WO2021048171A1 - Method to improve phagocytosis - Google Patents

Abstract

The present invention relates to the improvement of phagocytosis. In this study, the inventors demonstrate that HRV16 impairs macrophage phagocytosis of multiple targets. This was not due to a global dysregulation of the actin cytoskeleton. They report that HRV16 induced a down-regulation of Arpin in macrophages. By re-expressing Arpin in a model cellular system where HRV16 exposure led to decreased internalisation they could rescue this defect. Based on these results they postulated that Arpin is necessary for phagocytosis. Further analysis revealed that Arpin is required for efficient phagosome formation. Thus, Arpin plays a critical role in coordinating and orchestrating actin remodelling around internalised particles necessary for efficient phagocytosis. Therefore, they add phagocytosis to the growing list of functions being attributed to Arpin and highlight a host cell factor specifically targeted by rhinovirus. Thus the invention relates to an Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the improvement of phagocytosis in a subject in need thereof.

Description

METHOD TO IMPROVE PHAGOCYTOSIS

FIELD OF THE INVENTION:

The present invention relates to an Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the improvement of phagocytosis in a subj ect in need thereof.

BACKGROUND OF THE INVENTION:

Human rhinovirus (HRV) belongs to the Picornaviradae family. It is a small, non- enveloped virus with a single stranded, positive sense RNA genome encased within an icosahedral protein capsid with 60 copies each of four key viral proteins, VP1-VP4 (Jacobs et al, 2013). Dependent on the clades the viruses use either the low-density lipoprotein receptor (LDLR) family, the intracellular adhesion molecular 1 (ICAM1) or cadherin related family member 3 to bind and enter cells (Bochkov et al, 2015; Hofer et al, 1994; Palmenberg et al, 2009; Staunton et al., 1989). HRV is known to productively infect epithelial cells (Arruda et al., 1995; Gern et al, 1996; Kennedy et al, 2012; Papi and Johnston, 1999; Sajjan et al, 2008; Whiteman et al., 2003; Winther et al., 2002), but the response in macrophages has received limited attention (Gern et al., 1996; Oliver et al., 2008). Reports suggest that HRV can infect monocytes/macrophages (Gem et al, 1996; Laza-Stanca et al., 2006; Zhou et al, 2017). A recent study suggested an interplay between epithelial cells and monocytes allowed monocytes to become infected with the vims (Zhou et al, 2017). Traditionally HRV is seen as an upper respiratory tract pathogen (Blaas and Fuchs, 2016). However, mounting evidence shows that HRV can infect the lower respiratory tract in patients with chronic inflammatory diseases including chronic obstructive pulmonary disease (COPD) driving disease exacerbations (Gern et al., 1997; Papadopoulos et al., 2001; Wilkinson et al, 2006; Wilkinson et al, 2017). How HRV disrupts macrophage/monocyte functions remains unknown, but HRV was reported to induce a defective secondary response in macrophages (Oliver et al., 2008; Unger et al., 2012).

An important arm of the innate immune responses is the phagocytic uptake by myeloid cells. Phagocytosis is a mechanism of internalization of large particulate material, cell debris and microorganisms (Flannagan et al, 2009; Niedergang, 2016; Niedergang and Grinstein, 2018). It is strictly dependent on actin polymerization that represents the major force driving plasma membrane deformation and engulfment. Actin polymerization is induced by surface phagocytic receptors after ligation of the target and intracellular signaling transduction. Phagocytic receptors include receptors for host serum factors (opsonins) such as immunoglobulin (Ig) and the complement fragment C3bi that engage Fc receptor (FcRs) and complement receptors (CR3, aMb2), respectively, and non-opsonic receptors such as the Toll like receptors (TLRs), the lectins and scavenger receptors (Canton et al., 2013; Flannagan et al., 2009; Flannagan et al., 2012). Key players of the signaling to actin polymerization are the small GTPases of the Rho family (Caron and Hall, 1998; Niedergang and Chavrier, 2005). In the well-characterized FcR-mediated phagocytosis, Cdc42 activation in the nascent phagocytic cup activates effectors like N-WASP, an actin nucleati on-promoting factor (NPF) that acts on the actin related protein 2/3 (Arp2/3) actin nucleation complex. Racl is then essential for F-actin polymerization to complete extension and closure, through activation of another NPF, the WAVE complex (Hoppe and Swanson, 2004; Niedergang and Grinstein, 2018; Swanson, 2008).

During phagosome formation, actin polymerization is transient and forms a specific F- actin ring-like structure, called the phagocytic cup. The actin ring diameter progressively shrinks until the membrane extensions eventually fuse, a step promoted by dynamin (Marie- Anais et al, 2016; Niedergang and Grinstein, 2018). Actin filaments experience a high turnover, with intense polymerization in the tips of the membrane folds and depolymerization at the base of the phagocytic cup (Greenberg et al., 1991; Hoppe and Swanson, 2004; Marion et al., 2012; May and Machesky, 2001; Schlam et al, 2015)}. Several protein activities have been reported to play a role in actin remodeling, including cofilin, which can sever F actin filaments (Aizawa et al, 1997; Carlier et al, 1999; Ulvila et al, 2011). In addition, Cdc42 inactivation is directly dependent on PIP(4,5)2 hydrolysis (Scott et al, 2005). Several enzymatic activities have been implicated in this step, including the phospholipase C (PLC) and the oculocerebrorenal syndrome of Lowe (OCRL) (Bohdanowicz et al, 2012; Marion et al, 2012). PIP(4,5)2 is also consumed and transformed into PIP(3,4,5)3 by PI3-kinases (PI3K) (Araki et al, 2003; Cox et al, 1999; Schlam et al, 2015), which in turn serves to recruit some Rho-GAPs, and contributes to inactivate the GTPases (Schlam et al., 2015).

In addition, proteins inhibiting directly Arp2/3 have been described, namely Gadkin, PICK1 and Arpin (Dang et al, 2013; Maritzen et al, 2012; Rocca et al., 2008), for which no role in phagocytosis has been reported yet. These inhibitors are not found freely in the cytosol but localise to specific membranes like NPFs making them ideal candidates to counteract NPF activity (Molinie and Gautreau, 2018). Gadkin maintains Arp2/3 in an inhibitory conformation by sequestering it to endosomal vesicles (Maritzen et al, 2012). PICK1 binds to the Arp2/3 complex and inhibits its basal activity via N-WASP displacement (Rocca et al., 2008). Arpin was found to bind to the Arp2/3 complex without activating it (Dang et al., 2013). Instead Arpin exposes its COOH terminal acidic tail to inhibit the Arp2/3 complex (Fetics et al., 2016). When the Arp2/3 complex is bound to Arpin, it is inactive because the Arp2 and Arp3 subunits are pushed far apart in the structure (Sokolova et al., 2017). In cells studied so far, Arpin localizes at lamellipodial edges along with the WAVE complex (Dang et al., 2013). Single molecule imaging revealed that at lamellipodial edges not all Arp2/3 complexes become activated and incorporated into branched actin networks but some moved laterally in the plasma membrane (Millius et al, 2012) and it is at these sites that Arpin is predicted to maintain Arp2/3 in an inactive conformation. The ability of Arpin to interact with Arp2/3 was found to depend on Racl signalling (Dang et al., 2013). In response to Racl signalling, Arpin inhibited Arp2/3 at lamellipodial tips where Racl also stimulates actin polymerisation through WAVE (Dang et al., 2013). This placed Arpin downstream of Racl in a cycle with Rac inducing and inhibiting actin polymerisation (Dang et al., 2013). The major function of Arpin described to date is the inhibition of cell migration (Gorelik and Gautreau, 2015) and a control of cell steering (Dang et al., 2013), while it was dispensable for chemotaxis of tumour cells and Dictyostelium amoeba (article Dang Biol Cell 2017).

SUMMARY OF THE INVENTION:

In this study, the inventors demonstrate that HRV16 impairs macrophage phagocytosis of multiple targets. This was not due to a global dysregulation of the actin cytoskeleton. They report that HRV16 induced a down-regulation of Arpin in macrophages. By re-expressing Arpin in a model cellular system where HRV16 exposure led to decreased internalisation they could rescue this defect. Based on these results they postulated that Arpin is necessary for phagocytosis. Further analysis revealed that Arpin is required for efficient phagosome formation. Thus, Arpin plays a critical role in coordinating and orchestrating actin remodelling around internalised particles necessary for efficient phagocytosis. Therefore, they add phagocytosis to the growing list of functions being attributed to Arpin and highlight a host cell factor specifically targeted by rhinovirus. Thus, the present invention relates to an Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the improvement of phagocytosis in a subject in need thereof. Particularly, the invention is defined by its claims.

PET ATT /ED DESCRIPTION OF THE INVENTION:

Accordingly, the present invention relates to the Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the improvement of phagocytosis in a subject in need thereof. As used herein, the term “an agent for Arpin protein expression” denotes an agent which can increase or restore the Arpin protein expression or increase the activity of the Arpin. To increase or restore the Arpin protein expression, the agent can also increase or restore the Arpin gene expression.

In order to test the functionality of a putative agent for Arpin protein expression a test is necessary. For that purpose, to identify agent for Arpin protein expression, it is possible to run a western blot analysis on cell extracts to test the effect on the putative agent for Arpin protein expression on the level of Arpin. If the level of Arpin is increased, the putative agent for Arpin protein expression will have the desired effect.

As used herein, the term “subject” denotes a mammal. Typically, a subject according to the invention refers to any subject (preferably human) afflicted with or susceptible to be afflicted with inflammatory diseases. Typically, a subject according to the invention refers to any subject (preferably human) afflicted with or susceptible to be afflicted with like chronic obstructive pulmonary disease (COPD) or asthma.

Thus, the invention also relates to the Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the improvement of phagocytosis in a subject afflicted with an inflammatory disease. Particularly, the inflammatory diseases are chronic obstructive pulmonary disease (COPD) or asthma.

Particularly, the invention relates to the Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the treatment of chronic obstructive pulmonary disease (COPD) or asthma.

More particularly, the invention relates to the Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the treatment of chronic obstructive pulmonary disease (COPD) or asthma exacerbations induced by a respiratory virus. Particularly, the respiratory virus is the human rhinovirus (HRV) or the Human respiratory syncytial virus (HRSV).

More particularly, the invention relates to the Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the treatment of chronic obstructive pulmonary disease (COPD) or asthma exacerbations induced by a respiratory virus.

More particularly, the invention relates to the Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the treatment of chronic obstructive pulmonary disease (COPD) or asthma exacerbations. As used herein, the term "Chronic obstructive pulmonary disease (COPD)" has its general meaning in the art and is a type of obstructive lung disease characterized by long-term breathing problems and poor airflow. The main symptoms include shortness of breath and cough with sputum production. COPD is a progressive disease, meaning it typically worsens over time. Eventually, everyday activities such as walking or getting dressed become difficult. Chronic bronchitis and emphysema are older terms used for different types of COPD. The term "chronic bronchitis" is still used to define a productive cough that is present for at least three months each year for two years. Those with such a cough are at a greater risk of developing COPD. The term "emphysema" is also used for the abnormal presence of air or other gas within tissues.

