US20050287558A1 - SNPs of apolipoprotein B and modulation of their expression - Google Patents

SNPs of apolipoprotein B and modulation of their expression Download PDF

Info

Publication number
US20050287558A1
US20050287558A1 US11124020 US12402005A US2005287558A1 US 20050287558 A1 US20050287558 A1 US 20050287558A1 US 11124020 US11124020 US 11124020 US 12402005 A US12402005 A US 12402005A US 2005287558 A1 US2005287558 A1 US 2005287558A1
Authority
US
Grant status
Application
Patent type
Prior art keywords
oligonucleotide
antisense
invention
compounds
acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11124020
Inventor
Rosanne Crooke
Mark Graham
Steven Mah
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kastle Therapeutics LLC
Sequenom Inc
Original Assignee
Ionis Pharmaceuticals Inc
Sequenom Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Abstract

Compounds, compositions and methods are provided for modulating the expression of apolipoprotein B. The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein B. Methods of using these compounds for modulation of apolipoprotein B expression and for diagnosis and treatment of diseases and conditions associated with expression of apolipoprotein B are provided.

Description

    CROSS REFERENCE TO RELATED APPLICATIONS
  • [0001]
    This application claims the benefit of priority of U.S. Provisional Application Ser. No. 60/568,409, filed May 5, 2004, which is herein incorporated by reference in its entirety.
  • SEQUENCE LISTING
  • [0002]
    A paper copy of the sequence listing and a computer-readable form of the sequence listing, on diskette, containing the file named BIOL0021USSEQ.txt, which is 129,536 bytes and was created on May 5, 2005, are herein incorporated by reference.
  • FIELD OF THE INVENTION
  • [0003]
    The present invention provides compositions and methods for modulating the expression of variants of apolipoprotein B (apo B). In particular, this invention relates to antisense compounds, particularly oligonucleotide compounds, which, in preferred embodiments, hybridize with nucleic acid molecules encoding apolipoprotein B and containing SNPs.
  • BACKGROUND OF THE INVENTION
  • [0004]
    Natural genetic sequence variability exists between individuals in any and every population. Subtle alteration(s) in the primary nucleotide sequence of a gene encoding a pharmaceutically-important protein may be manifested as significant variation in expression, structure and/or function of the protein. Such alterations may explain the different response of individuals to therapy with a particular drug.
  • [0005]
    Variability in genetic sequence is particularly likely to cause a variable response to therapy when the therapeutic is an antisense compound that modulates the expression of protein through specific hybridization to the genetic sequence. In this case, changes in the sequence of the DNA or RNA can have a direct effect on the ability of such a compound to specifically hybridize.
  • [0006]
    Identification of polymorphisms among various populations is desirable to tailor design of suitable antisense therapeutics, select antisense therapeutics to administer to a particular population, and also predict responsiveness to therapeutics.
  • SUMMARY OF THE INVENTION
  • [0007]
    The present invention is directed to antisense compounds, especially nucleic acid and nucleic acid-like oligomers, which are targeted to a nucleic acid encoding apolipoprotein B, and which modulate the expression of apolipoprotein B. Pharmaceutical and other compositions comprising the compounds of the invention are also provided. Further provided are methods of screening for modulators of apolipoprotein B and methods of modulating the expression of apolipoprotein B in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more of the compounds or compositions of the invention. Methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of apolipoprotein B are also set forth herein. Such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention to the person in need of treatment.
  • DETAILED DESCRIPTION OF THE INVENTION
  • [0000]
    A. Overview of the Invention
  • [0008]
    The present invention employs antisense compounds, preferably oligonucleotides and similar species for use in modulating the function or effect of nucleic acid molecules encoding apolipoprotein B. This is accomplished by providing oligonucleotides which specifically hybridize with one or more nucleic acid molecules encoding apolipoprotein B. As used herein, the terms “target nucleic acid” and “nucleic acid molecule encoding apolipoprotein B” have been used for convenience to encompass DNA encoding apolipoprotein B, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA. The hybridization of a compound of this invention with its target nucleic acid is generally referred to as “antisense”. Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as “antisense inhibition.” Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.
  • [0009]
    The functions of DNA to be interfered with can include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise. The functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. One preferred result of such interference with target nucleic acid function is modulation of the expression of apolipoprotein B. In the context of the present invention, “modulation” and “modulation of expression” mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.
  • [0010]
    In the context of this invention, “hybridization” means the pairing of complementary strands of oligomeric compounds. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances.
  • [0011]
    An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
  • [0012]
    In the present invention the phrase “stringent hybridization conditions” or “stringent conditions” refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances and in the context of this invention, “stringent conditions” under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
  • [0013]
    “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound), is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.
  • [0014]
    It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). It is preferred that the antisense compounds of the present invention comprise at least 70%, or at least 75%, or at least 80%, or at least 85% sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise at least 90% sequence complementarity and even more preferably comprise at least 95% or at least 99% sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
  • [0015]
    Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489). In some preferred embodiments, homology, sequence identity or complementarity, between the oligomeric and target is between about 50% to about 60%. In some embodiments, homology, sequence identity or complementarity, is between about 60% to about 70%. In preferred embodiments, homology, sequence identity or complementarity, is between about 70% and about 80%. In more preferred embodiments, homology, sequence identity or complementarity, is between about 80% and about 90%. In some preferred embodiments, homology, sequence identity or complementarity, is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100%.
  • [0000]
    B. Compounds of the Invention
  • [0016]
    According to the present invention, antisense compounds include antisense oligomeric compounds, antisense oligonucleotides, siRNAs, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid. As such, these compounds may be introduced in the form of single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops. Once introduced to a system, the compounds of the invention may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid.
  • [0017]
    One non-limiting example of such an enzyme is RNAse H, a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are “DNA-like” elicit RNAse H. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.
  • [0018]
    While the preferred form of antisense compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection to viral defense and transposon silencing.
  • [0019]
    The first evidence that dsRNA, also known as small interfering RNAs (siRNAs) could lead to gene silencing in animals came in 1995 from work in the nematode, Caenorhabditis elegans (Guo and Kempheus, Cell, 1995, 81, 611-620). Montgomery et al. have shown that the primary interference effects of dsRNA are posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507). The posttranscriptional antisense mechanism defined in Caenorhabditis elegans resulting from exposure to double-stranded RNA (dsRNA) has since been designated RNA interference (RNAi). This term has been generalized to mean antisense-mediated gene silencing involving the introduction of dsRNA leading to the sequence-specific reduction of endogenous targeted mRNA levels (Fire et al., Nature, 1998, 391, 806-811). Recently, it has been shown that it is, in fact, the single-stranded RNA oligomers of antisense polarity of the dsRNAs which are the potent inducers of RNAi (Tijsterman et al., Science, 2002, 295, 694-697).
  • [0020]
    The antisense compounds of the present invention also include modified compounds in which a different base is present at one or more of the nucleotide positions in the compound. For example, if the first nucleotide is an adenosine, modified compounds may be produced which contain thymidine, guanosine or cytidine at this position. This may be done at any of the positions of the antisense compound. These compounds are then tested using the methods described herein to determine their ability to inhibit expression of apolipoprotein B mRNA.
  • [0021]
    In the context of this invention, the term “oligomeric compound” refers to a polymer or oligomer comprising a plurality of monomeric units. In the context of this invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.
  • [0022]
    While oligonucleotides are a preferred form of the antisense compounds of this invention, the present invention comprehends other families of antisense compounds as well, including but not limited to oligonucleotide analogs and mimetics such as those described herein.
  • [0023]
    The antisense compounds in accordance with this invention preferably comprise from about 8 to about 80 nucleobases (i.e. from about 8 to about 80 linked nucleosides). One of ordinary skill in the art will appreciate that the invention embodies compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases in length.
  • [0024]
    In one preferred embodiment, the antisense compounds of the invention are 12 to 50 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleobases in length.
  • [0025]
    In another preferred embodiment, the antisense compounds of the invention are 15 to 30 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length.
  • [0026]
    Particularly preferred compounds are oligonucleotides from about 12 to about 50 nucleobases, even more preferably those comprising from about 15 to about 30 nucleobases.
  • [0027]
    Antisense compounds 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative antisense compounds are considered to be suitable antisense compounds as well.
  • [0028]
    Exemplary preferred antisense compounds include oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 5′-terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately upstream of the 5′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases). Similarly preferred antisense compounds are represented by oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 3′-terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately downstream of the 3′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases). It is also understood that preferred antisense compounds may be represented by oligonucleotide sequences that comprise at least 8 consecutive nucleobases from an internal portion of the sequence of an illustrative preferred antisense compound, and may extend in either or both directions until the oligonucleotide contains about 8 to about 80 nucleobases.
  • [0029]
    One having skill in the art armed with the preferred antisense compounds illustrated herein will be able, without undue experimentation, to identify further preferred antisense compounds.
  • [0000]
    C. Targets of the Invention
  • [0030]
    “Targeting” an antisense compound to a particular nucleic acid molecule, in the context of this invention, can be a multistep process. The process usually begins with the identification of a target nucleic acid whose function is to be modulated. This target nucleic acid may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target nucleic acid encodes apolipoprotein B.
  • [0031]
    The targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect, e.g., modulation of expression, will result. Within the context of the present invention, the term “region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Within regions of target nucleic acids are segments. “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid. “Sites,” as used in the present invention, are defined as positions within a target nucleic acid.
  • [0032]
    Since, as is known in the art, the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the “AUG codon,” the “start codon” or the “AUG start codon”. A minority of genes has a translation initiation codon having the RNA sequence 5′-GUG, 5′-UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo. Thus, the terms “translation initiation codon” and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, “start codon” and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding apolipoprotein B, regardless of the sequence(s) of such codons. It is also known in the art that a translation termination codon (or “stop codon”) of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively).
  • [0033]
    The terms “start codon region” and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon. Similarly, the terms “stop codon region” and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon. Consequently, the “start codon region” (or “translation initiation codon region”) and the “stop codon region” (or “translation termination codon region”) are all regions which may be targeted effectively with the antisense compounds of the present invention.
  • [0034]
    The open reading frame (ORF) or “coding region,” which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Within the context of the present invention, a preferred region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.
  • [0035]
    Other target regions include the 5′ untranslated region (5UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3′ untranslated region (3UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA (or corresponding nucleotides on the gene). The 5′ cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5′-most residue of the mRNA via a 5′-5′ triphosphate linkage. The 5′ cap region of an mRNA is considered to include the 5′ cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5′ cap region.
  • [0036]
    Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as “introns,” which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence, resulting in exon-exon junctions at the sites where exons are joined. Targeting exon-exon junctions can be useful in situations where the overproduction of a normal splice product is implicated in disease, or where the overproduction of an aberrant splice product is implicated in disease. Targeting splice sites, i.e., intron-exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as “fusion transcripts”. It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA.
  • [0037]
    It is also known in the art that alternative RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as “variants”. More specifically, “pre-mRNA variants” are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence.
  • [0038]
    Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller “mRNA variants”. Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as “alternative splice variants”. If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.
  • [0039]
    It is also known in the art that variants can be produced through the use of alternative signals to start or stop transcription and that pre-mRNAs and mRNAs can possess more that one start codon or stop codon. Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as “alternative start variants” of that pre-mRNA or mRNA. Those transcripts that use an alternative stop codon are known as “alternative stop variants” of that pre-mRNA or mRNA. One specific type of alternative stop variant is the “polyA variant” in which the multiple transcripts produced result from the alternative selection of one of the “polyA stop signals” by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites. Within the context of the invention, the types of variants described herein are also preferred target nucleic acids.
  • [0040]
    The locations on the target nucleic acid to which the preferred antisense compounds hybridize are hereinbelow referred to as “preferred target segments.” As used herein the term “preferred target segment” is defined as at least an 8-nucleobase portion of a target region to which an active antisense compound is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic acid which are accessible for hybridization.
  • [0041]
    While the specific sequences of certain preferred target segments are set forth herein, one of skill in the art will recognize that these serve to illustrate and describe particular embodiments within the scope of the present invention. Additional preferred target segments may be identified by one having ordinary skill.
  • [0042]
    Target segments 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative preferred target segments are considered to be suitable for targeting as well.
  • [0043]
    Target segments can include DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 5′-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately upstream of the 5′-terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases). Similarly preferred target segments are represented by DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 3′-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately downstream of the 3 ′-terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases). It is also understood that preferred antisense target segments may be represented by DNA or RNA sequences that comprise at least 8 consecutive nucleobases from an internal portion of the sequence of an illustrative preferred target segment, and may extend in either or both directions until the oligonucleotide contains about 8 to about 80 nucleobases. One having skill in the art armed with the preferred target segments illustrated herein will be able, without undue experimentation, to identify further preferred target segments.
  • [0044]
    Once one or more target regions, segments or sites have been identified, antisense compounds are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
  • [0045]
    The oligomeric antisense compounds can also be targeted to regions of a target nucleobase sequence, such as those disclosed herein. All regions of the target nucleobase sequence to which an oligomeric antisense compound can be targeted, wherein the regions are greater than or equal to 8 and less than or equal to 80 nucleobases, are described as follows:
  • [0046]
    Let R(n, n+m−1) be a region from a target nucleobase sequence, where “n” is the 5′-most nucleobase position of the region, where “n+m−1” is the 3′-most nucleobase position of the region and where “m” is the length of the region. A set “S(m)”, of regions of length “m” is defined as the regions where n ranges from 1 to L−m+1, where L is the length of the target nucleobase sequence and L>m. A set, “A”, of all regions can be constructed as a union of the sets of regions for each length from where m is greater than or equal to 8 and is less than or equal to 80.
  • [0047]
    This set of regions can be represented using the following mathematical notation: A = m S ( m ) where m N 8 m 80 and S ( m ) = { R n , n + m - 1 n { 1 , 2 , 3 , , L - m + 1 } }
    where the mathematical operator | indicates “such that”,
    where the mathematical operator ε indicates “a member of a set” (e.g. y ε Z indicates that element y is a member of set Z),
    where x is a variable,
    where N indicates all natural numbers, defined as positive integers,
    and where the mathematical operator ∪ indicates “the union of sets”.
  • [0048]
    For example, the set of regions for m equal to 8, 9 and 80 can be constructed in the following manner. The set of regions, each 8 nucleobases in length, S(m=8), in a target nucleobase sequence 100 nucleobases in length (L=100), beginning at position 1 (n=1) of the target nucleobase sequence, can be created using the following expression:
    S(8)={R 1,8 |nε{1, 2, 3, . . . , 93}}
    and describes the set of regions comprising nucleobases 1-8, 2-9, 3-10, 4-11, 5-12, 6-13, 7-14, 8-15, 9-16, 10-17, 11-18, 12-19, 13-20, 14-21, 15-22, 16-23, 17-24, 18-25, 19-26, 20-27, 21-28, 22-29, 23-30, 24-31, 25-32, 26-33, 27-34, 28-35, 29-36, 30-37, 31-38, 32-39, 33-40, 34-41, 35-42, 36-43, 37-44, 38-45, 39-46, 40-47, 41-48, 42-49, 43-50, 44-51, 45-52, 46-53, 47-54, 48-55, 49-56, 50-57, 51-58, 52-59, 53-60, 54-61, 55-62, 56-63, 57-64, 58-65, 59-66, 60-67, 61-68, 62-69, 63-70, 64-71, 65-72, 66-73, 67-74, 68-75, 69-76, 70-77, 71-78, 72-79, 73-80, 74-81, 75-82, 76-83, 77-84, 78-85, 79-86, 80-87, 81-88, 82-89, 83-90, 84-91, 85-92, 86-93, 87-94, 88-95, 89-96, 90-97, 91-98, 92-99, 93-100.
  • [0049]
    An additional set for regions 20 nucleobases in length, in a target sequence 100 nucleobases in length, beginning at position 1 of the target nucleobase sequence, can be described using the following expression:
    S(20)={R 1,20 |nε{1, 2, 3, . . . , 81}}
    and describes the set of regions comprising nucleobases 1-20, 2-21, 3-22, 4-23, 5-24, 6-25, 7-26, 8-27, 9-28, 10-29, 11-30, 12-31, 13-32, 14-33, 15-34, 16-35, 17-36, 18-37, 19-38, 20-39, 21-40, 22-41, 23-42, 24-43, 25-44, 26-45, 27-46, 28-47, 29-48, 30-49, 31-50, 32-51, 33-52, 34-53, 35-54, 36-55, 37-56, 38-57, 39-58, 40-59, 41-60, 42-61, 43-62, 44-63, 45-64, 46-65, 47-66, 48-67, 49-68, 50-69, 51-70, 52-71, 53-72, 54-73, 55-74, 56-75, 57-76, 58-77, 59-78, 60-79, 61-80, 62-81, 63-82, 64-83, 65-84, 65-84, 66-85, 67-86, 68-87-69-88, 70-89, 71-90, 72-91, 73-92, 74-93, 75-94, 76-95, 77-96, 78-97, 79-98, 80-99, 81-100.
  • [0050]
    An additional set for regions 80 nucleobases in length, in a target sequence 100 nucleobases in length, beginning at position 1 of the target nucleobase sequence, can be described using the following expression:
    S(80)={R 1,80 |nε{1, 2, 3, . . . , 21}}
    and describes the set of regions comprising nucleobases 1-80, 2-81, 3-82, 4-83, 5-84, 6-85, 7-86, 8-87, 9-88, 10-89, 11-90, 12-91, 13-92, 14-93, 15-94, 16-95, 17-96, 18-97, 19-98, 20-99, 21-100.
  • [0051]
    Thus, in this example, A would include regions 1-8, 2-9, 3-10...93-100, 1-20, 2-21, 3-22 . . . 81-100, 1-80, 2-81, 3-82 . . . 21-100.
  • [0052]
    The union of these aforementioned example sets and other sets for lengths from 10 to 19 and 21 to 79 can be described using the mathematical expression A = m S ( m )
    where ∪ represents the union of the sets obtained by combining all members of all sets.
  • [0053]
    The mathematical expressions described herein defines all possible target regions in a target nucleobase sequence of any length L, where the region is of length m, and where m is greater than or equal to 8 and less than or equal to 80 nucleobases and, and where m is less than L, and where n is less than L−m+1.
  • [0000]
    D. Screening and Target Validation
  • [0054]
    In a further embodiment, the “preferred target segments” identified herein may be employed in a screen for additional compounds that modulate the expression of apolipoprotein B. “Modulators” are those compounds that decrease or increase the expression of a nucleic acid molecule encoding apolipoprotein B and which comprise at least an 8-nucleobase portion which is complementary to a preferred target segment. The screening method comprises the steps of contacting a preferred target segment of a nucleic acid molecule encoding apolipoprotein B with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding apolipoprotein B. Once it is shown that the candidate modulator or modulators are capable of modulating (e.g. either decreasing or increasing) the expression of a nucleic acid molecule encoding apolipoprotein B, the modulator may then be employed in further investigative studies of the function of apolipoprotein B, or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.
  • [0055]
    The preferred target segments of the present invention may be also be combined with their respective complementary antisense compounds of the present invention to form stabilized double-stranded (duplexed) oligonucleotides.
  • [0056]
    Such double stranded oligonucleotide moieties have been shown in the art to modulate target expression and regulate translation as well as RNA processsing via an antisense mechanism. Moreover, the double-stranded moieties may be subject to chemical modifications (Fire et al., Nature, 1998, 391, 806-811; Timmons and Fire, Nature 1998, 395, 854; Timmons et al., Gene, 2001, 263, 103-112; Tabara et al., Science, 1998, 282, 430-431; Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et al., Genes Dev., 1999, 13, 3191-3197; Elbashir et al., Nature, 2001, 411, 494-498; Elbashir et al., Genes Dev. 2001, 15, 188-200). For example, such double-stranded moieties have been shown to inhibit the target by the classical hybridization of antisense strand of the duplex to the target, thereby triggering enzymatic degradation of the target (Tijsterman et al., Science, 2002, 295, 694-697).
  • [0057]
    The antisense compounds of the present invention can also be applied in the areas of drug discovery and target validation. The present invention comprehends the use of the compounds and preferred target segments identified herein in drug discovery efforts to elucidate relationships that exist between apolipoprotein B and a disease state, phenotype, or condition. These methods include detecting or modulating apolipoprotein B comprising contacting a sample, tissue, cell, or organism with the compounds of the present invention, measuring the nucleic acid or protein level of apolipoprotein B and/or a related phenotypic or chemical endpoint at some time after treatment, and optionally comparing the measured value to a non-treated sample or sample treated with a further compound of the invention. These methods can also be performed in parallel or in combination with other experiments to determine the function of unknown genes for the process of target validation or to determine the validity of a particular gene product as a target for treatment or prevention of a particular disease, condition, or phenotype.
