WO1997020078A1 - Methods for generating polynucleotides having desired characteristics by iterative selection and recombination - Google Patents

Methods for generating polynucleotides having desired characteristics by iterative selection and recombination Download PDF

Info

Publication number
WO1997020078A1
WO1997020078A1 PCT/US1996/019256 US9619256W WO9720078A1 WO 1997020078 A1 WO1997020078 A1 WO 1997020078A1 US 9619256 W US9619256 W US 9619256W WO 9720078 A1 WO9720078 A1 WO 9720078A1
Authority
WO
WIPO (PCT)
Prior art keywords
polynucleotide
sequence
recombination
dna
sequences
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1996/019256
Other languages
English (en)
French (fr)
Inventor
Willem P. C. Stemmer
Andreas Crameri
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Affymax Technologies NV
Maxygen Inc
Original Assignee
Affymax Technologies NV
Maxygen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27073702&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1997020078(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from US08/564,955 external-priority patent/US5811238A/en
Priority to IL12467596A priority Critical patent/IL124675A0/xx
Priority to CA002239099A priority patent/CA2239099C/en
Application filed by Affymax Technologies NV, Maxygen Inc filed Critical Affymax Technologies NV
Priority to DE0876509T priority patent/DE876509T1/de
Priority to DK96940934.1T priority patent/DK0876509T4/da
Priority to DE69615406T priority patent/DE69615406T3/de
Priority to JP52074497A priority patent/JP4015193B2/ja
Priority to AU10873/97A priority patent/AU713952B2/en
Priority to EP96940934A priority patent/EP0876509B2/en
Priority to AT96940934T priority patent/ATE205877T1/de
Priority to US08/769,062 priority patent/US6335160B1/en
Publication of WO1997020078A1 publication Critical patent/WO1997020078A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/02Libraries contained in or displayed by microorganisms, e.g. bacteria or animal cells; Libraries contained in or displayed by vectors, e.g. plasmids; Libraries containing only microorganisms or vectors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43595Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/545IL-1
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • C12N15/1027Mutagenizing nucleic acids by DNA shuffling, e.g. RSR, STEP, RPR
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1037Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1058Directional evolution of libraries, e.g. evolution of libraries is achieved by mutagenesis and screening or selection of mixed population of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/64General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2468Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
    • C12N9/2471Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/78Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/86Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in cyclic amides, e.g. penicillinase (3.5.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6811Selection methods for production or design of target specific oligonucleotides or binding molecules
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01023Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/02Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amides (3.5.2)
    • C12Y305/02006Beta-lactamase (3.5.2.6)
    • HELECTRICITY
    • H10SEMICONDUCTOR DEVICES; ELECTRIC SOLID-STATE DEVICES NOT OTHERWISE PROVIDED FOR
    • H10NELECTRIC SOLID-STATE DEVICES NOT OTHERWISE PROVIDED FOR
    • H10N60/00Superconducting devices
    • H10N60/10Junction-based devices
    • H10N60/128Junction-based devices having three or more electrodes, e.g. transistor-like structures
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)

Definitions

  • the present invention relates to a method for the production of polynucleotides conferring a desired phenotype and/or encoding a protein having an advantageous predetermined property which is selectable or can be screened for.
  • the method is used for generating and selecting or screening for desired nucleic acid fragments encoding mutant proteins.
  • the information content of a protein has been defined as the resistance of the active protein to amino acid sequence variation, calculated from the minimum number of invariable amino acids (bits) required to describe a family of related sequences with the same function (9, 10). Proteins that are sensitive to random mutagenesis have a high information content. In 1974, when this definition was coined, protein diversity existed only as taxonomic diversity.
  • Information density is the Information Content/unit length of a sequence. Active sites of enzymes tend to have a high information density. By contrast, flexible linkers in enzymes have a low information density (8) .
  • Error-prone PCR uses low-fidelity polymerization conditions to introduce a low level of point mutations randomly over a long sequence. Error prone PCR can be used to mutagenize a mixture of fragments of unknown sequence. However, computer simulations have suggested that point mutagenesis alone may often be too gradual to allow the block changes that are required for continued sequence evolution. The published error-prone PCR protocols are generally unsuited for reliable amplification of DNA fragments greater than 0.5 to 1.0 kb, limiting their practical application. Further, repeated cycles of error-prone PCR lead to an accumulation of neutral mutations, which, for example, may make a protein immunogenic.
  • oligonucleotide-directed mutagenesis a short sequence is replaced with a synthetically mutagenized oligonucleotide. This approach does not generate combinations of distant mutations and is thus not significantly combinatorial.
  • the limited library size relative to the vast sequence length means that many rounds of selection are unavoidable for protein optimization.
  • Mutagenesis with synthetic oligonucleotides requires sequencing of individual clones after each selection round followed by grouping into families, arbitrarily choosing a single family, and reducing it to a consensus motif, which is resynthesized and reinserted into a single gene followed by additional selection. This process constitutes a statistical bottleneck, it is labor intensive and not practical for many rounds of mutagenesis.
  • Error-prone PCR and oligonucleotide-directed mutagenesis are thus useful for single cycles of sequence fine tuning but rapidly become limiting when applied for multiple cycles.
  • Error-prone PCR can be used to mutagenize a mixture of fragments of unknown sequence (11, 12) .
  • the published error-prone PCR protocols (11, 12) suffer from a low processivity of the polymerase. Therefore, the protocol is very difficult to employ for the random mutagenesis of an average-sized gene. This inability limits the practical application of error-prone PCR.
  • mutagenesis with synthetic oligonucleotides requires sequencing of individual clones after each selection round (20) . Therefore, this approach is tedious and is not practical for many rounds of mutagenesis.
  • Error-prone PCR and cassette mutagenesis are thus best suited and have been widely used for fine-tuning areas of comparatively low information content.
  • An example is the selection of an RNA ligase ribozyme from a random library using many rounds of amplification by error-prone PCR and selection (13). It is becoming increasingly clear our scientific tools for the design of recombinant linear biological sequences such as protein, RNA and DNA are not suitable for generating the necessary sequence diversity needed to optimize many desired properties of a macromolecule or organism. Finding better and better mutants depends on searching more and more sequences within larger and larger libraries, and increasing numbers of cycles of mutagenic amplification and selection are necessary. However as discussed above, the existing mutagenesis methods that are in widespread use have distinct limitations when used for repeated cycles.
  • Marton et al. (27) describes the use of PCR in vitro to monitor recombination in a plasmid having directly repeated sequences. Marton et al. discloses that recombination will occur during PCR as a result of breaking or nicking of the DNA. This will give rise to recombinant molecules. Meyerhans et al. (23) also disclose the existence of DNA recombination during in vitro PCR.
  • AME Applied Molecular Evolution
  • Caren et al. (45) describe a method for generating a large population of multiple mutants using random in vivo recombination. However, their method requires the recombination of two different libraries of plasmids, each library having a different selectable marker. Thus the method is limited to a finite number of recombinations equal to the number of selectable markers existing, and produces a concomitant linear increase in the number of marker genes linked to the selected sequence(s). Caren et al. does not describe the use of multiple selection cycles; recombination is used solely to construct larger libraries.
  • Calogero et al. (46) and Galizzi et al. (47) report that in vivo recombination between two homologous but truncated insect-toxin genes on a plasmid can produce a hybrid gene.
  • Radman et al. (49) report in vivo recombination of substantially mismatched DNA sequences in a host cell having defective mismatch repair enzymes, resulting in hybrid molecule formation. It would be advantageous to develop a method for the production of mutant proteins which method allowed for the development of large libraries of mutant nucleic acid sequences which were easily searched.
  • the invention described herein is directed to the use of repeated cycles of point mutagenesis, nucleic acid shuffling and selection which allow for the directed molecular evolution in vitro of highly complex linear sequences, such as proteins through random recombination.
  • the present invention is directed to a method for generating a selected polynucleotide sequence or population of selected polynucleotide sequences, typically in the form of amplified and/or cloned polynucleotides, whereby the selected polynucleotide sequence(s) possess a desired phenotypic characteristic (e.g., encode a polypeptide, promote transcription of linked polynucleotides, bind a protein, and the like) which can be selected for.
  • a desired phenotypic characteristic e.g., encode a polypeptide, promote transcription of linked polynucleotides, bind a protein, and the like
  • One method of identifying polypeptides that possess a desired structure or functional property involves the screening of a large library of polypeptides for individual library members which possess the desired structure or functional property conferred by the amino acid sequence of the polypeptide.
  • the invention provides a method, termed "sequence shuffling", for generating libraries of recombinant polynucleotides having a desired characteristic which can be selected or screened for.
  • Libraries of recombinant polynucleotides are generated from a population of related- sequence polynucleotides which comprise sequence regions which have substantial sequence identity and can be homologously recombined jLn vitro or in vivo.
  • At least two species of the related-sequence polynucleotides are combined in a recombination system suitable for generating sequence- recombined polynucleotides, wherein said sequence-recombined polynucleotides comprise a portion of at least one first species of a related-sequence polynucleotide with at least one adjacent portion of at least one second species of a related-sequence polynucleotide.
  • Recombination systems suitable for generating sequence-recombined polynucleotides can be either: (1) in vitro systems for homologous recombination or sequence shuffling via amplification or other formats described herein, or (2) n vivo systems for homologous recombination or site-specific recombination as described herein.
  • the population of sequence- recombined polynucleotides comprises a subpopulation of polynucleotides which possess desired or advantageous characteristics and which can be selected by a suitable selection or screening method.