As used herein, the term "treatment" or "treat" refer to both prophylactic or preventive treatment as well as curative or disease-modifying treatment, including treatment of subjects at risk of contracting the disease or suspected to have contracted the disease as well as subjects who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment. By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a subject during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at a regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., disease manifestation, etc.]).

The term “ Arpin” has its general meaning in the art and refers to uncharacterized Protein Family UPF0552 in the databases. The protein of amino acid sequence SEQ ID NO: 1 (GenBank Accession number AAH53602 or UniProtKB/Swiss-Prot Q7Z6K5) is the product of human C15orf38 gene (Gene ID 348110 or NM 182616; location 15q26.1; complement of positions 90443832 to 90456222 on human chromosome 15).

In some embodiments, the Arpin protein of the invention is an isolated, synthetic or recombinant Arpin protein.

In some embodiments, said Arpin protein comprises a sequence as set forth by SEQ ID

NO: 1.

SEQ ID NO: 1: MSRIYHDGAL RNKAVQSVRL PGAWDPAAHQ GGN GVLLEGE LIDVSRHSIL DTHGRKERYY VLYIRPSHIH RRKFDAKGNE IEPNFSATRK VNTGFLMSSY KVEAKGDTDR LTPEALKGLV NKPELLALTE SLTPDHTVAF WMPE SEMEVM ELELGAGVRL KTRGDGPFLD SLAKLEAGTV TKCNFTGDGK T GASWTDNIM AQKCSKGAAA EIREQGDGAE DEEWDD

In some embodiments, the Arpin protein of the present invention comprises or consists of an amino acid sequence having at least 70% of identity with SEQ ID NO: 1.

According to the invention a first amino acid sequence having at least 70% of identity with a second amino acid sequence means that the first sequence has 70; 71; 72; 73; 74; 75; 76; 77; 78; 79; 80; 81; 82; 83; 84; 85; 86; 87; 88; 89; 90; 91; 92; 93; 94; 95; 96; 97; 98; or 99, or 100% of identity with the second amino acid sequence. Amino acid sequence identity is preferably determined using a suitable sequence alignment algorithm and default parameters, such as BLAST P (Karlin and Altschul, 1990). In particular the Arpin protein of the invention is a functional conservative variant of the Arpin protein according to the invention. As used herein the term “function-conservative variant" are those in which a given amino acid residue in a protein or enzyme has been changed without altering the overall conformation and function of the Arpin protein, including, but not limited to, replacement of an amino acid with one having similar properties (such as, for example, polarity, hydrogen bonding potential, acidic, basic, hydrophobic, aromatic, and the like). Accordingly, a "function-conservative variant" also includes an Arpin protein which has at least 70 % amino acid identity and which has the same or substantially similar properties or functions as the native or parent Arpin protein to which it is compared. Functional properties of the Arpin protein of the invention could typically be assessed in any functional assay as described in the EXAMPLE.

In another particularly embodiment, the fragment of the Arpin protein can be a peptide of at least 13 consecutive amino acids from said Arpin protein, which comprises at least the acidic motif (A motif) of said Arpin protein.

Indeed, the Arpin protein has a conserved structure characterized by a C-terminal A motif. The A motif consists of a sequence of about 16 amino acids (usually 13 to 17 amino acids), comprising a tryptophan residue (W) at the antepenultimate or penultimate position and at least seven aspartic acid (D) or glutamic acid (E) residues.

Particularly, the peptide of the invention comprises or consists an amino acids sequences as set forth of SEQ ID NO: 3 to 7.

SEQ ID NO: 3: EIREQGDGAEDEEWDD

SEQ ID NO: 4: EPRGQGDGAEDDEWD

SEQ ID NO: 5: KSAAQGEGADDDEWDD

SEQ ID NO: 6: KPGQEENEGAGDDEWD

SEQ ID NO: 7: QQQQEEEDDDEWK

Thus, in some embodiment, the fragment of the Arpin protein comprises or consists an amino acids sequences as set forth of SEQ ID NO: 3 to 7.

Particularly, a peptide suitable for the invention is described in the patent application WO2015033267.

A further aspect of the present invention relates to a fusion protein comprising the protein or peptide according to the invention that is fused to at least one heterologous polypeptide.

The term “fusion protein” refers to the protein or peptide according to the invention that is fused directly or via a spacer to at least one heterologous polypeptide.

According to the invention, the fusion protein comprises the protein or peptide according to the invention that is fused either directly or via a spacer at its C-terminal end to the N-terminal end of the heterologous polypeptide, or at its N-terminal end to the C-terminal end of the heterologous polypeptide.

As used herein, the term “directly” means that the (first or last) amino acid at the terminal end (N or C-terminal end) of the protein or peptide is fused to the (first or last) amino acid at the terminal end (N or C-terminal end) of the heterologous polypeptide. In other words, in this embodiment, the last amino acid of the C-terminal end of said protein or peptide is directly linked by a covalent bond to the first amino acid of the N-terminal end of said heterologous polypeptide, or the first amino acid of the N-terminal end of said protein or peptide is directly linked by a covalent bond to the last amino acid of the C-terminal end of said heterologous polypeptide.

As used herein, the term “spacer” refers to a sequence of at least one amino acid that links the protein or peptide of the invention to the heterologous polypeptide. Such a spacer may be useful to prevent steric hindrances.

In some embodiments, the heterologous polypeptide is a cell-penetrating peptide, a Transactivator of Transcription (TAT) cell penetrating sequence, a cell permeable peptide or a membranous penetrating sequence.

The term “cell-penetrating peptides” are well known in the art and refers to cell permeable sequence or membranous penetrating sequence such as penetratin, TAT mitochondrial penetrating sequence and compounds (Bechara and Sagan, 2013; Jones and Sayers, 2012; Khafagy el and Morishita, 2012; Malhi and Murthy, 2012).

The proteins, peptides or fusion proteins of the invention may be produced by any technique known per se in the art, such as, without limitation, any chemical, biological, genetic or enzymatic technique, either alone or in combination. Knowing the amino acid sequence of the desired sequence, one skilled in the art can readily produce said proteins, peptides or fusion proteins, by standard techniques for production of amino acid sequences. For instance, they can be synthesized using well-known solid phase method, preferably using a commercially available peptide synthesis apparatus (such as that made by Applied Biosystems, Foster City, California) and following the manufacturer’s instructions. Alternatively, the proteins, peptides or fusion proteins of the invention can be synthesized by recombinant DNA techniques as is now well-known in the art. For example, these fragments can be obtained as DNA expression products after incorporation of DNA sequences encoding the desired (poly) peptide into expression vectors and introduction of such vectors into suitable eukaryotic or prokaryotic hosts that will express the desired (poly) peptide, from which they can be later isolated using well- known techniques.

The proteins, peptides or fusion proteins of the invention can be used in an isolated (e.g., purified) form or contained in a vector, such as a membrane or lipid vesicle (e.g. a liposome).

In specific embodiments, it is contemplated that proteins, peptides or fusion proteins according to the invention may be modified in order to improve their therapeutic efficacy and their stability using well-known techniques. Such modification of therapeutic compounds may be used to decrease toxicity, increase circulatory time, or modify biodistribution. For example, the toxicity of potentially important therapeutic compounds can be decreased significantly by combination with a variety of drug carrier vehicles that modify biodistribution.

A strategy for improving drug stability is the utilization of water-soluble polymers. Various water-soluble polymers have been shown to modify biodistribution, improve the mode of cellular uptake, change the permeability through physiological barriers; and modify the rate of clearance from the body. To achieve either a targeting or sustained-release effect, water- soluble polymers have been synthesized that contain drug moieties as terminal groups, as part of the backbone, or as pendent groups on the polymer chain.

For example, Pegylation is a well-established and validated approach for the modification of a range of polypeptides (Chapman, 2002). The benefits include among others: (a) markedly improved circulating half-lives in vivo due to either evasion of renal clearance as a result of the polymer increasing the apparent size of the molecule to above the glomerular filtration limit, and/or through evasion of cellular clearance mechanisms; (b) reduced antigenicity and immunogenicity of the molecule to which PEG is attached; (c) improved pharmacokinetics; (d) enhanced proteolytic resistance of the conjugated protein (Cunningham- Rundles et.al, 1992); and (e) improved thermal and mechanical stability of the PEGylated polypeptide.

Therefore, advantageously, the proteins, peptides or fusion proteins of the invention may be covalently linked with one or more polyethylene glycol (PEG) group(s). One skilled in the art can select a suitable molecular mass for PEG, based on how the pegylated polypeptide will be used therapeutically by considering different factors including desired dosage, circulation time, resistance to proteolysis, immunogenicity, etc.

In one embodiment, the PEG of the invention terminates on one end with hydroxy or methoxy, i.e., X is H or CEP ("methoxy PEG"). In addition, such a PEG can consist of one or more PEG side-chains which are linked together. PEGs with more than one PEG chain are called branched PEGs. Branched PEGs can be prepared, for example, by the addition of polyethylene oxide to various polyols, including glycerol, pentaerythriol, and sorbitol. For example, a four-armed branched PEG can be prepared from pentaerythriol and ethylene oxide. One form of PEGs includes two PEG side-chains (PEG2) linked via the primary amino groups of a lysine (Monfardini et ak, 1995).

To effect covalent attachment of PEG groups to the polypeptide, the hydroxyl end groups of the polymer molecule must be provided in activated form, i. e. with reactive functional groups (examples of which include primary amino groups, hydrazide (HZ), thiol, succinate (SUC), succinimidyl succinate (SS), succinimidyl succinamide (SSA), succinimidyl proprionate (SPA), succinimidyl carboxymethylate (SCM),benzotriazole carbonate (BTC), N- hydroxysuccinimide (NHS), aldehyde, nitrophenyl carbonate (NPC), and tresylate (TRES)). Suitable activated polymer molecules are commercially available, e. g. from Shearwater Polymers, Inc., Huntsville, AL, USA, or from PolyMASC Pharmaceuticals pic, UK. Alternatively, the polymer molecules can be activated by conventional methods known in the art, e. g. as disclosed in WO 90/13540. Specific examples of activated linear or branched polymer molecules for use in the present invention are described in the Shearwater Polymers, Inc. 1997 and 2000 Catalogs (Functionalized Biocompatible Polymers for Research and pharmaceuticals, Polyethylene Glycol and Derivatives, incorporated herein by reference). Specific examples of activated PEG polymers include the following linear PEGs : NHS-PEG (e g. SPA-PEG, SSPA-PEG, SBA-PEG, SS-PEG, SSA-PEG, SC-PEG, SG-PEG, and SCM- PEG), and NOR-PEG, BTC-PEG, EPOX-PEG, NCO-PEG, NPC-PEG, CDI-PEG, ALD-PEG, TRES-PEG, VS-PEG, IODO-PEG, and MAL-PEG, and branched PEGs such as PEG2-NHS.

The conjugation of the proteins, peptides or fusion proteins and the activated polymer molecules is conducted by use of any conventional method. Conventional methods are known to the skilled artisan. The skilled person will be aware that the activation method and/or conjugation chemistry to be used depends on the attachment group(s) of the polypeptides as well as the functional groups of the PEG molecule (e.g., being amine, hydroxyl, carboxyl, aldehyde, ketone, sulfhydryl, succinimidyl, maleimide, vinylsulfone or haloacetate).