  • [0000]
    E. Kits, Research Reagents, Diagnostics, and Therapeutics
  • [0058]
    The antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits. Furthermore, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway.
  • [0059]
    For use in kits and diagnostics, the compounds of the present invention, either alone or in combination with other compounds or therapeutics, can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.
  • [0060]
    As one nonlimiting example, expression patterns within cells or tissues treated with one or more antisense compounds are compared to control cells or tissues not treated with antisense compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds which affect expression patterns.
  • [0061]
    Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett., 2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE (serial analysis of gene expression)(Madden, et al., Drug Discov. Today, 2000, 5, 415-425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999, 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), protein arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16; Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57), subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal. Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41, 203-208), subtractive cloning, differential display (DD) (Jurecic and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl., 1998, 31, 286-96), FISH (fluorescent in situ hybridization) techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35, 1895-904) and mass spectrometry methods (To, Comb. Chem. High Throughput Screen, 2000, 3, 235-41).
  • [0062]
    The antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding apolipoprotein B. For example, oligonucleotides that are shown to hybridize with such efficiency and under such conditions as disclosed herein as to be effective apolipoprotein B inhibitors will also be effective primers or probes under conditions favoring gene amplification or detection, respectively. These primers and probes are useful in methods requiring the specific detection of nucleic acid molecules encoding apolipoprotein B and in the amplification of said nucleic acid molecules for detection or for use in further studies of apolipoprotein B. Hybridization of the antisense oligonucleotides, particularly the primers and probes, of the invention with a nucleic acid encoding apolipoprotein B can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of apolipoprotein B in a sample may also be prepared.
  • [0063]
    The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense compounds have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Antisense oligonucleotide drugs, including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that antisense compounds can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
  • [0064]
    For therapeutics, an animal, preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of apolipoprotein B is treated by administering antisense compounds in accordance with this invention. For example, in one non-limiting embodiment, the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of an apolipoprotein B inhibitor. The apolipoprotein B inhibitors of the present invention effectively inhibit the activity of the apolipoprotein B protein or inhibit the expression of the apolipoprotein B protein. In one embodiment, the activity or expression of apolipoprotein B in an animal is inhibited by about 10%. Preferably, the activity or expression of apolipoprotein B in an animal is inhibited by about 30%. More preferably, the activity or expression of apolipoprotein B in an animal is inhibited by 50% or more. Thus, the oligomeric antisense compounds modulate expression of apolipoprotein B mRNA by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%.
  • [0065]
    For example, the reduction of the expression of apolipoprotein B may be measured in serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal. Preferably, the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding apolipoprotein B protein and/or the apolipoprotein B protein itself.
  • [0066]
    The antisense compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the compounds and methods of the invention may also be useful prophylactically.
  • [0000]
    F. Modifications
  • [0067]
    As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base sometimes referred to as a “nucleobase” or simply a “base”. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′,3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3′ to 5′ phosphodiester linkage.
  • [0000]
    Modified Internucleoside Linkages (Backbones)
  • [0068]
    Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • [0069]
    Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriaminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′,5′ to 5′ or 2′ to 2′ linkage. Preferred oligonucleotides having inverted polarity comprise a single 3′ to 3′ linkage at the 3′-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.
  • [0070]
    Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050.
  • [0071]
    Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
  • [0072]
    Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439.
  • [0000]
    Modified Sugar and Internucleoside Linkages-Mimetics
  • [0073]
    In other preferred antisense compounds, e.g., oligonucleotide mimetics, both the sugar and the internucleoside linkage (i.e. the backbone), of the nucleotide units are replaced with novel groups. The nucleobase units are maintained for hybridization with an appropriate target nucleic acid. One such compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
  • [0074]
    Preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH2—NH—O—CH2—, —CH2—N(CH3)—O—CH2— [known as a methylene (methylimino) or MMI backbone), —CH2—O—N(CH3)—CH2—, —CH2—N(CH3)—N(CH3)—CH2— and —O—N(CH3)—CH2—CH2— [wherein the native phosphodiester backbone is represented as —O—P—O—CH2—) of the above referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above referenced U.S. Pat. No. 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.
  • [0000]
    Modified Sugars
  • [0075]
    Modified antisense compounds may also contain one or more substituted sugar moieties. Preferred are antisense compounds, preferably antisense oligonucleotides, comprising one of the following at the 2′ position: OH; F; O—, S—, or N-alkyl; O—, S—, or N-alkenyl; O—, S— or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly preferred are O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2′ position: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2′-methoxyethoxy (2′-O—CH2CH2OCH3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2′-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2′-DMAOE, as described in examples hereinbelow, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O-dimethyl-amino-ethoxy-ethyl or 2′-DMAEOE), i.e., 2′-O—CH2—O—CH2—N(CH3)2, also described in examples hereinbelow.
  • [0076]
    Other preferred modifications include 2′-methoxy (2′-O—CH3), 2′-aminopropoxy (2′-OCH2CH2CH2NH2), 2′-allyl (2′-CH2—CH═CH2), 2′-O-allyl (2′-O—CH2—CH2) and 2′-fluoro (2′-F). The 2′-modification may be in the arabino (up) position or ribo (down) position. A preferred 2′-arabino modification is 2′-F. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide. Antisense compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920.
  • [0077]
    A further preferred modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 3′ or 4′ carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (—CH2—)n group bridging the 2′ oxygen atom and the 4′ carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.
  • [0000]
    Natural and Modified Nucleobases
  • [0078]
    Antisense compounds may also include nucleobase (often referred to in the art as heterocyclic base or simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C≡C—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl a 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3′,2′:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyl-adenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. and are presently preferred base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.
  • [0079]
    Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; 5,750,692; and 5,681,941.
  • [0000]
    Conjugates
  • [0080]
    Another modification of the antisense compounds of the invention involves chemically linking to the antisense compound one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, the entire disclosures of which are incorporated herein by reference. Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety. Antisense compounds of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodo-benzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15, 1999) which is incorporated herein by reference in its entirety.
  • [0081]
    Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.
  • [0000]
    Chimeric Compounds
  • [0082]
    It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide.
  • [0083]
    The present invention also includes antisense compounds which are chimeric compounds. “Chimeric” antisense compounds or “chimeras,” in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. Chimeric antisense oligonucleotides are thus a form of antisense compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, increased stability and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNAse H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. The cleavage of RNA:RNA hybrids can, in like fashion, be accomplished through the actions of endoribonucleases, such as RNAseL which cleaves both cellular and viral RNA. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • [0084]
    Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Chimeric antisense compounds can be of several different types. These include a first type wherein the “gap” segment of linked nucleosides is positioned between 5′ and 3′ “wing” segments of linked nucleosides and a second “open end” type wherein the “gap” segment is located at either the 3′ or the 5′ terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as “hemimers” or “wingmers”. Such compounds have also been referred to in the art as hybrids . In a gapmer that is 20 nucleotides in length, a gap or wing can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18 nucleotides in length. In one embodiment, a 20-nucleotide gapmer is comprised of a gap 8 nucleotides in length, flanked on both the 5′ and 3′ sides by wings 6 nucleotides in length. In another embodiment, a 20-nucleotide gapmer is comprised of a gap 10 nucleotides in length, flanked on both the 5′ and 3′ sides by wings 5 nucleotides in length. In another embodiment, a 20-nucleotide gapmer is comprised of a gap 12 nucleotides in length flanked on both the 5′ and 3′ sides by wings 4 nucleotides in length. In a further embodiment, a 20-nucleotide gapmer is comprised of a gap 14 nucleotides in length flanked on both the 5′ and 3′ sides by wings 3 nucleotides in length. In another embodiment, a 20-nucleotide gapmer is comprised of a gap 16 nucleotides in length flanked on both the 5′ and 3′ sides by wings 2 nucleotides in length. In a further embodiment, a 20-nucleotide gapmer is comprised of a gap 18 nucleotides in length flanked on both the 5′ and 3′ ends by wings 1 nucleotide in length. Alternatively, the wings are of different lengths, for example, a 20-nucleotide gapmer may be comprised of a gap 10 nucleotides in length, flanked by a 6-nucleotide wing on one side (5′ or 3′) and a 4-nucleotide wing on the other side (5′ or 3′). In a hemimer, an “open end” chimeric antisense compound, 20 nucleotides in length, a gap segment, located at either the 5′ or 3′ terminus of the oligomeric compound, can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides in length. For example, a 20-nucleotide hemimer can have a gap segment of 10 nucleotides at the 5′ end and a second segment of 10 nucleotides at the 3′ end. Alternatively, a 20-nucleotide hemimer can have a gap segment of 10 nucleotides at the 3′ end and a second segment of 10 nucleotides at the 5′ end.
  • [0085]
    Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922.
  • [0000]
    G. Formulations
  • [0086]
    The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756.
  • [0087]
    The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • [0088]
    The term “pharmaceutically acceptable salts” refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For oligonucleotides, preferred examples of pharmaceutically acceptable salts and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0089]
    The present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.
  • [0090]
    The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • [0091]
    The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
  • [0092]
    Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations. The pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.
  • [0093]
    Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Microemulsions are included as an embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0094]
    Formulations of the present invention include liposomal formulations. As used in the present invention, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
  • [0095]
    Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0096]
    The pharmaceutical formulations and compositions of the present invention may also include surfactants. The use of surfactants in drug products, formulations and in emulsions is well known in the art. Surfactants and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0097]
    In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Penetration enhancers and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0098]
    One of skill in the art will recognize that formulations are routinely designed according to their intended use, i.e. route of administration.
  • [0099]
    Preferred formulations for topical administration include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA).
  • [0100]
    For topical or other administration, oligonucleotides of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, oligonucleotides may be complexed to lipids, in particular to cationic lipids. Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Topical formulations are described in detail in U.S. patent application Ser. No. 09/315,298 filed on May 20, 1999, which is incorporated herein by reference in its entirety.
  • [0101]
    Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Preferred bile acids/salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Also preferred are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Oral formulations for oligonucleotides and their preparation are described in detail in U.S. applications Ser. No. 09/108,673 (filed Jul. 1, 1998), U.S. Ser. No. 09/315,298 (filed May 20, 1999) and Ser. No. 10/071,822, filed Feb. 8, 2002, each of which is incorporated herein by reference in their entirety.
  • [0102]
    Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • [0103]
    Oligonucleotides may be formulated for delivery in vivo in an acceptable dosage form, e.g. as parenteral or non-parenteral formulations. Parenteral formulations include intravenous (IV), subcutaneous (SC), intraperitoneal (IP), intravitreal and intramuscular (IM) formulations, as well as formulations for delivery via pulmonary inhalation, intranasal administration, topical administration, etc. Non-parenteral formulations include formulations for delivery via the alimentary canal, e.g. oral administration, rectal administration, intrajejunal instillation, etc. Rectal administration includes administration as an enema or a suppository. Oral administration includes administration as a capsule, a gel capsule, a pill, an elixir, etc.
  • [0104]
    In some embodiments, an oligonucleotide may be administered to a subject via an oral route of administration. The subject may be an animal or a human (man). An animal subject may be a mammal, such as a mouse, a rat, a dog, a guinea pig, a non-human primate, a cat or a pig. Non-human primates include monkeys and chimpanzees. A suitable animal subject may be an experimental animal, such as a mouse, a rat, a dog, a non-human primate, a cat or a pig.
  • [0105]
    In some embodiments, the subject may be a human. In certain embodiments, the subject may be a human patient in need of therapeutic treatment as discussed in more detail herein. In certain embodiments, the subject may be in need of modulation of expression of one or more genes as discussed in more detail herein. In some particular embodiments, the subject may be in need of inhibition of expression of one or more genes as discussed in more detail herein. In particular embodiments, the subject may be in need of modulation, i.e. inhibition or enhancement, of hepatic lipase in order to obtain therapeutic indications discussed in more detail herein.
  • [0106]
    In some embodiments, non-parenteral (e.g. oral) oligonucleotide formulations according to the present invention result in enhanced bioavailability of the oligonucleotide. In this context, the term “bioavailability” refers to a measurement of that portion of an administered drug which reaches the circulatory system (e.g. blood, especially blood plasma) when a particular mode of administration is used to deliver the drug. Enhanced bioavailability refers to a particular mode of administration's ability to deliver oligonucleotide to the peripheral blood plasma of a subject relative to another mode of administration. For example, when a non-parenteral mode of administration (e.g. an oral mode) is used to introduce the drug into a subject, the bioavailability for that mode of administration may be compared to a different mode of administration, e.g. an IV mode of administration. In some embodiments, the area under a compound's blood plasma concentration curve (AUC0) after non-parenteral (e.g. oral, rectal, intrajejunal) administration may be divided by the area under the drug's plasma concentration curve after intravenous (i.v.) administration (AUCiv) to provide a dimensionless quotient (relative bioavailability, RB) that represents fraction of compound absorbed via the non-parenteral route as compared to the IV route. A composition's bioavailability is said to be enhanced in comparison to another composition's bioavailability when the first composition's relative bioavailability (RB1) is greater than the second composition's relative bioavailability (RB2).
  • [0107]
    In general, bioavailability correlates with therapeutic efficacy when a compound's therapeutic efficacy is related to the blood concentration achieved, even if the drug's ultimate site of action is intracellular (van Berge-Henegouwen et al., Gastroenterol., 1977, 73, 300). Bioavailability studies have been used to determine the degree of intestinal absorption of a drug by measuring the change in peripheral blood levels of the drug after an oral dose (DiSanto, Chapter 76 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 1451-1458).
  • [0108]
    In general, an oral composition's bioavailability is said to be “enhanced” when its relative bioavailability is greater than the bioavailability of a composition substantially consisting of pure oligonucleotide, i.e. oligonucleotide in the absence of a penetration enhancer.
  • [0109]
    Organ bioavailability refers to the concentration of compound in an organ. Organ bioavailability may be measured in test subjects by a number of means, such as by whole-body radiography. Organ bioavailability may be modified, e.g. enhanced, by one or more modifications to the oligonucleotide, by use of one or more carrier compounds or excipients, etc. as discussed in more detail herein. In general, an increase in bioavailability will result in an increase in organ bioavailability.
  • [0110]
    Oral oligonucleotide compositions according to the present invention may comprise one or more “mucosal penetration enhancers,” also known as “absorption enhancers” or simply as “penetration enhancers.” Accordingly, some embodiments of the invention comprise at least one oligonucleotide in combination with at least one penetration enhancer. In general, a penetration enhancer is a substance that facilitates the transport of a drug across mucous membrane(s) associated with the desired mode of administration, e.g. intestinal epithelial membranes. Accordingly it is desirable to select one or more penetration enhancers that facilitate the uptake of an oligonucleotide, without interfering with the activity of the oligonucleotide, and in a such a manner the oligonucleotide can be introduced into the body of an animal without unacceptable side-effects such as toxicity, irritation or allergic response.
  • [0111]
    Embodiments of the present invention provide compositions comprising one or more pharmaceutically acceptable penetration enhancers, and methods of using such compositions, which result in the improved bioavailability of oligonucleotides administered via non-parenteral modes of administration. Heretofore, certain penetration enhancers have been used to improve the bioavailability of certain drugs. See Muranishi, Crit. Rev. Ther. Drug Carrier Systems, 1990, 7, 1 and Lee et al., Crit. Rev. Ther. Drug Carrier Systems, 1991, 8, 91. It has been found that the uptake and delivery of oligonucleotides, relatively complex molecules which are known to be difficult to administer to animals and man, can be greatly improved even when administered by non-parenteral means through the use of a number of different classes of penetration enhancers.
  • [0112]
    In some embodiments, compositions for non-parenteral administration include one or more modifications from naturally-occurring oligonucleotides (i.e. full-phosphodiester deoxyribosyl or full-phosphodiester ribosyl oligonucleotides). Such modifications may increase binding affinity, nuclease stability, cell or tissue permeability, tissue distribution, or other biological or pharmacokinetic property. Modifications may be made to the base, the linker, or the sugar, in general, as discussed in more detail herein with regards to oligonucleotide chemistry. In some embodiments of the invention, compositions for administration to a subject, and in particular oral compositions for administration to an animal or human subject, will comprise modified oligonucleotides having one or more modifications for enhancing affinity, stability, tissue distribution, or other biological property.
  • [0113]
    Suitable modified linkers include phosphorothioate linkers. In some embodiments according to the invention, the oligonucleotide has at least one phosphorothioate linker. Phosphorothioate linkers provide nuclease stability as well as plasma protein binding characteristics to the oligonucleotide. Nuclease stability is useful for increasing the in vivo lifetime of oligonucleotides, while plasma protein binding decreases the rate of first pass clearance of oligonucleotide via renal excretion. In some embodiments according to the present invention, the oligonucleotide has at least two phosphorothioate linkers. In some embodiments, wherein the oligonucleotide has exactly n nucleosides, the oligonucleotide has from one to n−1 phosphorothioate linkages. In some embodiments, wherein the oligonucleotide has exactly n nucleosides, the oligonucleotide has n−1 phosphorothioate linkages. In other embodiments wherein the oligonucleotide has exactly n nucleoside, and n is even, the oligonucleotide has from 1 to n/2 phosphorothioate linkages, or, when n is odd, from 1 to (n−1)/2 phosphorothioate linkages. In some embodiments, the oligonucleotide has alternating phosphodiester (PO) and phosphorothioate (PS) linkages. In other embodiments, the oligonucleotide has at least one stretch of two or more consecutive PO linkages and at least one stretch of two or more PS linkages. In other embodiments, the oligonucleotide has at least two stretches of PO linkages interrupted by at least on PS linkage.
  • [0114]
    In some embodiments, at least one of the nucleosides is modified on the ribosyl sugar unit by a modification that imparts nuclease stability, binding affinity or some other beneficial biological property to the sugar. In some cases, the sugar modification includes a 2′-modification, e.g. the 2′-OH of the ribosyl sugar is replaced or substituted. Suitable replacements for 2′-OH include 2′-F and 2′-arabino-F. Suitable substitutions for OH include 2′-O-alkyl, e.g. 2-O-methyl, and 2′-O-substituted alkyl, e.g. 2′-O-methoxyethyl, 2′-O-aminopropyl, etc. In some embodiments, the oligonucleotide contains at least one 2′-modification. In some embodiments, the oligonucleotide contains at least 2 2′-modifications. In some embodiments, the oligonucleotide has at least one 2′-modification at each of the termini (i.e. the 3′- and 5′-terminal nucleosides each have the same or different 2′-modifications). In some embodiments, the oligonucleotide has at least two sequential 2′-modifications at each end of the oligonucleotide. In some embodiments, oligonucleotides further comprise at least one deoxynucleoside. In particular embodiments, oligonucleotides comprise a stretch of deoxynucleosides such that the stretch is capable of activating RNase (e.g. RNase H) cleavage of an RNA to which the oligonucleotide is capable of hybridizing. In some embodiments, a stretch of deoxynucleosides capable of activating RNase-mediated cleavage of RNA comprises about 6 to about 16, e.g. about 8 to about 16 consecutive deoxynucleosides.
  • [0115]
    Oral compositions for administration of non-parenteral oligonucleotide compositions of the present invention may be formulated in various dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The term “alimentary delivery” encompasses e.g. oral, rectal, endoscopic and sublingual/buccal administration. A common requirement for these modes of administration is absorption over some portion or all of the alimentary tract and a need for efficient mucosal penetration of the nucleic acid(s) so administered.
  • [0116]
    Delivery of a drug via the oral mucosa, as in the case of buccal and sublingual administration, has several desirable features, including, in many instances, a more rapid rise in plasma concentration of the drug than via oral delivery (Harvey, Chapter 35 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, page 711).
  • [0117]
