WO2007136988A2 - Compounds and methods for modulating expression of gccr - Google Patents

Compounds and methods for modulating expression of gccr Download PDF

Info

Publication number
WO2007136988A2
WO2007136988A2 PCT/US2007/068410 US2007068410W WO2007136988A2 WO 2007136988 A2 WO2007136988 A2 WO 2007136988A2 US 2007068410 W US2007068410 W US 2007068410W WO 2007136988 A2 WO2007136988 A2 WO 2007136988A2
Authority
WO
WIPO (PCT)
Prior art keywords
short antisense
certain embodiments
antisense compound
nucleotides
certain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2007/068410
Other languages
English (en)
French (fr)
Other versions
WO2007136988A8 (en
WO2007136988A3 (en
Inventor
Sanjay Bhanot
Richard S. Geary
Robert Mckay
Brett P. Monia
Punit P. Seth
Andrew M. Siwkowski
Eric E. Swayze
Edward Wancewicz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Isis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=40134111&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2007136988(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from PCT/US2007/061183 external-priority patent/WO2007090071A2/en
Priority to AU2007253909A priority Critical patent/AU2007253909B2/en
Priority to EP07811878.3A priority patent/EP2019692B1/en
Priority to DK07811878.3T priority patent/DK2019692T3/da
Priority to US12/299,583 priority patent/US8372967B2/en
Application filed by Isis Pharmaceuticals Inc filed Critical Isis Pharmaceuticals Inc
Priority to BRPI0711429-0A priority patent/BRPI0711429A2/pt
Priority to JP2009510136A priority patent/JP2009536039A/ja
Publication of WO2007136988A2 publication Critical patent/WO2007136988A2/en
Anticipated expiration legal-status Critical
Publication of WO2007136988A3 publication Critical patent/WO2007136988A3/en
Publication of WO2007136988A8 publication Critical patent/WO2007136988A8/en
Priority to US13/662,263 priority patent/US8969316B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/38Drugs for disorders of the endocrine system of the suprarenal hormones
    • A61P5/46Drugs for disorders of the endocrine system of the suprarenal hormones for decreasing, blocking or antagonising the activity of glucocorticosteroids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/48Drugs for disorders of the endocrine system of the pancreatic hormones
    • A61P5/50Drugs for disorders of the endocrine system of the pancreatic hormones for increasing or potentiating the activity of insulin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/01Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/0102Diacylglycerol O-acyltransferase (2.3.1.20)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3515Lipophilic moiety, e.g. cholesterol