  • the selected sequence-recombined polynucleotides which are typically related-sequence polynucleotides, can then be subjected to at least one recursive cycle wherein at least one selected sequence-recombined polynucleotide is combined with at least one distinct species of related-sequence polynucleotide (which may itself be a selected sequence-recombined polynucleotide) in a recombination system suitable for generating sequence-recombined polynucleotides, such that additional generations of sequence-recombined polynucleotide sequences are generated from the selected sequence-recombined polynucleotides obtained by the selection or screening method employed.
  • recursive sequence recombination generates library members which are sequence-recombined polynucleotides possessing desired characteristics.
  • characteristics can be any property or attribute capable of being selected for or detected in a screening system, and may include properties of: an encoded protein, a transcriptional element, a sequence controlling transcription, RNA processing, RNA stability, chromatin conformation, translation, or other expression property of a gene or transgene, a replicative element, a protein-binding element, or the like, such as any feature which confers a selectable or detectable property.
  • the present invention provides a method for generating libraries of displayed polypeptides or displayed antibodies suitable for affinity interaction screening or phenotypic screening.
  • the method comprises (1) obtaining a first plurality of selected library members comprising a displayed polypeptide or displayed antibody and an associated polynucleotide encoding said displayed polypeptide or displayed antibody, and obtaining said associated polynucleotides or copies thereof wherein said associated polynucleotides comprise a region of substantially identical sequence, optionally introducing mutations into said polynucleotides or copies, and (2) pooling and fragmenting, by nuclease digestion, partial extension PCR amplification, PCR stuttering, or other suitable fragmenting means, typically producing random fragments or fragment equivalents, said associated polynucleotides or copies to form fragments thereof under conditions suitable for PCR amplification, performing PCR amplification and optionally mutagenesis, and thereby homologously recombining said fragments to form a shuffled pool of recombined polynucleotides, whereby a substantial fraction (e.g., greater than 10 percent) of the recombined polynucleo
  • the method comprises the additional step of screening the library members of the shuffled pool to identify individual shuffled library members having the ability to bind or otherwise interact (e.g., such as catalytic antibodies) with a predetermined macromolecule, such as for example a proteinaceous receptor, peptide, oligosaccharide, virion, or other predetermined compound or structure.
  • a predetermined macromolecule such as for example a proteinaceous receptor, peptide, oligosaccharide, virion, or other predetermined compound or structure.
  • the displayed polypeptides, antibodies, peptidomimetic antibodies, and variable region sequences that are identified from such libraries can be used for therapeutic, diagnostic, research, and related purposes (e.g., catalysts, solutes for increasing osmolarity of an aqueous solution, and the like) , and/or can be subjected to one or more additional cycles of shuffling and/or affinity selection.
  • the method can be modified such that the step of selecting is for a phenotypic characteristic other than binding affinity for a predetermined molecule (e.g., for catalytic activity, stability, oxidation resistance, drug resistance, or detectable phenotype conferred on a host cell) .
  • the first plurality of selected library members is fragmented and homologously recombined by PCR in vitro. Fragment generation is by nuclease digestion, partial extension PCR amplification, PCR stuttering, or other suitable fragmenting means, such as described herein. Stuttering is fragmentation by incomplete polymerase extension of templates. A recombination format based on very short PCR extension times was employed to create partial PCR products, which continue to extend off a different template in the next (and subsequent) cycle(s) .
  • the first plurality of selected library members is fragmented in vitro. the resultant fragments transferred into a host cell or organism and homologously recombined to form shuffled library members in vivo.
  • the first plurality of selected library members is cloned or amplified on episomally replicable vectors, a multiplicity of said vectors is transferred into a cell and homologously recombined to form shuffled library members in vivo.
  • the first plurality of selected library members is not fragmented, but is cloned or amplified on an episomally replicable vector as a direct repeat or indirect (or inverted) repeat, which each repeat comprising a distinct species of selected library member sequence, said vector is transferred into a cell and homologously recombined by intra- vector or inter-vector recombination to form shuffled library members in vivo.
  • combinations of in vitro and in vivo shuffling are provided to enhance combinatorial diversity.
  • the present invention provides a method for generating libraries of displayed antibodies suitable for affinity interaction screening.
  • the method comprises (l) obtaining a first plurality of selected library members comprising a displayed antibody and an associated polynucleotide encoding said displayed antibody, and obtaining said associated polynucleotides or copies thereof, wherein said associated polynucleotides comprise a region of substantially identical variable region framework sequence, and (2) pooling and fragmenting said associated polynucleotides or copies to form fragments thereof under conditions suitable for PCR amplification and thereby homologously recombining said fragments to form a shuffled pool of recombined polynucleotides comprising novel combinations of CDRs, whereby a substantial fraction (e.g., greater than 10 percent) of the recombined polynucleotides of said shuffled pool comprise CDR combinations which are not present in the first plurality of selected library members, said shuffled pool composing a library of displayed antibodies comprising CDR permutations and
  • the shuffled pool is subjected to affinity screening to select shuffled library members which bind to a predetermined epitope (antigen) and thereby selecting a plurality of selected shuffled library members.
  • the plurality of selected shuffled library members can be shuffled and screened iteratively, from 1 to about 1000 cycles or as desired until library members having a desired binding affinity are obtained.
  • one aspect of the present invention provides a method for introducing one or more mutations into a template double-stranded polynucleotide, wherein the template double-stranded polynucleotide has been cleaved or PCR amplified (via partial extension or stuttering) into random fragments of a desired size, by adding to the resultant population of double- stranded fragments one or more single or double-stranded oligonucleotides, wherein said oligonucleotides comprise an area of identity and an area of heterology to the template polynucleotide; denaturing the resultant mixture of double- stranded random fragments and oligonucleotides into single- stranded fragments; incubating the resultant population of single-stranded fragments with a polymerase under conditions which result in the annealing of said single-stranded fragments at regions of identity between the single-stranded fragments and formation of a mutagenized double-
  • the present invention is directed to a method of producing recombinant proteins having biological activity by treating a sample comprising double-stranded template polynucleotides encoding a wild-type protein under conditions which provide for the cleavage of said template polynucleotides into random double-stranded fragments having a desired size; adding to the resultant population of random fragments one or more single or double-stranded oligonucleotides, wherein said oligonucleotides comprise areas of identity and areas of heterology to the template polynucleotide; denaturing the resultant mixture of double-stranded fragments and oligonucleotides into single-stranded fragments; incubating the resultant population of single-stranded fragments with a polymerase under conditions which result in the annealing of said single-stranded fragments at the areas of identity and formation of a mutagenized double-stranded polynucleotide; repeating the above steps as desired; and
  • a third aspect of the present invention is directed to a method for obtaining a chimeric polynucleotide by treating a sample comprising different double-stranded template polynucleotides wherein said different template polynucleotides contain areas of identity and areas of heterology under conditions which provide for the cleavage of said template polynucleotides into random double-stranded fragments of a desired size; denaturing the resultant random double-stranded fragments contained in the treated sample into single-stranded fragments; incubating the resultant single-stranded fragments with polymerase under conditions which provide for the annealing of the single-stranded fragments at the areas of identity and the formation of a chimeric double-stranded polynucleotide sequence comprising template polynucleotide sequences; and repeating the above steps as desired.
  • a fourth aspect of the present invention is directed to a method of replicating a template polynucleotide by combining in vitro single-stranded template polynucleotides with small random single-stranded fragments resulting from the cleavage and denaturation of the template polynucleotide, and incubating said mixture of nucleic acid fragments in the presence of a nucleic acid polymerase under conditions wherein a population of double- stranded template polynucleotides is formed.
  • the invention also provides the use of polynucleotide shuffling, in vitro and/or in vivo to shuffle polynucleotides encoding polypeptides and/or polynucleotides comprising transcriptional regulatory sequences.
  • the invention also provides the use of polynucleotide shuffling to shuffle a population of viral genes (e.g. , capsid proteins, spike glycoproteins, polymerases, proteases, etc.) or viral genomes (e.g., paramyxoviridae, orthomyxoviridae, herpesviruses, retroviruses, reoviruses, rhinoviruses, etc.) .
  • viral genes e.g. , capsid proteins, spike glycoproteins, polymerases, proteases, etc.
  • viral genomes e.g., paramyxoviridae, orthomyxoviridae, herpesviruses, retroviruses, reoviruses, rhinoviruses, etc.
  • the invention provides a method for shuffling sequences encoding all or portions of immunogenic viral proteins to generate novel combinations of epitopes as well as novel epitopes created by recombination; such shuffled viral proteins may comprise epitopes or combinations of epitopes which are likely to arise in the natural environment as a consequence of viral evolution (e.g., such as recombination of influenza virus strains) .
  • the invention also provides the use of polynucleotide shuffling to shuffle a population of protein variants, such as taxonomically-related, structurally-related, and/or functionally- related enzymes and/or mutated variants thereof to create and identify advantageous novel polypeptides, such as enzymes having altered properties of catalysis, temperature profile, stability, oxidation resistance, or other desired feature which can be selected for.
  • Methods suitable for molecular evolution and directed molecular evolution are provided.
  • Methods to focus selection pressure(s) upon specific portions of polynucleotides are provided.
  • the invention also provides a method suitable for shuffling polynucleotide sequences for generating gene therapy vectors and replication-defective gene therapy constructs, such as may be used for human gene therapy, including but not limited to vaccination vectors for DNA-based vaccination, as well as anti-neoplastic gene therapy and other gene therapy formats.