    Endoscopy may be used for drug delivery directly to an interior portion of the alimentary tract. For example, endoscopic retrograde cystopancreatography (ERCP) takes advantage of extended gastroscopy and permits selective access to the biliary tract and the pancreatic duct (Hirahata et al., Gan To Kagaku Ryoho, 1992, 19(10 Suppl), 1591). Pharmaceutical compositions, including liposomal formulations, can be delivered directly into portions of the alimentary canal, such as, e.g., the duodenum (Somogyi et al., Pharm. Res., 1995, 12, 149) or the gastric submucosa (Akamo et al., Japanese J. Cancer Res., 1994, 85, 652) via endoscopic means. Gastric lavage devices (Inoue et al., Artif Organs, 1997, 21, 28) and percutaneous endoscopic feeding devices (Pennington et al., Ailment Pharmacol. Ther., 1995, 9, 471) can also be used for direct alimentary delivery of pharmaceutical compositions.
  • [0118]
    In some embodiments, oligonucleotide formulations may be administered through the anus into the rectum or lower intestine. Rectal suppositories, retention enemas or rectal catheters can be used for this purpose and may be preferred when patient compliance might otherwise be difficult to achieve (e.g., in pediatric and geriatric applications, or when the patient is vomiting or unconscious). Rectal administration can result in more prompt and higher blood levels than the oral route. (Harvey, Chapter 35 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, page 711). Because about 50% of the drug that is absorbed from the rectum will bypass the liver, administration by this route significantly reduces the potential for first-pass metabolism (Benet et al., Chapter 1 In: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill, New York, N.Y., 1996).
  • [0119]
    One advantageous method of non-parenteral administration oligonucleotide compositions is oral delivery. Some embodiments employ various penetration enhancers in order to effect transport of oligonucleotides and other nucleic acids across mucosal and epithelial membranes. Penetration enhancers may be classified as belonging to one of five broad categories—surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Accordingly, some embodiments comprise oral oligonucleotide compositions comprising at least one member of the group consisting of surfactants, fatty acids, bile salts, chelating agents, and non-chelating surfactants. Further embodiments comprise oral oligonucleotide comprising at least one fatty acid, e.g. capric or lauric acid, or combinations or salts thereof. Other embodiments comprise methods of enhancing the oral bioavailability of an oligonucleotide, the method comprising co-administering the oligonucleotide and at least one penetration enhancer.
  • [0120]
    Other excipients that may be added to oral oligonucleotide compositions include surfactants (or “surface-active agents”), which are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the alimentary mucosa and other epithelial membranes is enhanced. In addition to bile salts and fatty acids, surfactants include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and perfluorohemical emulsions, such as FC-43 (Takahashi et al., J. Pharm. Phamacol., 1988, 40, 252).
  • [0121]
    Fatty acids and their derivatives which act as penetration enhancers and may be used in compositions of the present invention include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines and mono- and di-glycerides thereof and/or physiologically acceptable salts thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; El-Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651).
  • [0122]
    In some embodiments, oligonucleotide compositions for oral delivery comprise at least two discrete phases, which phases may comprise particles, capsules, gel-capsules, microspheres, etc. Each phase may contain one or more oligonucleotides, penetration enhancers, surfactants, bioadhesives, effervescent agents, or other adjuvant, excipient or diluent. In some embodiments, one phase comprises at least one oligonucleotide and at lease one penetration enhancer. In some embodiments, a first phase comprises at least one oligonucleotide and at least one penetration enhancer, while a second phase comprises at least one penetration enhancer. In some embodiments, a first phase comprises at least one oligonucleotide and at least one penetration enhancer, while a second phase comprises at least one penetration enhancer and substantially no oligonucleotide. In some embodiments, at least one phase is compounded with at least one degradation retardant, such as a coating or a matrix, which delays release of the contents of that phase. In some embodiments, a first phase comprises at least one oligonucleotide, at least one penetration enhancer, while a second phase comprises at least one penetration enhancer and a release-retardant. In particular embodiments, an oral oligonucleotide comprises a first phase comprising particles containing an oligonucleotide and a penetration enhancer, and a second phase comprising particles coated with a release-retarding agent and containing penetration enhancer.
  • [0123]
    A variety of bile salts also function as penetration enhancers to facilitate the uptake and bioavailability of drugs. The physiological roles of bile include the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38 In: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill, New York, N.Y., 1996, pages 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus, the term “bile salt” includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (CDCA, sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92, Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579).
  • [0124]
    In some embodiments, penetration enhancers useful in some embodiments of present invention are mixtures of penetration enhancing compounds. One such penetration enhancer is a mixture of UDCA (and/or CDCA) with capric and/or lauric acids or salts thereof e.g. sodium. Such mixtures are useful for enhancing the delivery of biologically active substances across mucosal membranes, in particular intestinal mucosa. Other penetration enhancer mixtures comprise about 5-95% of bile acid or salt(s) UDCA and/or CDCA with 5-95% capric and/or lauric acid. Particular penetration enhancers are mixtures of the sodium salts of UDCA, capric acid and lauric acid in a ratio of about 1:2:2 respectively. Anther such penetration enhancer is a mixture of capric and lauric acid (or salts thereof) in a 0.01:1 to 1:0.01 ratio (mole basis). In particular embodiments capric acid and lauric acid are present in molar ratios of e.g. about 0.1:1 to about 1:0.1, in particular about 0.5:1 to about 1:0.5.
  • [0125]
    Other excipients include chelating agents, i.e. compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucelotides through the alimentary and other mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315). Chelating agents of the invention include, but are not limited to, disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; Buur et al., J. Control Rel., 1990, 14, 43).
  • [0126]
    As used herein, non-chelating non-surfactant penetration enhancers may be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of oligonucleotides through the alimentary and other mucosal membranes (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1). This class of penetration enhancers includes, but is not limited to, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621).
  • [0127]
    Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), can be used.
  • [0128]
    Some oral oligonucleotide compositions also incorporate carrier compounds in the formulation. As used herein, “carrier compound” or “carrier” can refer to a nucleic acid, or analog thereof, which may be inert (i.e., does not possess biological activity per se) or may be necessary for transport, recognition or pathway activation or mediation, or is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4′isothiocyano-stilbene-2,2′-disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5, 115; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177).
  • [0129]
    A “pharmaceutical carrier” or “excipient” may be a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, EXPLOTAB); and wetting agents (e.g., sodium lauryl sulphate, etc.).
  • [0130]
    Oral oligonucleotide compositions may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipuritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the composition of present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention.
  • [0131]
    Certain embodiments of the invention provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophospharnide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
  • [0132]
    In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Alternatively, compositions of the invention may contain two or more antisense compounds targeted to different regions of the same nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
  • [0000]
    H. Dosing
  • [0133]
    The formulation of therapeutic compositions and their subsequent administration (dosing) is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 ug to 100 g per kg of body weight, from 0.1 μg to 10 g per kg of body weight, from 1.0 μg to 1 g kg of body weight, from 10.0 μg to 100 mg per kg of body weight, from 100 μg to 10 mg per kg of body weight, or from 1 mg to 5 mg per kg of body weight and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily, to once every 20 years.
  • [0134]
    The effects of treatments with therapeutic compositions can be assessed following collection of tissues or fluids from a patient or subject receiving said treatments. It is known in the art that a biopsy sample can be procured from certain tissues without resulting in detrimental effects to a patient or subject. In certain embodiments, a tissue and its constituent cells comprise, but are not limited to, blood (e.g., hematopoietic cells, such as human hematopoietic progenitor cells, human hematopoietic stem cells, CD34+ cells CD4+ cells), lymphocytes and other blood lineage cells, bone marrow, breast, cervix, colon, esophagus, lymph node, muscle, peripheral blood, oral mucosa and skin. In other embodiments, a fluid and its constituent cells comprise, but are not limited to, blood, urine, semen, synovial fluid, lymphatic fluid and cerebro-spinal fluid. Tissues or fluids procured from patients can be evaluated for expression levels of the target mRNA or protein by techniques known in the art. Additionally, the mRNA or protein expression levels of other genes known or suspected to be associated with the specific disease state, condition or phenotype, or levels of biological markers associated with the disease state, condition or phenotype, can similarly be assessed. Target or associated gene mRNA levels can be measured or evaluated by real-time PCR, Northern blot, in situ hybridization or DNA array analysis. Target or associated protein levels or biomarkers can be measured or evaluated by ELISA, immunoblotting, quantitative protein assays, protein activity assays (for example, caspase activity assays) immunohistochemistry, immunocytochemistry or routine clinical analysis.
  • [0000]
    I. Polymorphisms
  • [0135]
    One common allelic genomic sequence for apolipoprotein B is set forth in SEQ ID NO: 1 and is referred to herein as the “wild-type” sequence. Novel polymorphic sites have been identified in this gene at positions 27751, 27735, 27685, 27683, 27679, 27634, 27627 and 27618 of SEQ ID NO: 1 (and corresponding positions 15695, 15711, 15761, 15763, 15767, 15812, 15819 and 15828 of the reverse complement, SEQ ID NO: 2).
  • [0136]
    A polymorphism is a sequence variation in the gene observed within the population, and can include nucleotide substitutions (single nucleotide polymorphisms or SNPs), insertions, or deletions. Polymorphisms may or may not result in detectable differences in gene expression, protein structure, or protein function. A polymorphism may alter one or more properties of the gene or gene products, including DNA or RNA stability, binding of transcriptional or translation factors to the DNA or RNA, interactions of the DNA or RNA with other parts of the nuclear or cytosolic cell machinery, or may confer a change upon the encoded polypeptide sequence which in turn may alter the polypeptide's biological activity. Identification of polymorphisms among various populations is desirable to tailor design of suitable antisense therapeutics, select antisense therapeutics to administer to a particular population, and also predict responsiveness to therapeutics.
  • [0137]
    A “polymorphic site” is a position within a genetic locus at which at least one alternative nucleotide sequence variation (e.g., substitution, insertion, or deletion) has been observed in a population, and includes the position on both complementary strands at the polymorphic site. The first identified form of the nucleotide sequence at the polymorphic site is sometimes called the reference sequence, and the alternative forms are called alternative or variant alleles (or “allelic variant”). The most commonly occurring form of the nucleotide sequence at the polymorphic site is also sometimes called the wild type allele. Polymorphic sites of the invention are listed in the following table along with their approximate frequency.
    Approximate frequency of
    Position in SNP detection out of 213
    Sequence variation SEQ ID NO: 1 samples of diverse ancestry
    Substitution of A to G 27751 15%
    Substitution of C to G 27735  <1%  
    Substitution of T to C 27685 27%
    Substitution of T to C 27683
    Substitution of T to C 27679 40%
    Substitution of C to T 27634  <1%  
    Substitution of G to A 27627  2%
    Substitution of T to C 27618  <1%  
  • [0138]
    The invention provides a variety of polynucleotides, including reverse complements, single or double stranded polynucleotides, RNA, DNA or mimetics thereof, and antisense compounds, as defined above, that either contain or specifically hybridize to a polymorphic sequence at one or more of these polymorphic sites. Such “sequence-specific” polynucleotides can be used, alone or linked to other moieties, in a variety of areas. For example, the polynucleotides may be useful as therapeutic products for inhibiting gene expression, as probes or primers for detecting the polymorphic sequence as part of genotyping, diagnostic, pharmacogenomics and/or treatment methods, as part of arrays for screening, as part of diagnostic or therapeutic kits, or as tools for producing recombinant protein in host cells or transgenic organisms.
  • [0139]
    Methods of producing polynucleotides are well-known in the art, including chemical synthesis, cloning, and PCR amplification. The polymorphic polynucleotide sequences of the invention are preferably isolated, meaning in a form other than as part of an intact naturally occurring chromosome. Usually the polynucleotide sequences will also be purified, meaning at least about 50%, 75%, 80% or 90% pure or substantially free of other polynucleotide sequences that do not include an apolipoprotein B polynucleotide sequence or fragment thereof. The polynucleotide sequences can also be “recombinant”, meaning flanked by one or more nucleotides with which they are not normally associated on a naturally occurring chromosome.
  • [0140]
    As noted elsewhere herein, polynucleotides or oligonucleotides may include modifications, including but not limited to modifications to the internucleoside linkages, modifications to the sugar moieties, and modified nucleobases, so long as the modified polynucleotides retain the ability to hybridize specifically to the target polymorphic site.
  • [0141]
    Such polynucleotides of the invention may be linked to a second moiety such as an additional nucleotide sequence for stabilization purposes or for directing transcription or translation, a moiety which facilitates linkage to a solid support (such as a microarray or microparticle), or a label to facilitate detection of the polynucleotide. Such labels include, without limitation, a radioactive label, a fluorescent label, a chemiluminescent label, a paramagnetic label, an enzymatic label, one member of a high affinity binding partner pair (such as biotin/avidin) or other labels known in the art. The second moiety may be attached to any position of the polynucleotide, so long as the polynucleotide retains its ability to hybridize to the polymorphic sites described herein. The second moiety may be linked to the polynucleotide after it has been generated, or may be linked to a component nucleobase that is then incorporated into the polynucleotide during synthesis or assembly. Polynucleotides of the invention can also be attached to the surface of a solid support through means not involving direct chemical linkage.
  • [0142]
    As used herein, “sequence-specific” means that the polynucleotide, oligonucleotide or antisense compound specifically hybridizes to one nucleotide sequence at a polymorphic site compared to another, e.g. preferentially hybridizes more strongly to the one sequence than to an alternative nucleotide sequence that has been observed in some individuals at that polymorphic site.
  • [0143]
    Sequence-specific polynucleotides when used for sequence detection must be capable of hybridizing to the polymorphic sites under conditions of stringency such as those employed in hybridization-based sequence determination methods, primer extension-based sequence determination methods, restriction site analysis, polynucleotide amplification methods, ligase-based sequencing methods, methods based on enzymatic detection of mismatches, microarray-based sequence determination methods, and other sequence determination methods known in the art. In a related embodiment, the invention also contemplates primer pairs comprising an oligonucleotide useful for amplification of a polymorphic site in the gene. Such primer pairs may comprise the polymorphic site or may surround it. Kits comprising such oligonucleotides and primer pairs are also contemplated.
  • [0144]
    In some embodiments, the invention provides sequence-specific polynucleotides comprising at least 15 contiguous nucleotides of SEQ ID NO: 1, or comprising at least 15 continguous nucleotides of an allelic variant of SEQ ID NO: 1, said polynucleotide including at least one of:
    • C at position 27751 of SEQ ID NO: 1;
    • C at position 27735 of SEQ ID NO: 1;
    • G at position 27685 of SEQ ID NO: 1;
    • G at position 27683 of SEQ ID NO: 1;
    • G at position 27679 of SEQ ID NO: 1;
    • A at position 27634 of SEQ ID NO: 1;
    • T/U at position 27627 of SEQ ID NO: 1; or
    • G at position 27618 of SEQ ID NO: 1, wherein G is guanine, C is cytosine, T is thymine, U is uracil, and A is adenine.
  • [0153]
    In related embodiments, the invention further provides sequence-specific polynucleotides comprising at least 15 contiguous nucleotides of SEQ ID NO: 2, or comprising at least 15 contiguous nucleotides of an allelic variant of SEQ ID NO: 2, which is the reverse complement of SEQ ID NO: 1, said polynucleotide including at least one of:
    • G at position 15695 of SEQ ID NO: 2;
    • G at position 15711 of SEQ ID NO: 2;
    • C at position 15761 of SEQ ID NO: 2;
    • C at position 15763 of SEQ ID NO: 2;
    • C at position 15767 of SEQ ID NO: 2;
    • T/U at position 15812 of SEQ ID NO: 2;
    • A at position 15819 of SEQ ID NO: 2; or
    • C at position 15828 of SEQ ID NO: 2.
  • [0162]
    Such polynucleotides, including reverse complements, or single or double stranded polynucleotides, may range in length, for example, from at least 8, 12, 15, or 20 bases, such as 12-20, 15-30, 15-50, 50-100, 8-80, 8-30, 8-50, 12-50, or 12-30 contiguous bases, or may correspond to the full length of the encoding cDNA.
  • [0163]
    As part of these above aspects of the invention, the invention contemplates a sequence-specific oligonucleotide or antisense compound of no more than 100 nucleobases in length that hybridize to a portion of SEQ ID NO: 1 including at least one polymorphic site selected from the group consisting of:
    • C at position 27751 of SEQ ID NO: 1;
    • C at position 27735 of SEQ ID NO: 1;
    • G at position 27685 of SEQ ID NO: 1;
    • G at position 27683 of SEQ ID NO: 1;
    • G at position 27679 of SEQ ID NO: 1;
    • A at position 27634 of SEQ ID NO: 1;
    • T/U at position 27627 of SEQ ID NO: 1; or
    • G at position 27618 of SEQ ID NO: 1.
  • [0172]
    The invention also contemplates a sequence-specific oligonucleotides or antisense compound of no more than 100 nucleobases in length that hybridizes to a portion of SEQ ID NO: 2, which is the reverse complement of SEQ ID NO: 1, including at least one polymorphic site selected from the group consisting of:
    • G at position 15695 of SEQ ID NO: 2;
    • G at position 15711 of SEQ ID NO: 2;
    • C at position 15761 of SEQ ID NO: 2;
    • C at position 15763 of SEQ ID NO: 2;
    • C at position 15767 of SEQ ID NO: 2;
    • T/U at position 15812 of SEQ ID NO: 2;
    • A at position 15819 of SEQ ID NO: 2; or
    • C at position 15828 of SEQ ID NO: 2.
  • [0181]
    The invention further contemplates an oligonucleotide comprising about 15 to 3o contiguous nucleobases of an allelic variant of SEQ ID NO: 1, said allelic variant comprising at least one of:
    • C at position 27751 of SEQ ID NO: 1;
    • C at position 27735 of SEQ ID NO: 1;
    • G at position 27685 of SEQ ID NO: 1;
    • G at position 27683 of SEQ ID NO: 1;
    • G at position 27679 of SEQ ID NO: 1;
    • A at position 27634 of SEQ ID NO: 1;
    • T/U at position 27627 of SEQ ID NO: 1; or
    • G at position 27618 of SEQ ID NO: 1.
  • [0190]
    The invention also contemplates an oligonucleotide comprising about 15 to 3o contiguous nucleobases of an allelic variant of SEQ ID NO: 2, said allelic variant comprising at least one of:
    • G at position 15695 of SEQ ID NO: 2;
    • G at position 15711 of SEQ ID NO: 2;
    • C at position 15761 of SEQ ID NO: 2;
    • C at position 15763 of SEQ ID NO: 2;
    • C at position 15767 of SEQ ID NO: 2;
    • T/U at position 15812 of SEQ ID NO: 2;
    • A at position 15819 of SEQ ID NO: 2; or
    • C at position 15828 of SEQ ID NO: 2.
  • [0199]
    As noted above, such oligonucleotides or antisense compounds may be single or double stranded, may include reverse complements, may be RNA, DNA or mimetics, may be chemically modified, and may range in length, for example, from at least 8, 12, 15, or 20 bases, such as 12-20, 15-30, 15-50, 50-100, 8-80, 8-30, 8-50, 12-50, or 12-30 contiguous bases. In particular, an oligonucleotide or antisense compound that specifically hybridizes with a polymorphic sequence of a polymorphic site identified herein is useful for antisense therapy as described in other sections herein.
  • [0200]
    Where the polymorphism results in a change in the encoded amino acid sequence, expression vectors, host cells and recombinant organisms useful for producing the encoded protein are additionally contemplated. Polypeptides of limited length may also be prepared using chemical synthesis methods. Expression vectors may include nucleotide sequences that regulate transcription and/or translation, which may be inducible or constitutive, and which are preferably operably linked to coding sequence. Host cells include any prokaryotic, eukaryotic host cells known in the art, including bacteria, yeast, insect and mammalian cells. A large variety of techniques for expressing and purifying recombinant protein in host cell systems are known in the art. The polynucleotides of the invention can also be used to generate genetically modified (or transgenic) non-human animals or site specific gene modifications in cell lines using techniques known in the art. Such transgenic animals or cell lines include those in which the polymorphic gene is deleted or knocked out, those in which an exogenous polynucleotide comprising the polymorphism is stably inserted and transmitted to progeny, or those in which an endogenous polynucleotide comprising the polymorphism is operably linked to an exogenous regulatory sequence. Homologous recombination techniques are well known, and may utilize nucleic acid alone or as part of a suitable vector, such as viral vectors.
  • [0201]
    The variant polypeptides encoded by polynucleotides comprising one or more polymorphisms are also of interest, as are fragments thereof particularly antigenic epitopes, functional domains, binding sites, and other regions of interest, and including fusion proteins thereof. Polypeptides thus expressed are useful for protein structure analysis, for drug binding studies, and for screening candidate drugs to treat diseases related to apolipoprotein B activity. Antibodies specific for the variant polypeptides that differentiate between variant polypeptides and wild type polypeptide, including monoclonal antibodies and humanized or human antibodies, are also contemplated.
  • [0202]
    Expression assays can be used to detect differences in expression of polymorphisms with respect to tissue specificity, expression level, or expression in response to exposure to various substrates, and/or timing of expression during development. Expression assays may be performed in cell-free extracts, or by transforming cells with a suitable vector. Alterations in expression may occur in the basal level that is expressed in one or more cell types, or in the effect that an expression modifier has on the ability of the gene to be inhibited or induced. Expression levels of variant alleles are compared by various methods known in the art.
  • [0203]
    Screening can also be performed to determine if the polymorphisms described herein are genetically linked to other polymorphisms, to microsatellite markers, or to a phenotypic variant in apolipoprotein B activity or expression. Two polymorphisms may be in linkage disequilibrium, i.e. where alleles show non-random associations between genes even though individual loci are in Hardy-Weinberg equilibrium. Association of a polymorphism with a phenotypic trait (risk of a disease, severity or staging of a disease, or response to a drug) can also be identified by comparing the frequency of the polymorphism in a population exhibiting the trait to the frequency in a reference population; a higher frequency occurrence of the polymorphism in the population exhibiting the trait indicates that the trait is associated with the polymorphism. When such an association is established, the risk of disease, severity or staging of a disease, or response of an individual to a drug can then be predicted by determining the patient's genotype with respect to the polymorphism. Where there is a differential distribution of a polymorphism by racial background, guidelines for drug administration can be generally tailored to a particular ethnic group.
  • [0204]
    Identifying the presence or absence of a SNP is useful in methods of genotyping a human comprising the step of determining the identity of a nucleotide at a particular polymorphic site, in either the sense strand or its complement. The genotyping method may comprise identifying the nucleotide pair that is present at one or more polymorphic sites described herein. Genotyping compositions or kits of the invention comprises an oligonucleotide probe or primer which is designed to specifically hybridize to a target region containing, or adjacent to, one of these novel polymorphic sites. A genotyping kit of the invention may further comprise a set of oligonucleotides designed to genotype other polymorphic sites.
