmid pAMG21 (ATCC accession no. 98113).
• Figure 18A shows the hemoglobin, red blood cells, and hematocrit generated in vivo in normal female BDFl mice treated with one 100 ⁇ g/kg bolus injection of various compounds.
• Figure 18B shows the same results with mice treated with 100 ⁇ g/kg per day delivered the same dose by 7- day micro-osmotic pump with the EMPs delivered at 100 ⁇ g/kg, rhEPO at 30U/mouse. (In both experiments, neutrophils, lymphocytes, and platelets were unaffected.) In these figures, the terms are defined as follows.
• Fc-EMP the compound of SEQ ID NO: 16 ( Figure 13) dimerized with an identical second monomer (i.e., Cys residues 7 and 10 are bound to the corresponding Cys residues in the second monomer to form a dimer, as shown in Figure 2);
• EMP-Fc the compound of SEQ ID NO: 18 ( Figure 14) dimerized in the same way as Fc-EMP except that the Fc domain is attached at the C-terminal end rather than the N-terminal end of the EMP peptide.
• EMP-EMP-Fc refers to a tandem repeat of the same peptide (SEQ ID NO:
• Fc-EMP-EMP refers to the same tandem repeat of the peptide but with the same Fc domain attached at the amino terminus of the tandem repeat. All molecules are expressed in E. coli and so are not glycosylated.
• Figures 19A and 19B show the nucleotide and amino acid sequences (SEQ ID NOS: 1055 and 1056) of the Fc-TNF- ⁇ inhibitor fusion molecule described in Example 4 hereinafter.
• Figures 20A and 20B show the nucleotide and amino acid sequences (SEQ ID NOS: 1057 and 1058) of the TNF- ⁇ inhibitor-Fc fusion molecule described in Example 4 hereinafter.
• Figures 21 A and 21B show the nucleotide and amino acid sequences (SEQ ID NOS: 1059 and 1060) of the Fc-IL-1 antagonist fusion molecule described in Example 5 hereinafter.
• Figures 22A and 22B show the nucleotide and amino acid sequences (SEQ ID NOS: 1061 and 1062) of the IL-1 antagonist-Fc fusion molecule described in Example 5 hereinafter.
• Figures 23 A, 23B, and 23C show the nucleotide and amino acid sequences (SEQ ID NOS: 1063 and 1064) of the Fc-NEGF antagonist fusion molecule described in Example 6 hereinafter.
• Figures 24A and 24B show the nucleotide and amino acid sequences (SEQ ID NOS: 1065 and 1066) of the VEGF antagonist-Fc fusion molecule described in Example 6 hereinafter.
• Figures 25A and 25B show the nucleotide and amino acid sequences (SEQ ID NOS: 1067 and 1068) of the Fc-MMP inhibitor fusion molecule described in Example 7 hereinafter.
• Figures 26A and 26B show the nucleotide and amino acid sequences (SEQ ID NOS: 1069 and 1070) of the MMP inhibitor-Fc fusion molecule described in Example 7 hereinafter. Detailed Description of the Invention
• a compound may include additional amino acids on either or both of the N- or C- termini of the given sequence. Of course, these additional amino acids should not significantly interfere with the activity of the compound.
• vehicle refers to a molecule that prevents degradation and /or increases half-life, reduces toxicity, reduces immunogenicity, or increases biological activity of a therapeutic protein.
• exemplary vehicles include an Fc domain (which is preferred) as well as a linear polymer (e.g., polyethylene glycol (PEG), polylysine, dextran, etc.); a branched-chain polymer (see, for example, U.S.
• native Fc refers to molecule or sequence comprising the sequence of a non-antigen-binding fragment resulting from digestion of whole antibody, whether in monomeric or multimeric form.
• the original immunoglobulin source of the native Fc is preferably of human origin and may be any of the immunoglobulins, although IgGi and IgG2 are preferred.
• Native Fc's are made up of monomeric polypeptides that may be linked into dimeric or multimeric forms by covalent (i.e., disulfide bonds) and non-covalent association.
• the number of intermolecular disulfide bonds between monomeric subunits of native Fc molecules ranges from 1 to 4 depending on class (e.g., IgG, IgA, IgE) or subclass (e.g., IgGi, IgG2, IgG3, IgAl, IgGA2).
• class e.g., IgG, IgA, IgE
• subclass e.g., IgGi, IgG2, IgG3, IgAl, IgGA2
• One example of a native Fc is a disulfide- bonded dimer resulting from papain digestion of an IgG (see Ellison et al. (1982), Nucleic Acids Res. 10: 4071-9).
• native Fc as used herein is generic to the monomeric, dimeric, and multimeric forms.
• Fc variant refers to a molecule or sequence that is modified from a native Fc but still comprises a binding site for the salvage receptor, FcRn.
• International applications WO 97/34631 (published 25 September 1997) and WO 96/32478 describe exemplary Fc variants, as well as interaction with the salvage receptor, and are hereby incorporated by reference.
• Fc variant comprises a molecule or sequence that is humanized from a non-human native Fc.
• a native Fc comprises sites that may be removed because they provide structural features or biological activity that are not required for the fusion molecules of the present invention.
• Fc variant comprises a molecule or sequence that lacks one or more native Fc sites or residues that affect or are involved in (1) disulfide bond formation, (2) incompatibility with a selected host cell (3) N-terminal heterogeneity upon expression in a selected host cell, (4) glycosylation, (5) interaction with complement, (6) binding to an Fc receptor other than a salvage receptor, or (7) antibody-dependent cellular cytotoxicity (ADCC).
• ADCC antibody-dependent cellular cytotoxicity
• Fc domain encompasses native Fc and Fc variant molecules and sequences as defined above. As with Fc variants and native Fc's, the term “Fc domain” includes molecules in monomeric or multimeric form, whether digested from whole antibody or produced by other means.
• multimer as applied to Fc domains or molecules comprising Fc domains refers to molecules having two or more polypeptide chains associated covalently, noncovalently, or by both covalent and non-covalent interactions.
• IgG molecules typically form dimers; IgM, pentamers; IgD, dimers; and IgA, monomers, dimers, trimers, or tetramers. Multimers may be formed by exploiting the sequence and resulting activity of the native Ig source of the Fc or by derivatizing (as defined below) such a native Fc.
• dimers refers to molecules having two polypeptide chains associated covalently or non-covalently.
• exemplary dimers within the scope of this invention are as shown in Figure 2.
• the terms “derivatizing” and “derivative” or “derivatized” comprise processes and resulting compounds respectively in which (1) the compound has a cyclic portion; for example, cross-linking between cysteinyl residues within the compound; (2) the compound is cross-linked or has a cross-linking site; for example, the compound has a cysteinyl residue and thus forms cross-linked dimers in culture or in vivo; (3) one or more peptidyl linkage is replaced by a non-peptidyl linkage; (4) the N- terminus is replaced by -NRR 1 , NRC(0)R 1 , -NRCXOJOR 1 , -NRS(0) 2 R ⁇ - NHC(0)NHR, a succinimide group, or substituted or unsubsti
• peptide refers to molecules of 2 to 40 amino acids, with molecules of 3 to 20 amino acids preferred and those of 6 to 15 amino acids most preferred. Exemplary peptides may be randomly generated by any of the methods cited above, carried in a peptide library (e.g., a phage display library), or derived by digestion of proteins.
• a peptide library e.g., a phage display library
• randomized refers to fully random sequences (e.g., selected by phage display methods) and sequences in which one or more residues of a naturally occurring molecule is replaced by an amino acid residue not appearing in that position in the naturally occurring molecule.
• Exemplary methods for identifying peptide sequences include phage display, E. coli display, ribosome display, RNA- peptide screening, chemical screening, and the like.
• pharmacologically active means that a substance so described is determined to have activity that affects a medical parameter (e.g., blood pressure, blood cell count, cholesterol level) or disease state (e.g., cancer, autoimmune disorders).
• pharmacologically active peptides comprise agonistic or mimetic and antagonistic peptides as defined below.
• -mimetic peptide and “-agonist peptide” refer to a peptide having biological activity comparable to a protein (e.g., EPO, TPO,
• G-CSF G-CSF
• G-CSF-mimetic peptide comprises any peptides that can be identified or derived as described in Wrighton et al. (1996), Science 273: 458-63, Naranda e ak (1999), Proc. Natl. Acad. Sci. USA 96: 7569-74, or any other reference in Table 2 identified as having EPO-mimetic subject matter.
• EPO-mimetic peptide comprises any peptides that can be identified or derived as described in Wrighton et al. (1996), Science 273: 458-63, Naranda e ak (1999), Proc. Natl. Acad. Sci. USA 96: 7569-74, or any other reference in Table 2 identified as having EPO-mimetic subject matter.
• Those of ordinary skill in the art appreciate that each of these references enables one to select different peptides than actually disclosed therein by following the disclosed procedures with different peptide libraries.
• TPO-mimetic peptide comprises peptides that can be identified or derived as described in Cwirla et al. (1997), Science 276: 1696- 9 , U.S. Pat. Nos. 5,869,451 and 5,932,946 and any other reference in Table 2 identifed as having TPO-mimetic subject matter, as well as the U.S. patent application, "Thrombopoietic Compounds," filed on even date herewith and hereby incorporated by reference. Those of ordinary skill in the art appreciate that each of these references enables one to select different peptides than actually disclosed therein by following the disclosed procedures with different peptide libraries.
• G-CSF-mimetic peptide comprises any peptides that can be identified or described in Paukovits et al. (1984), Hoppe-Seylers Z. Physiol. Chem. 365: 303-11 or any of the references in Table 2 identified as having G-CSF-mimetic subject matter.
• CTLA4-mimetic peptide comprises any peptides that can be identified or derived as described in Fukumoto et al. (1998), Nature Biotech. 16: 267-70.
• each of , these references enables one to select different peptides than actually disclosed therein by following the disclosed procedures with different peptide libraries.
• -antagonist peptide or “inhibitor peptide” refers to a peptide that blocks or in some way interferes with the biological activity of the associated protein of interest, or has biological activity comparable to a known antagonist or inhibitor of the associated protein of interest.
• TNF-antagonist peptide comprises peptides that can be identified or derived as described in Takasaki et al. (1997), Nature Biotech. 15: 1266-70 or any of the references in Table 2 identified as having TNF- antagonistic subject matter. Those of ordinary skill in the art appreciate that each of these references enables one to select different peptides than actually disclosed therein by following the disclosed procedures with different peptide libraries.
• IL-1 antagonist and "IL-lra-mimetic peptide” comprises peptides that inhibit or down-regulate activation of the IL-1 receptor by IL-1.
• IL-1 receptor activation results from formation of a complex among IL-1, IL-1 receptor, and IL-1 receptor accessory protein.
• IL-1 antagonist or IL-lra-mimetic peptides bind to IL-1, IL-1 receptor, or IL-1 receptor accessory protein and obstruct complex formation among any two or three components of the complex.
• Exemplary IL-1 antagonist or IL-lra-mimetic peptides can be identified or derived as described in U.S. Pat. Nos.
• VEGF-antagonist peptide comprises peptides that can be identified or derived as described in Fairbrother (1998), Biochem. 37: 17754-64, and in any of the references in Table 2 identified as having NEGF-antagonistic subject matter. Those of ordinary skill in the art appreciate that each of these references enables one to select different peptides than actually disclosed therein by following the disclosed procedures with different peptide libraries.
