Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
  • C12N2740/13041—Use of virus, viral particle or viral elements as a vector
  • C12N2740/13043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/16011—Human Immunodeficiency Virus, HIV
  • C12N2740/16021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/16011—Human Immunodeficiency Virus, HIV
  • C12N2740/16022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/16011—Human Immunodeficiency Virus, HIV
  • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
  • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/16011—Human Immunodeficiency Virus, HIV
  • C12N2740/16061—Methods of inactivation or attenuation
  • C12N2740/16062—Methods of inactivation or attenuation by genetic engineering
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
  • C12N2760/00011—Details
  • C12N2760/20011—Rhabdoviridae
  • C12N2760/20211—Vesiculovirus, e.g. vesicular stomatitis Indiana virus
  • C12N2760/20222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

• retroviruses deliver their nucleoprotein core into the cytoplasm of the target cell.
• reverse transcription of the viral genome takes place while the core matures into a preintegration complex.
• the complex must reach the nucleus to achieve integration of the viral DNA into the host cell chromosomes.
• retroviral vectors into the host genome was thought to be restricted to cells undergoing DNA replication.
• retroviral vectors capable of infecting a broad class of cell types are known, cell division is necessary for the proviral integration of these vectors This effectively restricts the efficient use of retrovirus vectors to replicating cells
• retroviruses have not been utilized to introduce genes into non-dividing or post-mitotic cells
• Lentiviruses are complex retroviruses, which, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function
• HIV Human Immunodeficiency Virus
• MDM monocyte-de ⁇ ved macrophages
• HeLa-Cd4 or T lymphoid cells arrested in the cell cycle by treatment with aphidicolin or y irradiation Infection of these cells is dependent on the active nuclear import of HIV preintegration complexes through the nuclear pores of the target cells This occurs by the interaction of multiple, partly redundant, molecular determinants in the complex with the nuclear import machinery of
• the present invention provides a recombinant retrovirus that infects non-dividing host cells and transfers nucleic acid sequences which can then be expressed in the host cell
• the present invention solves a long-felt need for a means of delivery of nucleic acid sequences to non-dividing cells
• the invention provides a recombinant retrovirus capable of infecting a non-dividing cell comprising a viral GAG, a viral POL, a viral ENV, a heterologous nucleic acid sequence operably linked to a regulatory nucleic acid sequence, and c/s-actmg nucleic acid sequences necessary for reverse transc ⁇ ption and integration .
• the recombinant retrovirus ofthe invention is preferably a lentivirus.
• the invention provides a method of producing a recombinant retrovirus capable of infecting a non-dividing cell comprising transfecting a suitable host cell with the following a vector providing a nucleic acid encoding a viral gag and a viral pol, a vector providing a nucleic acid encoding a viral env, a vector providing a nucleic acid sequence encoding a packaging signal flanked by c/s-acting nucleic acid sequences for reverse transcription and integration, and providing a cloning site for introduction of a heterologous nucleic acid sequence, operably linked to a regul ⁇ atory nucleic acid sequence, and recovering the recombinant virus
• the invention provides a method for introduction and expression of a heterologous nucleic acid sequence in a non-dividing cell comprising infecting the non-dividing cell with the recombinant virus of the invention and expressing the heterologous nucleic acid sequence in the non-dividing cell
• Figure 1 is a schematic illustration of the method for production of an HIV-based recombinant retrovirus
• Figure 3 is a table of titers of recombinant virus after co-transfection of 293T cells (fibroblast packaging cell line) with HIV-based and MLV-based packaging constructs
• Figure 4 is a graph of the efficiency of transduction of HIV and MLV-based CMV- ⁇ - galactosidase vectors into growing HeLa cells, cells arrested at the G1/S interphase by aphidico n, and cells arrested at G2 by x-rays
• Figure 5 is a graph of the efficiency of transduction of HIV and MLV CMV-luciferase vectors into rat 208F fibroblasts in GO after 4, 7, 11 , and 15 days
• Figure 6 is a graph of the efficiency of transduction of HIV and MLV CMV-luciferase vectors into human primary macrophages.
• Figure 7 is a graph of survival of HIV- and MLV-based vector in cells arrested for 3 weeks, inoculated with the vectors, and induced to divide at indicated times after infection Description of the Preferred Embodiments
• the present invention provides a recombinant retrovirus capable of infecting non- dividing cells.
• the virus is useful for the in vivo and ex vivo transfer and expression of genes nucleic acid sequences (e.g., in non-dividing cells).
• Retroviruses are RNA viruses wherein the viral genome is RNA.
• the genomic RNA is reverse transcribed into a DNA intermediate which is integrated very efficiently into the chromosomal DNA of infected cells.