  • [0205]
    Detection of the polymorphism can be performed by DNA or RNA sequence analysis of any patient sample that contains genetic material, including biopsied tissue, blood, skin, or other cell samples. The sample polynucleotide or desired segment thereof can be amplified or cloned by methods known in the art. The presence or absence of the polymorphism in question can be determined in a variety of ways known in the art. For example, the sequence of the sample polynucleotide may be determined by dideoxy sequencing or other conventional chemical analytical methods. Hybridization-based methods include Southern blots or dot blots, detecting a pattern of hybridization to sets of probes, ligase-based methods, primer extension-based methods, allele-specific amplification, Taqman, and other PCR-based methods. Other methods such as single strand conformational polymorphism (SSCP) analysis, denaturing gradient gel electrophoresis (DGGE), and heteroduplex analysis in gel matrices are used to detect conformational changes created by DNA sequence variation as alterations in electrophoretic mobility. If a polymorphism creates or destroys a recognition site for a restriction endonuclease (restriction fragment length polymorphism, RFLP), polymorphic sequence can be detected by digesting the sample with that endonuclease, and separating the products by size (e.g. using gel or capillary electrophoresis) to determine whether the fragment was digested. Mismatch cleavage detection using enzymes or chemical cleavage agents followed by detecting product size using electrophoretic or mass spectrometry methods can also be carried out. Moreover, in cases where the polymorphism of the invention is linked to another marker (such as another polymorphism or a microsatellite marker) then detecting the presence of the marker serves to detect the presence of the polymorphism.
  • [0206]
    In one preferred embodiment, the invention provides a method of analyzing a patient's polynucleotides for the presence or absence of a mutation comprising: (a) providing a test sample comprising polynucleotides or replicas thereof from a biological sample obtained from the patient; (b) contacting the test sample with a probe comprising at least 15 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 1 or the complement thereof, the probe comprising at least one of the nucleotides at a polymorphic site in SEQ ID NO: 1 or the complement thereof; and (c) determining if the test sample comprises a polynucleotide that specifically hybridizes to the probe.
  • [0207]
    In another preferred embodiment, the invention provides a method of analyzing a patient's polynucleotides for the presence or absence of a mutation using PCR comprising: (a) providing a test sample comprising polynucleotides or replicas thereof from a biological sample obtained from the patient; (b) contacting the test sample with at least one primer comprising at least 15 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 1 or its complement, and a polymerase, wherein the primer comprises at least one of the nucleotides at a polymorphic site in SEQ ID NO: 1 or the complement thereof; and (c) determining if a PCR product of the appropriate size is amplified.
  • [0208]
    Such analysis methods and related kits are useful for diagnostic, prognostic or pharmacogenomic purposes. Thus, the invention provides methods of (1) predicting risk of developing a disease condition (2) diagnosing a condition, and/or (3) predicting prognosis of a condition comprising: (a) analyzing a patient's polynucleotides to determine the identity of at least one of the nucleotides at a polymorphic site in SEQ ID NO: 1, wherein the presence or absence of the nucleotide correlates with a higher likelihood of developing said condition. The correlation may be based on statistically associating either the presence or absence of a single polymorphism (or multiple polymorphisms) with risk of developing a disease or condition, or with the diagnosis of a disease or condition, or with prognosis or staging of a disease or condition.
  • [0209]
    The invention further provides a method for selecting a treatment for a patient suffering from a disease or condition by determining whether or not a gene or genes in cells of the patient contain at least one polymorphism which is correlated to the effectiveness of the treatment of the disease or condition. The selection may be the selection of a method or methods which is/are more or less effective, safer, or toxic than certain other therapeutic regimens. The selection may involve either choice of a treatment to use or avoidance of a treatment. For example, a contra-indicated treatment should be avoided if it will not result in a therapeutic benefit, or if it will result in an excessive level of undesirable side effects. Thus, the frequency of the polymorphism itself may be correlated to the frequency of a beneficial therapeutic response to a drug or unresponsiveness to the drug, or it may be correlated to the frequency of an adverse event resulting from administration of the drug. Even where there the frequency of the polymorphism does not correspond closely with the frequency of a beneficial or adverse response, the polymorphism may still be useful for identifying a patient subset with high response or toxicity incidence. Preferably, the drug will be effective in more than 20%, 40% or 60% of individuals with one or more specific polymorphisms. Altematively, the drug will be toxic or create clinically unacceptable side effects in more than 10%, 30%, 50%, 70% or 90% of individuals with one or more specific polymorphisms.
  • [0210]
    The invention thus provides a method of predicting a beneficial treatment for a patient comprising: (a) analyzing a patient's polynucleotides to determine the identity of at least one of the nucleotides at a polymorphic site in SEQ ID NO: 1 wherein the presence or absence of the nucleotide correlates with a prediction that the treatment will be beneficial. The method may further include selecting a suitable dosage amount and/or frequency of administration.
  • [0211]
    Similarly, the invention provides a method of predicting a contraindicated treatment for a patient comprising: (a) analyzing a patient's polynucleotides to determine the identity of at least one of the nucleotides at a polymorphic site in SEQ ID NO: 1, wherein the presence or absence of the nucleotide correlates with a prediction that the treatment will not be effective or will have significantly adverse effects. The correlation may be based on statistically associating either the presence or absence of a single polymorphism (or multiple polymorphisms) with a beneficial effect or contraindicated effect resulting from drug treatment.
  • [0212]
    One aspect of the invention specifically provides methods of treatment with sequence-specific antisense compounds comprising the step of detecting the presence of a polymorphism of the invention in the patient's sample prior to treatment with the desired sequence-specific compound, where detection of the polymorphism guides selection of the proper sequence-specific compound. For example, the presence of a polymorphism in a patient's genes may indicate that treatment with a compound that specifically hybridizes to the polymorphism may be beneficial. Similarly, the absence of a polymorphism in the patient's genes may mean that treatment with a compound that specifically hybridizes to the polymorphism is contraindicated.
  • [0213]
    While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same. Each of the references, GENBANK® accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.
  • EXAMPLES Example 1
  • [0000]
    Synthesis of Nucleoside Phosphoramidites
  • [0214]
    The following compounds, including amidites and their intermediates were prepared as described in U.S. Pat. No. 6,426,220 and published PCT WO 02/36743; 5′-O-Dimethoxytrityl-thymidine intermediate for 5-methyl dC amidite, 5′-O-Dimethoxytrityl-2′-deoxy-5-methylcytidine intermediate for 5-methyl-dC amidite, 5′-O-Dimethoxytrityl-2′-deoxy-N4-benzoyl-5-methylcytidine penultimate intermediate for 5-methyl dC amidite, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-deoxy-N4-benzoyl-5-methylcytidin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (5-methyl dC amidite), 2′-Fluorodeoxyadenosine, 2′-Fluorodeoxyguanosine, 2′-Fluorouridine, 2′-Fluorodeoxycytidine, 2′-O-(2-Methoxyethyl) modified amidites, 2′-O-(2-methoxyethyl)-5-methyluridine intermediate, 5′-O-DMT-2′-O-(2-methoxyethyl)-5-methyluridine penultimate intermediate, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-5-methyluridin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE T amidite), 5′-O-Dimethoxytrityl-2′-O-(2-methoxyethyl)-5-methylcytidine intermediate, 5′-O-dimethoxytrityl-2′-O-(2-methoxyethyl)-N4-benzoyl-5-methyl-cytidine penultimate intermediate, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N4-benzoyl-5-methylcytidin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramnidite (MOE 5-Me-C amidite), [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N6-benzoyladenosin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE A amdite), [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N4-isobutyrylguanosin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE G amidite), 2′-O-(Aminooxyethyl) nucleoside amidites and 2′-O-(dimethylaminooxyethyl) nucleoside amidites, 2′-(Dimethylaminooxyethoxy) nucleoside amidites, 5′-O-tert-Butyldiphenylsilyl-O2-2′-anhydro-5-methyluridine, 5′-O-tert-Butyldiphenylsilyl-2′-O-(2-hydroxyethyl)-5-methyluridine, 2′-O-([2-phthalimidoxy)ethyl]-5′-t-butyldiphenylsilyl-5-methyluridine, 5′-O-tert-butyldiphenylsilyl-2′-O-[(2-formadoximinooxy)ethyl]-5-methyluridine, 5′-O-tert-Butyldiphenylsilyl-2′-O-[N,N dimethylaminooxyethyl]-5-methyluridine, 2′-O-(dimethylaminooxyethyl)-5-methyluridine, 5′-O-DMT-2′-O-(dimethylaminooxyethyl)-5-methyluridine, 5′-O-DMT-2′-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite], 2′-(Aminooxyethoxy) nucleoside amidites, N2-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite], 2′-dimethylaminoethoxyethoxy (2′-DMAEOE) nucleoside amidites, 2′-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine, 5′-O-dimethoxytrityl-2′-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine and 5′-O-Dimethoxytrityl-2′-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine-3′-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite.
  • Example 2
  • [0000]
    Oligonucleotide and Oligonucleoside Synthesis
  • [0215]
    The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • [0216]
    Oligonucleotides: Unsubstituted and substituted phosphodiester (P═O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with oxidation by iodine.
  • [0217]
    Phosphorothioates (P═S) are synthesized similar to phosphodiester oligonucleotides with the following exceptions: thiation was effected by utilizing a 10% w/v solution of 3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the oxidation of the phosphite linkages. The thiation reaction step time was increased to 180 sec and preceded by the normal capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55° C. (12-16 hr), the oligonucleotides were recovered by precipitating with >3 volumes of ethanol from a 1 M NH4OAc solution. Phosphinate oligonucleotides are prepared as described in U.S. Pat. No. 5,508,270.
  • [0218]
    Alkyl phosphonate oligonucleotides are prepared as described in U.S. Pat. No. 4,469,863.
  • [0219]
    3′-Deoxy-3′-methylene phosphonate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050.
  • [0220]
    Phosphoramidite oligonucleotides are prepared as described in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878.
  • [0221]
    Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively).
  • [0222]
    3′-Deoxy-3′-amino phosphoramidate oligonucleotides are prepared as described in U.S. Pat. No. 5,476,925.
  • [0223]
    Phosphotriester oligonucleotides are prepared as described in U.S. Pat. No. 5,023,243.
  • [0224]
    Borano phosphate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,130,302 and 5,177,198.
  • [0225]
    Oligonucleosides: Methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, and methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide4 linked oligonucleosides, as well as mixed backbone compounds having, for instance, alternating MMI and P═O or P═S linkages are prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289, all of which are herein incorporated by reference.
  • [0226]
    Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564.
  • [0227]
    Ethylene oxide linked oligonucleosides are prepared as described in U.S. Pat. No. 5,223,618.
  • Example 3
  • [0000]
    RNA Synthesis
  • [0228]
    In general, RNA synthesis chemistry is based on the selective incorporation of various protecting groups at strategic intermediary reactions. Although one of ordinary skill in the art will understand the use of protecting groups in organic synthesis, a useful class of protecting groups includes silyl ethers. In particular bulky silyl ethers are used to protect the 5′-hydroxyl in combination with an acid-labile orthoester protecting group on the 2′-hydroxyl. This set of protecting groups is then used with standard solid-phase synthesis technology. It is important to lastly remove the acid labile orthoester protecting group after all other synthetic steps. Moreover, the early use of the silyl protecting groups during synthesis ensures facile removal when desired, without undesired deprotection of 2′ hydroxyl.
  • [0229]
    Following this procedure for the sequential protection of the 5′-hydroxyl in combination with protection of the 2′-hydroxyl by protecting groups that are differentially removed and are differentially chemically labile, RNA oligonucleotides were synthesized.
  • [0230]
    RNA oligonucleotides are synthesized in a stepwise fashion. Each nucleotide is added sequentially (3′- to 5′-direction) to a solid support-bound oligonucleotide. The first nucleoside at the 3′-end of the chain is covalently attached to a solid support. The nucleotide precursor, a ribonucleoside phosphoramidite, and activator are added, coupling the second base onto the 5′-end of the first nucleoside. The support is washed and any unreacted 5′-hydroxyl groups are capped with acetic anhydride to yield 5′-acetyl moieties. The linkage is then oxidized to the more stable and ultimately desired P(V) linkage. At the end of the nucleotide addition cycle, the 5′-silyl group is cleaved with fluoride. The cycle is repeated for each subsequent nucleotide.
  • [0231]
    Following synthesis, the methyl protecting groups on the phosphates are cleaved in 30 minutes utilizing 1 M disodium-2-carbamoyl-2-cyanoethylene-1,1-dithiolate trihydrate (S2Na2) in DMF. The deprotection solution is washed from the solid support-bound oligonucleotide using water. The support is then treated with 40% methylamine in water for 10 minutes at 55° C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines, and modifies the 2′-groups. The oligonucleotides can be analyzed by anion exchange HPLC at this stage.
  • [0232]
    The 2′-orthoester groups are the last protecting groups to be removed. The ethylene glycol monoacetate orthoester protecting group developed by Dharmacon Research, Inc. (Lafayette, Colo.), is one example of a useful orthoester protecting group which, has the following important properties. It is stable to the conditions of nucleoside phosphoramidite synthesis and oligonucleotide synthesis. However, after oligonucleotide synthesis the oligonucleotide is treated with methylamine which not only cleaves the oligonucleotide from the solid support but also removes the acetyl groups from the orthoesters. The resulting 2-ethyl-hydroxyl substituents on the orthoester are less electron withdrawing than the acetylated precursor. As a result, the modified orthoester becomes more labile to acid-catalyzed hydrolysis. Specifically, the rate of cleavage is approximately 10 times faster after the acetyl groups are removed. Therefore, this orthoester possesses sufficient stability in order to be compatible with oligonucleotide synthesis and yet, when subsequently modified, permits deprotection to be carried out under relatively mild aqueous conditions compatible with the final RNA oligonucleotide product.
  • [0233]
    Additionally, methods of RNA synthesis are well known in the art (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996; Scaringe, S. A., et al., J. Am. Chem. Soc., 1998, 120, 11820-11821; Matteucci, M. D. and Caruthers, M. H. J. Am. Chem. Soc., 1981, 103, 3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett., 1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem. Scand,. 1990, 44, 639-641; Reddy, M. P., et al., Tetrahedrom Lett., 1994, 25, 43114314; Wincott, F. et al., Nucleic Acids Res., 1995, 23, 2677-2684; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2301-2313; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2315-2331).
  • [0234]
    RNA antisense compounds (RNA oligonucleotides) of the present invention can be synthesized by the methods herein or purchased from Dharmacon Research, Inc (Lafayette, Colo.). Once synthesized, complementary RNA antisense compounds can then be annealed by methods known in the art to form double stranded (duplexed) antisense compounds. For example, duplexes can be formed by combining 30 μl of each of the complementary strands of RNA oligonucleotides (50 uM RNA oligonucleotide solution) and 15 μl of 5× annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1 minute at 90° C., then 1 hour at 37° C. The resulting duplexed antisense compounds can be used in kits, assays, screens, or other methods to investigate the role of a target nucleic acid, or for diagnostic or therapeutic purposes.
  • Example 4
  • [0000]
    Synthesis of Chimeric Compounds
  • [0235]
    Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the “gap” segment of linked nucleosides is positioned between 5′ and 3′ “wing” segments of linked nucleosides and a second “open end” type wherein the “gap” segment is located at either the 3′ or the 5′ terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as “hemimers” or “wingmers”.
  • [0236]
    [2′-O-Me]—[2′-deoxy]—[2′-O-Me] Chimeric Phosphorothioate Oligonucleotides
  • [0237]
    Chimeric oligonucleotides having 2′-O-alkyl phosphorothioate and 2′-deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 394, as above. Oligonucleotides are synthesized using the automated synthesizer and 2′-deoxy-5′-dimethoxytrityl-3′-O-phosphoramidite for the DNA portion and 5′-dimethoxytrityl-2′-O-methyl-3′-O-phosphoramidite for 5′ and 3′ wings. The standard synthesis cycle is modified by incorporating coupling steps with increased reaction times for the 5′-dimethoxytrityl-2′-O-methyl-3′-O-phosphoramidite. The fully protected oligonucleotide is cleaved from the support and deprotected in concentrated ammonia (NH4OH) for 12-16 hr at 55° C. The deprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, volume reduced in vacuo and analyzed spetrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.
  • [0238]
    [2′-O-(2-Methoxyethyl)]—[2′-deoxy]—[2′-O-(Methoxyethyl)] Chimeric Phosphorothioate Oligonucleotides
  • [0239]
    [2′-O-(2-methoxyethyl)]—[2′-deoxy]—[-2′-O-(methoxyethyl)] chimeric phosphorothioate oligonucleotides were prepared as per the procedure above for the 2′-O-methyl chimeric oligonucleotide, with the substitution of 2′-O-(methoxyethyl) amidites for the 2′-O-methyl amidites.
  • [0240]
    [2′-O-(2-Methoxyethyl)Phosphodiester]—[2′-deoxy Phosphorothioate]—[2′-O-(2-Methoxyethyl) Phosphodiester] Chimeric Oligonucleotides
  • [0241]
    [2′-O-(2-methoxyethyl phosphodiester]—[2′-deoxy phosphorothioate]—[2′-O-(methoxyethyl) phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2′-O-methyl chimeric oligonucleotide with the substitution of 2′-O-(methoxyethyl) amidites for the 2′-O-methyl amidites, oxidation with iodine to generate the phosphodiester internucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the center gap.
  • [0242]
    Other chimeric oligonucleotides, chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to U.S. Pat. No. 5,623,065.
  • Example 5
  • [0000]
    Design and Screening of Duplexed Antisense Compounds Targeting Apolipoprotein B
  • [0243]
    In accordance with the present invention, a series of nucleic acid duplexes comprising the antisense compounds of the present invention and their complements can be designed to target apolipoprotein B. The nucleobase sequence of the antisense strand of the duplex comprises at least an 8-nucleobase portion of an oligonucleotide in Table 1. The ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang. The sense strand of the dsRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to either terminus. For example, in one embodiment, both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini.
  • [0244]
    In one embodiment, a duplex comprising an antisense strand having the sequence CGAGAGGCGGACGGGACCG (SEQ ID NO: 3), can be prepared with blunt ends (no single stranded overhang) as shown:
    cgagaggcggacgggaccg Antisense Strand (SEQ ID NO: 3)
    |||||||||||||||||||
    gctctccgcctgccctggc Complement (SEQ ID NO: 4)
  • [0245]
    In another embodiment, both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini. For example, a duplex comprising an antisense strand having the sequence CGAGAGGCGGACGGGACCG (SEQ ID NO: 3) and having a two-nucleobase overhang of deoxythymidine(dT) would have the following structure:
      cgagaggcggacgggaccgTT Antisense Strand (SEQ ID NO: 5)
      |||||||||||||||||||
    TTgctctccgcctgccctggc Complement (SEQ ID NO: 6)
  • [0246]
    Overhangs can range from 2 to 6 nucleobases and these nucleobases may or may not be complementary to the target nucleic acid. In another embodiment, the duplexes can have an overhang on only one terminus.
  • [0247]
    The RNA duplex can be unimolecular or bimolecular; i.e, the two strands can be part of a single molecule or may be separate molecules.
  • [0248]
    RNA strands of the duplex can be synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, Colo.). Once synthesized, the complementary strands are annealed. The single strands are aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each strand is combined with 15 uL of a 5× solution of annealing buffer. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2 mM magnesium acetate. The final volume is 75 uL. This solution is incubated for 1 minute at 90° C. and then centrifuged for 15 seconds. The tube is allowed to sit for 1 hour at 37° C. at which time the dsRNA duplexes are used in experimentation. The final concentration of the dsRNA duplex is 20 uM. This solution can be stored frozen (−20° C.) and freeze-thawed up to 5 times.
  • [0249]
    Once prepared, the duplexed compounds are evaluated for their ability to modulate apolipoprotein B expression. When cells reach approximately 80% confluency, they are treated with duplexed compounds of the invention. For cells grown in 96-well plates, wells are washed once with 200 μL OPTI-MEMO® reduced-serum medium (Invitrogen Life Technologies, Carlsbad, Calif.) and then treated with 130 μL of OPTI-MEM® 1 containing 12 μg/mL LIPOFECTIN® (Invitrogen Life Technologies, Carlsbad, Calif.) and the desired duplex antisense compound (e.g. 200 nM) at a ratio of 6 μg/mL LIPOFECTIN® per 100 nM duplex antisense compound. After approximately 5 hours of treatment, the medium is replaced with fresh medium. Cells are harvested approximately 16 hours after treatment, at which time RNA is isolated and target reduction measured by real-time PCR.
  • Example 6
  • [0000]
    Oligonucleotide Isolation
  • [0250]
    After cleavage from the controlled pore glass solid support and deblocking in concentrated ammonium hydroxide at 55° C. for 12-16 hours, the oligonucleotides or oligonucleosides are recovered by precipitation out of 1 M NH4OAc with >3 volumes of ethanol. Synthesized oligonucleotides were analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis and judged to be at least 70% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis was determined by the ratio of correct molecular weight relative to the −16 amu product (±32 ±48). For some studies oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.
  • Example 7
  • [0000]
    Oligonucleotide Synthesis—96 Well Plate Format
  • [0251]
    Oligonucleotides were synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format. Phosphodiester internucleotide linkages were afforded by oxidation with aqueous iodine. Phosphorothioate internucleotide linkages were generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard nucleosides are synthesized as per standard or patented methods. They are utilized as base protected beta-cyanoethyldiisopropyl phosphoramidites.
  • [0252]
    Oligonucleotides were cleaved from support and deprotected with concentrated NH4OH at elevated temperature (55-60° C.) for 12-16 hours and the released product then dried in vacuo. The dried product was then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
  • Example 8
  • [0000]
    Oligonucleotide Analysis—96-Well Plate Format
  • [0253]
    The concentration of oligonucleotide in each well was assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products was evaluated by capillary electrophoresis (CE) in either the 96-well format (Beckman P/ACE™ MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE™ 5000, ABI 270). Base and backbone composition was confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates were diluted from the master plate using single and multi-channel robotic pipettors. Plates were judged to be acceptable if at least 85% of the compounds on the plate were at least 85% full length.
  • Example 9
  • [0000]
    Cell Culture and Oligonucleotide Treatment
  • [0254]
    The effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays, or RT-PCR.
  • [0000]
    HepG2 Cells:
  • [0255]
    The human hepatoblastoma cell line HepG2 is available from the American Type Culture Collection (Manassas, Va.). HepG2 cells are routinely cultured in Eagle's MEM supplemented with 10% fetal bovine serum, non-essential amino acids, and 1 mM sodium pyruvate (Invitrogen Life Technologies, Carlsbad, Calif.). Cells are routinely passaged by trypsinization and dilution when they reach 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #3872, BD Biosciences, Bedford, Mass.) at a density of approximately 7000 cells/well for use in antisense oligonucleotide transfection experiments. For Northern blotting or other analyses, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