Definitions

  • RNAi RNA interference
  • Sequence-specificity makes antisense compounds extremely attractive as tools for target validation and gene functionalization, as well as research tools for identifying and characterizing nucleases and as therapeutics to selectively modulate the expression of genes involved in the pathogenesis of any one of a variety of diseases.
  • Antisense technology is an effective means for reducing the expression of one or more specific gene products and can therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications.
  • Chemically modified nucleosides are routinely used for incorporation into i ⁇ oi vv ⁇ iz - -
  • RNAi RNA interference
  • Sequence-specificity makes antisense compounds extremely attractive as tools for target validation and gene functionalization, as well as research tools for identifying and characterizing nucleases and as therapeutics to selectively modulate the expression of genes involved in the pathogenesis of any one of a variety of diseases.
  • Antisense technology is an effective means for reducing the expression of one or more specific gene products and can therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications.
  • Chemically modified nucleosides are routinely used for incorporation into - - antisense compounds to enhance one or more properties, such as nuclease resistance, pharmacokinetics or affinity for a target RNA.
  • the present disclosure describes incorporation of chemically-modified high-affinity nucleotides into antisense compounds allows for short antisense compounds about 8-16 nucleobases in length useful in the reduction of target RNAs in animals with increased potency and improved therapeutic index.
  • short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo.
  • Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment.
  • short antisense compounds and methods of using said compounds to reduce target RNA expression in cells or tissues.
  • a method of reducing expression of a target in an animal comprising administering to the animal a short antisense compound targeted to a nucleic acid of such target.
  • shorts antisense compounds are oligonucleotide compounds.
  • short antisense oligonucleotides are about 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length and comprises a gap region flanked on each side by a wing, wherein each wing independently consists of 1 to 3 nucleotides.
  • Preferred motifs include but are not limited to wing - deoxy gap -wing motifs selected from 3-10-3, 2-10-3, 2-10-2, 1-10-1, 2-8-2, 1-8-1, 3-6-3 or 1-6-1.
  • the short antisense oligonucleotide comprise at least one high-affinity modification.
  • the high-affinity modification includes chemically-modified high-affinity nucleotides.
  • each wing independently consists of 1 to 3 high-affinity modified nucleotides.
  • the high affinity modified nucleotides are sugar-modified nucleotides.
  • short antisense compounds exhibit greater uptake in the gut as compared to antisense compounds of greater length.
  • methods of reducing a target in an animal comprising orally administering the short antisense compounds of the present invention.
  • short antisense compounds are targeted to a nucleic acid encoding a protein selected from ApoB, SGLT2, PCSK9, SODl, CRP, GCCR, GCGR, DGAT2, PTPlB and PTEN.
  • a short antisense compound targeted to a nucleic acid encoding a target that is involved in regulating glucose metabolism or clearance, lipid metabolism, cholesterol metabolism, or insulin signaling wherein said short antisense compound is 8 to 16 nucleotides in length and comprises a gap region flanked on each side by a wing, wherein each wing independently consists of 1 to 3 high- affinity modified nucleotides.
  • Certain targets involved in regulating glucose metabolism or clearance, lipid metabolism, cholesterol metabolism, or insulin signaling include, but are not limited to, GCGR and ApoB-100.
  • short antisense compounds targeting nucleic acids encoding GCGR and ApoB-100 and methods of reducing expression of said targets and/or target nucleic acids in animal.
  • short antisense compounds targeting nucleic acids encoding GCGR, and ApoB-100 for the treatment of a metabolic or cardiovascular disease or condition.
  • short antisense compounds further comprise a conjugate group. Conjugate groups include, but are not limited to, Ci 6 and cholesterol.
  • short antisense compounds comprise at least one modified nucleobase, interaucleoside linkage or sugar moiety.
  • such modified internucleoside linkage is a phosphorothioate internucleoside linkage.
  • each internucleoside linkage is a phosphorothioate internucleoside linkage.
  • short antisense compounds comprise at least one high affinity modification.
  • the high-affinity modification is a chemically-modified high- affinity nucleotide
  • chemically-modified high affinity nucleotides are sugar- modified nucleotides
  • at least one of the sugar-modified nucleotides comprises a bridge between the 4' and the 2' position of the sugar.
  • each of the sugar-modified nucleotides is, independently, in the ⁇ -D or ⁇ -L sugar conformation, hi certain embodiments, each of said high-affinity modified nucleotides confers a T 1n of at least 1 to 4 degrees per nucleotide, hi certain embodiments, each of said sugar-modified nucleotides comprises a 2'-substituent group that is other than H or OH.
  • Such sugar-modified nucleotides include those having a 4' to 2' bridged bicyclic sugar moiety, hi certain embodiments, each of the 2'-substituent groups is, independently, alkoxy, substituted alkoxy, or halogen.
  • each of the 2'-substituent groups is OCH 2 CH 2 OCH 3 (2'-MOE).
  • each of said bridges is, independently, -[C(Ri)(R 2 )],,-, -[C(R] )(R 2 )] n -O-, -C(RjR 2 )- N(Rj)-O- or -C(R J R 2 )-O-N(R J )-.
  • each of said bridges is, independently, 4'-(CH 2 ) 3 -2', 4'-(CH 2 ) 2 -2', 4'-CR 2 -O-I', 4'-(CH 2 ) 2 -O-2', 4'-CH 2 -O-N(Rj)-2' and 4'-CH 2 -N(R,)-O-2'- wherein each R, is, independently, H, a protecting group or C]-C] 2 alkyl.
  • provided herein are short antisense compounds useful in the reduction of targets and/or target RNAs associated with disease states in animals.
  • methods of using the short antisense compounds for reducing expression of a target RNA in an animal hi certain embodiments, provided herein is the use of a short antisense compound in the preparation of a medicament for the treatment of a metabolic disorder in an animal.
  • provided herein is the use of a short antisense compound in the preparation of a medicament for increasing insulin sensitivity, decreasing blood glucose or decreasing HbA] 0 in an animal.
  • a short antisense compound in the preparation of a medicament for decreasing total serum cholesterol, serum LDL, serum VLDL, serum HDL, serum triglycerides, serum apolipoprotein(a) or free fatty acids in an animal.
  • short antisense compounds provided herein exhibit equal or increased potency with regard to target RNA knockdown as compared to longer parent antisense oligonucleotide at least 20 nucleotides in length. In certain embodiments, short antisense compounds exhibit a faster onset of action (target RNA reduction) as compared to the parent antisense oligonucleotide. In certain embodiments, increased potency is in the kidney. In certain embodiments, target RNA is predominately expressed in the kidney. In certain embodiments, increased potency is in the liver. In certain embodiments, target RNA is predominately expressed in the liver.
  • nucleoside means a glycosylamine comprising a nucleobase and a sugar. Nucleosides includes, but are not limited to, naturally occurring nucleosides, abasic nucleosides, modified nucleosides, and nucleosides having mimetic bases and/or sugar groups.
  • nucleotide refers to a glycosomine comprising a nucleobase and a sugur having a phosphate group covalently linked to the sugar. Nucleotides may be modified with any of a variety of substituents.
  • nucleobase refers to the base portion of a nucleoside or nucleotide.
  • a nucleobase may comprise any atom or group of atoms capable of hydrogen bonding to a base of another nucleic acid.
  • heterocyclic base moiety refers to a nucleobase comprising a heterocycle.
  • deoxyribonucleotide means a nucleotide having a hydrogen at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a - - variety of substituents.
  • ribonucleotide means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.
  • oligomeric compound refers to a polymeric structure comprising two or more sub-structures and capable of hybridizing to a region of a nucleic acid molecule.
  • oligomeric compounds are oligonucleosides.
  • oligomeric compounds are oligonucleotides.
  • oligomeric compounds are antisense compounds.
  • oligomeric compounds are antisense oligonucleotides.
  • oligomeric compounds are short antisense compounds.
  • oligomeric compounds are short antisense oligonucleotides.
  • oligomeric compounds are chimeric oligonucleotides.
  • monomer refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occuring or modified.
  • oligonucleoside refers to an oligonucleotide in which the internucleoside linkages do not contain a phosphorus atom.
  • oligonucleotide refers to an oligomeric compound comprising a plurality of linked nucleotides. In certain embodiment, one or more nucleotides of an oligonucleotide is modified. In certain embodiments, an oligonucleotide comprises ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). In certain embodiments, oligonucleotides are composed of naturally- and/or non-naturally-occurring nucleobases, sugars and covalent internucleotide linkages, and may further include non-nucleic acid conjugates.
  • nucleotide linkage refers to a covalent linkage between adjacent nucleotides.
  • Monomelic linkage refers to a covalent linkage between two monmers.
  • Monomelic linkages include, but are not limited to internucleotide linkages and internucleoside linkages.
  • naturally occuring internucleotide linkage refers to a 3' to 5' phosphodiester linkage.
  • antisense compound refers to an oligomeric compound that is at least partially complementary to a target nucleic acid molecule to which it hybridizes. In certain embodiments, an antisense compound modulates (increases or decreases) expression of a target nucleic acid.
  • Antisense compounds include, but are not limited to, compounds that are oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, and chimeric combinations of these. Consequently, while all antisense compounds are oligomeric compounds, not all oligomeric compounds are antisense compounds.
  • antisense oligonucleotide refers to an antisense compound that is an oligonucleotide.
  • parent antisense oligonucleotide refers to an oligonucleotide 20 nucleotides in length having a deoxy gap region having ten 2'-deoxyribonucleotides, flanked by a first and a second wing region each having five 2'-O-(2-methoxyethyl) ribonucleotides (a 5-10-5 MOE gapmer) and comprising the sequence of the corresponding short antisense compound to which it is a parent.
  • short antisense compound refers to an antisense compound about 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomers in length.
  • a short antisense compound has at least one high-affinity modification.
  • short antisense oligonucleotide or refers to an antisense oligonucleotide about 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleotides in length.
  • a short antisense oligonucleotide has at least one high-affinity modification.
  • short gapmer refers to a short antisense oligonucleotide having a first and a second wing region each independently 1 to 3 nucleotides in length and a gap region 2 to 14 nucleobase in length.
  • motif refers to the pattern of unmodified and modified nucleotides in a short antisense compound
  • chimeric antisense oligomer refers to an antisense oligomeric compound, having at least one sugar, nucleobase or internucleoside linkage that is differentially modified as compared to at least on other sugar, nucleobase or internucleoside linkage within the same antisense oligomeric compound.
  • the remainder of the sugars, nucleobases and internucleoside linkages can be independently modified or unmodified, the same or different.
  • chimeric antisense oligonucleotide refers to an antisense oligonucleotide, having at least one sugar, nucleobase or internucleoside linkage that is differentially modified as compared to at least on other sugar, nucleobase or internucleoside linkage within the same antisense oligonucleotide.
  • the remainder of the sugars, nucleobases and internucleoside linkages can be independently modified or unmodified, the same or different.
  • mixed-backbone antisense oligonucleotide refers to an antisense oligonucleotide wherein at least one internucleoside linkage of the antisense oligonucleotide is different from at least one other internucleotide linkage of the antisense oligonucleotide.
  • target refers to a protein, the modulation of which is desired.
  • target gene refers to a gene encoding a target.
  • target nucleic acid and “nucleic acid molecule encoding a target” refer to any nucleic acid molecule the expression or activity of which is capable of being modulated by an antisense compound.
  • Target nucleic acids include, but are not limited to, RNA (including, but not limited to pre-mRNA and mRNA or portions thereof) transcribed from DNA encoding a target, and also cDNA derived from such RNA, and miRNA.
  • the target nucleic acid can be a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. ⁇ oiw ⁇ iz - -
  • targeting refers to the association of an antisense compound to a particular target nucleic acid molecule or a particular region of nucleotides within a target nucleic acid molecule.
  • 5' target site refers to the nucleotide of a target nucleic acid which is complementary to the 5 '-most nucleotide of a particular antisense compound.
  • 3' target site refers to the nucleotide of a target nucleic acid which is complementary to the 3 '-most nucleotide of a particular antisense compound.
  • target region refers to a portion of a target nucleic acid to which one or more antisense compounds is complementary.
  • target segment refers to a smaller or sub-portions of a region within a target nucleic acid.
  • nucleobase complementarity refers to a nucleobase that is capable of base pairing with another nucleobase.
  • adenine (A) is complementary to thymine (T).
  • adenine (A) is complementary to uracil (U).
  • complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid.
  • nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid
  • the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
  • non-complementary nucleobase refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
  • the term "complementary” refers to the capacity of an oligomeric compound to hybridize to another oligomeric compound or nucleic acid through nucleobase complementarity.
  • an antisense compound and its target are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleobases that can bond with each other to allow stable association between the antisense compound and the target.
  • nucleobases that can bond with each other to allow stable association between the antisense compound and the target.
  • antisense compounds may comprise up to about 20% nucleotides that are mismatched (i.e., are not nucleobase complementary to the corresponding nucleotides of the target).
  • the antisense compounds contain no more than about 15%, more preferably not more than about 10%, most preferably not more than 5% or no mismatches.
  • the remaining nucleotides are nucleobase complementary or otherwise do not disrupt hybridization (e.g., universal bases).
  • One of ordinary skill in the art would recognize the compounds provided herein are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to a target nucleic acid.
  • mismatch refers to a non-complementary nucleobase within a complementary oligomeric compound.
  • hybridization means the pairing of complementary oligomeric compounds (e.g., COREUU&IWUIZ -9- an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases).
  • nucleobases complementary nucleoside or nucleotide bases
  • the natural base adenine is nucleobase complementary to the natural nucleobases thymidine and uracil which pair through the formation of hydrogen bonds.
  • the natural base guanine is nucleobase complementary to the natural bases cytosine and 5-methyl cytosine. Hybridization can occur under varying circumstances.
  • the term “specifically hybridizes” refers to the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site.
  • an antisense oligonucleotide specifically hybridizes to more than one target site.
  • design or “designed to” refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
  • modulation refers to a perturbation of function or activity when compared to the level of the function or activity prior to modulation.
  • modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression.
  • modulation of expression can include perturbing splice site selection of pre-mRNA processing.
  • expression refers to all the functions and steps by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.
  • variant refers to an alternative RNA transcript that can be produced from the same genomic region of DNA. Variants include, but are not limited to “pre-mRNA variants” which are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence. Variants also include, but are not limited to, those with alternate splice junctions, or alternate initiation and termination codons.
  • high-affinity modified monomer refers to a monomer having at least one modified nucleobase, internucleoside linkage or sugar moiety, when compared to naturally occurring monomers, such that the modification increases the affinity of an antisense compound comprising the high-affinity modified monomer to its target nucleic acid.
  • High-affinity modifications include, but are not limited to, monomers (e.g., nucleosides and nucleotides) comprising 2'-modifed sugars.
  • 2'-modified or "2 '-substituted” means a sugar comprising substituent at the 2' position other than H or OH.
  • short antisense compounds comprise a 2'modified monomer that does not have the formula 2'-O(CH 2 ) n H, wherein n is one to six.
  • short antisense - - compounds comprise a 2 'modified monomer that does not have the formula 2'-OCH 3
  • short antisense compounds comprise a 2'modified monomer that does not have the formula or, in the alternative, 2'-O(CH 2 ) 2 OCH 3 .
  • bicyclic nucleic acid or "BNA” or "bicyclic nucleoside” or “bicyclic nucleotide” refers to a nucleoside or nucleotide wherein the furanose portion of the nucleoside includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.
  • methyleneoxy BNA alone refers to ⁇ -D- methyleneoxy BNA.
  • MOE refers to a 2'-methoxyethyl substituent
  • the term “gapmer” refers to a chimeric oligomeric compound comprising a central region (a "gap") and a region on either side of the central region (the “wings”), wherein the gap comprises at least one modification that is different from that of each wing.
  • modifications include nucleobase, monomelic linkage, and sugar modifications as well as the absence of modification (unmodified).
  • the nucleotide linkages in each of the wings are different than the nucleotide linkages in the gap.
  • each wing comprises nucleotides with high affinity modifications and the gap comprises nucleotides that do not comprise that modification.
  • nucleotides in the gap and the nucleotides in the wings all comprise high affinity modifications, but the high affinity modifications in the gap are different than the high affinity modifications in the wings.
  • the modifications in the wings are the same as one another. In certain embodiments, the modifications in the wings are different from each other.
  • nucleotides in the gap are unmodified and nucleotides in the wings are modified.
  • the modification(s) in each wing are the same.
  • the modification(s) in one wing are different from the modification(s) in the other wing.
  • short antisense compounds are gapmers having 2'-deoxynucleotides in the gap and nucleotides with high- affinity modifications in the wing.
  • prodrug refers to a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
  • pharmaceutically acceptable salts refers to salts of active compounds that retain the desired biological activity of the active compound and do not impart undesired toxicological effects thereto.
  • cap structure or “terminal cap moiety” refers to chemical modifications, which have been incorporated at either terminus of an antisense compound.
  • prevention refers to delaying or forestalling the onset or development of a condition or disease for a period of time from hours to days, preferably weeks to months.
  • the term "amelioration" refers to a lessening of at least one indicator of the severity of a condition or disease.
  • the severity of indicators may be determined by subjective or objective measures which are known to those skilled in the art. - -
  • treatment refers to administering a composition of the invention to effect an alteration or improvement of the disease or condition.
  • Prevention, amelioration, and/or treatment may require administration of multiple doses at regular intervals, or prior to onset of the disease or condition to alter the course of the disease or condition.
  • a single agent may be used in a single individual for each prevention, amelioration, and treatment of a condition or disease sequentially, or concurrently.
  • the term "pharmaceutical agent” refers to a substance provides a therapeutic benefit when administered to a subject.
  • terapéuticaally effective amount refers to an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal.
  • administering means providing a pharmaceutical agent to an animal, and includes, but is not limited to administering by a medical professional and self-administering.
  • co-administration refers to administration of two or more pharmaceutical agents to an animal.
  • the two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions.
  • Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration.
  • Co-administration encompasses administration in parallel or sequentially.
  • a pharmaceutical composition refers to a mixture of substances suitable for administering to an individual.
  • a pharmaceutical composition may comprise an antisense oligonucleotide and a sterile aqueous solution.
  • the term "individual” refers to a human or non-human animal selected for treatment or therapy.
  • animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
  • the term "subject” refers to an animal, including, but not limited to a human, to whom a pharmaceutical composition is administered.
  • the term “duration” refers to the period of time during which an activity or event continues.
  • the duration of treatment is the period of time during which doses of a pharmaceutical agent are administered.
  • parenteral administration refers to administration through injection or infusion.
  • Parenteral administration includes, but is not limited to, subcutaneous administration, intravenous administration, or intramuscular administration.
  • subcutaneous administration refers to administration just below the skin.
  • Intravenous administration means administration into a vein.
  • a dose refers to a specified quantity of a pharmaceutical agent provided in a single administration.
  • a dose may be administered in two or more boluses, tablets, or injections.
  • the desired dose requires a volume not easily accommodated by a single injection.
  • two or more injections may be used to achieve the desired dose.
  • a dose may be administered in two or more injections to minimize injection site reaction in an individual.
  • a dosage unit refers to a form in which a pharmaceutical agent is provided.
  • a dosage unit is a vial comprising lyophilized antisense oligonucleotide.
  • a dosage unit is a vial comprising reconstituted antisense oligonucleotide.
  • an antisense oligonucleotide is a pharmaceutical agent.
  • active pharmaceutical ingredient refers to the substance in a pharmaceutical composition that provides a desired effect.
  • a therapeutically effective amount refers to an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
  • a therapeutically effective amount of an antisense compound is the amount that needs to be administered to result in an observable benefit.
  • hypocholesterolemia refers to a condition characterized by elevated serum cholesterol.
  • hypolipidemia refers to a condition characterized by elevated serum lipids.
  • hypotriglyceridemia refers to a condition characterized by elevated triglyceride levels.
  • non-familial hypercholesterolemia refers to a condition characterized by elevated cholesterol that is not the result of a single inherited gene mutation.
  • polygenic hypercholesterolemia refers to a condition characterized by elevated cholesterol that results from the influence of a variety of genetic factors. In certain embodiments, polygenic hypercholesterolemia may be exacerbated by dietary intake of lipids.
  • FH familial hypercholesterolemia
  • a diagnosis of familial hypercholesterolemia is made when a individual meets one or more of the following criteria: genetic testing confirming 2 mutated LDL- receptor genes; genetic testing confirming one mutated LDL-receptor gene; document history of untreated serum LDL-cholesterol greater than 500 mg/dL; tendinous and/or cutaneous xanthoma prior to age 10 years; or, both parents have documented elevated serum LDL-cholesterol prior to lipid-lowering therapy consistent with heterozygous familial hypercholesterolemia.
  • homozygous familial hypercholesterolemia or “HoFH” refers to a condition characterized by a mutation in both maternal and paternal LDL-R genes.
  • heterozygous familial hypercholesterolemia or “HeFH” refers to a - - condition characterized by a mutation in either the maternal or paternal LDL-R gene.
  • mixed dyslipidemia refers to a condition characterized by elevated serum cholesterol and elevated serum triglycerides.
  • diabetes dyslipidemia or “Type II diabetes with dyslipidemia” refers to a condition characterized by Type II diabetes, reduced HDL-C, elevated serum triglycerides, and elevated small, dense LDL particles.
  • CHD risk equivalents refers to indicators of clinical atherosclerotic disease that confer a high risk for coronary heart disease.
  • CHD risk equivalents include, without limitation, clinical coronary heart disease, symptomatic carotid artery disease, peripheral arterial disease, and/or abdominal aortic aneurysm.
  • non-alcoholic fatty liver disease refers to a condition characterized by fatty inflammation of the liver that is not due to excessive alcohol use (for example, alcohol consumption of over 20 g/day).
  • NAFLD is related to insulin resistance and the metabolic syndrome.
  • non-alcoholic steatohepatitis refers to a condition characterized by inflammation and the accumulation of fat and fibrous tissue in the liver, that is not due to excessive alcohol use. NASH is an extreme form of NAFLD.
  • major risk factors refers to factors that contribute to a high risk for a particular disease or condition.
  • major risk factors for coronary heart disease include, without limitation, cigarette smoking, hypertension, low HDL-C, family history of coronary heart disease, and age.
  • CHD risk factors refers to CHD risk equivalents and major risk factors.
  • coronary heart disease refers to a narrowing of the small blood vessels that supply blood and oxygen to the heart, which is often a result of atherosclerosis.
  • reduced coronary heart disease risk refers to a reduction in the likelihood that a individual will develop coronary heart disease.
  • a reduction in coronary heart disease risk is measured by an improvement in one or more CHD risk factors, for example, a decrease in LDL-C levels.
  • the term "atherosclerosis” refers to a hardening of the arteries affecting large and medium-sized arteries and is characterized by the presence of fatty deposits.
  • the fatty deposits are called “atheromas” or “plaques,” which consist mainly of cholesterol and other fats, calcium and scar tissue, and damage the lining of arteries.
  • history of coronary heart disease refers to the occurrence of clinically evident coronary heart disease in the medical history of a individual or a individual's family member.
  • Early onset coronary heart disease refers to a diagnosis of coronary heart disease prior to age 50.
  • statin intolerant individual refers to a individual who as a result of - - statin therapy experiences one or more of creatine kinase increases, liver function test abnormalities, muscle aches, or central nervous system side effects.
  • efficacy refers to the ability to produce a desired effect.
  • efficacy of a lipid-lowering therapy may be reduction in the concentration of one or more of LDL-C, VLDL-C, IDL-C, non-HDL-C, ApoB, lipoprotein(a), or triglycerides.
  • acceptable safety profile refers to a pattern of side effects that is within clinically acceptable limits.
  • side effects refers to physiological responses attributable to a treatment other than desired effects.
  • side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.
  • increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality.
  • increased bilirubin may indicate liver toxicity or liver function abnormality.
  • injection site reaction refers to inflammation or abnormal redness of skin at a site of injection in an individual.
  • individual compliance refers to adherence to a recommended or prescribed therapy by an individual.
  • lipid-lowering therapy refers to a therapeutic regimen provided to a individual to reduce one or more lipids in a individual.
  • a lipid-lowering therapy is provide to reduce one or more of ApoB, total cholesterol, LDL-C, VLDL-C, IDL-C, non-HDL-C, triglycerides, small dense LDL particles, and Lp(a) in an individual.
  • lipid-lowering agent refers to a pharmaceutical agent provided to a individual to achieve a lowering of lipids in the individual.
  • a lipid- lowering agent is provided to an individual to reduce one or more of ApoB, LDL-C, total cholesterol, and triglycerides.
  • LDL-C target refers to an LDL-C level that is desired following lipid-lowering therapy.
  • the term “comply” refers to the adherence with a recommended therapy by an individual.
  • the term "recommended therapy” refers to a therapeutic regimen recommended by a medical professional for the treatment, amelioration, or prevention of a disease.
  • low LDL-receptor activity refers to LDL-receptor activity that is not sufficiently high to maintain clinically acceptable levels of LDL-C in the bloodstream.
  • cardiovascular outcome refers to the occurrence of major adverse cardiovascular events.
  • the term "improved cardiovascular outcome” refers to a reduction in the occurrence of major adverse cardiovascular events, or the risk thereof.
  • major adverse cardiovascular events include, without limitation, death, reinfarction, stroke, cardiogenic shock, - - pulmonary edema, cardiac arrest, and atrial dysrhythmia.
  • surrogate markers of cardiovascular outcome refers to indirect indicators of cardiovascular events, or the risk thereof.
  • surrogate markers of cardiovascular outcome include carotid intimal media thickness (CDVIT).
  • CDVIT carotid intimal media thickness
  • IVXJS intravascular ultrasound
  • the term "increased HDL-C" refers to an increase in serum HDL-C in an individual over time.
  • lipid-lowering refers to a reduction in one or more serum lipids in an individual over time.
  • Metabolic disorder refers to a condition characterized by an alteration or disturbance in metabolic function.
  • Metabolic and “metabolism” are terms well know in the art and generally include the whole range of., biochemical processes that occur within a living organism. Metabolic disorders include, but are not limited to, hyperglycemia, prediabetes, diabetes (type I and type II), obesity, insulin resistance and metabolic syndrome.
  • metabolic syndrome refers to a clustering of lipid and non-lipid cardiovascular risk factors of metabolic origin. It has been closely linked to the generalized metabolic disorder known as insulin resistance.
  • NCEP National Cholesterol Education Program
  • ATPIII Adult Treatment Panel HI
  • the five risk determinants are abdominal obesity defined as waist circumference of greater than 102 cm for men or greater than 88cm for women, triglyceride levels greater than or equal to 150 mg/dL, HDL cholesterol levels of less than 40 mg/dL for men and less than 50 mg/dL for women, blood pressure greater than or equal to 130/85 mm Hg and fasting glucose levels greater than or equal to 110 mg/dL. These determinants can be readily measured in clinical practice (JAMA, 2001, 285: 2486-2497).
  • alkyl refers to a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms.
  • alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like.
  • Alkyl groups typically include from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms (Ci-Ci 2 alkyl) with from 1 to about 6 carbon atoms being more preferred.
  • the term "lower alkyl” as used herein includes from 1 to about 6 carbon atoms.
  • Alkyl groups as used herein may optionally include one or more further substituent groups.
  • alkenyl refers to a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms and having at least one carbon-carbon double bond.
  • alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, 1 -methyl-2-buten- 1-yl, dienes such as 1,3-butadiene and the like.
  • Alkenyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred.
  • Alkenyl groups as used herein may optionally include one or more further substituent - - groups.
  • alkynyl refers to a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond.
  • alkynyl groups include, but are not limited to, ethynyl, 1 -propynyl, 1 -butynyl, and the like.
  • Alkynyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred.
  • Alkynyl groups as used herein may optionally include one or more further substitutent groups.
  • aminoalkyl refers to an amino substituted alkyl radical. This term is meant to include C t -Ci 2 alkyl groups having an amino substituent at any position and wherein the alkyl group attaches the aminoalkyl group to the parent molecule. The alkyl and/or amino portions of the aminoalkyl group can be further substituted with substituent groups.
  • aliphatic refers to a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond.
  • An aliphatic group preferably contains from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms being more preferred.
  • the straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus.
  • Such aliphatic groups interrupted by heteroatoms include without limitation polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substitutent groups.
  • alicyclic refers to a cyclic ring system wherein the ring is aliphatic.
  • the ring system can comprise one or more rings wherein at least one ring is aliphatic.
  • Preferred alicyclics include rings having from about 5 to about 9 carbon atoms in the ring.
  • Alicyclic as used herein may optionally include further substitutent groups.
  • alkoxy refers to a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule.
  • alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n- butoxy, sec-butoxy, tert-hvXoxy, n-pentoxy, neopentoxy, n-hexoxy and the like.
  • Alkoxy groups as used herein may optionally include further substitutent groups.
  • halo and halogen, as used herein, refer to an atom selected from fluorine, chlorine, bromine and iodine.
  • aryl and aromatic refer to a mono- or polycyclic carbocyclic ring system radicals having one or more aromatic rings.
  • aryl groups include, but are not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like.
  • Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings.
  • Aryl groups as used herein may optionally include further substitutent groups.
  • aralkyl and arylalkyl refer to a radical formed between an alkyl group and an aryl group wherein the alkyl group is used to attach the aralkyl group to a parent molecule. Examples include, but are not limited to, benzyl, phenethyl and the like. Aralkyl groups as used herein - may optionally include further substitutent groups attached to the alkyl, the aryl or both groups that form the radical group.
  • heterocyclic radical refers to a radical mono-, or poly-cyclic ring system that includes at least one heteroatom and is unsaturated, partially saturated or fully saturated, thereby including heteroaryl groups. Heterocyclic is also meant to include fused ring systems wherein one or more of the fused rings contain at least one heteroatom and the other rings can contain one or more heteroatoms or optionally contain no heteroatoms.
  • a heterocyclic group typically includes at least one atom selected from sulfur, nitrogen or oxygen.
  • heterocyclic groups include, [ 1 ,3]dioxolane, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and the like.
  • Heterocyclic groups as used herein may optionally include further substitutent groups.
  • heteroaryl refers to a radical comprising a mono- or poly-cyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatom. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen.
  • heteroaryl groups include, but are not limited to, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl, and the like.
  • Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or hetero atom.
  • Heteroaryl groups as used herein may optionally include further substitutent groups.
  • heteroarylalkyl refers to a heteroaryl group as previously defined having an alky radical that can attach the heteroarylalkyl group to a parent molecule. Examples include, but are not limited to, pyridinylmethyl, pyrimidinylethyl, napthyridinylpropyl and the like. Heteroarylalkyl groups as used herein may optionally include further substitutent groups on one or both of the heteroaryl or alkyl portions.
  • mono or poly cyclic structure includes all ring systems that are single or polycyclic having rings that are fused or linked and is meant to be inclusive of single and mixed ring systems individually selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl, heteroaromatic, heteroarylalkyl.
  • Such mono and poly cyclic structures can contain rings that are uniform or have varying degrees of saturation including fully saturated, partially saturated or fully unsaturated.
  • Each ring can comprise ring atoms selected from C, N, O and S to give rise to heterocyclic rings as well as rings comprising only C ring atoms which can be present in a mixed motif such as for example benzimidazole wherein one ring has only carbon ring atoms and the fused ring has two nitrogen atoms.
  • mono or poly cyclic structures can be attached to a parent molecule directly - through a ring atom, through a substituent group or a bifunctional linking moiety.
  • acyl refers to a radical formed by removal of a hydroxyl group from an organic acid an d has the general formula -C(O)-X where X is typically aliphatic, alicyclic or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substitutent groups.
  • hydrocarbyl includes groups comprising C, O and H. Included are straight, branched and cyclic groups having any degree of saturation. Such hydrocarbyl groups can include one or more heteroatoms selected from N, O and S and can be further mono or poly substituted with one or more substituent groups.
  • substituted and substituteduent group include groups that are typically added to other groups or parent compounds to enhance desired properties or give desired effects. Substituent groups can be protected or unprotected and can be added to one available site or to many available sites in a parent compound. Substituent groups may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound.
  • each R aa , R bb and R 00 is, independently, H, an optionally linked chemical functional group or a further substituent group with a preferred list including without limitation H, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl.
  • oligomeric compounds compared to naturally occuring oligomers, such as DNA or RNA.
  • Certain such modifications alter the activity of the oligomeric compound.
  • Certain such chemical modifications can alter activity by, for example: increasing affinity of an antisense compound for its target nucleic acid, increasing its resistance to one or more nucleases, and/or altering the pharmacokinetics or tissue distribution of the oligomeric compound.
  • the use of chemistries that increase the affinity of an oligomeric compound for its target can allow for the use of shorter oligomeric compounds.
  • oligomeric compounds comprise one or more modified monomer.
  • oligomeric compounds comprise one or more high affinity monomer.
  • the oligomeric compounds including, but no limited to short antisense compounds of the present invention, comprise one or more high affinity monomers provided that the oligomeric compound does not comprise a nucleotide comprising a 2'-O(CH 2 ) n H, wherein n is one to six.
  • the oligomeric compounds including, but no limited to short antisense compounds of the present invention, comprise one or more high affinity monomer provided that the oligomeric compound does not comprise a nucleotide comprising a 2'-OCH 3 or a 2'-O(CH 2 ) 2 OCH 3 .
  • the oligomeric compounds including, but no limited to short antisense compounds of the present invention, comprise one or more high affinity monomer provided that the oligomeric compound does not comprise a ⁇ -L-Methyleneoxy (4'-CH 2 -O-2') BNA.
  • the oligomeric compounds including, but no limited to short antisense compounds of the present invention, comprise one or more high affinity monomer provided that the oligomeric compound does not comprise a ⁇ -D-Methyleneoxy (4'-CH 2 -O-2') BNA.
  • the oligomeric compounds including, but no limited to short antisense compounds of the present invention, comprise one or more high affinity monomer provided that the oligomeric compound does not comprise a ⁇ -L-Methyleneoxy (4'-CH 2 -O-2') BNA or a ⁇ -D- Methyleneoxy (4'-CH 2 -O-2') BNA.
  • the naturally occurring base portion of a nucleoside is typically a heterocyclic base.
  • the two most common classes of such heterocyclic bases are the purines and the pyrimidines.
  • a phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar.
  • those phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
  • the phosphate groups are commonly referred to as forming the internucleotide backbone of the oligonucleotide.
  • the naturally occurring linkage or backbone of RNA and of DNA is a 3' to 5' phosphodiester linkage.
  • a modified nucleobase is a nucleobase that is fairly similar in structure to the parent nucleobase, such as for example a 7-deaza purine, a 5 -methyl cytosine, or a G-clamp.
  • nucleobase mimetic include more complicated structures, such as for example a tricyclic phenoxazine nucleobase mimetic. Methods for preparation of the above noted modified nucleobases are well known to those skilled in the art. - - b. Certain sugars
  • Oligomeric compounds provided herein may comprise one or more monomer, including a nucleoside or nucleotide, having a modified sugar moiety.
  • the furanosyl sugar ring of a nucleoside can be modified in a number of ways including, but not limited to, addition of a substituent group, bridging of two non-geminal ring atoms to form a bicyclic nucleic acid (BNA).
  • BNA bicyclic nucleic acid
  • oligomeric compounds comprise one or more monomers that is a BNA.
  • BNA s include, but are not limited to, (A) ⁇ -L-Methyleneoxy (4'- CH 2 -O-2') BNA , (B) ⁇ -D-Methyleneoxy (4'-CH 2 -O-2') BNA , (C) Ethyleneoxy (4'-(CH 2 ) 2 -O-2') BNA , (D) Aminooxy (4'-CH 2 -O-N(R)-2') BNA and (E) Oxyamino (4'-CH 2 -N(R)-O-2') BNA, as depicted in Figure 1.
  • each of the bridges of the BNA compounds is, independently, -[C(Ri)(R 2 )],,- , -[C(R 1 )(R 2 )J n -O-, -C(R 1 R 2 ) ⁇ (RO-O- or -C(R 1 R ⁇ -O-N(RO-.
  • each of said bridges is, independently, 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 J 3 -T, 4'-CH 2 -O-2', 4'-(CH 2 ) 2 -O-2', 4'-CH 2 -O- N(R0-2' and 4'-CH 2 -N(R0-O-2'- wherein each R 1 is, independently, H, a protecting group or C 1 -C 12 alkyl. - -
  • BNAs in which the 2'-hydroxyl group of the ribosyl sugar ring is linked to the 4' carbon atom of the sugar ring thereby forming a methyleneoxy (4'-CH 2 -O-2') linkage to form the bicyclic sugar moiety
  • methyleneoxy (4'-CH 2 -O-2') linkage to form the bicyclic sugar moiety
  • the linkage can be a methylene (-CH 2 -) group bridging the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'-CH 2 -O-2') BNA is used for the bicyclic moiety; in the case of an ethylene group in this position, the term ethyleneoxy (4'-CH 2 CH 2 -O-2') BNA is used (Singh et al., Chem. Commun., 1998, 4, 455-456: Morita et al, Bioorganic Medicinal Chemistry, 2003, 11, 2211-2226).
  • Potent and nontoxic antisense oligonucleotides compriseing BNAs have been described (Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633-5638).
  • alpha-L- methyleneoxy (4'-CH 2 -O-2') BNA An isomer of methyleneoxy (4'-CH 2 -O-2') BNA that has also been discussed is alpha-L- methyleneoxy (4'-CH 2 -O-2') BNA which has been shown to have superior stability against a 3'- exonuclease.
  • the alpha-L- methyleneoxy (4'-CH 2 -O-2') BNA's were incorporated into antisense gapmers and chimeras that showed potent antisense activity (Frieden et al, Nucleic Acids Research, 2003, 21, 6365-6372).
  • BNA methyleneoxy (4'-CH 2 -O-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.
  • Modified sugar moieties are well known and can be used to alter, typically increase, the affinity of the antisense compound for its target and/or increase nuclease resistance.
  • a representative list of preferred modified sugars includes but is not limited to bicyclic modified sugars (BNA's), including methyleneoxy (4'-CH 2 -O-2') BNA and ethyleneoxy (4'-(CH 2 ) 2 -O-2' bridge) BNA ; substituted sugars, especially 2'-substituted sugars having a 2'-F, 2'-OCH 3 or a 2'-0(CH 2 VOCH 3 substituent group; and 4'- thio modified sugars.
  • Sugars can also be replaced with sugar mimetic groups among others.
  • BNA's include bicyclic nucleoside having the formula:
  • Bx is a heterocyclic base moiety
  • Ti is H or a hydroxyl protecting group
  • T 2 is H, a hydroxyl protecting group or a reactive phosphorus group
  • Z is Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 1 -C 6 alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C 6 alkynyl, acyl, substituted acyl, or substituted amide.
  • the Z group is C 1 -C 6 alkyl substituted with one or more X x , wherein each X x is independently halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH 3 O-), substituted alkoxy or azido.
  • X x is independently halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH 3 O-), substituted alkoxy or azido.
  • the Z group is -CH 2 X X , wherein X x is halo (e.g., fluoro), - - hydroxyl, alkoxy (e.g., CH 3 O-) or azido.
  • the Z group is in the (R)-configuration:
  • the Z group is in the ( ⁇ -configuration:
  • each Ti and T 2 is a hydroxyl protecting group.
  • a preferred list of hydroxyl protecting groups includes benzyl, benzoyl, 2,6-dichlorobenzyl, t-butyldimethylsilyl, t-butyl- diphenylsilyl, mesylate, tosylate, dimethoxytrityl (DMT), 9-phenylxanthine-9-yl (Pixyl) and 9-(p- methoxyphenyl)xanthine-9-yl (MOX).
  • T] is a hydroxyl protecting group selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl and dimethoxytrityl wherein a more preferred hydroxyl protecting group is Ti is 4,4'-dimethoxytrityl.
  • T 2 is a reactive phosphorus group wherein preferred reactive phosphorus groups include diisopropylcyanoethoxy phosphoramidite and H-phosphonate.
  • preferred reactive phosphorus groups include diisopropylcyanoethoxy phosphoramidite and H-phosphonate.
  • Ti is 4,4'-dimethoxytrityl and T 2 is diisopropylcyanoethoxy phosphoramidite.
  • oligomeric compounds have at least one monomer of the formula:
  • Bx is a heterocyclic base moiety
  • T 3 is H, a hydroxyl protecting group, a linked conjugate group or an internucleoside linking group attached to a nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a monomelic subunit or an oligomeric compound;
  • T 4 is H, a hydroxyl protecting group, a linked conjugate group or an internucleoside linking group attached to a nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a monomelic subunit or an oligomeric compound; wherein at least one of T 3 and T 4 is an internucleoside linking group attached to a nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a monomelic subunit or an oligomeric compound; and
  • Z is CpC 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted Q-C 6 alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C 6 alkynyl, acyl, substituted acyl, or substituted amide.
  • At least one Z is CpC 6 alkyl or substituted C 1 -C 6 alkyl. In certain embodiments, each Z is, independently, C 1 -C 6 alkyl or substituted C 1 -C 6 alkyl. In certain embodiments, at least one Z is C 1 -C 6 alkyl. In certain embodiments, each Z is, independently, C 1 -C 6 alkyl. In certain embodiments, at least one Z is methyl. In certain embodiments, each Z is methyl. In certain embodiments, at least one Z is ethyl. In certain embodiments, each Z is ethyl. In certain embodiments, at least one Z is substituted C 1 -C 6 alkyl.
  • each Z is, independently, substituted Q- C 6 alkyl. In certain embodiments, at least one Z is substituted methyl. In certain embodiments, each Z is substituted methyl, hi certain embodiments, at least one Z is substituted ethyl. In certain embodiments, each Z is substituted ethyl.
  • At least one substituent group is C 1 -C 6 alkoxy (e.g., at least one Z is C 1 - C 6 alkyl substituted with one or more C 1 -C 6 alkoxy).
  • each substituent group is, independently, C 1 -C 6 alkoxy (e.g., each Z is, independently, C 1 -C 6 alkyl substituted with one or more C 1 - C 6 alkoxy).
  • At least one C 1 -C 6 alkoxy substituent group is CH 3 O- (e.g., at least one Z is CH 3 OCH 2 -). In another embodiment, each C 1 -C 6 alkoxy substituent group is CH 3 O- (e.g., each Z is CH 3 OCH 2 -).
  • At least one substituent group is halogen (e.g., at least one Z is C 1 -C 6 alkyl substituted with one or more halogen).
  • each substituent group is, independently, halogen (e.g., each Z is, independently, C 1 -C 6 alkyl substituted with one or more halogen).
  • at least one halogen substituent group is fluoro (e.g., at least one Z is CH 2 FCH 2 -, - - -
  • each halo substituent group is fluoro (e.g., each Z is, independently, CH 2 FCH 2 -, CHF 2 CH 2 - or CF 3 CH 2 -).
  • At least one substituent group is hydroxyl (e.g., at least one Z is C 1 -C 6 alkyl substituted with one or more hydroxyl). In certain embodiments, each substituent group is, independently, hydroxyl (e.g., each Z is, independently, C 1 -C 6 alkyl substituted with one or more hydroxyl). In certain embodiments, at least one Z is HOCH 2 -. In another embodiment, each Z is HOCH 2 -.
  • At least one Z is CH 3 -, CH 3 CH 2 -, CH 2 OCH 3 -, CH 2 F- or HOCH 2 -.
  • each Z is, independently, CH 3 -, CH 3 CH 2 -, CH 2 OCH 3 -, CH 2 F- or HOCH 2 -.
  • At least one Z group is CpC 6 alkyl substituted with one or more X x , wherein each X x is, independently, halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH 3 O-) or azido.
  • X x is, independently, halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH 3 O-) or azido.
  • each Z group is, independently, CpC 6 alkyl substituted with one or more X x , wherein each X x is independently halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH 3 O-) or azido.
  • X x is independently halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH 3 O-) or azido.
  • At least one Z group is -CH 2 X X , wherein X x is OJ
  • at least one Z group is -CH 2 X", wherein X" is halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH 3 O-) or azido.
  • each Z group is, independently, -CH 2 X", wherein each X x is, independently, halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CH 3 O-) or azido.
  • At least one Z is CH 3 -. In another embodiment, each Z is, CH 3 -.
  • the Z group of at least one monomer is in the (R)- configuration represented by the formula:
  • the Z group of each monomer of the formula is in the (R)- configuration.
  • the Z group of at least one monomer is in the (S)- configuration represented by the formula:
  • the Z group of each monomer of the formula is in the (S)- configuration.
  • T 3 is H or a hydroxyl protecting group. In certain embodiments, T 4 is H or a hydroxyl protecting group. In a further embodiment T 3 is an internucleoside linking group attached to a nucleoside, a nucleotide or a monomelic subunit. In certain embodiments, T 4 is an internucleoside linking group attached to a nucleoside, a nucleotide or a monomelic subunit. In certain embodiments,T 3 is an internucleoside linking group attached to an oligonucleoside or an oligonucleotide. In certain embodiments, T 4 is an internucleoside linking group attached to an oligonucleoside or an oligonucleotide.
  • T 3 is an internucleoside linking group attached to an oligomeric compound.
  • T 4 is an internucleoside linking group attached to an oligomeric compound.
  • at least one of T 3 and T 4 comprises an internucleoside linking group selected from phosphodiester or phosphorothioate.
  • oligomeric compounds have at least one region of at least two contiguous monomers of the formula:
  • the oligomeric compound comprises at least two regions of at least two contiguous monomers of the above formula. In certain embodiments, the oligomeric compound comprises a gapped oligomeric compound. In certain embodiments, the oligmeric compound comprises at least one region of from about 8 to about 14 contiguous ⁇ -D-2'-deoxyribofuranosyl nucleosides. In certain embodiments, the oligomeric compound comprises at least one region of from about 9 to about 12 contiguous ⁇ -D-2'-deoxyribofuranosyl nucleosides.
  • monmers include sugar mimetics.
  • a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
  • Representative examples of a sugar mimetics include, but are not limited to, cyclohexenyl or morpholino.
  • Representative examples of a mimetic for a sugar- internucleoside linkage combination include, but are not limited to, peptide nucleic acids (PNA) and morpholino groups linked by uncharged achiral linkages. In some instances a mimetic is used in place of the nucleobase.
  • nucleobase mimetics are well known in the art and include, but are not limited to, tricyclic phenoxazine analogs and universal bases (Berger et al., Nuc Acid Res. 2000, 28:2911-14, incorporated herein by reference). Methods of synthesis of sugar, nucleoside and nucleobase mimetics are well known to those skilled in the art.
  • linking groups that link monomers (including, but not limited to, modified - - and unmodified nucleosides and nucleotides) together, thereby forming an oligomeric compound.
  • the two main classes of linking groups are defined by the presence or absence of a phosphorus atom.
  • Non-phosphorus containing linking groups include, but are not limited to, methylenemethylimino (-CH 2 - N(CH 3 )-O-CH 2 -), thiodiester (-O-C(O)-S-), thionocarbamate (-0-C(O)(NH)-S-); siloxane (-O-Si(H)2-O- ); and N,N'-dimethylhydrazine (-CH 2 -N(CH 3 )-N(CH 3 )-). Oligomeric compounds having non-phosphorus linking groups are referred to as oligonucleosides.
  • Modified linkages compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligomeric compound.
  • linkages having a chiral atom can be prepared a racemic mixtures, as separate enantomers.
  • Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous- containing linkages are well known to those skilled in the art.
  • the oligomeric compounds described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomer ⁇ configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), ⁇ or ⁇ such as for sugar anomers, or as (D) or (L) such as for amino acids et al. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.
  • oligomeric compounds having reactive phosphorus groups useful for forming linkages including for example phosphodiester and phosphorothioate internucleoside linkages.
  • Methods of preparation and/or purification of precursors or oligomeric compounds are not a limitation of the compositions or methods provided herein.
  • Methods for synthesis and purification of oligomeric compounds including DNA, RNA, oligonucleotides, oligonucleosides, and antisense compounds are well known to those skilled in the art.
  • oligomeric compounds comprise a plurality of monomelic subunits linked together by linking groups.
  • Nonlimiting examples of oligomeric compounds include primers, probes, antisense compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternate splicers, and siRNAs.
  • these compounds can be introduced in the form of single-stranded, double-stranded, circular, branched or hairpins and can contain structural elements such as internal or terminal bulges or loops.
  • Oligomeric double-stranded compounds can be two strands hybridized to form double-stranded compounds or a single strand with sufficient self complementarity to allow for hybridization and formation of a fully or partially double-stranded compound.
  • the present invention provides chimeric oligomeric compounds.
  • chimeric oligomeric compounds are chimeric oligonucleotides.
  • the chimeric oligonucleotides comprise differently modified nucleotides.
  • chimeric oligonucleotides are mixed-backbone antisense oligonucleotides.
  • a chimeric oligomeric compound will have modified nucleosides that can be in RE - - isolated positions or grouped together in regions that will define a particular motif. Any combination of modifications and/or mimetic groups can comprise a chimeric oligomeric compound as described herein.
  • chimeric oligomeric compounds typically comprise at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
  • an additional region of the oligomeric compound may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of inhibition of gene expression.
  • RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • chimeric oligomeric compounds are gapmers. In certain embodiments, chimeric compounds are short antisense compounds. In certain embodiments, short antisense compounds are gapmers. In certain such embodiments, a mixed-backbone antisense oligomer has one type of internucleotide linkages in one or both wings and a different type of internucleotide linkages in the gap. Ln certain such embodiments, the mixed-backbone antisense oligonucleotide has phosphodiester linkages in the wings and phosphorothioate linkages in the gap.
  • the internucleotide linkage bridging that wing and the gap is the same as the internucleotide linkage in the wing.
  • the internucleotide linkage bridging that wing and the gap is the same as the internucleotide linkage in the gap.
  • short antisense compounds are 9 to 14 nucleotides in length.
  • short antisense compounds are 10 to 14 nucleotides in length, hi certain embodiments, such short antisense compounds are short antisense oligonucleotides.
  • short antisense compounds comprise one or more chemical modifications. In certain such embodiments, short antisense compounds comprise at least one modified nucleotide. In certain embodiments short antisense compounds comprise at least two or more modified nucleotides. In certain embodiments, short antisense compounds comprise at least one modified internucleotide linkage. In certain embodiments, short antisense compounds are mixed-backbone oligonucleotides. In certain embodiments, short antisense compounds are chimeric oligonucleotides. In certain embodiments, short antisense oligonucleotides are uniformly modified. In certain embodiments, short antisense oligonucleotides comprise modifications independently selected at each nucleobase and at - - each linkage.
  • short antisense compounds are short gapmers.
  • short gapmers comprise at least one high affinity modification in one or more wings of the compound.
  • short antisense compounds comprise 1 to 3 high-affinity modifications in each wing.
  • high affinity modifications of the short antisense compounds allow for a target affinity similar to, or even greater than, the target affinity of longer antisense compounds.
  • the high-affinity modified nucleotides are sugar modified nucleotides. Such sugar modified nucleotides include those comprising a bridge between the 4' and 2' position of the sugar. Exemplary high affinity sugar modifications include, but are not limited to, BNA s and other 2 '-modifications such as 2'-MOE.
  • the high affinity modified nucleotide is not a 2'-OCH 3 or a 2'-OCH 2 CH 2 ⁇ CH 3 nucleotide.
  • the high-affinity modified nucleotides confer a T n , of at least 1, at least 1.5, at least 2, at least 2.5, at least 3.0, at least 3.5 or at least 4.0 degrees per nucleotide.
  • short antisense compounds having a limited number (generally 2 to 6) of high affinity modifications exhibit little to no increase in toxicity but retain or increase affinity for the target RNA, while also significantly reducing expression of the RNA target.
  • Short antisense compounds of the invention may optionally comprise a conjugate group, such as, for example, cholesterol or Ci 6 .
  • the short antisense compounds comprise a 5' wing and/or a 3' wing.
  • the features of the 3' wing and the features of the 5' wing are selected independently.
  • the number of monomers in the 5' wing and the number of monomers (length) in the 3' wing may be the same or may be different;
  • the modifications, if any, in the 5' wing may be the same as the modifications, if any, in the 3' wing or such modifications, if any, may be different;
  • the monomelic linkages in the 5' wing and the monomelic linkages in the 3' wing may be the same or they may be different.
  • a wing comprises one, two or three monomers (i.e. has a length of 1 , 2, or 3).
  • the monomers of a wing are modified.
  • the monomers of the wing are modified to increase affinity of the antisense compound for its target nucleic acid.
  • the monomers of a wing are nucleosides or nucleotides.
  • the nucleosides or nucleotides of the wing comprise a 2' modification.
  • the monomers (nucleosides or nucleotides) of the wing are BNA' s.
  • the monomers of the wing are selected from ⁇ -L-Methyleneoxy (4'-CH 2 -O-2') BNA , ⁇ -D- Methyleneoxy (4'-CH 2 -O-2') BNA , Ethyleneoxy (4'-(CH 2 ) 2 -O-2') BNA , Aminooxy (4'-CH 2 -O-N(R)- 2') BNA and Oxyamino (4'-CH 2 -N(R)-O-2') BNA.
  • the monomers of a wing comprise a substituent at the 2' position selected from allyl, amino, azido, thio, O-allyl, 0-C 1 -Ci O alkyl, - - -
  • each R m and R n is, independently, H or substituted or unsubstituted Ci-Ci 0 alkyl.
  • the monomers of a wing are 2'MOE nucleotides.
  • a wing comprises two, three or four monomers
  • those two, three or four monomers all comprise the same modifications, if any.
  • one or more of those two, three or four nucleobases comprises one or more modifications that is different from one or more of the modifications of one or more of the remaining monomers.
  • the short antisense compounds comprise a gap between the 5' wing and the 3' wing.
  • the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
  • the monomers of the gap are unmodified deoxyribonucleotides.
  • the monomers of the gap are unmodified ribonucleotides.
  • gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
  • the wings and the gaps discussed above may be selected and then combined in a variety of combinations to generate gapped oligomeric compounds, including, but not limited to, gapped antisense oligomeric compounds, and gapped antisense oligonucleotides.
  • the features (length, modifications, linkages) of the 5' wing and the 3' wing may be selected independently of one another.
  • the features of the gap include at least one difference in modification compared to the features of the 5' wing and at least one difference compared to the features of the 3' wing (i.e., there must be at least one difference in modification between neighboring regions to distinguish those neighboring regions from one another).
  • the features of the gap may otherwise be selected independently.
  • the oligomeric compounds disclosed herein may comprise from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • oligomeric compounds are antisense compounds.
  • short antisense compounds are 8 nucleobases in length.
  • short antisense compounds are 9 nucleobases in length.
  • short antisense compounds are 10 nucleobases in length.
  • short antisense compounds are 11 nucleobases in length.
  • short antisense compounds are 12 nucleobases in length.
  • short antisense compounds are 13 nucleobases in length.
  • short antisense compounds are 14 nucleobases in length.
  • short antisense compounds are 15 nucleobases in length.
  • short antisense compounds are 16 nucleobases in length.
  • short antisense compounds are 8 monomers in length. In certain embodiments, short antisense compounds are 9 monomers in length. In certain embodiments, short antisense compounds are 10 monomers in length. In certain embodiments, short antisense compounds are 11 monomers in length. In certain embodiments, short antisense compounds are monomers in length. In certain embodiments, short antisense compounds are 13 monomers in length. In certain embodiments, short antisense compounds are 14 monomers in length. In certain embodiments, short antisense compounds are 15 monomers in length, hi certain embodiments, short antisense compounds are 16 monomers in length. Pn certain embodiments, short antisense compounds comprise 9 to 15 monomers. In certain embodiments, short antisense compounds comprise 10 to 15 monomers. In certain embodiments, short antisense compounds comprise 12 to 14 monomers. In certain embodiments, short antisense compounds comprise 12 to 14 nucleotides or nucleosides.
  • short antisense compounds comprise a gap flanked by more than one wing on either or both sides.
  • a short antisense compound comprises two or more 5' wings and two or more 3' wings.
  • a short antisense compound comprises one 5' wing and two or more 3' wings.
  • a short antisense compound comprises one 3' wing and two or more 5' wings.
  • Certain such embodiments comprise, for example, the following regions: a first 5' wing - a bridge - a second 5' wing - a bridge - a gap - a bridge - a second 3' wing - a bridge - a first 3 'wing.
  • each region has at least one difference in modification when compared to its neighboring region.
  • the second 5' wing and the second 3' wing each independently comprises one or more differences in modification compared to the gap and compared to the first 5' wing and the first 3' wing.
  • the modifications of the first 3' wing and first 5' wing may either or both be the same or different from the modifications of the gap, if any.
  • oligomeric compounds are modified by covalent attachment of one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligomeric compound including but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and clearance.
  • Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional linking moiety or linking group to a parent compound such as an oligomeric compound.
  • conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes.
  • Preferred conjugate groups amenable to the present invention include lipid moieties such as a cholesterol moiety (Letsinger et al, Proc. Natl. Acad. Sci. USA, 1989, 86, 6553); cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053); a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306; Manoharan et al., Bioorg. Med. Chem.
  • lipid moieties such as a cholesterol moiety (Letsinger et al, Proc. Natl. Acad. Sci. USA, 1989, 86, 6553); cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053); a thioether,
  • Linking groups or bifunctional linking moieties such as those known in the art are amenable to the compounds provided herein. Linking groups are useful for attachment of chemical functional groups, conjugate groups, reporter groups and other groups to selective sites in a parent compound such as for example an oligomeric compound.
  • a bifunctional linking moiety comprises a hydrocarbyl moiety having two functional groups. One of the functional groups is selected to bind to a parent molecule or compound of interest and the other is selected to bind essentially any selected group such as chemical functional group or a conjugate group.
  • the linker comprises a chain structure or an oligomer of repeating units such as ethylene glycol or amino acid units.
  • bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), and the like.
  • bifunctional linking moieties include 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N- maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • linking groups include, but are not limited to, substituted Ci-Ci 0 alkyl, substituted or unsubstituted C 2 -Ci 0 alkenyl or substituted or unsubstituted C 2 -Ci 0 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • Oligomerization of modified and unmodified nucleosides and nucleotides can be routinely performed according to literature procedures for DNA (Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press) and/or RNA (Scaringe, Methods (2001), 23, 206-217. Gait et al., Applications of Chemically synthesized RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36. Gallo et al. Tetrahedron (2001), 57, 5707-5713).
  • Oligomeric compounds provided herein can be conveniently and routinely made through the well-known technique of solid phase synthesis.
  • Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • the invention is not limited by the method of antisense compound synthesis.
  • Analysis methods include capillary electrophoresis (CE) and electrospray-mass spectroscopy. Such synthesis and analysis methods can be performed in multi-well plates.
  • the method of the invention is not limited by the method of oligomer purification.
  • Antisense mechanisms are all those involving the hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
  • RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNAse H activity in mammalian cells. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of DNA-like oligonucleotide-mediated inhibition of gene expression.
  • chemically-modified antisense compounds have a higher affinity for target RNAs than does non-modified DNA. In certain such embodiments, that higher affinity in turn provides increased potency allowing for the administration of lower doses of such compounds, reduced potential for toxicity and improvement in therapeutic index and decreased overall cost of therapy.
  • the present disclosure demonstrates that the incorporation of chemically-modified high-affinity nucleotides and nucleosides into antisense compounds allows for the design of short antisense compounds 8-16 nucleobases in length useful for the reduction of target RNAs and/or target proteins in cells, tissues, and animals, including, but not limited to, humans with increased potency and improved therapeutic index.
  • short antisense compounds comprising high- affinity nucleotide modifications useful for reducing a target RNA in vivo. Certain such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, certain short antisense compounds have greater potential for oral dosing.
  • short antisense compounds (8-16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length) with increased activity in vivo relative to longer compounds.
  • Certain short antisense compounds are gapmer compounds comprising high-affinity chemically-modified nucleotides on the 3' and 5' ends (wings) of the compound, hi certain embodiments, the addition of high-affinity modified nucleotides allows antisense compounds to be active against, and specific for, their intended target RNA in vivo despite being shorter in length.
  • Contemplated herein are short antisense compounds wherein each of the wings independently comprises 1 to 3 high-affinity modified nucleotides.
  • the high-affinity modifications are sugar modifications.
  • High-affinity modified nucleotides include, but are not limited to, BNA s or other 2'-modified nucleotides, such as 2'-MOE nucleotides.
  • short antisense compounds having at least one modified internucleotide linkage, such as a phosphorothioate internucleotide linkage.
  • the short antisense compounds of the present invention can have all phosphorothioate internucleoside linkages.
  • the short antisense compounds optionally comprise a conjugate group. As shown herein, short antisense compounds have greater affinity for target RNA than they have for DNA and are significantly more potent in vivo as shown by reduction of target mRNA as well as by amelioration of a variety of disease indications.
  • an RNA which is involved in regulating glucose metabolism or clearance, lipid - - metabolism, cholesterol metabolism or insulin metabolism is any RNA involved in the biochemical pathways that regulate these processes.
  • RNAs are well known in the art.
  • target genes include, but are not limited to, ApoB-100 (also known as APOB; Ag(x) antigen; apoB-48; apolipoprotein B; apolipoprotein B-IOO; apolipoprotein B-48) and GCGR (also known as glucagon receptor; GR), CRP, DGAT2, GCCR, PCSK9, PTEN, PTPlB, SGLT2, and SODl.
  • ApoB-100 also known as APOB
  • Ag(x) antigen apoB-48
  • apolipoprotein B apolipoprotein B-IOO
  • apolipoprotein B-48 apolipoprotein B-IOO
  • apolipoprotein B-48 apolipoprotein B
  • a target is identified and antisense oligonucleotides are designed to modulate that target or its expression.
  • designing an oligomeric compound to a target nucleic acid molecule can be a multistep process. Typically the process begins with the identification of a target protein, the activity of which is to be modulated, and then identifying the nucleic acid the expression of which yields the target protein.
  • designing of an antisense compound results in an antisense compound that is hybridizable to the targeted nucleic acid molecule.
  • the antisense compound is an antisense oligonucleotide or antisense oligonucleoside.
  • an antisense compound and a target nucleic acid are complementary to one another. In certain such embodiments, an antisense compound is perfectly complementary to a target nucleic acid. In certain embodiments, an antisense compound includes one mismatch. In certain embodiments, an antisense compound includes two mismatches. In certain embodiments, an antisense compound includes three or more mismatches.
  • RNA to be modulated include, but are not limited to, translocation functions, which include, but are not limited to, translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, and translation of protein from the RNA.
  • RNA processing functions that can be modulated include, but are not limited to, splicing of the RNA to yield one or more RNA species, capping of the RNA, 3' maturation of the RNA and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA.
  • Modulation of expression can result in the increased level of one or more nucleic acid species or the decreased level of one or more nucleic acid species, either temporally or by net steady state level.
  • modulation of expression can mean increase or decrease in target RNA or protein levels.
  • modulation of expression can mean an increase or decrease of one or more RNA splice products, or a change in the ratio of two or more splice products.
  • expression of a target gene is modulated using an oligomeric compound comprising from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • an oligomeric compound comprising from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • methods of modulating a target gene comprises use of a short antisense compound that is 8 nucleobases in length. In certain embodiments, methods of modulating a target gene - - comprises use of a short antisense compound that is 9 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 8 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 10 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 10 nucleobases in length.
  • methods of modulating a target gene comprises use of a short antisense compound that is 11 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 12 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 13 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 14 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 15 nucleobases in length. In certain embodiments, methods of modulating a target gene comprises use of a short antisense compound that is 16 nucleobases in length.
  • methods of modulating expression of a target gene comprises use of a short antisense compound comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of a target gene comprises use of a short antisense compound comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of a target gene comprises use of a short antisense compound comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of a target gene comprises use of a short antisense compound comprising 12 or 14 nucleotides or nucleosides.
  • antisense compounds specifically hybridize when there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
  • stringent hybridization conditions or “stringent conditions” refers to conditions under which an antisense compound will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances, and “stringent conditions” under which antisense compounds hybridize to a target sequence are determined by the nature and composition of the antisense compounds and the assays in which they are being investigated.
  • T m melting temperature
  • Antisense compounds, or a portion thereof, may have a defined percent identity to a SEQ DD NO, or a compound having a specific Isis number.
  • a sequence is identical to the sequence disclosed herein if it has the same nucleobase pairing ability.
  • an RNA which contains uracil in place of thymidine in the disclosed sequences of the compounds described herein would be considered identical as they both pair with adenine.
  • This identity may be over the entire length of the oligomeric compound, or in a portion of the antisense compound (e.g., nucleobases 1-20 of a 27-mer may be compared to a 20-mer to determine percent identity of the oligomeric compound to the SEQ BD NO.
  • an antisense compound need not have an identical sequence to those described herein to function similarly to the antisense compound described herein.
  • Shortened versions of antisense compounds taught herein, or non-identical versions of the antisense compounds taught herein, are also provided herein.
  • Non-identical versions are those wherein each base does not have the same pairing activity as the antisense compounds disclosed herein. Bases do not have the same pairing activity by being shorter or having at least one abasic site.
  • a non-identical version can include at least one base replaced with a different base with different pairing activity (e.g., G can be replaced by C, A, or T).
  • Percent identity is calculated according to the number of bases that have identical base pairing corresponding to the SEQ ID NO or antisense compound to which it is being compared.
  • the non-identical bases may be adjacent to each other, dispersed through out the oligonucleotide, or both.
  • a 16-mer having the same sequence as nucleobases 2-17 of a 20-mer is 80% identical to the 20-mer.
  • a 20-mer containing four nucleobases not identical to the 20-mer is also 80% identical to the 20-mer.
  • a 14-mer having the same sequence as nucleobases 1-14 of an 18-mer is 78% identical to the 18-mer.
  • the percent identity is based on the percent of nucleobases in the original sequence present in a portion of the modified sequence. Therefore, a 30 nucleobase antisense compound comprising the full sequence of the complement of a 20 nucleobase active target segment would have a portion of 100% identity with the complement of the 20 nucleobase active target segment, while further comprising an additional 10 nucleobase portion.
  • the complement of an active target segment may constitute a single portion.
  • the oligonucleotides provided herein are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to at least a portion of the complement of the active target segments presented herein.
  • Target Nucleic Acids, Regions and Segments are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to at least a portion of the complement of the active target segments presented herein.
  • short antisense compounds may be designed to target any target nucleic acid.
  • the target nucleic acid encodes a target that is clinically relevant. In such embodiments, modulation of the target nucleic acid results in clinical benefit.
  • Certain target nucleic acids include, but are not limited to, the target nucleic acids illustrated in Table 1.
  • a target nucleic acid is a nucleic acid molecule encoding ApoB.
  • Nucleic acid molecules that encode ApoB include, without limitation, SEQ ED NO: 1 and SEQ ID NO: 2.
  • a target nucleic acid is a nucleic acid molecule encoding SGLT2.
  • Nucleic acid molecules that encode SGLT2 include, without limitation, SEQ ED NO: 3.
  • a target nucleic acid is a nucleic acid molecule encoding PCSK9.
  • Nucleic acid molecules that encode PCSK9 include, without limitation, SEQ ID NO: 4.
  • a target nucleic acid is a nucleic acid molecule encoding SODl .
  • Nucleic acid molecules that encode SODl include, without limitation, SEQ ED NO: 5.
  • a target nucleic acid is a nucleic acid molecule encoding CRP.
  • Nucleic acid molecules that encode CRP include, without limitation, SEQ ED NO: 6.
  • a target nucleic acid is a nucleic acid molecule encoding GCCR.
  • Nucleic acid molecules that encode GCCR include, without limitation, SEQ ID NO: 7 and SEQ ID NO:
  • a target nucleic acid is a nucleic acid molecule encoding GCGR.
  • Nucleic acid molecules that encode GCGR include, without limitation, SEQ ED NO: 9.
  • a target nucleic acid is a nucleic acid molecule encoding DGAT2.
  • Nucleic acid molecules that encode DGAT2 include, without limitation, SEQ ID NO: 10.
  • a target nucleic acid is a nucleic acid molecule encoding PTPlB.
  • Nucleic acid molecules that encode PTPlB include, without limitation, SEQ ID NO: 11 and SEQ ED NO: 12.
  • a target nucleic acid is a nucleic acid molecule encoding PTEN.
  • Nucleic acid molecules that encode PTEN include, without limitation, SEQ ID NO: 14 or SEQ ED NO: 15.
  • the targeting process usually includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect will result.
  • the 5 '-most nucleotide of a target region is the 5' target site of a short antisense compound and the 3 '-most nucleotide of a target region is the 3' target site of the same short antisense compound. In certain embodiments, the 5 '-most nucleotide of a target region is the 5' target site of a short antisense compound and the 3 '-most nucleotide of a target region is the 3' target site of a different short antisense compound. In certain embodiments, a target region comprises a nucleotide sequence within 10, 15, or 20 nucleotides of a 5' target site or a 3' target site.
  • a target region is a structurally defined region of the nucleic acid.
  • a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region.
  • the target nucleic acid having one or more active short antisense compounds targeted thereto is a target RNA.
  • the compounds are preferably separated by no more than about 10 nucleotides on the target sequence, more preferably no more than about 5 nucleotides on the target sequence, even more preferably the short antisense compounds are contiguous, most preferably the short antisense compounds are overlapping. There may be substantial variation in activity (e.g., as defined by percent inhibition) of the short antisense compounds within an active target segment.
  • Active short antisense compounds are those that modulate the expression of their target nucleic acid, including but not limited to a target RNA. Active short antisense compounds inhibit expression of their target RNA at least 10%, preferably 20%. In a preferred embodiment, at least about 50%, preferably about 70% of the short antisense compounds targeted to the active target segment modulate expression of their target RNA at least 40%. In a more preferred embodiment, the level of inhibition required to define an active short antisense compound is defined based on the results from the screen used to define the active target segments.
  • a suitable target segment is at least about an 8-nucleobase portion of a target region to which an active short antisense compound is targeted.
  • Target segments can include DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 5'-terminus of one of the illustrative target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately upstream of the 5 '-terminus of the target segment and continuing until the DNA or RNA comprises about 8 to about 16 nucleobases).
  • Target segments are also represented by DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 3'-terminus of one of the illustrative target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately downstream of the 3'-terminus of the target segment and continuing until the DNA or RNA comprises about 8 to about 16 nucleobases).
  • antisense target segments may be represented by DNA or RNA sequences that comprise at least 8 consecutive nucleobases from an internal portion of the sequence of an illustrative target segment, and may extend in either or both directions until the short antisense compound comprises about 8 to about 16 nucleobases.
  • short antisense compounds are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
  • the short antisense compounds may also be targeted to regions of the target nucleobase sequence comprising any consecutive nucleobases 8 to 16 nucleobases in length along the target nucleic acid molecule.
  • Target segments 8-16 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative target segments are considered to be suitable for targeting as well.
  • the short antisense compounds may also encompass 8-16 nucleobases within those segments identified herein as beginning at a particular 5' target site. Any segment of 8, 9, 10, 11, or more preferably 12, 13, 14, 15 or 16 contiguous nucleobases in a 50, preferably 25, more preferably 16 nucleobase perimeter around these regions are also considered to be suitable for targeting.
  • the "suitable target segments” identified herein may be employed in a screen for additional short antisense compounds that modulate the expression of a target nucleic acid.
  • “Modulators” are those compounds that decrease or increase the expression of a target nucleic acid and which comprise at least an 8-nucleobase portion which is complementary to a target segment.
  • the screening method comprises the steps of contacting a target segment of a nucleic acid with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a target nucleic acid.
  • the candidate modulator or modulators are capable of modulating (e.g. either decreasing or increasing) the expression of a target nucleic acid, the modulator may then be employed in further investigative studies of the function of the target, or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.
  • sequence, monomer, monomelic modification, and monomeric linkage may each be selected independently.
  • short antisense compounds are described by a motif.
  • any motif may be used with any sequence, whether or not the sequence and/or the motif is specifically disclosed herein.
  • short antisense compounds comprise modifications that are not amenable to description by motif (for example, short antisense compounds comprising several different modifications and/or linkages at various positions throughout the compound). Such combinations may be incorporated for any sequence, whether or not it is disclosed herein.
  • sequence listing accompanying this filing provides certain nucleic acid sequences independent of chemical modification. Though that listing identifies each sequence as either "RNA" or "DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications and/or motifs.
  • short antisense compounds comprise at least one high-affinity modified monomer.
  • short antisense compounds targeted to nucleic acid molecules encoding targets including, but not limited to, ApoB-100 (also known as APOB; Ag(x) antigen; apoB-48; apolipoprotein B; apolipoprotein B-IOO; apolipoprotein B-48), GCGR (also known as glucagon receptor; GR), CRP, DGAT2, GCCR, PCSK9, PTEN, PTPlB, SGLT2, and SODl.
  • ApoB-100 also known as APOB
  • Ag(x) antigen also known as APOB
  • apoB-48 apolipoprotein B
  • apolipoprotein B-IOO apolipoprotein B-48
  • GCGR also known as glucagon receptor
  • CRP CRP
  • DGAT2 DGAT2
  • GCCR PCSK9
  • PTEN PTPlB
  • short antisense compounds may be designed to modulate any target.
  • the target is clinically relevant. In such embodiments, modulation of the target results in clinical benefit.
  • Certain targets are preferentially expressed in the kidney.
  • Certain targets are preferentially expressed in the liver.
  • Certain targets are associated with a metabolic disorder.
  • Certain targets are associated to a cardiovascular disorder.
  • a target is selected from: ApoB, SGLT2, PCSK9, SODl, CRP, GCCR, GCGR, DGAT2, PTPlB, and PTEN.
  • a target is selected from: ApoB, SGLT2, PCSK9, SODl, CRP, GCCR, GCGR, DGAT2, and PTPlB.
  • a target is any protein other than SGLT2.
  • short antisense compounds exhibit liver and kidney-specific target RNA reduction in vivo. Such property renders those short antisense compounds particularly useful for inhibition of many target RNAs involved in metabolic and cardiovascular diseases.
  • methods of treating cardiovascular or metabolic disorders by contacting said kidney or liver tissues with short antisense compounds targeted to RNAs associated with said disorders.
  • methods for ameliorating any of a variety of metabolic or cardiovascular disease indications with the short antisense compounds of the present invention are also provided.
  • ApoB also known as apolipoprotein B-IOO; ApoB-100, apolipoprotein B-48; ApoB-48 and Ag(x) antigen
  • ApoB performs a variety of activities, from the absorption and processing of dietary lipids to the regulation of circulating lipoprotein levels (Davidson and Shelness, Annu. Rev. Nutr., 2000, 20, 169-193). This latter property underlies its relevance in terms of atherosclerosis susceptibility, which is highly correlated with the ambient concentration of ApoB-containing lipoproteins (Davidson and Shelness, - -
  • ApoB-100 is the major protein component of LDL-C and contains the domain required for interaction of this lipoprotein species with the LDL receptor. Elevated levels of LDL-C are a risk factor for cardiovascular disease, including atherosclerosis.
  • ApoB is the gene product or protein of which expression is to be modulated by administration of a short antisense compound.
  • ApoB nucleic acid means any nucleic acid encoding ApoB.
  • a ApoB nucleic acid includes, without limitation, a DNA sequence encoding ApoB, an RNA sequence transcribed from DNA encoding ApoB, and an mRNA sequence encoding ApoB.
  • ApoB mRNA means an mRNA encoding ApoB.
  • the invention provides methods of modulating the expression of ApoB in an individual comprising administering a short antisense compound targeted to an ApoB nucleic acid. In certain embodiments, the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions comprising a short antisense compound targeted to an ApoB nucleic acid.
  • the individual has hypercholesterolemia, non-familial hypercholesterolemia, familial hypercholesterolemia, heterozygous familial hypercholesterolemia, homozygous familial hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease.
  • LDL-C levels of 130-159 mg/dL, 160-189 mg/dL, and greater than or equal to 190 mg/dL are considered borderline high, high, and very high, respectively.
  • Total cholesterol levels of 200-239 and greater than or equal to 240 mg/dL are considered borderline high and high, respectively.
  • HDL-C levels of less than 40 mg/dL are considered low.
  • the individual has been identified as in need of lipid-lowering therapy. In certain such embodiments, the individual has been identified as in need of lipid-lowering therapy according to the guidelines established in 2001 by Adult Treatment Panel III (ATP III) of the National Cholesterol Education Program (NCEP), and updated in 2004 (Grundy et al., Circulation, 2004, 110, 227- 239).
  • the individual in need of lipid-lowering therapy has LDL-C above 190 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 160 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 130 mg/dL.
  • the individual in need of lipid-lowering therapy has LDL- C above 100 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 160 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 130 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 100 mg/dL. In certain such embodiments the individual should maintain LDL-C below 70 mg/dL.