• This integrated DNA intermediate is referred to as a provirus.
• Transcription of the provirus and assembly into infectious virus occurs in the presence of an appropriate helper virus or in a cell line containing appropriate sequences enabling encapsidation without coincident production of a contaminating helper virus.
• a helper virus is not required for the production of the recombinant retrovirus of the present invention, since the sequences for encapsidation are provided by co-transfection with appropriate vectors
• the retroviral genome and the proviral DNA have three genes- the gag, the pol, and the env, which are flanked by two long terminal repeat (LTR) sequences.
• the gag gene encodes the internal structural (matrix, capsid, and nucleocapsid) proteins; the pol gene encodes the RNA-directed DNA polymerase (reverse transcriptase) and the env gene encodes viral envelope glycoproteins.
• the 5' and 3' LTRs serve to promote transcription and polyadenylation of the vi ⁇ on RNAs.
• the LTR contains all other cis- actmg sequences necessary for viral replication.
• Lentiviruses have additional genes including vif, vpr, tat, rev, vpu, nef, and vpx (in HIV-1 , HIV-2 and/or SIV).
• Adjacent to the 5' LTR are sequences necessary for reverse transcription of the genome (the tRNA primer binding site) and for efficient encapsidation of viral RNA into particles (the Psi site) If the sequences necessary for encapsidation (or packaging of retrovirual RNA into infectious virions) are missing from the viral genome, the result is a cis defect which prevents encapsidation of genomic RNA. However, the resulting mutant is still capable of directing the synthesis of all virion proteins.
• the invention provides a recombinant retrovirus capable of infecting a non-dividing cell.
• the recombinant retrovirus comprises a viral GAG, a viral POL, a viral ENV, a heterologous nucleic acid sequence operably linked to a regulatory nucleic acid sequence, and c/s-acting nucleic acid sequences necessary for packaging, reverse transcription and integration, as described above It should be understood that the recombinant retrovirus of the invention is capable of infecting dividing cells as well as non-dividing cells
• the recombinant retrovirus of the invention is therefore genetically modified in such a way that some of the structural, infectious genes of the native virus have been removed and replaced instead with a nucleic acid sequence to be delivered to a target non-dividing cell
• the virus injects its nucleic acid into the cell and the retrovirus genetic material can integrate into the host cell genome
• the transferred retrovirus genetic material is then transcribed and translated into proteins within the host cell
• the invention provides a method of producing a recombinant retrovirus capable of infecting a non-dividing cell comprising transfecting a suitable host cell with the following a vector providing a nucleic acid encoding a viral gag and a viral pol, a vector providing a nucleic acid encoding a viral env, a vector providing a nucleic acid sequence encoding a packaging signal flanked by c/s-acting nucleic acid sequences for reverse transcription and integration, and providing a cloning site for introduction of a heterologous gene, operably linked to a regulatory nucleic acid sequence and recovering the recombinant virus
• FIGURE 1 An illustration of the individual vectors used in the method of the invention is shown in FIGURE 1
• the method of the invention includes the combination of a minimum of three vectors in order to produce a recombinant vi ⁇ on or recombinant retrovirus
• a first vector provides a nucleic acid encoding a viral gag and a viral pol (see the illustrative Packaging Construct, FIGURE 1) These sequences encode a group specific antigen and reverse transcriptase, (and mtegrase and protease-enzymes necessary for maturation and reverse transcription), respectively, as discussed above
• the viral gag and pol are derived from a lentivirus, and most preferably from HIV
• a second vector provides a nucleic acid encoding a viral envelope (env)
• the env gene can be derived from any virus, including retroviruses.