  • [0000]
    T-24 Cells:
  • [0256]
    The human transitional cell bladder carcinoma cell line T-24 is available from the American Type Culture Collection (ATCC) (Manassas, Va.). T-24 cells are routinely cultured in complete McCoy's 5A basal media supplemented with 10% fetal bovine serum, 100 units per mL penicillin, and 100 ug per mL streptomycin (media and supplements from Invitrogen Life Technologies, Carlsbad, Calif.). Cells are routinely passaged by trypsinization and dilution when they reach approximately 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #353872, BD Biosciences, Bedford, Mass.) at a density of approximately 7000 cells/well for use in antisense oligonucleotide transfection experiments. For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
  • [0000]
    A549 Cells:
  • [0257]
    The human lung carcinoma cell line A549 is available from the American Type Culture Collection (ATCC) (Manassas, Va.). A549 cells are routinely cultured in DMEM basal media (Invitrogen Corporation, Carlsbad, Calif.) supplemented with 10% fetal bovine serum, 100 units per mL penicillin, and 100 ug per mL streptomycin (media and supplements from Invitrogen Life Technologies, Carlsbad, Calif.). Cells are routinely passaged by trypsinization and dilution when they reach approximately 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #353872, BD Biosciences, Bedford, Mass.) at a density of approximately 7000 cells/well for use in antisense oligonucleotide transfection experiments. For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
  • [0000]
    NHDF Cells:
  • [0258]
    Human neonatal dermal fibroblast (NHDF) are available from the Clonetics Corporation (Walkersville, Md.). NHDFs are routinely maintained in Fibroblast Growth Medium (Clonetics Corporation, Walkersville, Md.) supplemented as recommended by the supplier. Cells are maintained for up to 10 passages as recommended by the supplier.
  • [0000]
    HEK Cells:
  • [0259]
    Human embryonic keratinocytes (HEK) are available from the Clonetics Corporation (Walkersville, Md.). HEKs are routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville, Md.) formulated as recommended by the supplier. Cells are routinely maintained for up to 10 passages as recommended by the supplier.
  • [0000]
    Treatment with Antisense Compounds:
  • [0260]
    When cells reached 65-75% confluency, they are treated with oligonucleotide. Oligonucleotide is mixed with LIPOFECTIN® Invitrogen Life Technologies, Carlsbad, Calif.) in OPTI-MEM® 1 reduced serum medium (Invitrogen Life Technologies, Carlsbad, Calif.) to achieve the desired concentration of oligonucleotide and a LIPOFECTIN® concentration of 2.5 or 3 μg/mL per 100 nM oligonucleotide. This transfection mixture is incubated at room temperature for approximately 0.5 hours. For cells grown in 96-well plates, wells are washed once with 100 μL OPTI-MEM® 1 and then treated with 130 μL of the transfection mixture. Cells grown in 24-well plates or other standard tissue culture plates are treated similarly, using appropriate volumes of medium and oligonucleotide. Cells are treated and data are obtained in duplicate or triplicate. After approximately 4-7 hours of treatment at 37° C., the medium containing the transfection mixture is replaced with fresh culture medium. Cells are harvested 16-24 hours after oligonucleotide treatment.
  • [0261]
    The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. For human cells the positive control oligonucleotide is selected from either ISIS 13920 (TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 7) which is targeted to human H-ras, or ISIS 18078, (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 8) which is targeted to human Jun-N-terminal kinase-2 (JNK2). ISIS 13920 is a chimeric oligonucleotide having a 9 nucleotide gap segment composed of 2′-deoxynucleotides, which is flanked on the 5′ side and 3′ sides by 3 nucleotide and 8 nucleotide wing segments, respectively. ISIS 18078 is a chimeric oligonucleotide having a 5 nucleotide gap segment composed of 2′-deoxynucleotides, which is flanked on the 5′ and 3′ sides by 5 nucleotide and 6 nucleotide wing segments, respectively. The wings are composed of 2′-O-methoxyethyl nucleotides. Both compounds have phosphorothioate internucleoside (backbone) linkages, and cytidines in the wing segments are 5-methylcytidines. For mouse or rat cells the positive control oligonucleotide is ISIS 15770 (ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 9), a 2′-O-methoxyethyl gapmer (2′-O-methoxyethyls shown in bold), which is which is targeted to both mouse and rat c-raf. ISIS 15770 is a chimeric oligonucleotide having a 10 nucleotide gap segment composed of 2′-deoxynucleotides, which is flanked on the 5′ side and 3′ sides by 5 nucleotide wing segments. The wings are composed of 2′-O-methoxyethyl nucleotides. Internucleoside (backbone) linkages are phosphorothioate and cytidines in the wing segments are 5-methylcytidines. The concentration of positive control oligonucleotide that results in 80% inhibition of c-H-ras (for ISIS 13920), JNK2 (for ISIS 18078) or c-raf (for ISIS 15770) mRNA is then utilized as the screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not achieved, the lowest concentration of positive control oligonucleotide that results in 60% inhibition of c-H-ras, JNK2 or c-raf mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments. The concentrations of antisense oligonucleotides used herein are from 50 nM to 300 nM.
  • Example 10
  • [0000]
    Analysis of Oligonucleotide Inhibition of Apolipoprotein B Expression
  • [0262]
    Antisense modulation of apolipoprotein B expression can be assayed in a variety of ways known in the art. For example, apolipoprotein B mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR. Real-time quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Northern blot analysis is routine in the art and is taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., 1996. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM® 7700 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.
  • [0263]
    Protein levels of apolipoprotein B can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence-activated cell sorting (FACS). Antibodies directed to apolipoprotein B can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies is taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.
  • [0264]
    Immunoprecipitation methods are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., 1998. Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.
  • Example 11
  • [0000]
    Poly(A)+ mRNA Isolation
  • [0265]
    Poly(A)+ mRNA was isolated according to Miura et al., Clin. Chem., 1996, 42, 1758-1764. Other methods for poly(A)+ mRNA isolation are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 μL cold PBS. 60 μL lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) was added to each well, the plate was gently agitated and then incubated at room temperature for five minutes. 55 μL of lysate was transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated for 60 minutes at room temperature, washed 3 times with 200 μL of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate was blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 μL of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70° C. was added to each well, the plate was incubated on a 90° C. hot plate for 5 minutes, and the eluate was then transferred to a fresh 96-well plate.
  • [0266]
    Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.
  • Example 12
  • [0000]
    Total RNA Isolation
  • [0267]
    Total RNA was isolated using an RNEASY® 96 kit and buffers purchased from Qiagen Inc. (Valencia, Calif.) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 μL cold PBS. 100 μL Buffer RLT was added to each well and the plate vigorously agitated for 20 seconds. 100 μL of 70% ethanol was then added to each well and the contents mixed by pipetting three times up and down. The samples were then transferred to the RNEASY® 96 well plate attached to a QIAvac manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum was applied for 15 seconds. 1 mL of Buffer RW1 was added to each well of the RNEASY® 96 plate and the vacuum again applied for 15 seconds. 1 mL of Buffer RPE was then added to each well of the RNEASY® 96 plate and the vacuum applied for a period of 15 seconds. The Buffer RPE wash was then repeated and the vacuum was applied for an additional 10 minutes. The plate was then removed from the QIAvac manifold and blotted dry on paper towels. The plate was then re-attached to the QIAvac manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA was then eluted by pipetting 60 μL water into each well, incubating 1 minute, and then applying the vacuum for 30 seconds. The elution step was repeated with an additional 60 μL water.
  • [0268]
    The repetitive pipetting and elution steps may be automated using a QIAGEN® Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
  • Example 13
  • [0000]
    Real-Time Quantitative PCR Analysis of Apolipoprotein B mRNA Levels
  • [0269]
    Quantitation of apolipoprotein B mRNA levels was determined by real-time quantitative PCR using the ABI PRISM® 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR, in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., JOE™, FAM™, or VIC™, obtained from either Operon Technologies Inc., Alameda, Calif. or PE-Applied Biosystems, Foster City, Calif.) is attached to the 5′ end of the probe and a quencher dye (e.g., TAMRA™, obtained from either Operon Technologies Inc., Alameda, Calif. or PE-Applied Biosystems, Foster City, Calif.) is attached to the 3′ end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3′ quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5′-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM® 7700 Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
  • [0270]
    Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be “multiplexed” with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only (“single-plexing”), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art.
  • [0271]
    After isolation the RNA is subjected to sequential reverse transcriptase (RT) reaction and real-time PCR, both of which are performed in the same well. RT and PCR reagents were obtained from Invitrogen Life Technologies (Carlsbad, Calif.). RT, real-time PCR was carried out in the same by adding 20 μL PCR cocktail (2.5× PCR buffer minus MgCl2, 6.6 mM MgCl2, 375 μM each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM® Taq, 5 Units MuLV reverse transcriptase, and 2.5× ROX dye) to 96-well plates containing 30 μL total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48° C. Following a 10 minute incubation at 95° C. to activate the PLATINUM® Taq, 40 cycles of a two-step PCR protocol were carried out: 95° C. for 15 seconds (denaturation) followed by 60° C. for 1.5 minutes (annealing/extension).
  • [0272]
    Gene target quantities obtained by real time PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RIBOGREEN® (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN® RNA quantification reagent from Molecular Probes. Methods of RNA quantification by RIBOGREEN® are taught in Jones, L. J., et al, Analytical Biochemistry, 1998, 265, 368-374.
  • [0273]
    In this assay, 175 μL of RIBOGREEN® working reagent (RIBOGREEN® reagent diluted 1:2865 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 25 uL purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 480 nm and emission at 520 nm.
  • [0274]
    Probes and primers to human apolipoprotein B were designed to hybridize to a human apolipoprotein B sequence, using published sequence information (GENBANK® accession number NM000384.1, incorporated herein as SEQ ID NO: 10). For human apolipoprotein B the PCR primers were:
    • forward primer: TGCTAAAGGCACATATGGCCT (SEQ ID NO: 11)
    • reverse primer: CTCAGGTTGGACTCTCCATTGAG (SEQ ID NO: 12) and the PCR probe was: FAM-CTTGTCAGAGGGATCCTAACACTGGCCG-TAMRA (SEQ ID NO: 13) where FAM™ (PE-Applied Biosystems, Foster City, Calif.) is the fluorescent reporter dye) and TAMRA™ (PE-Applied Biosystems, Foster City, Calif.) is the quencher dye.
    • For human GAPDH the PCR primers were:
    • forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 14)
    • reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 15) and the PCR probe was: 5′ JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3′ (SEQ ID NO: 16) where JOE™ (PE-Applied Biosystems, Foster City, Calif.) is the fluorescent reporter dye) and TAMRA™ (PE-Applied Biosystems, Foster City, Calif.) is the quencher dye.
  • [0280]
    Probes and primers to mouse apolipoprotein B were designed to hybridize to a mouse apolipoprotein B sequence, using published sequence information (GENBANK® accession number M35186, incorporated herein as SEQ ID NO: 17). For mouse apolipoprotein B the PCR primers were:
    • forward primer: CGTGGGCTCCAGCATTCTA (SEQ ID NO: 18)
    • reverse primer: AGTCATTTCTGCCTTTGCGTC (SEQ ID NO: 19) and the PCR probe was: 5′ FAM-CCAATGGTCGGGCACTGCTCAA-TAMRA 3′(SEQ ID NO: 20) where FAM™ (PE-Applied Biosystems, Foster City, Calif.) is the fluorescent reporter dye) and TAMRA™ (PE-Applied Biosystems, Foster City, Calif.) is the quencher dye. For mouse GAPDH the PCR primers were:
    • forward primer: GGCAAATTCAACGGCACAGT (SEQ ID NO: 21)
    • reverse primer: GGGTCTCGCTCCTGGAAGAT (SEQ ID NO: 22) and the PCR probe was: 5′ JOE-AAGGCCGAGAATGGGAAGCTTGTCATC-TAMRA 3′ (SEQ ID NO: 23) where JOE™ (PE-Applied Biosystems, Foster City, Calif.) is the fluorescent reporter dye) and TAMRA™ (PE-Applied Biosystems, Foster City, Calif.) is the quencher dye.
    Example 14
  • [0000]
    Northern Blot Analysis of Apolipoprotein B mRNA Levels
  • [0285]
    Eighteen hours after antisense treatment, cell monolayers were washed twice with cold PBS and lysed in 1 mL RNAZOL® (TEL-TEST “B” Inc., Friendswood, Tex.). Total RNA was prepared following manufacturer's recommended protocols. Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the gel to HYBOND®-N+ nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) by overnight capillary transfer using a Northern/Southern Transfer buffer system (TEL-TEST “B” Inc., Friendswood, Tex.). RNA transfer was confirmed by UV visualization. Membranes were fixed by UV cross-linking using a STRATALINKER® UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then robed using QUICKHYB® hybridization solution (Stratagene, La Jolla, Calif.) using manufacturer's recommendations for stringent conditions.
  • [0286]
    To detect human apolipoprotein B, a human apolipoprotein B specific probe was prepared by PCR using the forward primer TGCTAAAGGCACATATGGCCT (SEQ ID NO: 11) and the reverse primer CTCAGGTTGGACTCTCCATTGAG (SEQ ID NO: 12). To normalize for variations in loading and transfer efficiency membranes were stripped and probed for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).
  • [0287]
    To detect mouse apolipoprotein B, a human apolipoprotein B specific probe was prepared by PCR using the forward primer CGTGGGCTCCAGCATTCTA (SEQ ID NO: 18) and the reverse primer AGTCATTTCTGCCTTTGCGTC (SEQ ID NO: 19). To normalize for variations in loading and transfer efficiency membranes were stripped and probed for mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).
  • [0288]
    Hybridized membranes were visualized and quantitated using a PHOSPHORIMAGER® and IMAGEQUANT® Software V3.3 (Molecular Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels in untreated controls.
  • Example 15
  • [0000]
    Western Blot Analysis of Apolipoprotein B Protein Levels
  • [0289]
    Western blot analysis (immunoblot analysis) was carried out using standard methods. Cells were harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels were run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to apolipoprotein B was used, with a radiolabelled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands were visualized using a PHOSPHORIMAGER® (Molecular Dynamics, Sunnyvale Calif.) or the ECL PLUS® chemiluminescent detection system (Amersham Biosciences, Piscataway, N.J.).
  • Example 16
  • [0000]
    Antisense Inhibition of Apolipoprotein B Expression
  • [0290]
    U.S. Application Publication No. 20040214325 published Oct. 28, 2004 and International Patent Publication WO2004044181 published May 27, 2004, the disclosures and particularly the examples of which are hereby incorporated by reference in their entirety, describe the activity in vitro and in vivo of a variety of different antisense compounds, including dsRNA and chimeric phosphorothioate oligonucleotides, designed to target different regions of the human, mouse, rabbit and monkey apolipoprotein B RNA.
  • [0291]
    A number of different compounds demonstrated at least 10%, at least 30%, and/or at least 50% inhibition of apolipoprotein B expression. The target regions to which these preferred sequences are complementary are herein referred to as “preferred target segments” and are therefore preferred for targeting by compounds of the present invention. Where sequences are shown to contain thymine (T) one of skill in the art will appreciate that thymine (T) is generally replaced by uracil (U) in RNA sequences.
  • [0292]
    As these “preferred target segments” have been found by experimentation to be open to, and accessible for, hybridization with the antisense compounds of the present invention, one of skill in the art will recognize or be able to ascertain, using no more than routine experimentation, further embodiments of the invention that encompass other compounds that specifically hybridize to these preferred target segments and consequently inhibit the expression of apolipoprotein B.
  • [0293]
    According to the present invention, antisense compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other short oligomeric compounds which hybridize to at least a portion of the target nucleic acid.
  • Example 17
  • [0000]
    Design of Phenotypic Assays for the use of Apolipoprotein B Inhibitors
  • [0294]
    Once apolipoprotein B inhibitors have been identified by the methods disclosed herein, the compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition. Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of apolipoprotein B in health and disease. Representative phenotypic assays, which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston, Mass.), protein-based assays including enzymatic assays (Panvera, LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene Research Products, San Diego, Calif.), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation (Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, Calif.; Amersham Biosciences, Piscataway, N.J.).
  • [0295]
    In one non-limiting example, cells determined to be appropriate for a particular phenotypic assay (i.e., MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with apolipoprotein B inhibitors identified from the in vitro studies as well as control compounds at optimal concentrations which are determined by the methods described above. At the end of the treatment period, treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.
  • [0296]
    Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest.
  • [0297]
    Measurement of the expression of one or more of the genes of the cell after treatment is also used as an indicator of the efficacy or potency of the apolipoprotein B inhibitors. Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.
  • Example 18
  • [0000]
    Activity in Animal Models
  • [0298]
    U.S. Application Publication No. 20040214325 published Oct. 28, 2004 and International Patent Publication WO2004044181 published May 27, 2004, the disclosures and particularly the examples of which are hereby incorporated by reference in their entirety, also describe the in vitro and in vivo biological effects of antisense inhibition of apolipoprotein B expression in mice and monkeys.
  • [0299]
    Treatment with ISIS 147764, a mouse-specific oligonucleotide, lowered cholesterol as well as LDL and HDL lipoproteins and serum glucose in both lean and high fat mice. The effects demonstrated are, in fact, due to the inhibition of apolipoprotein B expression as supported by the decrease in mRNA levels. No significant changes in liver enzyme levels were observed, indicating that the antisense oligonucleotide was not toxic to either treatment group.
  • [0300]
    Treatment of high fat fed mice with ISIS 147764 decreased apolipoprotein B protein expression in liver in a dose-dependent manner, reduced serum cholesterol and triglycerides, lowered levels of serum HDL, LDL and VLDL lipoproteins, reduced serum glucose levels, and decreased fat pad weight.
  • [0301]
    Treatment of apo E knockout mice with ISIS 147764 lowered glucose and cholesterol as well as serum HDL, LDL and VLDL lipoproteins. Further, these decreases correlated with a decrease in both protein and RNA levels of apolipoprotein B, demonstrating an antisense mechanism of action. No significant changes in liver enzyme levels were observed, indicating that the antisense oligonucleotide was not toxic to either treatment group.
  • [0302]
    LDL receptor-deficient mice (LDLr(−/−)mice), a strain that cannot edit the apolipoprotein B mRNA and therefore synthesize exclusively apolipoprotein B-100, have markedly elevated LDL cholesterol and apolipoprotein B-100 levels and develop extensive atherosclerosis. ISIS 147764 was able to lower cholesterol, triglycerides, and mRNA levels in a dose-dependent manner in both male and female LDLr(−/−) mice while the 4-base mismatch ISIS 270906 was not able to do this.
  • [0303]
    C57BL/6NTac-TgN(APOB100) transgenic mice have the human apolipoprotein B gene “knocked-in”. These mice express high levels of human apolipoprotein B100 resulting in mice with elevated serum levels of LDL cholesterol. Treatment with either of these oligonucleotides targeted to the human apolipoprotein B which is expressed in these mice markedly decreased the mRNA levels of the human apolipoprotein, while the levels of the endogenous mouse apolipoprotein B were unaffected, indicating that these oligonucleotides exhibit specificity for the human apolipoprotein B. Immunoblot analysis of liver protein samples reveals a reduction in the expression of both forms of human apolipoprotein B, apolipoprotein B-100 and apolipoprotein B-48. Mouse apolipoprotein B levels in liver were not significantly changed. LDL-cholesterol levels were significantly reduced.
  • [0304]
    ob/ob mice have a mutation in the leptin gene which results in obesity and hyperglycemia. Treatment of ob/ob mice receiving a high fat and cholesterol diet with ISIS 147483 and 147764 were both able to lower apolipoprotein B mRNA levels, as well as glucose, cholesterol, and triglyceride levels
  • [0305]
    Toxicity studies in mice revealed no severe toxic effects. In vitro assays showed that ISIS 301012 does not possess immunostimulatory activity.
  • [0306]
    In Cynomolgus monkeys, antisense inhibition by ISIS 301012 was compared to that of ISIS 326358, which is a perfect match to the Cynomolgus monkey apolipoprotein B sequence to which ISIS 301012 hybridizes. These data demonstrate that both ISIS 326359 and ISIS 301012 (despite two mismatches with the Cynomolgus monkey apolipoprotein B sequence) can inhibit the expression of apolipoprotein B mRNA in Cynomolgus monkey primary hepatocytes, in a dose- and time-dependent manner.
    TABLE 1
    Effects of antisense inhibition by ISIS 301012 in lean Cynomolgus monkeys
    Intravenous delivery Subcutaneous injection
    2 mg/kg 4 mg/kg 12 mg/kg 3.5 mg/kg 20 mg/kg
    apolipoprotein B expression −45 −76 −96 N.D. −94
    % change normalized to saline
    antisense oligonucleotide 92 179 550 N.D. 855
    concentration μg/g
    Lipid parameters,
    % change normalized
    to untreated
    baseline value Saline 2 mg/kg 4 mg/kg 12 mg/kg 3.5 mg/kg 20 mg/kg
    Total cholesterol +1 −6 −2 −2 +5 −5
    LDL-cholesterol +17 +15 +9 +3 −4 −16
    HDL-cholesterol −11 −23 −15 −8 +13 +5
    LDL/HDL +62 +94 +38 +44 −15 −19
    Total cholesterol/HDL +30 +44 +22 +21 −7 −10
    Triglyceride +37 +26 +32 +15 +1 −3
    LDL Particle +15 +8 +8 −11 −14 −21
    concentration
  • [0307]
    These data show that ISIS 301012 inhibits apolipoprotein B expression in a dose-dependent manner in a primate species and concomitantly lowers lipid levels at higher doses of ISIS 301012. Furthermore, these results demonstrate that antisense oligonucleotide accumulates in the liver in a dose-dependent manner.
  • Example 19
  • [0000]
    Identification of SNPs
  • [0308]
    Polymorphisms were discovered by comparing the apolipoprotein B genomic sequences of 213 DNA samples. An initial analysis of 23 DNA samples and a followup analysis of an additional 190 DNA samples was conducted to identify SNPs in the target region of ISIS 301012 (exon 20, boundary of intron 20). The 190 DNA samples came from individuals self-identified as belonging to one of four major population groups: Caucasian (47 individuals), African descent (48 individuals), Asian (47 individuals), or Hispanic (48 individuals). All samples were analyzed in replicates using SEQUENOM's MASSARRAY® approach including MASSCLEAVE® biochemistry.
  • [0309]
    Seven previously unknown SNPs with varying frequencies were discovered in an approximately 541 bp portion of the ISIS 301012 target region, none in the antisense or exon regions. The SNPs and their positions and frequencies are set forth in Table 2 below.
    TABLE 2
    Identification of SNPs
    Approximate frequency of
    Position in SNP detection out of 213
    Sequence variation SEQ ID NO: 1 samples of diverse ancestry
    Substitution of A to G 27751 15%
    Substitution of C to G 27735  <1%  
    Substitution of T to C 27685 27%
    Substitution of T to C 27683
    Substitution of T to C 27679 40%
    Substitution of C to T 27634  <1%  
    Substitution of G to A 27627  2%
    Substitution of T to C 27618  <1%  
  • [0310]
    The frequency of the T/C substitution at position 27679 and the T/C substitution at 27685 was significantly lower in Asian DNA samples compared to other ethnic groups. See table below.
    Position in African
    SEQ ID NO: 1 Asian American Hispanic Caucasian
    27685 9.8% 32.4% 42.2% 32.6%
    27679 19.7% 45.6% 43.8% 48.6%
  • [0311]
    The C/T substitution at position 27634 was only present in Asian samples. It was detected in one heterozygote Asian sample and one homozygote Asian sample.
  • [0312]
    The distribution of the A/G substitution at position 27751 does not match the Hardy-Weinberg disequilibrium; all samples carrying this sequence variation are heterozygote.
  • [0313]
    The G/A substitution at position 27627 was found only in four samples of African American origin.
  • [0314]
    The T/C substitution at position 27618 was found in one African American sample.