In one embodiment, the proteins, peptides or fusion proteins of the invention are conjugated with PEGs at amino acid D and E (for COOH), T, Y and S (for OH), K (for MB), C (for SH if at least one cysteine is conserved) or/and Q and N (for the amide function).

In one embodiment, additional sites for PEGylation can be introduced by site-directed mutagenesis by introducing one or more lysine residues. For instance, one or more arginine residues may be mutated to a lysine residue. In another embodiment, additional PEGylation sites are chemically introduced by modifying amino acids on proteins, peptides or fusion proteins of the invention.

In one embodiment, PEGs are conjugated to the polypeptides or fusion proteins through a linker. Suitable linkers are well known to the skilled person. A preferred example is cyanuric chloride ((Abuchowski et ak, 1977); US 4,179, 337).

Conventional separation and purification techniques known in the art can be used to purify pegylated polypeptides of the invention, such as size exclusion (e.g. gel filtration) and ion exchange chromatography. Products may also be separated using SDS-PAGE. In one embodiment, the pegylated polypeptides provided by the invention have a serum half-life in vivo at least 50%, 75%, 100%, 150% or 200% greater than that of an unmodified polypeptide.

In some embodiments, the agent for Arpin protein expression of the invention is selected from the group consisting of an isolated, synthetic or recombinant nucleic acid encoding for Arpin protein, a nucleic acid sequence encoding for the fusion protein, a nucleic acid encoding a fragment of a Arpin protein, a nucleic acid encoding a fragment of a peptide according to the invention, a cell expressing Arpin protein, and agent inducing Arpin gene expression and their combinations.

In some embodiments, said nucleic acid encoding for Arpin protein comprises a sequence as set forth by SEQ ID NO: 2.

SEQ ID NO: 2: atgagccgcatctaccacgacggcgcgctccggaacaaggcggtgcagagcgtccggctgccaggggcctgggaccccgccgcc caccaggggggaaatggtgtcctgctggagggagaactgatcgatgtatctcggcacagcatcttggacactcatggcaggaaggag cgctactacgtgctgtatatccggcccagtcacatccatcgccgtaaattcgacgccaagggaaatgaaatcgagcccaacttcagcgc caccaggaaggtgaacacgggcttcctcatgtcgtcctacaaggtggaagccaagggggacactgacaggctcacgcccgaggcg ctgaaggggctggtcaacaagccagagctgctcgcgctgacagagagcctcacccccgaccacacagtggcgttctggatgcccga gtcagagatggaggtgatggaactcgagctgggggccggggtacggctgaagactcggggcgatggtcccttcctggattcattggc caaacttgaggctggaacagtgaccaagtgtaatttcactgggatggaaagacaggggcatcctggacagacaacatcatggcccaa aagtgttcgaagggggctgcagcggagatccgag agcagggggatggggcagaggacgaggagtgggatgactga

In some embodiments, the nucleic acid encoding for Arpin protein for example comprises or consists of a sequence at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 % identical to sequence SEQ ID NO: 2.

As used herein, a sequence "encoding" an expression product, such as a RNA, polypeptide, protein, or enzyme, is a nucleotide sequence that, when expressed, results in the production of that RNA, polypeptide, protein, or enzyme, i.e., the nucleotide sequence encodes an amino acid sequence for that polypeptide, protein or enzyme. A coding sequence for a protein may include a start codon (usually ATG) and a stop codon.

These nucleic acid sequences can be obtained by conventional methods well known to those skilled in the art. Typically, said nucleic acid is a DNA or RNA molecule, which may be included in a suitable vector, such as a plasmid, cosmid, episome, artificial chromosome, phage or viral vector. So, a further object of the present invention relates to a vector and an expression cassette in which a nucleic acid molecule encoding for a proteins, peptides or fusion proteins of the invention is associated with suitable elements for controlling transcription (in particular promoter, enhancer and, optionally, terminator) and, optionally translation, and also the recombinant vectors into which a nucleic acid molecule in accordance with the invention is inserted. These recombinant vectors may, for example, be cloning vectors, or expression vectors.

As used herein, the terms "vector", "cloning vector" and "expression vector" mean the vehicle by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence.

Any expression vector for animal cell can be used. Examples of suitable vectors include pAGE107 (Miyaji et al., 1990), pAGE103 (Mizukami and Itoh, 1987), pHSG274 (Brady et al.,

1984), pKCR (O'Hare et al., 1981), pSGl beta d2-4 (Miyaji et al, 1990) and the like.

Other examples of plasmids include replicating plasmids comprising an origin of replication, or integrative plasmids, such as for instance pUC, pcDNA, pBR, and the like.

Other examples of viral vectors include adenoviral, lentiviral, retroviral, herpes virus and AAV vectors. Such recombinant viruses may be produced by techniques known in the art, such as by transfecting packaging cells or by transient transfection with helper plasmids or viruses. Typical examples of virus packaging cells include PA317 cells, PsiCRIP cells, GPenv+ cells, 293 cells, etc. Detailed protocols for producing such replication-defective recombinant viruses may be found for instance in WO 95/14785, WO 96/22378, ETS 5,882,877, ETS 6,013,516, US 4,861,719, US 5,278,056 and WO 94/19478.

Examples of promoters and enhancers used in the expression vector for animal cell include early promoter and enhancer of SV40 (Mizukami and Itoh, 1987), LTR promoter and enhancer of Moloney mouse leukemia virus (Kuwana et al, 1987), promoter (Mason et al.,

1985) and enhancer (Gillies et al., 1983) of immunoglobulin H chain and the like.

A further aspect of the invention relates to a host cell comprising a nucleic acid molecule encoding for a protein, peptide or a fusion protein according to the invention or a vector according to the invention. In particular, a subject of the present invention is a prokaryotic or eukaryotic host cell genetically transformed with at least one nucleic acid molecule or vector according to the invention.

The term "transformation" means the introduction of a "foreign" (i.e. extrinsic or extracellular) gene, DNA or RNA sequence to a host cell, so that the host cell will express the introduced gene or sequence to produce a desired substance, typically a protein or enzyme coded by the introduced gene or sequence. A host cell that receives and expresses introduced DNA or RNA has been "transformed".

In a particular embodiment, for expressing and producing proteins, peptides or fusion proteins of the invention, prokaryotic cells, in particular E. coli cells, will be chosen. Actually, according to the invention, it is not mandatory to produce the proteins, peptides or fusion proteins of the invention in a eukaryotic context that will favour post-translational modifications (e.g. glycosylation). Furthermore, prokaryotic cells have the advantages to produce protein in large amounts. If a eukaryotic context is needed, yeasts (e.g. saccharomyces strains) may be particularly suitable since they allow production of large amounts of proteins. Otherwise, typical eukaryotic cell lines such as CHO, BHK-21, COS-7, C127, PER.C6, YB2/0, HEK293, mononuclear macrophage/monocyte-lineage hematopoietic precursors, Haematopoietic stem cells, Mononuclear precursor cells, osteoblast or inactive osteoclast could be used, for their ability to process to the right post-translational modifications of the fusion protein of the invention.

The construction of expression vectors in accordance with the invention, and the transformation of the host cells can be carried out using conventional molecular biology techniques. The protein, peptide or the fusion protein of the invention, can, for example, be obtained by culturing genetically transformed cells in accordance with the invention and recovering the proteins, peptides or fusion proteins expressed by said cell, from the culture. They may then, if necessary, be purified by conventional procedures, known in themselves to those skilled in the art, for example by fractional precipitation, in particular ammonium sulfate precipitation, electrophoresis, gel filtration, affinity chromatography, etc. In particular, conventional methods for preparing and purifying recombinant proteins may be used for producing the proteins in accordance with the invention.

A further aspect of the invention relates to a method for producing a protein, peptide or a fusion protein of the invention comprising the step consisting of: (i) culturing a transformed host cell according to the invention under conditions suitable to allow expression of said protein, peptide or fusion protein; and (ii) recovering the expressed protein, peptide or fusion protein.

In some embodiments, the agent for Arpin protein expression of the invention is an agent inducing Arpin gene and peptide expression selected from the group consisting of, but not limited to, Human Cytomegalovirus (HCMV), VHL/E HCMV strain, and TB40/E HCMV strain. In a further aspect, the present invention relates to the Arpin protein or fragment thereof and/or an agent for Arpin protein expression according to the invention in combination with one or more anti-COPD compound for use in the treatment of COPD in a subject in need thereof.

The term “anti-COPD” has its general meaning in the art and refers to compounds and therapeutic active agent used which can be used to treat the symptoms and the progression of the disease. Anti-COPD compounds can be bronchodilators like b2 agonists and anticholinergics or corticosteroids.

In a further aspect, the present invention relates to the Arpin protein or fragment thereof and/or an agent for Arpin protein expression according to the invention in combination with one or more anti-asthma compound for use in the treatment of asthma in a subject in need thereof.

The term “anti-asthma” has its general meaning in the art and refers to compounds and therapeutic active agent used which can be used to treat asthma. Anti-asthma compounds can be beta2-adrenoceptor agonists like salbutamol, anticholinergic like ipratropium bromide or adrenergic agonists like epinephrine.

In some embodiments, the Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the present invention is administered sequentially or concomitantly with one or more therapeutic active agent.

In one embodiment, said additional active compounds may be contained in the same composition or administrated separately.

Typically the Arpin protein or fragment thereof and/or an agent for Arpin protein expression according to the invention as described above are administered to the subject in a therapeutically effective amount.

By a "therapeutically effective amount" of the Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the present invention as above described is meant a sufficient amount of the Arpin protein or fragment thereof and/or an agent for Arpin protein expression for treating COPOD and/or asthma at a reasonable benefit/risk ratio applicable to any medical treatment. It will be understood, however, that the total daily usage of the Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific the Arpin protein or fragment thereof and/or an agent for Arpin protein expression employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific the Arpin protein or fragment thereof and/or an agent for Arpin protein expression employed; the duration of the treatment; drugs used in combination or coincidental with the specific the Arpin protein or fragment thereof and/or an agent for Arpin protein expression employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the the Arpin protein or fragment thereof and/or an agent for Arpin protein expression at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Typically, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the the Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the present invention for the symptomatic adjustment of the dosage to the subject to be treated. A medicament typically contains from about 0.01 mg to about 500 mg of the the Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the present invention, preferably from 1 mg to about 100 mg of the Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the present invention. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.

In a particular embodiment, the Arpin protein or fragment thereof and/or an agent for Arpin protein expression according to the invention may be used in a concentration between 0.01 mM and 20 mM, particularly, the Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the invention may be used in a concentration of 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 20.0 pM.

According to the invention, the Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the present invention is administered to the subject in the form of a pharmaceutical composition. Thus, the invention also relates to a therapeutic composition comprising the Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the improvement of phagocytosis in a subject in need thereof.

Typically, the Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the present invention may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form therapeutic compositions. "Pharmaceutically" or "pharmaceutically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.