  • the invention provides a method for generating an enhanced green fluorescent protein (GFP) and polynucleotides encoding same, comprising performing DNA shuffling on a GFP encoding expression vector and selecting or screening for variants having an enhanced desired property, such as enhanced fluorescence.
  • GFP green fluorescent protein
  • an embodiment comprises a step of error-prone or mutagenic amplification, propagation in a mutator strain (e.g., a host cell having a hypermutational phenotype; mut , etc.; yeast strains such as those described in Klein (1995) Progr. Nucl. Acid Res. Mol. Biol. 51: 217, incorporated herein by reference) , chemical mutagenesis, or site-directed mutagenesis.
  • a mutator strain e.g., a host cell having a hypermutational phenotype; mut , etc.; yeast strains such as those described in Klein (1995) Progr. Nucl. Acid Res. Mol. Biol. 51: 217, incorporated herein by reference
  • the enhanced GFP protein comprises a point mutation outside the chromophore region (amino acid ⁇ 64-69) , preferably in the region from amino acid 100 to amino acid 173, with specific preferred embodiments at residue 100, 154, and 164; typically, the mutation is a substitution mutation, such a ⁇ F100S, M154T or V164A. In an embodiment, the mutation substitutes a hydrophilic residue for a hydrophobic residue. In an embodiment, multiple mutations are present in the enhanced GFP protein and its encoding polynucleotide. The invention also provides the use of such an enhanced GFP protein, such as for a diagnostic reporter for assays and high throughput screening assays and the like.
  • the improved shuffling method includes the addition of at lea ⁇ t one additive which enhances the rate or extent of reannealing or recombination of related-sequence polynucleotides.
  • the additive is polyethylene glycol (PEG) , typically added to a shuffling reaction to a final concentration of 0.1 to 25 percent, often to a final concentration of 2.5 to 15 percent, to a final concentration of about 10 percent.
  • the additive is dextran sulfate, typically added to a shuffling reaction to a final concentration of 0.1 to 25 percent, often at about 10 percent.
  • the additive is an agent which reduces sequence specificity of reannealing and promotes promiscuous hybridization and/or recombination in vitro.
  • the additive is an agent which increases sequence specificity of reannealing and promotes high fidelity hybridization and/or recombination n vitro.
  • Other long-chain polymers which do not interfere with the reaction may also be used (e.g., polyvinylpyrrolidone, etc.).
  • the improved shuffling method includes the addition of at least one additive which is a cationic detergent.
  • Suitable cationic detergents include but are not limited to: cetyltrimethylammonium bromide (CTAB) , dodecyltrimethylammonium bromide (DTAB) , and tetramethylammonium chloride (TMAC) , and the like.
  • CTAB cetyltrimethylammonium bromide
  • DTAB dodecyltrimethylammonium bromide
  • TMAC tetramethylammonium chloride
  • the improved shuffling method includes the addition of at least one additive which is a recombinogenic protein that catalyzes or non-catalytically enhances homologous pairing and/or strand exchange in vitro.
  • a recombinogenic protein that catalyzes or non-catalytically enhances homologous pairing and/or strand exchange in vitro.
  • suitable recombinogenic proteins include but are not limited to: E. coli recA protein, the T4 uvsX protein, the reel protein from Ustilago maydis, other recA family recombinases from other species, single strand binding protein (SSB) , ribonucleoprotein Al, and the like.
  • Shuffling can be used to improve one or more properties of a recombinogenic protein; for example, mutant sequences encoding recA can be shuffled and improved heat-stable variants selected by recursive sequence recombination.
  • Non-specific (general recombination) recombinases such as Topoisomerase I, Topoisomerase II (Tse et al. (1980) J. Biol. Chem. 255: 5560; Trask et al. (1984) EMBO J. 3 : 671, incorporated herein by reference) and the like can be used to catalyze in vitro recombination reactions to shuffle a plurality of related sequence polynucelotide species by the recursive methods of the invention.
  • the improved shuffling method includes the addition of at least one additive which is an enzyme having an exonuclease activity which is active at removing non-templated nucleotides introduced at 3 ' ends of product polynucleotides in shuffling amplification reactions catalyzed by a non-proofreading polymerase.
  • an enzyme having an exonuclease activity includes but is not limited to Pfu polymerase.
  • Other suitable poly erases include, but are not limited to: Ther us flavus DNA polymerase (Tfl)
  • thermophilus DNA polymerase (Tth) Thermus thermophilus DNA polymerase (Tth)
  • Thermococcus litoralis DNA polymerase (Tli, Vent)
  • Thermus brockianus DNA polymerase (Thermozyme)
  • the improved shuffling method comprises the modification wherein at least one cycle of amplification
  • telomere extension with a polymerase i.e., extension with a polymerase
  • a substantial fraction typically at least 20 percent or more, of incompletely extended amplification products.
  • the amplification products, including the incompletely extended amplification products are denatured and subjected to at least one additional cycle of reannealing and amplification.
  • This variation wherein at least one cycle of reannealing and amplification provides a substantial fraction of incompletely extended products, is termed "stuttering" and in the subsequent amplification round the incompletely extended products reanneal to and prime extension on different sequence-related template species.
  • the improved shuffling method comprises the modification wherein at least one cycle of amplification is conducted using a collection of overlapping single-stranded DNA fragments of varying lengths corresponding to a first polynucleotide species or set of related-sequence polynucleotide species, wherein each overlapping fragment can each hybridize to and prime polynucleotide chain extension from a second polynucleotide species serving as a template, thus forming sequence-recombined polynucleotides, wherein said sequence- recombined polynucleotides comprise a portion of at least one first polynucleotide species with an adjacent portion of the second polynucleotide species which serves as a template.
  • the second polynucleotide species serving as a template contains uracil (i.e., a Kunkel-type template) and is substantially non-replicable in cells.
  • uracil i.e., a Kunkel-type template
  • This aspect of the invention can also comprise at least two recursive cycles of this variation.
  • PCR can be conducted wherein the nucleotide mix comprises a nucleotide species having uracil as the base.
  • the PCR product(s) can then be fragmented by digestion with UDG-glycosylase which produces strand breaks.
  • the fragment size can be controlled by the fraction of uracil-containing NTP in the PCR mix.
  • the improved shuffling method comprises the modification wherein at least one cycle of amplification is conducted with an additive or polymerase in suitable conditions which promote template switching.
  • an additive or polymerase in suitable conditions which promote template switching.
  • addition of recA or other polymerases e.g., viral polymerases, reverse transcriptase
  • Template-switching can also be increased by increasing the DNA template concentration, among other means known by those skilled in the art.
  • libraries of sequence-recombined polynucleotides are generated from sequence- related polynucleotides which are naturally-occurring genes or alleles of a gene.
  • at least two naturally- occurring genes and/or alleles which comprise regions of at least 50 consecutive nucleotides which have at least 70 percent sequence identity, preferably at least 90 percent sequence identity are selected from a pool of gene sequences, such as by hybrid selection or via computerized sequence analysis using sequence data from a database.
  • At least three naturally-occurring genes and/or alleles which comprise regions of at least 50 consecutive nucleotides which have at least 70 percent sequence identity, prefereably at least 90 percent sequence identity are selected from a pool of gene sequences, such as by hybrid selection or via computerized sequence analysis using sequence data from a database.
  • the selected sequences are obtained as polynucleotides, either by cloning or via DNA synthesis, and shuffled by any of the various embodiments of the invention.
  • multi-pool shuffling is performed. Shuffling of multiple pools of polynucleotide sequences allows each separate pool to generate a different combinatorial solution to produce the desired property.
  • the pool of parental polynucleotides sequences (or any subsequent shuffled library or selected pool of library members) is subdivided (or segregated) into two or more discrete pools of sequences and are separately subjected to one or more rounds of recursive sequence recombination and selection (or screening) .
  • selected library members from each separate pool may be recombined (integrated) in latter rounds of shuffling.
  • multiple separate parental pools may be used.
  • Inbreeding wherein selected (or screened) library members within a pool are crossed with each other by the recursive sequence recombination methods of the invention, can be performed, alone or in combination with outbreeding, wherein library members of different pools are crossed with each other by the recursive sequence recombination methods of the invention.
  • the method comprises the further step of removing non-shuffled products (e.g., parental sequences) from sequence-recombined polynucleotides produced by any of the disclosed shuffling methods.
  • Non-shuffled products can be removed or avoided by performing amplification with: (1) a first PCR primer which hybridizes to a first parental polynucleotide species but does not substantially hybridize to a second parental polynucleotide species, and (2) a second PCR primer which hybridizes to a second parental polynucleotide species but does not substantially hybridize to the first parental polynucleotide species, such that amplification occurs from templates comprising the portion of the first parental sequence which hybridizes to the first PCR primer and also comprising the portion of the second parental sequence which hybridizes to the second PCR primer, thus only sequence- recombined polynucleotides are amplified.
  • the invention also provides for alternative embodiments for performing in vivo sequence shuffling.
  • the alternative shuffling method includes the use of inter-plasmidic recombination, wherein libraries of sequence-recombined polynucleotide sequences are obtained by genetic recombination in vivo of compatible or non-compatible multicopy plasmids inside suitable host cells.
  • non-compatible plasmids typically each plasmid type has a distinct selectable marker and selction for retention of each desired plasmid type is applied.
  • the related-sequence polynucleotide sequences to be recombined are separately incorporated into separately replicable multicopy vectors, typically bacterial plasmids each having a distinct and separately selectable marker gene (e.g. , a drug resistance gene) .