  • the invention provides methods for reducing ApoB in an individual. In certain embodiments the invention provides methods for reducing ApoB-containing lipoprotein in an individual. In certain embodiments the invention provides methods for reducing LDL-C in an individual. In certain embodiments the invention provides methods for reducing VLDL-C in an individual. In certain embodiments the invention provides methods for reducing EDL-C in an individual. In certain embodiments the invention provides methods for reducing non-HDL-C in an individual. In certain embodiments the invention provides methods for reducing Lp(a) in an individual. In certain embodiments the invention provides methods for reducing serum triglyceride in an individual. In certain embodiments the invention provides methods for reducing liver triglyceride in an individual.
  • the invention provides methods for reducing Ox-LDL-C in an individual. In certain embodiments the invention provides methods for reducing small LDL particles in an individual. In certain embodiments the invention provides methods for reducing small VLDL particles in an individual. In certain embodiments the invention provides methods for reducing phospholipids in an individual. In certain embodiments the invention provides methods for reducing oxidized phospholipids in an individual.
  • the invention provides methods for reducing Ox-LDL-C concentration in a subject.
  • the reduction in ApoB, LDL-C, VLDL-C, BDL-C, total cholesterol, non-HDL-C, Lp(a), triglyerides, or Ox-LDL-C is, independently, selected from at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, and at least 100%.
  • the reduction in ApoB, LDL-C, VLDL-C, IDL-C, total cholesterol, non-HDL-C, Lp(a), triglyerides, or Ox-LDL-C is, independently, selected from at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, and at least 70%. In certain such embodiments, the reduction in ApoB, LDL-C, VLDL-C, IDL-C, total cholesterol, non-HDL- C, Lp(a), triglyerides, or Ox-LDL-C is, independently, selected from at least 40%, at least 50%, at least 60%, and at least 70%.
  • the invention provides method for raising HDL-C concentration in a subject.
  • the methods provided by the present invention do not lower HDL-C. In certain embodiments, the methods provided by the present invention do not result in accumulation of lipids in the liver. In certain embodiments, the methods provided by the present invention do not cause hepatic steatosis. In certain embodiments, the invention provides methods for lowering ApoB concentration in a subject while reducing side effects associated with treatment. In certain such embodiments, a side effect is liver toxicity. In certain such embodiments, a side effect is abnormal liver function. In certain such embodiments, a side effect is elevated alanine aminotransferase (ALT). Li certain such embodiments, a side effect is elevated aspartate aminotransferase (AST).
  • ALT alanine aminotransferase
  • AST aspartate aminotransferase
  • the invention provides methods for lowering ApoB concentration in a subject who is not reaching target LDL-C levels as a result of lipid-lowering therapy
  • a short antisense compound targeted to an ApoB nucleic acid is the only lipid-lowering agent administered to the subject, hi certain such embodiments, the subject has not complied with recommended lipid-lowering therapy, hi certain such embodiments, a pharmaceutical composition of the invention is co-administered with an additional different lipid-lowering therapy.
  • an additional lipid-lowering therapy is LDL-apheresis.
  • an additional lipid-lowering therapy is a statin
  • an additional lipid-lowering therapy is ezetimibe.
  • the invention provides methods for lowering ApoB concentration in a statin-intolerant subject, hi certain such embodiments, the subject has creatine kinase concentration increases as a result of statin administration, hi certain such embodiments, the subject has liver function abnormalities as a result of statin administration, hi certain such embodiments the subject has muscle aches as a result of statin administration, hi certain such embodiments the subject has central nervous system side effects as a result of statin administration. In certain embodiments, the subject has not complied with recommended statin administration.
  • the invention provides methods for lowering liver triglycerides in a subject, hi certain such embodiments, the subject has elevated liver triglycerides, hi certain such embodiments, the subject has steatohepatitis. hi certain such embodiments, the subject has steatosis, hi certain such embodiments, liver triglyceride levels are measured by magnetic resonance imaging. hi certain embodiments, the invention provides methods for reducing coronary heart disease risk in a subject.
  • the invention provides methods for slowing the progression of atherosclerosis in a subject, hi certain such embodiments the invention provides methods for stopping the progression of atherosclerosis in a subject, hi certain such embodiments the invention provides methods for reducing the size and/or prevalence of atherosclerotic plaques in a subject, hi certain embodiments the methods provided reduce a subject's risk of developing atherosclerosis.
  • improved cardiovascular outcome is the reduction of the risk of developing coronary heart disease
  • improved cardiovascular outcome is a reduction in the occurrence of one or more major cardiovascular events, which include, but are not limited to, death, myocardial infarction, reinfarction, stroke, cardiogenic shock, pulmonary edema, cardiac arrest, and atrial dysrhythmia
  • major cardiovascular events which include, but are not limited to, death, myocardial infarction, reinfarction, stroke, cardiogenic shock, pulmonary edema, cardiac arrest, and atrial dysrhythmia
  • the improved cardiovascular outcome is evidenced by improved carotid intimal media thickness
  • improved carotid intimal media thickness is a decrease in thickness.
  • improved carotid intimal media thickness is a prevention an increase of intimal media thickness.
  • a pharmaceutical composition comprising a short antisense compound targeted to an ApoB nucleic acid is for use in therapy.
  • the therapy is the reduction of LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a) , serum triglyceride, liver triglyceride, Ox-LDL-C, small LDL particles, small VLDL, phospholipids, or oxidized phospholipids in an individual.
  • the therapy is the treatment of hypercholesterolemia, non-familial hypercholesterolemia, familial hypercholesterolemia, heterozygous familial hypercholesterolemia, homozygous familial hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease.
  • the therapy is the reduction of CHD risk.
  • the therapy is prevention of atherosclerosis.
  • the therapy is the prevention of coronary heart disease.
  • a pharmaceutical composition comprising a short antisense compound targeted to an ApoB nucleic acid is used for the preparation of a medicament for reducing LDL-C, ApoB, VLDL-C, EDL-C, non-HDL-C, Lp(a) , serum triglyceride, liver triglyceride, Ox-LDL-C, small LDL particles, small VLDL, phospholipids, or oxidized phospholipids in an individual.
  • pharmaceutical composition comprising a short antisense compound targeted to an ApoB nucleic acid is used for the preparation of a medicament for reducing coronary heart disease risk.
  • a short antisense compound targeted to an ApoB nucleic acid is used for the preparation of a medicament for the treatment of hypercholesterolemia, non-familial hypercholesterolemia, familial hypercholesterolemia, heterozygous familial hypercholesterolemia, homozygous familial hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease.
  • one or more pharmaceutical compositions comprising a short antisense compound targeted to an ApoB nucleic acid are co-administered with one or more other pharmaceutical agents.
  • such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention.
  • the one or more pharmaceutical agents are lipid-lowering agents.
  • such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention.
  • such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention.
  • one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent.
  • one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time.
  • one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times.
  • one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation.
  • one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition comprising a short antisense compound targeted to an ApoB nucleic acid include lipid-lowering agents.
  • pharmaceutical agents that may be coadministered with a pharmaceutical composition of the present invention include, but are not limited to atorvastatin, simvastatin, rosuvastatin, and ezetimibe.
  • the lipid-lowering agent is administered prior to administration of a pharmaceutical composition of the present invention.
  • the lipid-lowering agent is administered following administration of a pharmaceutical composition of the present invention.
  • the lipid-lowering agent is administered at the same time as a pharmaceutical composition of the present invention.
  • the dose of a co-administered lipid-lowering agent is the same as the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is lower than the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a coadministered lipid-lowering agent is greater than the dose that would be administered if the lipid-lowering agent was administered alone.
  • a co-administered lipid-lowering agent is a HMG-CoA reductase inhibitor.
  • the HMG-CoA reductase inhibitor is a statin.
  • the statin is selected from atorvastatin, simvastatin, pravastatin, fluvastatin, and rosuvastatin.
  • a co-administered lipid-lowering agent is a cholesterol absorption inhibitor.
  • cholesterol absorption inhibitor is ezetimibe.
  • a co-administered lipid-lowering agent is a co-formulated HMG-CoA reductase inhibitor and cholesterol absorption inhibitor.
  • the co-formulated lipid-lowering agent is ezetimibe/simvastatin.
  • a co-administered lipid-lowering agent is a microsomal triglyceride transfer protein inhibitor (MTP inhibitor).
  • MTP inhibitor microsomal triglyceride transfer protein inhibitor
  • a co-administered pharmaceutical agent is a bile acid sequestrant.
  • the bile acid sequestrant is selected from cholestyramine, colestipol, and colesevelam.
  • a co-administered pharmaceutical agent is a nicotinic acid.
  • the nicotinic acid is selected from immediate release nicotinic acid, extended release nicotinic acid, and sustained release nicotinic acid.
  • a co-administered pharmaceutical agent is a fibric acid.
  • a fibric acid is selected from gemfibrozil, fenofibrate, clof ⁇ brate, bezaf ⁇ brate, and ciprofibrate.
  • compositions comprising a short antisense compound targeted to an ApoB nucleic acid include, but are not limited to, corticosteroids, including but not limited to prednisone; immunoglobulins, including, but not limited to intravenous immunoglobulin (IVIg); analgesics (e.g., acetaminophen); anti-inflammatory agents, including, but not limited to non-steroidal anti-inflammatory drugs (e.g., ibuprofen, COX-I inhibitors, and COX-2, inhibitors); salicylates; antibiotics; antivirals; antifungal agents; antidiabetic agents (e.g., biguanides, glucosidase inhibitors, insulins, sulfonylureas, and thiazolidenediones); adrenergic modifiers; diuretics; hormones (e.g., anabolic steroids, androgen, estrogen,
  • a pharmaceutical composition comprising a short antisense compound targeted to an ApoB nucleic acid may be administered in conjunction with a lipid-lowering therapy.
  • a lipid-lowering therapy is therapeutic lifestyle change.
  • a lipid-lowering therapy is LDL apheresis.
  • the antisense compounds provided herein can be used to lower the level of apolipoprotein B-containing lipoproteins in a human subject.
  • apolipoprotein B- containing lipoprotein refers to any lipoprotein that has apolipoprotein B as its protein component, and is understood to include LDL, VLDL, IDL, and lipoprotein(a).
  • LDL, VLDL, IDL and lipoprotein(a) each contain one molecule of apolipoprotein B, thus a serum apolipoprotein B measurement reflects the total number of these lipoproteins.
  • each of the aforementioned lipoproteins is atherogenic.
  • lowering one or more apolipoprotein B-containing lipoproteins in serum may provide a therapeutic benefit to a human subject.
  • Small LDL particles are considered to be particularly atherogenic relative to large LDL particles, thus lowering small LDL particles can provide a therapeutic benefit to a human subject.
  • Additional lipid parameters can also be determined in a subject. Reduction of total cholesterol:HDL ratio or LDLiHDL ratio is a clinically desirable improvement in cholesterol ratio. Similarly, it is clinically desirable to reduce serum triglycerides in humans who exhibit elevated lipid levels.
  • serum LDL particle size refers to the classification of serum LDL particle size, which may be very small, small, medium, or large, and is typically expressed in g/ ⁇ mol.
  • serum LDL cholesteryl ester concentration means the amount of cholesteryl ester present in LDL particles, and is typically measured as mg/dL.
  • serum LDL cholesteryl ester composition is a measurement of the percentage of saturated, monounsaturated and polyunsaturated cholesteryl ester fatty acids present in serum LDL particles.
  • Polyunsaturation of serum LDL cholesteryl esters means the percentage of polyunsaturated cholesteryl ester fatty acids in serum LDL particles.
  • the antisense compounds provided herein can be used to treat metabolic disorders.
  • a variety of biomarkers can be used for evaluating metabolic disease. For example, blood glucose levels can be determined by a physician or even by the patient using a commonly available test kit or glucometer (for example, the Ascensia ELITETM kit, Ascensia (Bayer), Tarrytown NY, or Accucheck, Roche Diagnostics).
  • Glycated hemoglobin (HbAi c ) can also be measured.
  • HbAi 0 is a stable minor hemoglobin variant formed in vivo via posttranslational modification by glucose, and it contains predominantly glycated NB ⁇ -terminal ⁇ -chains.
  • HbAi 0 is often viewed as the "gold standard" for measuring sustained blood glucose control (Bunn, H.F. et al., 1978, Science. 200, 21-7).
  • HbAi c can be measured by ion-exchange HPLC or immunoassay; home blood collection and mailing kits for HbAi 0 measurement are now widely available.
  • Serum fructosamine is another measure of stable glucose control and can be measured by a colorimetric method (Cobas Integra, Roche Diagnostics).
  • short antisense compounds are targeted to an ApoB nucleic acid having the sequence of GENBANK® Accession No. NM 000384.1, incorporated herein as SEQ ID NO: 1.
  • a short antisense compound targeted to SEQ ID NO: 1 is at least 90% complementary to SEQ ID NO: 1.
  • a short antisense compound targeted to SEQ ID NO: 1 is at least 95% complementary to SEQ ID NO: 1.
  • a short antisense compound targeted to SEQ ID NO: 1 is 100% complementary to SEQ ID NO: 1.
  • a short antisense compound targeted to SEQ ID NO: 1 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Table 2 and Table 3.
  • nucleotide sequence set forth in each SEQ ID NO in Tables 2 and 3 is independent of any modification to a sugar moiety, a monomelic linkage, or a nucleobase.
  • short antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Tables 2 and 3 illustrate examples of short antisense compounds targeted to SEQ ID NO: 1.
  • Table 2 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 1.
  • Table 3 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO: 1.
  • the column labeled 'gapmer motif indicates the wing-gap-wing motif of each short antisense compounds.
  • the gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2 '-modified sugar.
  • the particular 2 '-modified sugar is also indicated in the 'gapmer motif column.
  • '2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten T- deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate.
  • the short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
  • "5-mC in gap only” indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
  • Table 3 Short antisense compounds targeted to SEQ ID NO: 1 and having 1 or 2 mismatches
  • a target region is nucleotides 263-278 of SEQ ID NO: 1.
  • short antisense compounds targeted to nucleotides 263-278 of SEQ ID NO: 1 comprise a nucleotide sequence selected from SEQ ID NO: 16 or 17.
  • a short antisense compound targeted to nucleotides 263-278 of SEQ ID NO: 1 is selected from Isis NO. 372816 or 372894.
  • a target region is nucleotides 428-483 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 428-483 of SEQ ED NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27.
  • a short antisense compound targeted to nucleotides 428-483 of SEQ ID NO: 1 is selected from Isis NO. 372817, 372895, 372818, 372896, 372819, 372897, 372820, 372898, 372821, or 372899.
  • a target region is nucleotides 428-458 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 428-458 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 18, 19, 20, 21, 22, 23, 24, or 25.
  • a short antisense compound targeted to nucleotides 428-458 of SEQ ID NO: 1 is selected from Isis NO. 372817, 372895, 372818, 372896, 372819, 372897, 372820, or 372898.
  • a target region is nucleotides 468-483 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 468-483 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 26 or 27.
  • a short antisense compound targeted to nucleotides 468-483 of SEQ ID NO: 1 is selected from Isis NO. 372821 or 372899.
  • a target region is nucleotides 587-607 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 587-607 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 28, 29, 30, or 31.
  • a short antisense compound targeted to nucleotides 587-607 of SEQ ID NO: 1 is selected from ISIS NO. 372822, 372900, 372823, or 372901.
  • a target region is nucleotides 715-736 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 715-736 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 32, 33, 34, 35, 36, 37, 38, 39, or 40.
  • a short antisense compound targeted to nucleotides 715-736 of SEQ ID NO: 1 is selected from Isis NO. 346583, 346584, 346585, 346586, 346587, 346588, 346589, 346590, or 346591.
  • a target region is nucleotides 929-944 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 929-944 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 41 or 42.
  • a short antisense compound targeted to nucleotides 929-944 of SEQ ID NO: 1 is selected from Isis NO. 372824 or 372902.
  • a target region is nucleotides 1256-1319 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 1256-1319 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 43, 44, 45, or 46.
  • a short antisense compound targeted to nucleotides 1256-1319 of SEQ ID NO: 1 is selected from Isis NO. 372825, 372903, 372826, or 372904.
  • a target region is nucleotides 1256-1271 of SEQ DD NO: 1.
  • a short antisense compound targeted to nucleotides 1256-1271 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 43 or 44.
  • a short antisense compound targeted to nucleotides 1256-1271 of SEQ ID NO: 1 is selected from Isis NO. 372825 or 372903.
  • a target region is nucleotides 1304-1319 of SEQ DD NO: 1.
  • a short antisense compound targeted to nucleotides 1304-1319 of SEQ DD NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 45 or 46.
  • a short antisense compound targeted to nucleotides 1304-1319 of SEQ ID NO: 1 is selected from Isis NO. 372826 or 372904.
  • a target region is nucleotides 2135-2150 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 2135-2150 of SEQ DD NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 47 or 48.
  • a short antisense compound targeted to nucleotides 2135-2150 of SEQ ID NO: 1 is selected from ISIS NO. 372829 or 372907.
  • a target region is nucleotides 2774-2794 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 2774-2794 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 49, 50, 51, or 52.
  • a short antisense compound targeted to nucleotides 2774-2794 of SEQ ID NO: 1 is selected from ISIS NO. 372832, 372910, 372833, or 372911.
  • a target region is nucleotides 2961-2976 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 2961-2976 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 53 or 54.
  • a short antisense compound targeted to nucleotides 2961-2976 of SEQ ID NO: 1 is selected from ISIS NO. 372835 or 372913.
  • a target region is nucleotides 3248-3269 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 3248-3269 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 55, 56, 57, 58, 59, 60, 61, 62, or 63.
  • a short antisense compound targeted to nucleotides 3248-3269 of SEQ ID NO: 1 is selected from ISIS NO. 346592, 346593, 346594, 346595, 346596, 346597, 346598, 346599, or 346600.
  • a target region is nucleotides 3350-3375 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 3350-3375 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 64, 65, 66, 67, 68, or 69.
  • a short antisense compound targeted to nucleotides 3350-3375 of SEQ ID NO: 1 is selected from ISIS NO. 372836, 372914, 372837, 372915, 372838, or 372916.
  • a target region is nucleotides 3409-3424 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 3409-3424 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 70 or 73.
  • a short antisense compound targeted to nucleotides 3409-3424 of SEQ ID NO: 1 is selected from ISIS NO. 372839, 387461, 380147, or 372917.
  • a target region is nucleotides 3573-3588 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 3573-3588 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 74 or 75.
  • a short antisense compound targeted to nucleotides 3573-3588 of SEQ ID NO: 1 is selected from ISIS NO. 372840 or 372918.
  • a target region is nucleotides 3701-3716 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 3701-3716 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 76 or 77.
  • a short antisense compound targeted to nucleotides 3701-3716 of SEQ DD NO: 1 is selected from ISIS NO. 372841 or 372919.
  • a target region is nucleotides 4219-4234 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 4219-4234 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 78 or 79.
  • a short antisense compound targeted to nucleotides 4219-4234 of SEQ ID NO: 1 is selected from ISIS NO. 372843 or 372921.
  • a target region is nucleotides 4301-4323 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 4301-4323 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 80, 81, 82, or 83.
  • a short antisense compound targeted to nucleotides 4301-4323 of SEQ ID NO: 1 is selected from ISIS NO. 372844, 372922, 372845, or 372923.
  • a target region is nucleotides 5588-5609 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 5588-5609 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 84, 85, 86, 87, 88, 89, 90, 91, or 92.
  • a short antisense compound targeted to nucleotides 5588-5609 of SEQ ID NO: 1 is selected from ISIS NO. 346601, 346602, 346603, 346604, 346605, 346606, 346607, 346608, or 346609.
  • a target region is nucleotides 5924-5939 of SEQ YD NO: 1.
  • a short antisense compound targeted to nucleotides 5924-5939 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 93 or 94.
  • a short antisense compound targeted to nucleotides 5924-5939 of SEQ ID NO: 1 is selected from ISIS NO. 372851 or 372929.
  • a target region is nucleotides 6664-6679 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 6664-6679 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 95 or 96.
  • a short antisense compound targeted to nucleotides 6664-6679 of SEQ ID NO: 1 is selected from ISIS NO.
  • a target region is nucleotides 6908-6923 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 6908-6923 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 97 or 98.
  • a short antisense compound targeted to nucleotides 6908-6923 of SEQ ID NO: 1 is selected from ISIS NO.
  • a target region is nucleotides 7190-7205 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 7190-7205 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 99 or 100.
  • a short antisense compound targeted to nucleotides 7190-7205 of SEQ ID NO: 1 is selected from ISIS NO. 372856 or 372934.
  • a target region is nucleotides 7817-7839 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 7817-7839 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 101, 102, 104, 105, 106, 107, 108, 109, 110, or 111.
  • a short antisense compound targeted to nucleotides 7817-7839 of SEQ ID NO: 1 is selected from ISIS NO. 372858, 372936, 346610, 346611, 346612, 346613, 346614, 346615, 346616, 346617, or 346618.
  • a target region is nucleotides 7995-8010 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 7995-8010 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 112 or 113.
  • a short antisense compound targeted to nucleotides 7995-8010 of SEQ ID NO: 1 is selected from ISIS NO. 372859 or 372937.
  • a target region is nucleotides 8336-8356 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 8336-8356 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 114, 115, 116, or 117.
  • a short antisense compound targeted to nucleotides 8336-8356 of SEQ ID NO: 1 is selected from ISIS NO. 372861, 372939, 372862, or 372940.
  • a target region is nucleotides 8539-8554 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 8539-8554 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 118 or 119.
  • a short antisense compound targeted to nucleotides 8539-8554 of SEQ ID NO: 1 is selected from ISIS NO. 372863 or 372941.
  • a target region is nucleotides 9344-9359 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 9344-9359 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 120 or 121.
  • a short antisense compound targeted to nucleotides 9344-9359 of SEQ ID NO: 1 is selected from ISIS NO.
  • a target region is nucleotides 9515-9530 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 9515-9530 of SEQ ED NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 122 or 123.
  • a short antisense compound targeted to nucleotides 9515-9530 of SEQ ID NO: 1 is selected from ISIS NO.
  • a target region is nucleotides 9794-9809 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 9794-9809 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 124 or 125.
  • a short antisense compound targeted to nucleotides 9794-9809 of SEQ ID NO: 1 is selected from ISIS NO. 372875 or 372953.
  • a target region is nucleotides 10157-10187 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 10157-10187 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 126, 127, 128, 129, 130, 131, 132, or 133.
  • a short antisense compound targeted to nucleotides 10157-10187 of SEQ ID NO: 1 is selected from ISIS NO. 372877, 372955, 372878, 372956, 372879, 372957, 372880, or 372958.
  • a target region is nucleotides 10838-10859 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 10838-10859 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 134, 135, 136, 137, 138, 139, 140, 141, or 142.
  • a short antisense compound targeted to nucleotides 10838-10859 of SEQ ID NO: 1 is selected from ISIS NO. 346619, 346620, 346621, 346622, 346623, 346624, 346625, 346626, or 346627.
  • a target region is nucleotides 13689-13714 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 13689-13714 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 143, 144, 145, 146, 147, or 148.
  • a short antisense compound targeted to nucleotides 13689-13714 of SEQ ID NO: 1 is selected from ISIS NO. 372890, 372968, 372891, 372969, 372892, or 372970.
  • a target region is nucleotides 13907-13928 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 13907-13928 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 149, 150, 151, 152, 153, 154, 155, 156, or 157.
  • a short antisense compound targeted to nucleotides 13907-13928 of SEQ ID NO: 1 is selected from ISIS NO. 346628, 346629, 346630, 346631, 346632, 346633, 346634, 346635, or 346636.
  • a target region is nucleotides 13963-13984 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 13963-13984 of SEQ ID NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 158, 159, 160, 161, 162, 163, 164, 165, or 166.
  • a short antisense compound targeted to nucleotides 13963-13984 of SEQ ID NO: 1 is selected from ISIS NO. 346637, 346638, 346639, 346640, 346641, 346642, 346643, 346644, or 346645.
  • a target region is nucleotides 14051-14072 of SEQ ID NO: 1.
  • a short antisense compound targeted to nucleotides 14051-14072 of SEQ BD NO: 1 comprises a nucleotide sequence selected from SEQ ID NO 167, 168, 169, 170, 171, 172, 173, 174, or 175.
  • a short antisense compound targeted to nucleotides 14051-14072 of SEQ ID NO: 1 is selected from ISIS NO. 346646, 346647, 346648, 346649, 346650, 346651, 346652, 346653, or 346654.
  • short antisense compounds targeted to an ApoB nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
  • short antisense compounds targeted to an ApoB nucleic acid are short gapmers.
  • short gapmers targeted to an ApoB nucleic acid comprise at least one high affinity modification in one or more wings of the compound.
  • short antisense compounds targeted to an ApoB nucleic acid comprise 1 to 3 high-affinity modifications in each wing.
  • the nucleosides or nucleotides of the wing comprise a 2' modification.
  • the monomers of the wing are BNA' s.
  • the monomers of the wing are selected from ⁇ -L-Methyleneoxy (4'-CH 2 -O-2') BNA , ⁇ -D- Methyleneoxy (4'-CH 2 -O-2') BNA , Ethyleneoxy (4'-(CH 2 ) 2 -O-2') BNA , Aminooxy (4'-CH 2 -O-N(R)- 2') BNA and Oxyamino (4'-CH 2 -N(R)-O-2') BNA.
  • the monomers of a wing are 2'MOE nucleotides.
  • short antisense compounds targeted to an ApoB nucleic acid comprise a gap between the 5' wing and the 3' wing.
  • the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
  • the monomers of the gap are unmodified deoxyribonucleotides.
  • the monomers of the gap are unmodified ribonucleotides.
  • gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
  • short antisense compounds targeted to an ApoB nucleic acid have uniform monomelic linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid have mixed backbones.
  • short antisense compounds targeted to an ApoB nucleic acid are 8 monomers in length, hi certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 13 monomers in length. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 14 monomers in length.
  • short antisense compounds targeted to an ApoB nucleic acid are 15 monomers in length, hi certain embodiments, short antisense compounds targeted to an ApoB nucleic acid are 16 monomers in length, hi certain embodiments, short antisense compounds targeted to an ApoB nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to an ApoB nucleic acid comprise 12 to 14 nucleotides or nucleosides.
  • the invention provides methods of modulating expression of ApoB.
  • such methods comprise use of one or more short antisense compound targeted to an ApoB nucleic acid, wherein the short antisense compound targeted to an ApoB nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • the short antisense compound targeted to an ApoB nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 11 monomers in length.
  • methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid that is 16 monomers in length.
  • methods of modulating expression of ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of ApoB comprise use of a short antisense compound targeted to an ApoB nucleic acid comprising 12 or 14 nucleotides or nucleosides.
  • short antisense compounds targeting a ApoB nucleic acid may have any one or more properties or characteristics of the short antisense compounds generally described herein.
  • short antisense compounds targeting a ApoB nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8- 3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2. 2.
  • motif wing - deoxy gap -wing
  • SGLT-2 Sodium dependent glucose transporter 2
  • SGLT-2 is expressed in the kidney proximal tubule epithelial cells, and functions to reabsorb glucose preventing glucose loss in the urine.
  • SGLT-2 is a member of an 11-membered family of sodium substrate co-transporters. Many of these family members share sequence homology, for example SGLT-I shares about 59% sequence identity with SGLT-2 and about 70% sequence identity with SGLT-3.
  • SGLT-I is a glucose transporter found in the heart and the CNS.
  • SGLT-3 is a glucose sensing sodium channel in the small intestine.
  • the separate localization patterns for these SGLTs is one point of distinction between the homologous family members. (Handlon, A.L., Expert Opin.
  • Diabetes is a disorder characterized by hyperglycemia due to deficient insulin action.
  • Chronic hyperglycemia is a major risk factor for diabetes-associated complications, including heart disease, retinopathy, nephropathy and neuropathy.
  • Diabetic nephropathy is the most common cause of end-stage renal disease that develops in many patients with diabetes.
  • Glucotoxicity which results from long-term hyperglycemia, induces tissue-dependent insulin resistance in diabetic patients (Nawano et al., Am. J. Physiol. Endocrinol. Metab., 2000, 278, E535-543).
  • Sodium dependent glucose transporter 2 is the gene product or protein of which expression is to be modulated by administration of a short antisense compound.
  • Sodium dependent glucose transporter 2 is generally referred to as SGLT2 but may also be referred to as SLC5A2; sodium-glucose transporter 2; sodium-glucose cotransporter, kidney low affinity; sodium-glucose cotransporter, renal; solute carrier family 5 (sodium/glucose cotransporter), member 2; SL52.
  • SGLT2 nucleic acid means any nucleic acid encoding SGLT2.
  • a SGLT2 nucleic acid includes, without limitation, a DNA sequence encoding SGLT2, an RNA sequence transcribed from DNA encoding SGLT2, and an mRNA sequence encoding SGLT2.
  • SGLT2 mRNA means an mRNA encoding a SGLT2 protein.
  • short antisense compounds are used to modulate expression of SGLT-2 and related proteins.
  • such modulation is accomplished by providing short antisense compounds that hybridize with one or more target nucleic acid molecules encoding SGLT-2, including, but is not limited to, SGLT2, SL52, SLC5A2, Sodium-Glucose Co-Transporter, Kidney Low Affinity Sodium-Glucose Co-Transporter, Renal Sodium-Glucose Co-Transporter 2 and Solute Carrier Family 5 Sodium/Glucose Co-Transporter Member 2. Also provided are methods of treating metabolic and/or cardiovascular disease and disorders as described herein.
  • short antisense compounds that inhibit the expression of SGLT2 are used in methods of lowering blood glucose levels in an animal and methods of delaying or preventing the onset of type 2 diabetes. Such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds of the invention to the animal, which may be in need of treatment.
  • the one or more compounds can be a short antisense compound targeting a nucleic acid encoding SGLT2.
  • short antisense compounds are chimeric oligomeric compounds having mixed phosphorothioate and phosphodiester backbones,.
  • Certain mixed backbone short antisense compounds have a central gap comprising at least 5 contiguous 2'-deoxy nucleosides flanked by two wings each of which comprises at least one 2'-O-methoxyethyl nucleoside.
  • the internucleoside linkages of the mixed backbone compounds are phosphorothioate linkages in the gap and phosphodiester linkages in the two wings.
  • mixed backbone compounds have phosphorothioate linkages in the wings, except for one phosphodiester linkage at one or both of the extreme 5' and 3' ends of the oligonucleotide.
  • short antisense compounds targeted to SGLT2 have a motif (wing - deoxy gap -wing) selected from 3-10-3, 2-10-3, 2-10-2, 1-10- 1,1-10-2, 2-8-2, 1-9-2, 1-8-1, 3-6-3 or 1-6-1.
  • short antisense compounds targeted to SGLT2 have a motif (wing - deoxy gap -wing) selected from 1-10-1, 1-10-2, 2-8-2, 1-9-2, 1-8-1, 3-6-3 or 1-6-1.
  • short antisense compounds targeted to an SGLT2 nucleic acid and having a mixed backbone are efficiently delivered to the kidney.
  • administration of short antisense compounds targeted to an SGLT2 nucleic acid and having a mixed backbone results in modulation of target gene expression in the kidney.
  • short antisense compounds targeted to an SGLT2 nucleic acid and having a mixed backbone are more potent for reducing SGLT-2 mRNA and have a faster onset compared with a short antisense compound that does not have a mixed back-bone, but is otherwise identical.
  • such increase potency and/or reduced toxicity is in mouse and/or rat.
  • such increase potency and/or reduced toxicity is in a human.
  • ISIS 145733 which comprises uniform phosphorothioate linkages and ISIS 257016 which comprises phosphodiester linkage in the wings and phosphorothioate linkages in the gap, are otherwise identical. Both comprise the sequence GAAGTAGCCACCAACTGTGC (SEQ E) NO. 1572). Both of the oligonucleotides further comprise a gap consisting of ten 2'-deoxynucleotides, flanked on each side by five-nucleotide "2'-methoxyethyl (T- MOE) nucleotides. All cytidine residues are 5-methylcytidines.
  • the mixed back-bone compound, ISIS 257016 was about 50 times more potent for reducing SGLT-2 mRNA compared to the non-mixed parent compound, ISIS 145733 (see EXAMPLE 9).
  • ISIS 257016 Pharmacokinetic studies of certain mixed backbone compound ISIS 257016 indicate that in certain embodiments, the compound acts as a prodrug that is metabolized to a 12 nucleobase pharmacophore.
  • ISIS 370717 is a 12 nucleobase antisense oligonucleotide targeted to SGLT-2 comprising the sequence TAGCCACCAACT (SEQ ID NO.
  • ISIS 257016 further comprising a gap consisting of ten 2'-deoxynucleotides, flanked on both sides by one-nucleotide wings.
  • the wings are composed of 2'-methoxyethyl (2'-MOE) nucleotides. All cytidine residues are 5-methylcytidines.
  • short antisense compounds comprising 2' MOE monomers in the wings are efficiently delivered to the kidney and treatment with such compounds results in efficient modulation of target gene expression in the kidney without liver or kidney toxicity. It is further shown herein that in certain embodiments, short antisense compounds are more potent for reducing SGLT-2 mRNA and have a faster onset compared with parent oligonucleotides targeted to SGLT-2 mRNA in mouse and rat. 2' MOE gap shortmers are shown herein to improve potency and bioavailability over parent compounds.
  • ISIS 370717 1-10-1 gapmer was used as a template to make sequence related oligos with varying motifs. Studies evaluating wing, gap and total length variations around the ISIS 370717 12 mer oligonucleotide can be seen in EXAMPLE 12. Certain motifs evaluated included 1-10-1, 2-8-2, 1-8-1, 3-6-3, and 1-6-1 (see Table 60 in EXAMPLE 12).
  • the compounds were analyzed for their effect on SGLT2 mRNA levels. All the motifs inhibited the expression of SGLT2 in vivo in a dose-dependent manner. The 1-10-1, 2-8-2 and 1-8-1 gapmers were found to be particularly potent. SGLT-2 mRNA was reduced by more than 80% over the controls using these motifs.
  • the invention provides short antisense compounds targeted to an SGLT2 nucleic acid and having a motif selected from: 1-10-1 and 1-10-2 MOE gapmer. (see Table 62 in EXAMPLE 13). Certain such compounds were analyzed for their effect on rat SGLT2 mRNA. Results in Table 63 illustrate that both the 1-10-1 and 1-10-2 MOE gapmers inhibit the expression of SGLT2 in vivo in a dose-dependent manner and over 80% reduction of SGLT-2 mRNA could be achieved.
  • ISIS 388625 the effect of ISIS 388625 on dog SGLT2 mRNA levels was also analyzed. Dog studies illustrate that greater than 80% inhibition of the expression of SGLT2 can be achieved at a 1 mg/kg/wk dose. Even greater inhibition can be achieved at slightly higher doses. Administration of ISIS 388625 in dog was also shown to improved glucose tolerance. Peak plasma glucose levels were decreased by over 50% on average and the subsequent drop in glucose was lessened compared to saline controls in a standard glucose tolerance test (See EXAMPLE 17). Also, in a rat model of diabetes, short antisense compounds were shown to significantly decrease plasma glucose levels and HbAlC over time compared to PBS and control treated animals (See Example 16).
  • short antisense compounds are targeted to an SGLT2 nucleic acid having the sequence of GENBANK® Accession No. NM_003041.1, incorporated herein as SEQ ID NO: 2.
  • a short antisense compound targeted to SEQ ID NO: 3 is at least 90% complementary to SEQ ID NO: 3.
  • a short antisense compound targeted to SEQ ID NO: 3 is at least 95% complementary to SEQ ID NO: 3.
  • a short antisense compound targeted to SEQ UD NO: 3 is 100% complementary to SEQ ID NO: 1.
  • a short antisense compound targeted to SEQ ID NO: 3 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Table 4 and 5.
  • nucleotide sequence set forth in each SEQ ID NO set forth in Tables 4 and 5 is independent of any modification to a sugar moiety, a monomelic linkage, or a nucleobase.
  • short antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Tables 4 and 5 illustrate examples of short antisense compounds targeted to SEQ ID NO: 3.
  • Table 4 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 3.
  • Table 5 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO: 3.
  • the column labeled 'gapmer motif indicates the wing-gap-wing motif of each short antisense compounds.
  • the gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2 '-modified sugar.
  • the particular 2 '-modified sugar is also indicated in the 'gapmer motif column.
  • '2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten T- deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate.
  • the short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
  • "5-mC in gap only” indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
  • Table 5 Short antisense compounds targeted to SEQ ID NO: 3 and having 1 or 2 mismatches
  • a target region is nucleotides 85-184 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 85-184 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 85-184 comprises a nucleotide sequence selected from SEQ E) NO 214, 215, 216, 217, 218, 219, 221, 222, 223, 224, 225, or 227.
  • a short antisense compound targeted to nucleotides 85-184 of SEQ ID NO: 3 is selected from Isis No 379684, 405193, 405194, 405195, 405196, 405197, 379685, 405198, 405199, 405200, 405201, 379686, 379711 or 388628.
  • a target region is nucleotides 113-132 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 113-132 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 113-132 comprises a nucleotide sequence selected from SEQ ID NO 215, 216, 217, 218, 219, 221, 222, 223, or 224.
  • a short antisense compound targeted to nucleotides 113-132 of SEQ ID NO: 3 is selected from Isis No 405193, 405194, 405195, 405196, 405197, 379685, 405198, 405199, 405200, or 405201.
  • a target region is nucleotides 207-329 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 207-329 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 207-329 comprises a nucleotide sequence selected from SEQ ID NO 228, 229, 230, 232, 233, 234, 235, 236, 237, 238, 239, 240, or 241.
  • a short antisense compound targeted to nucleotides 207-329 of SEQ ID NO: 3 is selected from Isis No 405202, 405203, 405204, 379687, 405205, 405206, 405207, 405208, 405209, 405210, 405211, 405212, 379688, or 379689.
  • a target region is nucleotides 207-273 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 207-273 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 207-273 comprises a nucleotide sequence selected from SEQ ID NO 228, 229, 230, 232, 233, 234, 235, 236, 237, 238, or 239.
  • a short antisense compound targeted to nucleotides 207-273 of SEQ ID NO: 3 is selected from Isis No 405202, 405203, 405204, 379687, 405205, 405206, 405207, 405208, 405209, 405210, 405211, or 405212.
  • a target region is nucleotides 207-219 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 207-219 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 207-219 comprises a nucleotide sequence selected from SEQ ID NO 228 or 229.
  • a short antisense compound targeted to nucleotides 207-219 of SEQ ID NO: 3 is selected from Isis NO.. 405202 or 405203.
  • a target region is nucleotides 236-252 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 236-252 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 236-252 comprises a nucleotide sequence selected from SEQ ID NO 230, 232, 233, 234, 235, or 236.
  • a short antisense compound targeted to nucleotides 236-252 of SEQ DD NO: 3 is selected from Isis NO. 405204, 379687, 405205, 405206, 405207, 405208, or 405209.
  • a target region is nucleotides 260-273 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 260-273 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 260-273 comprises a nucleotide sequence selected from SEQ ID NO 237, 238, or 239.
  • a short antisense compound targeted to nucleotides 260-273 of SEQ ID NO: 3 is selected from Isis NO. 405210, 405211, or 405212.
  • a target region is nucleotides 435-640 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 435-640 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 435-640 comprises a nucleotide sequence selected from SEQ ID NO 242, 243, 245, 246, 251, 252, 253, 254, 256, 257, 258, 259, 260, 261, 262, 263, or 264.
  • a short antisense compound targeted to nucleotides 435- 640 of SEQ ID NO: 3 is selected from Isis NO.
  • a target region is nucleotides 527-540 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 527-540 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 527-540 comprises a nucleotide sequence selected from SEQ ID NO 245, 246, or 251.
  • a short antisense compound targeted to nucleotides 527-540 of SEQ ID NO: 3 is selected from Isis NO. 389780, 379692, 382676, 388626, 392170, 392173, or 405213.
  • a target region is nucleotides 564-603 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 564-603 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 564-603 comprises a nucleotide sequence selected from SEQ ID NO 252, 253, 254, 256, 257, 258, 259, 260, 261, 262, or 263.
  • a short antisense compound targeted to nucleotides 564-603 of SEQ ID NO: 3 is selected from Isis NO. 405214, 405215, 405216, 379693, 405217, 405218, 405219, 405220, 405221,
  • a target region is nucleotides 564-579 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 564-579 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 564-579 comprises a nucleotide sequence selected from SEQ ID NO 252, 253, 254, 256, or 257.
  • a short antisense compound targeted to nucleotides 564-579 of SEQ ID NO: 3 is selected from Isis NO. 405214, 405215, 405216, 379693, 405217, or 405218.
  • a target region is nucleotides 587-603 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 587-603 of SEQ ED NO: 3.
  • a short antisense compound targeted to nucleotides 587-603 comprises a nucleotide sequence selected from SEQ ID NO 258, 259, 260, 261, 262, or 263.
  • a short antisense compound targeted to nucleotides 587-603 of SEQ ID NO: 3 is selected from Isis NO. 405219, 405220, 405221, 405222, 405223, or 405224.
  • a target region is nucleotides 974-1014 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 974-1014 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 974-1014 comprises a nucleotide sequence selected from SEQ ID NO 267, 268, 269, 270, 271, 272, or 274.
  • a short antisense compound targeted to nucleotides 974-1014 of SEQ ID NO: 3 is selected from Isis NO. 379696, 405226, 405227, 405228, 405229, 405230, 379697, or 405231.
  • a target region is nucleotides 998-1014 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 998-1014 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 998-1014 comprises a nucleotide sequence selected from SEQ ID NO 268, 269, 270, 271, 272, or 274.
  • a short antisense compound targeted to nucleotides 998-1014 of SEQ ID NO: 3 is selected from Isis NO. 405226, 405227, 405228, 405229, 405230, 379697, or 405231.
  • a target region is nucleotides 1091-1170 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 1091-1170 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 1091-1170 comprises a nucleotide sequence selected from SEQ ID NO 275, 276, 277, 278, 279, 280, 281, 283, 284, 285, 286, or 287.
  • a short antisense compound targeted to nucleotides 1091-1170 of SEQ ID NO: 3 is selected from Isis NO. 379698, 405232, 405233, 405234, 405235, 388626, 379699, 382677,
  • a target region is nucleotides 1091-1104 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 1091-1104 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 1091-1104 comprises a nucleotide sequence selected from SEQ ID NO 275, 276, or 277.
  • an short antisense compound targeted to nucleotides 1091-1104 of SEQ ID NO: 3 is selected from Isis NO. 379698, 405232, or 405233.
  • a target region is nucleotides 1130-1144 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 1130-1144 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 1130-1144 comprises a nucleotide sequence selected from SEQ ID NO 278, 279, 280, 281, or 283.
  • a short antisense compound targeted to nucleotides 1130-1144 of SEQ ID NO: 3 is selected from Isis NO. 405234, 405235, 388626, 379699, 382677, or 405236.
  • a target region is nucleotides 1157-1170 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 1157-1170 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 1157-1170 comprises a nucleotide sequence selected from SEQ ID NO 284, 285, or 287.
  • a short antisense compound targeted to nucleotides 1157-1170 of SEQ ID NO: 3 is selected from Isis NO.
  • a target region is nucleotides 1542-1556 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 1542-1556 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 1542-1556 comprises a nucleotide sequence selected from SEQ ID NO 289, 290, 291, 292, or 293.
  • a short antisense compound targeted to nucleotides 1542-1556 of SEQ ID NO: 3 is selected from Isis NO. 405240, 405241, 405242, 388629, 379702, or 382678.
  • a target region is nucleotides 1976-1991 of SEQ ID NO: 3.
  • a short antisense compound is targeted to nucleotides 1976-1991 of SEQ ID NO: 3.
  • a short antisense compound targeted to nucleotides 1976-1991 comprises a nucleotide sequence selected from SEQ ID NO 296, 297, 298, 299, or 300.
  • a short antisense compound targeted to nucleotides 1976-1991 of SEQ ID NO: 3 is selected from Isis NO. 405243, 405244, 405245, 405246, or 405247.
  • short antisense compounds targeted to an SGLT2 nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
  • short antisense compounds targeted to an SGLT2 nucleic acid are short gapmers.
  • short gapmers targeted to an SGLT2 nucleic acid comprise at least one high affinity modification in one or more wings of the compound.
  • short antisense compounds targeted to an SGLT2 nucleic acid comprise 1 to 3 high-affinity modifications in each wing.
  • the nucleosides or nucleotides of the wing comprise a 2' modification.
  • the monomers of the wing are BNA' s.
  • the monomers of the wing are selected from ⁇ -L-Methyleneoxy (4'-CH 2 -O-2') BNA , ⁇ -D- Methyleneoxy (4'-CH 2 -O-2') BNA , Ethyleneoxy (4'-(CH 2 ) 2 -O-2') BNA , Aminooxy (4'-CH 2 -O-N(R)- 2') BNA and Oxyamino (4'-CH 2 -N(R)-O-2') BNA.
  • the monomers of a wing are 2'MOE nucleotides.
  • short antisense compounds targeted to an SGLT2 nucleic acid comprise a gap between the 5' wing and the 3' wing.
  • the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
  • the monomers of the gap are unmodified deoxyribonucleotides.
  • the monomers of the gap are unmodified ribonucleotides.
  • gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
  • short antisense compounds targeted to an SGLT2 nucleic acid have uniform monomelic linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid have mixed backbones.
  • short antisense compounds targeted to an SGLT2 nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 13 monomers in length.
  • short antisense compounds targeted to an SGLT2 nucleic acid are 14 monomers in length. Li certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 15 monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to an SGLT2 nucleic acid comprise 12 to 14 nucleotides or nucleosides.
  • the invention provides methods of modulating expression of SGLT2.
  • such methods comprise use of one or more short antisense compound targeted to an SGLT2 nucleic acid, wherein the short antisense compound targeted to an SGLT2 nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • the short antisense compound targeted to an SGLT2 nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 11 monomers in length.
  • methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid that is 16 monomers in length.
  • methods of modulating expression of SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of SGLT2 comprise use of a short antisense compound targeted to an SGLT2 nucleic acid comprising 12 or 14 nucleotides or nucleosides.
  • LDL-R LDL-receptor
  • apoB apolipoprotein B
  • PCSK9 proprotein convertase subtilisin/kexin type 9
  • ApoB participates in the intracellular assembly and secretion of triglyceride-rich lipoproteins and is a ligand for the LDL-R.
  • PCSK9 is proposed to reduce LDL-R expression levels in the liver. Reduced LDL-R expression results in reduced hepatic uptake of circulating ApoB-containing lipoproteins, which in turn leads to elevated cholesterol.
  • PCSK9 is the gene product or protein of which expression is to be modulated by administration of a short antisense compound.
  • PCSK9 nucleic acid means any nucleic acid encoding PCSK9.
  • a PCSK9nucleic acid includes, without limitation, a DNA sequence encoding PCSK9, an RNA sequence transcribed from DNA encoding PCSK9, and an mRNA sequence encoding PCSK9.
  • PCSK9 mRNA means an mRNA encoding PCSK9.
  • the invention provides methods of modulating the expression of PCSK9 in an individual comprising administering a short antisense compound targeted to a PCSK9 nucleic acid. In certain embodiments, the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions of the present invention.
  • the individual has hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease.
  • LDL-C levels of 130-159 mg/dL, 160-189 mg/dL, and greater than or equal to 190 mg/dL are considered borderline high, high, and very high, respectively.
  • Total cholesterol levels of 200-239 and greater than or equal to 240 mg/dL are considered borderline high and high, respectively.
  • HDL-C levels of less than 40 mg/dL are considered low.
  • the individual has been identified as in need of lipid-lowering therapy. In certain such embodiments, the individual has been identified as in need of lipid-lowering therapy according to the guidelines established in 2001 by Adult Treatment Panel III (ATP III) of the National Cholesterol Education Program (NCEP), and updated in 2004 (Grundy et al., Circulation, 2004, 110, 227- 239).
  • the individual in need of lipid-lowering therapy has LDL-C above 190 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 160 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 130 mg/dL.
  • the individual in need of lipid-lowering therapy has LDL- C above 100 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 160 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 130 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 100 mg/dL. In certain such embodiments the individual should maintain LDL-C below 70 mg/dL.
  • the invention provides methods for reducing ApoB in an individual. In certain embodiments the invention provides methods for reducing ApoB-containing lipoprotein in an individual. In certain embodiments the invention provides methods for reducing LDL-C in an individual. In certain embodiments the invention provides methods for reducing VLDL-C in an individual. In certain embodiments the invention provides methods for reducing IDL-C in an individual. In certain embodiments the invention provides methods for reducing non-HDL-C in an individual. In certain embodiments the invention provides methods for reducing Lp(a) in an individual. In certain embodiments the invention provides methods for reducing serum triglyceride in an individual. In certain embodiments the invention provides methods for reducing liver triglyceride in an individual.
  • the invention provides methods for reducing Ox-LDL-C in an individual. In certain embodiments the invention provides methods for reducing small LDL particles in an individual. In certain embodiments the invention provides methods for reducing small VLDL particles in an individual. In certain embodiments the invention provides methods for reducing phospholipids in an individual. In certain embodiments the invention provides methods for reducing oxidized phospholipids in an individual.
  • the methods provided by the present invention do not lower HDL-C. In certain embodiments, the methods provided by the present invention do not result in accumulation of lipids in the liver.
  • a pharmaceutical composition comprising a short antisense compound targeted to a PCSK9 nucleic acid is for use in therapy.
  • the therapy is the reduction of LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a) , serum triglyceride, liver triglyceride, Ox-LDL-C, small LDL particles, small VLDL, phospholipids, or oxidized phospholipids in an individual.
  • the therapy is the treatment of hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease.
  • the therapy is the reduction of CHD risk.
  • the therapy is prevention of atherosclerosis.
  • the therapy is the prevention of coronary heart disease.
  • a pharmaceutical composition comprising a short antisense compound targeted to a PCSK9 nucleic acid is used for the preparation of a medicament for reducing LDL-C, ApoB, VLDL-C, IDL-C, non-HDL-C, Lp(a) , serum triglyceride, liver triglyceride, Ox-LDL-C, small LDL particles, small VLDL, phospholipids, or oxidized phospholipids in an individual.
  • pharmaceutical composition comprising a short antisense compound targeted to PCKS9 is used for the preparation of a medicament for reducing coronary heart disease risk.
  • a short antisense compound targeted to a PCSK9 nucleic acid is used for the preparation of a medicament for the treatment of hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease, type II diabetes, type II diabetes with dyslipidemia, dyslipidemia, hypertriglyceridemia, hyperlipidemia, hyperfattyacidemia, hepatic steatosis, non-alcoholic steatohepatitis, or non-alcoholic fatty liver disease.
  • one or more pharmaceutical compositions of the present invention are co-administered with one or more other pharmaceutical agents.
  • such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention.
  • such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention, hi certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention, hi certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent, hi certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time, hi certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include lipid-lowering agents.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition of the present invention include, but are not limited to atorvastatin, simvastatin, rosuvastatin, and ezetimibe.
  • the lipid-lowering agent is administered prior to administration of a pharmaceutical composition of the present invention.
  • the lipid-lowering agent is administered following administration of a pharmaceutical composition of the present invention.
  • the lipid-lowering agent is administered at the same time as a pharmaceutical composition of the present invention.
  • the dose of a coadministered lipid-lowering agent is the same as the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is lower than the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is greater than the dose that would be administered if the lipid-lowering agent was administered alone.
  • a co-administered lipid-lowering agent is a HMG-CoA reductase inhibitor.
  • the HMG-CoA reductase inhibitor is a statin.
  • the statin is selected from atorvastatin, simvastatin, pravastatin, fluvastatin, and rosuvastatin.
  • a co-administered lipid-lowering agent is a cholesterol absorption inhibitor.
  • cholesterol absorption inhibitor is ezetimibe.
  • a co-administered lipid-lowering agent is a co-formulated HMG-CoA reductase inhibitor and cholesterol absorption inhibitor.
  • the co-formulated lipid-lowering agent is ezetimibe/simvastatin.
  • a co-administered lipid-lowering agent is a microsomal triglyceride transfer protein inhibitor (MTP inhibitor).
  • MTP inhibitor microsomal triglyceride transfer protein inhibitor
  • a co-administered lipid-lowering agent is an oligonucleotide targeted to an ApoB nucleic acid.
  • a co-administered pharmaceutical agent is a bile acid sequestrant.
  • the bile acid sequestrant is selected from cholestyramine, colestipol, and colesevelam.
  • a co-administered pharmaceutical agent is a nicotinic acid.
  • the nicotinic acid is selected from immediate release nicotinic acid, extended release nicotinic acid, and sustained release nicotinic acid.
  • a co-administered pharmaceutical agent is a fibric acid.
  • a f ⁇ bric acid is selected from gemfibrozil, fenofibrate, clofibrate, bezafibrate, and ciprofibrate.
  • compositions of the present invention include, but are not limited to, corticosteroids, including but not limited to prednisone; immunoglobulins, including, but not limited to intravenous immunoglobulin (IVIg); analgesics (e.g., acetaminophen); anti-inflammatory agents, including, but not limited to nonsteroidal anti-inflammatory drugs (e.g., ibuprofen, COX-I inhibitors, and COX-2, inhibitors); salicylates; antibiotics; antivirals; antifungal agents; antidiabetic agents (e.g., biguanides, glucosidase inhibitors, insulins, sulfonylureas, and thiazolidenediones); adrenergic modifiers; diuretics; hormones (e.g., anabolic steroids, androgen, estrogen, calcitonin, progestin, somatostan, and
  • the pharmaceutical compositions of the present invention may be administered in conjuction with a lipid-lowering therapy.
  • a lipid-lowering therapy is therapeutic lifestyle change, hi certain such embodiments, a lipid-lowering therapy is LDL apheresis.
  • short antisense compounds are targeted to a PCSK9 nucleic acid having the sequence of GENBANK® Accession No. NM l 74936.2, incorporated herein as SEQ ED NO: 4.
  • a short antisense compound targeted to SEQ ED NO: 4 is at least 90% complementary to SEQ ID NO: 4.
  • a short antisense compound targeted to SEQ ED NO: 4 is at least 95% complementary to SEQ ED NO: 4.
  • a short antisense compound targeted to SEQ ED NO: 4 is 100% complementary to SEQ ED NO: 4.
  • a short antisense compound targeted to SEQ ED NO: 4 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Table 6 or Table 7.
  • nucleotide sequence set forth in each SEQ ED NO in Tables 6 and 7 is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • short antisense compounds defined by a SEQ ED NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Short antisense compounds described by Isis Number indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Tables 6 and 7 illustrate examples of short antisense compounds targeted to SEQ ED NO: 4.
  • Table 6 illustrates short antisense compounds that are 100% complementary to SEQ ED NO: 4.
  • Table 7 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ED NO: 4.
  • the column labeled 'gapmer motif indicates the wing-gap-wing motif of each short antisense compounds.
  • the gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2 '-modified sugar.
  • the particular 2 '-modified sugar is also indicated in the 'gapmer motif column.
  • '2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten T- deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate.
  • the short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
  • "5-mC in gap only” indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
  • Table 7 Short antisense compounds targeted to SEQ ID NO: 4 and having 1 or 2 mismatches
  • a target region is nucleotides 695-710 of SEQ ID NO: 4.
  • short antisense compounds targeted to nucleotides 695-710 of SEQ ID NO: 4 comprise a nucleotide sequence selected from SEQ ID NO: 329, 330, or 331.
  • a short antisense compound targeted to nucleotides 695-710 of SEQ ID NO: 4 is selected from Isis NO. 400297, 400298, or 400299.
  • a target region is nucleotides 742-770 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 742-770 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 332 or 333.
  • a short antisense compound targeted to nucleotides 742-770 of SEQ ID NO: 4 is selected from Isis NO. 400300 or 400301.
  • a target region is nucleotides 828-843 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 828-843 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 334, 335, or 336.
  • a short antisense compound targeted to nucleotides 828-843 of SEQ ID NO: 4 is selected from ISIS No. 400302, 400303, or 400304.
  • a target region is nucleotides 937-1007 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 937-1007 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 337, 338, 339, 340, 341, 342, 343, 344, or 345.
  • a short antisense compound targeted to nucleotides 937-1007 of SEQ ID NO: 4 is selected from Isis NO. 400305, 400306, 400307, 400308, 400309, 400310, 400311, 400312, 400313, or 403739.
  • a target region is nucleotides 937-965 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 937-965 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 337 or 338.
  • a short antisense compound targeted to nucleotides 937-965 of SEQ ID NO: 4 is selected from Isis NO. 400305 or 400306.
  • a target region is nucleotides 988-1007 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 988-1007 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 339, 340, 341, 342, 343, 344, or 345.
  • a short antisense compound targeted to nucleotides 937-1007 of SEQ ID NO: 4 is selected - - from lsis NO. 400307, 400308, 400309, 400310, 400311, 400312, 4003313, or 403739.
  • a target region is nucleotides 1057-1160 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 1057-1160 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 346, 347, 348, 349, 350, 351, 352, 353, 354, or 355.
  • a short antisense compound targeted to nucleotides 1057-1160 of SEQ ID NO: 4 is selected from ISIS NO. 400314, 400315, 400316, 400317, 400318, 400319, 400320, 400321, 400322, or 400323.
  • a target region is nucleotides 1057-1109 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 1057-1109 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 346, 347, 348, 349, 350, 351, 352, 353, or 354.
  • a short antisense compound targeted to nucleotides 1057-1109 of SEQ ID NO: 4 is selected from ISIS NO. 400314, 400315, 400316, 400317, 400318, 400319, 400320, 400321, or 400322.
  • a target region is nucleotides 1057-1091 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 1057-1091 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 346, 347, 348, 349, or 350.
  • a short antisense compound targeted to nucleotides 1057-1091 of SEQ ID NO: 4 is selected from ISIS NO. 400314, 400315, 400316, 400317, or 400318.
  • a target region is nucleotides 1093-1109 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 1093-1109 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 351, 352, 353, or 354.
  • a short antisense compound targeted to nucleotides 1057-1109 of SEQ ID NO: 4 is selected from ISIS NO. 400319, 400320, 400321, or 400322.
  • a target region is nucleotides 1334-1349 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 1334-1349 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 357, 358, or 359.
  • a short antisense compound targeted to nucleotides 1334-1349 of SEQ DD NO: 4 is selected from ISIS NO 400325, 400326, or 400327.
  • a target region is nucleotides 1453-1469 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 1453-1469 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 360, 361, 362, or 363.
  • a short antisense compound targeted to nucleotides 1453-1469 of SEQ ID NO: 4 is selected from ISIS NO 400328, 400329, 400330, 400331, or 403470.
  • a target region is nucleotides 1569-1591 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 1569-1591 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 364, 365, 366, 367, 368, 369, 370, 371, 372, or 373.
  • a short antisense compound targeted to nucleotides 1569-1591 of SEQ ID NO: 4 is selected from ISIS NO 400332, 400333, 400334, 400335, 400336, 400337, 400338, 400339, 400340, or 400341.
  • a target region is nucleotides 1621-1637 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 1621-1637 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 374, 375, 376, or 377.
  • a short antisense compound targeted to nucleotides 1621-1637 of SEQ ID NO: 4 is selected from ISIS NO 400342, 400343, 400344, or 400345.
  • a target region is nucleotides 1738-1754 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 1738-1754 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 378, 379, 380, or 381.
  • a short antisense compound targeted to nucleotides 1738-1754 of SEQ ID NO: 4 is selected from ISIS NO 400346, 400347, 400348, or 400349.
  • a target region is nucleotides 1834-1853 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 1834-1853 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 382, 383, 384, 385, 386, 387, or 388.
  • a short antisense compound targeted to nucleotides 1834-1853 of SEQ ID NO: 4 is selected from ISIS NO 400350, 400351, 400352, 400353, 400354, 400355, or 400356.
  • a target region is nucleotides 2083-2099 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 2083-2099 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 389, 390, 391, or 392.
  • a short antisense compound targeted to nucleotides 2083-2099 of SEQ ID NO: 4 is selected from ISIS NO 400357, 400358, 400359, or 400360.
  • a target region is nucleotides 2316-2338 of SEQ ID NO: 4.
  • a short antisense compound targeted to nucleotides 2316-2338 of SEQ ID NO: 4 comprises a nucleotide sequence selected from SEQ ID NO 393, 394, 395, 396, 397, 398, 399, 400, 401, or 402.
  • a short antisense compound targeted to nucleotides 2316-2338 of SEQ ID NO: 4 is selected from ISIS NO 400361, 400362, 400363, 400364, 400365, 400366, 400367, 400368, 400369, or 400370.
  • short antisense compounds targeted to a PCSK9 nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides .
  • short antisense compounds targeted to a PCSK9 nucleic acid are short gapmers.
  • short gapmers targeted to a PCSK9 nucleic acid comprise at least one high affinity modification in one or more wings of the compound.
  • short antisense compounds targeted to a PCSK9 nucleic acid comprise 1 to 3 high-affinity modifications in each wing.
  • the nucleosides or nucleotides of the wing comprise a 2' - - modification.
  • the monomers of the wing are BNA's.
  • the monomers of the wing are selected from ⁇ -L-Methyleneoxy (4'-CH 2 -O-2') BNA , ⁇ -D- Methyleneoxy (4'-CH 2 -O-2') BNA , Ethyleneoxy (4'-(CH 2 ) 2 -O-2') BNA , Aminooxy (4'-CH 2 -O-N(R)- 2') BNA and Oxyamino (4'-CH 2 -N(R)-O-2') BNA.
  • the monomers of a wing are 2'MOE nucleotides.
  • short antisense compounds targeted to a PCSK9 nucleic acid comprise a gap between the 5' wing and the 3' wing.
  • the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
  • the monomers of the gap are unmodified deoxyribonucleotides.
  • the monomers of the gap are unmodified ribonucleotides.
  • gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
  • short antisense compounds targeting a PCSK9 nucleic acid may have any one or more properties or characteristics of the short antisense compounds generally described herein.
  • short antisense compounds targeting a PCSK9 nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8- 3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.
  • short antisense compounds targeted to a PCSK9 nucleic acid have uniform monomelic linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid have mixed backbones.
  • short antisense compounds targeted to a PCSK9 nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 13 monomers in length.
  • short antisense compounds targeted to a PCSK9 nucleic acid are 14 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 15 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid comprise 10 to 15 monomers, hi certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a PCSK9 nucleic acid comprise 12 to 14 nucleotides or nucleosides.
  • the invention provides methods of modulating expression of PCSK9.
  • such methods comprise use of one or more short antisense compound targeted to a PCSK9 nucleic acid, wherein the short antisense compound targeted to a PCSK9 nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • the short antisense compound targeted to a PCSK9 nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 11 monomers in length.
  • methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid that is 16 monomers in length.
  • methods of modulating expression of PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of PCSK9 comprise use of a short antisense compound targeted to a PCSK9 nucleic acid comprising 12 or 14 nucleotides or nucleosides.
  • SODs superoxide dismutases
  • H 2 O 2 hydrogen peroxide
  • ALS amyotrophic lateral sclerosis
  • ALS amyotrophic lateral sclerosis
  • ALS also known as Lou Gehrig's disease
  • the deleterious effects of various mutations on superoxide dismutase 1 are most likely mediated through a gain of toxic function rather than a loss of superoxide dismutase 1 activity, as the complete absence of superoxide dismutase 1 in mice neither diminishes life nor provokes overt disease (Al-Chalabi and Leigh, Curr. Opin. Neurol, 2000, 13, 397-405; Alisky and Davidson, Hum. Gene Ther., 2000, 11, 2315-2329).
  • SODl means the gene product or protein of which expression is to be modulated by administration of a short antisense compound.
  • SODl nucleic acid means any nucleic acid encoding SODl.
  • a SODl nucleic acid includes, without limitations, a DNA sequence encoding SODl, an RNA sequence transcribed from DNA encoding SODl, and an mRNA sequence encoding SODl.
  • SODl mRNA means an mRNA encoding SODl .
  • the invention provides methods for the slowing of disease progression in an individual suffering from familial ALS by administering to such an individual a short antisense compound targeted to an SODl nucleic acid.
  • a short antisense compound targeted to SODl are delivered directly to the cerebrospinal fluid of the individual.
  • methods further comprise increasing survival time of an individual suffering from familial ALS. Slowing of disease progression is indicated by an improvement in one or more indicators of ALS disease progression, including, without limitation, the revised ALS functional rating scale, pulmonary function tests, and muscle strength measurements.
  • one or more pharmaceutical compositions comprising a short antisense compound targeted to an SODl nucleic acid is co-administered with one or more other pharmaceutical agents.
  • such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention.
  • such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention.
  • such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention.
  • one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent.
  • one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
  • a co-administered pharmaceutical agent is a nicotinic acid.
  • the nicotinic acid is selected from immediate release nicotinic acid, extended release nicotinic acid, and sustained release nicotinic acid.
  • a co-administered pharmaceutical agent is a fibric acid.
  • a fibric acid is selected from gemfibrozil, fenof ⁇ brate, clofibrate, bezafibrate, and ciprofibrate.
  • compositions comprising a short antisense compound targeted to SODl include, but are not limited to, corticosteroids, including but not limited to prednisone; immunoglobulins, including, but not limited to intravenous immunoglobulin (FVIg); analgesics (e.g., acetaminophen); anti-inflammatory agents, including, but not limited to non-steroidal anti-inflammatory drugs (e.g., ibuprofen, COX-I inhibitors, and COX-2, inhibitors); salicylates; antibiotics; antivirals; antifungal agents; antidiabetic agents (e.g., biguanides, glucosidase inhibitors, insulins, sulfonylureas, and thiazolidenediones); adrenergic modifiers; diuretics; hormones (e.g., anabolic steroids, androgen, estrogen, calcitonin,
  • corticosteroids including but not limited to prednisone
  • short antisense compounds are targeted to a SODl nucleic acid having the sequence of GENBANK® Accession No. NM_X02317.1, incorporated herein as SEQ ID NO: 5.
  • a short antisense compound targeted to SEQ ID NO: 5 is at least 90% complementary to SEQ DD NO: 5.
  • a short antisense compound targeted to SEQ ID NO: 5 is at least 95% complementary to SEQ ID NO: 5.
  • a short antisense compound targeted to SEQ ID NO: 5 is 100% complementary to SEQ ID NO: 5.
  • a short antisense compound targeted to SEQ ID NO: 5 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Table 8 or Table 9.
  • nucleotide sequence set forth in each SEQ ID NO in Tables 8 and 9 is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • short antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Short antisense compounds described by Isis Number indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Table 8 illustrates examples of short antisense compounds targeted to SEQ ID NO: 5.
  • Table 8 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 5.
  • the column labeled 'gapmer motif indicates the wing-gap-wing motif of each short antisense compounds.
  • the gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2'- modified sugar.
  • the particular 2 '-modified sugar is also indicated in the 'gapmer motif column.
  • '2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten 2'-deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate.
  • the short antisense compounds comprise 5- methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
  • "5-mC in gap only” indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
  • short antisense compounds targeting a SODl nucleic acid may have any one or more properties or characteristics of the short antisense compounds generally described herein.
  • short antisense compounds targeting a SODl nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8- 3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.
  • a target region is nucleotides 85-100 of SEQ BD NO: 5.
  • short antisense compounds targeted to nucleotides 85-100 of SEQ ED NO: 5 comprise a nucleotide sequence selected from SEQ ID NO: 406, 407, or 408.
  • a short - - antisense compound targeted to nucleotides 85-100 of SEQ ID NO: 5 is selected from Isis No. 387541, 387540, or 387539.
  • short antisense compounds targeted to a SODl nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides .
  • short antisense compounds targeted to a SODl nucleic acid are short gapmers.
  • short gapmers targeted to a SODl nucleic acid comprise at least one high affinity modification in one or more wings of the compound.
  • short antisense compounds targeted to a SODl nucleic acid comprise 1 to 3 high-affinity modifications in each wing.
  • the nucleosides or nucleotides of the wing comprise a 2' modification.
  • the monomers of the wing are BNA' s.
  • the monomers of the wing are selected from ⁇ -L-Methyleneoxy (4'-CH 2 -O-2') BNA , ⁇ -D- Methyleneoxy (4'-CH 2 -O-2') BNA , Ethyleneoxy (4'-(CH 2 ) 2 -O-2') BNA , Aminooxy (4'-CH 2 -O-N(R)- 2') BNA and Oxyamino (4'-CH 2 -N(R)-O-2') BNA.
  • the monomers of a wing are 2'MOE nucleotides.
  • short antisense compounds targeted to a SODl nucleic acid comprise a gap between the 5' wing and the 3' wing.
  • the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
  • the monomers of the gap are unmodified deoxyribonucleotides.
  • the monomers of the gap are unmodified ribonucleotides.
  • gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
  • short antisense compounds targeted to a SODl nucleic acid have uniform monomelic linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid have mixed backbones.
  • short antisense compounds targeted to a SODl nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid are monomers in length. In certain embodiments, short antisense CORE0061 -92- compounds targeted to a SODl nucleic acid are 13 monomers in length.
  • short antisense compounds targeted to a SODl nucleic acid are 14 monomers in length. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid are 15 monomers in length. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a SODl nucleic acid comprise 12 to 14 nucleotides or nucleosides.
  • the invention provides methods of modulating expression of SODl .
  • such methods comprise use of one or more short antisense compound targeted to a SODl nucleic acid, wherein the short antisense compound targeted to a SODl nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • the short antisense compound targeted to a SODl nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • methods of modulating SODl comprise use of a short antisense compound targeted to a SODl nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating SODl comprise use of a short antisense compound targeted to a SODl nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating SODl comprise use of a short antisense compound targeted to a SODl nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating SODl comprise use of a short antisense compound targeted to a SODl nucleic acid that is 11 monomers in length.
  • methods of modulating SODl comprise use of a short antisense compound targeted to a SODl nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating SODl comprise use of a short antisense compound targeted to a SODl nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating SODl comprise use of a short antisense compound targeted to a SODl nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating SODl comprise use of a short antisense compound targeted to a SODl nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating SODl comprise use of a short antisense compound targeted to a SODl nucleic acid that is 16 monomers in length.
  • methods of modulating expression of SODl comprise use of a short antisense compound targeted to a SODl nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of SODl comprise use of a short antisense compound targeted to a SODl nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of SODl comprise use of a short antisense compound targeted to a SODl nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of SODl comprise use of a short antisense compound targeted to a SODl nucleic acid comprising 12 or 14 nucleo tides or nucleosides.
  • CRP also known as C-reactive protein and PTXl
  • PTXl a protein that is highly conserved and considered to be an early indicator of infectious or inflammatory conditions.
  • Plasma CRP levels increase 1, 000-fold in response to infection, ischemia, trauma, burns, and inflammatory conditions.
  • statin therapy lipid-lowering therapy, such as statin therapy, it has been demonstrated that patients having reductions in both LDL-C and CRP have a reduced risk of future coronary events relative to patients experiencing only reductions in LDL-C.
  • CRP means the gene product or protein of which expression is to be modulated by a short antisense compound.
  • CRP nucleic acid means any nucleic acid encoding CRP.
  • a CRP nucleic acid includes, without limitations, a DNA sequence encoding CRP, an RNA sequence transcribed from DNA encoding CRP, and an mRNA sequence encoding CRP.
  • CRP mRNA means an mRNA encoding CRP.
  • the invention provides methods of modulating CRP expression in an individual comprising administering to the individual a short antisense compound targeted to a CRP nucleic acid. In certain embodiments, the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions comprising a short antisense compound targeted to a CRP nucleic acid.
  • the individual has hypercholesterolemia, non-familial hypercholesterolemia, familial hypercholesterolemia, heterozygous familial hypercholesterolemia, homozygous familial hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, one or more risk factors for coronary heart disease.
  • the individual has acute coronary syndrome, vascular injury, arterial occlusion, unstable angina, post peripheral vascular disease, post myocardial infarction (MI), thrombosis, deep vein thrombus, end-stage renal disease (ESRD), chronic renal failure, complement activation, congestive heart failure, or systemic vasculitis.
  • the individual has had a stroke.
  • the individual has undergone a procedure selected from elective stent placement, angioplasty, post percutaneous transluminal angioplasty (PTCA), cardiac transplantation, renal dialysis or cardiopulmonary bypass.
  • a procedure selected from elective stent placement, angioplasty, post percutaneous transluminal angioplasty (PTCA), cardiac transplantation, renal dialysis or cardiopulmonary bypass.
  • the individual has an inflammatory disease.
  • the inflammatory disease is selected from inflammatory bowel disease, ulcerative colitis, - - rheumatoid arthritis, or osteoarthritis.
  • LDL-C levels 130-159 mg/dL, 160-189 mg/dL, and greater than or equal to 190 mg/dL are considered borderline high, high, and very high, respectively.
  • Total cholesterol levels of 200-239 and greater than or equal to 240 mg/dL are considered borderline high and high, respectively.
  • HDL-C levels of less than 40 mg/dL are considered low.
  • the individual has been identified as in need of lipid-lowering therapy. In certain such embodiments, the individual has been identified as in need of lipid-lowering therapy according to the guidelines established in 2001 by Adult Treatment Panel III (ATP III) of the National Cholesterol Education Program (NCEP), and updated in 2004 (Grundy et al., Circulation, 2004, 110, 227- 239).
  • the individual in need of lipid-lowering therapy has LDL-C above 190 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 160 mg/dL. In certain such embodiments, the individual in need of lipid-lowering therapy has LDL-C above 130 mg/dL.
  • the individual in need of lipid-lowering therapy has LDL- C above 100 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 160 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 130 mg/dL. In certain such embodiments the individual in need of lipid-lowering therapy should maintain LDL-C below 100 mg/dL. In certain such embodiments the individual should maintain LDL-C below 70 mg/dL.
  • the invention provides methods for reducing CRP in an individual.
  • the reduction in CRP is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, and at least 100%.
  • the methods provided by the present invention do not lower HDL-C. In certain embodiments, the methods provided by the present invention do not result in accumulation of lipids in the liver. In certain embodiments, the methods provided by the present invention do not cause hepatic steatosis.
  • the invention provides methods for lowering CRP concentration in a subject while reducing side effects associated with treatment.
  • a side effect is liver toxicity.
  • a side effect is abnormal liver function.
  • a side effect is elevated alanine aminotransferase (ALT).
  • a side effect is elevated aspartate aminotransferase (AST).
  • the invention provides methods for lowering CRP concentration in a subject who is not reaching target LDL-C levels as a result of lipid-lowering therapy.
  • a short antisense compound targeted to a CRP nucleic acid is the only pharmaceutical agent administered to the subject.
  • the subject has not complied with recommended lipid-lowering therapy.
  • a pharmaceutical composition of the invention is co-administered with an additional different lipid-lowering therapy.
  • an additional lipid-lowering therapy is LDL-apheresis.
  • an additional lipid-lowering therapy is a statin.
  • an additional lipid-lowering therapy is ezetimibe.
  • the invention provides methods for lowering CRP concentration in a statin-intolerant subject.
  • the subject has creatine kinase concentration increases as a result of statin administration.
  • the subject has liver function abnormalities as a result of statin administration.
  • the subject has muscle aches as a result of statin administration.
  • the subject has central nervous system side effects as a result of statin administration.
  • the subject has not complied with recommended statin administration.
  • the invention provides methods for reducing coronary heart disease risk in a subject. In certain embodiments the invention provides methods for slowing the progression of atherosclerosis in a subject. In certain such embodiments the invention provides methods for stopping the progression of atherosclerosis in a subject. In certain such embodiments the invention provides methods for reducing the size and/or prevalence of atherosclerotic plaques in a subject. In certain embodiments the methods provided reduce a subject's risk of developing atherosclerosis.
  • the methods provided improve the cardiovascular outcome in a subject.
  • improved cardiovascular outcome is the reduction of the risk of developing coronary heart disease.
  • improved cardiovascular outcome is a reduction in the occurance of one or more major cardiovascular events, which include, but are not limited to, death, myocardial infarction, reinfarction, stroke, cardiogenic shock, pulmonary edema, cardiac arrest, and atrial dysrhythmia.
  • the improved cardiovascular outcome is evidenced by improved carotid intimal media thickness.
  • improved carotid intimal media thickness is a decrease in thickness.
  • improved carotid intimal media thickness is a prevention an increase of intimal media thickness.
  • a pharmaceutical composition comprising a short antisense compound targeted to a CRP nucleic acid is for use in therapy.
  • the therapy is the reduction of CRP in an individual.
  • the therapy is the treatment of hypercholesterolemia, non-familial hypercholesterolemia, familial hypercholesterolemia, heterozygous familial hypercholesterolemia, homozygous familial hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, or early onset coronary heart disease.
  • the therapy is the reduction of CHD risk.
  • the therapy is prevention of atherosclerosis.
  • the therapy is the prevention of coronary heart disease.
  • the therapy is the treatment of acute coronary syndrome, chronic renal failure, vascular injury, arterial occlusion, atherothrombosis, unstable angina, - - post peripheral vascular disease, post myocardial infarction (MI), thrombosis, deep vein thrombus, end- stage renal disease (ESRD), complement activation, congestive heart failure, or systemic vasculitis.
  • the therapy is the treatment of an individual who has undergone a procedure selected from elective stent placement, angioplasty, post percutaneous transluminal angioplasty (PTCA), cardiac transplantation, renal dialysis or cardiopulmonary bypass.
  • the therapy is the treatment of an inflammatory disorder.
  • a pharmaceutical composition comprising a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for reducing CRP in an individual.
  • pharmaceutical composition comprising a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for reducing coronary heart disease risk.
  • a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for the treatment of hypercholesterolemia, non-familial hypercholesterolemia, familial hypercholesterolemia, heterozygous familial hypercholesterolemia, homozygous familial hypercholesterolemia, mixed dyslipidemia, atherosclerosis, a risk of developing atherosclerosis, coronary heart disease, a history of coronary heart disease, early onset coronary heart disease, or one or more risk factors for coronary heart disease.
  • a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for the treatment of acute coronary syndrome, chronic renal failure, vascular injury, arterial occlusion, atherothrombosis, unstable angina, post peripheral vascular disease, post myocardial infarction (MI), thrombosis, deep vein thrombus, end-stage renal disease (ESRD), complement activation, congestive heart failure, or systemic vasculitis.
  • a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for the treatment of an individual who has had a stroke.
  • a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for the treatment in an individual who has undergone a procedure selected from elective stent placement, angioplasty, post percutaneous transluminal angioplasty (PTCA), cardiac transplantation, renal dialysis or cardiopulmonary bypass.
  • PTCA post percutaneous transluminal angioplasty
  • a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for the treatment of an inflammatory disease. In certain such embodiments, a short antisense compound targeted to a CRP nucleic acid is used for the preparation of a medicament for the treatment of inflammatory bowel disease, ulcerative colitis, rheumatoid arthritis, or osteoarthritis.
  • one or more pharmaceutical compositions comprising a short antisense compound targeted to a CRP nucleic acid are co-administered with one or more other pharmaceutical agents.
  • the one or more other pharmaceutical agents is a lipid-lowering agent.
  • such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention.
  • such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention.