Claims (18)

  1. 1. An antisense compound 15 to 30 nucleobases in length which specifically hybridizes with an allelic variant of a nucleic acid of SEQ ID NO: 1 encoding human apolipoprotein B, wherein said compound inhibits the expression of apolipoprotein B mRNA by at least 10% and wherein said compound is targeted to a region that includes at least one nucleobase selected from the group consisting of:
    (a) C at position 27751 of SEQ ID NO: 1;
    (b) C at position 27735 of SEQ ID NO: 1;
    (c) G at position 27685 of SEQ ID NO: 1;
    (d) G at position 27683 of SEQ ID NO: 1;
    (e) G at position 27679 of SEQ ID NO: 1;
    (f) A at position 27634 of SEQ ID NO: 1;
    (g) T/U at position 27627 of SEQ ID NO: 1; or
    (h) G at position 27618 of SEQ ID NO: 1, wherein G is guanine, C is cytosine, T is thymine, U is uracil, and A is adenine.
  2. 2. The antisense compound of claim 1 comprising at least one nucleobase selected from the group consisting of:
    (a) G at position 15695 of SEQ ID NO: 2;
    (b) G at position 15711 of SEQ ID NO: 2;
    (c) C at position 15761 of SEQ ID NO: 2;
    (d) C at position 15763 of SEQ ID NO: 2;
    (e) C at position 15767 of SEQ ID NO: 2;
    (f) T/U at position 15812 of SEQ ID NO: 2;
    (g) A at position 15819 of SEQ ID NO: 2; or
    (h) C at position 15828 of SEQ ID NO: 2, wherein G is guanine, C is cytosine, T is thymine, U is uracil, and A is adenine.
  3. 3. The antisense compound of claim 1 which is 20 nucleobases in length.
  4. 4. The antisense compound of claim 1 comprising an oligonucleotide.
  5. 5. The antisense compound of claim 4 comprising a DNA oligonucleotide.
  6. 6. The antisense compound of claim 4 comprising an RNA oligonucleotide.
  7. 7. The antisense compound of claim 4 comprising a chimeric oligonucleotide.
  8. 8. The antisense compound of claim 4 wherein at least a portion of said compound hybridizes with RNA to form an oligonucleotide-RNA duplex.
  9. 9. The antisense compound of claim 1 having at least 80%, at least 85%, at least 90% or, at least 95% or at least 99% complementarity with said nucleic acid molecule encoding apolipoprotein B.
  10. 10. The antisense compound of claim 1 having one, two or more types of modifications, wherein the modification comprises a modified internucleoside linkage, sugar moiety, or nucleobase.
  11. 11. The antisense compound of claim 1 having at least one 2′-O-methoxyethyl sugar moiety.
  12. 12. The antisense compound of claim 1 having at least one phosphorothioate internucleoside linkage.
  13. 13. The antisense compound of claim 1 wherein at least one cytosine is a 5-methylcytosine.
  14. 14. A method of inhibiting the expression of apolipoprotein B in a cell or tissue comprising contacting said cell or tissue with the antisense compound of claim 1 so that expression of apolipoprotein B is inhibited.
  15. 15. A method of screening for a modulator of apolipoprotein B, the method comprising the steps of:
    contacting a preferred target segment of a nucleic acid molecule encoding apolipoprotein B with one or more candidate modulators of apolipoprotein B, and
    identifying one or more modulators of apolipoprotein B expression which modulate the expression of apolipoprotein B, wherein said preferred target segment comprises at least one of:
    (a) C at position 27751 of SEQ ID NO: 1;
    (b) C at position 27735 of SEQ ID NO: 1;
    (c) G at position 27685 of SEQ ID NO: 1;
    (d) G at position 27683 of SEQ ID NO: 1;
    (e) G at position 27679 of SEQ ID NO: 1;
    (f) A at position 27634 of SEQ ID NO: 1;
    (g) T/U at position 27627 of SEQ ID NO: 1; or
    (h) G at position 27618 of SEQ ID NO: 1, wherein G is guanine, C is cytosine, T is thymine, U is uracil, and A is adenine.
  16. 16. The method of claim 15 wherein the modulator of apolipoprotein B expression comprises an oligonucleotide, an antisense oligonucleotide, a DNA oligonucleotide, an RNA oligonucleotide, an RNA oligonucleotide having at least a portion of said RNA oligonucleotide capable of hybridizing with RNA to form an oligonucleotide-RNA duplex, or a chimeric oligonucleotide.
  17. 17. A method of treating an animal having a disease or condition associated with apolipoprotein B comprising administering to said animal a therapeutically or prophylactically effective amount of the antisense compound of claim 1 so that expression of apolipoprotein B is inhibited.
  18. 18. The method of claim 21 wherein the disease or condition is a disorder of lipid metabolism.
US11124020 2004-05-05 2005-05-05 SNPs of apolipoprotein B and modulation of their expression Abandoned US20050287558A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US56840904 true 2004-05-05 2004-05-05
US11124020 US20050287558A1 (en) 2004-05-05 2005-05-05 SNPs of apolipoprotein B and modulation of their expression