  • bacterial plasmids each having a distinct and separately selectable marker gene (e.g. , a drug resistance gene) .
  • Suitable host cells are transformed with both species of plasmid and cells expressing both selectable marker genes are selected and sequence-recombined sequences are recovered and can be subjected to additional rounds of shuffling by any of the means described herein.
  • the alternative shuffling method includes the use of intra-plasmidic recombination, wherein libraries of sequence-recombined polynucleotide sequences are obtained by genetic recombination in vivo of direct or inverted sequence repeats located on the same plasmid.
  • the sequences to be recombined are flanked by site-specific recombination sequences and the polynucleotides are present in a site-specific recombination system, such as an integron (Hall and Collins (1995) Mol. Microbiol. 15: 593, incorporated herein by reference) and can include insertion sequences, transposons (e.g. , ISI) , and the like.
  • Introns have a low rate of natural mobility and can be used as mobile genetic elements both in prokaryotes and eukaryotes. Shuffling can be used to improve the performance of mobile genetic elements. These high frequency recombination vehicles can be used for the rapid optimization of large sequences via transfer of large sequence blocks. Recombination between repeated, interspersed, and diverged DNA sequences, also called "homeologous" sequences, is typically suppressed in normal cells. However, in MutL and MutS cells, this suppression is relieved and the rate of intrachromosomal recombination is increased (Petit et al. (1996) Genetics 129: 327, incorporated herein by reference) .
  • mutator strains of host cells are used to enhance recombination of more highly mismatched sequence-related polynucleotides.
  • Bacterials strains such as
  • MutL, MutS, MutT, or MutH or other cells expressing the Mut proteins can be used as host cells for shuffling of sequence-related polynucleotides by in vivo recombination.
  • Other mutation-prone host cell types can also be used, such as those having a proofreading-defective polymerase (Foster et al. (1995) Proc. Natl. Acad. Sci. fU.S.A.) 92: 7951, incorporated herein by reference) .
  • Mutator strains of yeast can be used, as can hypermutational mammalian cells, including ataxia telangiectasia cells, such as described in Luo et al. (1996) J. Biol. Chem. 271: 4497, incorporated herein by reference.
  • in vivo and in vitro utagenic formats can be employed, including administering chemical or radiological mutagens to host cells.
  • utagens include but are not limited to: MNU, ENU, MNNG, nitrosourea, BuDR, and the like.
  • Ultraviolet light can also be used to generate mutations and/or to enhance the rate of recombination, such as by irradiation of cells used to enhance in vivo recombination.
  • Ionizing radiation and clastogenic agents can also be used to enhance mutational frequency and/or to enhance recombination and/or to effect polynucleotide fragmentation.
  • Figure 1 is a schematic diagram comparing mutagenic shuffling over error-prone PCR; (a) the initial library; (b) pool of selected sequences in first round of affinity selection; (d) in vitro recombination of the selected sequences ('shuffling'); (f) pool of selected sequences in second round of affinity selection after shuffling; (c) error-prone PCR; (e) pool of selected sequences in second round of affinity selection after error-prone PCR.
  • Figure 2 illustrates the reassembly of a 1.0 kb LacZ alpha gene fragment from 10-50 bp random fragments.
  • FIG. 3 is a schematic illustration of the LacZ alpha gene stop codon mutants and their DNA sequences. The boxed regions are heterologous areas, serving as markers. The stop codons are located in smaller boxes or underlined.
  • Figure 4 is a schematic illustration of the introduction or spiking of a synthetic oligonucleotide into the reassembly process of the LacZ alpha gene.
  • Figure 5 illustrates the regions of homology between a murine IL1-B gene (M) and a human IL1-B gene (H) with E. coli codon usage. Regions of heterology are boxed. The "_
  • Figure 6 is a schematic diagram of the antibody CDR shuffling model system using the scFv of anti-rabbit IgG antibody (A10B) .
  • FIG. 7 panels A-D illustrates the observed frequency of occurrence of certain combinations of CDRs in the shuffled DNA of the scFv.
  • Panel (A) shows the length and mutagenesis rate of all six synthetic CDRs.
  • Panel (B) shows library construction by shuffling scFv with all six CDRs.
  • Panel (C) shows CDR insertion determined by PCR with primers for native CDRs.
  • Panel (D) shows insertion rates and distributions of synthetic CDR insertions.
  • Figure 8 illustrates the improved avidity of the scFv anti-rabbit antibody after DNA shuffling and each cycle of selection.
  • Figure 9 schematically portrays pBR322-Sfi-BL-LA-Sfi and in vivo intraplasmidic recombination via direct repeats, as well as the rate of generation of ampicillin-resistant colonies by intraplasmidic recombination reconstituting a functional beta- lactamase gene.
  • Figure 10 schematically portrays pBR322-Sfi-2Bla-Sfi and in vivo intraplasmidic recombination via direct repeats, as well as the rate of generation of ampicillin-resistant colonies by intraplasmidic recombination reconstituting a functional beta- lactamase gene.
  • Figure 11 illustrates the method for testing the efficiency of multiple rounds of homologous recombination after the introduction of polynucleotide fragments into cells for the generation of recombinant proteins.
  • Figure 12 schematically portrays generation of a library of vectors by shuffling cassettes at the following loci: promoter, leader peptide, terminator, selectable drug resistance gene, and origin of replication.
  • the multiple parallel lines at each locus represent the multiplicity of cassettes for that cassette.
  • Figure 13 schematically shows some examples of cassettes suitable at various loci for constructing prokaryotic vector libraries by shuffling.
  • Figure 14 shows the prokaryotic GFP expression vector
  • PBAD-GFP (5,371 bp) was derived from pBADl ⁇ (Guzman et al. (1995)
  • Alpha+GFP (7,591 bp) was derived from the vector Alpha- (Whitehorn et al. (1995) Bio/Technology 12: 1215).
  • Figure 15A and 15B show comparison of the fluorescence of different GFP constructs in whole E. coli cells. Compared are the 'Clontech' construct which contains a 24 amino acid N- terminal extension, the Affymax wildtype construct ('wt', with improved codon usage) , and the mutants obtained after 2 and after 3 cycles of sexual PCR and selection ('cycle 2', 'cycle 3'). The 'Clontech' construct was induced with IPTG, whereas the other constructs were induced with arabinose. All samples were assayed at equal 0D 6oo .
  • Figure 15A shows fluorescence spectra indicating that the whole cell fluorescence signal from the 'wt' construct is 2.8-fold greater than from the 'Clontech' construct.
  • the signal of the 'cycle 3' mutant is 16-fold increased over the Affymax 'wt', and 45-fold over the 'Clontech' wt construct.
  • Figure 15B is a comparison of excitation spectra of GFP constructs in E . coli . The peak excitation wavelengths are unaltered by the mutations that were selected.
  • Figure 16 shows SDS-PAGE analysis of relative GFP protein expression levels.
  • Panel (a) 12% Tris-Glycine SDS-PAGE analysis (Novex, Encinitas, CA) of equal amounts (OD600) Of whole E. coli cells expressing the wildtype, the cycle 2 mutant or the cycle 3 mutant of GFP. Stained with Coomassie Blue. GFP (27 kD) represents about 75% of total protein, and the selection did not increase the expression level.
  • Panel (b) 12% Tris-Glycine SDS- PAGE analysis Novex, Encinitas, CA) of equal amounts (OD600) of E . coli fractions.
  • Lane 1 Pellet of lysed ceils expres ⁇ ing wt GFP; lane 2: Supernatant of lysed ceils expressing wt GFP. Most of the wt GFP is in inclu ⁇ ion bodies; lane 3: Pellet of lysed cells expressing cycle 3 mutant GFP; lane 4: Supernatant of lysed cells expressing cycle 3 mutant GFP. Most of the wt GFPis soluble. The GFP that ends up in inclusion bodies does not contain the chromophore, since there is no detectable fluorescence in this fraction.
  • Figure 17 shows mutation analysis of the cycle 2 and cycle 3 mutants versus wildtype GFP.
  • Panel (A) shows that the mutations are spread out rather than clustered near the tripeptide chromophore. Mutations F100S, M154T, and V164A involve the replacement of hydrophobic residues with more hydrophilic residues. The increased hydrophilicity may help guide the protein into a native folding pathway rather than toward aggregation and inclusion body formation.
  • Panel (B) shows a restriction map indicating the chromophore region and positions of introduced mutations.
  • Figure 18A and 18B show comparison of CHO cells expressing different GFP proteins.
  • Figure 18A is a FACS analysis of clones of CHO cells expressing different GFP mutants.
  • 18B B shows fluorescence spectroscopy of clones of CHO cells expressing different GFP mutants.
  • Figure 19 shows enhancement of resistance to arsenate toxicity as a result of shuffling the pGJ103 plasmid containing the arsenate detoxification pathway operon.
  • Figure 20 schematically shows the generation of combinatorial libraires using synthetic or naturally-occurring intron sequences as the basis for recombining a plurality of exons species which can lack sequence identity (as exemplified by random sequence exons) , wherein homologous and/or site- specific recombination occurs between intron sequences of distinct library members.
  • Figure 21 schematically shows variations of the method for shuffling exons.
  • the numbers refer to reading frames, as demonstrated in panel (A) .
  • Panel (B) shows the various classes of intron and exon relative to their individual splice frames.
  • Panel (C) provides an example of a naturally-occurring gene
  • Panels D through F shows how multiple exons can be concatemerized via PCR using primers which span intron segments, so that proper splicing frames are retained, if desired.