In the pharmaceutical compositions of the present invention for oral, sublingual, subcutaneous, intramuscular, intravenous, transdermal, local or rectal administration, the active principle, alone or in combination with another active principle, can be administered in a unit administration form, as a mixture with conventional pharmaceutical supports, to animals and human beings. Suitable unit administration forms comprise oral-route forms such as tablets, gel capsules, powders, granules and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, transdermal, intrathecal and intranasal administration forms and rectal administration forms.

Typically, the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Solutions comprising the Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the invention as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the present invention can be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetables oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized agent of the present inventions into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the typical methods of preparation are vacuum drying and freeze-drying techniques which yield a powder of the Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the present invention plus any additional desired ingredient from a previously sterile-filtered solution thereof. The preparation of more, or highly concentrated solutions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small tumor area. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed. For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.

In another embodiment, the pharmaceutical composition of the invention relates to combined preparation for simultaneous, separate or sequential use in the treatment of COPD and/or asthma in a subject in need thereof.

In a further aspect, the present invention relates to a method for improving phagocytosis in a subject in need thereof comprising a step of administering to said subject a therapeutically effective amount of an Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the invention.

The invention also provides kits comprising the Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the invention.

The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

FIGURES:

Figure 1: HRV16 downregulates Arpin expression in macrophages. hMDMs were challenged with HRV16 or controls and then stained or lysed. (J) Quantification of the mRNA expression of Arpin normalized to 18S control, n=3. (K) Quantification of FcR phagocytosis in RPE-1 cells challenged with mock medium (MI) or HRV16 and then transfected with plasmids encoding GFP or Arpin-GFP, n=4.

Figure 2: Arpin knockdown impairs bacterial internalisation by macrophages. hMDMs were non-treated, treated with siLuciferase or 2 different Arpin siRNA sequences for 96 h. (B) Quantification of the expression of Arpin normalized to tubulin and presented relative to non-treated as a percentage, n=9, ****p<0.0001 One Way Anova with Bonferonni’s Post Test vs non-treated. Error bars represent standard error of the mean (SEM).

EXAMPLE:

Material & Methods

Antibodies and reagents The following primary antibodies were used: mouse anti-actin (clone AC-40; Sigma, A3853), mouse anti-Cdc42 (BD Bioscience, 610929), mouse anti-Racl (BD Bioscience, 610650), rabbit anti-Arpin (kind gift from Alexis Gautreau), mouse anti-pl6 (Synaptic Systems, 305011), rabbit anti-p34 (Merck Millipore, 07-227), rabbit anti-phospho cofilin (Cell Signalling #3313), mouse anti-total cofilin (Cell Signalling, Clone D3F9, #5175), mouse anti-tubulin alpha (clone DM1 A, Sigma, T9026) and purified rabbit anti-SRBCs (IGN Biochemicals). DAPI was from Sigma (D9542) and phalloidin-Cy3 from Life Technologies (A22283). Zymosan A (Sigma-Aldrich) was coupled to Cy2 (GE Healthcare). Secondary antibodies were all from

Jackson Immunoresearch and were as follows: Cy5 or 488-labeled F(ab')2 anti-rabbit IgG, and mouse or rabbit anti-IgG-HRP.

Cell culture

Human peripheral blood mononuclear cells (PBMCs) were isolated from whole blood of healthy donors (Etablissement Franqais du Sang Ile-de-France, Site Trinite, Inserm agreement #15/EFS/012 and #18/EF S/030 ensuring that all donors gave a written informed consent and providing anonymized samples) by density gradient sedimentation using Ficoll- Plaque (GE Healthcare). This was followed by adhesion on plastic at 37°C for 2 h and culture in the presence of adhesion medium (RPMI 1640 (Life Technologies) supplemented with 100 pg/ml streptomycin/penicillin and 2 mM L-glutamine (Invitrogen/Gibco). Then, the adhered cells were washed once with warm adhesion medium and left to rest in macrophage medium (RPMI 1640 supplemented with 10% FCS (Eurobio), 100 pg/ml streptomycin/penicillin, and 2 mM L-glutamine). On day 1, the cultures were washed with adhesion medium and then supplemented every 2 days with fresh macrophage medium. The adherent monocytes were left to differentiate into macrophages as described previously (Jubrail et al, 2016) and used for experiments at day 10.

Human alveolar macrophages (AMs) were obtained by bronchoalveolar lavage fluid (BALF) of lung specimens from non-smokers or healthy smokers (Protocole de recherche non interventionnelle, Number ID RCB 2015-A01809) ensuring that all donors signed a consent form. The health condition of the patient was registered before the samples were treated anonymously. The sample was initially centrifuged at 290 x g for 5 minutes, the pellet resuspended in the original volume in adhesion medium and the cell count obtained. Cells were then plated onto plastic and incubated for 4 h in adhesion medium at 37°C. They were then washed thoroughly with adhesion medium and rested overnight in AM media (X-VIVO 10 without phenol red and gentamicin (Lonza) supplemented with 50 pg/ml streptomycin/penicillin, 1 Mm L-glutamine and 20 pg/ml amphotericin B (Sigma)) and experiments were performed the next day.

HeLa Ohio cells were purchased from the European Collection of Authenticated Cell Cultures (ECACC) and were cultured in DMEM GlutaMax containing 25 mM D-glucose and 1 mM sodium pyruvate (Life Technologies) supplemented with 10% FCS, 100 pg/ml penicillin/streptomycin and 2 mM L-glutamine. They were passaged every 3 days.

Generation of RPE-l-FcgRIIA cells.

FcgRIIA gene was amplified by PCR from the pRK5-FcgRIIA plasmid (E. Caron, Imperial College, London) using oligos carrying Notl and Agel restriction site. The Notl/Agel digested amplicons were inserted in a pLEX MCS plasmid (Open Biosystems) digested as well and dephosphorylated. Lentiviral particles were produced by co-transfection of HEK293T cells with packaging plasmids (pCMV 8.91 and pEnvVSVG) and pLEX-FcgRIIA plasmid. After 48 h of culture at 37°C, the virus-containing supernatant was filtered and ultracentrifuged at 60,000 x g for 90 min at 4°C on a PEG cushion (50 %). The virion-enriched pellet was resuspended in PBS and aliquoted for storage at -80°C. hTERT RPE-1 cells (ATCC(R) n° CRL-4000TM, BIOPHENICS facility, Institut Curie, Paris) were infected with lentiviral particles from MOI 1 to MOI 10. FcgRIIA-expressing hTERT RPE-1 cells were cultured in Dubelcco’s modified Eagle medium (DMEM) F-12 (Thermo Fisher Scientific) supplemented with 10 % Fetal Calf Serum (FCS, Gibco), 10 pg/ml hygromycin B and 2.5 pg/ml puromycin (Sigma). They were passaged every two days.

Bacterial strains and culture

NTHi strain RdKW20 (Bishop-Hurley et al., 2005; Domenech et al, 2016) and Moraxella catarrhalis strain 25293 (Blakeway et al., 2014) were purchased from the American Type Culture Collection (ATCC). Staphylococcus aureus strain 160201753001 and Pseudomonas aeruginosa strain 160601067201 from blood culture were provided by Professor Claire Poyart (Cochin Hospital). NTHi, S. aureus and P. aeruginosa were cultured on chocolate agar plates and M. catarrhalis was cultured on brain-heart infusion (BHI) agar plates. Plates were incubated for 24 h at 37°C until colonies appeared. All strains were grown in LB medium but for NTHi, this was also supplemented with 10 pg/ml hemin and 1 pg/ml nicotinamide adenine dinucleotide (NAD).

Human rhinovirus production

Human Rhinovirus 16 (HRV16) (VR-283, strain 11757, lot 62342987) was purchased from the ATCC and stocks were produced by infecting HeLa Ohio cells in virus medium (DMEM GlutaMax containing 25 mM D-glucose and 1 mM sodium pyruvate supplemented with 10% FCS and 2 mM L-glutamine) as described previously (Bennett et al., 2012). Briefly, HeLa Ohio cells were grown to 80% confluence and infected with 5 ml HRV16 or control media for 1 h at room temperature with agitation. The remaining solution was made to 10 ml and the cells with HRV16 left for 48 h to allow for 90% CPE to develop. Supernatants were then clarified by centrifugation and filtration (Bennett et al., 2012) and 1 ml stocks were produced and stored at -80°C. To UV inactivate HRV16 it was treated with UV light (1000mJ/cm2) for 20 minutes. Inactivation was confirmed by adding the inactivated virus to HeLa Ohio cells and checking for CPE.

Quantification of the tissue culture infective dose 50 (TCID50) of HRV16

HeLa Ohio cells were cultivated in 96 well plates at 1 x 10⁵ cells/well for 24 h. HRV16 was diluted 10-fold from undiluted to 10-9 in virus medium 50 mΐ of each dilution was added to the cells in 8 replicate wells. 50 mΐ of virus medium was added to 2 groups of control wells in 8 replicate wells per group. Cultures were incubated for 4 days at 37°C until CPE was observed in 50% of wells. TCID50 was calculated using the Spearman-Karber formula as previously outlined (Bennett et al., 2012).

HRV16 and bacterial infection of human macrophages

Macrophages were washed once in PBS and rested in virus medium. HRV16, HRV16UV or MI supernatants were added to the macrophages and placed at room temperature for 1 h with agitation to achieve a TCID50 of 1 x 10⁷/ml. Cultures were then washed with virus medium and rested in macrophage medium overnight.

NTHi, M. catarrhalis, S. aureus or P. aeruginosa were grown until mid-log growth phase, centrifuged at 1692 x g for 5 min and re-suspended in 1 ml phagocytosis medium (RPMI supplemented with 2 mM L-glutamine). Bacteria was added to macrophages pre-treated with HRV 16, HRV 16UV or MI to achieve a multiplicity of infection (MO I) of 10/cell. Cultures were then centrifuged at 602 x g for 2 min and placed at 37°C, 5% C02 for 30 or 120 min. At each time point, cultures were washed with PBS and treated with 100 Dg/ml gentamicin (NTHi, S. aureus, P. aeruginosa) or 20 Dg/ml (M. catarrhalis) for 20 min. Cultures were washed and lysed in saponin as previously described (Jubrail et al., 2016) and colony forming units (CFU) estimated using the Miles-Misra technique (Miles et al., 1938).

Measurement of bacterial binding

Macrophages were challenged with HRV16 or controls as described above and bacteria was prepared in the same manner. Cultures were washed with PBS and bacteria were added to macrophages to achieve an MOI of 10 bacteria per cell. They were placed on ice for 5, 15 or 30 min. At each time point the extracellular supernatant was taken for CFU determination. Cultures were then washed with PBS and the final wash again taken for CFU determination to determine no residual bacteria remained. Cultures were then treated with saponin and lysed and CFU estimated as described previously (Jubrail et al., 2016).