• the env may be amphotropic envelope protein which allows transduction of cells of human and other species, or may be ecotropic envelope protein, which is able to transduce only mouse and rat cells Further, it may be desirable to target the recombinant virus by linkage of the envelope protein with an antibody or a particular ligand for targeting to a receptor of a particular cell-type
• the vector is now target specific Retroviral vectors can be made target specific by inserting, for example, a glycolipid, or a protein Targeting is often accomplished by using an antibody to target the retroviral vector Those of skill in the art will know of, or can readily ascertain without undue experimentation, specific methods to achieve delivery of a retroviral vector
• retroviral-de ⁇ ved env genes include, but are not limited to Moloney murine leukemia virus (MoMuLV) Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV) gibbon ape leukemia virus (GaLV) human immunodeficiency virus (HIV) and Rous Sarcoma Virus (RSV)
• MoMuLV Moloney murine leukemia virus
• HaMuSV Harvey murine sarcoma virus
• MoMTV murine mammary tumor virus
• GaLV gibbon ape leukemia virus
• HV human immunodeficiency virus
• RSV Rous Sarcoma Virus
• VSV Vesicular stomatitis virus
• the vector providing the viral env nucleic acid sequence is operably associated with regulatory sequence, e g , a promoter or enhancer (see Pseudotyping ENV plasmid, FIGURE 1 )
• the regulatory sequence is a viral promoter
• the regulatory sequence can be any eukaryotic promoter or enhancer, including for example, the Moloney murine leukemia virus promoter-enhancer element, the human cytomegalovirus enhancer (as used in the illustrative example), or the vaccinia P7 5 promoter In some cases such as the Moloney murine leukemia virus promoter- enhancer element, these promoter-enhancer elements are located within or adjacent to the LTR sequences
• a third vector provides the cis-acting viral sequences necessary for the viral life cycle Such sequences include the ⁇ packaging sequence, reverse transcription signals, integration signals, viral promoter, enhancer, and polyadenylation sequences
• the third vector also contains a cloning site for a heterologous nucleic acid sequence to be transferred to a non-dividing cell
• FIGURE 1 A schematic illustration of a suitable vector is shown in FIGURE 1)
• helper cell lines which have deletions of the packaging signal include but are not limited to ⁇ 2, PA317 and PA12, for example Suitable cell lines produce empty virions, since no genome is packaged If a retroviral vector is introduced into such cells in which the packaging signal is intact, but the structural genes are replaced by other genes of interest, the vector can be packaged and vector vinon produced
• the method of producing the recombinant retrovirus of the invention is different than the standard helper virus/packaging cell line method described above
• the three or more individual vectors used to co-transfect a suitable packaging cell line collectively contain all of the required genes for production of a recombinant virus for infection and transfer of nucleic acid to a non-dividing cell Consequently there is no need for a helper virus
• heterologous nucleic acid sequence is operably linked to a regulatory nucleic acid sequence
• heterologous nucleic acid sequence refers to a sequence that o ⁇ ginates from a foreign species, or, if from the same species, it may be substantially modified from its original form Alternatively, an unchanged nucleic acid sequence that is not normally expressed in a cell is a heterologous nucleic acid sequence
• operably linked refers to functional linkage between the regulatory sequence and the heterologous nucleic acid sequence
• heterologous sequence is linked to a promoter, resulting in a chimeric gene
• the heterologous nucleic acid sequence is preferably under control of either the viral LTR promoter-enhancer signals or of an internal promoter, and retained signals within the retrovirual LTR can still bring about efficient integration ofthe vector into the host cell genome
• the promoter sequence may be homologous or heterologous to the desired gene sequence
• a wide range of promoters may be utilized, including viral or mammalian promoter Cell or tissue specific promoters can be utilized to target expression of gene sequences in specific cell populations Suitable mammalian and viral promoters for the present invention are available in the art
• the nucleic acid construct referred to as the transfer vector having the packaging signal and the heterologous cloning site, also contains a selectable marker gene.
• Marker genes are utilized to assay for the presence of the vector, and thus, to confirm infection and integration. The presence of this marker gene ensures the growth of only those host cells which express the inserts.
• Typical selection genes encode proteins that confer resistance to antibiotics and other toxic substances, e.g., histidinol, puromycin, hygromycin, neomycin, methotrexate, etc.
• the illustrative examples herein utilize the ⁇ -galactosidase (LacZ) or luciferase reporter or marker system
• nucleic acid sequence refers to any nucleic acid molecule, preferably DNA
• the nucleic acid molecule may be derived from a variety of sources, including DNA, cDNA, synthetic DNA, RNA, or combinations thereof
• Such nucleic acid sequences may comprise genomic DNA which may or may not include naturally occurring introns.
• genomic DNA may be obtained in association with promoter regions, introns, or poly A sequences
• Genomic DNA may be extracted and purified from suitable cells by means well known in the art Alternatively, messenger RNA (mRNA) can be isolated from cells and used to produce cDNA by reverse transcription or other means.
• mRNA messenger RNA
• non-dividing cell refers to a cell that does not go through mitosis. Non-dividing cells may be blocked at any point in the cell cycle, (e.g., G Q /G,, GJS, G 2 /M), as long as the cell is not actively dividing.
• a dividing cell can be treated to block cell division by standard techniques used by those of skill in the art, including, irradiation, aphidocohn treatment, serum starvation, and contact inhibition
• ex vivo infection is often performed without blocking the cells since many cells are already arrested (e.g., stem cells).
• the recombinant retrovirus vector of the invention is capable of infecting any non-dividing cell, regardless of the mechanism used to block cell division or the point in the cell cycle at which the cell is blocked.