  • Panel (G) exemplifies the exon shuffling process (IG: immunoglobulin exon; IFN: interferon exon)
  • Figure 22 schematically shows an exon splicing frame diagram for several human genes, showing that preferred units for shuffling exons begin and end in the same splicing frame, such that a splicing module (or shuffling exon) can comprise multiple naturally-occurring exons but typically has the same splicing frame at each end.
  • Figure 23 schematically shows how partial PCR extension
  • stuttering can be used to provide recursive sequence recombination (shuffling) resulting in a library of chimeras representing multiple crossovers.
  • Figure 24 shows how stuttering can be used to shuffle a wild-type sequence with a multiply mutated sequence to generate an optimal set of mutations via shuffling.
  • Figure 25 schematically shows plasmid-plasmid recombination by electroporation of a cell population representing multiple plasmid species, present initially as a single plasmid species per cell prior to electroporation and multiple plasmid species per cell suitable for in vivo recombination subsequent to electroporation of the cell population.
  • Figure 26 shows plasmid-plasmid recombination.
  • Figure 27 shows plasmid-virus recombination.
  • Figure 28 shows virus-virus recombination.
  • Figure 29 shows plasmid-chromosome recombination.
  • Figure 30 shows conjugation-mediated recombination.
  • Figure 31 shows Ab-phage recovery rate versus selection cycle. Shuffling was applied after selection rounds two to eight. Total increase is 440-fold.
  • Figure 32 shows binding specificity after ten selection rounds, including two rounds of backcrossing.
  • Figure 33 shows Ab-phage recovery versus mutagenesis method.
  • the present invention relates to a method for nucleic acid molecule reassembly after random fragmentation and its application to mutagenesis of DNA sequences. Also de ⁇ cribed is a method for the production of nucleic acid fragments encoding mutant proteins having enhanced biological activity. In particular, the present invention also relates to a method of repeated cycles of mutagenesis, nucleic acid shuffling and selection which allow for the creation of mutant proteins having enhanced biological activity.
  • the present invention is directed to a method for generating a very large library of DNA, RNA or protein mutants; in embodiments where a metabolic enzyme or multicomponent pathway is subjected to shuffling, a library can compose the resultant metabolites in addition to a library of the ⁇ huffled enzyme(s).
  • This method ha ⁇ particular advantages in the generation of related DNA fragments from which the desired nucleic acid fragment(s) may be selected.
  • the present invention also relates to a method of repeated cycles of mutagenesis, homologous recombination and selection which allow for the creation of mutant proteins having enhanced biological activity.
  • the following terms will first be defined.
  • DNA shuffling is used herein to indicate recombination between substantially homologous but non- identical sequences, in some embodiments DNA shuffling may involve crossover via nonhomologous recombination, ⁇ uch as via cre/lox and/or flp/frt systems and the like, such that recombination need not require sub ⁇ tantially homologou ⁇ polynucleotide sequences.
  • Homologous and non-homologous recombination formats can be used, and, in some embodiments, can generate molecular chimeras and/or molecular hybrids of substantially dissimilar sequences.
  • amplification means that the number of copies of a nucleic acid fragment is increased.
  • identical or “identity” means that two nucleic acid sequences have the same sequence or a complementary sequence.
  • areas of identity means that regions or areas of a nucleic acid fragment or polynucleotide are identical or complementary to another polynucleotide or nucleic acid fragment.
  • correlates to is used herein to mean that a polynucleotide sequence is homologous (i.e., is identical, not strictly evolutionarily related) to all or a portion of a reference polynucleotide sequence, or that a polypeptide sequence is identical to a reference polypeptide sequence.
  • complementary to is used herein to mean that the complementary ⁇ equence is homologous to all or a portion of a reference polynucleotide sequence.
  • the nucleotide sequence "TATAC” corre ⁇ pond ⁇ to a reference sequence "TATAC” and is complementary to a reference sequence "GTATA” .
  • reference sequence is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA or gene sequence given in a sequence listing, such as a polynucleotide sequence of Fig. 1 or Fig. 2(b), or may comprise a complete cDNA or gene sequence.
  • a reference sequence i ⁇ at least 20 nucleotides in length, frequently at least 25 nucleotides in length, and often at least 50 nucleotides in length.
  • two polynucleotides may each (1) comprise a sequence (i.e., a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) may further comprise a sequence that is divergent between the two polynucleotides
  • sequence compari ⁇ ons between two (or more) polynucleotide ⁇ are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local region ⁇ of ⁇ equence ⁇ imilarity.
  • a “comparison window”, as used herein, refers to a conceptual segment of at least 20 contiguous nucleotide position ⁇ wherein a polynucleotide ⁇ equence may be compared to a reference sequence of at least 20 contiguous nucleotides and wherein the portion of the polynucleotide ⁇ equence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math.
  • sequence identity means that two polynucleotide sequences are identical (i.e., on a nucleotide-by- nucleotide basis) over the window of comparison.
  • percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of po ⁇ itions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequence ⁇ to yield the number of matched positions, dividing the number of matched positions by the total number of position ⁇ in the window of comparison (i.e. , the window size) , and multiplying the result by 100 to yield the percentage of sequence identity.
  • the identical nucleic acid base e.g., A, T, C, G, U, or I
  • substantially identical denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 80 percent sequence identity, preferably at least 85 percent identity and often 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison window of at least 20 nucleotide position ⁇ , frequently over a window of at least 25-50 nucleotides, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the polynucleotide ⁇ equence which may include deletion ⁇ or additions which total 20 percent or les ⁇ of the reference ⁇ equence over the window of comparison.
  • Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains.
  • a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains i ⁇ serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chain ⁇ is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine.
  • Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine- arginine, alanine-valine, and asparagine-glutamine.
  • homologous or “homeologou ⁇ ” means that one ⁇ ingle-stranded nucleic acid ⁇ equence may hybridize to a complementary single-stranded nucleic acid sequence.
  • the degree of hybridization may depend on a number of factor ⁇ including the amount of identity between the sequences and the hybridization conditions such as temperature and salt concentration as discu ⁇ sed later.
  • the region of identity is greater than about 5 bp, more preferably the region of identity is greater than 10 bp.
  • heterologous means that one single-stranded nucleic acid sequence is unable to hybridize to another single- stranded nucleic acid sequence or its complement.
  • areas of heterology means that nucleic acid fragments or polynucleotides have areas or regions in the sequence which are unable to hybridize to another nucleic acid or polynucleotide. Such regions or areas are, for example, areas of mutations.
  • the term "cognate” as used herein refers to a gene sequence that is evolutionarily and functionally related between species.
  • the human CD4 gene is the cognate gene to the mouse CD4 gene, since the sequences and structures of these two genes indicate that they are highly homologous and both genes encode a protein which functions in signaling T cell activation through MHC class II-restricted antigen recognition.
  • wild-type means that the nucleic acid fragment does not comprise any mutations.
  • a wild-type protein means that the protein will be active at a level of activity found in nature and typically will comprise the amino acid sequence found in nature.
  • wild type or parental sequence can indicate a starting or reference sequence prior to a manipulation of the invention.
  • related polynucleotides means that regions or areas of the polynucleotide ⁇ are identical and region ⁇ or area ⁇ of the polynucleotides are heterologous.
  • chimeric polynucleotide means that the polynucleotide compri ⁇ es region ⁇ which are wild-type and regions which are mutated. It may also mean that the polynucleotide comprise ⁇ wild-type region ⁇ from one polynucleotide and wild-type region ⁇ from another related polynucleotide.
  • the term “cleaving” mean ⁇ dige ⁇ ting the polynucleotide with enzymes or breaking the polynucleotide, or generating partial length copies of a parent ⁇ equence( ⁇ ) via partial PCR exten ⁇ ion, PCR stuttering, differential fragment amplification, or other means of producing partial length copies of one or more parental sequences.
  • the term “population” as used herein means a collection of components such as polynucleotides, nucleic acid fragments or proteins.
  • a “mixed population” means a collection of components which belong to the same family of nucleic acids or proteins (i.e. are related) but which differ in their sequence (i.e. are not identical) and hence in their biological activity.
  • nucleic acid fragment means a nucleic acid fragment having certain end points and having a certain nucleic acid sequence. Two nucleic acid fragments wherein one nucleic acid fragment has the identical sequence as a portion of the second nucleic acid fragment but different ends comprise two different specific nucleic acid fragments.
  • mutations means changes in the ⁇ equence of a wild-type nucleic acid ⁇ equence or changes in the sequence of a peptide. Such mutations may be point mutations ⁇ uch as transitions or transversions. The mutations may be deletions, insertions or duplications.
  • the lefthand direction is the amino terminal direction and the righthand direction is the carboxy-terminal direction, in accordance with standard usage and convention.
  • the lefthand end of single- ⁇ tranded polynucleotide ⁇ equence ⁇ i ⁇ the 5' end; the lefthand direction of double- ⁇ tranded polynucleotide sequences is referred to a ⁇ the 5 ' direction.
  • RNA transcripts The direction of 5* to 3' addition of na ⁇ cent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA and which are 5' to the 5' end of the RNA transcript are referred to a ⁇ "upstream sequences"; sequence regions on the DNA strand having the same ⁇ equence as the RNA and which are 3 ' to the 3 ' end of the coding RNA transcript are referred to as "downstream sequences".
  • upstream sequences sequence regions on the DNA strand having the same ⁇ equence as the RNA and which are 3 ' to the 3 ' end of the coding RNA transcript are referred to as "downstream sequences".