FcR, CR3 or zymosan phagocytosis

Macrophages were challenged with either IgM-iC3b or IgG-opsonised SRBC or zymosan for up to 60 min as described (Marion et al., 2012). Briefly, for CR3-mediated phagocytosis, SRBCs were washed in PBS/BSA 0.1% and incubated for 30 min with rotation in rabbit IgM anti-SRBCs. They were washed and incubated in complement C5-deficient serum without rotation for 20 min at 37°C. SRBCs were further washed, re-suspended in phagocytosis medium and added to macrophages to give approximately 10 SRBCs per cell. The plates were centrifuged at room temperature at 502 x g for 2 min and then placed at 37°C for various time points. At each time point, cells were washed with room temperature phagocytosis medium and fixed in warm 4% paraformaldehyde (Sigma- Aldrich) at room temperature for 15 min and then treated with 0.05M NH4C1/PBS1X for 10 min. For FcR-mediated phagocytosis, SRBCs were washed as above and opsonized for 30 min with rotation in rabbit IgG anti-SRBCs. They were further washed, re-suspended in phagocytosis medium and added to macrophages as above. All subsequent steps were as for CR3. For zymosan uptake, zymosan was washed twice in PBS/BSA 0.1%and then re-suspended in phagocytosis medium. Macrophages were challenged with zymosan for 60 min and all subsequent steps were as described above.

Microscopy

For FcR or CR3 mediated phagocytosis cultures were washed in lXPBS/2% FCS and external SRBCs were labelled for 30 min with F(ab’)2 anti-rabbit IgG Alexa Fluor 488 in PBS/2% FCS. Cells were then washed with 1XPBS/2%FCS and re-fixed in 4% PFA for 15 min at room temperature and then treated with 0.05M NH4C1 for 10 min before being permeabilized in lXPBS/2%FCS/0.05% saponin. Intracellular SRBCs were then detected using a Cy5-labeled F(ab’)2 anti-rabbit IgG and F-actin was stained using phalloidin-Cy3 in lXPBS/2%FCS/0.05% saponin for 30 min. After washing in lXPBS/2%FCS/0.05% saponin cells were stained with DAPI for 5 min and mounted using Fluormount G (Interchim). For zymosan uptake, cultures were washed in lXPBS/2% FCS and external zymosan was detected with an anti- zymosan antibody for 30 min followed by Cy5-labeled F(ab’)2 anti-rabbit IgG for 30 min. Cultures were washed in lXPBS/2% FCS and permeabilized in lXPBS/2%FCS/0.05% saponin before labelling with phallodin Cy3 to detect F-actin. After washing as above, cultures were treated with DAPI for 5 min and mounted using Fluormount G. To quantify phagocytosis, the number of internalized SRBCs/zymosan per cell was counted in 30 cells randomly chosen on the cover- slips corresponding to the phagocytic index. The index obtained was divided by the index obtained for control cells and was expressed as a percentage of control cells. To determine the index of association, the total number of bound and internalized SRBCs in a cell was divided by the total number of macrophages counted. Image acquisition was performed on an inverted wide-field microscope (Leica DMI6000) with a IOO^c (1.4 NA) objective and a MicroMAX camera (Princeton Instruments). Z-series of images were taken at 0.3-pm increments. Analyses were performed using custom-made ImageJ (National Institutes of Health) routines.

Quantification of F-actin recruitment in phagocytic cups and in macrophages

Quantification was performed as described previously (Braun et al., 2007). Briefly, quantification was performed on ImageJ 64bit software (NIH libraries) on a selected region in 1 place of a 16-bit stack that was acquired. Primary fluorescence intensities through the phagocytic cup and in the cell cortex were measured and background corrected. Ratio values were calculated by dividing the fluorescence intensities in the phagocytic cups by the fluorescence intensities in the cell cortex’s and plotted. To quantify the F-actin intensity in HRV16 exposed macrophages two macros were used. The first macro was written to quantify the intensity of staining in the entire field of cells. Quantification was performed using ImageJ 64bit software on entire 16-bit Z stacks. The macro automatically decided which plane of the Z stack to use and when in focus it divided the field into 4 sections and quantified the fluorescence of the punctate F-actin and the total F-actin in each section. The second macro was written to quantify the intensity of the punctate F-actin per cell. This was done in the same way as for macro 1 apart from instead of calculating the intensity in the section, the macro quantified it in each individual cell within the field selected by the macro. To quantify the F- actin intensity each macro used the FindFocussedSlices filter and two automatic ImageJ thresholding. The first was Percentile Dark for the total F-actin and the second was Default Dark for the punctate F-actin. The results from each output were reported as a summary for each cell or field in ImageJ. All results for both macro 1 and 2 were transferred to Graphpad Prism and plotted.

Western blots

Macrophages were lysed with lysis buffer (20 mM Tris HC1, pH 7.5, 150 mM NaCl, 0.5 % NP-40, 50 mM NaF, and 1 mM sodium orthovanadate, supplemented with complete protease inhibitor cocktail (Roche Diagnostic)) for 15 min. Lysates were centrifuged at 16,100 x g for 10 min at 4°C. The supernatants were removed and stored at -20 °C and an equal concentration of protein (BCA dosage kit, Pierce) was analyzed by SDS-PAGE. Proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore) at 4°C for 100 min and incubated in blocking solution TBS/0.1% Tween-20 supplemented with 5% milk or BSA for 2 h. Blots were rinsed with TBS/0.1% Tween-20 and primary antibodies were incubated in the blocking solution overnight or for 2 h as required. The membrane was further washed and incubated with HRP-coupled secondary antibodies in blocking buffer for 45 min. Detection was performed using ECL Dura substrate (GE Healthcare) and bands imaged by Fusion (Vilber Lourmat) and quantified in Image!

Scanning electron microscopy

Cells were fixed with 2.5 % glutaraldehyde (Sigma Aldrich) in 0.1M HEPES, pH 7.2 in phagocytosis medium at 37°C for 1 h. They were then fixed in 2.5% glutaraldehyde in 0.1M HEPES buffer in PBS at 4°C overnight. Post fixation was done with 1 % osmium tetroxide (Merck) and 1.5 % ferrocyanide (Sigma Aldrich) in 0.1M HEPES. After dehydration by a graded series of ethanol, the samples were transferred to a Leica EM CPD300 and dried according to standard procedures. Samples were mounted on aluminium stubs and sputter coated with 7 nm of gold palladium in a Gatan ion beam coater. Samples were examined at 5kV in an Jeol 6700F scanning electron microscope. siRNA Treatment

Macrophages at day 7 were washed twice with macrophage medium and kept in macrophage medium at 37°C. The siRNA solution was prepared in OptiMEM medium (GlutaMAX supplemented, Gibco), containing Lipofectamine RNAiMAX reagent (Invitrogen) and siRNA at a concentration of 100 mM. siRNA was added to each well and cultures left for 96 h at 37°C before being used. qPCR hMDMs were exposed to HRV 16 or MI control as described above. After overnight rest, cultures were washed with PBS and RNA was extracted as previously described (Chomczynski and Sacchi, 1987). Briefly, hMDMs were washed with PBS at room temperature and lysed using Trizol reagent (ThermoFischer Scientific). Proteins (organic phase) and RNA and DNA (aqueous phase) were separated using chlorophorm for 2 min at room temperature followed by 15 min centrifugation at 4°C at 12,000 x g. The aqueous phase was collected and isopropanol was added to precipitate RNA and incubated for 10 min at room temperature. Samples were centrifuged for 20 min at 4°C at 15,000 x g and the pellet of RNA washed with 75% ethanol and centrifuged for a further 5 min at 4°C at 10,000 x g. The pellet was dried at room temperature and resuspended in pure water and warmed at 55°C for 5 min. The total amount of RNA was quantified using nanodrop. For reverse transcription 1 pg of mRNA was retro- transcribed into DNA using Superscript II Reverse Transcriptase (ThermoFischer Scientific). qPCR was performed using the LightCycler 480 SYBR Green I Master (Roche) with specific oligos to detect Arpin with 18S RNA as control (Table 2).

RPE-1 cell transfection

RPEl cells at 80 % confluence were washed with PBS and detached using 0.25 % Trypsin/EDTA (Life Technologies). After centrifugation, the cell count was determined and the cells seeded on coverslips at a density of 15, 000 per coverslip and allowed to adhere overnight. The next day, the coverslips were exposed to HRV16 or mock infected as described above. Then they were transferred to a 6 well plate and transfected. The plasmid solution was prepared in OptiMEM medium (GlutaMAX supplemented, Gibco), containing Fugene reagent (Invitrogen) and each plasmid at a concentration of 3 pg. Plasmid solution was added to each well and cultures left for 24 h at 37°C before being treated for FcR phagocytosis.

Statistical analysis

Statistical tests were performed using Graphpad prism® version 6 software. All statistical tests are listed in the figure legends and significance was determined if p <0.05.

Results

Human rhinovirus 16 impairs bacterial internalisation in human macrophages

We first set out to determine if macrophages could internalise bacteria after HRV16 challenge. We challenged human monocyte-derived macrophages (hMDMs) with HRV16, HRV16 inactivated by a UV treatment (HR VI 6UV) or mock infected medium (MI) for 1 h at room temperature followed by overnight rest. The next day, we exposed them to non-typeable Haemophilus influenza (NTHi), Moraxella catarrhalis, Staphylococcus aureus or Pseudomonas aeruginosa and measured internalisation at 30 and 120 min after washing and incubation with antibiotics to kill extracellular bacteria. We found that hMDMs challenged with HRV16 were significantly impaired in their ability to internalise all four bacteria over 120 min compared to hMDMs challenged with HRV16UV or mock infected (data not shown). To determine if this result was due to a high HRV16 tissue culture infective dose 50 (TCID50), we repeated our experiments over a range of TCID50’s and measured internalisation of NTHi and S. aureus over 120 min. We found that HRV16 impaired the internalisation of NTHi (data not shown) and S. aureus in hMDMs (data not shown) from TCTD50’s as low as 1 x 10³ reaching a maximal impairment at TCID50 1 x 10⁷. We also calculated the percentage inhibition of internalisation of NTHi or S. aureus at 120 min for all TCID50’s relative to mock infection and found that on average the impairment in internalisation caused by HRV16 was greater for S. aureus than NTHi at TCID50 1 x 10⁵ or 1 x 10⁶ but identical and maximal by TCID50 1 x 10⁷ reaching 80% (data not shown).

Then, because reduced internalization of bacteria could be due to a reduced initial binding to the cell surface, we repeated our experiments over 30 minutes by incubating hMDMs with the different bacteria on ice for 5, 15 or 30 min (data not shown). No differences in bacterial attachment to hMDMs were observed in cells challenged with HRV16 or control conditions. These results indicated that HRV16 impaired the response of hMDMs to bacteria at the level of internalisation.

Finally, because HRV16 is a predominant cause of exacerbation in COPD (Caramori et al, 2003, Wilkinson et al, 2017), we decided to explore the effect of HRV16 challenge on bacterial internalisation by human alveolar macrophages (AMs). We found that non-smoker, non-COPD AMs challenged with HRV16 were significantly impaired in their ability to internalise NTHi over 120 min compared to AMs challenged with HRV 16UV or mock infection (MI) (data not shown). When we repeated our experiments using healthy smoker AMs we first found that they internalised less bacteria at baseline relative to non-smoker, non-COPD AMs (data not shown). Interestingly, even if smoking itself impaired bacterial internalisation, we found that HRV16 challenge led to an additive impairment in NTHi internalisation by healthy smoker AMs (data not shown).