  • such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention.
  • one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent.
  • one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time.
  • one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times.
  • one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation.
  • one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition comprising a short antisense compound targeted to a CRP nucleic acid include lipid-lowering agents.
  • pharmaceutical agents that may be coadministered with a pharmaceutical composition of the present invention include, but are not limited to atorvastatin, simvastatin, rosuvastatin, and ezetimibe.
  • the lipid-lowering agent is administered prior to administration of a pharmaceutical composition of the present invention.
  • the lipid-lowering agent is administered following administration of a pharmaceutical composition of the present invention.
  • the lipid-lowering agent is administered at the same time as a pharmaceutical composition of the present invention.
  • the dose of a co-administered lipid-lowering agent is the same as the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a co-administered lipid-lowering agent is lower than the dose that would be administered if the lipid-lowering agent was administered alone. In certain such embodiments the dose of a coadministered lipid-lowering agent is greater than the dose that would be administered if the lipid-lowering agent was administered alone.
  • a co-administered lipid-lowering agent is a HMG-CoA reductase inhibitor.
  • the HMG-CoA reductase inhibitor is a statin.
  • the statin is selected from atorvastatin, simvastatin, pravastatin, fluvastatin, and rosuvastatin.
  • a co-administered lipid-lowering agent is ISIS 301012.
  • a co-administered lipid-lowering agent is a cholesterol absorption inhibitor.
  • cholesterol absorption inhibitor is ezetimibe.
  • a co-administered lipid-lowering agent is a co-formulated HMG-CoA reductase inhibitor and cholesterol absorption inhibitor.
  • the co-formulated lipid-lowering agent is ezetimibe/simvastatin.
  • a co-administered lipid-lowering agent is a microsomal triglyceride transfer protein inhibitor (MTP inhibitor).
  • MTP inhibitor microsomal triglyceride transfer protein inhibitor
  • a co-administered pharmaceutical agent is a bile acid sequestrant.
  • the bile acid sequestrant is selected from cholestyramine, colestipol, and colesevelam.
  • a co-administered pharmaceutical agent is a nicotinic acid.
  • the nicotinic acid is selected from immediate release nicotinic acid, extended release nicotinic acid, and sustained release nicotinic acid.
  • a co-administered pharmaceutical agent is a fibric acid.
  • a fibric acid is selected from gemfibrozil, fenof ⁇ brate, clofibrate, bezafibrate, and ciprofibrate.
  • compositions comprising a short antisense compound targeted to a CRP nucleic acid include, but are not limited to, corticosteroids, including but not limited to prednisone; immunoglobulins, including, but not limited to intravenous immunoglobulin (IVIg); analgesics (e.g., acetaminophen); anti-inflammatory agents, including, but not limited to non-steroidal anti-inflammatory drugs (e.g., ibuprofen, COX-I inhibitors, and COX-2, inhibitors); salicylates; antibiotics; antivirals; antifungal agents; antidiabetic agents (e.g., biguanides, glucosidase inhibitors, insulins, sulfonylureas, and thiazolidenediones); adrenergic modifiers; diuretics; hormones (e.g., anabolic steroids, androgen, estrogen,
  • a pharmaceutical composition comprising a short antisense compound targeted to a CRP nucleic acid may be administered in conjuction with a lipid-lowering therapy.
  • a lipid-lowering therapy is therapeutic lifestyle change.
  • a lipid-lowering therapy is LDL apheresis.
  • short antisense compounds are targeted to a CRP nucleic acid having the sequence of GENBANK® Accession No. NM_000567.1, incorporated herein as SEQ ED NO: 6.
  • a short antisense compound targeted to SEQ ID NO: 6 is at least 90% complementary to SEQ ID NO: 6.
  • a short antisense compound targeted to SEQ ID NO: 6 is at least 95% complementary to SEQ ID NO: 6.
  • a short antisense compound targeted to SEQ ID NO: 6 is 100% complementary to SEQ ID NO: 6.
  • a short antisense compound targeted to SEQ ID NO: 6 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Table 9.
  • the nucleotide sequence set forth in each SEQ ID NO in Table 9 is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • short antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Short antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Table 9 illustrates examples of short antisense compounds targeted to SEQ ID NO: 6.
  • Table 9 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 6.
  • the column labeled 'gapmer motif indicates the wing-gap-wing motif of each short antisense compounds.
  • the gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a T- modified sugar.
  • the particular 2 '-modified sugar is also indicated in the 'gapmer motif column.
  • '2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten 2'-deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate.
  • the short antisense compounds comprise 5- methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
  • "5-mC in gap only” indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
  • short antisense compounds targeting a CRP nucleic acid may have any one or more properties or characteristics of the short antisense compounds generally described herein.
  • short antisense compounds targeting a CRP nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8- 3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.
  • a target region is nucleotides 1305-1320 of NM_000567.1.
  • short antisense compounds targeted to nucleotides 1305-1320 of NM_000567.1 comprise a nucleotide sequence selected from SEQ ID NO: 1305 or 1306.
  • a short antisense compound targeted to nucleotides 263-278 of NM 000567.1 is selected from Isis NO. 353484 or 353485.
  • a target region is nucleotides 1257-1272 of NM 000567.1.
  • a short antisense compound targeted to nucleotides 1257-1272 of NM_000567.1 comprises a nucleotide sequence selected from SEQ ID NO 1257 or 1258.
  • a short antisense compound targeted to nucleotides 428-483 of NM 000567.1 is selected from Isis NO. 353506 or 353507.
  • short antisense compounds targeted to a CRP nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
  • short antisense compounds targeted to a CRP nucleic acid are short gapmers.
  • short gapmers targeted to a CRP nucleic acid comprise at least one high affinity modification in one or more wings of the compound.
  • short antisense compounds targeted to a CRP nucleic acid comprise 1 to 3 high-affinity modifications in each wing.
  • the nucleosides or nucleotides of the wing comprise a 2' modification.
  • the monomers of the wing are BNA's.
  • the monomers of the wing are selected from ⁇ -L-Methyleneoxy (4'-CH 2 -O-2') BNA , ⁇ -D- Methyleneoxy (4'-CH 2 -O-2') BNA , Ethyleneoxy (4'-(CH 2 ) 2 -O-2') BNA , Aminooxy (4'-CH 2 -O-N(R)- 2') BNA and Oxyamino (4'-CH 2 -N(R)-O-2') BNA.
  • the monomers of a wing are 2'MOE nucleotides.
  • short antisense compounds targeted to a CRP nucleic acid comprise a gap between the 5' wing and the 3' wing.
  • the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
  • the monomers of the gap are unmodified deoxyribonucleotides.
  • the monomers of the gap are unmodified ribonucleotides.
  • gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
  • short antisense compounds targeted to a CRP nucleic acid have uniform monomelic linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid have mixed backbones.
  • short antisense compounds targeted to a CRP nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP CORE0 W -1 1- nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 13 monomers in length.
  • short antisense compounds targeted to a CRP nucleic acid are 14 monomers in length, hi certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 15 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a CRP nucleic acid comprise 12 to 14 nucleotides or nucleosides.
  • the invention provides methods of modulating expression of CRP.
  • such methods comprise use of one or more short antisense compound targeted to a CRP nucleic acid, wherein the short antisense compound targeted to a CRP nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • the short antisense compound targeted to a CRP nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 11 monomers in length.
  • methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating CRP comprise use of a short antisense compound targeted to a CRP nucleic acid that is 16 monomers in length.
  • methods of modulating expression of CRP comprise use of a short antisense compound targeted to a CRP nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of CRP comprise use of a short antisense compound targeted to a CRP nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of CRP comprise use of a short antisense compound targeted to a CRP nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of CRP comprise use of a short antisense compound targeted to a CRP nucleic acid comprising 12 or 14 nucleotides or nucleosides.
  • GCCR Glucocorticoid Receptor
  • Glucocorticoids were among the first steroid hormones to be identified and are responsible for a multitude of physiological functions, including the stimulation of gluconeogenesis, decreased glucose uptake and utilization in peripheral tissues, increased glycogen deposition, suppression of immune and inflammatory responses, inhibition of cytokine synthesis and acceleration of various developmental events. Glucocorticoids are also especially important for combating stress. Stress-induced elevation of glucocorticoid synthesis and release leads to, among other responses, increased ventricular workload, inhibition of inflammatory mediators, inhibition of cytokine synthesis and increased glucose production (Karin, Cell, 1998, 93, 487-490).
  • glucocorticoid receptor a ubiquitously expressed cytoplasmic member of the nuclear hormone superfamily of receptors.
  • Human glucocorticoid receptor is also known as nuclear receptor subfamily 3, group C, member 1; NR3C1; GCCR; GCR; GRL; Glucocorticoid receptor, lymphocyte.
  • the gene is located on human chromosome 5ql l-ql3 and consists of 9 exons (Encio and Detera-Wadleigh, J Biol Chem, 1991, 266, 7182-7188; Gehring et al., Proc Natl Acad Sci U SA, 1985, 82, 3751-3755).
  • human glucocorticoid receptor mRNA a 5.5 kb human glucocorticoid receptor ⁇ cDNA containing exons 1-8 and exon 9 ⁇ ; a 4.3 kb human glucocorticoid receptor ⁇ cDNA containing exons 1-8 and exon 9 ⁇ ; and a 7.0 kb human glucocorticoid receptor ⁇ cDNA containing exons 1-8 and the entire exon 9, which includes exon 9 ⁇ , exon 9 ⁇ and the 'J region', which is flanked by exons 9 ⁇ and 9 ⁇ (Hollenberg et al., Nature, 1985, 318, 635-641; Oakley et al., J Biol Chem, 1996, 271, 9550-9559).
  • Human glucocorticoid receptor ⁇ is the predominant isoform of the receptor and the one that exhibits steroid binding activity (Hollenberg et al., Nature, 1985, 318, 635-641). Additionally, through usage of three different promoters three different exon 1 variants can be transcribed, and alternative splicing of one exon 1 variant can result in three different versions of this exon. Thus, human glucocorticoid receptor mRNA may contain 5 different versions of exon 1 (Breslin et al., MoI Endocrinol, 2001, 15, 1381-1395).
  • ⁇ and ⁇ isoforms of human glucocorticoid receptor mRNA Examination of the expression patterns of the ⁇ and ⁇ isoforms of human glucocorticoid receptor mRNA reveals that the ⁇ isoform is more abundantly expressed. Both isoforms are expressed in similar tissues and cell types, including lung, kidney, heart, liver, skeletal muscle, macrophages, neutrophils and peripheral blood mononuclear cells. Only human glucocorticoid receptor ⁇ is expressed in colon.
  • the ⁇ isoform is undetectable, suggesting that under physiological conditions, the default splicing pathway is the one that produces the ⁇ isoform (Pujols et al., Am J Physiol Cell Physiol, 2002, 283, C1324-1331).
  • the ⁇ isoform of glucocorticoid receptor binds neither a glucocorticoid agonist nor an antagonist.
  • the ⁇ isoform is localized primarily in the nucleus in transfected cells, independent of hormone stimulation. - -
  • the glucocorticoid receptor ⁇ inhibits the hormone- induced, glucocorticoid receptor ⁇ -mediated stimulation of gene expression, suggesting that the ⁇ isoform functions as an inhibitor of glucocorticoid receptor ⁇ activity (Oakley et al., J Biol Chem, 1996, 271, 9550-9559).
  • the human glucocorticoid receptor described herein is defined as the ubiquitous product(s) of the gene located on chromosome 5ql l-ql3.
  • glucocorticoid receptor antagonists have been measured in animal models designed to assess anxiety, learning and memory. Reduced expression of glucocorticoid receptor in rats long-term intracerebroventricularly infused with antisense oligodeoxynucleotides targeting glucocorticoid receptor mRNA did not interfere with spatial navigation in the Morris water maze test (Engelmann et al., Eur J Pharmacol, 1998, 361, 17-26).
  • Glucocorticoids are frequently used for their immunosuppressive, anti-inflammatory effects in the treatment of diseases such as allergies, athsma, rheumatoid arthritis, AIDS, systemic lupus erythematosus and degenerative osteoarthritis.
  • Negative regulation of gene expression such as that caused by the interaction of glucocorticoid receptor with NF-kB, is proposed to be at least partly responsible for the anti-inflammatory action of glucocorticoids in vivo.
  • Interleukin-6, tumor necrosis factor ⁇ and interleukin-1 are the three cytokines that account for most of the hypothalamic-pituitary-adrenal (HPA) axis stimulation during the stress of inflammation.
  • HPA hypothalamic-pituitary-adrenal
  • HPA axis and the systemic sympathetic and adrenomedullary system are the peripheral components of the stress system, responsible for maintaining basal and stress-related homeostasis.
  • Glucocorticoids the end products of the HPA axis, inhibit the production of all three inflammatory cytokines and also inhibit their effects on target tissues, with the exception of interleukin-6, which acts synergistically with glucocorticoids to stimulate the production of acute-phase reactants.
  • Glucocorticoid treatment decreases the activity of the HPA axis (Chrousos, N Engl J Med, 1995, 332, 1351-1362).
  • glucocorticoid receptor gene A total of 15 missense, three nonsense, three frameshift, one splice site, and two alternative spliced mutations, as well as 16 polymorphisms, have been reported in the NR3C1 gene in association with glucocorticoid resistance (Bray and Cotton, Hum Mutat, 2003, 21, 557-568). Additional studies in humans have suggested a positive association between metabolic syndrome incidence and progression, with alleles at the glucocorticoid receptor (GR) gene (Rosmond, Obes Res, 2002, 10, 1078-1086).
  • GR glucocorticoid receptor
  • glucocorticoid receptor ⁇ Increased expression of glucocorticoid receptor ⁇ is also observed in a significantly high number of glucocorticoid-insensitive asthmatics. Additionally, cytokine-induced abnormalities in the DNA binding capacity of the glucocorticoid receptor were found in peripheral blood mononuclear cells from glucocorticoid-insensitive patients transfection, and HepG2 cells with the glucocorticoid receptor ⁇ gene resulted in a significant reduction of glucocorticoid receptor ⁇ DNA-binding capacity (Leung et al., J Exp Med, 1997, 186, 1567-1574).
  • glucocorticoid receptor ⁇ does not alter the affinity of glucocorticoid receptor a for hormonal ligands, but rather its ability to bind to the GRE (Bamberger et al., J Clin Invest, 1995, 95, 2435-2441). Taken together, these results illustrate that glucocorticoid receptor ⁇ , through competition with glucocorticoid receptor ⁇ for GRE target sites, may function as a physiologically and pathophysiological ⁇ / relevant endogenous inhibitor of glucocorticoid action.
  • glucocorticoid agonists increase hepatic glucose production by activating the glucocorticoid receptor, which subsequently leads to increased expression of the gluconeogenic enzymes phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase.
  • PPCK phosphoenolpyruvate carboxykinase
  • glucose-6-phosphatase Through gluconeogenesis, glucose is formed through non-hexose precursors, such as lactate, pyruvate and alanine (Link, Curr Opin Investig Drugs, 2003, 4, 421-429).
  • Steroidal glucocorticoid receptor antagonists such as RU 486 have been tested in rodent models of diabetes.
  • mice deficient in the leptin receptor gene are genetically obese, diabetic and hyperinsulinemic.
  • Treatment of hyperglycemic db/db mice with RU 486 decreased blood glucose levels by approximately 49%, without affecting plasma insulin levels. Additionally, RU 486 treatment reduced the expression of glucocorticoid receptor responsive genes PEPCK, glucose-6-phosphatase, glucose transporter type 2 and tyrosine aminotransferase in db/db mice as compared to untreated animals (Friedman et al., J Biol Chem, 1997, 272, 31475-31481).
  • RU 486 also ameliorates diabetes in the ob/ob mouse model of diabetes, obesity and hyperinsulinemia, through a reduction in serum insulin and blood glucose levels (Gettys et al., Int J Obes Relat Metab Disord, 1997, 21, 865-873).
  • glucocorticoid receptor antagonists include activation of the HPA axis (Link, Curr Opin Investig Drugs, 2003, 4, 421-429). Increased HPA axis activity is associated with suppression of immune-related inflammatory action, which can increase susceptibility to infectious agents and neoplasms.
  • Conditions associated with suppression of immune-mediated inflammation through defects in the HPA axis, or its target tissues include Cushing's syndrome, chronic stress, chronic alcoholism and melancholic depression (Chrousos, N Engl J Med, 1995, 332, 1351-1362).
  • Steroidal glucocorticoid receptor antagonists have been conjugated to bile acids for the purpose of targeting them to the liver (Apelqvist et al., 2000).
  • Currently, there are no known therapeutic agents that target the glucocorticoid receptor without undesired peripheral effects (Link, Curr Opin Investig Drugs, 2003, 4, 421-429). Consequently, there remains a long felt need for agents capable of effectively inhibiting hepatic glucocorticoid receptor.
  • Glucocorticoid receptor is the gene product or protein of which expression is to be modulated by administration of a short antisense compound. Glucocorticoid receptor is generally referred to as GCCR.
  • GCCR nucleic acid means any nucleic acid encoding GCCR.
  • a GCCR nucleic acid includes, without limitation, a DNA sequence encoding GCCR, an RNA sequence transcribed from DNA encoding GCCR, and an mRNA sequence encoding GCCR.
  • GCCR mRNA means an mRNA encoding GCCR.
  • Antisense technology is an effective means of reducing the expression of specific gene products and therefore is useful in a number of therapeutic, diagnostic and research applications for the modulation of glucocorticoid receptor expression.
  • liver is one of the tissues in which the highest concentrations of antisense oligonucleotides are found following administration (Geary et al., Curr. Opin. Investig. Drugs, 2001, 2, 562-573). Therefore, in such embodiments, antisense technology represents an attractive method for the liver-specific inhibition of glucocorticoid receptor.
  • short antisense compounds targeted to a nucleic acid encoding glucocorticoid receptor are preferentially distributed to the liver.
  • short antisense compounds have increased potency in the liver when compared to a longer parent compound.
  • target RNA is predominantly expressed in the liver.
  • a subject, suspected of having a disease or disorder which can be treated by modulating the expression of GCCR is treated by administering one or more short antisense compound.
  • the methods comprise the step of administering to an animal a therapeutically effective amount of a short antisense compound.
  • Certain short antisense compounds inhibit the activity of GCCR and/ or inhibit expression of GCCR.
  • the activity or expression of GCCR in a subject is inhibited by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%.
  • the activity or expression of GCCR in a subject is inhibited by at least 30%.
  • the activity or expression of GCCR in a subject is inhibited by at least 50% or more.
  • GCCR reduced expression of GCCR
  • cells contained within such fluids, tissues or organs being analyzed comprise nucleic acids encoding GCCR and/or they contain the GCCR protein itself.
  • short antisense compounds are also provided.
  • short antisense compounds are be utilized in pharmaceutical compositions by adding to them an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier.
  • short antisense compounds targeting a GCCR nucleic acid have any one or more properties or characteristics of the short antisense compounds generally described herein.
  • short antisense compounds targeting a GCCR nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8- 3, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, .
  • short antisense compounds targeting a GCCR nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-10-1, 2-10-2, 3-10-3, and 1-9-2. .
  • short antisense compounds targeting a GCCR nucleic acid have a motif (wing - deoxy gap -wing) selected from 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 2-8-2, 1-8-1, 3-6-3 or 1-6-1, more preferably 2-10-2 and 2-8-2.
  • motif wing - deoxy gap -wing
  • provided herein are methods of treating an individual by administering one or more short antisense compound targeted to a GCCR nucleic acid or a pharmaceutical composition comprising such compound. Further provided are methods of treating a subject having a disease or conditions associated with GCCR activity by administering a short antisense compound targeted to a GCCR nucleic acid.
  • diseases and conditions associated with GCCR include but are not limited to, obesity, Metabolic syndrome X, Cushing's Syndrome, Addison's disease, inflammatory diseases such as asthma, rhinitis and arthritis, allergy, autoimmune disease, immunodeficiency, anorexia, cachexia, bone loss or bone frailty, and wound healing.
  • Metabolic syndrome, metabolic syndrome X or simply Syndrome X refers to a cluster of risk factors that include obesity, dyslipidemia, particularly high blood triglycerides, glucose intolerance, high blood sugar and high blood pressure.
  • short antisense compounds targeted to GCCR are used for amelioration of hyperglycemia induced by systemic steroid therapy.
  • antisense technology provides a means of inhibiting the expression of the glucocorticoid receptor ⁇ isoform, demonstrated to be overexpressed in patients refractory to glucocorticoid treatment.
  • the invention provides short antisense compounds targeted to a nucleic acid encoding GCGR, and which modulate the expression of glucocorticoid receptor.
  • Pharmaceutical and other compositions comprising the compounds of the invention are also provided. Further provided are methods of screening for modulators of glucocorticoid receptor and methods of modulating the expression of glucocorticoid receptor in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more of the compounds or compositions of the invention. Methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of glucocorticoid receptor are also set forth herein. Such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention to the person in need of treatment.
  • short antisense compounds are targeted to a GCCR nucleic acid having the sequence of nucleotides 1 to 106000 of GENBANK® Accession No. ACO 12634, incorporated herein as SEQ ID NO: 8.
  • a short antisense compound targeted to SEQ ID NO: 8 is at least 90% complementary to SEQ ID NO: 8.
  • a short antisense compound targeted to SEQ ID NO: 8 is at least 95% complementary to SEQ ID NO: 8.
  • a short antisense compound targeted to SEQ ID NO: 8 is 100% complementary to SEQ ID NO: 8.
  • a short antisense compound targeted to SEQ ID NO: 8 includes a nucleotide sequence selected from the nucleotide sequences set forth in Tables 10 and 11.
  • nucleotide sequence set forth in each SEQ ID NO in Tables 10 and 11 is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • short antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Short antisense compounds described by Isis Number indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • short antisense compounds targeted to a GCCR nucleic acid comprise a gapmer motif. In certain embodiments, a short antisense compound targeted to a GCCR nucleic acid comprises a 2-10-2 gapmer motif.
  • Tables 10 and 11 illustrate examples of short antisense compounds targeted to SEQ ID NO: 8.
  • Table 10 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 8.
  • Table 11 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO: 8.
  • the column labeled 'gapmer motif indicates the wing-gap-wing motif of each short antisense compounds.
  • the gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2 '-modified sugar.
  • the particular 2 '-modified sugar is also indicated in the 'gapmer motif column.
  • '2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten T- deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate.
  • the short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
  • "5-mC in gap only” indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
  • Table 11 Short antisense compounds targeted to SEQ ID NO: 8 and having 1 or 2 mismatches
  • a target region is nucleotides 88142-88269 of SEQ ID NO: 8.
  • a short antisense compound is targeted to nucleotides 88142-88269 of SEQ ID NO: 8.
  • a short antisense compound targeted to nucleotides 88142-88269 comprises a nucleotide sequence selected from SEQ ID NO 413, 414, 415, 416, 417, or 418.
  • an antisense compound targeted to nucleotides 88142-88269 of SEQ ID NO: 8 is selected - - from Isis NO. 371644, 371645, 371649, 371651, 371652, or 371653.
  • a target region is nucleotides 88142-88169 of SEQ ID NO: 8.
  • a short antisense compound is targeted to nucleotides 88142-88169 of SEQ ID NO: 8.
  • a short antisense compound targeted to nucleotides 88142-88169 comprises a nucleotide sequence selected from SEQ ID NO 413 or 414.
  • an antisense compound targeted to nucleotides 88142-88169 of SEQ ID NO: 8 is selected from Isis NO. 371644 or 371645.
  • a target region is nucleotides 88242-88269 of SEQ ID NO: 8.
  • a short antisense compound is targeted to nucleotides 88242-88269 of SEQ ID NO: 8.
  • a short antisense compound targeted to nucleotides 88242-88269 comprises a nucleotide sequence selected from SEQ ID NO 416, 417, or 418.
  • an antisense compound targeted to nucleotides 88242-88269 of SEQ ID NO: 8 is selected from Isis NO. 371651, 371652, or 371653.
  • a target region is nucleotides 92037-92155 of SEQ ID NO: 8.
  • a short antisense compound is targeted to nucleotides 92037-92155 of SEQ ID NO: 8.
  • a short antisense compound targeted to nucleotides 92037-92155 comprises a nucleotide sequence selected from SEQ ID NO 419, 420, 421, or 422.
  • an antisense compound targeted to nucleotides 92037-92155 of SEQ ID NO: 8 is selected from Isis NO. 371665, 371669, 371671, or 171673.
  • a target region is nucleotides 92114-92155 of SEQ ID NO: 8.
  • a short antisense compound is targeted to nucleotides 92114-92155 of SEQ ID NO: 8.
  • a short antisense compound targeted to nucleotides 92114-92155 comprises a nucleotide sequence selected from SEQ ID NO 421 or 422.
  • an antisense compound targeted to nucleotides 92114-92155 of SEQ ID NO: 8 is selected from Isis NO. 371671 or 171673.
  • short antisense compounds targeted to a GCCR nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides .
  • short antisense compounds targeted to a GCCR nucleic acid are short gapmers.
  • short gapmers targeted to a GCCR nucleic acid comprise at least one high affinity modification in one or more wings of the compound.
  • short antisense compounds targeted to a GCCR nucleic acid comprise 1 to 3 high-affinity modifications in each wing.
  • the nucleosides or nucleotides of the wing comprise a 2' modification.
  • the monomers of the wing are BNA' s.
  • the monomers of the wing are selected from ⁇ -L-Methyleneoxy (4'-CH 2 -O-2') BNA , ⁇ -D- -
  • the monomers of a wing are 2'MOE nucleotides.
  • short antisense compounds targeted to a GCCR nucleic acid comprise a gap between the 5' wing and the 3' wing.
  • the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
  • the monomers of the gap are unmodified deoxyribonucleotides.
  • the monomers of the gap are unmodified ribonucleotides.
  • gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
  • short antisense compounds targeted to a GCCR nucleic acid have uniform monomelic linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid have mixed backbones. hi certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 9 monomers in length, hi certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 10 monomers in length.
  • short antisense compounds targeted to a GCCR nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 13 monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 14 monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 15 monomers in length. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid are 16 monomers in length.
  • short antisense compounds targeted to a GCCR nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise 12 to 14 nucleotides or nucleosides.
  • the invention provides methods of modulating expression of GCCR.
  • such methods comprise use of one or more short antisense compound targeted to a GCCR nucleic acid, wherein the short antisense compound targeted to a GCCR nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • the short antisense compound targeted to a GCCR nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 11 monomers in length.
  • methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 15 monomers in length.
  • methods of modulating GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid that is 16 monomers in length.
  • methods of modulating expression of GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid comprising 9 to 15 monomers.
  • methods of modulating expression of GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid comprising 10 to 15 monomers.
  • methods of modulating expression of GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid comprising 12 to 14 monomers.
  • methods of modulating expression of GCCR comprise use of a short antisense compound targeted to a GCCR nucleic acid comprising 12 or 14 nucleotides or nucleosides.
  • GCGR Glucagon Receptor
  • Glucagon the 29- amino acid peptide responsible for maintaining blood glucose levels in the postabsorbative state, increases glucose release from the liver by activating hepatic glycogenolysis, gluconeogenesis, stimulating lipolysis in adipose tissue, and stimulating insulin secretion.
  • insulin reverses the glucagon-mediated enhancement of glycogenolysis and gluconeogenesis.
  • insulin is either not available or not fully effective. While treatment for diabetes has traditionally focused on increasing insulin levels, antagonism of glucagon function has been considered as an alternative therapy.
  • glucagon exerts its physiological effects by signaling through the glucagon receptor
  • the glucagon receptor has been proposed as a potential therapeutic target for diabetes (Madsen et al., Curr. Pharm. Des., 1999, 5, 683-691).
  • Glucagon receptor is belongs to the superfamily of G-protein-coupled receptors having seven transmembrane domains. It is also a member of the smaller sub-family of homologous receptors which bind peptides that are structurally similar to glucagon.
  • the gene encoding human glucagon receptor was cloned in 1994 and analysis of the genomic sequence revealed multiple introns and an 82% identity to the rat glucagon receptor gene (Lok et al., Gene, 1994, 140, 203-209.; MacNeil et al., Biochem. Biophys. Res. Commun., 1994, 198, 328-334).
  • rat glucagon receptor gene Cloning of the rat glucagon receptor gene also led to the description of multiple alternative splice variants (Maget et al., FEBS Lett., 1994, 351, 271-275).
  • the human glucagon receptor gene is localized to chromosome 17q25 (Menzel et al., Genomics, 1994, 20, 327-328).
  • a missense mutation of GIy to Ser at codon 40 in the glucagon receptor gene leads to a 3-fold lower affinity for glucagon (Fujisawa et al., Diabetologia, 1995, 38, 983-985) and this mutation has been linked to several disease states, including non-insulin-dependent diabetes mellitus (Fujisawa et al., Diabetologia, 1995, 38, 983-985), hypertension (Chambers and Morris, Nat. Genet., 1996, 12, 122), and central adiposity (Siani et al., Obes. Res., 2001, 9, 722-726).
  • Glucagon receptor is the gene product or protein of which expression is to be modulated by administration of a short antisense compound. Glucagon receptor is generally referred to as GCGR but may also be referred to as GR, GGR, MGCl 38246, MGC93090.
  • GCGR nucleic acid means any nucleic acid encoding GCGR.
  • a GCGR nucleic acid includes, without limitation, a GCGR sequence encoding GCGR, an RNA sequence transcribed from DNA encoding GCGR, and an mRNA sequence encoding GCGR.
  • GCGR mRNA means an mRNA encoding a GCGR protein.
  • Antisense technology is an effective means for reducing glucagon receptor (GCGR) expression and has proven to be uniquely useful in a number of therapeutic, diagnostic, and research applications.
  • the present invention provides short antisense compounds targeted to a nucleic acid encoding glucagon receptor, and which modulate the expression of glucagon receptor.
  • short antisense compounds capable of inhibiting GCGR expression.
  • methods of treating an individual comprising administering one or more pharmaceutical compositions comprising a short antisense compound targeted to a GCGR nucleic acid.
  • short antisense compounds targeted to a GCGR nucleic acid inhibit GCGR expression
  • methods of treating a subject having a disease or condition associated with GCGR activity by administering one or more pharmaceutical compositions comprising a short antisense compound targeted to a GCGR nucleic acid.
  • methods of treating a subject having high blood glucose, hyperglycemia, prediabetes, diabetes, Type 2 diabetes, metabolic syndrome, obesity and/or insulin resistance are provided herein.
  • compositions comprising one or more short antisense compounds targeted to GCGR and optionally a pharmaceutically acceptable carrier, diluent, enhancer or excipient.
  • Certain compounds of the invention can also be used in the manufacture of a medicament for the treatment of diseases and disorders related to glucagon effects mediated by GCGR.
  • Certain embodiments of the present invention include methods of reducing the expression of GCGR in tissues or cells comprising contacting said cells or tissues with a short antisense compound targeted to a nucleic acid encoding GCGR or pharmaceutical composition comprising such a short antisense compound.
  • the invention provides methods of decreasing blood glucose levels, blood triglyceride levels, or blood cholesterol levels in a subject comprising administering to the subject a short antisense compound or a pharmaceutical composition. Blood levels may be plasma levels or serum levels.
  • methods of improving insulin sensitivity methods of increasing GLP-I levels and methods of inhibiting hepatic glucose output in an animal comprising administering to said animal an antisense oligonucleotide or a pharmaceutical composition of the invention.
  • An improvement in insulin sensitivity may be indicated by a reduction in circulating insulin levels.
  • the invention provides methods of treating a subject having a disease or condition associated with glucagon activity via GCGR comprising administering to the subject a therapeutically or prophylactically effective amount of a short antisense compound or a pharmaceutical composition.
  • disease or condition may be a metabolic disease or condition.
  • the metabolic disease or condition is diabetes, hyperglycemia, hyperlipidemia, metabolic syndrome X, obesity, primary hyperglucagonemia, insulin deficiency, or insulin resistance.
  • the diabetes is Type 2 diabetes.
  • the obesity is diet-induced.
  • hyperlipidemia is associated with elevated blood lipid levels. Lipids include cholesterol and triglycerides.
  • the condition is liver steatosis, hi some embodiments, the steatosis is steatohepatitis or non-alcoholic steatohepatitis.
  • the invention provides methods of preventing or delaying the onset of elevated blood glucose levels in an animal as well as methods of preserving beta-cell function in an animal using the oligomeric compounds delineated herein.
  • Certain short antisense compounds targeted to GCGR can be used to modulate the expression of GCGR in a subject in need thereof, such as an animal, including, but not limited to, a human
  • such methods comprise the step of administering to said animal an effective amount of a short antisense compound that reduces expression of GCGR RNA.
  • short antisense compounds effectively reduce the levels or function of GCGR RNA. Because reduction in GCGR mRNA levels can lead to alteration in GCGR protein products of expression as well, such resultant alterations can also be measured.
  • Certain antisense compounds that effectively reduce the levels or function of GCGR RNA or protein products of expression is considered an active antisense compound.
  • short antisense compounds reduce the expression of GCGR causing a reduction of RNA by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%.
  • methods of screening for modulators of glucagon receptor and methods of modulating the expression of glucagon receptor in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more short antisense compounds targeted to GCGR or with compositions comprising such compounds.
  • Methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of glucagon receptor are also set forth herein. Certain such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention to the person in need of treatment.
  • the reduction of the expression of glucagon receptor may be measured, for example, in blood, plasma, serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal.
  • the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding glucagon receptor protein and/or the glucagon receptor protein itself.
  • compositions comprising short antisense compounds are also provided.
  • short antisense compounds targeted to a nucleic acid encoding GCGR are utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier.
  • the short antisense compounds targeting a GCGR nucleic acid may have any one or more properties or characteristics of the short antisense compounds generally described herein.
  • short antisense compounds targeting a GCGR nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8-3, 2-8-2, 1- 8-1, 3-6-3 or 1-6-1.
  • short antisense compounds targeting a GCGR nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-12-1, 2-10-2, 3-10-3, 3-8-3, 1-1-10-2.
  • short antisense compounds are targeted to a GCGR nucleic acid having the sequence GENBANK® Accession No. NMJ)OO 160.1, incorporated herein as SEQ ID NO: 9.
  • a short antisense compound targeted to SEQ ID NO: 9 is at least 90% complementary to SEQ ID NO: 9.
  • a short antisense compound targeted to SEQ ID NO: 9 is at least 95% complementary to SEQ ID NO: 9.
  • a short antisense compound targeted to SEQ DD NO: 9 is 100% complementary to SEQ DD NO: 9.
  • a short antisense compound targeted to SEQ DD NO: 9 includes a nucleotide sequence selected from the nucleotide sequences set forth in Tables 12 and 13.
  • nucleotide sequences set forth in each SEQ DD NO in Tables 12 and 13 are independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • short antisense compounds defined by a SEQ DD NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Short antisense compounds described by Isis Number indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • short antisense compounds targeted to a GCCR nucleic acid comprise a gapmer motif. In certain embodiments, a short antisense compound targeted to a GCCR nucleic acid comprises a 3-10-3 gapmer motif. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise a gapmer motif. In certain embodiments, a short antisense compound targeted to a GCCR nucleic acid comprises a 3-8-3 gapmer motif. In certain embodiments, short antisense compounds targeted to a GCCR nucleic acid comprise a gapmer motif. In certain embodiments, a short antisense compound targeted to a GCCR nucleic acid comprises a 2-10-2 gapmer motif.
  • Tables 12 and 13 illustrate examples of short antisense compounds targeted to SEQ ID NO: 9.
  • Table 12 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 9.
  • Table 13 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO: 9.
  • the column labeled 'gapmer motif indicates the wing-gap-wing motif of each short antisense compounds.
  • the gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2'-modified sugar.
  • the particular 2'-modified sugar is also indicated in the 'gapmer motif column.
  • '2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten T- deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate.
  • the short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
  • "5-mC in gap only” indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
  • Table 13 Short antisense compounds targeted to SEQ ID NO: 1 and having 1 or 2 mismatches
  • a target region is nucleotides 378-391 of SEQ ID NO: 9.
  • a short antisense compound is targeted to nucleotides 378-391 of SEQ ID NO: 9.
  • a short antisense compound targeted to nucleotides 378-391 comprises a nucleotide sequence selected from SEQ ID NO 486 or 487.
  • a short antisense compound targeted to nucleotides 378-391 of SEQ ID NO: 9 is selected from Isis No 338463 or 338534.
  • a target region is nucleotides 499-521 of SEQ ID NO: 9.
  • a short antisense compound is targeted to nucleotides 499-521 of SEQ DD NO: 9.
  • a short antisense compound targeted to nucleotides 499-521 comprises a nucleotide sequence selected from SEQ ID NO 488, 489, 490, 491, 492, 493, 494, 495, 496, or 497.
  • a short antisense compound targeted to nucleotides 499-521 of SEQ DD NO: 9 is selected from Isis No 327130, 327131, 327132, 327133, 327134, 327135, 327136, 327137, 327138, or 327139.
  • a target region is nucleotides 531-553 of SEQ DD NO: 9.
  • a short antisense compound is targeted to nucleotides 531-553 of SEQ DD NO: 9.
  • a short antisense compound targeted to nucleotides 531-553 comprises a nucleotide sequence selected from SEQ DD NO 498, 499, 500, 501, 502, 503, 504, 505, 506, or 507.
  • a short antisense compound targeted to nucleotides 531-553 of SEQ DD NO: 9 is selected from Isis No 327140, 327141, 327142, 327143, 327144, 327145, 327146, 327147, 327148, or 327149.
  • a target region is nucleotides 545-567 of SEQ DD NO: 9.
  • a short antisense compound is targeted to nucleotides 545-567 of SEQ DD NO: 9.
  • a short antisense compound targeted to nucleotides 545-567 comprises a nucleotide sequence selected from SEQ DD NO 508, 509, 510, 511, 512, 513, 514, 515, 516, or 517.
  • a short antisense compound targeted to nucleotides 545-567 of SEQ ID NO: 9 is selected from Isis No 327150, 327151, 327152, 327153, 327154, 327155, 327156, 327157, 327158, or 327159.
  • a target region is nucleotides 531-567 of SEQ ID NO: 9.
  • a short antisense compound is targeted to nucleotides 531-567 of SEQ ID NO: 9.
  • a short antisense compound targeted to nucleotides 531-567 comprises a nucleotide sequence selected from SEQ ID NO 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, or 517.
  • a short antisense compound targeted to nucleotides 531-567 of SEQ ID NO: 9 is selected from Isis No 327140, 327141, 327142, 327143, 327144, 327145, 327146, 327147, 327148, 327149, 327150, 327151, 327152, 327153, 327154, 327155, 327156, 327157, 327158, or 327159.
  • a target region is nucleotides 684-714 of SEQ ID NO: 9.
  • a short antisense compound is targeted to nucleotides 684-714 of SEQ ID NO: 9.
  • a short antisense compound targeted to nucleotides 684-714 comprises a nucleotide sequence selected from SEQ ID NO 518, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, or 536.
  • a short antisense compound targeted to nucleotides 684-714 of SEQ ID NO: 9 is selected from Isis No 345897, 327160, 327161, 327162, 327163, 327164, 327165, 327166, 327167, 327168, 327169, 327170, 327171, 327172, 327173, 327174, 327175, 327176, or 327177.
  • a target region is nucleotides 869-891 of SEQ ID NO: 9.
  • a short antisense compound is targeted to nucleotides 869-891 of SEQ ID NO: 9.
  • a short antisense compound targeted to nucleotides 869-891 comprises a nucleotide sequence selected from SEQ ID NO 537, 538, 539, 540, 541, 542, 543, 544, 545, or 546.
  • a short antisense compound targeted to nucleotides 869-891 of SEQ ID NO: 9 is selected from Isis No 327178, 327179, 327180, 327181, 327182, 327183, 327184, 327185, 327186, or 327187.
  • a target region is nucleotides 955-977 of SEQ ID NO: 9.
  • a short antisense compound is targeted to nucleotides 955-977 of SEQ ID NO: 9.
  • a short antisense compound targeted to nucleotides 955-977 comprises a nucleotide sequence selected from SEQ ID NO 547, 548, 549, 550, 551, 552, 553, 554, 555, or 556.
  • a short antisense compound targeted to nucleotides 955-977 of SEQ ID NO: 9 is selected from Isis No 327188, 327189, 327190, 327191, 327192, 327193, 327194, 327195, 327196, or 327197.
  • a target region is nucleotides 1019-1041 of SEQ DD NO: 9.
  • a short antisense compound is targeted to nucleotides 1019-1041 of SEQ ID NO: 9.
  • a short antisense compound targeted to nucleotides 1019-1041 comprises a nucleotide sequence selected from SEQ ID NO 557, 558, 559, 560, 561, 562, 563, 564, 565, or 566.
  • a short antisense compound targeted to nucleotides 1019-1041 of SEQ ID NO: 9 is selected from Isis No 327198, 327199, 327200, 327201, 327202, 327203, 327204, 327205, 327206, or 327207.
  • a target region is nucleotides 1160-1175 of SEQ ID NO: 9.
  • a short antisense compound is targeted to nucleotides 1160-1175 of SEQ ID NO: 9.
  • a short antisense compound targeted to nucleotides 1160-1175 comprises a nucleotide sequence selected from SEQ ID NO 567 or 568.
  • a short antisense compound targeted to nucleotides 1160-1175 of SEQ ID NO: 9 is selected from Isis No 338491 or 338562.
  • a target region is nucleotides 1307-1377 of SEQ ID NO: 9.
  • a short antisense compound is targeted to nucleotides 1307-1377 of SEQ ID NO: 9.
  • a short antisense compound targeted to nucleotides 1307-1377 comprises a nucleotide sequence selected from SEQ ID NO 569, 570, 571, 572, or 573.
  • a short antisense compound targeted to nucleotides 1307-1377 of SEQ ID NO: 9 is selected from Isis No 338498, 338569, 338499, 338570, or 385067.
  • a target region is nucleotides 1307-1414 of SEQ ID NO: 9.
  • a short antisense compound is targeted to nucleotides 1307-1414 of SEQ ID NO: 9.
  • a short antisense compound targeted to nucleotides 1307-1414 comprises a nucleotide sequence selected from SEQ ID NO 569, 570, 571, 572, 573, or 574.
  • a short antisense compound targeted to nucleotides 1307-1414 of SEQ ID NO: 9 is selected from Isis No 338498, 338569, 338499, 338570, 385067, or 338573.
  • short antisense compounds targeted to a GCGR nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
  • short antisense compounds targeted to a GCGR nucleic acid are short gapmers.
  • short gapmers targeted to a GCGR nucleic acid comprise at least one high affinity modification in one or more wings of the compound.
  • short antisense compounds targeted to a GCGR nucleic acid comprise 1 to 3 high-affinity modifications in each wing.
  • the nucleosides or nucleotides of the wing comprise a 2' modification.
  • the monomers of the wing are BNA's.
  • the monomers of the wing are selected from ⁇ -L-Methyleneoxy (4'-CH 2 -O-2') BNA , ⁇ -D- Methyleneoxy (4'-CH 2 -O-2') BNA , Ethyleneoxy (4'-(CH 2 ) r O-2') BNA , Aminooxy (4'-CH 2 -O-N(R)- 2') BNA and Oxyamino (4'-CH 2 -N(R)-O-2') BNA.
  • the monomers of a wing are 2'MOE nucleotides.
  • short antisense compounds targeted to a GCGR nucleic acid comprise a gap between the 5' wing and the 3' wing.
  • the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
  • the monomers of the gap are unmodified deoxyribonucleotides.
  • the monomers of the gap are unmodified ribonucleotides.
  • gap modifications (if any) gap result in an antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
  • short antisense compounds targeted to a GCGR nucleic acid have uniform monomelic linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid have mixed backbones.
  • short antisense compounds targeted to a GCGR nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 13 monomers in length.
  • short antisense compounds targeted to a GCGR nucleic acid are 14 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 15 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a GCGR nucleic acid comprise 12 to 14 nucleotides or nucleosides.
  • the invention provides methods of modulating expression of GCGR.
  • such methods comprise use of one or more short antisense compound targeted to a GCGR nucleic acid, wherein the short antisense compound targeted to a GCGR nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • the short antisense compound targeted to a GCGR nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 11 monomers in length. In certain embodiments, methods of modulating - -
  • GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 14 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 15 monomers in length. In certain embodiments, methods of modulating GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid that is 16 monomers in length.
  • methods of modulating expression of GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid comprising 10 to 15 monomers. In certain embodiments, methods of modulating expression of GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid comprising 12 to 14 monomers. In certain embodiments, methods of modulating expression of GCGR comprise use of a short antisense compound targeted to a GCGR nucleic acid comprising 12 or 14 nucleotides or nucleosides.
  • Diacylglycerol transferase 2 (also known as DGAT2, diacylglycerol O-transferase 2, acyl- CoA:diacylglycerol acyltransferase 2), Diacylglycerol transferase 2 has been shown to be implicated in the absorption process of triglycerides (also called triacylglycerols) from food.
  • the absorption of triglycerides from food is a very efficient process which occurs by a series of steps wherein the dietary triacylglycerols are hydrolyzed in the intestinal lumen and then resynthesized within enterocytes.
  • the resynthesis of triacylglycerols can occur via the monoacylglycerol pathwaywhich commences with monoacylglycerol acyltransferase (MGAT) catalyzing the synthesis of diacylglycerol from monoacylglycerol and fatty acyl-CoA.
  • MGAT monoacylglycerol acyltransferase
  • diacylglycerols are provided by the glycerol-phosphate pathway which describes the coupling of two molecules of fatty acyl-CoA to glycerol-3-phosphate.
  • diacylglycerol is then acylated with another molecule of fatty acyl- CoA in a reaction catalyzed by one of two diacylglycerol acyltransferase enzymes to form the triglyceride (Farese et al., Curr. Opin. Lipidol, 2000, 11, 229-234).
  • diacylglycerol acyltransferase The reaction catalyzed by diacylglycerol acyltransferase is the final and only committed step in triglyceride synthesis. As such, diacylglycerol acyltransferase is involved in intestinal fat absorption, lipoprotein assembly, regulating plasma triglyceride concentrations, and fat storage in adipocytes.
  • the first diacylglycerol acyltransferase, diacylglycerol transferase 1 was identified in 1960 and the human and mouse genes encoding this protein were isolated in 1998 (Cases et al., Proc. Natl. Acad. Sci. U. S.
  • diacylglycerol transferase 2 also known as DGAT2, diacylglycerol O-transferase 2, acyl-CoA: diacylglycerol acyltransferase 2
  • DGAT2 diacylglycerol O-transferase 2
  • acyl-CoA diacylglycerol acyltransferase 2
  • Enzymatic assays indicate that this recently identified protein does possess diacylglycerol transferase activity that utilizes a broad range of long chain fatty acyl-CoA substrates (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876).
  • Diacylglycerol transferase 2 is a member of a family of genes whose sequences are unrelated to diacylglycerol transferase 1. In addition to differing in sequence compared to diacylglycerol transferase 1, in vitro assays illustrate that diacylglycerol transferase 2 has higher activity at lower concentrations of magnesium chloride and oleoyl-CoA (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876).
  • the predicted protein sequence of diacylglycerol transferase 2 contains at least one putative transmembrane domain, three potential N-linked glycosylation sites, six potential protein kinase C phosphorylation consensus sites, as well as sequences in common with a putative glycerol phosphorylation site found in acyltransferase enzymes (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876).
  • the International Radiation Hybrid Mapping Consortium has mapped human diacylglycerol transferase 2 to chromosome I lql3.3.
  • diacylglycerol transferase 2 In human tissues, the highest levels of diacylglycerol transferase 2 are detected in liver and white adipose tissues, with lower levels found in mammary gland, testis and peripheral blood leukocytes (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876). Two mRNA species of 2.4 and 1.8 kilobases are detected in human tissues, whereas the major diacylglycerol transferase 2 mRNA species in mouse tissues is 2.4 kilobases.
  • diacylglycerol transferase 2 is expressed in all segments of the small intestine in mice, with higher expression in the proximal intestine and lower expression in the distal intestine (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876).
  • Diacylglycerol transferase activity exhibits distinct patterns during postnatal development of the rat liver. As there is no correlation between the mRNA expression and activity patterns, post-translational modifications may participate in the regulation of diacylglycerol transferase 2 activity during rat development (Waterman et al., J. Lipid. Res., 2002, 43, 1555-1562).
  • Diacylglycerol transferase 2 mRNA is preferentially upregulated by insulin treatment, as shown by in vitro assays measuring the diacylglycerol activity from the membrane fraction of cultured mouse adipocytes (Meegalla et al., Biochem. Biophys. Res. Commun., 2002, 298, 317-323). In fasting mice, diacylglycerol transferase 2 expression is greatly reduced, and dramatically increases upon refeeding. The expression patterns of two enzymes that participate in fatty acid synthesis, acetyl-CoA carboxylase and fatty acid synthase, respond to fasting and refeeding in a similar fashion.
  • mice harboring a disruption in the diacylglycerol acyltransferase 1 gene provide evidence that diacylglycerol acyltransferase 2 contributes to triglyceride synthesis.
  • Levels of diacylglycerol transferase 2 mRNA expression are similar in intestinal segments from both wild type and diacylglycerol transferase 1 -deficient mice (Buhman et al., J. Biol. Chem., 2002, 277, 25474-25479). Using magnesium chloride to distinguish between diacylglycerol transferase 1 and 2 activity, Buhman, et al.
  • diacylglycerol transferase 1 -deficient mice diacylglycerol transferase activity is reduced to 50% in the proximal intestine and to 10-15% in the distal intestine (Buhman et al., J. Biol. Chem., 2002, 277, 25474-25479).
  • diacylglycerol transferase 2 mRNA levels are not up-regulated the liver or adipose tissues of diacylglycerol transferase 1 -deficient mice, even after weeks of high-fat diet (Cases et al., J. Biol. Chem., 2001, 276, 38870-38876; Chen et al., J. Clin. Invest, 2002, 109, 1049-1055).
  • diacylglycerol transferase 2 is more highly expressed than in wild type mice, suggesting that diacylglycerol transferase 2 may be partly responsible for the highly accumulated fat mass seen in these mice. Furthermore, the combined mutations of leptin and diacylglycerol transferase 1 leads to a three-fold elevation in diacylglycerol transferase 2 expression in white adipose tissue, compared to the levels in the same tissue from diacylglycerol transferase 1-deficient mice (Chen et al., J. Clin. Invest., 2002, 109, 1049-1055).
  • Diacylglycerol transferase 2 mRNA is also upregulated in the skin of these mice (Chen et al., J. Clin. Invest., 2002, 109, 175-181). These data suggest leptin normally downregulates diacylglycerol transferase 2 expression, and that the upregulation of diacylglycerol transferase 2 in white adipose tissue in these mice may provide an alternate pathway for the triglyceride synthesis that still occurs in leptin deficient/ diacylglycerol transferase 1-deficient mice (Chen et al., J. Clin. Invest., 2002, 109, 1049-1055).
  • Diacylglycerol acyltransferase 1 knockout mice exhibit interesting phenotypes in that they are lean, resistant to diet-induce obesity, have decreased levels of tissue triglycerides and increased sensitivity to insulin and leptin (Chen et al., J. Clin. Invest, 2002, 109, 1049-1055; Smith et al., Nat. Genet, 2000, 25, 87-90).
  • diacylglycerol transferase 2 also participates in triglyceride synthesis, interfering with diacylglycerol transferase 2 may similarly lead to reduced body fat content.
  • DGAT2 means the gene product or protein of which expression is to be modulated by administration of a short antisense compound.
  • DGAT2 nucleic acid means any nucleic acid encoding DGAT2.
  • a DGAT2 nucleic acid includes, without limitation, a DNA sequence encoding DGAT2, an RNA sequence transcribed from DNA encoding DGAT2, and an mRNA sequence encoding DGAT2.
  • DGAT2 mRNA means an mRNA encoding DGAT2.
  • Antisense technology is an effective means for reducing DGAT2 expression and has proven to be uniquely useful in a number of therapeutic, diagnostic, and research applications.
  • the present invention provides compounds targeted to nucleic acid encoding DGAT2, which modulate the expression of DGAT2.
  • Further provided herein are short antisense compounds capable of effectively inhibiting DGAT2 expression.
  • a subject, suspected of having a disease or associated with DGAT2 is treated by administering one or more short antisense compounds targeted to a nucleic acid encoding DGAT2.
  • such methods comprise the step of administering to an animal a therapeutically effective amount of a short antisense compound.
  • short antisense compounds effectively inhibit the activity of DGAT2 or inhibit the expression of DGAT2.
  • the activity or expression of DGAT2 in a subject is inhibited by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%.
  • the activity or expression of DGAT2 in a subject is inhibited by about 30%. More preferably, -the activity or expression of DGAT2 in a subject is inhibited by 50% or more.
  • the reduction of the expression of DGAT2 may be measured, for example, in blood, plasma, serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal.
  • the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding DGAT2 and/or the DGAT2 protein itself.
  • compositions comprising the compounds of the invention are also provided.
  • short antisense compounds targeted to a DGAT2 nucleic acid can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier.
  • short antisense compounds targeting DGAT2 may have any one or more properties or characteristics of the short antisense compounds generally described herein.
  • short antisense compounds targeting a DGAT2 nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6- 3 or 1-6-1.
  • short antisense compounds targeting a DGAT2 nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-10-1, 2-10-2 and 3-10-3.
  • DGAT2 nucleic acid Provided herein are methods of treating an individual by administering one or more short antisense compound targeted to a DGAT2 nucleic acid or a pharmaceutical composition comprising such compound. Further provided are methods of treating a subject having a disease or conditions associated with DGAT2 activity by administering a short antisense compound targeted to a DGAT2 nucleic acid.
  • Diseases and conditions associated with DGAT2 include, but are not limited to, cardiovascular disorders, obesity, diabetes, cholesterolemia, and liver steatosis.
  • short antisense compounds are targeted to a DGAT2 nucleic acid having the sequence of GENBANK® Accession No. NM_032564.2, incorporated herein as SEQ ID NO: - -
  • a short antisense compound targeted to SEQ ID NO: 10 is at least 90% complementary to SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 10 is at least 95% complementary to SEQ ID NO: 10. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 10 is 100% complementary to SEQ ID NO: 10. In certain embodiments, a short antisense compound targeted to SEQ ID NO: 10 includes a nucleotide sequence selected from the nucleotide sequences set forth in Tables 14 and 15.
  • Each nucleotide sequence set forth in each Tables 14 and 15 is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • short antisense compounds comprising a nucleotide sequence as set forth in Tables 14 and 15 may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Tables 14 and 15 illustrate examples of short antisense compounds targeted to SEQ ID NO: 10.
  • Table 14 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 10.
  • Table 15 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO: 10.
  • the column labeled 'gapmer motif indicates the wing-gap-wing motif of each short antisense compounds.
  • the gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2 '-modified sugar.
  • the particular 2 '-modified sugar is also indicated in the 'gapmer motif column.
  • '2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten T- deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate.
  • the short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine" is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
  • "5-mC in gap only” indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
  • Table 15 Short antisense compounds targeted to SEQ ID NO: 10 and having 1 or 2 mismatches
  • a target region is nucleotides 231-267 of SEQ ID NO: 10.
  • a short antisense compound is targeted to nucleotides 231-267 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 231-267 comprises a nucleotide sequence selected from SEQ ID NO 681, 682, 683, 684, 685, 686, or 687.
  • a short antisense compound targeted to nucleotides 231-267 of SEQ ID NO: 10 is selected from Isis No 372556, 372557, 382601, 372480, 372481, 372558, or 372559.
  • a target region is nucleotides 249-267 of SEQ ID NO: 10.
  • a short antisense compound is targeted to nucleotides 249-267 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 249-267 comprises a - - nucleotide sequence selected from SEQ ID NO 683, 684, 685, 686, or 687.
  • a short antisense compound targeted to nucleotides 249-267 of SEQ ID NO: 10 is selected from Isis No 382601, 372480, 372481, 372558, or 372559.
  • a target region is nucleotides 331-493 of SEQ ID NO: 10.
  • a short antisense compound is targeted to nucleotides 331-493 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 331-493 comprises a nucleotide sequence selected from SEQ ID NO 688, 689, 690, 691, 692, 693, or 694.
  • a short antisense compound targeted to nucleotides 331-493 of SEQ ID NO: 10 is selected from Isis No 382603, 382604, 372485, 372563, 382605, 372565, or 382606.
  • a target region is nucleotides 331-427 of SEQ ID NO: 10.
  • a short antisense compound is targeted to nucleotides 331-427 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 331-427 comprises a nucleotide sequence selected from SEQ ID NO 688, 689, 690, 691, 692, or 693.
  • a short antisense compound targeted to nucleotides 331-427 of SEQ ID NO: 10 is selected from Isis No 382603, 382604, 372485, 372563, 382605, or 372565.
  • a target region is nucleotides 392-408 of SEQ ID NO: 10.
  • a short antisense compound is targeted to nucleotides 392-408 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 392-408 comprises a nucleotide sequence selected from SEQ ID NO 690, 691, or 692.
  • a short antisense compound targeted to nucleotides 392-408 of SEQ ID NO: 10 is selected from Isis No 372485, 372563, or 382605.
  • a target region is nucleotides 651-707 of SEQ ID NO: 10.
  • a short antisense compound is targeted to nucleotides 651-707 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 651-707 comprises a nucleotide sequence selected from SEQ ED NO 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, or 728.
  • a short antisense compound targeted to nucleotides 651-707 of SEQ ID NO: 10 is selected from Isis No 372497, 372498, 372575, 372576, 382607, 372499, 372577, 372500, 372578, 372501, 372579, 372502, 372580, 372503, 372581, 372504, 372582, 372505, 372506, 372583, 372584, 372507, 372585, 382608, 372508, 372586, 372509, 372587, 372510, 372588, 372511, 372512, 372589, or 372590.
  • a target region is nucleotides 724-745 of SEQ ID NO: 10.
  • a short antisense compound is targeted to nucleotides 724-745 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 724-745 comprises a nucleotide sequence selected from SEQ ID NO 729, 730, 731, 732, or 733.
  • a short antisense compound targeted to nucleotides 724-745 of SEQ ID NO: 10 is selected from Isis No 382609, 372514, 372592, 372515, or 372593.
  • a target region is nucleotides 651-745 of SEQ ID NO: 10.
  • a short antisense compound is targeted to nucleotides 651-745 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 651-745 comprises a nucleotide sequence selected from SEQ ID NO 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, or 733.
  • a short antisense compound targeted to nucleotides 651-745 of SEQ ID NO: 10 is selected from Isis No 372497, 372498, 372575, 372576, 382607, 372499, 372577, 372500, 372578, 372501, 372579, 372502, 372580, 372503, 372581, 372504, 372582, 372505, 372506, 372583, 372584, 372507, 372585, 382608, 372508, 372586, 372509, 372587, 372510, 372588, 372511, 372512, 372589, 372590, 382609, 372514, 372592, 372515, or 372593.
  • a target region is nucleotides 851-922 of SEQ ID NO: 10.
  • a short antisense compound is targeted to nucleotides 851-922 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 851-922 comprises a nucleotide sequence selected from SEQ ID NO 734, 735, 736, or 737.
  • a short antisense compound targeted to nucleotides 851-922 of SEQ ID NO: 10 is selected from Isis No
  • a target region is nucleotides 851-879 of SEQ ID NO: 10.
  • a short antisense compound is targeted to nucleotides 851-879 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 851-879 comprises a nucleotide sequence selected from SEQ DD NO 734, 735, or 736.
  • a short antisense compound targeted to nucleotides 851-879 of SEQ ED NO: 10 is selected from Isis No 382610,
  • a target region is nucleotides 965-1007 of SEQ DD NO: 10.
  • a short antisense compound is targeted to nucleotides 965-1007 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 965-1007 comprises a nucleotide sequence selected from SEQ DD NO 738, 739, 740, 741, 742, 743, 744, or 745.
  • a short antisense compound targeted to nucleotides 965-1007 of SEQ DD NO: 10 is selected from Isis No 372524, 372602, 382613, 382614, 372525, 372603, 372526, or 372604.
  • a target region is nucleotides 965-979 of SEQ DD NO: 10.
  • a short antisense compound is targeted to nucleotides 965-979 of SEQ DD NO: 10.
  • a short antisense compound targeted to nucleotides 965-979 comprises a nucleotide sequence selected from SEQ DD NO 738, 739, or 740.
  • a short antisense compound targeted to nucleotides 965-979 of SEQ DD NO: 10 is selected from Isis No 372524, 372602, or 382613.
  • a target region is nucleotides 987-1007 of SEQ DD NO: 10.
  • a short antisense compound is targeted to nucleotides 987-1007 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 987-1007 comprises a nucleotide sequence selected from SEQ DD NO 741, 742, 743, 744, or 745.
  • a short antisense compound targeted to nucleotides 987-1007 of SEQ DD NO: 10 is selected from Isis No 382614, 372525, 372603, 372526, or 372604.
  • a target region is nucleotides 1106-1132 of SEQ ID NO: 10.
  • a short antisense compound is targeted to nucleotides 1106-1132 of SEQ ID NO: 10.
  • a short antisense compound targeted to nucleotides 1106-1132 comprises a nucleotide sequence selected from SEQ ID NO 746, 747, 748, 749, 750, 751, 752, 753, or 754.
  • a short antisense compound targeted to nucleotides 1106-1132 of SEQ ID NO: 10 is selected from Isis No 372530, 372608, 372531, 372609, 372532, 372610, 372533, 382615, or 372611.
  • a target region is nucleotides 1199-1233 of SEQ ID NO: 10.
  • a short antisense compound is targeted to nucleotides 1199-1233 of SEQ DD NO: 10.
  • a short antisense compound targeted to nucleotides 1199-1233 comprises a nucleotide sequence selected from SEQ ED NO 755, 756, 757, 758, 759, 760, 761, 762, or 763.
  • a short antisense compound targeted to nucleotides 1199-1233 of SEQ DD NO: 10 is selected from Isis No 372536, 372614, 372537, 372615, 372538, 372616, 382616, 372539, or 372617.
  • a target region is nucleotides 1293-1394 of SEQ DD NO: 10.
  • a short antisense compound is targeted to nucleotides 1293-1394 of SEQ DD NO: 10.
  • a short antisense compound targeted to nucleotides 1293-1394 comprises a nucleotide sequence selected from SEQ DD NO 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, or 777.
  • a short antisense compound targeted to nucleotides 1293- 1394 of SEQ DD NO: 10 is selected from Isis No 372540, 372618, 382617, 372541, 372619, 372542, 372620, 372543, 372621, 372544, 372622, 382618, 382619, or 382620.
  • a target region is nucleotides 1293-1336 of SEQ DD NO: 10.
  • a short antisense compound is targeted to nucleotides 1293-1336 of SEQ DD NO: 10.
  • a short antisense compound targeted to nucleotides 1293-1336 comprises a nucleotide sequence selected from SEQ DD NO 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, or 776.
  • a short antisense compound targeted to nucleotides 1293-1336 of SEQ DD NO: 10 is selected from Isis No 372540, 372618, 382617, 372541, 372619, 372542, 372620, 372543, 372621, 372544, 372622, 382618, or 382619.
  • a target region is nucleotides 1293-1324 of SEQ DD NO: 10.
  • a short antisense compound is targeted to nucleotides 1293-1324 of SEQ DD NO: 10.
  • a short antisense compound targeted to nucleotides 1293-1324 comprises a nucleotide sequence selected from SEQ DD NO 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, or 775.
  • a short antisense compound targeted to nucleotides 1293-1324 of SEQ ID NO: 10 is selected from Isis No 372540, 372618, 382617, 372541, 372619, 372542, 372620, 372543, 372621, 372544, 372622, or 382618.
  • short antisense compounds targeted to a DGAT2 nucleic acid are 8 to 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 9 to 14 nucleotides in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 10 to 14 nucleotides in length. In certain embodiments, such short antisense compounds are short antisense oligonucleotides.
  • short antisense compounds targeted to a DGAT2 nucleic acid are short gapmers.
  • short gapmers targeted to a DGAT2 nucleic acid comprise at least one high affinity modification in one or more wings of the compound.
  • short antisense compounds targeted to a DGAT2 nucleic acid comprise 1 to 3 high-affinity modifications in each wing.
  • the nucleosides or nucleotides of the wing comprise a 2' modification.
  • the monomers of the wing are BNA's.
  • the monomers of the wing are selected from ⁇ -L-Methyleneoxy (4'-CH 2 -O-2') BNA , ⁇ -D- Methyleneoxy (4'-CH 2 -O-2') BNA , Ethyleneoxy (4'-(CH 2 ) 2 -O-2') BNA , Aminooxy (4'-CH 2 -O-N(R)- 2') BNA and Oxyamino (4'-CH 2 -N(R)-O-2') BNA.
  • the monomers of a wing are 2'MOE nucleotides.
  • short antisense compounds targeted to a DGAT2 nucleic acid comprise a gap between the 5' wing and the 3' wing.
  • the gap comprises five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen monomers.
  • the monomers of the gap are unmodified deoxyribonucleotides.
  • the monomers of the gap are unmodified ribonucleotides.
  • gap modifications (if any) gap result in a short antisense compound that, when bound to its target nucleic acid, supports cleavage by an RNase, including, but not limited to, RNase H.
  • short antisense compounds targeted to a DGAT2 nucleic acid have uniform monomelic linkages. In certain such embodiments, those linkages are all phosphorothioate linkages. In certain embodiments, the linkages are all phosphodiester linkages. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid have mixed backbones.
  • short antisense compounds targeted to a DGAT2 nucleic acid are 8 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 9 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 10 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 11 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 13 monomers in length.
  • short antisense compounds targeted to a DGAT2 nucleic acid are 14 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 15 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid are 16 monomers in length. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid comprise 9 to 15 monomers. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid comprise 10 to 15 monomers. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid comprise 12 to 14 monomers. In certain embodiments, short antisense compounds targeted to a DGAT2 nucleic acid comprise 12 to 14 nucleotides or nucleosides.
  • the invention provides methods of modulating expression of DGAT2.
  • such methods comprise use of one or more short antisense compound targeted to a DGAT2 nucleic acid, wherein the short antisense compound targeted to a DGAT2 nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • the short antisense compound targeted to a DGAT2 nucleic acid is from about 8 to about 16, preferably 9 to 15, more preferably 9 to 14, more preferably 10 to 14 monomers (i.e. from about 8 to about 16 linked monomers).
  • methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 8 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 9 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 10 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 11 monomers in length.
  • methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 12 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 13 monomers in length. In certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 14 monomers in length.
  • methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 15 monomers in length, hi certain embodiments, methods of modulating DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid that is 16 monomers in length.
  • methods of modulating expression of DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid comprising 9 to 15 monomers. In certain embodiments, methods of modulating expression of DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid comprising 10 to 15 monomers, hi certain embodiments, methods of modulating expression of DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid comprising 12 to 14 monomers, hi certain embodiments, methods of modulating expression of DGAT2 comprise use of a short antisense compound targeted to a DGAT2 nucleic acid comprising 12 or 14 nucleotides or nucleosides.
  • PTPlB (also known as protein phosphatase IB and PTPNl) is an endoplasmic reticulum (ER)- associated enzyme originally isolated as the major protein tyrosine phosphatase of the human placenta -
  • PTPlB An essential regulatory role in signaling mediated by the insulin receptor has been established for PTPlB.
  • PTPlB interacts with and dephosphorylates the activated insulin receptor both in vitro and in intact cells resulting in the downregulation of the signaling pathway (Goldstein et al, MoI. Cell. Biochem., 1998, 182, 91-99; Seely et al, Diabetes, 1996, 45, 1379-1385).
  • PTPlB modulates the mitogenic actions of insulin (Goldstein et al, Mol. Cell. Biochem., 1998, 182, 91-99).
  • PTPlB Mouse knockout models lacking the PTPlB gene also point toward the negative regulation of insulin signaling by PTPlB. Mice harboring a disrupted PTPlB gene showed increased insulin sensitivity and increased phosphorylation of the insulin receptor. When placed on a high-fat diet, PTPlB -/- mice were. resistant to weight gain and remained insulin sensitive (Elchebly et al, Science, 1999, 283, 1544-1548). These studies clearly establish PTPlB as a therapeutic target in the treatment of diabetes and obesity.
  • Diabetes and obesity are interrelated. Most human obesity is associated with insulin resistance and leptin resistance. In fact obesity may have an even greater impact on insulin action than does diabetes itself (Sindelka et al., Physiol Res., 2002, 51, 85-91). Syndrome X or metabolic syndrome is a new term for a cluster of conditions, that, when occurring together, may indicate a predisposition to diabetes and cardiovascular disease. These symptoms, including high blood pressure, high triglycerides, decreased HDL and obesity, tend to appear together in some individuals. Because of its role in both diabetes and obesity, PTPlB is believed to be a therapeutic target for a range of metabolic conditions, including diabetes, obesity and metabolic syndrome. By improving blood glucose control, inhibitors of PTPlB may also be useful in slowing, preventing, delaying or ameliorating the sequelae of diabetes, which include retinopathy, neuropathy, cardiovascular complications and nephropathy.
  • PTPlB which is differentially regulated during the cell cycle (Schievella et al, Cell. Growth Differ., 1993, 4, 239-246), is expressed in insulin sensitive tissues as two different isoforms that arise from alternate splicing of the pre-mRNA (Shifrin and Neel, J. Biol. Chem., 1993, 268, 25376-25384).
  • the ratio of the alternatively spliced products is affected by growth factors, such as insulin, and differs in various tissues examined (Sell and Reese, MoI Genet. Metab., 1999, 66, 189-192).
  • the levels of the variants correlated with the plasma insulin concentration and percentage body fat. These variants may therefore be used as a biomarker for patients with chronic hyperinsulinemia or type 2 diabetes.
  • Protein tyrosine phosphatase IB is the gene product or protein of which expression is to be modulated by administration of a short antisense compound. Protein tyrosine phosphatase IB is generally referred to as PTPlB but may also be referred to as protein tyrosine phosphatase; PTPNl; RKPTP; protein tyrosine phosphatase, non-receptor type 1.
  • PTPlB nucleic acid means any nucleic acid encoding PTPlB.
  • a PTPlB nucleic acid includes, without limitation, a DNA sequence encoding PTPlB, an RNA sequence transcribed from DNA encoding PTPlB, and an rnRNA sequence encoding PTPlB.
  • PTPlB mRNA means an mRNA encoding a PTPlB protein.
  • Antisense technology is an effective means for reducing PTPlB expression and has proven to be uniquely useful in a number of therapeutic, diagnostic, and research applications.
  • the present invention provides compounds targeted to a nucleic acid encoding PTPlB, which modulate the expression of PTPlB. Further provided herein are short antisense compounds capable of effectively inhibiting PTPlB expression.
  • a subject, suspected of having a disease or disorder which can be treated by modulating the expression of PTPlB is treated by administering one or more short antisense compounds targeted to a nucleic acid encoding PTPlB.
  • the methods comprise the step of administering to an animal a therapeutically effective amount of a short antisense compound.
  • the short antisense compounds of the present invention effectively inhibit the activity of PTPlB or inhibit the expression of PTPlB.
  • the activity or expression of PTPlB in a subject is inhibited by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%.
  • activity or expression of PTPlB in a subject is inhibited by about 30%.
  • the activity or expression of PTPlB in a subject is inhibited by 50% or more.
  • the reduction of the expression of PTPlB may be measured, for example, in blood, plasma, serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal.
  • the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding PTPlB and/or the PTPlB protein itself.
  • compositions comprising the compounds of the invention are also provided.
  • short antisense compounds targeted to a PTPlB nucleic acid are utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier.
  • the short antisense compounds targeting PTPlB may have any one or more properties or characteristics of the short antisense compounds generally described herein.
  • short antisense compounds targeting a PTPlB nucleic acid have a motif (wing - deoxy gap -wing) selected from 1-12-1, 1-1-10-2, 2-10-1-1, 3-10-3, 2-10-3, 2-10-2, 1-10-1,1-10-2, 3-8-3, 2-8-2, 1-8-1, 3-6- 3 or 1-6-1, more preferably 1-10-1, 2-10-2, 3-10-3, and 1-9-2.
  • methods of treating an individual by administering one or more short antisense compound targeted to a PTPlB nucleic acid or a pharmaceutical composition comprising such compound are provided herein. Further provided are methods of treating a subject having a disease or conditions associated with PTPlB activity by administering a short antisense compound targeted to a PTPlB nucleic acid.
  • Diseases and conditions associated with PTPlB include but are not limited to high blood glucose or hyperglycemia, prediabetes, diabetes, Type 2 diabetes, metabolic syndrome, obesity and insulin resistance. Therefore, provided herein are methods of treating to high blood glucose or hyperglycemia, prediabetes, diabetes, Type 2 diabetes, metabolic syndrome, obesity and insulin resistance by administering a short antisense compound targeted to a PTPlB nucleic acid.
  • the present invention provides compositions and methods for decreasing blood glucose levels in a subject or for preventing or delaying the onset of a rise in blood glucose levels in a subject, by administering to the subject a short antisense inhibitor of PTPlB expression.
  • the present invention provides compositions and methods for improving insulin sensitivity in a subject or for preventing or delaying the onset of insulin resistance in a subject, by administering to the subject a short antisense inhibitor of PTPlB expression.
  • the present invention provides compositions and methods for treating a metabolic condition in a subject or for preventing or delaying the onset of a metabolic condition in a subject, by administering to the subject a short antisense compound targeted to a PTPlB nucleic acid.
  • Such metabolic condition may be any metabolic condition associated with PTPlB expression, including but not limited to diabetes and obesity.
  • methods of reducing adiposity Also provided is a method of treating obesity wherein metabolic rate is increased.
  • the subject has Type 2 diabetes.
  • the subject exhibits elevated HbAIc levels
  • HbAIc levels are at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10% or at least about 11%.
  • HbA 1 c levels are reduced to about 7% or below about 7%.
  • the subject exhibits an elevated body mass index In certain embodiments, the elevated body mass index is greater than 25 kg/m2.
  • the subject exhibits hyperglycemia or elevated blood glucose levels.
  • the blood glucose levels are fasting blood glucose levels.
  • the elevated fasting blood glucose levels are at least 130 mg/dL.
  • the subject exhibits hyperglycemia prior to the start of treatment or exhibits fasting blood glucose levels above about 130 mg/dL, baseline HbA !c levels of at least about 7%, or body mass index of greater than 25 kg/m 2 or any combination thereof.
  • a method of reducing one or more such levels by administering a short antisense compound targeted to a PTPlB nucleic acid is provided.
  • Fasting glucose may be fasting blood glucose, fasting serum glucose, or fasting plasma glucose.
  • fasting plasma glucose levels are reduced by at least about 25 mg/dL or by at least about 10 mg/dL.
  • said subject does not achieve normal glucose levels on a therapeutic regimen of a glucose- - - lowering agent such as insulin, sulfonylurea, or metformin.
  • the invention provides methods of altering lipid levels. Certain such methods reduce cholesterol, LDL and/or VLDL levels or any combination thereof in a subject by administering to the subject a short antisense compound targeted to a PTPlB nucleic acid. In certain embodiments HDL levels in a subject are increased by administering to the subject a short antisense compound targeted to a PTPlB nucleic acid. In certain embodiments, LDL:HDL ratio and/or total cholesterol:HDL ratio in a subject is reduced by administering to the subject a short antisense compound targeted to a PTPlB nucleic acid.
  • lipid profile in a subject is improved by increasing HDL, lowering LDL, lowering VLDL, lowering triglycerides, lowering apolipoprotein B levels, or lowering total cholesterol levels, or a combination thereof, by administering to the subject a short antisense compound targeted to a PTPlB nucleic acid .
  • the subject is an animal, including a human.
  • one or more pharmaceutical compositions comprising a short antisense compound targeted to a PTPlB nucleic acid are co-administered with one or more other pharmaceutical agents.
  • such one or more other pharmaceutical agents are designed to treat the same disease or condition as the one or more pharmaceutical compositions of the present invention.
  • such one or more other pharmaceutical agents are designed to treat a different disease or condition as the one or more pharmaceutical compositions of the present invention.
  • such one or more other pharmaceutical agents are designed to treat an undesired effect of one or more pharmaceutical compositions of the present invention.
  • one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent.
  • one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
  • the glucose-lowering agent is a PPAR agonist (gamma, dual, or pan), a dipeptidyl peptidase (IV) inhibitor, a GLP-I analog, insulin or an insulin analog, an insulin secretagogue, a SGLT2 inhibitor, a human amylin analog, a biguanide, an - - alpha-glucosidase inhibitor, a meglitinide, a thiazolidinedione, or a sulfonylurea.
  • the glucose-lowering therapeutic is a GLP-I analog.
  • the GLP-I analog is exendin-4 or liraglutide.
  • the glucose-lowering therapeutic is a sulfonylurea.
  • the sulfonylurea is acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, a glipizide, a glyburide, or a gliclazide.
  • the glucose lowering drug is a biguanide.
  • the biguanide is metformin, and in some embodiments, blood glucose levels are decreased without increased lactic acidosis as compared to the lactic acidosis observed after treatment with metformin alone.
  • the glucose lowering drug is a meglitinide.
  • the meglitinide is nateglinide or repaglinide.
  • the glucose-lowering drug is a thiazolidinedione.
  • the thiazolidinedione is pioglitazone, rosiglitazone, or troglitazone.
  • blood glucose levels are decreased without greater weight gain than observed with rosiglitazone treatment alone.
  • the glucose-lowering drug is an alpha-glucosidase inhibitor.
  • the alpha-glucosidase inhibitor is acarbose or miglitol.
  • a co-administered glucose-lowering agent is ISIS 113715.
  • glucose-lowering therapy is therapeutic lifestyle change.
  • the glucose-lowering agent is administered prior to administration of a pharmaceutical composition of the present invention. In certain such embodiments, the glucose - lowering agent is administered following administration of a pharmaceutical composition of the present invention. In certain such embodiments the glucose -lowering agent is administered at the same time as a pharmaceutical composition of the present invention. In certain such embodiments the dose of a coadministered glucose -lowering agent is the same as the dose that would be administered if the glucose - lowering agent was administered alone. In certain such embodiments the dose of a co-administered glucose -lowering agent is lower than the dose that would be administered if the glucose -lowering agent was administered alone. In certain such embodiments the dose of a co-administered glucose -lowering agent is greater than the dose that would be administered if the glucose -lowering agent was administered alone.
  • pharmaceutical agents that may be co-administered with a pharmaceutical composition comprising a short antisense compound targeted to a PTPlB nucleic acid include anti-obesity agents therapeutics.
  • anti-obesity agents therapeutics may be administered as described above for glucose lowering agents.
  • a short antisense compound which is targeted to a PTPlB nucleic acid for the preparation of a medicament for reducing blood glucose levels including fasting glucose levels, and HbAj c levels, body mass index levels or any combination thereof.
  • the medicament can be administered during a loading period and a maintenance period.
  • the medicament is administered subcutaneously or intravenously.
  • the administration of said medicament occurs at least once daily, at least once weekly, or at least once monthly.
  • the short antisense compound present in the medicament is administered in a dose lower than a short antisense compound with a longer sequence and particularly a sequence 20 or more nucleobases.
  • the medicament may be administered to a subject that exhibits high blood glucose or hyperglycemia, prediabetes, diabetes, Type 2 diabetes, metabolic syndrome, obesity and insulin resistance.
  • short antisense compounds are targeted to a PTPlB nucleic acid having the sequence of GENBANK® Accession No. NM_002827.2, incorporated herein as SEQ ID NO: 11 or the nucleotides 14178000 to 1425600 of the sequence of GENBANK® Accession No. NT O 11362.9, incorporated herein as SEQ ID NO: 12.
  • a short antisense compound targeted to SEQ ID NO: 11 is at least 90% complementary to SEQ ID NO: 11.
  • a short antisense compound targeted to SEQ ID NO: 11 is at least 95% complementary to SEQ ID NO: 11.
  • a short antisense compound targeted to SEQ ID NO: 12 is 100% complementary to SEQ BD NO: 12. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 12 is at least 90% complementary to SEQ ID NO: 12. In certain such embodiments, a short antisense compound targeted to SEQ ID NO: 12 is at least 95% complementary to SEQ ID NO: 12. In certain such embodiments, a short antisense compound targeted to SEQ ED NO: 12 is 100% complementary to SEQ ED NO: 12.
  • a short antisense compound targeted to SEQ ED NO: 11 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Tables 16 and 17.
  • a short antisense compound targeted to SEQ ID NO: 12 comprises a nucleotide sequence selected from the nucleotide sequences set forth in Tables 18 and 19.
  • Each nucleotide sequence set forth in each Tables 16, 17, 18, and 19 is independent of any - modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • short antisense compounds comprising a nucleotide sequence as set forth in Tables 16, 17, 18, and 19 may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number (Isis NO.) indicate a combination of nucleobase sequence and one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Tables 16 and 17 illustrate examples of short antisense compounds targeted to SEQ ID NO: 11.
  • Table 16 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 11.
  • Table 17 illustrates short antisense compounds that have one or two mismatches with respect to SEQ ID NO:
  • Table 18 illustrates short antisense compounds that are 100% complementary to SEQ ID NO: 12.
  • Table 19 illustrates short antisense compounds that have 1 or 2 mismatches with respect to SEQ ID NO:
  • the column labeled 'gapmer motif indicates the wing-gap-wing motif of each short antisense compounds.
  • the gap segment comprises 2'-deoxynucleotides and each nucleotide of each wing segment comprises a 2 '-modified sugar.
  • the particular 2 '-modified sugar is also indicated in the 'gapmer motif column.
  • '2-10-2 MOE' means a 2-10-2 gapmer motif, where a gap segment of ten T- deoxynucleotides is flanked by wing segments of two nucleotides, where the nucleotides of the wing segments are 2'-MOE nucleotides. Internucleoside linkages are phosphorothioate.
  • the short antisense compounds comprise 5-methylcytidine in place of unmodified cytosine, unless "unmodified cytosine” is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
  • unmodified cytosine is listed in the gapmer motif column, in which case the indicated cytosines are unmodified cytosines.
  • “5-mC in gap only” indicates that the gap segment has 5-methylcytosines, while the wing segments have unmodified cytosines.
  • Table 17 Short antisense compounds targeted to SEQ ID NO: 11 and having 1 or 2 mismatches