  • upstream sequences sequence regions on the DNA strand having the same ⁇ equence as the RNA and which are 3 ' to the 3 ' end of the coding RNA transcript are referred to as "downstream sequences”.
  • upstream sequences sequence regions on the DNA strand having the same ⁇ e
  • a polypeptide or polynucleotide sequence that is present in an organism that can be i ⁇ olated from a ⁇ ource in nature and which ha ⁇ not been intentionally modified by man in the laboratory i ⁇ naturally- occurring.
  • the term naturally-occurring refer ⁇ to an object as present in a non-pathological (undiseased) individual, such a ⁇ would be typical for the species.
  • agent is used herein to denote a chemical compound, a mixture of chemical compounds, an array of spatially localized compounds (e.g., a VLSIPS peptide array, polynucleotide array, and/or combinatorial small molecule array) , a biological macromolecule, a bacteriophage peptide display library, a bacteriophage antibody (e.g., scFv) di ⁇ play library, a poly ⁇ ome peptide display library, or an extract made from biological materials such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues.
  • Agents are evaluated for potential activity as antineopla ⁇ tics, anti-inflammatories, or apoptosis modulators by inclusion in screening assays described hereinbelow.
  • Agents are evaluated for potential activity as specific protein interaction inhibitors (i.e., an agent which selectively inhibits a binding interaction between two predetermined polypeptides but which does not sub ⁇ tantially interfere with cell viability) by inclusion in screening as ⁇ ays described hereinbelow.
  • substantially pure means an object specie ⁇ is the predominant species present (i.e., on a molar basis it is more abundant than any other individual macromolecular species in the composition) , and preferably a substantially purified fraction is a composition wherein the object species comprises at least about 50 percent (on a molar ba ⁇ is) of all macromolecular species present. Generally, a substantially pure composition will comprise more than about 80 to 90 percent of all macromolecular species present in the compo ⁇ ition. Mo ⁇ t preferably, the object ⁇ pecies is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species. Solvent species, small molecules ( ⁇ 500 Daltons) , and elemental ion species are not considered macromolecular species.
  • physiological conditions refers to temperature, pH, ionic strength, viscosity, and like biochemical parameters which are compatible with a viable organism, and/or which typically exi ⁇ t intracellularly in a viable cultured yeast cell or mammalian cell.
  • intracellular condition ⁇ in a yea ⁇ t cell grown under typical laboratory culture condition ⁇ are physiological conditions.
  • Suitable in vitro reaction conditions for in vitro transcription cocktails are generally physiological conditions.
  • in vitro phy ⁇ iological conditions comprise 50-200 mM NaCl or KCl, pH 6.5-8.5, 20-45°C and 0.001-10 mM divalent cation (e.g., Mg ++ , Ca ++ ) ; preferably about 150 mM NaCl or KCl, pH 7.2-7.6, 5 mM divalent cation, and often include 0.01-1.0 percent nonspecific protein (e.g., BSA) .
  • a non-ionic detergent can often be present, usually at about 0.001 to 2%, typically 0.05-0.2% (v/v).
  • Particular aqueous conditions may be selected by the practitioner according to conventional methods.
  • buffered aqueous conditions may be applicable: 10-250 mM NaCl, 5-50 mM Tris HCl, pH 5-8, with optional addition of divalent cation(s) and/or metal chelators and/or nonionic detergents and/or membrane fractions and/or antifoam agents and/or scintillants.
  • hybridization is defined herein as the formation of hybrids between a first polynucleotide and a second polynucleotide (e.g., a polynucleotide having a distinct but substantially identical sequence to the first polynucleotide) , wherein the first polynucleotide preferentially hybridizes to the second polynucleotide under stringent hybridization conditions wherein substantially unrelated polynucleotide sequences do not form hybrids in the mixture.
  • a first polynucleotide and a second polynucleotide e.g., a polynucleotide having a distinct but substantially identical sequence to the first polynucleotide
  • single-chain antibody refers to a polypeptide compri ⁇ ing a V H domain and a V L domain in polypeptide linkage, generally linked via a spacer peptide (e.g., [Gly-Gly-Gly-Gly-Ser] ⁇ ) , and which may comprise additional amino acid sequences at the amino- and/or carboxy- termini.
  • a single-chain antibody may comprise a tether segment for linking to the encoding polynucleotide.
  • a scFv is a single-chain antibody.
  • Single-chain antibodies are generally proteins consisting of one or more polypeptide segments of at least 10 contiguous amino acids sub ⁇ tantially encoded by gene ⁇ of the immunoglobulin ⁇ uperfa ily (e.g., see The Immunoglobulin Gene Superfamily. A.F. Williams and A.N. Barclay, in Immunoglobulin Genes. T. Honjo, F.W. Alt, and T.H. Rabbitts, eds., (1989) Academic Press: San Diego, CA, pp.361-387, which is incorporated herein by reference) , most frequently encoded by a rodent, non-human primate, avian, porcine, bovine, ovine, goat, or human heavy chain or light chain gene ⁇ equence.
  • a functional single-chain antibody generally contain ⁇ a ⁇ ufficient portion of an immunoglobulin ⁇ uperfamily gene product ⁇ o as to retain the property of binding to a specific target molecule, typically a receptor or antigen (epitope
  • CDR complementarity-determining region
  • Kabat and Chothia CDR definitions also generally known as hypervariable regions or hypervariable loops
  • Variable region domains typically comprise the amino-terminal approximately 105-115 amino acids of a naturally-occurring immunoglobulin chain (e.g. , amino acids 1-110) , although variable domains somewhat shorter or longer are al ⁇ o ⁇ uitable for forming single-chain antibodies.
  • An immunoglobulin light or heavy chain variable region consists of a "framework" region interrupted by three hypervariable regions, also called CDR's.
  • the extent of the framework region and CDR's have been precisely defined (see. "Sequences of Proteins of Immunological Interest,” E. Kabat et al. , 4th Ed., U.S. Department of Health and Human Services, Bethesda, MD (1987)) .
  • the sequences of the framework regions of different light or heavy chains are relatively conserved within a species.
  • a "human framework region” is a framework region that is substantially identical (about 85% or more, usually 90-95% or more) to the framework region of a naturally occurring human immunoglobulin.
  • variable segment refers to a portion of a nascent peptide which comprises a random, pseudorandom, or defined kernal sequence.
  • a variable segment can comprise both variant and invariant residue position ⁇ , and the degree of re ⁇ idue variation at a variant residue position may be limited; both options are selected at the discretion of the practitioner.
  • variable segments are about 5 to 20 amino acid residues in length (e.g., 8 to 10), although variable segments may be longer and may comprise antibody portions or receptor proteins, such as an antibody fragment, a nucleic acid binding protein, a receptor protein, and the like.
  • random peptide sequence refers to an amino acid sequence composed of two or more amino acid monomers and constructed by a stochastic or random process.
  • a random peptide can include framework or scaffolding motifs, which may comprise invariant sequences.
  • random peptide library refers to a set of polynucleotide sequences that encodes a set of random peptides, and to the set of random peptides encoded by those polynucleotide sequences, as well as the fusion proteins containing those random peptides.
  • the term "pseudorandom" refer ⁇ to a set of sequences that have limited variability, so that for example the degree of residue variability at one position i ⁇ different than the degree of residue variability at another position, but any pseudorandom position is allowed some degree of re ⁇ idue variation, however circum ⁇ cribed.
  • defined sequence framework refers to a set of defined sequence ⁇ that are ⁇ elected on a nonrandom ba ⁇ is, generally on the basi ⁇ of experimental data or ⁇ tructural data; for example, a defined ⁇ equence framework may comprise a ⁇ et of amino acid ⁇ equences that are predicted to form a jS-sheet structure or may comprise a leucine zipper heptad repeat motif, a zinc-finger domain, among other variations.
  • a "defined sequence kernal" i ⁇ a ⁇ et of ⁇ equences which encompass a limited scope of variability.
  • a completely random 10-mer sequence of the 20 conventional amino acids can be any of (20) 10 sequences
  • a pseudorandom 10-mer sequence of the 20 conventional amino acids can be any of (20) 10 sequences but will exhibit a bias for certain residue ⁇ at certain po ⁇ ition ⁇ and/or overall
  • a defined ⁇ equence kernal generally comprises variant and invariant residue positions and/or comprises variant residue positions which can comprise a residue selected from a defined subset of amino acid residues) , and the like, either segmentally or over the entire length of the individual selected library member sequence.
  • sequence kernals can refer to either amino acid ⁇ equences or polynucleotide sequences.
  • sequences (NNK) 10 and (NNM) 10 where N represent ⁇ A, T, G, or C; K represents G or T; and M represents A or C, are defined sequence kernals.
  • epitope refers to that portion of an antigen or other macromolecule capable of forming a binding interaction that interacts with the variable region binding pocket of an antibody. Typically, such binding interaction is manifested as an intermolecular contact with one or more amino acid residues of a CDR.
  • receptor refers to a molecule that has an affinity for a given ligand. Receptors can be naturally occurring or synthetic molecules. Receptor ⁇ can be employed in an unaltered ⁇ tate or as aggregates with other ⁇ pecies. Receptors can be attached, covalently or noncovalently, to a binding member, either directly or via a specific binding sub ⁇ tance. Examples of receptors include, but are not limited to, antibodies, including monoclonal antibodies and antisera reactive with specific antigenic determinants (such as on viruses, cells, or other materials), cell membrane receptors, complex carbohydrates and glycoproteins, enzymes, and hormone receptors.