• MMP inhibitor peptide comprises peptides that can be identified or derived as described in Koivunen (1999), Nature Biotech. 17: 768-74 and in any of the references in Table 2 identified as having MMP inhibitory subject matter. Those of ordinary skill in the art appreciate that each of these references enables one to select different peptides than actually disclosed therein by following the disclosed procedures with different peptide libraries.
• physiologically acceptable salts of the compounds of this invention are also encompassed herein.
• physiologically acceptable salts is meant any salts that are known or later discovered to be pharmaceutically acceptable. Some specific examples are: acetate; trifluoroacetate; hydrohalides, such as hydrochloride and hydrobromide; sulfate; citrate; tartrate; glycolate; and oxalate. Structure of compounds In General.
• the peptide may be attached to the vehicle through the peptide's N-terminus or C-terminus.
• the vehicle-peptide molecules of this invention may be described by the following formula I: I (X 1 ) " 1 -(X 2 ) b wherein:
• F 1 is a vehicle (preferably an Fc domain);
• X 1 and X 2 are each independently selected from -(L ⁇ -P 1 , -(L P 1 - (L 2 ) d -P 2 , -(L 1 ) c -P 1 -(L 2 ) d -P 2 -(L 3 ) e -P 3 , and -(L 1 ) c -P 1 -(L 2 ) d -P 2 -(L 3 ) e -P 3 -(L 4 ) f -P 4 _?
• P 1 , P 2 , P 3 , and P 4 are each independently sequences of pharmacologically active peptides;
• L 1 , L 2 , L 3 , and L 4 are each independently linkers; and a, b, c, d, e, and f are each independently 0 or 1, provided that at least one of a and b is 1.
• compound I comprises preferred compounds of the formulae II
• Peptides Any number of peptides may be used in conjunction with the present invention. Of particular interest are peptides that mimic the activity of EPO, TPO, growth hormone, G-CSF, GM-CSF, IL-lra, leptin, CTLA4, TRAIL, TGF- ⁇ , and TGF- ⁇ . Peptide antagonists are also of interest, particularly those antagonistic to the activity of T ⁇ F, leptin, any of the interleukins (IL-1, 2, 3, ...), and proteins involved in complement activation (e.g., C3b). Targeting peptides are also of interest, including tumor-homing peptides, membrane-transporting peptides, and the like. All of these classes of peptides may be discovered by methods described in the references cited in this specification and other references.
• Phage display in particular, is useful in generating peptides for use in the present invention. It has been stated that affinity selection from libraries of random peptides can be used to identify peptide ligands for any site of any gene product. Dedman et al. (1993), I. Biol. Chem. 268: 23025-30. Phage display is particularly well suited for identifying peptides that bind to such proteins of interest as cell surface receptors or any proteins having Hnear epitopes. Wilson et al. (1998), Can. I. Microbiol. 44: 313-29; Kay et al. (1998), Drug Disc. Today 3: 370-8. Such proteins are extensively reviewed in Herz et al. (1997), I.
• c IL-17R belongs to the CKR family but is not assigned to any of the 4 indicated subjamilies. d Other IFN type I subtypes remain unassigned. Hematopoietic cytokines, IL-10 ligands and interferons do not possess functional intrinsic protein kinases. The signaling molecules for the cytokines are JAK's, STATs and related non-receptor molecules. IL-14, IL-16 and IL-18 have been cloned but according to the receptor code they remain unassigned. ⁇ TNF receptors use multiple, distinct intracellular molecules for signal transduction including "death domain" of FAS R and 55 kDa TNF- ⁇ R that participates in their cytotoxic effects.
• NGF/TNF R can bind both NGF and related factors as well as TNF ligands.
• Chemokine receptors are G protein-coupled, seven transmembrane (7TM, serpentine) domain receptors.
• the Duffy blood group antigen (DARC) is an erythrocyte receptor that can bind several different chemokines. It belongs to the immunoglobulin superfamily but characteristics of its signal transduction events remain unclear.
• DARC Duffy blood group antigen
• RKF 1. TK sub-family
• VV-F19 (EGF- TK-I like)
• Exemplary peptides for this invention appear in Tables 4 through 20 below. These peptides may be prepared by methods disclosed in the art. Single letter amino acid abbreviations are used. The X in these sequences (and throughout this specification, unless specified otherwise in a particular instance) means that any of the 20 naturally occurring amino acid residues may be present. Any of these peptides may be linked in tandem (i.e., sequentially), with or without linkers, and a few tandem- linked examples are provided in the table. Linkers are listed as "A" and may be any of the linkers described herein. Tandem repeats and linkers are shown separated by dashes for clarity.
• Any peptide containing a cysteinyl residue may be cross-linked with another Cys-containing peptide, either or both of which may be linked to a vehicle.
• Cys-containing peptide either or both of which may be linked to a vehicle.
• Any peptide having more than one Cys residue may form an intrapeptide disulfide bond, as well; see, for example, EPO-mimetic peptides in Table 5.
• intrapeptide disulfide-bonded peptides are specified in the table. Any of these peptides may be derivatized as described herein, and a few derivatized examples are provided in the table. Derivatized peptides in
• the neurotrophic cytokines can associate with NGF/TNF receptors also.
• the J substituent and the Z substituents are as defined in U.S. Pat. Nos. 5,608,035 ,5,786,331, and 5,880,096, which are incorporated by reference.
• the substituents X 2 through X.. and the integer “n” are as defined in WO 96/40772, which is incorporated by reference.
• the substituents " ⁇ ,” “ ⁇ ,” and “+” are as defined in Sparks et al. (1996), Proc. Natl. Acad. Sci. 93: 1540-4, which is hereby incorporated by reference.
• X 4 , X 5 , X 6 , and X 7 are as defined in U.S. Pat. No. 5,773,569, which is hereby incorporated by reference, except that: for integrin-binding peptides, X v X 2 , X 3 , X 4 , X 5 , X 6 , X 7 , and X 8 are as defined in International applications WO 95/14714, published June 1, 1995 and WO 97/08203, published March 6, 1997, which are also incorporated by reference; and for NIP-mimetic peptides, X,, X.', X ", X 2 , X 3 , X 4 , X 5 , X 6 and Z and the integers m and n are as defined in WO 97/40070, published October 30, 1997, which is also incorporated by reference.
• Xaa and Yaa below are as defined in WO 98/09985, published March 12, 1998, which is incorporated by reference.
• AA ⁇ , AA 2 , AB j , AB 2 , and AC are as defined in International application YJO 98/53842, published December 3, 1998, which is incorporated by reference.
• X 1 , X 2 , X 3 , and X 4 in Table 17 only are as defined in European application EP 0911
• h STKS may encompass many other TGF- ⁇ -related factors that remain unassigned.
• the protein kinases are intrinsic part of the intracellular domain of receptor kinase family (RKF). The enzymes participate in the signals transmission via the receptors. 393, pubHshed April 28, 1999. Residues appearing in boldface are D- amino acids. All peptides are linked through peptide bonds unless otherwise noted. Abbreviations are listed at the end of this specification. In the "SEQ ID NO.” column, "NR" means that no sequence listing is required for the given sequence.
• the present invention is also particularly useful with peptides having activity in treatment of:
• the peptide is a NEGF-mimetic or a NEGF receptor antagonist, a HER2 agonist or antagonist, a CD20 antagonist and the like;
• the protein of interest is a CKR3 antagonist, an IL-5 receptor antagonist, and the like;
• thrombosis wherein the protein of interest is a GPIIb antagonist, a GPIIIa antagonist, and the like;
• F 1 , F 2 attached to a peptide through the N-terminus, C-terminus or a sidechain of one of the amino acid residues.
• Multiple vehicles may also be used; e.g., Fc's at each terminus or an Fc at a terminus and a PEG group at the other terminus or a sidechain.
• An Fc domain is the preferred vehicle.
• the Fc domain may be fused to the N or C termini of the peptides or at both the N and C termini.
• molecules having the Fc domain fused to the N terminus of the peptide portion of the molecule are more bioactive than other such fusions, so fusion to the N terminus is preferred.
• Fc variants are suitable vehicles within the scope of this invention.
• a native Fc may be extensively modified to form an Fc variant in accordance with this invention, provided binding to the salvage receptor is maintained; see, for example WO 97/34631 and WO 96/32478.
• One may remove these sites by, for example, substituting or deleting residues, inserting residues into the site, or truncating portions containing the site.
• the inserted or substituted residues may also be altered amino acids, such as peptidomimetics or D- amino acids.
• Fc variants may be desirable for a number of reasons, several of which are described below.
• Exemplary Fc variants include molecules and sequences in which:
• cysteine-containing segment at the N-terminus may be truncated or cysteine residues may be deleted or substituted with other amino acids (e.g., alanyl, seryl).
• cysteine residues may be deleted or substituted with other amino acids (e.g., alanyl, seryl).
• one may truncate the N- terminal 20-amino acid segment of SEQ ID NO: 2 or delete or substitute the cysteine residues at positions 7 and 10 of SEQ ID NO: 2.
• cysteine residues are removed, the single chain Fc domains can still form a dimeric Fc domain that is held together non-covalently.
• a native Fc is modified to make it more compatible with a selected host cell. For example, one may remove the PA sequence near the N- terminus of a typical native Fc, which may be recognized by a digestive enzyme in E. coli such as proline iminopeptidase. One may also add an N-terminal methionine residue, especially when the molecule is expressed recombinantly in a bacterial cell such as E. coli.
• the Fc domain of SEQ ID NO: 2 ( Figure 4) is one such Fc variant.
• a portion of the N-terminus of a native Fc is removed to prevent N- terminal heterogeneity when expressed in a selected host cell. For this purpose, one may delete any of the first 20 amino acid residues at the N-terminus, particularly those at positions 1, 2, 3, 4 and 5. 4.
• One or more glycosylation sites are removed. Residues that are typically glycosylated (e.g., asparagine) may confer cytolytic response. Such residues may be deleted or substituted with unglycosylated residues (e.g., alanine). 5.
• Sites involved in interaction with complement, such as the Clq binding site are removed. For example, one may delete or substitute the EKK sequence of human IgGi.
• Complement recruitment may not be advantageous for the molecules of this invention and s ⁇ may be avoided with such an Fc variant.
• Sites are removed that affect binding to Fc receptors other than a salvage receptor.
• a native Fc may have sites for interaction with certain white blood cells that are not required for the fusion molecules of the present invention and so may be removed.
• the ADCC site is removed. ADCC sites are known in the art; see, for example, Molec. Immunol. 29 (5): 633-9 (1992) with regard to ADCC sites in IgGi. These sites, as well, are not required for the fusion molecules of the present invention and so may be removed.
• the native Fc When the native Fc is derived from a non-human antibody, the native Fc may be humanized. Typically, to humanize a native Fc, one will substitute selected residues in the non-human native Fc with residues that are normally found in human native Fc. Techniques for antibody humanization are well known in the art.
• Preferred Fc variants include the following.
• the leucine at position 15 may be substituted with glutamate; the glutamate at position 99, with alanine; and the lysines at positions 101 and 103, with alanines.
• one or more tyrosine residues can be replaced by pheny alanine residues.
• An alternative vehicle would be a protein, polypeptide, peptide, antibody, antibody fragment, , or small molecule (e.g., a peptidomimetic compound) capable of binding to a salvage receptor.
• a polypeptide as described in U.S. Pat. No. 5,739,277, issued April 14, 1998 to Presta et al.
• Peptides could also be selected by phage display for binding to the FcRn salvage receptor.