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US11124020 US20050287558A1 (en) 2004-05-05 2005-05-05 SNPs of apolipoprotein B and modulation of their expression
US13016917 US8916694B2 (en) 2004-05-05 2011-01-28 SNPs of apolipoprotein B and modulation of their expression
US14558402 US20150322429A1 (en) 2004-05-05 2014-12-02 SNPs OF APOLIPOPROTEIN B AND MODULATION OF THEIR EXPRESSION

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13016917 Continuation US8916694B2 (en) 2004-05-05 2011-01-28 SNPs of apolipoprotein B and modulation of their expression

Publications (1)

Publication Number Publication Date
US20050287558A1 true true US20050287558A1 (en) 2005-12-29

Family

ID=35506289

Family Applications (3)

Application Number Title Priority Date Filing Date
US11124020 Abandoned US20050287558A1 (en) 2004-05-05 2005-05-05 SNPs of apolipoprotein B and modulation of their expression
US13016917 Active US8916694B2 (en) 2004-05-05 2011-01-28 SNPs of apolipoprotein B and modulation of their expression
US14558402 Abandoned US20150322429A1 (en) 2004-05-05 2014-12-02 SNPs OF APOLIPOPROTEIN B AND MODULATION OF THEIR EXPRESSION

Family Applications After (2)

Application Number Title Priority Date Filing Date
US13016917 Active US8916694B2 (en) 2004-05-05 2011-01-28 SNPs of apolipoprotein B and modulation of their expression
US14558402 Abandoned US20150322429A1 (en) 2004-05-05 2014-12-02 SNPs OF APOLIPOPROTEIN B AND MODULATION OF THEIR EXPRESSION

Country Status (1)

Country Link
US (3) US20050287558A1 (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030087853A1 (en) * 2001-08-01 2003-05-08 Crooke Rosanne M. Antisense modulation of apolipoprotein B expression
US20030215943A1 (en) * 2001-08-01 2003-11-20 Crooke Rosanne M. Antisense modulation of apolipoprotein B expression
US20040214325A1 (en) * 2002-11-13 2004-10-28 Rosanne Crooke Antisense modulation of apolipoprotein B expression
US20060009410A1 (en) * 2002-11-13 2006-01-12 Crooke Rosanne M Effects of apolipoprotein B inhibition on gene expression profiles in animals
US20060035858A1 (en) * 2004-08-10 2006-02-16 Geary Richard S Methods for modulating lipoprotein and cholesterol levels in humans
US20060134189A1 (en) * 2004-11-17 2006-06-22 Protiva Biotherapeutics, Inc siRNA silencing of apolipoprotein B
US20070293451A1 (en) * 2006-05-02 2007-12-20 University Of Pittsburgh Regulation ao ApoB by Hsp110 proteins and related compositions and methods
WO2008140776A1 (en) * 2007-05-09 2008-11-20 The Brigham And Women's Hospital, Inc. Polymorphism in the apo (a) gene predict responsiveness to acetylsalicylic acid treatment
US20100297105A1 (en) * 2007-03-24 2010-11-25 Genzyme Corporation Administering antisense oligonucleotides complementary to human apolipoprotein b
US20130281313A1 (en) * 2010-09-01 2013-10-24 Institut Gustave Roussy Prognostic and/or predictive biomarkers and biological applications thereof
USRE44760E1 (en) 2002-11-13 2014-02-11 Genzyme Corporation Antisense modulation of apolipoprotein B-expression
US8673871B2 (en) 2006-05-05 2014-03-18 Isis Pharmaceuticals, Inc. Compounds and methods for modulating expression ApoB
US8916694B2 (en) 2004-05-05 2014-12-23 Genzyme Corporation SNPs of apolipoprotein B and modulation of their expression
US9107933B2 (en) 2009-03-16 2015-08-18 Isis Pharmaceuticals, Inc. Compositions and methods of targeting apolipoprotein B for the reduction of apolipoprotein C-III

Citations (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6184212B2 (en) *
US5220006A (en) * 1990-10-23 1993-06-15 The United States Of America As Represented By The Department Of Health And Human Services Identification of a suppressor of atherogenic apolipoprotein
US5434058A (en) * 1993-02-09 1995-07-18 Arch Development Corporation Apolipoprotein B MRNA editing protein compositions and methods
US5618674A (en) * 1991-12-23 1997-04-08 Chiron Corporation Chlamydiae probes for use in solution phase sandwich hybridization assays
US5656612A (en) * 1994-05-31 1997-08-12 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of raf gene expression
US5712257A (en) * 1987-08-12 1998-01-27 Hem Research, Inc. Topically active compositions of mismatched dsRNAs
US5786206A (en) * 1991-10-09 1998-07-28 The Scripps Research Institute DNA encoding recombinant lipoprotein antigens
US5801154A (en) * 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5945290A (en) * 1998-09-18 1999-08-31 Isis Pharmaceuticals, Inc. Antisense modulation of RhoA expression
US6033910A (en) * 1999-07-19 2000-03-07 Isis Pharmaceuticals Inc. Antisense inhibition of MAP kinase kinase 6 expression
US6096516A (en) * 1995-11-02 2000-08-01 Korea Institute Of Science & Technology cDNAs encoding murine antibody against human plasma apolipoprotein B-100
US6156315A (en) * 1997-10-10 2000-12-05 The Trustees Of Columbia University In The City Of New York Method for inhibiting the binding of low density lipoprotein to blood vessel matrix
US6172216B1 (en) * 1998-10-07 2001-01-09 Isis Pharmaceuticals Inc. Antisense modulation of BCL-X expression
US6184212B1 (en) * 1998-03-26 2001-02-06 Isis Pharmaceuticals Inc. Antisense modulation of human mdm2 expression
US6235470B1 (en) * 1993-11-12 2001-05-22 The Johns Hopkins University School Of Medicine Detection of neoplasia by analysis of saliva
US20020123617A1 (en) * 1999-12-23 2002-09-05 Starling Gary C. Novel immunoglobulin superfamily members of APEX-1, APEX-2 and APEX-3 and uses thereof
US6512161B1 (en) * 1998-01-08 2003-01-28 Aventis Pharmaceuticals, Inc. Transgenic rabbit that expresses a functional human lipoprotein (a)
US6534277B1 (en) * 2000-04-14 2003-03-18 Millennium Pharmaceuticals, Inc. Method for identifying a compound to be tested for an ability to reduce immune rejection by determining Stat4 and Stat6 proteins
US20030087853A1 (en) * 2001-08-01 2003-05-08 Crooke Rosanne M. Antisense modulation of apolipoprotein B expression
US6582908B2 (en) * 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US20030215943A1 (en) * 2001-08-01 2003-11-20 Crooke Rosanne M. Antisense modulation of apolipoprotein B expression
US6660737B2 (en) * 2001-05-04 2003-12-09 The Procter & Gamble Company Medicinal uses of hydrazones
US20030228613A1 (en) * 2001-10-15 2003-12-11 Carole Bornarth Nucleic acid amplification
US6670461B1 (en) * 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US20040171566A1 (en) * 1999-04-06 2004-09-02 Monia Brett P. Antisense modulation of p38 mitogen activated protein kinase expression
US20040209838A1 (en) * 2003-03-21 2004-10-21 Monia Brett P. Modulation of diacylglycerol acyltransferase 1 expression
US20040214325A1 (en) * 2002-11-13 2004-10-28 Rosanne Crooke Antisense modulation of apolipoprotein B expression
US20040241651A1 (en) * 2000-04-07 2004-12-02 Alexander Olek Detection of single nucleotide polymorphisms (snp's) and cytosine-methylations
US20040266714A1 (en) * 2003-04-28 2004-12-30 Susan Freier Modulation of glucagon receptor expression
US20050014713A1 (en) * 2003-04-28 2005-01-20 Freier Susan M. Modulation of glucagon receptor expression
US20050043524A1 (en) * 2003-08-18 2005-02-24 Isis Pharmaceuticals, Inc. Modulation of diacylglycerol acyltransferase 2 expression
US6878729B2 (en) * 2001-05-04 2005-04-12 The Procter & Gamble Company Medicinal uses of dihydropyrazoles
US20050164271A1 (en) * 2004-01-20 2005-07-28 Sanjay Bhanot Modulation of glucocorticoid receptor expression
US6949367B1 (en) * 1998-04-03 2005-09-27 Epoch Pharmaceuticals, Inc. Modified oligonucleotides for mismatch discrimination
US20060009410A1 (en) * 2002-11-13 2006-01-12 Crooke Rosanne M Effects of apolipoprotein B inhibition on gene expression profiles in animals
US20060035858A1 (en) * 2004-08-10 2006-02-16 Geary Richard S Methods for modulating lipoprotein and cholesterol levels in humans
US20070087987A1 (en) * 2005-09-19 2007-04-19 Monia Brett P Modulation of glucagon receptor expression
US20070238698A1 (en) * 2006-04-07 2007-10-11 Hsien-Chih Lin Method for manufacturing drinking water having chitosan