Taken together, these results demonstrate that HRV16 challenge in in vitro derived macrophages impaired their ability to internalise bacteria. Importantly, we observed the same defect in human lung resident macrophages.

Human rhinovirus 16 impairs zymosan, CR3- and FcR-mediated internalisation in human macrophages

We next wanted to determine if the impairment in internalisation caused by HRV16 was specific to bacteria. Therefore, we exposed hMDMs post HRV 16 challenge to zymosan for 60 min. We found that hMDMs challenged with HRV16 were significantly impaired in their ability to internalise zymosan compared to MI or HRV16UV treated hMDMs (data not shown), internalising on average 70% less zymosan (data not shown). To allow us to better characterize the defect in internalisation caused by HRV16 we decided to next analyse the internalisation of opsonized particles that trigger only one type of phagocytic receptor. Therefore, post HRV16 challenge we exposed hMDMs to sheep red blood cells (SRBC) opsonized with either IgM- iC3b or IgG for 60 min. hMDMs challenged with HRV16 were significantly impaired in their ability to internalise either IgM-iC3b or IgG opsonized SRBC compared to control or HRV16UV treated hMDMs (data not shown), internalising on average 50% less of either particle (data not shown). Representative images of mock infected or HRV16 treated hMDMs highlighted the internalized SRBC. The images clearly demonstrate the impaired internalisation caused by HRV16 towards IgM-iC3b opsonized SRBC (data not shown) or IgG opsonized SRBC (data not shown).

These results along with the previous results demonstrate that HRV16 challenge of hMDMs impairs various phagocytic pathways, suggesting that HRV16 targets a global regulator of phagocytosis in macrophages.

Human rhinovirus 16 impairs phagocytic cup formation in human macrophages

Having shown that HRV16 impaired internalisation by hMDMs, we next set out to analyse if HRV16 altered membrane remodelling at the onset of phagocytosis. For this, we challenged hMDMs with HRV 16 or MI control and then exposed them to IgG-opsonised SRBC for 2-30 min. The samples were stained with phalloidin to analyse F-actin recruitment around the internalised SRBC. We counted the number of F-actin positive cups (data not shown) and calculated the enrichment of F-actin around the SRBC at each phagocytic cup relative to the cell cortex (Braun 2007) (data not shown). Over the first 5 min of internalisation, we did not observe any significant difference in the number of F-actin cups that formed in mock infected or HRV16 treated hMDMs (data not shown). Despite this, there was less internalisation in HRV16 challenged hMDMs over the first 5 min compared to control hMDMs (data not shown). Importantly, there was no equivalent difference in SRBC association to HRV16 challenged hMDMs over these first 5 min (data not shown). Despite the similarity in the number of F-actin cups that formed at 5 min in both conditions, we could observe differences in the F-actin make up around the internalised SRBC. The cups looked thinner and less defined in HRV16 challenged hMDMs compared to control hMDMs, and the intensity of F-actin staining around the cups was lower in the early time point (2 min, data not shown). At 15 and 30 min post internalisation, we observed a sustained number of F-actin cups in HRV16 challenged hMDMs compared to mock infected hMDMs where only few F-actin cups were still observed data not shown) and this reached statistical significance at 15 min (data not shown). In line with these results, we observed significantly less internalisation over these later time points in HRV16 challenged hMDMs (data not shown), with no differences in association (data not shown). Importantly, internalisation was still inhibited at 60 min in HRV16 challenged hMDMs, demonstrating that HRV16 does not just delay, but inhibits, internalisation (data not shown). When we next looked at F-actin cups at 15 min, we could see they were stalled and still contained F-actin, similar to MI at 5 min, but the intensity of staining was lower (data not shown). Very interestingly, we observed a sustained enrichment of F-actin around internalised SRBC that was similar from 5-30 minutes and showed no clear decrease, as opposed to the control cells (data not shown).

Finally, to better visualise the membrane architecture in HRV16 challenged hMDMs, we performed scanning electron microscopy on mock infected or HRV16 challenged hMDMs after 5 min of internalisation of IgG-opsonised SRBC (data not shown). In mock infected hMDMs, we often observed a lot of membrane folds in several layers progressing over the SRBC (data not shown). In HRV16 challenged hMDMs, there were fewer membrane folds, the membrane covering the SRBC was thinner and only partially covered of the SRBC (data not shown). Combined with our fluorescence images, these results demonstrate that HRV16 impairs internalisation in hMDMs by perturbing early phagosome formation and actin remodelling.

Human rhinovirus does not affect the expression of F-actin in human macrophages but down-regulates the expression of Arpin

We next set out to determine more precisely whether HRV16 disrupted the actin cytoskeleton in hMDMs. We challenged hMDMs with HRV16 or control medium for 1 h followed by overnight rest and then stained the cells with phalloidin. The F-actin network did not appear to be disrupted by HRV16, but the global F-actin intensity was lower in HRV16 challenged hMDMs compared to mock infected hMDMs (data not shown). When we quantified our images we first determined that the total F-actin intensity in each field imaged was significantly lower in HRV16 challenged hMDMs compared to control hMDMs (data not shown). In addition, we observed that the intensity of the punctate F-actin was significantly lower in HRV16 challenged vs mock treated hMDMs (data not shown). Because the primary cells are heterogeneous, we re-analysed the data on a per cell basis and we also determined that the intensity of staining of punctate F-actin was significantly lower in individual cells in HRV 16 challenged hMDMs compared to control conditions (data not shown). Collectively these results suggested that HRV16 was disrupting the F-actin network in hMDMs.

We therefore postulated that there might be globally less actin protein in our HRV16 challenged hMDMs. However, immunoblot analysis revealed no change in the actin expression between HRV16 challenged, HRV16UV challenged or mock infected cells (data not shown). Although the quantification across 10 donors revealed variations in the global amount there was no significant trend in either direction towards more or less F-actin in either condition (data not shown). This result suggested that HRV16 might be targeting a regulator of the F-actin network in hMDMs rather than the G-actin pool. To test this hypothesis, we challenged hMDMs to HRV 16 or HRV16UV or mock conditions and screened for a range of actin-associated proteins. Of the actin regulators that we tested, we found that the Arp2/3 inhibitor Arpin was consistently and significantly down-regulated on average by 30% in HRV16 challenged hMDMs compared to control conditions (data not shown). Of note, there was no effect on the global expression of Racl, which is upstream of Arpin and activates Arp2/3 via WAVE (Eden 2002) (data not shown). We found no significant decrease in the expression of Cdc42 that activates Arp2/3 via WASP (data not shown). We then looked at subunits of Arp2/3 including ArpC2 (p34-Arc) and ArpC5 (pl6-Arc). We observed no difference in the global expression of p34-Arc in HRV16 challenged hMDMs compared to control conditions and a non-significant increase in the global expression of pl6-Arc that was not specific to the live virus (data not shown). We also analysed the expression of cofilin and observed no difference in the total or phosphorylated forms (data not shown). We next checked if HRV16 affected the mRNA level for Arpin by qRT-PCR. There was approximately 50% less mRNA for Arpin in HRV16 exposed hMDMs as compared to control mock treated cells (Figure 1 A). This indicates that HRV16 regulates Arpin expression at the transcriptional level.

Finally, to further confirm that the disruption of Arpin expression by HRV16 was mediating deficient internalisation caused by HRV16, we set out to re-express the protein and analyse if internalisation is restored. To overcome the issues of transfecting primary human macrophages, we made use of retinal pigment epithelial- 1 (RPE-1) cells that were transduced with lentivirus to express the phagocytic FcgRIIA/CD32. We first verified by flow cytometry that the transduced cells expressed the receptor and found that 99% of cells were positive for CD32 (data not shown). Next, we exposed these cells to HRV16 or to mock infected medium for 1 h followed by overnight rest and then challenged them with IgG opsonised SRBC for 1 h. We found that RPE-l-FcgRIIA cells exposed to HRV16 internalised on average 40% less SRBC compared to a mock treatment (data not shown). Having confirmed that RPE-1 -FcgRIIA cells responded like human macrophages to HRV16 (data not shown), we next exposed these cells to HRV16 or mock medium and, after the overnight rest, transfected them with plasmids encoding either GFP or Arpin-GFP for 24 h. Then we performed a phagocytosis experiment using IgG-opsonised SRBC for 1 h. We demonstrated that RPE-l-FcgRIIA cells exposed to HRV16 and then transfected with GFP internalised significantly less SRBC compared to mock infection controls (data not shown) which averaged an approximate 40% decrease (Figure IB). Importantly, when RPE-1 -FcgRIIA cells were exposed to HRV16 and then transfected with Arpin-GFP, the internalisation of SRBC was restored back to mock infection levels (Figure IB).

Taken together, our results show that live HRV16 impairs the F-actin network in hMDMs and reveal that the Arp2/3 inhibitor Arpin is down-regulated in live HRV16-treated macrophages. Furthermore, these results demonstrate that HRV16 specifically targeted Arpin to decrease internalisation and that transient expression of the protein restored the phagocytic capacities of HRV16-treated macrophages. Therefore, Arpin is a crucial factor targeted by this rhinovirus to impair phagocytosis.

Arpin knockdown impairs bacterial internalisation

Because the Arp2/3 inhibitor had never been implicated in phagocytosis, we next addressed whether a decrease in Arpin expression could recapitulate the perturbations in phagosome formation that we observed in macrophages challenged with HRV. We treated hMDMs with two siRNA against Arpin (Dang et al, 2013) or luciferase as a control, or left them non-treated for 96 h. Immunoblot analysis and quantification demonstrated significant Arpin reduction for both siRNA sequences in 9 donors (Figure 2). We challenged the Arpin- depleted macrophages with either NTHi, M. catarrhalis, S. aureus or P. aeruginosa for up to 120 min. We found that hMDMs treated with Arpin siRNA were significantly impaired in their ability to internalise all bacteria (data not shown) relative to non-treated hMDMs. Importantly, hMDMs treated with siLuciferase demonstrated similar bacterial internalisation to non-treated hMDMs (data not shown). Finally, we also assessed bacterial binding to hMDMs over 5-30 minutes of infection post siRNA treatment and found this to not be different between the four conditions (data not shown). These results demonstrate that Arpin plays a crucial role in bacterial internalisation in hMDMs.