• salvage receptor-binding compounds are also included within the meaning of
• vehicle and are within the scope of this invention. Such vehicles should be selected for increased half-life (e.g., by avoiding sequences recognized - by proteases) and decreased immunogenicity (e.g., by favoring non- immunogenic sequences, as discovered in antibody humanization). As noted above, polymer vehicles may also be used for F 1 and F 2 .
• Various means for attaching chemical moieties useful as vehicles are currently available, see, e.g., Patent Cooperation Treaty (“PCT") International Publication No. WO 96/11953, entitled “N-Terminally Chemically Modified Protein Compositions and Methods," herein incorporated by reference in its entirety. This PCT publication discloses, among other things, the selective attachment of water soluble polymers to the N-terminus of proteins.
• a preferred polymer vehicle is polyethylene glycol (PEG).
• PEG polyethylene glycol
• the PEG group may be of any convenient molecular weight and may be linear or branched.
• the average molecular weight of the PEG will preferably range from about 2 kiloDalton ("kD") to about 100 kDa, more preferably from about 5 kDa to about 50 kDa, most preferably from about 5 kDa to about 10 kDa.
• the PEG groups will generally be attached to the compounds of the invention via acylation or reductive alkylation through a reactive group on the PEG moiety (e.g., an aldehyde, amino, thiol, or ester group) to a reactive group on the inventive compound (e.g., an aldehyde, amino, or ester group).
• a reactive group on the PEG moiety e.g., an aldehyde, amino, thiol, or ester group
• a reactive group on the inventive compound e.g., an aldehyde, amino, or ester group
• a useful strategy for the PEGylation of synthetic peptides consists of combining, through forming a conjugate linkage in solution, a peptide and a PEG moiety, each bearing a special functionality that is mutually reactive toward the other.
• the peptides can be easily prepared with conventional solid phase synthesis (see, for example, Figures 5 and 6 and the accompanying text herein).
• the peptides are "preactivated” with an appropriate functional group at a specific site.
• the precursors are purified and fully characterized prior to reacting with the PEG moiety.
• Ligation of the peptide with PEG usually takes place in aqueous phase and can be easily monitored by reverse phase analytical HPLC.
• the PEGylated peptides can be easily purified by preparative HPLC and characterized by analytical HPLC, amino acid analysis and laser desorption mass spectrometry.
• Polysaccharide polymers are another type of water soluble polymer which may be used for protein modification.
• Dextrans are polysaccharide polymers comprised of individual subunits of glucose predominantly linked by ⁇ l-6 linkages. The dextran itself is available in many molecular weight ranges, and is readily available in molecular weights from about 1 kD to about 70 kD.
• Dextran is a suitable water soluble polymer for use in the present invention as a vehicle by itself or in combination with another vehicle (e.g., Fc). See, for example, WO 96/11953 and WO 96/05309. The use of dextran conjugated to therapeutic or diagnostic immunoglobulins has been reported; see, for example, European Patent Publication No. 0 315456, which is hereby incorporated by reference. Dextran of about 1 kD to about 20 kD is preferred when dextran is used as a vehicle in accordance with the present invention.
• Linkers Any "linker” group is optional. When present, its chemical structure is not critical, since it serves primarily as a spacer.
• the linker is preferably made up of amino acids linked together by peptide bonds.
• the linker is made up of from 1 to 20 amino acids linked by peptide bonds, wherein the amino acids are selected from the 20 naturally occurring amino acids. Some of these amino acids may be glycosylated, as is well understood by those in the art.
• the 1 to 20 amino acids are selected from glycine, alanine, proline, asparagine, glutamine, and lysine.
• a linker is made up of a majority of amino acids that are sterically unhindered, such as glycine and alanine.
• preferred linkers are polyglycines (particularly (Gly) 4 , (Gly) 5 ), poly (Gly- Ala), and polyalanines. .
• Other specific examples of linkers are:
• (G_y) 3 Lys(Gly) 4 (SEQ ID NO: 333); (Gly) 3 AsnGlySer(Gly) 2 (SEQ ID NO: 334); (Gly) 3 Cys(Gly) 4 (SEQ ID NO: 335); and GlyProAsnGlyGly (SEQ ID NO: 336).
• (Gly) 3 Lys(Gly) 4 means Gly-Gly-Gly-Lys-Gly-Gly-Gly-Gly. Combinations of Gly and Ala are also preferred.
• the linkers shown here are exemplary; linkers within the scope of this invention may be much longer and may include other residues.
• Non-peptide linkers are also possible.
• These alkyl linkers may further be substituted by any non-sterically hindering group such as lower alkyl (e.g., C--C 6 ) lower acyl, halogen (e.g., Cl, Br), CN, NH 2 , phenyl, etc.
• An exemplary non-peptide linker is a PEG linker, VI
• n is such that the linker has a molecular weight of 100 to 5000 kD, preferably 100 to 500 kD.
• the peptide linkers may be altered to form derivatives in the same manner as described above.
• Derivatives The inventors also contemplate derivatizing the peptide and/or vehicle portion of the compounds. Such derivatives may improve the solubility, absorption, biological half life, and the like of the compounds.
• the moieties may alternatively eliminate or attenuate any undesirable side-effect of the compounds and the like.
• Exemplary derivatives include compounds in which: 1.
• the compound or some portion thereof is cyclic.
• the peptide portion may be modified to contain two or more Cys residues (e.g., in the linker), which could cyclize by disulfide bond formation.
• the compound is cross-linked or is rendered capable of cross-linking between molecules.
• the peptide portion may be modified to contain one Cys residue and thereby be able to form an intermolecular disulfide bond with a like molecule.
• the compound may also be cross-linked through its C-terminus, as in the molecule shown below. Nil
• One or more peptidyl [-C(0)NR-] linkages (bonds) is replaced by a non-peptidyl linkage.
• Exemplary non-peptidyl linkages are -CH 2 - carbamate [-CH 2 -OC(0)NR-], phosphonate , -CH 2 -sulfonamide [-CH--
• the N-terminus is derivatized. Typically, the N-terminus may be acylated or modified to a substituted amine.
• Exemplary N-terminal derivative groups include -NRR 1 (other than -NH,), -NRC(0)R 1 , -NRC(0)OR ⁇ -NRS(0) 2 R ⁇ -NHC(0)NHR ⁇ succinimide, or benzyloxycarbonyl-NH- (CBZ-NH-), wherein R and R 1 are each independently hydrogen or lower alkyl and wherein the phenyl ring may be substituted with 1 to 3 substituents selected from the group consisting of C C 4 alkyl, - alkoxy, chloro, and bromo.
• the free C-terminus is derivatized. Typically, the C-terminus is esterified or amidated. For example, one may use methods described in the art to add (NH-CH 2 -CH 2 -NH 2 ) 2 to compounds of this invention having any of SEQ ID NOS: 504 to 508 at the C-terminus. Likewise, one may use methods described in the art to add -NH 2 to compounds of this invention having any of SEQ ID NOS: 924 to 955, 963 to 972, 1005 to 1013, or 1018 to 1023 at the C-terminus.
• Exemplary C-terminal derivative groups include, for example, -C(0)R 2 wherein R 2 is lower alkoxy or -NR 3 R 4 wherein R 3 and R 4 are independently hydrogen or C C 8 alkyl (preferably - alkyl).
• a disulfide bond is replaced with another, preferably more stable, cross-linking moiety (e.g., an alkylene). See, e.g., Bhatnagar et al. (1996), T. Med. Chem.39: 3814-9; Alberts et_al. (1993) Thirteenth Am.
• One or more individual amino acid residues is modified.
• Various derivatizing agents are known to react specifically with selected sidechains or terminal residues, as described in detail below. Lysinyl residues and amino terminal residues may be reacted with succinic or other carboxylic acid anhydrides, which reverse the charge of the lysinyl residues.
• Suitable reagents for derivatizing alpha-amino- containing residues include imidoesters such as methyl picolinimidate; pyridoxal phosphate; pyridoxal; chloroborohydride; trinitrobenzenesulfonic acid; O-methylisourea; 2,4 pentanedione; and transaminase-catalyzed reaction with glyoxylate.
• imidoesters such as methyl picolinimidate; pyridoxal phosphate; pyridoxal; chloroborohydride; trinitrobenzenesulfonic acid; O-methylisourea; 2,4 pentanedione; and transaminase-catalyzed reaction with glyoxylate.
• Arginyl residues may be modified by reaction with any one or combination of several conventional reagents, including phenylglyoxal, 2,3- butanedione, 1,2-cyclohexanedione, and ninhydrin. Derivatization of arginyl residues requires that the reaction be performed in alkaline conditions because of the high pKa of the guanidine functional group. Furthermore, these reagents may react with the groups of lysine as well as the arginin ⁇ epsilon-amino - group.
• aspartyl and glutamyl residues may be converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.
• Glutaminyl and asparaginyl residues may be deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Either form of these residues falls within the scope of this invention.
• Cysteinyl residues can be replaced by amino acid residues or other moieties either to eliminate disulfide bonding or, conversely, to stabilize cross- linking. See, e.g., Bhatnagar et al- (1996), I. Med. Chem. 39: 3814-9.
• Derivatization with bifunctional agents is useful for cross-linking the peptides or their functional derivatives to a water-insoluble support matrix or to other macromolecular vehicles.
• Commonly used cross-linking agents include, e.g., l,l-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N- hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifunctional imidoesters, including disuccinimidyl esters such as 3,3'- dithiobis(succinimidylpropionate), and bifunctional maleimides such as bis-N- maleimido-l,8-octane.
• Derivatizing agents such as methyl-3-[(p- azidophenyl)dithio]propioimidate yield photoactivatable intermediates that are capable of forming crosslinks in the presence of light.
• reactive water-insoluble matrices such as cyanogen bromide-activated carbohydrates and the reactive substrates described in U.S. Pat. Nos. 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537; and 4,330,440 are employed for protein immobilization.
• Carbohydrate (oligosaccharide) groups may conveniently be attached to sites that are known to be glycosylation sites in proteins.
• O-linked oligosaccharides are attached to serine (Ser) or threonine (Thr) residues while N-linked oligosaccharides are attached to asparagine (Asn) residues when they are part of the sequence Asn-X- Ser/Thr, where X can be any amino acid except proline.
• X is preferably one of the 19 naturally occurring amino acids other than proline.
• the structures of N-linked and O-linked oligosaccharides and the sugar residues found in each type are different.
• sialic acid is usually the terminal residue of both N-linked and O- linked oligosaccharides and, by virtue of its negative charge, may confer acidic properties to the glycosylated compound.
• site(s) may be incorporated in the linker of the compounds of this invention and are preferably glycosylated by a cell during recombinant production of the polypeptide compounds (e.g., in mammalian cells such as CHO, BHK, COS). However, such sites may further be glycosylated by synthetic or semi-synthetic procedures known in the art.
• Compounds of the present invention may be changed at the DNA level, as well.
• the DNA sequence of any portion of the compound may be any portion of the compound.
• the compounds of this invention largely may be made in transformed host cells using recombinant DNA techniques.
• a recombinant DNA molecule coding for the peptide is prepared.
• Methods of preparing such DNA molecules are well known in the art. For instance, sequences coding for the peptides could be excised from DNA using suitable restriction enzymes. Alternatively, the DNA molecule could be synthesized using chemical synthesis techniques, such as the phosphoramidate method. Also, a combination of these techniques could be used.
• the invention also includes a vector capable of expressing the peptides in an appropriate host.
• the vector comprises the DNA molecule that codes for the peptides operatively linked to appropriate expression control sequences. Methods of effecting this operative linking, either before or after the DNA molecule is inserted into the vector, are well known.