• Examples of pre-existing non-dividing cells in the body include neuronal, muscle, Iiver, skin, heart, lung, and bone marrow cells, and their derivatives.
• the recombinant retrovirus produced by the method of the invention is lentivirus-derived, and more preferably the recombinant lentivirus is a derivative of human immunodeficiency virus (HIV).
• HIV human immunodeficiency virus
• the env will be derived from a virus other than HIV
• the method of the invention provides at least three vectors which provide all of the functions required for packaging of recombinant virions as discussed above. The method also envisions transfection of vectors including viral genes such as vpr, vif, nef, vpx, tat, rev, and vpu.
• genes can be included on the packaging construct vector, for example, or, alternatively, they may reside on individual vectors. There is no limitation to the number of vectors which are utilized, as long as they are co-transfected to the packaging cell line in order to produce a single recombinant retrovirus. For example, one could put the env nucleic acid sequence on the same construct as the gag and pol
• the vectors are introduced via transfection or infection into the packaging cell line.
• the packaging cell line produces viral particles that contain the vector genome.
• Methods for transfection or infection are well known by those of skill in the art After co-transfection ofthe at least three vectors to the packaging cell line, the recombinant virus is recovered from the culture media and titered by standard methods used by those of skill in the art.
• the invention provides a recombinant retrovirus produced by the method of the invention as described above.
• the invention also provides a recombinant retrovirus capable of infecting a non- dividing cell comprising a viral GAG; a viral POL; a viral ENV; a heterologous nucleic acid sequence operably linked to a regulatory nucleic acid sequence; and cis-acting nucleic acid sequences necessary for packaging, reverse transcription and integration.
• the recombinant retrovirus is preferably a lentivirus, and most preferably HIV.
• the recombinant retrovirus of the invention may further include at least one of VPR, VIF, NEF, VPX, TAT, REV, and VPU protein.
• genes/protein products are important for increasing the viral titer of the recombinant retrovirus produced (e.g., NEF) or may be necessary for infection and packaging of virions, depending on the packaging cell line chosen (e.g., VIF).
• the invention also provides a method of nucleic acid transfer to a non-dividing cell to provide expression of a particular nucleic acid sequence. Therefore, in another embodiment, the invention provides a method for introduction and expression of a heterologous nucleic acid sequence in a non-dividing cell comprising infecting the non-d ⁇ v ⁇ d ⁇ ng cell with the recombinant virus of the invention and expressing the heterologous nucleic acid sequence in the non-dividing cell
• modulate envisions the suppression of expression of a gene when it is over-expressed, or augmentation of expression when it is under-expressed
• a cell proliferative disorder is associated with the expression of a gene nucleic acid sequences that interfere with the gene's expression at the translational level
• This approach utilizes, for example, antisense nucleic acid ribozymes or triplex agents to block transcription or translation of a specific mRNA, either by masking that mRNA with an antisense nucleic acid or triplex agent or by cleaving it with a ribozyme
• Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule (Weintraub, Scientific Amencan, 262 40, 1990) In the cell the antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule The antisense nucleic acids interfere with the translation of the mRNA since the cell will not translate a mRNA that is double- stranded Antisense oligomers of about 15 nucleotides are preferred, since they are easily synthesized and are less likely to cause problems than larger molecules when introduced into the target cell The use of antisense methods to inhibit the in vitro translation of genes is well known in the art (Marcus-Sakura Anal Biochem 172 289,
• the antisense nucleic acid can be used to block expression of a mutant protein or a dommantly active gene product, such as amyloid precursor protein that accumulates in Alzheimer s disease Such methods are also useful for the treatment of Huntington's disease, hereditary Parkmsonism, and other diseases Antisense nucleic acids are also useful for the inhibition of expression of proteins associated with toxicity
• Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases Through the modification of nucleotide sequences which encode these RNAs, it is possible to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and cleave it (Cech, J Amer Med Assn ,_26Q 3030, 1988)
• a major advantage of this approach is that, because they are sequence-specific, only mRNAs with particular sequences are inactivated
• nucleic acid encoding a biological response modifier includes immunopotentiating agents including nucleic acids encoding a number of the cytokines classified as "interleukins" These include, for example, interleukins 1 through 12 Also included in this category although not necessarily working according to the same mechanisms, are interferons, and in particular gamma interferon ( ⁇ -IFN), tumor necrosis factor (TNF) and granulocyte- macrophage-colony stimulating factor (GM-CSF) It may be desirable to deliver such nucleic acids to bone marrow cells or macrophages to treat enzymatic deficiencies or immune defects Nucleic acids encoding growth factors, toxic peptides, ligands, receptors, or other physiologically important proteins can also be introduced into specific non-dividing cells
• the recombinant retrovirus of the invention can be used to treat an HIV infected cell (e g , T-cell or macrophage) with an anti-HIV molecule
• respiratory epithelium for example, can be infected with a recombinant retrovirus of the invention having a gene for cystic fibrosis transmembrane conductance regulator (CFTR) for treatment of cystic fibrosis
• CFTR cystic fibrosis transmembrane conductance regulator
• the method of the invention may also be useful for neuronal or glial cell transplantation, or "grafting", which involves transplantation of cells infected with the recombinant retrovirus of the invention ex vivo, or infection in vivo into the central nervous system or into the vent ⁇ cular cavities or subdurally onto the surface of a host brain
• grafting Such methods for grafting will be known to those skilled in the art and are described in Neural Grafting in the Mammalian CNS, Bjorklund and Stenevi, eds., (1985), inco ⁇ orated by reference herein Procedures include intraparenchymal transplantation, (i.e , within the host brain) achieved by injection or deposition of tissue within the host brain so as to be apposed to the brain parenchyma at the time of transplantation
• Administration ofthe cells or virus into selected regions ofthe recipient subject's brain may be made by drilling a hole and piercing the dura to permit the needle of a microsyringe to be inserted.