Arpin knockdown impairs membrane dynamics around internalised particles

Having shown that Arpin knockdown impaired internalisation of bacteria by human macrophages, we next set out to analyse if it impaired F-actin dynamics at the phagocytic cup. We treated hMDMs with Arpin siRNA or controls and after 96 h challenged them with IgG- opsonised SRBC for 15-30 min. SRBC were significantly less internalized in macrophages where Arpin was knocked down, as compared with control conditions (data not shown). In contrast, there was a non- significant trend towards less association of SRBC to hMDMs treated with siRNA against Arpin (data not shown), indicating that depletion of Arpin leads to a defective phagocytosis. Similar to what we observed with HRV16, internalisation was not simply delayed in Arpin-depleted macrophages, as internalisation was still impaired after 60 min (data not shown). In addition, we observed significantly more F-actin cups in Arpin- depleted macrophages as compared to control conditions at 15 min post internalisation (data not shown). We then examined the F-actin cups in Arpin-depleted versus non-treated or siLuciferase treated hMDMs where the F-actin cups were complete, with homogeneous F-actin organisation around the particles (data not shown). In contrast, Arpin knockdown not only led to an increased number of cups, but also to cups that appeared fragmented with puncta of staining (data not shown). By 30 min post-internalisation there were very few cups in control conditions (data not shown). However, in Arpin knockdown hMDMs, there were still significantly more F-actin cups compared to control conditions albeit the global number had decreased (data not shown). We next calculated the enrichment of F-actin around internalised SRBC relative to the cell cortex. As expected, the enrichment of F-actin around internalised SRBC was similar for non-treated or siLuciferase treated hMDMs at 15 min and decreased by 30 min (data not shown). Strikingly, in Arpin-depleted hMDMs, we observed significantly more F-actin enrichment around internalised SRBC at 15 and 30 min relative to control conditions (data not shown), consistent with the increased number of F-actin cups counted (data not shown). To better observe the membrane architecture when Arpin was knocked down in human macrophages, we performed scanning electron microscopy on Arpin siRNA or control hMDMs after 15 min of internalisation of IgG-opsonised SRBC (data not shown). In control hMDMs, we could see a very thin covering of host membrane over the SRBC indicating near- complete internalisation (data not shown). In hMDMs treated with siRNA targeting Arpin, we could observe accumulation of membrane folds around the SRBC or thin membrane layers partially covering the particle (data not shown). This indicated that Arpin knockdown was impairing phagocytic cups progression and completion.

Together, these results show that Arpin is not required for the initial onset of actin polymerization but is rather critical and essential for regulating phagocytic cup extension and closure.

Conclusion:

In conclusion, our results demonstrate that Arpin is crucial for successful phagocytosis in macrophages and adds phagocytosis as a new function we can now attribute to this protein.

We therefore reveal that Arpin is a major target of HRV16 infection, which opens new avenues for strategies to improve clearance of apoptotic cells that would reduce inflammation and to increase bacterial phagocytosis that would suppress colonisation in the airways.

REFERENCES:

Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure. Aizawa, H., Y. Fukui, and I. Yahara. 1997. Live dynamics of Dictyostelium cofilin suggests a role in remodeling actin latticework into bundles. J Cell Sci. 110 ( Pt 19):2333-2344.

Araki, N., T. Hatae, A. Furukawa, and J.A. Swanson. 2003. Phosphoinositide-3 -kinase- independent contractile activities associated with Fcgamma-receptor-mediated phagocytosis and macropinocytosis in macrophages. J Cell Sci. 116:247-257.

Arruda, E., T.R. Boyle, B. Winther, D.C. Pevear, J.M. Gwaltney, Jr., and F.G. Hayden. 1995. Localization of human rhinovirus replication in the upper respiratory tract by in situ hybridization. J Infect Dis. 171:1329-1333.

Bennett, J.A., L.R. Prince, L.C. Parker, C.A. Stokes, H.G. de Bruin, M. van den Berge, I.H. Heijink, M.K. Whyte, and I. Sabroe. 2012. Pellino-1 selectively regulates epithelial cell responses to rhinovirus. J Virol. 86:6595-6604.

Bishop-Hurley, S.L., F.J. Schmidt, A.L. Erwin, and A.L. Smith. 2005. Peptides selected for binding to a virulent strain of Haemophilus influenzae by phage display are bactericidal. Antimicrob Agents Chemother. 49:2972-2978.

Blaas, D., and R. Fuchs. 2016. Mechanism of human rhinovirus infections. Mol Cell Pediatr. 3:21.

Blakeway, L.V., P.M. Power, F.E. Jen, S.R. Worboys, M. Boitano, T.A. Clark, J. Korlach, L.O. Bakaletz, M.P. Jennings, I.R. Peak, and K.L. Seib. 2014. ModM DNA methyltransferase methylome analysis reveals a potential role for Moraxella catarrhalis phasevarions in otitis media. FASEB J. 28:5197-5207.

Bochkov, Y.A., K. Watters, S. Ashraf, T.F. Griggs, M.K. Devries, D.J. Jackson, A.C. Palmenberg, and J.E. Gern. 2015. Cadherin-related family member 3, a childhood asthma susceptibility gene product, mediates rhinovirus C binding and replication. Proc Natl Acad Sci U S A. 112:5485-5490.

Bohdanowicz, M., D.M. Balkin, P. De Camilli, and S. Grinstein. 2012. Recruitment of OCRL and Inpp5B to phagosomes by Rab5 and APPLl depletes phosphoinositides and attenuates Akt signaling. Mol Biol Cell. 23:176-187.

Braun, V., C. Deschamps, G. Raposo, P. Benaroch, A. Benmerah, P. Chavrier, and F. Niedergang. 2007. AP-1 and ARFl Control Endosomal Dynamics at Sites of FcR mediated Phagocytosis. Mol Biol Cell. 18:4921-4931.

Canton, J., D. Neculai, and S. Grinstein. 2013. Scavenger receptors in homeostasis and immunity. Nat Rev Immunol. 13:621-634.

Carrier, M.F., F. Ressad, and D. Pantaloni. 1999. Control of actin dynamics in cell motility. Role of ADF/cofilin. J Biol Chem. 274:33827-33830. Caron, E., and A. Hall. 1998. Identification of two distinct mechanisms of phagocytosis controlled by different Rho GTPases. Science. 282:1717-1721.

Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical biochemistry. 162: 156-159.

Cole, J., J. Aberdein, J. Jubrail, and D.H. Dockrell. 2014. The role of macrophages in the innate immune response to Streptococcus pneumoniae and Staphylococcus aureus: mechanisms and contrasts. Adv Microb Physiol. 65:125-202.

Cox, D., C.C. Tseng, G. Bjekic, and S. Greenberg. 1999. A requirement for phosphatidylinositol 3-kinase in pseudopod extension. J Biol Chem. 274:1240-1247.

Dang, T, R. Gorelik, C. Sousa-Blin, E. Delivery, C. Guerin, J. Linkner, M. Nemethova, J.G. Dumortier, F.A. Giger, T.A. Chipysheva, V.D. Ermilova, S. Vacher, V. Campanacci, I. Herrada, A.G. Planson, S. Fetics, V. Henriot, V. David, K. Oguievetskaia, G. Lakisic, F. Pierre, A. Steffen, A. Boyreau, N. Peyrieras, K. Rottner, S. Zinn- Justin, J. Cherfils, I. Bieche, A.Y. Alexandrova, N.B. David, J.V. Small, J. Faix, L. Blanchoin, and A. Gautreau. 2013. Inhibitory signalling to the Arp2/3 complex steers cell migration. Nature. 503:281-284.

Dang, T, J. Linkner, J. Yan, D. Irimia, J. Faix, and A. Gautreau. 2017. The Arp2/3 inhibitory protein Arpin is dispensable for chemotaxis. Biol Cell. 109:162-166.

Domenech, M., E. Pedrero-Vega, A. Prieto, and E. Garcia. 2016. Evidence of the presence of nucleic acids and beta-glucan in the matrix of non-typeable Haemophilus influenzae in vitro biofilms. Sci Rep. 6:36424.

Fetics, S., A. Thureau, V. Campanacci, M. Aumont-Nicaise, I. Dang, A. Gautreau, J. Perez, and J. Cherfils. 2016. Hybrid Structural Analysis of the Arp2/3 Regulator Arpin Identifies Its Acidic Tail as a Primary Binding Epitope. Structure. 24:252-260.

Flannagan, R.S., G. Cosio, and S. Grinstein. 2009. Antimicrobial mechanisms of phagocytes and bacterial evasion strategies. Nat Rev Microbiol. 7:355-366.

Flannagan, R.S., V. Jaumouille, and S. Grinstein. 2012. The cell biology of phagocytosis. Annual review of pathology. 7:61-98.

Freeman, S.A., and S. Grinstein. 2014. Phagocytosis: receptors, signal integration, and the cytoskeleton. Immunol Rev. 262:193-215.

Gem, J.E., E.C. Dick, W.M. Lee, S. Murray, K. Meyer, Z.T. Handzel, and W.W. Busse. 1996. Rhinovirus enters but does not replicate inside monocytes and airway macrophages. J Immunol. 156:621-627. Gern, J.E., D.M. Galagan, N.N. Jarjour, E.C. Dick, and W.W. Busse. 1997. Detection of rhinovirus RNA in lower airway cells during experimentally induced infection. American journal of respiratory and critical care medicine. 155:1159-1161.

Gorelik, R., and A. Gautreau. 2015. The Arp2/3 inhibitory protein arpin induces cell turning by pausing cell migration. Cytoskeleton (Hoboken). 72:362-371.

Greenberg, S., J. el Khoury, F. di Virgilio, E.M. Kaplan, and S.C. Silverstein. 1991. Ca(2+)-independent F-actin assembly and disassembly during Fc receptor-mediated phagocytosis in mouse macrophages. J Cell Biol. 113:757-767.

Hodge, S., G. Hodge, J. Ahern, H. Jersmann, M. Holmes, and P.N. Reynolds. 2007. Smoking alters alveolar macrophage recognition and phagocytic ability: implications in chronic obstructive pulmonary disease. American journal of respiratory cell and molecular biology. 37:748-755.

Hofer, F., M. Gruenberger, H. Kowalski, H. Machat, M. Huettinger, E. Kuechler, and D. Blaas. 1994. Members of the low density lipoprotein receptor family mediate cell entry of a minor-group common cold virus. Proc Natl Acad Sci U S A. 91 : 1839-1842.

Hoppe, A.D., and J.A. Swanson. 2004. Cdc42, Racl, and Rac2 display distinct patterns of activation during phagocytosis. Mol Biol Cell. 15:3509-3519.

Hudy, M.H., S.L. Traves, and D. Proud. 2014. Transcriptional and epigenetic modulation of human rhinovirus-induced CXCL10 production by cigarette smoke. American journal of respiratory cell and molecular biology. 50:571-582.

Hudy, M.H., S.L. Traves, S. Wiehler, and D. Proud. 2010. Cigarette smoke modulates rhinovirus-induced airway epithelial cell chemokine production. The European respiratory journal. 35:1256-1263.

Jacobs, S.E., D.M. Lamson, K. St George, and T.J. Walsh. 2013. Human rhinoviruses. Clin Microbiol Rev. 26:135-162.

Jubrail, J., N. Kurian, and F. Niedergang. 2017. Macrophage phagocytosis cracking the defect code in COPD. Biomed J. 40:305-312.

Jubrail, J., P. Morris, M.A. Bewley, S. Stoneham, S.A. Johnston, S.J. Foster, A.A. Peden, R.C. Read, H.M. Marriott, and D.H. Dockrell. 2016. Inability to sustain intraphagolysosomal killing of Staphylococcus aureus predisposes to bacterial persistence in macrophages. Cell Microbiol. 18:80-96.

Kennedy, J.L., R.B. Turner, T. Braciale, P.W. Heymann, and L. Borish. 2012. Pathogenesis of rhinovirus infection. Current opinion in virology. 2:287-293. Laza-Stanca, V., L.A. Stanciu, S.D. Message, M.R. Edwards, J.E. Gern, and S.L. Johnston. 2006. Rhinovirus replication in human macrophages induces NF-kappaB-dependent tumor necrosis factor alpha production. J Virol. 80:8248-8258.