• Expression control sequences include promoters, activators, enhancers, operators, ribosomal binding sites, start signals, stop signals, cap signals, polyadenylation signals, and other signals involved with the control of transcription or translation.
• the resulting vector having the DNA molecule thereon is used to transform an appropriate host. This transformation may be performed using methods well known in the art.
• Any of a large number of available and well-known host cells may be used in the practice of this invention.
• the selection of a particular host is dependent upon a number of factors recognized by the art. These include, for example, compatibility with the chosen expression vector, toxicity of the peptides encoded by the DNA molecule, rate of transformation, ease of recovery of the peptides, expression characteristics, bio-safety and costs. A balance of these factors must be struck with the understanding that not all hosts may be equally effective for the expression of a particular DNA sequence.
• useful microbial hosts include bacteria (such as E. coli sp.), yeast (such as Saccharomyces sp.) and other fungi, insects, plants, mammalian (including human) cells in culture, or other hosts known in the art.
• Host cells may be cultured under conventional fermentation conditions so that the desired compounds are expressed. Such fermentation conditions are well known in the art.
• the peptides are purified from culture by methods well known in the art.
• the compounds may also be made by synthetic methods.
• solid phase synthesis techniques may be used. Suitable techniques are well known in the art, and include those described in Merrifield (1973), Chem. Polypeptides, pp. 335-61 (Katsoyannis and Panayotis eds.); Merrifield (1963), I. Am. Chem. Soc. 85: 2149; Davis et al. (1985), Biochem. Intl. 10: 394-414; Stewart and Young (1969), Solid Phase Peptide Synthesis; U.S. Pat. No. 3,941,763; Finn etal. (1976), The Proteins (3rd ed.) 2: 105-253; and Erickson et al. (1976), The Proteins (3rd ed.) 2: 257-527. Solid phase synthesis is the preferred technique of making individual peptides since it is the most cost-effective method of making small peptides.
• the compounds of this invention have pharmacologic activity resulting from their ability to bind to proteins of interest as agonists, mimetics or antagonists of the native ligands of such proteins of interest.
• the utility of specific compounds is shown in Table 2. The activity of these compounds can be measured by assays known in the art. For the TPO-mimetic and EPO-mimetic compounds, in vivo assays are further described in the Examples section herein.
• the compounds of the present invention are useful in diagnosing diseases characterized by dysfunction of their associated protein of interest.
• a method of detecting in a biological sample a protein of interest comprising the steps of: (a) contacting the sample with a compound of this invention; and (b) detecting activation of the protein of interest by the compound.
• the biological samples include tissue specimens, intact cells, or extracts thereof.
• the compounds of this invention may be used as part of a diagnostic kit to detect the presence of their associated proteins of interest in a biological sample. Such kits employ the compounds of the invention having an attached label to allow for detection. The compounds are useful for identifying normal or abnormal proteins of interest.
• EPO-mimetic compounds for example, presence of abnormal protein of interest in a biological sample may be indicative of such disorders as Diamond Blackfan anemia, where it is believed that the EPO receptor is dysfunctional.
• the EPO-mimetic compounds of the invention are useful for treating disorders characterized by low red blood cell levels. Included in the invention are methods of modulating the endogenous activity of an EPO receptor in a mammal, preferably methods of increasing the activity of an EPO receptor.
• any condition treatable by erythropoietin, such as anemia, may also be treated by the EPO-mimetic compounds of the invention.
• These compounds are administered by an amount and route of delivery that is appropriate for the nature and severity of the condition being treated and may be ascertained by one skilled in the art.
• administration is by injection, either subcutaneous, intramuscular, or intravenous.
• TPO-mimetic compounds For the TPO- mimetic compounds, one can utilize such standard assays as those described in W095/26746 entitled "Compositions and Methods for Stimulating Megakaryocyte Growth and Differentiation". In vivo assays also appear in the Examples hereinafter.
• the conditions to be treated are generally those that involve an existing megakaryocyte/platelet deficiency or an expected megakaryocyte/platelet deficiency (e.g., because of planned surgery or platelet donation). Such conditions will usually be the result of a deficiency (temporary or permanent) of active Mpl ligand in vivo.
• the generic term for platelet deficiency is thrombocytopenia, and hence the methods and compositions of the present invention are generally available for treating thrombocytopenia in patients in need thereof.
• Thrombocytopenia may be present for various reasons, including chemotherapy and other therapy with a variety of drugs, radiation therapy, surgery, accidental blood loss, and other specific disease conditions.
• Exemplary specific disease conditions that involve thrombocytopenia and may be treated in accordance with this invention are: aplastic anemia, idiopathic thrombocytopenia, metastatic tumors which result in thrombocytopenia, systemic lupus erythematosus, splenomegaly, Fanconi's syndrome, vitamin B12 deficiency folic acid deficiency, May-Hegglin anomaly, Wiskott-Aldrich syndrome, and paroxysmal nocturnal hemoglobinuria.
• certain treatments for AIDS result in thrombocytopenia (e.g., AZT).
• Certain wound healing disorders might also benefit from an increase in platelet numbers.
• a compound of the present invention could be administered several days to several hours prior to the need for platelets.
• a compound of this invention could be administered along with blood or purified platelets.
• TPO-mimetic compounds of this invention may also be useful in stimulating certain cell types other than megakaryocytes if such cells are found to express Mpl receptor. Conditions associated with such cells that express the Mpl receptor, which are responsive to stimulation by the Mpl ligand, are also within the scope of this invention.
• the TPO-mimetic compounds of this invention may be used in any situation in which production of platelets or platelet precursor cells is desired, or in which stimulation of the c-Mpl receptor is desired.
• the compounds of this invention may be used to treat any condition in a mammal wherein there is a need of platelets, megakaryocytes, and the like. Such conditions are described in detail in the following exemplary sources: W095/26746; W095/21919; W095/18858; WO95/21920 and are incorporated herein.
• the TPO-mimetic compounds of this invention may also be useful in maintaining the viability or storage life of platelets and /or megakaryocytes and related cells. Accordingly, it could be useful to include an effective amount of one or more such compounds in a composition containing such cells.
• the therapeutic methods, compositions and compounds of the present invention may also be employed, alone or in combination with other cytokines, soluble Mpl receptor, hematopoietic factors, interleukins, growth factors or antibodies in the treatment of disease states characterized by other symptoms as well as platelet deficiencies. It is anticipated that the inventive compound will prove useful in treating some forms of thrombocytopenia in combination with general stimulators of hematopoiesis, such as IL-3 or GM-CSF.
• Other megakaryocytic stimulatory factors i.e., meg-CSF, stem cell factor (SCF), leukemia inhibitory factor (LIF), oncostatin M (OSM), or other molecules with megakaryocyte stimulating activity may also be employed with Mpl ligand.
• Additional exemplary cytokines or hematopoietic factors for such co-administration include IL-1 alpha, IL-1 beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-11, colony stimulating factor-1 (CSF-1), SCF, GM-CSF, granulocyte colony stimulating factor (G-CSF), EPO, interferon-alpha (IFN-alpha), consensus interferon, IFN-beta, or IFN-gamma. It may further be useful to administer, either simultaneously or sequentially, an effective amount of a soluble mammalian Mpl receptor, which appears to have an effect of causing megakaryocytes to fragment into platelets once the megakaryocytes have reached mature form.
• administering to enhance the number of mature megakaryocytes
• administration of the soluble Mpl receptor to inactivate the ligand and allow the mature megakaryocytes to produce platelets
• the dosage recited above would be adjusted to compensate for such additional components in the therapeutic composition. Progress of the treated patient can be monitored by conventional methods.
• compositions of platelets and/or megakaryocytes and related cells the amount to be included will generally be ascertained experimentally by techniques and assays known in the art.
• An exemplary range of amounts isO.l ⁇ g — 1 mg inventive compound per 10 6 cells.
• the present invention also provides methods of using pharmaceutical compositions of the inventive compounds.
• Such pharmaceutical compositions may be for administration for injection, or for oral, pulmonary, nasal, transdermal or other forms of administration.
• the invention encompasses pharmaceutical compositions comprising effective amounts of a compound of the invention together with pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers.
• compositions include diluents of various buffer content (e.g., Tris-HCl, acetate, phosphate), pH and ionic strength; additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol); incorporation of the material into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes.
• buffer content e.g., Tris-HCl, acetate, phosphate
• additives e.g., Tween 80, Polysorbate 80
• anti-oxidants e.g., ascorbic acid, sodium metabisulfite
• preservatives e.g., Thimersol, benzyl alcohol
• Hyaluronic acid may also be used, and this may have the effect of promoting sustained duration in the circulation.
• Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the present proteins and derivatives. See, e.g., Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, PA 18042) pages 1435-1712 which are herein incorporated by reference.
• the compositions may be prepared in liquid form, or may be in dried powder, such as lyophilized form. Implantable sustained release formulations are also contemplated, as are transdermal formulations. Oral dosage forms.
• Solid dosage forms include tablets, capsules, pills, troches or lozenges, cachets or pellets. Also,
• liposomal or proteinoid encapsulation may be used to formulate the present compositions (as, for example, proteinoid microspheres reported in U.S. Patent No. 4,925,673).
• Liposomal encapsulation may be used and the liposomes may be derivatized with various polymers (e.g., U.S. Patent No. 5,013,556).
• U.S. Patent No. 5,013,556 e.g., U.S. Patent No. 5,013,556
• a description of possible solid dosage forms for the therapeutic is given in Chapter 10 of Marshall, K., Modern Pharmaceutics (1979), edited by G. S. Banker and C. T. Rhodes, herein incorporated by reference.
• the formulation will include the inventive compound, and inert ingredients which allow for protection against the stomach environment, and release of the biologically active material in the intestine.
• the compounds may be chemically modified so that oral delivery is efficacious.
• the chemical modification contemplated is the attachment of at least one moiety to the compound molecule itself, where said moiety permits (a) inhibition of proteolysis; and (b) uptake into the blood stream from the stomach or intestine.
• the increase in overall stability of the compound and increase in circulation time in the body are also contemplated.
• Moieties useful as covalently attached vehicles in this invention may also be used for this purpose. Examples of such moieties include: PEG, copolymers of ethylene glycol and propylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone and polyproline.
• a salt of a modified aliphatic amino acid such as sodium N-(8-[2-hydroxybenzoyl] amino) caprylate (SNAC)
• SNAC sodium N-(8-[2-hydroxybenzoyl] amino) caprylate
• the compounds of this invention can be included in the formulation as fine multiparticulates in the form of granules or pellets of particle size about 1 mm.
• the formulation of the material for capsule administration could also be as a powder, lightly compressed plugs or even as tablets.
• the therapeutic could be prepared by compression.
• Colorants and flavoring agents may all be included.
• the protein (or derivative) may be formulated (such as by liposome or microsphere encapsulation) and then further contained within an edible product, such as a refrigerated beverage containing colorants and flavoring agents.
• diluents could include carbohydrates, especially mannitol, ⁇ -lactose, anhydrous lactose, cellulose, sucrose, modified dextrans and starch.
• Certain inorganic salts may also be used as fillers including calcium triphosphate, magnesium carbonate and sodium chloride.
• Some commercially available diluents are Fast-Flo, Emdex, STA-Rx 1500, Emcompress and Avicell.
• Disintegrants may be included in the formulation of the therapeutic into a solid dosage form. Materials used as disintegrants include but are not limited to starch including the commercial disintegrant based on starch, Explotab.
• Sodium starch glycolate, Amberlite, sodium carboxymethylcellulose, ultramylopectin, sodium alginate, gelatin, orange l°l peel, acid carboxymethyl cellulose, natural sponge and bentonite may all be used.