• the cells or recombinant retrovirus can alternatively be injected intrathecally into the spinal cord region.
• a cell preparation infected ex vivo, or the recombinant retrovirus ofthe invention permits grafting of neuronal cells to any predetermined site in the brain or spinal cord, and allows multiple grafting simultaneously in several different sites using the same cell suspension or viral suspension and permits mixtures of cells from different anatomical regions.
• Cells infected with a recombinant retrovirus of the invention, in vivo, or ex vivo, used Tor treatment of a neuronal disorder for example, may optionally contain an exogenous gene, for example, a gene which encodes a receptor or a gene which encodes a ligand
• a gene which encodes a receptor or a gene which encodes a ligand include receptors which respond to dopamine, GABA, adrenaline, noradrenaline, serotonin, glutamate, acetylcholine and other neuropeptides, as described above.
• Examples of ligands which may provide a therapeutic effect in a neuronal disorder include dopamine, adrenaline, noradrenaline, acetylcholine, gamma-aminobutyric acid and serotonin.
• a cell genetically modified to secrete a neurotrophic factor such as nerve growth factor, (NGF) might be used to prevent degeneration of chohnergic neurons that might otherwise die without treatment.
• NGF nerve growth factor
• cells be grafted into a subject with a disorder of the basal ganglia can be modified to contain an exogenous gene encoding L-DOPA, the precursor to dopamine Parkinson's disease is characterized by a loss of dopamine neurone in the substantia-nigra of the midbrain, which have the basal ganglia as their major target organ.
• Alzheimer's disease is characterized by degeneration of the chohnergic neurons of the basal forebrain
• the neurotransmitter for these neurons is acetylcholine, which is necessary for their survival.
• Engraftment of chohnergic cells infected with a recombinant retrovirus of the invention containing an exogenous gene for a factor which would promote survival of these neurons can be accomplished by the method ofthe invention, as described.
• CA1 of the hippocampus As well as cortical cell loss which may underlie cognitive function and memory loss in these patients, molecules responsible for CA1 cell death can be inhibited by the methods of this invention
• antisense sequences, or a gene encoding an antagonist can be transferred to a neuronal cell and implanted into the hippocampal region of the brain
• the method of transferring nucleic acid also contemplates the grafting of neuroblasts in combination with other therapeutic procedures useful in the treatment of disorders of the CNS
• the retroviral infected cells can be co-administered with agents such as growth factors, gangliosides, antibiotics, neurotransmitters, n- eurohormones, toxins, neurite promoting molecules and antimetabolites and precursors of these molecules such as the precursor of dopamine L-DOPA
• lysosomal storage diseases such as those involving ⁇ - hexosaminidase or glucocerebrosidase, deficiencies in hypoxanthine phospho ⁇ bosyl transferase activity (the ' Lesch-Nyhan” syndrome"), amyloid polyneuropathies (- prealbumin), Duchenne s muscular dystrophy, and retinoblastoma, for example
• gene transfer could introduce a normal gene into the affected tissues for replacement therapy, as well as to create animal models for the disease using antisense mutations
• the following examples illustrate the three-plasmid lentiviral vector system of the invention
• a non infectious plasmid provides in trans the structural and regulatory proteins of HIV but the envelope (packaging construct, pCMV ⁇ R ⁇ )
• the transducing vector contains all known c/s-acting sequences of HIV-and cloning sites for the introduction of the gene to be transduced (vector plasmid, pHR')
• vector plasmid pHR'
• two marker genes E.