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Diabetes (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Endocrinology (AREA)
  • Virology (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Emergency Medicine (AREA)
  • Epidemiology (AREA)
  • Urology & Nephrology (AREA)
  • Vascular Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Child & Adolescent Psychology (AREA)
PCT/US2007/068410 2006-05-05 2007-05-07 Compounds and methods for modulating expression of gccr Ceased WO2007136988A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
JP2009510136A JP2009536039A (ja) 2006-05-05 2007-05-07 Gccrの発現を調節するための化合物および方法
BRPI0711429-0A BRPI0711429A2 (pt) 2006-05-05 2007-05-07 compostos e métodos para modulas expressão de gccr
EP07811878.3A EP2019692B1 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of gccr
DK07811878.3T DK2019692T3 (da) 2006-05-05 2007-05-07 Forbindelser og fremgangsmåder til modulation af ekspression af gccr
US12/299,583 US8372967B2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of GCCR
AU2007253909A AU2007253909B2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of GCCR
US13/662,263 US8969316B2 (en) 2006-05-05 2012-10-26 Compounds and methods for modulating expression of DGAT2

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
US74663106P 2006-05-05 2006-05-05
US60/746,631 2006-05-05
US74705906P 2006-05-11 2006-05-11
US60/747,059 2006-05-11
US80566006P 2006-06-23 2006-06-23
US60/805,660 2006-06-23
US86455406P 2006-11-06 2006-11-06
US60/864,554 2006-11-06
USPCT/US2007/061183 2007-01-27
PCT/US2007/061183 WO2007090071A2 (en) 2006-01-27 2007-01-27 6-modified bicyclic nucleic acid analogs