• Another form of the disintegrants are the insoluble cationic exchange resins.
• Powdered gums may be used as disintegrants and as binders and these can include powdered gums such as agar, Karaya or tragacanth. Alginic acid and its sodium salt are also useful as disintegrants.
• Binders may be used to hold the therapeutic agent together to form a hard tablet and include materials from natural products such as acacia, tragacanth, starch and gelatin. Others include methyl cellulose (MC), ethyl cellulose (EC) and carboxymethyl cellulose (CMC). Polyvinyl pyrrolidone (PVP) and hydroxypropylmethyl cellulose (HPMC) could both be used in alcoholic solutions to granulate the therapeutic.
• MC methyl cellulose
• EC ethyl cellulose
• CMC carboxymethyl cellulose
• PVP polyvinyl pyrrolidone
• HPMC hydroxypropylmethyl cellulose
• Lubricants may be used as a layer between the therapeutic and the die wall, and these can include but are not limited to; stearic acid including its magnesium and calcium salts, polytetrafluoroethylene (PTFE), liquid paraffin, vegetable oils and waxes. Soluble lubricants may also be used such as sodium lauryl sulfate, magnesium lauryl sulfate, polyethylene glycol of various molecular weights, Carbowax 4000 and 6000.
• the glidants may include starch, talc, pyrogenic silica and hydrated silicoaluminate.
• a surfactant might be added as a wetting agent.
• Surfactants may include anionic detergents such as sodium iauryl sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium sulfonate.
• Cationic detergents might be used and could include benzalkonium chloride or
• benzethonium chloride 2 ⁇ benzethonium chloride.
• nonionic detergents that could be included in the formulation as surfactants are lauromacrogol 400, polyoxyl 40 stearate, polyoxyethylene hydrogenated castor oil 10, 50 and 60, glycerol monostearate, polysorbate 40, 60, 65 and 80, sucrose fatty acid ester, methyl cellulose and carboxymethyl cellulose. These surfactants could be present in the formulation of the protein or derivative either alone or as a mixture in different ratios.
• Additives may also be included in the formulation to enhance uptake of the compound. Additives potentially having this property are for instance the fatty acids oleic acid, linoleic acid and linolenic acid.
• Controlled release formulation may be desirable.
• the compound of this invention could be incorporated into an inert matrix which permits release by either diffusion or leaching mechanisms e.g., gums.
• Slowly degenerating matrices may also be incorporated into the formulation, e.g., alginates, polysaccharides.
• Another form of a controlled release of the compounds of this invention is by a method based on the Oros therapeutic system (Alza Corp.), i.e., the drug is enclosed in a semipermeable membrane which allows water to enter and push drug out through a single small opening due to osmotic effects. Some enteric coatings also have a delayed release effect.
• coatings may be used for the formulation. These include a variety of sugars which could be applied in a coating pan.
• the therapeutic agent could also be given in a film coated tablet and the materials used in this instance are divided into 2 groups.
• the first are the nonenteric materials and include methyl cellulose, ethyl cellulose, hydroxyethyl cellulose, methylhydroxy-ethyl cellulose, hydroxypropyl cellulose, hydroxypropyl-methyl cellulose, sodium carboxy-methyl cellulose, providone and the polyethylene glycols.
• the second group consists of the enteric materials that are commonly esters of phthalic acid. A mix of materials might be used to provide the optimum film coating. Film coating may be carried out in a pan coater or in a fluidized bed or by compression coating.
• Pulmonary delivery forms are also contemplated herein.
• the protein (or derivative) is delivered to the lungs of a mammal while inhaling and traverses across the lung epithelial lining to the blood stream.
• Adjei et al. Pharma. Res. (1990) 7: 565-9
• Adjei et al. (1990), Internatl. I. Pharmaceutics 63: 135-44 (leuprolide acetate); Braquet et_al. (1989), T. Cardiovasc. Pharmacol. 13 (suppl.5): s.143-146 (endothelin- 1); Hubbard et_al.
• Contemplated for use in the practice of this invention are a wide range of mechanical devices designed for pulmonary delivery of therapeutic products, including but not limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art.
• Some specific examples of commercially available devices suitable for the practice of this invention are the Ultravent nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Missouri; the Acorn II nebulizer, manufactured by Marquest Medical Products,
• each formulation is specific to the type of device employed and may involve the use of an appropriate propellant material, in addition to diluents, adjuvants and /or carriers useful in therapy.
• the inventive compound should most advantageously be prepared in particulate form with an average particle size of less than 10 ⁇ m (or microns), most preferably 0.5 to 5 ⁇ m, for most effective delivery to the distal lung.
• Pharmaceutically acceptable carriers include carbohydrates such as trehalose, mannitol, xylitol, sucrose, lactose, and sorbitol. Other ingredients for use in formulations may include DPPC, DOPE, DSPC and DOPC. Natural or synthetic surfactants may be used. PEG may be used (even apart from its use in derivatizing the protein or analog). Dextrans, such as cyclodextran, may be used. Bile salts and other related enhancers may be used. Cellulose and cellulose derivatives may be used. Amino acids may be used, such as use in a buffer formulation.
• Formulations suitable for use with a nebulizer will typically comprise the inventive compound dissolved in water at a concentration of about 0.1 to 25 mg of biologically active protein per mL of solution.
• the formulation may also include a buffer and a simple sugar (e.g., for protein stabilization and regulation of osmotic pressure).
• the nebulizer formulation may also contain a surfactant, to reduce or prevent surface induced aggregation of the protein caused by atomization of the solution in forming the aerosol.
• Formulations for use with a metered-dose inhaler device will generally comprise a finely divided powder containing the inventive compound suspended in a propellant with the aid of a surfactant.
• the propellant may be any conventional material employed for this purpose, such as a chlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol, and 1,1,1,2- tetrafluoroethane, or combinations thereof.
• Suitable surfactants include sorbitan trioleate and soya lecithin. Oleic acid may also be useful as a surfactant.
• Formulations for dispensing from a powder inhaler device will comprise a finely divided dry powder containing the inventive compound and may also include a bulking agent, such as lactose, sorbitol, sucrose, mannitol, trehalose, or xylitol in amounts which facilitate dispersal of the powder from the device, e.g., 50 to 90% by weight of the formulation.
• a bulking agent such as lactose, sorbitol, sucrose, mannitol, trehalose, or xylitol in amounts which facilitate dispersal of the powder from the device, e.g., 50 to 90% by weight of the formulation.
• Nasal delivery forms Nasal delivery of the inventive compound is also contemplated. Nasal delivery allows the passage of the protein to the blood stream directly after administering the therapeutic product to the nose, without the necessity for deposition of the product in the lung.
• Formulations for nasal delivery include those with dextran or cyclodextran. Delivery via transport across other mucous membranes is also contemplated.
• the dosage regimen involved in a method for treating the above-described conditions will be determined by the attending physician, considering various factors which modify the action of drugs, e.g. the age, condition, body weight, sex and diet of the patient, the severity of any infection, time of administration and other clinical factors.
• the daily regimen should be in the range of 0.1-1000 micrograms of the inventive compound per kilogram of body weight, preferably 0.1-150 micrograms per kilogram.
• the inventors have determined preferred peptide sequences for molecules having many different kinds of activity.
• the inventors have further determined preferred structures of these preferred peptides combined with preferred linkers and vehicles. Preferred structures for these preferred peptides listed in Table 21 below.
• the TPO in vitro bioassay is a mitogenic assay utilizing an IL-3 dependent clone of murine 32D cells that have been transfected with human mpl receptor. This assay is described in greater detail in WO 95/26746.
• Cells are maintained in MEM medium containing 10% Fetal Clone II and 1 ng/ml mIL-3. Prior to sample addition, cells are prepared by rinsing twice with growth medium lacking mIL-3. An extended twelve point TPO standard curve is prepared, ranging from 33 to 39 pg/ml. Four dilutions, estimated to fall within the linear portion of the standard curve, (100 to 125 pg/ml), are prepared for each sample and run in triplicate.
• a volume of 100 ⁇ l of each dilution of sample or standard is added to appropriate wells of a 96 well microtiter plate containing 10,000 cells/well. After forty-four hours at 37 °C and 10% C0 2 , MTS (a tetrazolium compound which is bioreduced by cells to a formazan) is added to each well. Approximately six hours later, the optical density is read on a plate reader at 490 nm. A dose response curve (log TPO concentration vs. O.D.- Background) is generated and linear regression analysis of points which fall in the linear portion of the standard curve is performed. Concentrations of unknown test samples are determined using the resulting linear equation and a correction for the dilution factor. TMP tandem repeats with polyglycine linkers.
• tandem repeats Subsequent to this first series of TMP tandem repeats, several other molecules were designed either with different linkers or containing modifications within the monomer itself.
• the first of these molecules, peptide 13 has a linker composed of GPNG, a sequence known to have a high propensity to form a ⁇ -turn-type secondary structure. Although still about 100-fold more potent than the monomer, this peptide was found to be >10-fold less active than the equivalent GGGG-linked analog. Thus, introduction of a relatively rigid ⁇ -turn at the linker region seemed to have caused a slight distortion of the optimal agonist conformation in this short linker form.
• Trp9 in the TMP sequence is a highly conserved residue among the active peptides isolated from random peptide libraries. There is also a highly conserved Trp in the consensus sequences of EPO mimetic peptides and this Trp residue was found to be involved in the formation of a hydrophobic core between the two EMPs and contributed to hydrophobic interactions with the EPO receptor. Livnah et al. (1996), Science 273: 464- 71).
• Trp9 residue in TMP might have a similar function in dimerization of the peptide ligand, and as an attempt to modulate and estimate the effects of noncovalent hydrophobic forces exerted by the two indole rings, several analogs were made resulting from mutations at the Trp. So in peptide 14, the Trp residue was replaced in each of the two TMP monomers with a Cys, and an intramolecular disulfide bond was formed between the two cysteines by oxidation which was envisioned to mimic the hydrophobic interactions between the two Trp residues in peptide dimerization. Peptide 15 is the reduced form of peptide 14. In peptide 16, the two Trp residues were replaced by Ala. As the assay data show, all three analogs were inactive. These data further demonstrated that Trp is critical for the activity of the TPO mimetic peptide, not just for dimer formation.
• PEG PEGylated peptides
• a PEG moiety was introduced at the middle of a relatively long linker, so that the large PEG component (5 kDa) is far enough away from the critical binding sites in the peptide molecule.
• PEG is a known biocompatible polymer which is increasingly used as a covalent modifier to improve the pharmacokinetic profiles of peptide- and protein-based therapeutics.
• a modular, solution-based method was devised for convenient PEGylation of synthetic or recombinant peptides.
• the method is based on the now well established chemoselective ligation strategy which utilizes the specific reaction between a pair of mutually reactive functionalities. So, for pegylated peptide 19, the lysine side chain was preactivated with a bromoacetyl group to give peptide 17b to accommodate reaction with a thiol-derivatized PEG. To do that, an orthogonal protecting group, Dde, was employed for the protection of the lysine ⁇ -amine. Once the whole peptide chain was assembled, the N-terminal amine was reprotected with t-Boc.
• n Peptide 21 has in its 8-amino acid linker a potential glycosylation motif, NGS. Since our exemplary tandem repeats are made up of natural amino acids linked by peptide bonds, expression of such a molecule in an appropriate eukaryotic cell system should produce a glycopeptide with the carbohydrate moiety added on the side chain carboxyamide of Asn. Glycosylation is a common post-translational modification process which can have many positive impacts on the biological activity of a given protein by increasing its aqueous solubility and in vivo stability. As the assay data show, incorporation of this glycosylation motif into the linker maintained high bioactivity.