  • ligand refers to a molecule, such as a random peptide or variable segment sequence, that i ⁇ recognized by a particular receptor.
  • a molecule or macromolecular complex
  • the binding partner having a smaller molecular weight is referred to as the ligand and the binding partner having a greater molecular weight is referred to as a receptor.
  • linker or “spacer” refers to a molecule or group of molecules that connects two molecules, such as a DNA binding protein and a random peptide, and serves to place the two molecules in a preferred configuration, e.g. , so that the random peptide can bind to a receptor with minimal steric hindrance from the DNA binding protein.
  • operably linked refers to a linkage of polynucleotide elements in a functional relation ⁇ hip.
  • a nucleic acid is "operably linked” when it is placed into a functional relationship with another nucleic acid sequence.
  • a promoter or enhancer i ⁇ operably linked to a coding ⁇ equence if it affect ⁇ the transcription of the coding sequence.
  • Operably linked means that the DNA sequences being linked are typically contiguous and, where neces ⁇ ary to join two protein coding regions, contiguous and in reading frame.
  • recursive sequence recombination refers to a method whereby a population of polynucleotide sequences are recombined with each other by any suitable recombination means (e.g., sexual PCR, homologous recombination, ⁇ ite- ⁇ pecific recombination, etc.) to generate a library of sequence-recombined species which is then screened or subjected to selection to obtain those ⁇ equence-recombined ⁇ pecies having a desired property; the selected species are then subjected to at least one additional cycle of recombination with themselves and/or with other polynucleotide species and at subsequent selection or screening for the de ⁇ ired property.
  • suitable recombination means e.g., sexual PCR, homologous recombination, ⁇ ite- ⁇ pecific recombination, etc.
  • Screening i ⁇ in general, a two- ⁇ tep proce ⁇ s in which one first determines which cells do and do not expre ⁇ s a screening marker and then physically ⁇ eparates the cells having the desired property.
  • Selection is a form of screening in which identification and phy ⁇ ical ⁇ eparation are achieved simultaneously by expression of a selection marker, which, in some genetic circumstances, allows cells expressing the marker to survive while other cells die (or vice versa) .
  • Screening markers include luciferase, ⁇ -galactosidase, and green fluorescent protein. Selection markers include drug and toxin re ⁇ i ⁇ tance genes.
  • Nucleic acid shuffling is a method for recursive in vitro or in vivo homologous recombination of pools of nucleic acid fragments or polynucleotides. Mixtures of related nucleic acid sequences or polynucleotides are randomly or pseudorandomly fragmented, and reassembled to yield a library or mixed population of recombinant nucleic acid molecules or polynucleotides.
  • FIG. 1 is shown a schematic diagram of DNA shuffling as described herein.
  • the initial library can con ⁇ i ⁇ t of related ⁇ equences of diverse origin (i.e. antibodies from naive mRNA) or can be derived by any type of mutagenesis (including shuffling) of a single antibody gene.
  • a collection of selected complementarity determining regions ("CDRs") is obtained after the first round of affinity selection (Fig.l) .
  • the thick CDRs confer onto the antibody molecule increased affinity for the antigen.
  • Shuffling allows the free combinatorial association of all of the CDRls with all of the CDR2s with all of the CDR3s, etc. (Fig.l) .
  • This method differs from PCR, in that it is an inver ⁇ e chain reaction.
  • PCR the number of molecules grow ⁇ exponentially.
  • shuffling the number of the polymerase start sites and the number of molecules remains essentially the same.
  • the shuffling process becomes an inverse chain reaction generating fewer molecules. Since cross-overs occur at regions of homology, recombination will primarily occur between members of the same sequence family. This discourages combinations of CDRs that are grossly incompatible (eg.
  • Rare shufflants will contain a large number of the be ⁇ t (eg. highest affinity) CDRs and these rare ⁇ hufflants may be selected based on their superior affinity (Fig. 1) .
  • CDRs from a pool of 100 different selected antibody sequences can be permutated in up to 100 6 different ways. This large number of permutations cannot be repre ⁇ ented in a ⁇ ingle library of DNA sequences. Accordingly, it is contemplated that multiple cycles of DNA shuffling and selection may be required depending on the length of the sequence and the sequence diversity desired.
  • the template polynucleotide which may be used in the methods of this invention may be DNA or RNA. It may be of various lengths depending on the size of the gene or DNA fragment to be recombined or reassembled. Preferably the template polynucleotide is from 50 bp to 50 kb. It is contemplated that entire vectors containing the nucleic acid encoding the protein of interest can be used in the methods of this invention, and in fact have been successfully used.
  • the template polynucleotide may be obtained by amplification using the PCR reaction (U.S. Patent No. 4,683,202 and 4,683,195) or other amplification or cloning methods.
  • PCR reaction U.S. Patent No. 4,683,202 and 4,683,195
  • the removal of free primers from the PCR product before fragmentation provides a more efficient result. Failure to adequately remove the primers can lead to a low frequency of crossover clones.
  • the template polynucleotide often should be double-stranded.
  • a double- ⁇ tranded nucleic acid molecule is required to ensure that regions of the resulting single- ⁇ tranded nucleic acid fragments are complementary to each other and thus can hybridize to form a double-stranded molecule.
  • single-stranded or double-stranded nucleic acid fragments having regions of identity to the template polynucleotide and regions of heterology to the template polynucleotide may be added to the template polynucleotide at this step. It is also contemplated that two different but related polynucleotide template ⁇ can be mixed at thi ⁇ ⁇ tep.
  • the double- ⁇ tranded polynucleotide template and any added double-or single-stranded fragments are randomly digested into fragments of from about 5 bp to 5 kb or more.
  • the size of the random fragment ⁇ is from about 10 bp to 1000 bp, more preferably the size of the DNA fragments is from about 20 bp to 500 bp.
  • double-stranded nucleic acid having multiple nicks may be used in the methods of this invention.
  • a nick is a break in one strand of the double- stranded nucleic acid. The distance between such nick ⁇ i ⁇ preferably 5 bp to 5 kb, more preferably between 10 bp to 1000 bp.
  • the nucleic acid fragment may be digested by a number of different methods.
  • the nucleic acid fragment may be digested with a nuclease, such as DNAsel or RNAse.
  • the nucleic acid may be randomly sheared by the method of sonication or by passage through a tube having a small orifice.
  • the nucleic acid may also be partially digested with one or more restriction enzyme ⁇ , ⁇ uch that certain points of cross-over may be retained statistically.
  • concentration of any one specific nucleic acid fragment will not be greater than 1% by weight of the total nucleic acid, more preferably the concentration of any one specific nucleic acid ⁇ equence will not be greater than 0.1% by weight of the total nucleic acid.
  • the number of different ⁇ pecific nucleic acid fragments in the mixture will be at least about 100, preferably at least about 500, and more preferably at least about 1000.
  • single-stranded or double-stranded nucleic acid fragments may be added to the random double-stranded nucleic acid fragment ⁇ in order to increa ⁇ e the heterogeneity of the mixture of nucleic acid fragments.
  • populations of double-stranded randomly broken or nicked nucleic acid fragments may be mixed or combined at this step. Damaged DNA can be exploited to enhance recombination via the nicked portions which can participate in strand invasion, formation of recombination junctions, ⁇ erve as free 3' ends for hybrid formation and the like.
  • single-stranded or double-stranded nucleic acid fragments having a region of identity to the template polynucleotide and a region of heterology to the template polynucleotide may be added in a 20 fold excess by weight as compared to the total nucleic acid, more preferably the single-stranded nucleic acid fragments may be added in a 10 fold excess by weight as compared to the total nucleic acid.
  • population ⁇ of nucleic acid fragments from each of the templates may be combined at a ratio of les ⁇ than about 1:100, more preferably the ratio i ⁇ less than about 1:40.
  • a backcros ⁇ of the wild-type polynucleotide with a population of mutated polynucleotide may be de ⁇ ired to eliminate neutral mutations (e.g., mutations yielding an insub ⁇ tantial alteration in the phenotypic property being ⁇ elected for) .
  • the ratio of randomly digested wild-type polynucleotide fragment ⁇ which may be added to the randomly digested mutant polynucleotide fragments is approximately 1:1 to about 100:1, and more preferably from 1:1 to 40:1.
  • the mixed population of random length nucleic acid fragments are denatured to form single-stranded nucleic acid fragments and then reannealed. Only those single-stranded nucleic acid fragments having regions of homology with other ⁇ ingle- ⁇ tranded nucleic acid fragment ⁇ will reanneal.
  • the random length nucleic acid fragments may be denatured by heating.
  • One skilled in the art could determine the conditions necessary to completely denature the double stranded nucleic acid.
  • the temperature is from 80 °C to 100 °C, more preferably the temperature is from 90 °C to 96 °C.
  • Other method ⁇ which may be used to denature the nucleic acid fragments include pressure (36) and pH.
  • the nucleic acid fragments may be reannealed by cooling.
  • the temperature is from 20 °C to 75 °C, more preferably the temperature is from 40 °C to 65 °C. If a high frequency of crossovers is needed based on an average of only 4 consecutive base ⁇ of homology, recombination can be forced by u ⁇ ing a low annealing temperature, although the proce ⁇ becomes more difficult.
  • the degree of renaturation which occurs will depend on the degree of homology between the population of single-stranded nucleic acid fragments.
  • Renaturation can be accelerated by the addition of polyethylene glycol ("PEG”) or salt.