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/061183 Continuation-In-Part WO2007090071A2 (en) 2006-01-27 2007-01-27 6-modified bicyclic nucleic acid analogs

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12/299,583 A-371-Of-International US8372967B2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of GCCR
US13/662,263 Continuation US8969316B2 (en) 2006-05-05 2012-10-26 Compounds and methods for modulating expression of DGAT2

Publications (3)

Publication Number Publication Date
WO2007136988A2 true WO2007136988A2 (en) 2007-11-29
WO2007136988A3 WO2007136988A3 (en) 2009-05-07
WO2007136988A8 WO2007136988A8 (en) 2009-09-24

Family

ID=40134111

Family Applications (9)

Application Number Title Priority Date Filing Date
PCT/US2007/068410 Ceased WO2007136988A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of gccr
PCT/US2007/068401 Ceased WO2007146511A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating gene expression
PCT/US2007/068415 Ceased WO2007136989A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of dgat2
PCT/US2007/068412 Ceased WO2007134014A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of gcgr
PCT/US2007/068402 Ceased WO2007131237A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of ptp1b
PCT/US2007/068403 Ceased WO2007131238A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression apob
PCT/US2007/068406 Ceased WO2007143316A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of sglt2
PCT/US2007/068404 Ceased WO2007143315A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of pcsk9
PCT/US2007/068408 Ceased WO2007143317A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of crp

Family Applications After (8)

Application Number Title Priority Date Filing Date
PCT/US2007/068401 Ceased WO2007146511A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating gene expression
PCT/US2007/068415 Ceased WO2007136989A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of dgat2
PCT/US2007/068412 Ceased WO2007134014A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of gcgr
PCT/US2007/068402 Ceased WO2007131237A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of ptp1b
PCT/US2007/068403 Ceased WO2007131238A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression apob
PCT/US2007/068406 Ceased WO2007143316A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of sglt2
PCT/US2007/068404 Ceased WO2007143315A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of pcsk9
PCT/US2007/068408 Ceased WO2007143317A2 (en) 2006-05-05 2007-05-07 Compounds and methods for modulating expression of crp

Country Status (15)

Country Link
US (14) US20090326041A1 (https=)
EP (10) EP2023940B1 (https=)
JP (7) JP5825754B2 (https=)
KR (1) KR101441700B1 (https=)
CN (1) CN103554205A (https=)
AT (2) ATE514777T1 (https=)
AU (4) AU2007257094B2 (https=)
BR (1) BRPI0711429A2 (https=)
CA (3) CA2651309C (https=)
DK (5) DK2021472T3 (https=)
ES (2) ES2471978T3 (https=)
MX (1) MX2008014100A (https=)
NO (1) NO20084738L (https=)
PT (1) PT2015758E (https=)
WO (9) WO2007136988A2 (https=)

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014076195A1 (en) 2012-11-15 2014-05-22 Santaris Pharma A/S Oligonucleotide conjugates
WO2014118267A1 (en) 2013-01-30 2014-08-07 Santaris Pharma A/S Lna oligonucleotide carbohydrate conjugates
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US9394333B2 (en) 2008-12-02 2016-07-19 Wave Life Sciences Japan Method for the synthesis of phosphorus atom modified nucleic acids
US9598458B2 (en) 2012-07-13 2017-03-21 Wave Life Sciences Japan, Inc. Asymmetric auxiliary group
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US9994855B2 (en) 2014-05-01 2018-06-12 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US10570169B2 (en) 2014-05-22 2020-02-25 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US11400161B2 (en) 2016-10-06 2022-08-02 Ionis Pharmaceuticals, Inc. Method of conjugating oligomeric compounds
EP4035659A1 (en) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes for delivery of therapeutic agents
US11634710B2 (en) 2015-07-22 2023-04-25 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof

Families Citing this family (371)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7407943B2 (en) * 2001-08-01 2008-08-05 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein B expression
US20060009410A1 (en) * 2002-11-13 2006-01-12 Crooke Rosanne M Effects of apolipoprotein B inhibition on gene expression profiles in animals
US7511131B2 (en) 2002-11-13 2009-03-31 Genzyme Corporation Antisense modulation of apolipoprotein B expression
JP2005244488A (ja) 2004-02-25 2005-09-08 Matsushita Electric Ind Co Ltd 複合機
US20050287558A1 (en) 2004-05-05 2005-12-29 Crooke Rosanne M SNPs of apolipoprotein B and modulation of their expression
WO2007035771A2 (en) * 2005-09-19 2007-03-29 Johnson & Johnson Pharmaceutical Research & Development, L.L.C. Modulation of glucagon receptor expression
US8288354B2 (en) 2005-12-28 2012-10-16 The Scripps Research Institute Natural antisense and non-coding RNA transcripts as drug targets
US7764650B2 (en) 2006-03-02 2010-07-27 Intel Corporation Mobile station and method for fast roaming with integrity protection and source authentication using a common protocol
CA2648132C (en) 2006-04-03 2019-05-28 Santaris Pharma A/S Pharmaceutical composition comprising anti-mirna antisense oligonucleotides
EP2666859B1 (en) 2006-04-03 2019-01-02 Roche Innovation Center Copenhagen A/S Pharmaceutical composition comprising anti-mirna antisense oligonucleotides
EP2023940B1 (en) * 2006-05-05 2011-06-22 Isis Pharmaceuticals, Inc. Compounds and methods for modulating expression of sglt2
AU2007275365A1 (en) * 2006-07-17 2008-01-24 Sirna Therapeutics Inc. RNA interference mediated inhibition of Proprotein Convertase Subtilisin Kexin 9 (PCSK9) gene expression using short interfering nucleic acid (siNA)
WO2008049085A1 (en) * 2006-10-18 2008-04-24 Isis Pharmaceuticals, Inc. Antisense compounds
US8093222B2 (en) * 2006-11-27 2012-01-10 Isis Pharmaceuticals, Inc. Methods for treating hypercholesterolemia
JP2010510807A (ja) 2006-11-27 2010-04-08 アイシス ファーマシューティカルズ, インコーポレーテッド 高コレステロール血症を治療するための方法
CA2681406A1 (en) * 2007-03-22 2008-09-25 Santaris Pharma A/S Rna antagonist compounds for the inhibition of apo-b100 expression
CN101679979A (zh) 2007-03-24 2010-03-24 基酶有限公司 施用与人载脂蛋白b互补的反义寡核苷酸
EP2152879B1 (en) 2007-05-01 2012-11-14 Santaris Pharma A/S Rna antagonist compounds for the modulation of beta-catenin
NZ581201A (en) 2007-05-11 2012-05-25 Enzon Pharmaceuticals Inc Rna antagonist compounds for the modulation of her3
CA2692579C (en) 2007-07-05 2016-05-03 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
EP2025674A1 (de) 2007-08-15 2009-02-18 sanofi-aventis Substituierte Tetrahydronaphthaline, Verfahren zu ihrer Herstellung und ihre Verwendung als Arzneimittel
US8318496B2 (en) * 2007-10-04 2012-11-27 Isis Pharmaceuticals, Inc. Compounds and methods for improving cellular uptake of oligomeric compounds
EP2623599B1 (en) 2007-10-04 2019-01-02 Roche Innovation Center Copenhagen A/S Micromirs
US8450290B2 (en) 2007-11-26 2013-05-28 Enzon Pharmaceuticals, Inc. Methods for treating androgen receptor dependent disorders including cancers
JP5872162B2 (ja) 2007-11-26 2016-03-01 エンゾン ファーマシューティカルズ,インコーポレーテッド アンドロゲン受容体を標的化するlnaアンタゴニスト
WO2009071680A2 (en) * 2007-12-07 2009-06-11 Santaris Pharma A/S Rna antagonist compounds for the modulation of mcl-1
US10131904B2 (en) 2008-02-11 2018-11-20 Rxi Pharmaceuticals Corporation Modified RNAi polynucleotides and uses thereof
EP2268811A1 (en) 2008-03-07 2011-01-05 Santaris Pharma A/S Pharmaceutical compositions for treatment of microrna related diseases
WO2009117589A1 (en) 2008-03-21 2009-09-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising tricyclic nucleosides and methods for their use
US8846639B2 (en) 2008-04-04 2014-09-30 Isis Pharmaceutical, Inc. Oligomeric compounds comprising bicyclic nucleosides and having reduced toxicity
US20110224280A1 (en) * 2008-04-16 2011-09-15 Niels Fisker Nielsen Pharmaceutical Composition Comprising Anti PCSK9 Oligomers
EP2291200A4 (en) 2008-05-22 2012-05-30 Isis Pharmaceuticals Inc PROCESS FOR MODULATING THE EXPRESSION OF RBP4
CA2726052A1 (en) 2008-06-04 2009-12-10 The Board Of Regents Of The University Of Texas System Modulation of gene expression through endogenous small rna targeting of gene promoters
WO2009148605A2 (en) * 2008-06-04 2009-12-10 Isis Pharmaceuticals, Inc. Methods for treating hypercholesterolemia
WO2010014592A1 (en) 2008-07-29 2010-02-04 The Board Of Regents Of The University Of Texas Sytem Selective inhibition of polyglutamine protein expression
ES2541442T3 (es) 2008-08-01 2015-07-20 Roche Innovation Center Copenhagen A/S Modulación mediada por microARN de factores estimulantes de colonias
EP3375451A1 (en) 2008-08-25 2018-09-19 Excaliard Pharmaceuticals, Inc. Method for reducing scarring during wound healing using antisense compounds directed to ctgf
NZ601660A (en) 2008-08-25 2014-05-30 Excaliard Pharmaceuticals Inc Antisense oligonucleotides directed against connective tissue growth factor and uses thereof
CA2746527A1 (en) 2008-09-22 2010-03-25 Rxi Pharmaceuticals Corporation Rna interference in skin indications
WO2010040112A2 (en) 2008-10-03 2010-04-08 Curna, Inc. Treatment of apolipoprotein-a1 related diseases by inhibition of natural antisense transcript to apolipoprotein-a1
MX2011004097A (es) 2008-10-15 2011-07-28 Isis Pharmaceuticals Inc Modulacion de la expresion del factor 11.
WO2010048549A2 (en) * 2008-10-24 2010-04-29 Isis Pharmaceuticals, Inc. 5' and 2' bis-substituted nucleosides and oligomeric compounds prepared therefrom
ES2600781T3 (es) 2008-12-04 2017-02-10 Curna, Inc. Tratamiento para enfermedades relacionadas con el factor de crecimiento del endotelio vascular (vegf) mediante la inhibición de transcritos antisentido naturales de vegf
RU2620970C2 (ru) 2008-12-04 2017-05-30 КьюРНА,Инк., Лечение связанных с эритропоэтином (еро) заболеваний путем ингибирования природного антисмыслового транскрипта к еро
CN102361985B (zh) 2008-12-04 2017-06-20 库尔纳公司 通过抑制肿瘤抑制基因的天然反义转录物治疗肿瘤抑制基因相关性疾病
US20130064834A1 (en) 2008-12-15 2013-03-14 Regeneron Pharmaceuticals, Inc. Methods for treating hypercholesterolemia using antibodies to pcsk9
JO3672B1 (ar) 2008-12-15 2020-08-27 Regeneron Pharma أجسام مضادة بشرية عالية التفاعل الكيماوي بالنسبة لإنزيم سبتيليسين كنفرتيز بروبروتين / كيكسين نوع 9 (pcsk9).
US9493774B2 (en) 2009-01-05 2016-11-15 Rxi Pharmaceuticals Corporation Inhibition of PCSK9 through RNAi
AU2010211133A1 (en) * 2009-02-03 2011-07-21 F. Hoffmann-La Roche Ag Compositions and methods for inhibiting expression of PTP1B genes
US9745574B2 (en) 2009-02-04 2017-08-29 Rxi Pharmaceuticals Corporation RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
KR101805199B1 (ko) * 2009-02-12 2017-12-05 큐알엔에이, 인크. 신경교세포 유래된 신경영양성 인자 (gdnf)에 대한 자연 안티센스 전사체의 저해에 의한 신경교세포 유래된 신경영양성 인자 (gdnf) 관련된 질환의 치료
WO2010093904A2 (en) 2009-02-12 2010-08-19 Curna, Inc. Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
EP2408919B1 (en) 2009-03-16 2017-10-18 CuRNA, Inc. Treatment of nuclear factor (erythroid-derived 2)-like 2 (nrf2) related diseases by inhibition of natural antisense transcript to nrf2
EP2408796B1 (en) 2009-03-16 2020-04-22 Ionis Pharmaceuticals, Inc. Targeting Apolipoprotein B for the reduction of Apolipoprotein C-III
CA2755404C (en) 2009-03-17 2020-03-24 Curna, Inc. Treatment of delta-like 1 homolog (dlk1) related diseases by inhibition of natural antisense transcript to dlk1
EP2421972A2 (en) 2009-04-24 2012-02-29 The Board of Regents of The University of Texas System Modulation of gene expression using oligomers that target gene regions downstream of 3' untranslated regions
ES2599979T3 (es) 2009-04-24 2017-02-06 Roche Innovation Center Copenhagen A/S Composiciones farmacéuticas para el tratamiento de pacientes de VHC que no responden al interferón
CN102459596B (zh) 2009-05-06 2016-09-07 库尔纳公司 通过针对脂质转运和代谢基因的天然反义转录物的抑制治疗脂质转运和代谢基因相关疾病
KR101722541B1 (ko) 2009-05-06 2017-04-04 큐알엔에이, 인크. Ttp에 대한 천연 안티센스 전사체의 억제에 의한 트리스테트라프롤린 관련된 질환의 치료
ES2618572T3 (es) 2009-05-08 2017-06-21 Curna, Inc. Tratamiento de enfermedades relacionadas con la familia de la distrofina mediante inhibición de un transcrito antisentido natural para la familia de dmd
AU2010247389A1 (en) * 2009-05-15 2011-10-27 F. Hoffmann-La Roche Ag Compositions and methods for inhibiting expression of glucocorticoid receptor (GCR) genes
WO2010135329A2 (en) 2009-05-18 2010-11-25 Curna, Inc. Treatment of reprogramming factor related diseases by inhibition of natural antisense transcript to a reprogramming factor
CA2762987A1 (en) 2009-05-22 2010-11-25 Joseph Collard Treatment of transcription factor e3 (tfe3) and insulin receptor substrate 2 (irs2) related diseases by inhibition of natural antisense transcript to tfe3
KR101704988B1 (ko) 2009-05-28 2017-02-08 큐알엔에이, 인크. 항바이러스 유전자에 대한 천연 안티센스 전사체의 억제에 의한 항바이러스 유전자 관련된 질환의 치료
CA2765700C (en) 2009-06-16 2021-01-05 Opko Curna, Llc Treatment of collagen gene related diseases by inhibition of natural antisense transcript to a collagen gene
ES2629339T3 (es) 2009-06-16 2017-08-08 Curna, Inc. Tratamiento de enfermedades relacionadas con la paraoxonasa 1 (pon1) por inhibición de transcrito antisentido natural a pon1
ES2618894T3 (es) 2009-06-24 2017-06-22 Curna, Inc. Tratamiento de enfermedades relacionadas con el receptor del factor de necrosis tumoral 2 (tnfr2) por inhibición del transcrito natural antisentido para tnfr2
CN102482672B (zh) 2009-06-26 2016-11-09 库尔纳公司 通过抑制唐氏综合征基因的天然反义转录物治疗唐氏综合征基因相关疾病
US8563528B2 (en) 2009-07-21 2013-10-22 Santaris Pharma A/S Antisense oligomers targeting PCSK9
US20120252869A1 (en) 2009-07-24 2012-10-04 Opko Curna, Llc Treatment of sirtuin (sirt) related diseases by inhibition of natural antisense transcript to a sirtuin (sirt)
ES2585360T3 (es) 2009-08-05 2016-10-05 Curna, Inc. Tratamiento de enfermedades relacionadas con un gen de la insulina (INS) por inhibición de la transcripción antisentido natural en un gen de la insulina (INS)
ES2599986T3 (es) 2009-08-11 2017-02-06 Curna, Inc. Tratamiento de enfermedades relacionadas con adiponectina (ADIPOQ) mediante la inhibición de un transcrito antisentido natural de una adiponectina (ADIPOQ)
CN102482670B (zh) 2009-08-21 2018-06-15 库尔纳公司 通过抑制‘hsp70-相互作用蛋白的c末端’(chip)的天然反义转录物而治疗chip相关疾病
EP2470657B1 (en) 2009-08-25 2019-10-23 CuRNA, Inc. Treatment of 'iq motif containing gtpase activating protein' (iqgap) related diseases by inhibition of natural antisense transcript to iqgap
DK2480669T3 (en) 2009-09-25 2018-02-12 Curna Inc TREATMENT OF FILAGGRIN- (FLG) RELATED DISEASES BY MODULATING FLG EXPRESSION AND ACTIVITY
US20120270929A1 (en) * 2009-09-25 2012-10-25 Isis Pharmaceuticals, Inc. Modulation of ttc39 expression to increase hdl
WO2011046871A1 (en) * 2009-10-12 2011-04-21 Medimmune, Llc Quantification of ir-a and ir-b for tumor classification
US20130079382A1 (en) 2009-10-12 2013-03-28 Larry J. Smith Methods and Compositions for Modulating Gene Expression Using Oligonucleotide Based Drugs Administered in vivo or in vitro
US20110110860A1 (en) 2009-11-02 2011-05-12 The Board Of Regents Of The University Of Texas System Modulation of ldl receptor gene expression with double-stranded rnas targeting the ldl receptor gene promoter
WO2011054811A1 (en) 2009-11-03 2011-05-12 Santaris Pharma A/S Rna antagonists targeting hsp27 combination therapy
CA2782366A1 (en) 2009-12-16 2011-07-14 Opko Curna, Llc Treatment of membrane bound transcription factor peptidase, site 1 (mbtps1) related diseases by inhibition of natural antisense transcript to mbtps1
RU2619185C2 (ru) 2009-12-23 2017-05-12 Курна, Инк. Лечение заболеваний, связанных с разобщающим белком 2 (ucp2), путем ингибирования природного антисмыслового транскрипта к ucp2
NO2516648T3 (https=) 2009-12-23 2018-04-07
US8962585B2 (en) 2009-12-29 2015-02-24 Curna, Inc. Treatment of tumor protein 63 (p63) related diseases by inhibition of natural antisense transcript to p63
US8921334B2 (en) 2009-12-29 2014-12-30 Curna, Inc. Treatment of nuclear respiratory factor 1 (NRF1) related diseases by inhibition of natural antisense transcript to NRF1
DK2519632T3 (en) 2009-12-31 2018-07-23 Curna Inc TREATMENT OF INSULIN RECEPTOR SUBSTRATE 2- (IRS2) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPTION TO IRS2 AND TRANSCRIPTION FACTOR E3 (TFE3)
DK2521784T3 (en) 2010-01-04 2018-03-12 Curna Inc TREATMENT OF INTERFERON REGULATORY FACTOR 8- (IRF8) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENCE TRANSCRIPT TO IRF8
KR101853509B1 (ko) 2010-01-06 2018-04-30 큐알엔에이, 인크. 췌장 발달 유전자에 대한 천연 안티센스 전사체의 억제에 의한 췌장 발달 유전자와 관련된 질환의 치료
US8653047B2 (en) * 2010-01-08 2014-02-18 Isis Pharmaceuticals, Inc. Modulation of angiopoietin-like 3 expression
KR101854926B1 (ko) 2010-01-11 2018-05-04 큐알엔에이, 인크. 성 호르몬 결합 글로불린 (shbg)에 대한 자연 안티센스 전사체의 저해에 의한 성 호르몬 결합 글로불린 (shbg) 관련된 질환의 치료
WO2011088148A1 (en) * 2010-01-12 2011-07-21 Isis Pharmaceuticals, Inc. Modulation of transforming growth factor-beta 1 expression
DK2529015T3 (en) 2010-01-25 2018-02-26 Curna Inc TREATMENT OF RNASE H1-RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO RNASE H1
WO2011097388A1 (en) 2010-02-03 2011-08-11 Alnylam Pharmaceuticals, Inc. Selective inhibition of polyglutamine protein expression
WO2011097643A1 (en) 2010-02-08 2011-08-11 Isis Pharmaceuticals, Inc. Selective reduction of allelic variants
EP3628750A1 (en) * 2010-02-08 2020-04-01 Ionis Pharmaceuticals, Inc. Selective reduction of allelic variants
RU2608496C2 (ru) 2010-02-22 2017-01-18 Курна, Инк. Лечение заболеваний, связанных с пирролин-5 карбоксилатредуктазой 1(pycr1), путем ингибирования природного антисмыслового транскрипта к pycr1
WO2011107494A1 (de) 2010-03-03 2011-09-09 Sanofi Neue aromatische glykosidderivate, diese verbindungen enthaltende arzneimittel und deren verwendung
EP2545173A2 (en) * 2010-03-12 2013-01-16 Sarepta Therapeutics, Inc. Antisense modulation of nuclear hormone receptors
BR112012024049A2 (pt) 2010-03-24 2017-03-01 Rxi Pharmaceuticals Corp interferência de rna em indicações dérmicas e fibróticas
US8980856B2 (en) 2010-04-02 2015-03-17 Curna, Inc. Treatment of colony-stimulating factor 3 (CSF3) related diseases by inhibition of natural antisense transcript to CSF3
KR101900962B1 (ko) 2010-04-09 2018-09-20 큐알엔에이, 인크. 섬유아세포 성장 인자 21 (fgf21)에 대한 자연 안티센스 전사체의 저해에 의한 섬유아세포 성장 인자 21 (fgf21) 관련된 질환의 치료
RU2018110642A (ru) 2010-05-03 2019-02-27 Курна, Инк. Лечение заболеваний, связанных с сиртуином (sirt), путем ингибирования природного антисмыслового транскрипта к сиртуину (sirt)
TWI586356B (zh) 2010-05-14 2017-06-11 可娜公司 藉由抑制par4天然反股轉錄本治療par4相關疾病
JP5917497B2 (ja) 2010-05-26 2016-05-18 カッパーアールエヌエー,インコーポレイテッド メチオニンスルホキシドレダクターゼa(msra)に対する天然アンチセンス転写物の阻害によるmsra関連疾患の治療
CA2799207C (en) 2010-05-26 2019-03-26 Curna, Inc. Treatment of atonal homolog 1 (atoh1) related diseases by inhibition of natural antisense transcript to atoh1
RU2585491C2 (ru) 2010-06-04 2016-05-27 Борд Оф Риджентс, Зе Юниверсити Оф Техас Систем Регуляция метаболизма с помощью mir-378
JP5755326B2 (ja) * 2010-06-11 2015-07-29 日立化成株式会社 腎機能の特徴を決定する方法
WO2011156734A2 (en) 2010-06-11 2011-12-15 Hitachi Chemical Co., Ltd. Method of characterizing vascular diseases
EP2582397A4 (en) 2010-06-15 2014-10-29 Isis Pharmaceuticals Inc COMPOUNDS AND METHOD FOR MODULATING INTERACTION BETWEEN PROTEINS AND TARGET NUCLEIC ACIDS
WO2011157827A1 (de) 2010-06-18 2011-12-22 Sanofi Azolopyridin-3-on-derivate als inhibitoren von lipasen und phospholipasen
US8530413B2 (en) 2010-06-21 2013-09-10 Sanofi Heterocyclically substituted methoxyphenyl derivatives with an oxo group, processes for preparation thereof and use thereof as medicaments
WO2011163499A2 (en) * 2010-06-23 2011-12-29 Opko Curna, Llc Treatment of sodium channel, voltage-gated, alpha subunit (scna) related diseases by inhibition of natural antisense transcript to scna
TW201215387A (en) 2010-07-05 2012-04-16 Sanofi Aventis Spirocyclically substituted 1,3-propane dioxide derivatives, processes for preparation thereof and use thereof as a medicament
TW201215388A (en) 2010-07-05 2012-04-16 Sanofi Sa (2-aryloxyacetylamino)phenylpropionic acid derivatives, processes for preparation thereof and use thereof as medicaments
TW201221505A (en) 2010-07-05 2012-06-01 Sanofi Sa Aryloxyalkylene-substituted hydroxyphenylhexynoic acids, process for preparation thereof and use thereof as a medicament
CN103068982B (zh) 2010-07-14 2017-06-09 库尔纳公司 通过抑制盘状大同系物(dlg)的天然反义转录物而治疗dlg相关疾病
JP5875006B2 (ja) * 2010-08-31 2016-03-02 国立大学法人大阪大学 オリゴヌクレオチド、およびオリゴヌクレオチドを有効成分として含有する脂質異常症治療剤
WO2012034942A1 (en) 2010-09-13 2012-03-22 Santaris Pharma A/S Compounds for the modulation of aurora kinase b expression
ES2640755T3 (es) 2010-10-06 2017-11-06 Curna, Inc. Tratamiento de enfermedades relacionadas con la Sialidasa 4 (neu4) mediante inhibición del transcrito antisentido natural al gen neu4
US9222088B2 (en) 2010-10-22 2015-12-29 Curna, Inc. Treatment of alpha-L-iduronidase (IDUA) related diseases by inhibition of natural antisense transcript to IDUA
US9920317B2 (en) 2010-11-12 2018-03-20 The General Hospital Corporation Polycomb-associated non-coding RNAs
EP3260540A1 (en) 2010-11-12 2017-12-27 The General Hospital Corporation Polycomb-associated non-coding rnas
US10000752B2 (en) 2010-11-18 2018-06-19 Curna, Inc. Antagonat compositions and methods of use
WO2012066093A1 (en) 2010-11-19 2012-05-24 Santaris Pharma A/S Compounds for the modulation of pdz-binding kinase (pbk) expression
WO2012066092A1 (en) 2010-11-19 2012-05-24 Santaris Pharma A/S Compounds for the modulation of aurora kinase a expression
JO3756B1 (ar) 2010-11-23 2021-01-31 Regeneron Pharma اجسام مضادة بشرية لمستقبلات الجلوكاجون
ES2657590T3 (es) 2010-11-23 2018-03-06 Curna, Inc. Tratamiento de enfermedades relacionadas con nanog mediante inhibición del transcrito antisentido natural a nanog
US8771696B2 (en) 2010-11-23 2014-07-08 Regeneron Pharmaceuticals, Inc. Method of reducing the severity of stress hyperglycemia with human antibodies to the glucagon receptor
PL3395836T3 (pl) 2011-01-28 2021-12-13 Sanofi Biotechnology Ludzkie przeciwciała przeciwko pcsk9 do zastosowania w sposobach leczenia konkretnych grup osobników
KR101697396B1 (ko) 2011-02-02 2017-01-17 엑스칼리아드 파마슈티컬즈, 인코포레이티드 결합 조직 성장 인자(ctgf)를 표적으로 하는 안티센스 화합물을 사용하여 켈로이드 또는 비후성 흉터를 치료하는 방법
US10017764B2 (en) 2011-02-08 2018-07-10 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2012110457A2 (en) 2011-02-14 2012-08-23 Santaris Pharma A/S Compounds for the modulation of osteopontin expression
WO2012142458A1 (en) 2011-04-13 2012-10-18 Isis Pharmaceuticals, Inc. Antisense modulation of ptp1b expression
WO2012143427A1 (en) 2011-04-19 2012-10-26 Santaris Pharma A/S Anti polyomavirus compounds
RU2013151301A (ru) 2011-04-20 2015-05-27 Ларри Дж. СМИТ Способы и композиции для модулирования экспрессии генов с использованием компонентов, которые обладают способностью к самосборке в клетках и обусловливают рнкi-активность
EP2718439B1 (en) 2011-06-09 2017-08-09 CuRNA, Inc. Treatment of frataxin (fxn) related diseases by inhibition of natural antisense transcript to fxn
US9719129B2 (en) 2011-06-10 2017-08-01 Hitachi Chemical Co., Ltd. Methods for isolating vesicles from biological fluids
AR087305A1 (es) 2011-07-28 2014-03-12 Regeneron Pharma Formulaciones estabilizadas que contienen anticuerpos anti-pcsk9, metodo de preparacion y kit
ES2651514T3 (es) 2011-08-11 2018-01-26 Ionis Pharmaceuticals, Inc. Compuestos oligoméricos gapados que comprenden deoxirribonucleósidos modificados en 5 ' -en la brecha y usos de ellos
KR101991980B1 (ko) 2011-09-06 2019-06-21 큐알엔에이, 인크. 소형 분자로 전압-개폐된 나트륨 채널 (SCNxA)의 알파 아단위에 관련된 질환의 치료
WO2013037390A1 (en) 2011-09-12 2013-03-21 Sanofi 6-(4-hydroxy-phenyl)-3-styryl-1h-pyrazolo[3,4-b]pyridine-4-carboxylic acid amide derivatives as kinase inhibitors
HK1200484A1 (zh) 2011-09-14 2015-08-07 Translate Bio Ma, Inc. 多聚寡核苷酸化合物
ES2992345T3 (es) 2011-09-16 2024-12-11 Regeneron Pharma Métodos para reducir los niveles de lipoproteína(a) mediante la administración de un inhibidor de la proproteína convertasa subtilisina kexina-9 (PCSK9)
ES2796556T3 (es) * 2011-09-20 2020-11-27 Ionis Pharmaceuticals Inc Modulación antisentido de la expresión de GCGR
EP2760862B1 (en) 2011-09-27 2015-10-21 Sanofi 6-(4-hydroxy-phenyl)-3-alkyl-1h-pyrazolo[3,4-b]pyridine-4-carboxylic acid amide derivatives as kinase inhibitors
JP2015501155A (ja) 2011-10-25 2015-01-15 アイシス ファーマシューティカルズ, インコーポレーテッド Gccr発現のアンチセンス調整
AU2012353330B2 (en) 2011-12-16 2018-04-19 National University Corporation Tokyo Medical And Dental University Chimeric double-stranded nucleic acid
US20150031750A1 (en) 2012-03-15 2015-01-29 The Scripps Research Institute Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
AU2013203395A1 (en) 2012-03-30 2013-10-17 Isis Pharmaceuticals, Inc. Compositions and methods for modulating TAU expression for reducing seizure and modifying a neurodegenerative syndrome
WO2013159108A2 (en) * 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
US9255154B2 (en) 2012-05-08 2016-02-09 Alderbio Holdings, Llc Anti-PCSK9 antibodies and use thereof
AU2013262709A1 (en) 2012-05-16 2015-01-22 Rana Therapeutics, Inc. Compositions and methods for modulating MECP2 expression
CA2873766A1 (en) 2012-05-16 2013-11-21 Rana Therapeutics Inc. Compositions and methods for modulating atp2a2 expression
WO2013173652A1 (en) * 2012-05-16 2013-11-21 Rana Therapeutics, Inc. Compositions and methods for modulating gene expression
CA2873769A1 (en) 2012-05-16 2013-11-21 Rana Therapeutics Inc. Compositions and methods for modulating hemoglobin gene family expression
US10837014B2 (en) 2012-05-16 2020-11-17 Translate Bio Ma, Inc. Compositions and methods for modulating SMN gene family expression
WO2013173605A1 (en) * 2012-05-16 2013-11-21 Rana Therapeutics, Inc. Compositions and methods for modulating pten expression
BR112014028634A2 (pt) 2012-05-16 2017-06-27 Rana Therapeutics Inc composições e métodos para modulação da expressão de utrn
JP2015523854A (ja) 2012-05-16 2015-08-20 ラナ セラピューティクス インコーポレイテッド Smn遺伝子ファミリー発現を調節するための組成物及び方法
US20160002624A1 (en) 2012-05-17 2016-01-07 Isis Pharmaceuticals, Inc. Antisense oligonucleotide compositions
RU2748495C2 (ru) * 2012-05-24 2021-05-26 Ионис Фармасьютикалз, Инк. Способы и композиции для модулирования экспрессии аполипопротеина (а)
CN109810977A (zh) 2012-05-26 2019-05-28 株式会社博纳克 具有递送功能的基因表达调控用单链核酸分子
EP2895200B1 (en) 2012-09-14 2019-11-06 Translate Bio MA, Inc. Multimeric oligonucleotide compounds
WO2014045126A2 (en) 2012-09-18 2014-03-27 Uti Limited Partnership Treatment of pain by inhibition of usp5 de-ubiquitinase
WO2014059353A2 (en) * 2012-10-11 2014-04-17 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleosides and uses thereof
US20160138014A1 (en) 2012-10-12 2016-05-19 Isis Pharmaceuticals, Inc. Antisense compounds and uses thereof
HK1212597A1 (zh) 2012-10-15 2016-06-17 Isis Pharmaceuticals, Inc. 用於調節c90rf72表達的組合物
WO2014062736A1 (en) 2012-10-15 2014-04-24 Isis Pharmaceuticals, Inc. Methods for monitoring c9orf72 expression
BR112015012051A2 (pt) 2012-11-26 2017-12-12 Roche Innovation Ct Copenhagen As composições e métodos para modulação de expressão de fgfr3
WO2014120861A2 (en) * 2013-01-31 2014-08-07 Isis Pharmaceuticals, Inc. Method of preparing oligomeric compounds using modified coupling protocols
CN105143470B (zh) 2013-02-28 2020-06-09 德克萨斯大学系统董事会 用于将癌症分类为易感于tmepai定向疗法以及治疗所述癌症的方法
CA2901983A1 (en) 2013-03-01 2014-09-04 National University Corporation Tokyo Medical And Dental University Chimeric single-stranded antisense polynucleotides and double-stranded antisense agent
ES2807379T3 (es) 2013-03-14 2021-02-22 Ionis Pharmaceuticals Inc Composiciones y métodos para regular la expresión de Tau
DK2970970T3 (en) 2013-03-14 2019-02-11 Andes Biotechnologies Global Inc Antisense oligonucleotides for the treatment of cancer stem cells
CA2902571A1 (en) * 2013-03-15 2014-09-18 MiRagen Therapeutics, Inc. Bridged bicyclic nucleosides
MX2015014666A (es) 2013-04-17 2016-03-01 Pfizer Derivados de n-piperidin-3-ilbenzamida para tratar enfermedades cardiovasculares.
JP6297676B2 (ja) 2013-05-06 2018-03-20 日立化成株式会社 標的分子を捕捉するためのデバイス及び方法
CA2907694A1 (en) 2013-05-24 2014-11-27 Roche Innovation Center Copenhagen A/S Oligonucleotide modulators of b-cell cll/lymphoma 11a (bcl11a) and uses thereof
US10111953B2 (en) 2013-05-30 2018-10-30 Regeneron Pharmaceuticals, Inc. Methods for reducing remnant cholesterol and other lipoprotein fractions by administering an inhibitor of proprotein convertase subtilisin kexin-9 (PCSK9)
ES2700277T3 (es) 2013-05-30 2019-02-14 Univ Nat Corp Tokyo Medical & Dental Agentes de doble cadena para el suministro de oligonucleótidos terapéuticos
TW202021614A (zh) 2013-06-07 2020-06-16 法商賽諾菲生物技術公司 藉由投與pcsk9抑制劑抑制動脈粥狀硬化的方法
CN105324119A (zh) 2013-06-16 2016-02-10 国立大学法人东京医科齿科大学 具有外显子跳跃效应的双链反义核酸
ES2770667T3 (es) 2013-06-27 2020-07-02 Roche Innovation Ct Copenhagen As Oligómeros antisentido y conjugados que se dirigen a PCSK9
TWI772856B (zh) 2013-07-19 2022-08-01 美商百健Ma公司 用於調節τ蛋白表現之組合物
JP2016531570A (ja) 2013-08-16 2016-10-13 ラナ セラピューティクス インコーポレイテッド ユークロマチン領域を標的とするオリゴヌクレオチド
EP4166667A3 (en) 2013-10-11 2023-08-02 Ionis Pharmaceuticals, Inc. Compositions for modulating c9orf72 expression
MX2016006226A (es) 2013-11-12 2016-09-07 Sanofi Biotechnology Regimenes de dosificacion para uso con inhibidores de pcsk9.
CN111394355A (zh) 2013-12-24 2020-07-10 Ionis制药公司 促血管生成素样3表达的调节
CN105899663B (zh) 2013-12-26 2019-07-26 学校法人东京医科大学 用于基因表达控制的人工模拟miRNA及其用途
SG10201913570XA (en) 2013-12-27 2020-03-30 Bonac Corp Artificial match-type mirna for controlling gene expression and use therefor
SG11201608502TA (en) * 2014-05-01 2016-11-29 Ionis Pharmaceuticals Inc Compositions and methods for modulating complement factor b expression
PT3137605T (pt) 2014-05-01 2020-12-18 Ionis Pharmaceuticals Inc Composições e métodos para modulação da expressão de angiopoietina de tipo 3
GB201408623D0 (en) 2014-05-15 2014-07-02 Santaris Pharma As Oligomers and oligomer conjugates
GB201410693D0 (en) 2014-06-16 2014-07-30 Univ Southampton Splicing modulation
PL3169353T3 (pl) 2014-07-16 2020-06-01 Sanofi Biotechnology SPOSOBY LECZENIA PACJENTÓW Z HETEROZYGOTYCZNĄ HIPERCHOLESTEROLEMIĄ RODZINNĄ (heFH)
US10329570B2 (en) * 2014-07-31 2019-06-25 Academia Sinica Antagonistic PD-1 aptamer and its applications in cancer therapy related applications
WO2016024205A1 (en) 2014-08-15 2016-02-18 Pfizer Inc. Oligomers targeting hexanucleotide repeat expansion in human c9orf72 gene
CA2958524A1 (en) * 2014-08-20 2016-02-25 Lifesplice Pharma Llc Splice modulating oligonucleotides and methods of use thereof
EP3191591A1 (en) 2014-09-12 2017-07-19 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting complement component c5 and methods of use thereof
KR20170062466A (ko) 2014-09-16 2017-06-07 리제너론 파마슈티칼스 인코포레이티드 항-글루카곤 항체 및 그것의 사용
CN107109411B (zh) 2014-10-03 2022-07-01 冷泉港实验室 核基因输出的定向增加
WO2016055601A1 (en) 2014-10-10 2016-04-14 F. Hoffmann-La Roche Ag Galnac phosphoramidites, nucleic acid conjugates thereof and their use
WO2016061487A1 (en) 2014-10-17 2016-04-21 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting aminolevulinic acid synthase-1 (alas1) and uses thereof
CA2966044A1 (en) 2014-10-30 2016-05-06 The General Hospital Corporation Methods for modulating atrx-dependent gene repression
EP3212794B1 (en) 2014-10-30 2021-04-07 Genzyme Corporation Polynucleotide agents targeting serpinc1 (at3) and methods of use thereof
US10266895B2 (en) 2014-11-05 2019-04-23 Hitachi Chemical Company Ltd. Exosomes and microvesicles in intestinal luminal fluids and stool and use of same for the assessment of inflammatory bowel disease
US10370719B2 (en) 2014-11-12 2019-08-06 Hitachi Chemical Co., Ltd. Method and device for diagnosing organ injury
CA3193811A1 (en) 2014-11-14 2016-05-19 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (als)
CN107208092B (zh) 2014-12-16 2021-09-10 罗氏创新中心哥本哈根有限公司 手性毒性筛选方法
SG11201705223XA (en) 2014-12-27 2017-07-28 Bonac Corp NATURALLY OCCURING miRNA FOR CONTROLLING GENE EXPRESSION, AND USE OF SAME
AU2016215155A1 (en) 2015-02-04 2017-08-17 F. Hoffmann-La Roche Ag Tau antisense oligomers and uses thereof
EP3254104B1 (en) 2015-02-04 2021-08-25 Bristol-Myers Squibb Company Methods of selecting therapeutic molecules
WO2016130943A1 (en) 2015-02-13 2016-08-18 Rana Therapeutics, Inc. Hybrid oligonucleotides and uses thereof
WO2016149455A2 (en) 2015-03-17 2016-09-22 The General Hospital Corporation The rna interactome of polycomb repressive complex 1 (prc1)
WO2016154629A1 (en) 2015-03-26 2016-09-29 Woman & Infants' Hospital Of Rhode Island Therapy for malignant disease
JP6602847B2 (ja) 2015-03-27 2019-11-06 株式会社ボナック デリバリー機能と遺伝子発現制御能を有する一本鎖核酸分子
WO2016164746A1 (en) 2015-04-08 2016-10-13 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the lect2 gene
RS60230B1 (sr) 2015-04-16 2020-06-30 Ionis Pharmaceuticals Inc Kompozicije za moduliranje ekspresije c9orf72
WO2016205323A1 (en) 2015-06-18 2016-12-22 Alnylam Pharmaceuticals, Inc. Polynucleotde agents targeting hydroxyacid oxidase (glycolate oxidase, hao1) and methods of use thereof
US20180188257A1 (en) 2015-06-19 2018-07-05 University Of Rochester Septin proteins as novel biomarkers for detection and treatment of müllerian cancers
CA2991894A1 (en) 2015-07-10 2017-01-19 Ionis Pharmaceuticals, Inc. Modulators of diacyglycerol acyltransferase 2 (dgat2)
JP2018523684A (ja) 2015-08-18 2018-08-23 リジェネロン・ファーマシューティカルズ・インコーポレイテッドRegeneron Pharmaceuticals, Inc. リポタンパク質アフェレーシスを受けている高脂血症の患者を治療するための抗pcsk9阻害抗体
DE112016003948T5 (de) 2015-08-31 2018-05-09 City Of Sapporo Molekulare verfahren zum beurteilen einer urothelialen erkrankung
JP7014721B2 (ja) 2015-09-18 2022-02-01 ディーエヌエーアールエックス インビボでの核酸発現のためのシステム及び方法
EP3359685B1 (en) 2015-10-09 2026-01-28 University Of Southampton Modulation of gene expression for deregulated protein expression
WO2017070151A1 (en) 2015-10-19 2017-04-27 Rxi Pharmaceuticals Corporation Reduced size self-delivering nucleic acid compounds targeting long non-coding rna
EP3394258B1 (en) 2015-10-22 2021-09-22 Roche Innovation Center Copenhagen A/S In vitro toxicity screening assay
US11260073B2 (en) 2015-11-02 2022-03-01 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating C90RF72
AU2016349625B2 (en) 2015-11-06 2022-07-07 Ionis Pharmaceuticals, Inc. Modulating apolipoprotein (a) expression
HUE067905T2 (hu) 2015-11-12 2024-11-28 Hoffmann La Roche Oligonukleotidok paternális UBE3A expresszió indukálására
EP3933041B1 (en) 2015-12-14 2024-01-31 Cold Spring Harbor Laboratory Antisense oligomers for treatment of autosomal dominant retardation
US11096956B2 (en) 2015-12-14 2021-08-24 Stoke Therapeutics, Inc. Antisense oligomers and uses thereof
WO2017142054A1 (ja) 2016-02-17 2017-08-24 国立大学法人東京工業大学 人工ヌクレオシド及び人工ヌクレオチド並びに人工オリゴヌクレオチド
CA3016592A1 (en) 2016-03-04 2017-09-08 Rhode Island Hospital Targeting microrna for cancer treatment
KR20250065735A (ko) 2016-03-14 2025-05-13 에프. 호프만-라 로슈 아게 Pd-l1 발현의 감소를 위한 올리고뉴클레오티드
EP3442983A1 (en) 2016-04-14 2019-02-20 H. Hoffnabb-La Roche Ag TRITYL-MONO-Ga1NAc COMPOUNDS AND THEIR USE
SG10201913477UA (en) 2016-04-29 2020-02-27 Univ Nanyang Tech G-quadruplex-containing antisense oligonucleotides
CN109311925B (zh) * 2016-05-12 2022-06-03 罗氏创新中心哥本哈根有限公司 立体限定的氧杂氮杂磷杂环戊烷亚磷酰胺单体与核苷或寡核苷酸的增强的偶联
US11105794B2 (en) 2016-06-17 2021-08-31 Hoffmann-La Roche Inc. In vitro nephrotoxicity screening assay
WO2017216325A1 (en) 2016-06-17 2017-12-21 F. Hoffmann-La Roche Ag In vitro nephrotoxicity screening assay
CN109414448B (zh) 2016-06-17 2021-10-26 豪夫迈·罗氏有限公司 用于减少PAPD5或PAPD7 mRNA治疗乙型肝炎感染的核酸分子
EP3517610A4 (en) 2016-09-23 2020-05-27 National University Corporation Tokyo Medical and Dental University THROUGH HETERODUPLEX NUCLEIC ACID THROUGH BLOOD BRAIN CABINET
US11260134B2 (en) 2016-09-29 2022-03-01 National University Corporation Tokyo Medical And Dental University Double-stranded nucleic acid complex having overhang
ES2963428T3 (es) * 2016-09-29 2024-03-27 Biogen Ma Inc Compuestos y métodos para reducir la expresión de Tau
US20190248888A1 (en) 2016-10-20 2019-08-15 Regeneron Pharmaceuticals, Inc. Methods of lowering blood glucose levels
WO2018085656A1 (en) * 2016-11-03 2018-05-11 Ohio State Innovation Foundation Antisense oligomers targeting hoxb-as3 long non-coding rna
US20190345495A1 (en) 2017-01-13 2019-11-14 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides for modulating nfkb2 expression
WO2018130582A1 (en) 2017-01-13 2018-07-19 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides for modulating rel expression
WO2018130585A1 (en) 2017-01-13 2018-07-19 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides for modulating relb expression
US20200216845A1 (en) 2017-01-13 2020-07-09 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides for modulating rela expression
US20190367920A1 (en) 2017-01-13 2019-12-05 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides for modulating nfkb1 expression
CN110337495B (zh) 2017-02-06 2024-03-29 日产化学株式会社 单链寡核苷酸
WO2018155450A1 (ja) * 2017-02-21 2018-08-30 国立大学法人大阪大学 アンチセンスオリゴ核酸
US11180756B2 (en) 2017-03-09 2021-11-23 Ionis Pharmaceuticals Morpholino modified oligomeric compounds
EP3600428A4 (en) 2017-03-23 2020-08-26 Dnarx SYSTEMS AND METHODS FOR THE EXPRESSION OF NUCLEIC ACIDS IN VIVO
JOP20190215A1 (ar) * 2017-03-24 2019-09-19 Ionis Pharmaceuticals Inc مُعدّلات التعبير الوراثي عن pcsk9
WO2018181428A1 (ja) 2017-03-29 2018-10-04 塩野義製薬株式会社 核酸医薬及び多分岐脂質の複合体
NO344051B1 (en) * 2017-05-04 2019-08-26 Patogen As Novel virus in Fish and Method for detection
EP3618839A4 (en) 2017-05-05 2021-06-09 Voyager Therapeutics, Inc. COMPOSITIONS AND METHODS OF TREATMENT OF AMYOTROPHIC LATERAL SCLEROSIS (ALS)
US11273222B2 (en) 2017-05-26 2022-03-15 National Cerebral And Cardiovascular Center Antisense nucleic acid targeting PCSK9
WO2019004420A1 (ja) 2017-06-30 2019-01-03 国立大学法人東京医科歯科大学 ヘテロ二本鎖型antimiR
AU2018307294B2 (en) 2017-07-26 2025-04-17 Nissan Chemical Corporation Single-stranded oligonucleotide
SG11202001590RA (en) 2017-08-25 2020-03-30 Stoke Therapeutics Inc Antisense oligomers for treatment of conditions and diseases
UA126931C2 (uk) 2017-10-16 2023-02-22 Ф. Хоффманн-Ля Рош Аг МОЛЕКУЛИ НУКЛЕЇНОВИХ КИСЛОТ ДЛЯ ЗМЕНШЕННЯ РІВНЯ мРНК PAPD5 І PAPD7 ДЛЯ ЛІКУВАННЯ ІНФЕКЦІЙНОГО ГЕПАТИТУ B
WO2019079242A1 (en) 2017-10-16 2019-04-25 Voyager Therapeutics, Inc. TREATMENT OF AMYOTROPHIC LATERAL SCLEROSIS (ALS)
TW202413649A (zh) 2017-10-16 2024-04-01 美商航海家醫療公司 肌萎縮性脊髓側索硬化症(als)之治療
US20200385714A1 (en) 2017-12-11 2020-12-10 Roche Innovation Center Copenhagen A/S Oligonucleotides for modulating fndc3b expression
JP2021507253A (ja) 2017-12-21 2021-02-22 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft Htra1 rnaアンタゴニストについてのコンパニオン診断
WO2019122279A1 (en) 2017-12-22 2019-06-27 Roche Innovation Center Copenhagen A/S Oligonucleotides comprising a phosphorodithioate internucleoside linkage
WO2019122282A1 (en) 2017-12-22 2019-06-27 Roche Innovation Center Copenhagen A/S Gapmer oligonucleotides comprising a phosphorodithioate internucleoside linkage
CN111448316B (zh) 2017-12-22 2025-02-14 罗氏创新中心哥本哈根有限公司 新的硫代亚磷酰胺
US20210095274A1 (en) 2018-01-10 2021-04-01 Roche Innovation Center Copenhagen A/S Oligonucleotides for modulating pias4 expression
EA202091693A1 (ru) 2018-01-12 2021-04-14 Бристол-Маерс Сквибб Компани Антисмысловые олигонуклеотиды, целенаправленно воздействующие на альфа-синуклеин, и их применения
BR112020013994A2 (pt) 2018-01-12 2020-12-08 Bristol-Myers Squibb Company Oligonucleotídeos antissenso que direcionam alfa-sinucleína e seus usos
AU2019207859A1 (en) 2018-01-12 2020-07-02 Roche Innovation Center Copenhagen A/S Alpha-synuclein antisense oligonucleotides and uses thereof
US20210095275A1 (en) 2018-01-12 2021-04-01 Roche Innovation Center Copenhagen A/S Oligonucleotides for modulating gsk3b expression
CN111615558A (zh) 2018-01-17 2020-09-01 罗氏创新中心哥本哈根有限公司 用于调节erc1表达的寡核苷酸
WO2019145386A1 (en) 2018-01-26 2019-08-01 Roche Innovation Center Copenhagen A/S Oligonucleotides for modulating csnk1d expression
KR20200140805A (ko) 2018-02-21 2020-12-16 브리스톨-마이어스 스큅 컴퍼니 Camk2d 안티센스 올리고뉴클레오티드 및 그의 용도
JP7360170B2 (ja) 2018-02-28 2023-10-12 国立大学法人 東京医科歯科大学 虚血病変部位特異的な遺伝子治療法
EP3766972B1 (en) 2018-03-14 2025-04-23 Institute of Science Tokyo Nucleic acid complex
US11851654B2 (en) 2018-03-19 2023-12-26 National University Corporation Tokyo Medical And Dental University Nucleic acid with reduced toxicity
MX2020009765A (es) 2018-03-20 2021-01-08 Tokyo Inst Tech Oligonucleotido antisentido reducido en toxicidad.
JP7262816B2 (ja) 2018-03-22 2023-04-24 国立大学法人 東京医科歯科大学 ヘテロ核酸のbbb通過脂質リガンド
EP3775258A4 (en) 2018-03-28 2022-01-26 Board of Regents, The University of Texas System IDENTIFICATION OF EPIGENETIC ALTERATIONS IN DNA ISOLATED FROM EXOSOMES
MA52661A (fr) 2018-04-05 2021-02-17 Centre Leon Berard Utilisation d'inhibiteurs de fubp1 dans le traitement d'une infection par le virus de l'hépatite b
US12060558B2 (en) 2018-05-04 2024-08-13 Stoke Therapeutics, Inc. Methods and compositions for treatment of cholesteryl ester storage disease
JP7438135B2 (ja) 2018-05-09 2024-02-26 アイオーニス ファーマシューティカルズ, インコーポレーテッド Fxiの発現を低下させるための化合物及び方法
CA3103429A1 (en) * 2018-06-14 2019-12-19 Don W. Cleveland Compounds and methods for increasing stmn2 expression
US20210254103A1 (en) 2018-07-02 2021-08-19 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis and disorders associated with the spinal cord
SG11202012759XA (en) 2018-07-03 2021-01-28 Hoffmann La Roche Oligonucleotides for modulating tau expression
EP4512407A3 (en) 2018-07-13 2025-09-24 F. Hoffmann-La Roche AG Oligonucleotides for modulating rtel1 expression
US20210308170A1 (en) 2018-07-27 2021-10-07 Osaka University Composition for suppression of aging, prevention, amelioration, or treatment of an age-related disease or symptom, or extension of lifespan
US20210292358A1 (en) 2018-07-31 2021-09-23 Roche Innovation Center Copenhagen A/S Oligonucleotides comprising a phosphorotrithioate internucleoside linkage
EP3830101B1 (en) 2018-07-31 2025-11-19 Roche Innovation Center Copenhagen A/S Oligonucleotides comprising a phosphorotrithioate internucleoside linkage
US11911484B2 (en) 2018-08-02 2024-02-27 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US20220193250A1 (en) 2018-08-02 2022-06-23 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US12370264B1 (en) 2018-08-02 2025-07-29 Dyne Therapeutics, Inc. Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering oligonucleotide to a subject
US12097263B2 (en) 2018-08-02 2024-09-24 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US12018087B2 (en) 2018-08-02 2024-06-25 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of delivering oligonucleotide to a subject
WO2020077390A1 (en) * 2018-10-18 2020-04-23 Murdoch University Antisense therapy for ptp1b related conditions
CA3130431A1 (en) 2019-02-20 2020-08-27 Roche Innovation Center Copenhagen A/S Phosphonoacetate gapmer oligonucleotides
WO2020169696A1 (en) 2019-02-20 2020-08-27 Roche Innovation Center Copenhagen A/S Novel phosphoramidites
KR20210134003A (ko) 2019-02-27 2021-11-08 스톡 테라퓨틱스, 인크. 병태 및 질환의 치료를 위한 안티센스 올리고머
JP7530106B2 (ja) 2019-03-14 2024-08-07 レナセラピューティクス株式会社 Ihh発現を調節するための核酸複合体
EP3954395A4 (en) 2019-04-08 2023-06-28 National University Corporation Tokyo Medical and Dental University Pharmaceutical composition for muscle disease treatment
WO2021020412A1 (ja) 2019-07-30 2021-02-04 塩野義製薬株式会社 Murf1を標的とする核酸医薬
AU2020330133A1 (en) 2019-08-14 2022-03-17 Lonza Sales Ag Extracellular vesicle-ASO constructs targeting CEBP/beta
KR20220070433A (ko) 2019-08-14 2022-05-31 코디악 바이오사이언시즈, 인크. Stat6을 표적으로 하는 세포외 소포-aso 작제물
CA3147701A1 (en) 2019-08-14 2021-02-18 Codiak Biosciences, Inc. Extracellular vesicles with antisense oligonucleotides targeting kras
EP4013876A1 (en) 2019-08-14 2022-06-22 Codiak BioSciences, Inc. Extracellular vesicle-nlrp3 antagonist
CA3147366A1 (en) 2019-08-14 2021-02-18 Adam T. BOUTIN Extracellular vesicles with stat3-antisense oligonucleotides
EP4013767A4 (en) 2019-08-15 2023-10-25 Ionis Pharmaceuticals, Inc. Linkage modified oligomeric compounds and uses thereof
EP4019088A4 (en) * 2019-08-23 2024-01-17 National University Corporation Tokai National Higher Education and Research System INHIBITOR OF RNA ACTION AND ITS USE
US20220370491A1 (en) 2019-09-18 2022-11-24 National University Corporation Tokyo Medical And Dental University Nucleic acid complex
EP4034247A1 (en) 2019-09-25 2022-08-03 Codiak BioSciences, Inc. Sting agonist comprising exosomes for treating neuroimmunological disorders
JP7793144B2 (ja) 2019-10-11 2026-01-05 国立大学法人東京科学大学 修飾ヘテロ核酸
CN114828852A (zh) 2019-12-24 2022-07-29 豪夫迈·罗氏有限公司 用于治疗hbv的靶向hbv的抗病毒药剂和/或免疫调节剂的药物组合
EP4081639A1 (en) 2019-12-24 2022-11-02 F. Hoffmann-La Roche AG Pharmaceutical combination of a therapeutic oligonucleotide targeting hbv and a tlr7 agonist for treatment of hbv
EP4098747A4 (en) 2020-01-31 2025-03-26 Sanwa Kagaku Kenkyusho Co., Ltd. ATN1 ANTISENSE OLIGONUCLEOTIDE
JPWO2021177418A1 (https=) 2020-03-04 2021-09-10
WO2021184021A1 (en) 2020-03-13 2021-09-16 Codiak Biosciences, Inc. Extracellular vesicle-aso constructs targeting pmp22
WO2021184020A1 (en) 2020-03-13 2021-09-16 Codiak Biosciences, Inc. Methods of treating neuroinflammation
US20230174981A1 (en) 2020-03-16 2023-06-08 National University Corporation Tokyo Medical And Dental University Heteronucleic acid containing morpholino nucleic acid
EP4121534A1 (en) 2020-03-18 2023-01-25 Alnylam Pharmaceuticals, Inc. Compositions and methods for treating subjects having a heterozygous alanine-glyoxylate aminotransferase gene (agxt) variant
BR112022022889A2 (pt) 2020-05-11 2023-04-04 Stoke Therapeutics Inc Oligômeros antissentido de opa1 para tratamento de condições e doenças
US12534493B2 (en) 2020-06-15 2026-01-27 Liid Pharmaceuticals, Inc. Bridged nucleoside and nucleotide
WO2022076596A1 (en) 2020-10-06 2022-04-14 Codiak Biosciences, Inc. Extracellular vesicle-aso constructs targeting stat6
WO2022081725A1 (en) * 2020-10-16 2022-04-21 The Scripps Research Institute Therapeutic uses of glucocorticoids with anabolic effects in skeletal muscle
US11987795B2 (en) 2020-11-24 2024-05-21 The Broad Institute, Inc. Methods of modulating SLC7A11 pre-mRNA transcripts for diseases and conditions associated with expression of SLC7A11
CR20230308A (es) 2020-12-11 2023-09-08 Civi Biopharma Inc Entrega oral de conjugados antisentido que tienen por blanco a pcsk9
US20250304966A1 (en) 2020-12-23 2025-10-02 Argonaute RNA Limited Treatment of cardiovascular disease
US20240117356A1 (en) 2020-12-31 2024-04-11 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
JP2024512236A (ja) 2021-02-17 2024-03-19 ロンザ セールス アーゲー 細胞外ベシクル-nlrp3アンタゴニスト
IL305873A (en) 2021-04-01 2023-11-01 Lonza Sales Ag Extracellular vesicle compositions
US20240240183A1 (en) 2021-05-25 2024-07-18 National University Corporation Tokyo Medical And Dental University Heteronucleic acid containing scpBNA or AmNA
CN118369428A (zh) 2021-05-29 2024-07-19 强新科技国际研究院 作为新型基因沉默技术的短双链体dna及其应用
CN117858946A (zh) 2021-05-29 2024-04-09 强新科技国际研究院 作为新型基因沉默技术的非对称短双链体dna及其应用
CA3222167A1 (en) 2021-05-31 2022-12-08 Rena Therapeutics Inc. Ligand-binding nucleic acid complex
US11969475B2 (en) 2021-07-09 2024-04-30 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US11633498B2 (en) 2021-07-09 2023-04-25 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US11638761B2 (en) 2021-07-09 2023-05-02 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating Facioscapulohumeral muscular dystrophy
WO2023003805A1 (en) 2021-07-19 2023-01-26 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder
CA3228120A1 (en) 2021-08-04 2023-02-09 The University Of Tokyo Hairpin nucleic acid composition
US20250339459A1 (en) 2021-08-19 2025-11-06 National University Corporation Tokyo Medical And Dental University Modified heteronucleic acid containing morpholino nucleic acid
US20240390508A1 (en) 2021-08-21 2024-11-28 Takeda Pharmaceutical Company Limited Human transferrin receptor binding peptide-drug conjugate
JP2024532476A (ja) * 2021-09-02 2024-09-05 モレキュラー アクシオム エルエルシー Nlrp3またはnlrp1発現を調節するための組成物及び方法
WO2023041508A2 (en) 2021-09-14 2023-03-23 Argonaute RNA Limited Treatment of cardiovascular disease
WO2023042876A1 (ja) 2021-09-15 2023-03-23 国立大学法人東京医科歯科大学 2'-修飾ヌクレオシドを含むヘテロ核酸
AU2022345881A1 (en) 2021-09-20 2024-03-21 Alnylam Pharmaceuticals, Inc. Inhibin subunit beta e (inhbe) modulator compositions and methods of use thereof
JPWO2023080159A1 (https=) 2021-11-02 2023-05-11
CA3234478A1 (en) 2021-11-11 2023-05-19 Souphalone LUANGSAY Pharmaceutical combinations for treatment of hbv
DE102021131135A1 (de) 2021-11-26 2023-06-01 Zf Cv Systems Global Gmbh Funkkommunikationsmodul und Verfahren zum Absetzen eines Notrufs per Funkkommunikation
EP4448106A1 (en) 2021-12-17 2024-10-23 Hoffmann-La Roche Inc. Combination of oligonucleotides for modulating rtel1 and fubp1
EP4493570A2 (en) 2022-03-16 2025-01-22 Empirico Inc. Galnac compositions for improving sirna bioavailability
KR20240163743A (ko) 2022-03-28 2024-11-19 엠피리코 인크. 변형된 올리고뉴클레오티드
US20250339553A1 (en) 2022-04-15 2025-11-06 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating myotonic dystrophy
IL318625A (en) 2022-07-29 2025-03-01 Regeneron Pharma Compositions and methods for transferrin receptor (TFR)-mediated delivery to brain and muscle
EP4581143A1 (en) 2022-08-29 2025-07-09 University of Rochester Antisense oligonucleotide-based anti-fibrotic therapeutics
EP4340411A1 (en) 2022-09-19 2024-03-20 Cellnex Italia S.p.A System for monitoring the operating state of the emergency call service into tunnels
JPWO2024071099A1 (https=) 2022-09-29 2024-04-04
WO2024098061A2 (en) 2022-11-04 2024-05-10 Genkardia Inc. Oligonucleotide-based therapeutics targeting cyclin d2 for the treatment of heart failure
IL320016A (en) 2022-11-04 2025-06-01 Regeneron Pharma Calcium voltage-gated channel auxiliary subunit gamma 1 (cacng1) binding proteins and cacng1-mediated delivery to skeletal muscle
AU2023379457A1 (en) 2022-11-14 2025-05-15 Regeneron Pharmaceuticals, Inc. Compositions and methods for fibroblast growth factor receptor 3-mediated delivery to astrocytes
JP2026507051A (ja) 2023-02-21 2026-02-27 ブイアイビー ブイゼットダブリュ シナプトギリン-3発現を調節するためのオリゴヌクレオチド
WO2024175586A2 (en) 2023-02-21 2024-08-29 Vib Vzw Inhibitors of synaptogyrin-3 expression
WO2024226761A2 (en) 2023-04-26 2024-10-31 Voyager Therapeutics, Inc. Compositions and methods for treating amyotrophic lateral sclerosis
WO2025047953A1 (ja) 2023-08-30 2025-03-06 株式会社Stratoimmune RasGRP4のアンチセンスオリゴヌクレオチド
WO2025264554A1 (en) 2024-06-17 2025-12-26 Pepgen Inc. Antisense oligonucleotide conjugates targeting peripheral myelin protein 22 (pmp22) and methods of use thereof
WO2026041784A1 (en) 2024-08-23 2026-02-26 Vib Vzw Oligonucleotides for modulating synaptogyrin-3 expression
US12503702B1 (en) * 2024-09-25 2025-12-23 Wyvern Pharmaceuticals Inc. Composition for regulating production of interfering ribonucleic acid