• the synthetic precursor of the potential glycopeptide had in effect an activity comparable to that of the -(G) 8 - linked analog.
• this peptide is expected to have the same order of activity as the pegylated peptides, because of the similar chemophysical properties exhibited by a PEG and a carbohydrate moiety.
• the last peptide is a dimer of a tandem repeat. It was prepared by oxidizing peptide 18, which formed an intermolecular disulfide bond between the two cysteine residues located at the linker. This peptide was designed to address the possibility that TMP was active as a tetramer.
• one pegylated TMP tandem repeat (compound 20 in Table A) was delivered subcutaneously to normal mice via osmotic pumps. Time and dose-dependent increases were seen in platelet numbers for the duration of treatment. Peak platelet levels over 4-fold baseline were seen on day 8.
• a dose of lC ⁇ g/kg/day of - the pegylated TMP repeat produced a similar response to rHuMGDF (non-pegylated) at 100 ⁇ g/kg/day delivered by the same route.
• TMP-GGGCGGGG-TMP 363 Discussion. It is well accepted that MGDF acts in a way similar to hGH, i.e., one molecule of the protein ligand binds two molecules of the receptor for its activation. Wells et al.(1996), Ann. Rev. Biochem. 65: 609- 34. Now, this interaction is mimicked by the action of a much smaller peptide, TMP. However, the present studies suggest that this mimicry requires the concerted action of two TMP molecules, as covalent dimerization of TMP in either a C-C parallel or C-N sequential fashion increased the in vitro biological potency of the original monomer by a factor of greater than 10 3 .
• the relatively low biopotency of the monomer is probably due to inefficient formation of the noncovalent dimer.
• a preformed covalent repeat has the ability to eliminate the entropy barrier for the formation of a noncovalent dimer which is exclusively driven by weak, noncovalent interactions between two molecules of the small, 14- residue peptide. It is interesting that this tandem repeat approach had a similar effect on enhancing bioactivity as the reported C-C dimerization is intriguing. These two strategies brought about two very different molecular configurations.
• the C-C dimer is a quasi-symmetrical molecule, while the tandem repeats have no such symmetry in their linear structures.
• Insertion of one or more (up to 14) glycine residues at the junction did not increase (or decrease) significantly the activity any further. This may be due to the fact that a flexible polyglycine peptide chain is able to loop out easily from the junction without causing any significant changes in the overall conformation. This flexibility seems to provide the freedom of orientation for the TMP peptide chains to fold into the required conformation in interacting with the receptor and validate it as a site of modification.
• Trp9 in TMP plays a similar role as Trp 13 in EMP, which is involved not only in peptide:peptide interaction for the formation of dimers but also is important for contributing hydrophobic forces in peptide:receptor interaction.
• TMP peptide An analysis of the possible secondary structure of the TMP peptide can provide further understanding on the interaction between TMP and c- Mpl. This can be facilitated by making reference to the reported structure of the EPO mimetic peptide. Livnah et al- (1996), Science 273:464-75
• the receptor-bound EMP has a b-hairpin structure with a b-turn formed by the highly consensus Gly-Pro-Leu-Thr at the center of its sequence.
• TMP has a highly selected GPTL sequence which is likely to form a similar turn.
• this turn-like motif is located near the N-terminal part in TMP.
• Secondary structure prediction using Chau-Fasman method suggests that the C-terminal half of the peptide has a tendency to adopt a helical conformation. Together with the highly conserved Trp at position 9, this C-terminal helix may contribute to the stabilization of the dimeric structure.
• most of our tandem repeats are more potent than the C-terminal parallel dimer. Tandem repeats seem to give the molecule a better fit conformation than does the C-C parallel dimerization.
• tandem repeat The seemingly asymmetric feature of a tandem repeat might have brought it closer to the natural ligand which, as an asymmetric molecule, uses two different sites to bind two identical receptor molecules.
• Introduction of a PEG moiety was envisaged to enhance the in vivo activity of the modified peptide by providing it a protection against proteolytic degradation and by slowing down its clearance through renal filtration. It was unexpected that pegylation could further increase the m vitro bioactivity of a tandem repeated TMP peptide in the cell-based proliferation assay.
• TMPs (and EMPs as described in Example 3) were expressed in either monomeric or dimeric form as either N-terminal or C-terminal fusions to the Fc region of human IgGi.
• the expression construct utilized the luxPR promoter promoter in the plasmid expression vector pAMG21.
• Fc-TMP A DNA sequence coding for the Fc region of human IgGi fused in-frame to a monomer of the TPO-mimetic peptide was constructed - using standard PCR technology. Templates for PCR reactions were the pFc-A3 vector and a synthetic TMP gene. The synthetic gene was
• oligonucleotides were annealed to form the duplex encoding an amino acid sequence (SEQ ID NOS: 367 and 368, respectively) shown below: AAAGGTGGAGGTGGTGGTATCGAAGGTCCGACTCTGCGTCAGTGGCTGGCTGCTCGTGCT
• the Fc portion of the molecule was generated in a PCR reaction with pFc-A3 using the primers shown below (SEQ ID NOS: 369 and 370):
• the oligonucleotides 1830-51 and 1842-98 contain an overlap of 24 nucleotides, allowing the two genes to be fused together in the correct reading frame by combining the above PCR products in a third reaction using the outside primers, 1216-52 and 1842-97.
• the final PCR gene product (the full length fusion gene) was digested with restriction endonucleases Xbal and BamHI, and then ligated into the vector pAMG21 and transformed into competent E. coli strain
• IgGi fused in-frame to a dimer of the TPO-mimetic peptide was constructed using standard PCR technology. Templates for PCR reactions were the pFc-A3 vector and a synthetic TMP-TMP gene. The synthetic gene was constructed from the 4 overlapping oligonucleotides (SEQ ID NOS: 371 to 374, respectively) shown below:
• AAA AGG ATC CTC GAG ATT ATG CGC GTG CTG CAA GCC ATT GGC GAA GGG TTG GGC CCT CAA TAC CTC CGC CGC C
• the 4 oligonucleotides were annealed to form the duplex encoding an amino acid sequence (SEQ ID NOS: 375 and 376, respectively) shown below:
• This duplex was amplified in a PCR reaction using 1830-52 and 1830-55 as the sense and antisense primers.
• the Fc portion of the molecule was generated in a PCR reaction with pFc-A3 using the primers 1216-52 and 1830-51 as described above for Fc-TMP.
• the full length fusion gene was obtained from a third PCR reaction using the outside primers 1216-52 and 1830-55.
• the final PCR gene product (the full length fusion gene) was digested with restriction endonucleases Xbal and BamHI, and then ligated into the vector pAMG21 and transformed into competent E. coli strain
• TMP-TMP-Fc A DNA sequence coding for a tandem repeat of the
• TPO-mimetic peptide fused in-frame to the Fc region of human IgGi was constructed using standard PCR technology. Templates for PCR reactions were the EMP-Fc plasmid from strain #3688 (see Example 3) and a synthetic gene encoding the TMP dimer.
• the synthetic gene for the tandem repeat was constructed from the 7 overlapping oligonucleotides shown below (SEQ ID NOS: 377 to 383, respectively): 1885-52 TTT TTT CAT ATG ATC GAA GGT CCG ACT CTG CGT CAG TGG
• This duplex was amplified in a PCR reaction using 1885-52 and 1885-58 as the sense and antisense primers.
• the Fc portion of the molecule was generated in a PCR reaction with DNA from the EMP-Fc fusion strain #3688 (see Example 3) using the primers 1885-54 and 1200-54.
• the full length fusion gene was obtained from a third PCR reaction using the outside primers 1885-52 and 1200-54.
• the final PCR gene product (the full length fusion gene) was digested with restriction endonucleases Xbal and BamHI, and then ligated into the vector pAMG21 and transformed into competent E. coli strain 2596 cells as described for Fc-EMP herein. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. A single such clone was selected and designated Amgen strain #3798.
• nucelotide and amino acid sequences (SEQ ID NOS: 9 and 10) of the fusion protein are shown in Figure 9.
• TMP-Fc A DNA sequence coding for a monomer of the TPO- mimetic peptide fused in-frame to the Fc region of human IgGi was obtained fortuitously in the ligation in TMP-TMP-Fc, presumably due to the ability of primer 1885-54 to anneal to 1885-53 as well as to 1885-58.
• a single clone having the correct nucleotide sequence for the TMP-Fc construct was selected and designated Amgen strain #3788.
• E. coli Expression in E. coli. Cultures of each of the pAMG21-Fc-fusion constructs in E. coli GM221 were grown at 37 °C in Luria Broth medium containing 50 mg/ml kanamycin. Induction of gene product expression from the luxPR promoter was achieved following the addition of the synthetic autoinducer N-(3-oxohexanoyl)-DL-homoserine lactone to the culture media to a final concentration of 20 ng/ml. Cultures were incubated at 37 °C for a further 3 hours. After 3 hours, the bacterial cultures were examined by microscopy for the presence of inclusion bodies and were then collected by centrifugation.
• the expression plasmid pAMG21 can be derived from the Amgen expression vector pCFM1656 (ATCC #69576) which in turn be derived from the Amgen expression vector system described in US Patent No. 4,710,473.
• the pCFM1656 plasmid can be derived from the described pCFM836 plasmid (Patent No. 4,710,473) by:
• the expression plasmid pAMG21 can then be derived from pCFM1656 by making a series of site-directed base changes by PCR overlapping oligo mutagenesis and DNA sequence substitutions. Starting with the Bglll site (plasmid bp # 180) immediately 5' to the plasmid replication promoter PcopB and proceeding toward the plasmid replication genes, the base pair changes are as shown in Table B below.
• the Amgen host strain #2596 is an E.coli K- 12 strain derived from Amgen strain #393. It has been modified to contain both the temperature sensitive lambda repressor cI857s7 in the early ebg region and the lacI Q repressor in the late ebg region (68 minutes). The presence of these two repressor genes allows the use of this host with a variety of expression systems, however both of these repressors are irrelevant to the expression from luxP R . The untransformed host has no antibiotic resistances.
• the ribosome binding site of the cI857s7 gene has been modified to include an enhanced RBS.
• F'tet/GMIOI After recombination and resolution only the chromosomal insert described above remains in the cell. It was renamed F'tet/GMIOI. F'tet/GMIOI was then modified by the delivery of a lacI Q construct into the ebg operon between nucleotide position 2493 and 2937 as numbered in the Genbank accession number M64441Gb_Ba with the deletion of the intervening ebg sequence.
• the construct was delivered to the chromosome using a recombinant phage called AGebg-LacIQ#5 into F'tet/GMIOI. After recombination and resolution only the chromosomal insert described above remains in the cell. It was renamed F'tet/GM221.
• the F'tet episome was cured from the strain using acridine orange at a concentration of 25 ⁇ g/ml in LB. The cured strain was identified as tetracyline sensitive and was stored as GM221.
• Fc-TMP-TMP gene product expression from the luxPR promoter was achieved following the addition of the synthetic autoinducer N-(3-oxohexanoyl)-DL-homoserine lactone to the culture media to a final concentration of 20 ng/ml and cultures were incubated at 37°C for a further 3 hours. After 3 hours, the bacterial cultures were examined by microscopy for the presence of inclusion bodies and were then collected by centrifugation. Refractile inclusion bodies were observed in induced cultures indicating that the Fc-TMP-TMP was most likely produced in the insoluble fraction in E. coli.