Family Cites Families (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE68901285D1 (en) 1988-03-10 1992-05-27 Ici Plc Method of proof of nucleotide-sequences.
WO1992010590A1 (en) 1990-12-10 1992-06-25 Gilead Sciences, Inc. Inhibition of transcription by formation of triple helixes
DE69131718T2 (en) 1990-12-21 2000-03-02 Rockefeller University New Yor For liver-enriched transcription factor
US5578444A (en) 1991-06-27 1996-11-26 Genelabs Technologies, Inc. Sequence-directed DNA-binding molecules compositions and methods
US5877009A (en) 1991-08-16 1999-03-02 Trustees Of Boston University Isolated ApoA-I gene regulatory sequence elements
DE4129653A1 (en) 1991-09-06 1993-03-11 Boehringer Mannheim Gmbh A method for detecting nucleic acids similar
US6103890A (en) 1994-05-18 2000-08-15 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids that cleave C-fos
WO1994013794A1 (en) 1992-12-04 1994-06-23 Brigham And Women's Hospital, Inc. Human thrombospondin-4
US20030129589A1 (en) 1996-11-06 2003-07-10 Hubert Koster Dna diagnostics based on mass spectrometry
WO1997020924A1 (en) 1995-12-04 1997-06-12 Saicom S.R.L A class of oligonucleotides, therapeutically useful as antitumoural agents
JP2000507943A (en) 1996-03-26 2000-06-27 グラクソ、グループ、リミテッド Tumor necrosis factor α converter zero
WO1998036641A1 (en) 1997-02-20 1998-08-27 The Schepens Eye Research Institute, Inc. Control of il4 production as a therapeutic regulator of immune function
EP2341058A3 (en) 1997-09-12 2011-11-23 Exiqon A/S Oligonucleotide Analogues
GB9721240D0 (en) 1997-10-08 1997-12-03 Zeneca Ltd Assay
EP0911344B1 (en) 1997-10-15 2004-03-03 Fujirebio Inc. Anti-Apo-B-48 monoclonal antibody, hybridoma, and methods of use
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6007995A (en) 1998-06-26 1999-12-28 Isis Pharmaceuticals Inc. Antisense inhibition of TNFR1 expression
CN1350591A (en) 1999-03-18 2002-05-22 埃克西库恩公司 One step sample preparation and detection of nucleic acids in complex biological samples
RU2001128165A (en) 1999-03-18 2004-03-27 Эксикон А/С (Dk) Identification of mutations in genes by lna-specific primers
US6140124A (en) 1999-04-06 2000-10-31 Isis Pharmaceuticals Inc. Antisense modulation of P38 mitogen activated protein kinase expression
US5998148A (en) 1999-04-08 1999-12-07 Isis Pharmaceuticals Inc. Antisense modulation of microtubule-associated protein 4 expression
WO2001012789A3 (en) 1999-08-18 2001-06-14 Baylor College Medicine APOLIPOPROTEIN B mRNA-SPECIFIC RIBOZYME
WO2001030354A1 (en) 1999-10-26 2001-05-03 Thomas Jefferson University REGULATION OF Apob FOR DIAGNOSIS, TREATMENT AND DRUG SCREENING FOR CARDIOVASCULAR AND METABOLIC DISORDERS OR SYNDROMES
US6180403B1 (en) 1999-10-28 2001-01-30 Isis Pharmaceuticals Inc. Antisense inhibition of tumor necrosis factor alpha converting enzyme (TACE) expression
JP2003520042A (en) 2000-01-24 2003-07-02 アイシス・ファーマシューティカルス・インコーポレーテッド Antisense modulation of inducible nitric oxide synthase expression
EP1239051A3 (en) 2001-01-30 2004-03-17 Aeomica, Inc. Human posh-like protein 1
US20030064950A1 (en) 2001-02-23 2003-04-03 Ntambi James M. Methods for reducing body fat and increasing lean body mass by reducing stearoyl-CoA desaturase 1 activity
EP1263765A4 (en) 2000-03-28 2005-06-29 ALTERATION OF CELLULAR BEHAVIOR BY ANTISENSE MODULATION OF mRNA PROCESSING
WO2002026768A3 (en) 2000-09-29 2002-06-13 Genaissance Pharmaceuticals Haplotypes of the por gene
JP2002355074A (en) 2001-01-24 2002-12-10 Univ Tsukuba Nucleic acid molecule and polypeptide specific to enteropathogenic escherichia coli o157:h7 and method for using the same
US20030008373A1 (en) 2001-04-17 2003-01-09 Myriad Genetics, Incorporated APOA1-interacting proteins and use thereof
US6964950B2 (en) 2001-07-25 2005-11-15 Isis Pharmaceuticals, Inc. Antisense modulation of C-reactive protein expression
WO2003097662A8 (en) 2002-05-15 2004-10-07 Rosanne M Crooke Antisense modulation of apolipoprotein b expression
US6852536B2 (en) 2001-12-18 2005-02-08 Isis Pharmaceuticals, Inc. Antisense modulation of CD36L 1 expression
CA2477611A1 (en) 2002-03-01 2003-09-12 Ravgen, Inc. Rapid analysis of variations in a genome
JP4986109B2 (en) 2002-11-13 2012-07-25 ジェンザイム・コーポレーション Antisense modulation of apolipoprotein b expression
WO2003097097A1 (en) 2002-05-15 2003-11-27 Yoshiro Niitsu Method of treating and/or preventing acute leukemia using medicinal composition for therapeutic use containing vla4 antagonist, and method of diagnosing prognosis of acute leukemia using vla4 as indication
US8090542B2 (en) 2002-11-14 2012-01-03 Dharmacon Inc. Functional and hyperfunctional siRNA
EP1599849A1 (en) 2003-02-28 2005-11-30 Edmund John Gemmell Apparatus and method for displaying information
US7598227B2 (en) 2003-04-16 2009-10-06 Isis Pharmaceuticals Inc. Modulation of apolipoprotein C-III expression
EP1677822B1 (en) 2003-09-18 2014-04-23 Isis Pharmaceuticals, Inc. 4'-thionucleosides and oligomeric compounds
WO2005049621A1 (en) 2003-11-13 2005-06-02 Isis Pharmaceuticals, Inc. 5,6-dihydroxy-isoindole derivatives as linkers for oligomer solid phase synthesis
US20050287558A1 (en) 2004-05-05 2005-12-29 Crooke Rosanne M SNPs of apolipoprotein B and modulation of their expression
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
US20090118213A1 (en) 2005-09-15 2009-05-07 Henrik Frydenlund Hansen Rna antagonist compounds for the inhibition of apo-b100 expression
WO2007134014A3 (en) 2006-05-05 2009-04-09 Sanjay Bhanot Compounds and methods for modulating expression of gcgr
WO2007090071A3 (en) 2006-01-27 2008-01-24 Isis Pharmaceuticals Inc 6-modified bicyclic nucleic acid analogs
ES2389737T3 (en) 2006-05-11 2012-10-31 Isis Pharmaceuticals, Inc. Bicyclic analogues modified nucleic acids 5 '
KR20090128494A (en) 2007-03-24 2009-12-15 겐자임 코포레이션 Administering antisense oligonucleotides complementary to human apolipoprotein b
US9107933B2 (en) 2009-03-16 2015-08-18 Isis Pharmaceuticals, Inc. Compositions and methods of targeting apolipoprotein B for the reduction of apolipoprotein C-III

Patent Citations (44)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6184212B2 (en) *
US5712257A (en) * 1987-08-12 1998-01-27 Hem Research, Inc. Topically active compositions of mismatched dsRNAs
US5220006A (en) * 1990-10-23 1993-06-15 The United States Of America As Represented By The Department Of Health And Human Services Identification of a suppressor of atherogenic apolipoprotein
US6582908B2 (en) * 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5786206A (en) * 1991-10-09 1998-07-28 The Scripps Research Institute DNA encoding recombinant lipoprotein antigens
US5618674A (en) * 1991-12-23 1997-04-08 Chiron Corporation Chlamydiae probes for use in solution phase sandwich hybridization assays
US5434058A (en) * 1993-02-09 1995-07-18 Arch Development Corporation Apolipoprotein B MRNA editing protein compositions and methods
US5801154A (en) * 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US6235470B1 (en) * 1993-11-12 2001-05-22 The Johns Hopkins University School Of Medicine Detection of neoplasia by analysis of saliva
US5656612A (en) * 1994-05-31 1997-08-12 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of raf gene expression
US6096516A (en) * 1995-11-02 2000-08-01 Korea Institute Of Science & Technology cDNAs encoding murine antibody against human plasma apolipoprotein B-100
US6670461B1 (en) * 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US6156315A (en) * 1997-10-10 2000-12-05 The Trustees Of Columbia University In The City Of New York Method for inhibiting the binding of low density lipoprotein to blood vessel matrix
US6512161B1 (en) * 1998-01-08 2003-01-28 Aventis Pharmaceuticals, Inc. Transgenic rabbit that expresses a functional human lipoprotein (a)
US6184212B1 (en) * 1998-03-26 2001-02-06 Isis Pharmaceuticals Inc. Antisense modulation of human mdm2 expression
US6949367B1 (en) * 1998-04-03 2005-09-27 Epoch Pharmaceuticals, Inc. Modified oligonucleotides for mismatch discrimination
US5945290A (en) * 1998-09-18 1999-08-31 Isis Pharmaceuticals, Inc. Antisense modulation of RhoA expression
US6172216B1 (en) * 1998-10-07 2001-01-09 Isis Pharmaceuticals Inc. Antisense modulation of BCL-X expression
US20040171566A1 (en) * 1999-04-06 2004-09-02 Monia Brett P. Antisense modulation of p38 mitogen activated protein kinase expression
US6033910A (en) * 1999-07-19 2000-03-07 Isis Pharmaceuticals Inc. Antisense inhibition of MAP kinase kinase 6 expression
US20020123617A1 (en) * 1999-12-23 2002-09-05 Starling Gary C. Novel immunoglobulin superfamily members of APEX-1, APEX-2 and APEX-3 and uses thereof
US20040241651A1 (en) * 2000-04-07 2004-12-02 Alexander Olek Detection of single nucleotide polymorphisms (snp's) and cytosine-methylations
US6534277B1 (en) * 2000-04-14 2003-03-18 Millennium Pharmaceuticals, Inc. Method for identifying a compound to be tested for an ability to reduce immune rejection by determining Stat4 and Stat6 proteins
US6878729B2 (en) * 2001-05-04 2005-04-12 The Procter & Gamble Company Medicinal uses of dihydropyrazoles
US6660737B2 (en) * 2001-05-04 2003-12-09 The Procter & Gamble Company Medicinal uses of hydrazones
US7407943B2 (en) * 2001-08-01 2008-08-05 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein B expression
US20030087853A1 (en) * 2001-08-01 2003-05-08 Crooke Rosanne M. Antisense modulation of apolipoprotein B expression
US20030215943A1 (en) * 2001-08-01 2003-11-20 Crooke Rosanne M. Antisense modulation of apolipoprotein B expression
US20030228613A1 (en) * 2001-10-15 2003-12-11 Carole Bornarth Nucleic acid amplification
US20040214325A1 (en) * 2002-11-13 2004-10-28 Rosanne Crooke Antisense modulation of apolipoprotein B expression
US20050009088A1 (en) * 2002-11-13 2005-01-13 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein B-expression
US20060009410A1 (en) * 2002-11-13 2006-01-12 Crooke Rosanne M Effects of apolipoprotein B inhibition on gene expression profiles in animals
US7511131B2 (en) * 2002-11-13 2009-03-31 Genzyme Corporation Antisense modulation of apolipoprotein B expression
US20040209838A1 (en) * 2003-03-21 2004-10-21 Monia Brett P. Modulation of diacylglycerol acyltransferase 1 expression
US20050014713A1 (en) * 2003-04-28 2005-01-20 Freier Susan M. Modulation of glucagon receptor expression
US20040266714A1 (en) * 2003-04-28 2004-12-30 Susan Freier Modulation of glucagon receptor expression
US20070238688A1 (en) * 2003-04-28 2007-10-11 Sanjay Bhanot Modulation of glucagon receptor expression
US20050272680A1 (en) * 2003-08-18 2005-12-08 Sanjay Bhanot Modulation of diacylglycerol acyltransferase 2 expression
US20050043524A1 (en) * 2003-08-18 2005-02-24 Isis Pharmaceuticals, Inc. Modulation of diacylglycerol acyltransferase 2 expression
US20050164271A1 (en) * 2004-01-20 2005-07-28 Sanjay Bhanot Modulation of glucocorticoid receptor expression
US20060025373A1 (en) * 2004-01-20 2006-02-02 Isis Pharmaceuticals, Inc. Modulation of glucocorticoid receptor expression
US20060035858A1 (en) * 2004-08-10 2006-02-16 Geary Richard S Methods for modulating lipoprotein and cholesterol levels in humans
US20070087987A1 (en) * 2005-09-19 2007-04-19 Monia Brett P Modulation of glucagon receptor expression
US20070238698A1 (en) * 2006-04-07 2007-10-11 Hsien-Chih Lin Method for manufacturing drinking water having chitosan

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030215943A1 (en) * 2001-08-01 2003-11-20 Crooke Rosanne M. Antisense modulation of apolipoprotein B expression
US7407943B2 (en) 2001-08-01 2008-08-05 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein B expression
US20080242629A1 (en) * 2001-08-01 2008-10-02 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein b expression
US8735364B2 (en) 2001-08-01 2014-05-27 Genzyme Corporation Antisense modulation of apolipoprotein B expression
US7888324B2 (en) 2001-08-01 2011-02-15 Genzyme Corporation Antisense modulation of apolipoprotein B expression
US20030087853A1 (en) * 2001-08-01 2003-05-08 Crooke Rosanne M. Antisense modulation of apolipoprotein B expression
US7511131B2 (en) 2002-11-13 2009-03-31 Genzyme Corporation Antisense modulation of apolipoprotein B expression
US20060009410A1 (en) * 2002-11-13 2006-01-12 Crooke Rosanne M Effects of apolipoprotein B inhibition on gene expression profiles in animals
USRE44760E1 (en) 2002-11-13 2014-02-11 Genzyme Corporation Antisense modulation of apolipoprotein B-expression
US20040214325A1 (en) * 2002-11-13 2004-10-28 Rosanne Crooke Antisense modulation of apolipoprotein B expression
US20050009088A1 (en) * 2002-11-13 2005-01-13 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein B-expression
US20100331390A1 (en) * 2002-11-13 2010-12-30 Genzyme Corporation Effects of apolipoprotein b inhibition on gene expression profiles in animals
US7803930B2 (en) 2002-11-13 2010-09-28 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein B-expression
US8916694B2 (en) 2004-05-05 2014-12-23 Genzyme Corporation SNPs of apolipoprotein B and modulation of their expression
US20090326040A1 (en) * 2004-08-10 2009-12-31 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein b expression
US20060035858A1 (en) * 2004-08-10 2006-02-16 Geary Richard S Methods for modulating lipoprotein and cholesterol levels in humans
US20060134189A1 (en) * 2004-11-17 2006-06-22 Protiva Biotherapeutics, Inc siRNA silencing of apolipoprotein B
US20070293451A1 (en) * 2006-05-02 2007-12-20 University Of Pittsburgh Regulation ao ApoB by Hsp110 proteins and related compositions and methods
US8673871B2 (en) 2006-05-05 2014-03-18 Isis Pharmaceuticals, Inc. Compounds and methods for modulating expression ApoB
US9045754B2 (en) 2006-05-05 2015-06-02 Isis Pharmaceuticals, Inc. Short antisense compounds with gapmer configuration
US20100297105A1 (en) * 2007-03-24 2010-11-25 Genzyme Corporation Administering antisense oligonucleotides complementary to human apolipoprotein b
US9347061B2 (en) 2007-03-24 2016-05-24 Genzyme Corporation Administering antisense oligonucleotides complementary to human apolipoprotein B
US20110206667A1 (en) * 2007-05-09 2011-08-25 The Brigham And Women's Hospital, Inc. Polymorphism in the apo(a) gene predict responsiveness to acetylsalicylic acid treatment
US7943317B2 (en) 2007-05-09 2011-05-17 The Brigham And Women's Hospital, Inc. Polymorphism in the Apo(a) gene predict responsiveness to acetylsalicylic acid treatment
WO2008140776A1 (en) * 2007-05-09 2008-11-20 The Brigham And Women's Hospital, Inc. Polymorphism in the apo (a) gene predict responsiveness to acetylsalicylic acid treatment
US20090004187A1 (en) * 2007-05-09 2009-01-01 Paul Ridker Polymorphism in the apo(a) gene predict responsiveness to acetylsalicylic acid treatment (ridker)
US9107933B2 (en) 2009-03-16 2015-08-18 Isis Pharmaceuticals, Inc. Compositions and methods of targeting apolipoprotein B for the reduction of apolipoprotein C-III
US20130281313A1 (en) * 2010-09-01 2013-10-24 Institut Gustave Roussy Prognostic and/or predictive biomarkers and biological applications thereof

Also Published As

Publication number Publication date Type
US20150322429A1 (en) 2015-11-12 application
US8916694B2 (en) 2014-12-23 grant
US20110319469A1 (en) 2011-12-29 application

Similar Documents

Publication Publication Date Title
US20030139359A1 (en) Antisense modulation of phospholipid scramblase 3 expression
US20050107328A1 (en) Antisense modulation of polo-like kinase expression
US20030087853A1 (en) Antisense modulation of apolipoprotein B expression
US20060025372A1 (en) Antisense modulation of PTP1B expression
US20040214325A1 (en) Antisense modulation of apolipoprotein B expression
US6617162B2 (en) Antisense modulation of estrogen receptor alpha expression
US20030114412A1 (en) Antisense modulation of RECQL5 expression
US7229976B2 (en) Modulation of forkhead box O1A expression
US7468431B2 (en) Modulation of eIF4E-BP2 expression
US20050053981A1 (en) Gapped oligomeric compounds having linked bicyclic sugar moieties at the termini
US20040101857A1 (en) Modulation of cytokine-inducible kinase expression
US20050113326A1 (en) Antisense oligonucleotides optimized for kidney targeting
US20050074801A1 (en) Chimeric oligomeric compounds comprising alternating regions of northern and southern conformational geometry
US6455307B1 (en) Antisense modulation of casein kinase 2-alpha prime expression
US20040110150A1 (en) Modulation of Ephrin-B2 expression
US7217572B2 (en) Modulation of HIF1α and HIF2α expression
US7199107B2 (en) Antisense modulation of kinesin-like 1 expression
US7425545B2 (en) Modulation of C-reactive protein expression
US20040102391A1 (en) Modulation of Gankyrin expression
US20060025373A1 (en) Modulation of glucocorticoid receptor expression
US7732590B2 (en) Modulation of diacylglycerol acyltransferase 2 expression
US7399853B2 (en) Modulation of glucagon receptor expression
US7176303B2 (en) Modulation of STAT5 expression
US20050014713A1 (en) Modulation of glucagon receptor expression
US7750141B2 (en) Modulation of apolipoprotein c-III expression

Legal Events

Date Code Title Description
AS Assignment

Owner name: ISIS PHARMACEUTICALS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CROOKE, ROSANNE M.;GRAHAM, MARK J.;REEL/FRAME:016652/0754

Effective date: 20050803

Owner name: SEQUENOM, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:MAH, STEVEN;REEL/FRAME:016652/0958

Effective date: 20050810

AS Assignment

Owner name: GENZYME CORPORATION, MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ISIS PHARMACEUTICALS, INC.;REEL/FRAME:021303/0099

Effective date: 20080717

AS Assignment

Owner name: GENZYME CORPORATION, MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ISIS PHARMACEUTICALS, INC.;REEL/FRAME:021336/0565

Effective date: 20080717

AS Assignment

Owner name: IONIS PHARMACEUTICALS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:GENZYME CORPORATION;REEL/FRAME:038753/0455

Effective date: 20160502

Owner name: KASTLE THERAPEUTICS, LLC., ILLINOIS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:IONIS PHARMACEUTICALS, INC.;REEL/FRAME:038754/0487

Effective date: 20160505