Family Cites Families (261)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US469863A (en) * 1892-03-01 John marks
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US5132418A (en) * 1980-02-29 1992-07-21 University Patents, Inc. Process for preparing polynucleotides
US4500707A (en) * 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US4458066A (en) * 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4973679A (en) 1981-03-27 1990-11-27 University Patents, Inc. Process for oligonucleo tide synthesis using phosphormidite intermediates
US4668777A (en) * 1981-03-27 1987-05-26 University Patents, Inc. Phosphoramidite nucleoside compounds
US4415732A (en) 1981-03-27 1983-11-15 University Patents, Inc. Phosphoramidite compounds and processes
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
USRE34069E (en) 1983-08-18 1992-09-15 Biosyntech Gmbh Process for the preparation of oligonucleotides
DE3329892A1 (de) 1983-08-18 1985-03-07 Köster, Hubert, Prof. Dr., 2000 Hamburg Verfahren zur herstellung von oligonucleotiden
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
FR2567892B1 (fr) * 1984-07-19 1989-02-17 Centre Nat Rech Scient Nouveaux oligonucleotides, leur procede de preparation et leurs applications comme mediateurs dans le developpement des effets des interferons
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
FR2575751B1 (fr) 1985-01-08 1987-04-03 Pasteur Institut Nouveaux nucleosides de derives de l'adenosine, leur preparation et leurs applications biologiques
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5405938A (en) * 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
DE3788914T2 (de) * 1986-09-08 1994-08-25 Ajinomoto Kk Verbindungen zur Spaltung von RNS an eine spezifische Position, Oligomere, verwendet bei der Herstellung dieser Verbindungen und Ausgangsprodukte für die Synthese dieser Oligomere.
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
AU598946B2 (en) 1987-06-24 1990-07-05 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5712257A (en) 1987-08-12 1998-01-27 Hem Research, Inc. Topically active compositions of mismatched dsRNAs
US4924624A (en) * 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
ATE151467T1 (de) * 1987-11-30 1997-04-15 Univ Iowa Res Found Durch modifikationen an der 3'-terminalen phosphodiesterbindung stabilisierte dna moleküle, ihre verwendung als nukleinsäuresonden sowie als therapeutische mittel zur hemmung der expression spezifischer zielgene
US5403711A (en) * 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
IE61148B1 (en) 1988-03-10 1994-10-05 Ici Plc Method of detecting nucleotide sequences
WO1989009221A1 (en) 1988-03-25 1989-10-05 University Of Virginia Alumni Patents Foundation Oligonucleotide n-alkylphosphoramidates
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) * 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5134066A (en) * 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5591722A (en) * 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
ATE269870T1 (de) 1989-10-24 2004-07-15 Isis Pharmaceuticals Inc 2'-modifizierte oligonukleotide
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US6005087A (en) 1995-06-06 1999-12-21 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5587470A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5872232A (en) 1990-01-11 1999-02-16 Isis Pharmaceuticals Inc. 2'-O-modified oligonucleotides
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
GB9009980D0 (en) * 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
ES2116977T3 (es) * 1990-05-11 1998-08-01 Microprobe Corp Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente.
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5386023A (en) 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
BR9106702A (pt) * 1990-07-27 1993-06-08 Isis Pharmaceuticals Inc Analogo de oligonucleotideos e processos para modular a producao de uma proteina por um organismo e para tratar um organismo
US5489677A (en) * 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5610289A (en) * 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5623070A (en) * 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5223618A (en) 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
US5608046A (en) * 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
ES2083593T3 (es) 1990-08-03 1996-04-16 Sterling Winthrop Inc Compuestos y metodos para inhibir la expresion de genes.
US6852536B2 (en) 2001-12-18 2005-02-08 Isis Pharmaceuticals, Inc. Antisense modulation of CD36L 1 expression
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5214134A (en) * 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
CA2092002A1 (en) 1990-09-20 1992-03-21 Mark Matteucci Modified internucleoside linkages
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5220006A (en) 1990-10-23 1993-06-15 The United States Of America As Represented By The Department Of Health And Human Services Identification of a suppressor of atherogenic apolipoprotein
US6582908B2 (en) * 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5604115A (en) 1990-12-21 1997-02-18 The Rockefeller University Liver enriched transcription factor
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
US5965722A (en) 1991-05-21 1999-10-12 Isis Pharmaceuticals, Inc. Antisense inhibition of ras gene with chimeric and alternating oligonucleotides
US5578444A (en) 1991-06-27 1996-11-26 Genelabs Technologies, Inc. Sequence-directed DNA-binding molecules compositions and methods
WO1993001286A2 (en) 1991-06-28 1993-01-21 Massachusetts Institute Of Technology Localized oligonucleotide therapy
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5877009A (en) 1991-08-16 1999-03-02 Trustees Of Boston University Isolated ApoA-I gene regulatory sequence elements
DE4129653A1 (de) 1991-09-06 1993-03-11 Boehringer Mannheim Gmbh Verfahren zum nachweis aehnlicher nukleinsaeuren
US5408038A (en) 1991-10-09 1995-04-18 The Scripps Research Institute Nonnatural apolipoprotein B-100 peptides and apolipoprotein B-100-apolipoprotein A-I fusion peptides
EP0538194B1 (de) 1991-10-17 1997-06-04 Novartis AG Bicyclische Nukleoside, Oligonukleotide, Verfahren zu deren Herstellung und Zwischenprodukte
US5594121A (en) * 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
AU3222793A (en) * 1991-11-26 1993-06-28 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
TW393513B (en) 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
CA2124795A1 (en) 1991-12-23 1993-07-08 Ray Sanchez-Pescador Chlamydiae probes for use in solution phase sandwich hybridization assays
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
FR2687679B1 (fr) 1992-02-05 1994-10-28 Centre Nat Rech Scient Oligothionucleotides.
US5633360A (en) * 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
FR2692265B1 (fr) 1992-05-25 1996-11-08 Centre Nat Rech Scient Composes biologiquement actifs de type phosphotriesters.
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
NL9300058A (nl) 1992-06-18 1994-01-17 Stichting Rega V Z W 1,5-anhydrohexitol nucleoside analoga en farmaceutisch gebruik daarvan.
EP0577558A2 (de) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte
US5652355A (en) * 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
CA2140542A1 (en) 1992-07-27 1994-02-03 Abeysingle Padmapriya Oligonucleotide alkylphosphonothioates
US6180403B1 (en) 1999-10-28 2001-01-30 Isis Pharmaceuticals Inc. Antisense inhibition of tumor necrosis factor alpha converting enzyme (TACE) expression
EP0673559A1 (en) 1992-12-14 1995-09-27 Honeywell Inc. Motor system with individually controlled redundant windings
KR960701077A (ko) 1993-01-25 1996-02-24 다알렌 반스톤 올리고누클레오티드 알킬포스포네이트 및 알킬포스포노티오에이트(oligonucleotide alkylphosphonates and alkylphosphonothioates)
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5434058A (en) 1993-02-09 1995-07-18 Arch Development Corporation Apolipoprotein B MRNA editing protein compositions and methods
IL108340A (en) * 1993-03-04 1996-10-16 Innova Sa Citric acid extraction
GB9304620D0 (en) * 1993-03-06 1993-04-21 Ciba Geigy Ag Compounds
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
AU6449394A (en) 1993-03-30 1994-10-24 Sterling Winthrop Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
JPH08508490A (ja) 1993-03-31 1996-09-10 スターリング ウィンスロップ インコーポレイティド 新規5’−置換ヌクレオシド及びそれから得られるオリゴマー
CA2159629A1 (en) 1993-03-31 1994-10-13 Sanofi Oligonucleotides with amide linkages replacing phosphodiester linkages
DE4311944A1 (de) 1993-04-10 1994-10-13 Degussa Umhüllte Natriumpercarbonatpartikel, Verfahren zu deren Herstellung und sie enthaltende Wasch-, Reinigungs- und Bleichmittelzusammensetzungen
FR2705099B1 (fr) 1993-05-12 1995-08-04 Centre Nat Rech Scient Oligonucléotides phosphorothioates triesters et procédé de préparation.
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US6235470B1 (en) 1993-11-12 2001-05-22 The Johns Hopkins University School Of Medicine Detection of neoplasia by analysis of saliva
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
EP0733059B1 (en) 1993-12-09 2000-09-13 Thomas Jefferson University Compounds and methods for site-directed mutations in eukaryotic cells
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) * 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) * 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) * 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5646269A (en) 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US6103890A (en) 1994-05-18 2000-08-15 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids that cleave C-fos
US5525711A (en) * 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5656612A (en) 1994-05-31 1997-08-12 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of raf gene expression
US5485908A (en) * 1994-07-12 1996-01-23 Coin Acceptors, Inc. Pattern recognition using artificial neural network for coin validation
US5618065A (en) * 1994-07-21 1997-04-08 Hitachi Metals, Ltd. Electric welding pipe joint having a two layer outer member
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5792747A (en) 1995-01-24 1998-08-11 The Administrators Of The Tulane Educational Fund Highly potent agonists of growth hormone releasing hormone
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
KR0185334B1 (ko) 1995-11-02 1999-04-01 김은영 인간 혈장 아포지단백질 비-100에 결합하는 생쥐 항체를 암호하는 씨디엔에이
JP2000507943A (ja) 1996-03-26 2000-06-27 グラクソ、グループ、リミテッド 腫瘍壊死因子αコンバーターゼ
ES2192672T3 (es) 1996-11-18 2003-10-16 Takeshi Imanishi Nuevos analogos de nucleotidos.
WO1998036641A1 (en) 1997-02-20 1998-08-27 The Schepens Eye Research Institute, Inc. Control of il4 production as a therapeutic regulator of immune function
US6770748B2 (en) * 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
JP3756313B2 (ja) * 1997-03-07 2006-03-15 武 今西 新規ビシクロヌクレオシド及びオリゴヌクレオチド類縁体
US6133246A (en) 1997-08-13 2000-10-17 Isis Pharmaceuticals Inc. Antisense oligonucleotide compositions and methods for the modulation of JNK proteins
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
AU9063398A (en) 1997-09-12 1999-04-05 Exiqon A/S Oligonucleotide analogues
GB9721240D0 (en) 1997-10-08 1997-12-03 Zeneca Ltd Assay
US6156315A (en) 1997-10-10 2000-12-05 The Trustees Of Columbia University In The City Of New York Method for inhibiting the binding of low density lipoprotein to blood vessel matrix
EP0911344B1 (en) 1997-10-15 2004-03-03 Fujirebio Inc. Anti-Apo-B-48 monoclonal antibody, hybridoma, and methods of use
JP2002500039A (ja) 1998-01-08 2002-01-08 アベンティス ファーマスーティカルズ プロダクツ インコーポレイテッド 機能あるヒトリポタンパク質(a)を発現するトランスジェニックウサギ
US6238921B1 (en) 1998-03-26 2001-05-29 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of human mdm2 expression
US6949367B1 (en) 1998-04-03 2005-09-27 Epoch Pharmaceuticals, Inc. Modified oligonucleotides for mismatch discrimination
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6300319B1 (en) 1998-06-16 2001-10-09 Isis Pharmaceuticals, Inc. Targeted oligonucleotide conjugates
US6007995A (en) 1998-06-26 1999-12-28 Isis Pharmaceuticals Inc. Antisense inhibition of TNFR1 expression
US6043352A (en) 1998-08-07 2000-03-28 Isis Pharmaceuticals, Inc. 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides
EP0979869A1 (en) * 1998-08-07 2000-02-16 Hoechst Marion Roussel Deutschland GmbH Short oligonucleotides for the inhibition of VEGF expression
US6410323B1 (en) 1999-08-31 2002-06-25 Isis Pharmaceuticals, Inc. Antisense modulation of human Rho family gene expression
US5945290A (en) 1998-09-18 1999-08-31 Isis Pharmaceuticals, Inc. Antisense modulation of RhoA expression
US6172216B1 (en) 1998-10-07 2001-01-09 Isis Pharmaceuticals Inc. Antisense modulation of BCL-X expression
CZ296576B6 (cs) 1999-02-12 2006-04-12 Sankyo Company Limited Nukleosidový analog a oligonukleotidový analog a farmaceutický prostredek, sonda a primer s jeho obsahem
US7084125B2 (en) 1999-03-18 2006-08-01 Exiqon A/S Xylo-LNA analogues
RU2001128165A (ru) 1999-03-18 2004-03-27 Эксикон А/С (Dk) Выявление мутаций в генах посредством специфичных lna-праймеров
ATE314488T1 (de) 1999-03-18 2006-01-15 Exiqon As Einstufige probezubereitung und bestimmung von nukleinsäure in biologischen proben
US6436640B1 (en) 1999-03-18 2002-08-20 Exiqon A/S Use of LNA in mass spectrometry
US6140124A (en) 1999-04-06 2000-10-31 Isis Pharmaceuticals Inc. Antisense modulation of P38 mitogen activated protein kinase expression
US20040171566A1 (en) 1999-04-06 2004-09-02 Monia Brett P. Antisense modulation of p38 mitogen activated protein kinase expression
US5998148A (en) 1999-04-08 1999-12-07 Isis Pharmaceuticals Inc. Antisense modulation of microtubule-associated protein 4 expression
EP1178999B1 (en) * 1999-05-04 2007-03-14 Santaris Pharma A/S L-ribo-lna analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US6033910A (en) 1999-07-19 2000-03-07 Isis Pharmaceuticals Inc. Antisense inhibition of MAP kinase kinase 6 expression
JP4151751B2 (ja) * 1999-07-22 2008-09-17 第一三共株式会社 新規ビシクロヌクレオシド類縁体
WO2001012789A2 (en) 1999-08-18 2001-02-22 Baylor College Of Medicine APOLIPOPROTEIN B mRNA-SPECIFIC RIBOZYME
SK287400B6 (sk) 1999-09-25 2010-08-09 University Of Iowa Research Foundation Prostriedok s obsahom imunostimulačnej nukleovej kyseliny a jeho použitie na stimuláciu imunitnej reakcie
US20020068709A1 (en) 1999-12-23 2002-06-06 Henrik Orum Therapeutic uses of LNA-modified oligonucleotides
AU2911601A (en) 1999-12-23 2001-07-03 Bristol-Myers Squibb Company Novel immunoglobulin superfamily members apex-1, apex-2 and apex-3 and uses thereof
US20020055479A1 (en) 2000-01-18 2002-05-09 Cowsert Lex M. Antisense modulation of PTP1B expression
US7179796B2 (en) * 2000-01-18 2007-02-20 Isis Pharmaceuticals, Inc. Antisense modulation of PTP1B expression
US6261840B1 (en) 2000-01-18 2001-07-17 Isis Pharmaceuticals, Inc. Antisense modulation of PTP1B expression
US6602857B1 (en) * 2000-01-18 2003-08-05 Isis Pharmaceuticals, Inc. Antisense modulation of PTP1B expression
JP2003520042A (ja) 2000-01-24 2003-07-02 アイシス・ファーマシューティカルス・インコーポレーテッド 誘導性一酸化窒素シンターゼ発現のアンチセンスモジュレーション
US20030064950A1 (en) 2001-02-23 2003-04-03 Ntambi James M. Methods for reducing body fat and increasing lean body mass by reducing stearoyl-CoA desaturase 1 activity
JP2004509604A (ja) 2000-03-28 2004-04-02 アイシス・ファーマシューティカルス・インコーポレーテッド mRNAプロセッシングのアンチセンスモジュレーションによる、細胞行動の改変
AU2001250572A1 (en) 2000-04-07 2001-10-23 Epigenomics Ag Detection of single nucleotide polymorphisms (snp's) and cytosine-methylations
WO2001079555A2 (en) 2000-04-14 2001-10-25 Millennium Pharmaceuticals, Inc. Roles of jak/stat family members in tolerance induction
WO2002018388A1 (fr) 2000-08-29 2002-03-07 Takeshi Imanishi Analogues de nucleosides et derives d'oligonucleotides renfermant ces analogues
US20040024144A1 (en) * 2000-09-14 2004-02-05 Robert Solomon Aqueous dispersions of comb copolymers and coatings produced therefrom
WO2002026768A2 (en) 2000-09-29 2002-04-04 Genaissance Pharmaceuticals, Inc. Haplotypes of the por gene
US6426220B1 (en) 2000-10-30 2002-07-30 Isis Pharmaceuticals, Inc. Antisense modulation of calreticulin expression
US20030008373A1 (en) 2001-04-17 2003-01-09 Myriad Genetics, Incorporated APOA1-interacting proteins and use thereof
JP2002355074A (ja) 2001-01-24 2002-12-10 Univ Tsukuba 腸管出血性病原性大腸菌o157:h7に特異的な核酸分子およびポリペプチド並びにこれらの使用方法
EP1239051A3 (en) 2001-01-30 2004-03-17 Aeomica, Inc. Human posh-like protein 1
US6660737B2 (en) 2001-05-04 2003-12-09 The Procter & Gamble Company Medicinal uses of hydrazones
US6878729B2 (en) 2001-05-04 2005-04-12 The Procter & Gamble Company Medicinal uses of dihydropyrazoles
AU2002317437A1 (en) 2001-05-18 2002-12-03 Cureon A/S Therapeutic uses of lna-modified oligonucleotides in infectious diseases
US20050019915A1 (en) 2001-06-21 2005-01-27 Bennett C. Frank Antisense modulation of superoxide dismutase 1, soluble expression
US6964950B2 (en) 2001-07-25 2005-11-15 Isis Pharmaceuticals, Inc. Antisense modulation of C-reactive protein expression
US7425545B2 (en) * 2001-07-25 2008-09-16 Isis Pharmaceuticals, Inc. Modulation of C-reactive protein expression
US7888324B2 (en) 2001-08-01 2011-02-15 Genzyme Corporation Antisense modulation of apolipoprotein B expression
US7407943B2 (en) 2001-08-01 2008-08-05 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein B expression
AU2002334307A1 (en) 2001-09-04 2003-03-18 Exiqon A/S Novel lna compositions and uses thereof
US7297485B2 (en) 2001-10-15 2007-11-20 Qiagen Gmbh Method for nucleic acid amplification that results in low amplification bias
WO2003074740A1 (en) 2002-03-01 2003-09-12 Ravgen, Inc. Rapid analysis of variations in a genome
WO2003085110A2 (en) 2002-04-05 2003-10-16 Santaris Pharma A/S Oligomeric compounds for the modulation hif-1alpha expression
US7569575B2 (en) 2002-05-08 2009-08-04 Santaris Pharma A/S Synthesis of locked nucleic acid derivatives
WO2003097662A1 (en) 2002-05-15 2003-11-27 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein b expression
WO2003099215A2 (en) 2002-05-20 2003-12-04 Pharmacia Corporation Antisense modulation of glucocorticoid receptor expression
US7393950B2 (en) 2002-08-29 2008-07-01 Hong Kong University Of Science & Technology Antisense oligonucleotides targeted to human CDC45
US20040219565A1 (en) 2002-10-21 2004-11-04 Sakari Kauppinen Oligonucleotides useful for detecting and analyzing nucleic acids of interest
CA2505090A1 (en) 2002-11-05 2004-05-27 Isis Pharmaceuticals, Inc. Conjugated oligomeric compounds and their use in gene modulation
AU2003287505A1 (en) * 2002-11-05 2004-06-03 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds and their use in gene modulation
CA2504694C (en) 2002-11-05 2013-10-01 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
EP2336318B1 (en) * 2002-11-13 2013-04-24 Genzyme Corporation Antisense modulation of apolipoprotein b expression
US20060009410A1 (en) 2002-11-13 2006-01-12 Crooke Rosanne M Effects of apolipoprotein B inhibition on gene expression profiles in animals
US7511131B2 (en) 2002-11-13 2009-03-31 Genzyme Corporation Antisense modulation of apolipoprotein B expression
EP2305812A3 (en) * 2002-11-14 2012-06-06 Dharmacon, Inc. Fuctional and hyperfunctional sirna
US9045518B2 (en) * 2002-11-18 2015-06-02 Santaris Pharma A/S Amino-LNA, thio-LNA and alpha-L-oxy-LN
BR0317929A (pt) 2003-01-03 2006-04-11 Bristol Myers Squibb Co métodos de produzir inibidores de sglt2 de glicosìdeo de c-arila
US20040185559A1 (en) * 2003-03-21 2004-09-23 Isis Pharmaceuticals Inc. Modulation of diacylglycerol acyltransferase 1 expression
US7598227B2 (en) 2003-04-16 2009-10-06 Isis Pharmaceuticals Inc. Modulation of apolipoprotein C-III expression
DK1620544T3 (en) * 2003-04-17 2019-01-14 Alnylam Pharmaceuticals Inc MODIFIED iRNA AGENTS
US7399853B2 (en) 2003-04-28 2008-07-15 Isis Pharmaceuticals Modulation of glucagon receptor expression
US7750142B2 (en) 2003-04-28 2010-07-06 Isis Pharmaceuticals, Inc. Modulation of glucagon receptor expression
CA2524761A1 (en) 2003-05-12 2005-02-10 Union Carbide Chemicals & Plastics Technology Corporation Process for control of polymer fines in a gas-phase polymerization
JP2005060664A (ja) 2003-07-31 2005-03-10 Asahi Glass Co Ltd 含フッ素化合物、含フッ素ポリマーとその製造方法およびそれを含むレジスト組成物
US7683036B2 (en) 2003-07-31 2010-03-23 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of small non-coding RNAs
US7825235B2 (en) 2003-08-18 2010-11-02 Isis Pharmaceuticals, Inc. Modulation of diacylglycerol acyltransferase 2 expression
EP1661905B9 (en) * 2003-08-28 2012-12-19 IMANISHI, Takeshi Novel artificial nucleic acids of n-o bond crosslinkage type
US20050053981A1 (en) * 2003-09-09 2005-03-10 Swayze Eric E. Gapped oligomeric compounds having linked bicyclic sugar moieties at the termini
US20050074801A1 (en) 2003-09-09 2005-04-07 Monia Brett P. Chimeric oligomeric compounds comprising alternating regions of northern and southern conformational geometry
WO2005027962A1 (en) 2003-09-18 2005-03-31 Isis Pharmaceuticals, Inc. 4’-thionucleosides and oligomeric compounds
EP1687410A4 (en) 2003-10-07 2008-04-09 Isis Pharmaceuticals Inc ANTISENSE OLIGONUCLEOTIDE OPTIMIZED FOR KIDNEY TARGETING
US20050191653A1 (en) 2003-11-03 2005-09-01 Freier Susan M. Modulation of SGLT2 expression
ES2403937T3 (es) 2003-11-13 2013-05-22 Isis Pharmaceuticals, Inc. Derivados de 5,6-dihidroxi-isoindol como conectores para la síntesis de oligómeros en fase sólida
RU2377301C2 (ru) 2003-12-23 2009-12-27 Сантарис Фарма А/С ОЛИГОМЕРНОЕ СОЕДИНЕНИЕ, ПОНИЖАЮЩЕЕ ЭКСПРЕССИЮ ЧЕЛОВЕЧЕСКОГО ГЕНА Bcl-2, КОНЪЮГАТ, ФАРМАЦЕВТИЧЕСКАЯ КОМПОЗИЦИЯ И ПРИМЕНЕНИЕ ОЛИГОМЕРНОГО СОЕДИНЕНИЯ ДЛЯ ЛЕЧЕНИЯ РАКА
US20050164271A1 (en) * 2004-01-20 2005-07-28 Sanjay Bhanot Modulation of glucocorticoid receptor expression
US20050287558A1 (en) 2004-05-05 2005-12-29 Crooke Rosanne M SNPs of apolipoprotein B and modulation of their expression
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
AU2005252663B2 (en) 2004-06-03 2011-07-07 Isis Pharmaceuticals, Inc. Double strand compositions comprising differentially modified strands for use in gene modulation
ATE510914T1 (de) 2004-07-02 2011-06-15 Avi Biopharma Inc Antisinn antibakterielle verfahren und verbindungen
PL1786472T3 (pl) 2004-08-10 2013-06-28 Kastle Therapeutics Llc Antysensowna modulacja ekspresji apolipoproteiny B
EP2397563A3 (en) 2004-09-17 2012-07-18 Isis Pharmaceuticals, Inc. Enhanced antisense oligonucleotides
AR051446A1 (es) 2004-09-23 2007-01-17 Bristol Myers Squibb Co Glucosidos de c-arilo como inhibidores selectivos de transportadores de glucosa (sglt2)
KR20070095882A (ko) 2004-11-09 2007-10-01 산타리스 팔마 에이/에스 Lna 올리고뉴클레오티드 및 암의 치료
AU2005304112B2 (en) 2004-11-09 2009-06-04 Roche Innovation Center Copenhagen A/S Potent LNA oligonucleotides for the inhibition of HIF-1a expression
AU2006291836B2 (en) 2005-09-15 2012-02-23 Santaris Pharma A/S RNA antagonist compounds for the inhibition of Apo-Bl00 expression
BRPI0616370A2 (pt) * 2005-09-19 2011-06-14 Johnson & Johnson Pharmaceutical Res & Dev L L C modulaÇço da expressço de receptor de glucocorticàide
WO2007035771A2 (en) 2005-09-19 2007-03-29 Johnson & Johnson Pharmaceutical Research & Development, L.L.C. Modulation of glucagon receptor expression
JP5342881B2 (ja) 2006-01-27 2013-11-13 アイシス ファーマシューティカルズ, インコーポレーテッド 6−修飾された二環式核酸類似体
CA2648132C (en) 2006-04-03 2019-05-28 Santaris Pharma A/S Pharmaceutical composition comprising anti-mirna antisense oligonucleotides
US20070238698A1 (en) * 2006-04-07 2007-10-11 Hsien-Chih Lin Method for manufacturing drinking water having chitosan
EP2023940B1 (en) 2006-05-05 2011-06-22 Isis Pharmaceuticals, Inc. Compounds and methods for modulating expression of sglt2
JP2007311707A (ja) * 2006-05-22 2007-11-29 Ushio Inc 紫外線発光素子パッケージ
ES2603379T3 (es) 2006-10-09 2017-02-27 Roche Innovation Center Copenhagen A/S Compuestos antagonistas de ARN para la modulación de PCSK9
WO2008049085A1 (en) 2006-10-18 2008-04-24 Isis Pharmaceuticals, Inc. Antisense compounds
CN101679979A (zh) 2007-03-24 2010-03-24 基酶有限公司 施用与人载脂蛋白b互补的反义寡核苷酸

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
None
See also references of EP2019692A4

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
US10329318B2 (en) 2008-12-02 2019-06-25 Wave Life Sciences Ltd. Method for the synthesis of phosphorus atom modified nucleic acids
US9394333B2 (en) 2008-12-02 2016-07-19 Wave Life Sciences Japan Method for the synthesis of phosphorus atom modified nucleic acids
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10280192B2 (en) 2011-07-19 2019-05-07 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10590413B2 (en) 2012-07-13 2020-03-17 Wave Life Sciences Ltd. Chiral control
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US9598458B2 (en) 2012-07-13 2017-03-21 Wave Life Sciences Japan, Inc. Asymmetric auxiliary group
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
EP3406718A1 (en) 2012-11-15 2018-11-28 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugates
US10077443B2 (en) 2012-11-15 2018-09-18 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugates
US11155816B2 (en) 2012-11-15 2021-10-26 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugates
WO2014076195A1 (en) 2012-11-15 2014-05-22 Santaris Pharma A/S Oligonucleotide conjugates
WO2014118267A1 (en) 2013-01-30 2014-08-07 Santaris Pharma A/S Lna oligonucleotide carbohydrate conjugates
US12291709B2 (en) 2013-05-01 2025-05-06 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein (a) expression
US10883104B2 (en) 2013-05-01 2021-01-05 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein (a) expression
US9181549B2 (en) 2013-05-01 2015-11-10 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US9714421B2 (en) 2013-05-01 2017-07-25 Ionis Pharmaceuticals, Inc. Compositions and methods
US9127276B2 (en) 2013-05-01 2015-09-08 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US11299736B1 (en) 2013-05-01 2022-04-12 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US11851655B2 (en) 2013-05-01 2023-12-26 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating apolipoprotein (a) expression
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10793862B2 (en) 2014-05-01 2020-10-06 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US11312964B2 (en) 2014-05-01 2022-04-26 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US9994855B2 (en) 2014-05-01 2018-06-12 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating growth hormone receptor expression
US10570169B2 (en) 2014-05-22 2020-02-25 Ionis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
US11634710B2 (en) 2015-07-22 2023-04-25 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US12486505B2 (en) 2015-07-22 2025-12-02 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US11400161B2 (en) 2016-10-06 2022-08-02 Ionis Pharmaceuticals, Inc. Method of conjugating oligomeric compounds
EP4035659A1 (en) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes for delivery of therapeutic agents

Also Published As

Publication number Publication date
JP2009536037A (ja) 2009-10-08
ATE514777T1 (de) 2011-07-15
JP5372745B2 (ja) 2013-12-18
WO2007143317A3 (en) 2008-06-26
WO2007136988A8 (en) 2009-09-24
PT2015758E (pt) 2014-06-25
JP2014033674A (ja) 2014-02-24
WO2007143316A3 (en) 2008-06-26
US8673871B2 (en) 2014-03-18
US20090306180A1 (en) 2009-12-10
US8372967B2 (en) 2013-02-12
JP2016096826A (ja) 2016-05-30
EP2019692A2 (en) 2009-02-04
EP2019692B1 (en) 2014-06-04
US20130165496A1 (en) 2013-06-27
WO2007146511A2 (en) 2007-12-21
JP2009536039A (ja) 2009-10-08
US8188059B2 (en) 2012-05-29
CA3044969A1 (en) 2007-12-21
US20120208864A1 (en) 2012-08-16
WO2007131237A3 (en) 2008-11-13
ATE513912T1 (de) 2011-07-15
EP2015758B1 (en) 2014-04-02
EP2019692A4 (en) 2010-02-24
CA2651309A1 (en) 2007-12-21
AU2007253909A1 (en) 2007-11-29
AU2007253909B2 (en) 2012-08-09
AU2007258117A1 (en) 2007-12-21
CA2651042A1 (en) 2007-12-13
US20150057329A1 (en) 2015-02-26
JP5825754B2 (ja) 2015-12-02
CA2651309C (en) 2019-06-11
EP2023939A4 (en) 2009-04-29
EP2021472A2 (en) 2009-02-11
WO2007143315A3 (en) 2008-07-10
US20090326042A1 (en) 2009-12-31
KR20090034310A (ko) 2009-04-07
WO2007131237A2 (en) 2007-11-15
EP2397551A1 (en) 2011-12-21
JP5731115B2 (ja) 2015-06-10
EP2023939A2 (en) 2009-02-18
JP6272290B2 (ja) 2018-01-31
CN103554205A (zh) 2014-02-05
EP2363481B1 (en) 2017-04-12
MX2008014100A (es) 2009-02-25
WO2007143316A2 (en) 2007-12-13
HK1128418A1 (en) 2009-10-30
DK2021472T3 (da) 2011-09-19
US20110065775A1 (en) 2011-03-17
WO2007136989A3 (en) 2008-07-24
DK2363481T3 (en) 2017-06-26
US20150344879A1 (en) 2015-12-03
WO2007134014A2 (en) 2007-11-22
EP2458006B1 (en) 2018-06-20
AU2007257094B2 (en) 2012-10-25
ES2386578T3 (es) 2012-08-23
WO2007136988A3 (en) 2009-05-07
AU2007257094A1 (en) 2007-12-13
WO2007131238A3 (en) 2008-07-10
ES2471978T3 (es) 2014-06-27
EP2015758A4 (en) 2009-08-19
US20090306357A1 (en) 2009-12-10
US8362232B2 (en) 2013-01-29
AU2007257093A1 (en) 2007-12-13
EP2505646A1 (en) 2012-10-03
WO2007131238A8 (en) 2009-12-17
AU2007258117B2 (en) 2013-05-30
EP2023940A2 (en) 2009-02-18
EP2015758A2 (en) 2009-01-21
US20090306179A1 (en) 2009-12-10
JP2009536222A (ja) 2009-10-08
WO2007146511A8 (en) 2009-04-02
US20080015162A1 (en) 2008-01-17
US20090306005A1 (en) 2009-12-10
EP2023940B1 (en) 2011-06-22
EP2363481A1 (en) 2011-09-07
DK2019692T3 (da) 2014-07-14
US20090292006A1 (en) 2009-11-26
US8143230B2 (en) 2012-03-27
JP2009536664A (ja) 2009-10-15
DK2458006T3 (en) 2018-08-27
JP2009536038A (ja) 2009-10-08
WO2007143317A2 (en) 2007-12-13
WO2007134014A3 (en) 2009-04-09
US8586554B2 (en) 2013-11-19
WO2007131238A2 (en) 2007-11-15
WO2007146511A3 (en) 2008-06-12
DK2015758T3 (da) 2014-06-23
US9045754B2 (en) 2015-06-02
KR101441700B1 (ko) 2014-09-18
NO20084738L (no) 2009-01-20
US9617540B2 (en) 2017-04-11
EP2458006A1 (en) 2012-05-30
US8969316B2 (en) 2015-03-03
EP2021472B1 (en) 2011-06-29
EP2023940A4 (en) 2009-06-17
US20090326041A1 (en) 2009-12-31
WO2007136989A2 (en) 2007-11-29
EP2363482A1 (en) 2011-09-07
BRPI0711429A2 (pt) 2012-10-16
WO2007143315A2 (en) 2007-12-13
EP2023939B1 (en) 2012-06-27
US20090318532A1 (en) 2009-12-24

Similar Documents

Publication Publication Date Title
AU2007257094B2 (en) Compounds and methods for modulating expression of SGLT2
EP2527442A2 (en) Compounds and methods for modulating gene expression

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200780025416.7

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07811878

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2007253909

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2009510136

Country of ref document: JP

Ref document number: 4475/KOLNP/2008

Country of ref document: IN

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2007253909

Country of ref document: AU

Date of ref document: 20070507

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2007811878

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12299583

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0711429

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20081105