• Fc-TMP-TMP Purification of Fc-TMP-TMP. Cells are broken in water (1/10) by high pressure homogenization (2 passes at 14,000 PSI) and inclusion bodies are harvested by centrifugation (4200 RPM in J-6B for 1 hour).
• Inclusion bodies are solubilized in 6M guanidine, 50mM Tris, 8mM DTT, pH 8.7 for 1 hour at a 1/10 ratio.
• the solubilized mixture is diluted 20 times into 2M urea, 50 mM tris, 160mM arginine, 3mM cysteine, pH 8.5.
• the mixture is stirred overnight in the cold and then concentrated about 10 fold by ultafiltration. It is then diluted 3 fold with lOmM Tris, 1.5M urea, pH 9. The pH of this mixture is then adjusted to pH 5 with acetic acid.
• the precipitate is removed by centrifugation and the supernatant is loaded onto a SP-Sepharose Fast Flow column equilibrated in 20mM NaAc, 100 mM NaCl, pH 5(10mg/ml protein load, room temperature).
• the protein is eluted off using a 20 column volume gradient in the same buffer ranging from lOOmM NaCl to 500mM NaCl.
• the pool from the column is diluted 3 fold and loaded onto a SP-Sepharose HP column in 20 mM NaAc, 150 mM NaCl, pH 5(10 mg/ml protein load, room temperature).
• the protein is eluted off using a 20 column volume gradient hs in the same buffer ranging from 150 mM NaCl to 400 mM NaCl.
• the peak is pooled and filtered.
• mice per group treated on day 0 Two groups started 4 days apart for a total of 20 mice per group. Five mice bled at each time point, mice were bled a minimum of three times a week. Mice were anesthetized with isoflurane and a total volume of 140-160 ⁇ l of blood was obtained by puncture of the orbital sinus. Blood was counted on a Technicon HIE blood analyzer running software for murine blood. Parameters measured were white blood cells, red blood cells, hematocrit, hemoglobin, platelets, neutrophils.
• mice were either injected subcutaneously for a bolus treatment or implanted with 7-day micro-osmotic pumps for continuous delivery. Subcutaneous injections were delivered in a volume of 0.2 ml. Osmotic pumps were inserted into a subcutaneous incision made in the skin between the scapulae of anesthetized mice. Compounds were diluted in PBS with 0.1% BSA. All experiments included one control group, labeled "carrier" that were treated with this diluent only. The concentration of the test articles in the pumps was adjusted so that the calibrated flow rate from the pumps gave the treatment levels indicated in the graphs.
• mice A dose titration of the compound was delivered to mice in 7 day micro-osmotic pumps. Mice were treated with various compounds at a single dose of 100 ⁇ g/kg in 7 day osmotic pumps. Some of the same compounds were then given to mice as a single ⁇ bolus injection. -
• Activity test results The results of the activity experiments are shown in Figures 11 and 12.
• the maximum effect was seen with the compound of SEQ ID NO: 18 was at 100 ⁇ g/kg/day; the 10 ⁇ g/kg/day dose was about 50% maximally active and 1 ⁇ g/kg/day was the lowest dose at which activity could be seen in this assay system.
• the compound at 10 ⁇ g/kg/day dose was about equally active as 100 ⁇ g/kg/day unpegylated rHu-MGDF in the same experiment.
• Fc-EMP A DNA sequence coding for the Fc region of human IgGi fused in-frame to a monomer of the EPO-mimetic peptide was constructed using standard PCR technology. Templates for PCR reactions were a vector containing the Fc sequence (pFc-A3, described in International application WO 97/23614, published July 3, 1997) and a synthetic gene encoding EPO monomer. The synthetic gene for the monomer was constructed from the 4 overlapping oligonucleotides (SEQ ID NOS: 390 to 393, respectively) shown below:
• the 4 oligonucleotides were annealed to form the duplex encoding an amino acid sequence (SEQ ID NOS: 394 and 395, respectively) shown below:
• This duplex was amplified in a PCR reaction using 1798-18 GCA GAA GAG CCT CTC CCT GTC TCC GGG TAA AGG TGG AGG TGG TGG TGG AGG TAC TTA CTC T and
• the Fc portion of the molecule was generated in a PCR reaction with pFc-A3 using the primers
• oligonucleotides 1798-17 and 1798-18 contain an overlap of 61 nucleotides, allowing the two genes to be fused together in the correct reading frame by combining the above PCR products in a third reaction using the outside primers, 1216-52 and 1798-19.
• the final PCR gene product (the full length fusion gene) was digested with restriction endonucleases Xbal and BamHI, and then ligated into the vector p AMG21 (described below), also digested with Xbal and BamHI. Ligated DNA was transformed into competent host cells of E. coli strain 2596 (GM221, described herein). Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. A single such clone was selected and designated Amgen strain #3718.
• EMP-Fc A DNA sequence coding for a monomer of the EPO- mimetic peptide fused in-frame to the Fc region of human IgGi was constructed using standard PCR technology. Templates for PCR reactions were the pFC-A3a vector and a synthetic gene encoding EPO monomer. The synthetic gene for the monomer was constructed from the 4 overlapping oligonucleotides 1798-4 and 1798-5 (above) and 1798-6 and 1798-7 (SEQ ID NOS: 400 and 401, respectively) shown below:
• the 4 oligonucleotides were annealed to form the duplex encoding an amino acid sequence (SEQ ID NOS: 402 and 403, respectively) shown below:
• This duplex was amplified in a PCR reaction using
• the Fc portion of the molecule was generated in a PCR reaction with pFc-A3 using the primers
• oligonucleotides 1798-22 and 1798-23 contain an overlap of 43 nucleotides, allowing the two genes to be fused together in the correct reading frame by combining the above PCR products in a third reaction using the outside primers, 1787-21 and 1200-54.
• the final PCR gene product (the full length fusion gene) was digested with restriction endonucleases Xbal and BamHI, and then ligated
• EMP-EMP-Fc A DNA sequence coding for a dimer of the EPO- mimetic peptide fused in-frame to the Fc region of human IgGi was constructed using standard PCR technology. Templates for PCR reactions were the EMP-Fc plasmid from strain #3688 above and a synthetic gene encoding the EPO dimer. The synthetic gene for the dimer was constructed from the 8 overlapping oligonucleotides (SEQ ID NOS:408 to 415, respectively) shown below:
• This duplex was amplified in a PCR reaction using 1869-23 and 1871-79 (shown above) as the sense and antisense primers.
• the Fc portion of the molecule was generated in a PCR reaction with strain 3688 DNA using the primers 1798-23 and 1200-54 (shown above).
• the oligonucleotides 1871-79 and 1798-23 contain an overlap of 31 nucleotides, allowing the two genes to be fused together in the correct reading frame by combining the above PCR products in a third reaction using the outside primers, 1869-23 and 1200-54.
• the final PCR gene product (the full length fusion gene) was digested with restriction endonucleases Xbal and BamHI, and then ligated into the vector pAMG21 and transformed into competent E. coli strain 2596 cells as described for Fc-EMP. Clones were screened for ability to produce the recombinant protein product and possession of the gene fusion having the correct nucleotide sequence. A single such clone was selected and designated Amgen strain #3813.
• nucleotide and amino acid sequences (SEQ ID NOS: 19 and 20, respectively) of the resulting fusion protein are shown in Figure 15. There is a silent mutation at position 145 (A to G, shown in boldface) such that the final construct has a different nucleotide sequence than the oligonucleotide 1871-72 from which it was derived.
• Fc-EMP-EMP A DNA sequence coding for the Fc region of human IgGi fused in-frame to a dimer of the EPO-mimetic peptide was constructed using standard PCR technology. Templates for PCR reactions were the plasmids from strains 3688 and 3813 above.
• the Fc portion of the molecule was generated in a PCR reaction with strain 3688 DNA using the primers 1216-52 and 1798-17 (shown above).
• the EMP dimer portion of the molecule was the product of a second PCR reaction with strain 3813 DNA using the primers 1798-18 (also shown above) and SEQ ID NO: 418, shown below:
• the oligonucleotides 1798-17 and 1798-18 contain an overlap of 61 nucleotides, allowing the two genes to be fused together in the correct reading frame by combining the above PCR products in a third reaction using the outside primers, 1216-52 and 1798-20.
• the final PCR gene product (the full length fusion gene) was digested with restriction endonucleases Xbal and BamHI, and then ligated into the vector pAMG21 and transformed into competent E. coli strain 2596 cells as described for Fc-EMP. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. A single such clone was selected and designated Amgen strain #3822.
• nucleotide and amino acid sequences (SEQ ID NOS: and , respectively) of the fusion protein are shown in Figure 16.
• mice Normal female BDFl approximately 10-12 weeks of age.
• mice per group treated on day 0 Two groups started 4 days apart for a total of 20 mice per group. Five mice bled at each time point, mice were bled a maximum of three times a week. Mice were anesthetized with isoflurane and a total volume of 140-160 ml of blood was obtained by puncture of the orbital sinus. Blood was counted
• mice were either injected subcutaneously for a bolus treatment or implanted with 7 day micro-osmotic pumps for continuous delivery. Subcutaneous injections were delivered in a volume of 0.2 ml. Osmotic pumps were inserted into a subcutaneous incision made in the skin between the scapulae of anesthetized mice. Compounds were diluted in PBS with 0.1% BSA. All experiments included one control group, labeled "carrier" that were treated with this diluent only. The concentration of the test articles in the pumps was adjusted so that the calibrated flow rate from the pumps gave the treatment levels indicated in the graphs.
• EPO mimetic peptides were delivered to mice as a single bolus injection at a dose of 100 ⁇ g/kg.
• Fc-EMPs were delivered to mice in 7-day micro-osmotic pumps. The pumps were not replaced at the end of 7 days. Mice were bled until day 51 when HGB and HCT returned to baseline levels.
• TNF- ⁇ inhibitors Fc-TNF- ⁇ inhibitors.
• a DNA sequence coding for the Fc region of human IgGi fused in-frame to a monomer of the TNF- ⁇ inhibitory peptide was constructed using standard PCR technology.
• the Fc and 5 glycine linker portion of the molecule was generated in a PCR reaction with DNA from the Fc-EMP fusion strain #3718 (see Example 3) using the sense primer 1216-52 and the antisense primer 2295-89 (SEQ ID NOS: 1112 and 1113 , respectively).
• the nucleotides encoding the TNF- ⁇ inhibitory peptide were provided by the PCR primer 2295-89 shown below:
• the oligonucleotide 2295-89 overlaps the glycine linker and Fc portion of the template by 22 nucleotides, with the PCR resulting in the two genes being fused together in the correct reading frame.
• the PCR gene product (the full length fusion gene) was digested with restriction endonucleases Ndel and BamHI, and then ligated into the vector pAMG21 and transformed into competent E. coli strain 2596 cells as described for EMP-Fc herein. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. A single such clone was selected and designated Amgen strain #4544.
• TNF- ⁇ inhibitor-Fc A DNA sequence coding for a TNF- ⁇ inhibitory peptide fused in-frame to the Fc region of human IgGi was constructed using standard PCR technology. The template for the PCR reaction was a plasmid containing an unrelated peptide fused via a five glycine linker to Fc. The nucleotides encoding the TNF- ⁇ inhibitory peptide were provided by the sense PCR primer 2295-88, with primer 1200-54 serving as the antisense primer (SEQ ID NOS: 1117 and 407, respectively). The primer sequences are shown below:
• the oligonucleotide 2295-88 overlaps the glycine linker and Fc portion of the template by 24 nucleotides, with the PCR resulting in the two genes being fused together in the correct reading frame.