• a third plasmid encodes a heterologous envelope to pseudotype the viral particles Pseudotyping both broadens the host range of the vector, and increases its biosafety
• Plasmid pSV-A-MLV-env (Page, et al , 1990, J Virol., 64 5270, 1990) encodes the amphotropic envelope of the 4070 Moloney Leukemia Virus (MLV/Ampho) under the transcnptional control ofthe MLV LTR
• Plasmid pCMV-Eco env encodes the ecotropic envelope of the Moloney Leukemia Virus (MLV/Eco) under the transcnptional control of the CMV promoter (N Somia, Salk Institute, La Jolla, CA)
• Plasmid pMD G encodes the envelope protein G of the Vescicular Stomatitis Virus (VSV G) under the transcnptional control of the CMV promoter (D Ory and R Mulligan, Whitehead Institute, Cambridge, MA)
• Replication-defective viral particles were produced by the transient co-transfection of the three plasmids in 293T human kidney cells
• the conditioned medium was harvested, filtered, and assayed for the transduction of the reporter genes into target cells by standard methods
• Human HeLa cells and rat 208F fibroblasts were tested in different growth conditions, and the dependence of the transduction on the progression along the cell cycle was evaluated
• Growth arrest by density-dependent inhibition of growth (GO) was compared with pharmacological or other means of the cell cycle arrest (later phases of the cycle)
• the transduction of non-dividing, terminally differentiated cells such as macrophages and neurons was also tested, both in vitro and in vivo
• the packaging plasmid pCMVDR ⁇ was constructed in a series of steps starting from the plasmid pR8, an infectious molecular clone of proviral HIV DNA pR8 was made by replacing a BamHI-BssHII fragment in the plasmid pR7 (Kim et al , J Virol , 62.3708, 1989, von Schwedler et al., J Virol , 67 4945, 1993), which contains the
• HIV-1 HXB2d proviral DNA (Shaw et al., Science, 226, 1165, 1984) with a full-length nef reading frame, by the homologous fragment from the NL4 3 HIV proviral DNA NL4.3 is a molecularly constructed provirus that contains full-length, functional vpr and vpu reading frames (Adachi et al., J. Virol , 1609.284, 1986).
• the backbone of plasmid pR7/R8 contains the Amp resistance gene and the pUC ongin of replication from plasmid sp65, and the SV40 ongin of replication and the gpt gene from plasmid pSVgpt
• An env-defective version of pR8, p ⁇ ER8, was made by replacing the 2.7 kbp Sall-BamHI fragment with the homologous fragment from p ⁇ ER7, which contains a
• Plasmid pA ⁇ ER ⁇ was constructed by replacing the 3' HIV LTR with the polyadenylation site of insulin genomic DNA (Trono, et al , Cell , 59 113, 1989) maintaining intact the nef reading frame It was constructed by PCR, introducing a unique Notl site at the junction between the nef reading frame and the polyA signal
• a 961 bp fragment was amplified with the oligonucleotides gp41 4 (s), overlapping the BamHI site in gp41 of HIV1 HXB2- and nef27 (a) from the p ⁇ ER8 template, and a 402 bp fragment was amplified with the o- gonucleotides LN-A (s) and LN-B (a) containing an Xbal site - from a DNA template containing the polyadenylation site of the insulin gene Oligonucleotides nef27(a) and
• LN-A(s) contain a complementary sequence carrying a Notl restriction site
• the two amplificates were purified, mixed and used as template for a second amplification with the oligonucleotides gp41 4(s) and LN-B(a) (see Table 1 for oligo sequences)
• the final 1 3 kbp product was purified, digested with BamHI and Xbal and cloned in the 13.5 kpb BamHI-Xbal fragment of p ⁇ ER ⁇
• Plasmid pCMV ⁇ was constructed substituting the 5' LTR and leader sequences in pA ⁇ ER ⁇ with the CMV promoter.