Maciejewski, B.A., K.C. Jamieson, J.W. Arnason, C. Kooi, S. Wiehler, S.L. Traves, R. Leigh, and D. Proud. 2017. Rhinovirus-bacteria coexposure synergistically induces CCL20 production from human bronchial epithelial cells. Am J Physiol Lung Cell Mol Physiol. 312:L731-L740.

Marie- Anais, F., J. Mazzolini, F. Herit, and F. Niedergang. 2016. Dynamin-Actin Cross Talk Contributes to Phagosome Formation and Closure. Traffic. 17:487-499.

Marion, S., J. Mazzolini, F. Herit, P. Bourdoncle, N. Kambou-Pene, S. Hailfmger, M. Sachse, J. Ruland, A. Benmerah, A. Echard, M. Thome, and F. Niedergang. 2012. The NF- kappaB Signaling Protein Bel 10 Regulates Actin Dynamics by Controlling API and OCRL- Bearing Vesicles. Dev Cell. 23:954-967.

Maritzen, T., T. Zech, M.R. Schmidt, E. Krause, L.M. Machesky, and V. Haucke. 2012. Gadkin negatively regulates cell spreading and motility via sequestration of the actin-nucleating ARP2/3 complex. Proc Natl Acad Sci U S A. 109:10382-10387.

May, R.C., E. Caron, A. Hall, and L.M. Machesky. 2000. Involvement of the Arp2/3 complex in phagocytosis mediated by FcgammaR or CR3. Nat Cell Biol. 2:246-248.

May, R.C., and L.M. Machesky. 2001. Phagocytosis and the actin cytoskeleton. Journal of Cell Science. 114:1061-1077.

Miles, A.A., S.S. Misra, and J.O. Irwin. 1938. The estimation of the bactericidal power of the blood. J Hyg (Lond). 38:732-749.

Millius, A., N. Watanabe, and O.D. Weiner. 2012. Diffusion, capture and recycling of SCAR/WAVE and Arp2/3 complexes observed in cells by single-molecule imaging. J Cell Sci. 125:1165-1176.

Molinie, N., and A. Gautreau. 2018. The Arp2/3 Regulatory System and Its Deregulation in Cancer. Physiol Rev. 98:215-238.

Niedergang, F. 2016. Phagocytosis. In Encyclopedia of Cell Biology. Vol. 2. R. Bradshaw and P. Stahl, editors. Waltham, MA: Academic Press. 751-757.

Niedergang, F., and P. Chavrier. 2005. Regulation of phagocytosis by Rho GTPases. Curr Top Microbiol Immunol. 291:43-60.

Niedergang, F., and S. Grinstein. 2018. How to build a phagosome: new concepts for an old process. Curr Opin Cell Biol. 50:57-63. Oliver, B.G., S. Lim, P. Wark, V. Laza-Stanca, N. King, J.L. Black, J.K. Burgess, M. Roth, and S.L. Johnston. 2008. Rhinovirus exposure impairs immune responses to bacterial products in human alveolar macrophages. Thorax. 63:519-525.

Palmenberg, A.C., D. Spiro, R. Kuzmickas, S. Wang, A. Djikeng, J.A. Rathe, C.M. Fraser-Liggett, and S.B. Liggett. 2009. Sequencing and analyses of all known human rhinovirus genomes reveal structure and evolution. Science. 324:55-59.

Papadopoulos, N.G., A. Papi, J. Meyer, L.A. Stanciu, S. Salvi, S.T. Holgate, and S.L. Johnston. 2001. Rhinovirus infection up-regulates eotaxin and eotaxin-2 expression in bronchial epithelial cells. Clin Exp Allergy. 31:1060-1066.

Papi, A., and S.L. Johnston. 1999. Rhinovirus infection induces expression of its own receptor intercellular adhesion molecule 1 (ICAM-1) via increased NF-kappaB-mediated transcription. J Biol Chem. 274:9707-9720.

Prabhudas, M., D. Bowdish, K. Drickamer, M. Febbraio, J. Herz, L. Kobzik, M. Krieger, J. Loike, T.K. Means, S.K. Moestrup, S. Post, T. Sawamura, S. Silverstein, X.Y. Wang, and J. El Khoury. 2014. Standardizing scavenger receptor nomenclature. J Immunol. 192:1997-2006.

Rocca, D.L., S. Martin, E.L. Jenkins, and J.G. Hanley. 2008. Inhibition of Arp2/3- mediated actin polymerization by PICK1 regulates neuronal morphology and AMP A receptor endocytosis. Nat Cell Biol. 10:259-271.

Rotty, J.D., H.E. Brighton, S.L. Craig, S.B. Asokan, N. Cheng, J.P. Ting, and J.E. Bear. 2017. Arp2/3 Complex Is Required for Macrophage Integrin Functions but Is Dispensable for FcR Phagocytosis and In Vivo Motility. Dev Cell. 42:498-513 e496.

Sajjan, U., Q. Wang, Y. Zhao, D.C. Gruenert, and M.B. Hershenson. 2008. Rhinovirus disrupts the barrier function of polarized airway epithelial cells. American journal of respiratory and critical care medicine. 178:1271-1281.

Schlam, D., R.D. Bagshaw, S.A. Freeman, R.F. Collins, T. Pawson, G.D. Fairn, and S. Grinstein. 2015. Phosphoinositide 3 -kinase enables phagocytosis of large particles by terminating actin assembly through Rac/Cdc42 GTPase-activating proteins. Nat Commun. 6:8623.

Scott, C.C., W. Dobson, R.J. Botelho, N. Coady-Osberg, P. Chavrier, D.A. Knecht, C. Heath, P. Stahl, and S. Grinstein. 2005. Phosphatidylinositol-4,5-bisphosphate hydrolysis directs actin remodeling during phagocytosis. J Cell Biol. 169:139-149.

Shaykhiev, R., A. Krause, J. Salit, Y. Strulovici-Barel, B.G. Harvey, T.P. O'Connor, and R.G. Crystal. 2009. Smoking-dependent reprogramming of alveolar macrophage polarization: implication for pathogenesis of chronic obstructive pulmonary disease. J Immunol. 183:2867- 2883.

Sokolova, O.S., A. Chemeris, S. Guo, S.L. Alioto, M. Gandhi, S. Padrick, E. Pechnikova, V. David, A. Gautreau, and B.L. Goode. 2017. Structural Basis of Arp2/3 Complex Inhibition by GMF, Coronin, and Arpin. J Mol Biol. 429:237-248.

Staunton, D.E., V.J. Merluzzi, R. Rothlein, R. Barton, S.D. Marlin, and T.A. Springer. 1989. A cell adhesion molecule, ICAM-1, is the major surface receptor for rhinoviruses. Cell. 56:849-853.

Swanson, J. A. 2008. Shaping cups into phagosomes and macropinosomes. Nat Rev Mol Cell Biol. 9:639-649.

Ulvila, J., L.M. Vanha-aho, A. Kleino, M. Vaha-Makila, M. Vuoksio, S. Eskelinen, D. Hultmark, C. Kocks, M. Hallman, M. Parikka, and M. Ramet. 2011. Cofilin regulator 14-3- 3zeta is an evolutionarily conserved protein required for phagocytosis and microbial resistance. J Leukoc Biol. 89:649-659.

Unger, B.L., A.N. Fans, S. Ganesan, A.T. Comstock, M.B. Hershenson, andU.S. Sajjan. 2012. Rhinovirus attenuates non-typeable Hemophilus influenzae-stimulated IL-8 responses via TLR2-dependent degradation of IRAK-1. PLoS Pathog. 8:el002969.

Whiteman, S.C., A. Bianco, R.A. Knight, and M.A. Spiteri. 2003. Human rhinovirus selectively modulates membranous and soluble forms of its intercellular adhesion molecule- 1 (ICAM-1) receptor to promote epithelial cell infectivity. J Biol Chem. 278:11954-11961.

Wilkinson, T.M., J.R. Hurst, W.R. Perera, M. Wilks, G.C. Donaldson, and J.A. Wedzicha. 2006. Effect of interactions between lower airway bacterial and rhinoviral infection in exacerbations of COPD. Chest. 129:317-324.

Wilkinson, T.M.A., E. Aris, S. Bourne, S.C. Clarke, M. Peeters, T.G. Pascal, S. Schoonbroodt, A.C. Tuck, V. Kim, K. Ostridge, K.J. Staples, N. Williams, A. Williams, S. Wootton, J.M. Devaster, and A.S. Group. 2017. A prospective, observational cohort study of the seasonal dynamics of airway pathogens in the aetiology of exacerbations in COPD. Thorax. 72:919-927.

Winther, B., E. Arruda, T.J. Witek, S.D. Marlin, M.M. Tsianco, D.J. Innes, and F.G. Hayden. 2002. Expression of ICAM-1 in nasal epithelium and levels of soluble ICAM-1 in nasal lavage fluid during human experimental rhinovirus infection. Arch Otolaryngol Head Neck Surg. 128:131-136. Zhou, X., L. Zhu, R. Lizarraga, and Y. Chen. 2017. Human Airway Epithelial Cells Direct Significant Rhinovirus Replication in Monocytic Cells by Enhancing ICAM1 Expression. American journal of respiratory cell and molecular biology. 57:216-225.

Claims

CLAIMS:

1. An Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the improvement of phagocytosis in a subject in need thereof.

2. The Arpin protein or fragment thereof and/or an agent for Arpin protein expression for us according to claim 1 wherein the subject is afflicted with an inflammatory disease.

3. The Arpin protein or fragment thereof and/or an agent for Arpin protein expression for us according to claim 2 wherein the inflammatory diseases is a chronic obstructive pulmonary disease (COPD) or asthma.

4. The Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the treatment of chronic obstructive pulmonary disease (COPD) or asthma.

5. The Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the treatment of chronic obstructive pulmonary disease (COPD) or asthma induced by a respiratory virus.

6. The Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use according to claim 5 wherein the respiratory virus is the human rhinovirus (HRV) or the Human respiratory syncytial virus (HRSV).

7. The Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use according to claims 1 to 6 wherein the Arpin protein comprises a sequence as set forth by SEQ ID NO: 1.

8. The Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use according to claims 1 to 6 wherein the fragment of the Arpin protein can be a peptide of at least 13 consecutive amino acids from said Arpin protein of SEQ ID NO: 1, which comprises at least the acidic motif (A motif) of said Arpin protein.

9. The Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use according to claim 8 wherein the peptide of the invention comprises or consists an amino acids sequences as set forth of SEQ ID NO: 3 to 7.

10. The Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use according to claims 1 to 6 wherein the an agent for Arpin protein expression is a nucleic acid encoding for Arpin protein which comprises a sequence as set forth by SEQ ID NO: 2.

11. A therapeutic composition comprising the Arpin protein or fragment thereof and/or an agent for Arpin protein expression for use in the improvement of phagocytosis in a subject in need thereof.

12. A method for improving phagocytosis in a subject in need thereof comprising a step of administering to said subject a therapeutically effective amount of an Arpin protein or fragment thereof and/or an agent for Arpin protein expression of the invention.