• the PCR gene product (the full length fusion gene) was digested with restriction endonucleases Ndel and BamHI, and then ligated into the vector pAMG21 and transformed into competent E. coli strain 2596 cells as described for EMP-Fc herein. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. A single such clone was selected and designated Amgen strain #4543.
• the nucleotide and amino acid sequences (SEQ ID NOS: 1057 and 1058) of the fusion protein are shown in Figures 20A and 20B.
• Expression in E. coli Cultures of each of the pAMG21-Fc-fusion constructs in E. coli GM221 were grown at 37 °C in Luria Broth medium containing 50 mg/ml kanamycin. Induction of gene product expression from the luxPR promoter was achieved following the addition of the synthetic autoinducer N-(3-oxohexanoyl)-DL-homoserine lactone to the culture media to a final concentration of 20 ng/ml. Cultures were incubated at 37 °C for a further 3 hours.
• inclusion bodies are solubilized in 6M guanidine, 50mM Tris, 8mM DTT, pH 8.7 for 1 hour at a 1/10 ratio.
• the solubilized mixture is diluted 20 times into 2M urea, 50 mM tris, 160mM arginine, 3mM cysteine, pH 8.5.
• the mixture is stirred overnight in the cold and then concentrated about 10 fold by ultafiltration. It is then diluted 3 fold with lOmM Tris, 1.5M urea, pH 9. The pH of this mixture is then adjusted to pH 5 with acetic acid.
• the precipitate is removed by centrifugation and the supernatant is loaded onto a SP-Sepharose Fast Flow column equilibrated in 20mM NaAc, 100 mM NaCl, pH 5 (lOmg/ml protein load, room temperature).
• the protein is eluted from the column using a 20 column volume gradient in the same buffer ranging from lOOmM NaCl to 500mM NaCl.
• the pool from the column is diluted 3 fold and loaded onto a SP-Sepharose HP column in 20mM NaAc, 150mM NaCl, pH 5(10mg/ml protein load, room temperature).
• the protein is eluted using a 20 column volume gradient in the same buffer ranging from 150mM NaCl to 400mM NaCl. The peak is pooled and filtered. Characterization of activity of Fc-TNF- ⁇ inhibitor and TNF- ⁇ inhibitor -Fc. Binding of these peptide fusion proteins to TNF- ⁇ can be characterized by BIAcore by methods available to one of ordinary skill in the art who is armed with the teachings of the present specification.
• Fc-IL-1 antagonist A DNA sequence coding for the Fc region of human IgGi fused in-frame to a monomer of an IL-1 antagonist peptide was constructed using standard PCR technology. The Fc and 5 glycine linker portion of the molecule was generated in a PCR reaction with DNA from the Fc-EMP fusion strain #3718 (see Example 3) using the sense primer 1216-52 and the antisense primer 2269-70 (SEQ ID NOS: 1112 and 1118, respectively). The nucleotides encoding the IL-1 antagonist peptide ⁇ were provided by the PCR primer 2269-70 shown below:
• the oligonucleotide 2269-70 overlaps the glycine linker and Fc portion of the template by 22 nucleotides, with the PCR resulting in the two genes being fused together in the correct reading frame.
• the PCR gene product (the full length fusion gene) was digested with restriction endonucleases Ndel and BamHI, and then ligated into the vector pAMG21 and transformed into competent E. coli strain 2596 cells as described for EMP-Fc herein. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. A single such clone was selected and designated Amgen strain #4506.
• nucleotide and amino acid sequences (SEQ ID NOS: 1059 and 1060) of the fusion protein are shown in Figures 21 A and 21B.
• IL-1 antagonist-Fc A DNA sequence coding for an IL-1 antagonist peptide fused in-frame to the Fc region of human IgGi was constructed using standard PCR technology. The template for the PCR reaction was a plasmid containing an unrelated peptide fused via a five glycine linker to Fc. The nucleotides encoding the IL-1 antagonist peptide were provided by the sense PCR primer 2269-69, with primer 1200-54 serving as the antisense primer (SEQ ID NOS: 1119 and 407, respectively). The primer sequences are shown below:
• the oligonucleotide 2269-69 overlaps the glycine linker and Fc portion of the template by 24 nucleotides, with the PCR resulting in the two genes being fused together in the correct reading frame.
• the PCR gene product (the full length fusion gene) was digested with restriction endonucleases Ndel and BamHI, and then ligated into the vector pAMG21 and transformed into competent E. coli strain 2596 cells as described for EMP-Fc herein. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. A single such clone was selected and designated Amgen strain #4505.
• nucleotide and amino acid sequences (SEQ ID NOS: 1061 and 1062) of the fusion protein are shown in Figures 22 A and 22B. Expression and purification were carried out as in previous examples. Characterization of Fc-IL-1 antagonist peptide and IL-1 antagonist peptide-Fc activity. IL-1 Receptor Binding competition between IL-l ⁇ , IL- 1RA and Fc-conjugated IL-1 peptide sequences was carried out using the IGEN system.
• Reactions contained 0.4 nM biotin-IL-lR + 15 nM IL-l-TAG + 3 uM competitor + 20 ug/ml streptavidin-conjugate beads, where competitors were IL-1RA, Fc-IL-1 antagonist, IL-1 antagonist-Fc).
• Fc-NEGF Antagonist A D ⁇ A sequence coding for the Fc region of human IgGi fused in-frame to a monomer of the NEGF mimetic peptide was constructed using standard PCR technology.
• the templates for the PCR reaction were the pFc-A3 plasmid and a synthetic NEGF mimetic peptide gene.
• the synthetic gene was assembled by annealing the following two oligonucleotides primer (SEQ ID ⁇ OS: 1120 and 1121, respectively):
• the two oligonucleotides anneal to form the following duplex encoding an amino acid sequence shown below (SEQ ID ⁇ OS 1122 ):
• This duplex was amplified in a PCR reaction using 2293-05 and 2293-06 as the sense and antisense primers (SEQ ID ⁇ OS. 1125 and 1126).
• the Fc portion of the molecule was generated in a PCR reaction with the pFc-A3 plasmid using the primers 2293-03 and 2293-04 as the sense and antisense primers (SEQ ID ⁇ OS. 1123 and 1124 r respectively).
• the full length fusion gene was obtained from a third PCR reaction using the outside primers 2293-03 and 2293-06. These primers are shown below: 2293-03 ATT TGA TTC TAG AAG GAG GAA TAA CAT ATG GAC AAA ACT CAC ACA TGT
• the PCR gene product (the full length fusion gene) was digested with restriction endonucleases Ndel and BamHI, and then ligated into the vector p AMG21 and transformed into competent E. coli strain 2596 cells as described for EMP-Fc herein. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. A single such clone was selected and designated Amgen strain #4523.
• the nucleotide and amino acid sequences (SEQ ID NOS: 1063 and
• VEGF antagonist -Fc A DNA sequence coding for a NEGF mimetic peptide fused in-frame to the Fc region of human IgGi was constructed using standard PCR technology. The templates for the PCR reaction were the pFc-A3 plasmid and the synthetic NEGF mimetic peptide gene described above. The synthetic duplex was amplified in a PCR reaction using 2293-07 and 2293-08 as the sense and antisense primers (SEQ ID ⁇ OS. 1127 and 1128, respectively).
• the Fc portion of the molecule was generated in a PCR reaction with the pFc-A3 plasmid using the primers 2293-09 and 2293-10 as the sense and antisense primers (SEQ ID ⁇ OS. 1129 and 1130, respectively).
• the full length fusion gene was obtained from a third PCR reaction using the outside primers 2293-07 and 2293-10. These primers are shown below:
• the PCR gene product (the full length fusion gene) was digested with restriction endonucleases Ndel and BamHI, and then ligated into the vector pAMG21 and transformed into competent E. coli strain 2596 cells as described for EMP-Fc herein. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. A single such clone was selected and designated Amgen strain #4524.
• nucleotide and amino acid sequences (SEQ ID NOS: 1065 and 1066) of the fusion protein are shown in Figures 24A and 24B. Expression and purification were carried out as in previous examples.
• Fc-MMP inhibitor A DNA sequence coding for the Fc region of human IgGi fused in-frame to a monomer of an MMP inhibitory peptide was constructed using standard PCR technology. The Fc and 5 glycine linker portion of the molecule was generated in a PCR reaction with DNA from the Fc-TNF- ⁇ inhibitor fusion strain #4544 (see Example 4) using the sense primer 1216-52 and the antisense primer 2308-67 (SEQ ID NOS: 1112 and 1131, respectively). The nucleotides encoding the MMP inhibitor peptide were provided by the PCR primer 2308-67 shown below:
• the oligonucleotide 2308-67 overlaps the glycine linker and Fc portion of the template by 22 nucleotides, with the PCR resulting in the two genes being fused together in the correct reading frame.
• the PCR gene product (the full length fusion gene) was digested with restriction endonucleases Ndel and BamHI, and then ligated into the vector pAMG21 and transformed into competent E. coli strain 2596 cells as described for EMP-Fc herein. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. A single such clone was selected and designated Amgen strain #4597.
• nucleotide and amino acid sequences (SEQ ID NOS: 1067 and 1068) of the fusion protein are shown in Figures 25A and 25B. Expression and purification were carried out as in previous examples.
• MMP Inhibitor-Fc A DNA sequence coding for an MMP inhibitory peptide fused in-frame to the Fc region of human IgGi was constructed using standard PCR technology. The Fc and 5 glycine linker portion of the molecule was generated in a PCR reaction with DNA from the Fc-TNF- ⁇ inhibitor fusion strain #4543 (see Example 4). The nucleotides encoding the MMP inhibitory peptide were provided by the sense PCR primer 2308- 66, with primer 1200-54 serving as the antisense primer (SEQ ID NOS: 1132 and 407, respectively). The primer sequences are shown below: -
• the oligonucleotide 2269-69 overlaps the glycine linker and Fc portion of the template by 24 nucleotides, with the PCR resulting in the two genes being fused together in the correct reading frame.
• the PCR gene product (the full length fusion gene) was digested with restriction endonucleases Ndel and BamHI, and then ligated into the vector pAMG21 and transformed into competent E. coli strain 2596 cells as described for EMP-Fc herein. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. A single such clone was selected and designated Amgen strain #4598.
• G-CSF Granulocyte colony stimulating factor

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Engineering & Computer Science (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Chemical & Material Sciences (AREA)
• Genetics & Genomics (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Zoology (AREA)
• Biophysics (AREA)
• Gastroenterology & Hepatology (AREA)
• Toxicology (AREA)
• Hematology (AREA)
• Diabetes (AREA)
• Oncology (AREA)
• Wood Science & Technology (AREA)
• Biomedical Technology (AREA)
• Immunology (AREA)
• Virology (AREA)
• Communicable Diseases (AREA)
• Rheumatology (AREA)
• Biotechnology (AREA)
• Epidemiology (AREA)
• General Engineering & Computer Science (AREA)
• Microbiology (AREA)
• Pulmonology (AREA)
• Physical Education & Sports Medicine (AREA)
• AIDS & HIV (AREA)
• Orthopedic Medicine & Surgery (AREA)

Priority Applications (25)

Applications Claiming Priority (4)

Publications (2)

Family

ID=26802505

Family Applications (1)

Country Status (29)

Cited By (197)

Families Citing this family (379)