• Oligonucleotide Nucleotide sequence gp41 4 (s) 5' GTGAACGGATCCTTGGCACTATC 3' (SEQ ID NO 1)
• nef 27 (a) 5' CGGGGCGGCCGCTCAGCAGTTCT TGAAGTACTC 3' (SEQ ID NO 2)
• gag31 5' AAGACCACCGCACAGCAAGCGGC CGCTGACACAGGACACAGCAAT 3' (SEQ ID NO 5)
• the vector plasmid pHR' was constructed by cloning a fragment of the env gene encompassing the RRE (responsive element) and a splice acceptor site between the two LTR's of the HIV-1 HXB2 proviral DNA
• the leader and ⁇ sequences were retained in the construct, together with the 5' 0 3 kbp of the gag gene, previously shown to constitute an extended packaging signal
• a 654 bp env fragment (Bglll 7620-BamHI 6474) was obtained from pR7
• a Notl linker was added to the filled-in Bglll end
• the fragment was cloned into the 8 9 kbp Notl-BamHI fragment of plasmid pMAKK 113 TTR7, a pR7 derivative containing mutations in the gag codons 113, 114, and 118 (the last ones introduce a unique Notl cloning site, sequence as in o gonucleotide Gag 31 (s
• Plasmid pHR' was generated introducing a frameshift mutation 42 bp downstream the gag gene AUG, which closes the reading frame of the gene fragment retained in the construct The mutation was introduced by opening and fil ng-in a Cial site Two unique BamHI and Xhol sites are available in pHR' upstream of the 3' LTR for cloning inserts Example 3 CONSTRUCTION OF oHR'-CLacZ and pHR'-Clucif
• a Sall-Xhol 3 6 kbp fragment containing the fc " coli ⁇ -galactosidase gene under the trasc ⁇ ptional control of the CMV promoter was obtained from the plasmid pSLX- CMVLacZ (Scharfmann et al Proc Natl Acad Sci USA 68 4626, 1991 ) After filling-in the Sail ends the fragment was cloned into the 8 9 kbp Xhol-BamHI fragment of pHR' whose BamHI ends had previously been filled-in pHR'-ClacZ was obtained pHR'-CLucif was obtained replacing a 3 1 kbp BamHI-Xhol fragment in pHR'-CLacZ, containing the LacZ reading frame, with a 1 7 kbp BamHI-Xhol fragment from pGEM- lue (Promega) containing the firefly luciferase reading frame
• Replication-defective viral particles were produced by the transient cotransfection of the above-described plasmids in 293T human kidney cells All plasmids were transformed and grown in £ coli HB101 bacteria following standard molecular biology procedures For transfection of eukaryotic cells, plasmid DNA was purified twice by equilibrium centnfugation in CsCI-ethidium bromide gradients A total of 40 ⁇ g DNA was used for the transfection of a culture in a 10 cm dish in the following proportions 10 ⁇ g pCMV ⁇ R ⁇ 20 ⁇ g pHR', and 10 ⁇ g env plasmids, either MLV/Ampho MLV/Eco or VSV G When a plasmid was omitted, or added in different proportion, pGEM-LacZ was added to maintain constant the total amount of DNA added to the cells 293T cells were grown in DMEM supplemented with 10% fetal calf serum and antibiotics in a 10% C0 2 incubator Cells were plated
• Plasmid pSLX-CMVLacZ (Scharfmann et al., Proc. Natl. Acad. Sci. USA, 68:4626, 1991) is a MLV-derived vector carrying a CMV-driven E.coli ⁇ -galactosidase gene
• the pCL plasmid series carry a hybrid CMV-LTR promoter which allows for CMV-driven transcription in the packaging cell and reconstitution of a functional LTR in the target cell (R Naviaux. Salk Institute, La Jolla, CA).
• Plasmid pCLNC-Lucif is a MLV-derived vector carrying a CMV-driven Firefly luciferase gene.
• Plasmid pCL-ECO is a ecotropic packaging plasmid
• Plasmid pCMV-GAGPOL N. Somia, Salk Institute, La Jolla, CA
• pMD.G was used in conjunction with pMD.G to package VSV.G-pseudotyped MLV-based vectors.
• Figure 2 shows a comparison between the infectious titers of recombinant lentivirus (HIV) construct and an MLV construct assayed on 208F fibroblasts.
• HIV vector of the present invention is at least as infectious as the standard MLV vector.
• Purified stock indicated that titers after concentrating the supernatant by ultracent ⁇ fugation Yield reflects percent recovery of virus after concentration.
• FIG 3 shows the results of co-transfection of a packaging construct, env-encoding construct and transfer vector (as in Figure 1)
• Various HIV and MLV-based packaging constructs were compared using amphotropic and ecotropic env genes, as well as VSV.G env.
• the figure shows a comparison of infection of rat 208F cells with the resulting recombinant retroviruses.
• the titers for the HIV constructs having an MLV (amphotropic) or VSV.G env were similar to the standard MLV-based vector
• serial dilutions of conditioned medium from 293T transient transfectants or of concentrated viral stocks were added to the culture medium supplemented with ⁇ ⁇ g/ml polybrene
• the cells were incubated from 3 hrs to overnight, then the medium was replaced, and the cells further incubated for 36 hrs prior to assaying expression of the transduced gene Expression of ⁇ -Galactosidase
• Human HeLa cells were grown in RPMI 1640-10% fetal calf serum in an atmosphere of 5% CO z
• cells were seeded at a density of 1 6 x 10 5 /well in a 6-well tray the day before infection
• G1/S arrested cultures were prepared seeding 2 x 10 5 cells/well two days before infection, and adding 15 ⁇ g/ml aphidicolm 24 hrs before infection Aphidicohn was added daily to the medium throughout the infection and post-infection time, as described
• G2- arrested cells were prepared by exposing the cells for 20 mm to a 61 Co source calibrated at 200 rad/min one day before infection and seeding the cells at 4 x 10 5 /well. Cell cycle arrest at the indicating stage of the cycle was confirmed by propidium iodide staining and flow cytometry.
• Figure 4 shows the relative efficiency of transduction of CMV- ⁇ -Gal into HeLa cells.
• the cells were growth arrested using either pharmacological means (aphidicolin) or x-irradiation.
• the infection rate for the HIV-based vector was more efficient when cells were arrested at the G1/S interphase by aphidicolin, however, the HIV-based vector was more efficient than MLV-based vector overall.
• Rat 208F fibroblasts (a gift of B. Sefton, Salk Institute, La Jolla, CA) were grown in DMEM-10% calf serum in an atmosphere of 10% C0 2
• DMEM-10% calf serum in an atmosphere of 10% C0 2
• cells were seeded at a density of 10 5 cells/well in a 6-well tray the day before infection.
• Growth-arrested cultures were prepared by seeding 2.5 x 10 5 cells/well in a 6-well tissue culture tray, and shifting the cultures to medium containing 5% calf serum and 2 ⁇ M dexamethazone after they reached confluence, as described by Miller et al. ( Mol. Cell. Biol., 10:4239, 1990)
• Medium was changed every three-four days, and the cultures were kept for two to four weeks When not otherwise indicated,
• Figure 5 shows the relative efficiency of transduction of CMV-luciferase into rat 208F fibroblasts with the HIV- and MLV-based vectors in cells growth arrested for 4, 7, 11 or 15 days. The results show that the vectors both efficiently infect growing cells. The efficiency of transduction of the HIV-based vector versus the MLV-based vector was approximately 4-10 fold higher, depending on the length of time of the growth arrest.
• the survival of the HIV-based vector was assessed in growth arrested cells that were passaged over a period of 2- ⁇ days. Survival of the MLV-based vector was very low in cells at GO and after replating at 2, 4, and ⁇ days. However, the HIV-based vector maintained at about 45-50% infectivity in the same cells. While not wanting to be bound by a particular theory, it is believed that HIV can remain extrachromosomal without being degraded, unlike MLV Therefore, HIV is stable without integration.
• HIV-based and MLV-based vectors carrying a CMV-LacZ marker gene were used. Both vector types were pseudotyped with VSV.G envelope proteins Vectors were purified and concentrated to a titer of 3 x 10 8 I.U./ml in a vehicle of sterile PBS supplemented with 2 ⁇ g/ml polybrene. All procedures were performed according to institution-approved protocols for animal work, and in a biosafety level 3 (BSL3) environment. Normal adult female Fischer rats were anesthetized with a mixture of ketamine (44 mg/kg), acepromazme (0.75 mg/kg) and xyiozine (4 mg/kg) in 0.9% NaCl.
• BSL3 biosafety level 3
• GFAP GFAP is a astrocyte differentiation marker.
• the sections were then analyzed by confocal scanning laser microscopy (bioRad MRTC600). Immunofluorescent signals were collected, digitally color enhanced and superimposed. False color images were generated electronically using Adobe Photoshop (Adobe System Inc.). The results revealed numerous ⁇ -gal positive neurons in regions injected with the HIV-based vector, but not in those inoculated with the MLV-based vector

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Genetics & Genomics (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Wood Science & Technology (AREA)
• Biochemistry (AREA)
• Biomedical Technology (AREA)
• Virology (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Biotechnology (AREA)
• Biophysics (AREA)
• Microbiology (AREA)
• Medicinal Chemistry (AREA)
• Molecular Biology (AREA)
• Physics & Mathematics (AREA)
• Immunology (AREA)
• Plant Pathology (AREA)
• Gastroenterology & Hepatology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Priority Applications (7)

Applications Claiming Priority (2)

Publications (2)

Family

ID=24154683

Family Applications (1)

Country Status (9)

Cited By (74)

Families Citing this family (714)