  • PEG polyethylene glycol
  • the ⁇ alt concentration is preferably from 0 mM to about 400 mM, more preferably the salt concentration is from 10 mM to 100 mM.
  • the salt may be KCl or NaCl.
  • the concentration of PEG is preferably from 0% to 20%, more preferably from 5% to 10%. Higher concentrations of salt and/or PEG can be used, if desired.
  • the annealed nucleic acid fragments are next incubated in the presence of a nucleic acid polymera ⁇ e and dNTP's (i.e. dATP, dCTP, dGTP and dTTP) .
  • the nucleic acid polymerase may be the Klenow fragment, the Taq polymerase or any other DNA polymerase known in the art.
  • the approach to be used for the assembly depends on the minimum degree of homology that should still yield crossovers. If the areas of identity are large, Taq polymerase can be used with an annealing temperature of between 45-65°C. If the areas of identity are small, Klenow polymerase can be u ⁇ ed with an annealing temperature of between 20-30°C. One skilled in the art could vary the temperature of annealing to increase the number of cross-overs achieved. The polymerase may be added to the random nucleic acid fragments prior to annealing, simultaneously with annealing or after annealing.
  • the cycle of denaturation, renaturation and incubation in the presence of polymerase can be referred to as shuffling or reassembly of the nucleic acid.
  • This cycle is repeated for a de ⁇ ired number of times.
  • the cycle is repeated from 2 to 50 times, more preferably the sequence is repeated from 10 to 40 time ⁇ .
  • ⁇ huffling encompasses a broader range of recursive recombination proce ⁇ e ⁇ which can include, but are not obligated to, PCR amplification or similar amplification methods; thus, ⁇ huffling can involve homologou ⁇ recombination, ⁇ ite- ⁇ pecific recombination, chimera formation (e.g., Levichkin et al. op.cit) . and the like, so long as used recursively (i.e., for more than one cycle of sequence recombination) with selection and/or screening.
  • Non-determini ⁇ tic recombination ⁇ uch as general homologous recombination can be used in combination with or in place of deterministic recombination, such as site- ⁇ pecific recombination where the ⁇ ite ⁇ of recombination are known and/or defined.
  • the re ⁇ ulting nucleic acid is a larger double-stranded polynucleotide of from about 50 bp to about 100 kb, preferably the larger polynucleotide is from 500 bp to 50 kb.
  • Thi ⁇ larger polynucleotide fragment may contain a number of copie ⁇ of a nucleic acid fragment having the same size as the template polynucleotide in tandem.
  • This concatemeric fragment is then digested into single copies of the template polynucleotide.
  • the result will be a population of nucleic acid fragments of approximately the same ⁇ ize a ⁇ the template polynucleotide.
  • the population will be a mixed population where ⁇ ingle or double-stranded nucleic acid fragments having an area of identity and an area of heterology have been added to the template polynucleotide prior to shuffling.
  • the concatemer can be introduced (e.g., via electroporation.
  • the single nucleic acid fragments may be obtained from the larger concatemeric nucleic acid fragment by amplification of the single nucleic acid fragment ⁇ prior to cloning by a variety of method ⁇ including PCR (U.S. Patent No. 4,683,195 and 4,683,202) rather than by dige ⁇ tion of the concatemer.
  • the concatemer can be introduced (e.g., via electroporation. lipofection, or the like) directly without mono erization.
  • the vector used for cloning is not critical provided that it will accept a DNA fragment of the desired size.
  • the cloning vehicle ⁇ hould further comprise transcription and translation ⁇ ignal ⁇ next to the ⁇ ite of insertion of the DNA fragment to allow expression of the DNA fragment in the host cell.
  • Preferred vectors include the pUC memori ⁇ and the pBR ⁇ eries of plasmids.
  • the resulting bacterial population will include a number of recombinant DNA fragments having random mutations. This mixed population may be tested to identify the desired recombinant nucleic acid fragment. The method of selection will depend on the DNA fragment desired.
  • the protein ⁇ expre ⁇ ed by each of the DNA fragment ⁇ in the population or library may be tested for their ability to bind to the ligand by methods known in the art (i.e. panning, affinity chromatography) . If a DNA fragment which encodes for a protein with increased drug resistance is de ⁇ ired, the proteins expressed by each of the DNA fragments in the population or library may be tested for their ability to confer drug re ⁇ istance to the host organism.
  • One skilled in the art given knowledge of the desired protein, could readily test the population to identify DNA fragments which confer the desired properties onto the protein.
  • phage display sy ⁇ tem in which fragment ⁇ of the protein are expre ⁇ sed as fusion proteins on the phage surface (Pharmacia, Milwaukee WI) .
  • the recombinant DNA molecules are cloned into the phage DNA at a site which result ⁇ in the transcription of a fusion protein, a portion of which is encoded by the recombinant DNA molecule.
  • the phage containing the recombinant nucleic acid molecule undergoes replication and transcription in the cell.
  • the leader ⁇ equence of the fu ⁇ ion protein direct ⁇ the transport of the fusion protein to the tip of the phage particle.
  • the fusion protein which i ⁇ partially encoded by the recombinant DNA molecule i ⁇ displayed on the phage particle for detection and selection by the methods described above. It is further contemplated that a number of cycles of nucleic acid shuffling may be conducted with nucleic acid fragments from a subpopulation of the first population, which subpopulation contains DNA encoding the desired recombinant protein. In thi ⁇ manner, proteins with even higher binding affinities or enzymatic activity could be achieved.
  • a number of cycles of nucleic acid shuffling may be conducted with a mixture of wild-type nucleic acid fragments and a subpopulation of nucleic acid from the first or subsequent rounds of nucleic acid shuffling in order to remove any silent mutations from the subpopulation.
  • nucleic acid in purified form can be utilized as the starting nucleic acid.
  • the proces ⁇ may employ DNA or RNA including messenger RNA, which DNA or RNA may be single or double stranded.
  • a DNA-RNA hybrid which contain ⁇ one ⁇ trand of each may be utilized.
  • the nucleic acid sequence may be of various lengths depending on the size of the nucleic acid sequence to be mutated. Preferably the specific nucleic acid sequence is from 50 to 50000 base pairs. It is contemplated that entire vectors containing the nucleic acid encoding the protein of intere ⁇ t may be used in the method ⁇ of this invention.
  • the nucleic acid may be obtained from any ⁇ ource, for example, from plasmids such a pBR322, from cloned DNA or RNA or from natural DNA or RNA from any source including bacteria, yeast, viruses and higher organisms such as plant ⁇ or animals.
  • DNA or RNA may be extracted from blood or tissue material.
  • the template polynucleotide may be obtained by amplification using the polynucleotide chain reaction (PCR) (U.S. Patent no. 4,683,202 and 4,683,195).
  • PCR polynucleotide chain reaction
  • the polynucleotide may be present in a vector present in a cell and sufficient nucleic acid may be obtained by culturing the cell and extracting the nucleic acid from the cell by methods known in the art.
  • Any specific nucleic acid sequence can be used to produce the population of mutants by the present process. It is only nece ⁇ sary that a small population of mutant sequences of the specific nucleic acid sequence exist or be created prior to the present proces ⁇ .
  • the initial small population of the specific nucleic acid sequences having mutations may be created by a number of different methods. Mutations may be created by error-prone PCR. Error-prone PCR uses low-fidelity polymerization conditions to introduce a low level of point mutations randomly over a long sequence. Alternatively, mutations can be introduced into the template polynucleotide by oligonucleotide-directed mutagenesi ⁇ .
  • oligonucleotide-directed mutagene ⁇ is, a ⁇ hort sequence of the polynucleotide is removed from the polynucleotide using restriction enzyme digestion and is replaced with a ⁇ ynthetic polynucleotide in which variou ⁇ bases have been altered from the original sequence.
  • the polynucleotide sequence can also be altered by chemical mutagenesis.
  • Chemical mutagens include, for example, sodium bisulfite, nitrous acid, hydroxylamine, hydrazine or formic acid.
  • Other agents which are analogues of nucleotide precursor ⁇ include nitrosoguanidine, 5-bromouracil, 2- aminopurine, or acridine.
  • these agents are added to the PCR reaction in place of the nucleotide precursor thereby mutating the sequence.
  • Intercalating agent ⁇ such as proflavine, acriflavine, quinacrine and the like can also be used.
  • Random utagenesi ⁇ of the polynucleotide sequence can also be achieved by irradiation with X-rays or ultraviolet light.
  • plasmid DNA or DNA fragments so mutagenized are introduced into E. coli and propagated as a pool or library of mutant pla ⁇ mids.
  • the small mixed population of specific nucleic acids may be found in nature in that they may consist of different alleles of the same gene or the same gene from different related specie ⁇ (i.e., cognate gene ⁇ ) .
  • they may be related DNA sequences found within one species, for example, the immunoglobulin genes.
  • the polynucleotides can be used directly or in ⁇ erted into an appropriate cloning vector, u ⁇ ing techniques well-known in the art.
  • the choice of vector depends on the size of the polynucleotide sequence and the host cell to be employed in the methods of this invention.
  • the templates of this invention may be plasmids, phages, cosmids, phagemids, viruses (e.g., retroviruses, parainfluenzavirus, herpesviruses, reoviruses, paramyxoviruses, and the like) , or selected portions thereof (e.g., coat protein, spike glycoprotein, capsid protein).
  • cosmids for example, cosmids, phagemids, YACs, and BACs are preferred where the ⁇ pecific nucleic acid sequence to be mutated is larger because these vectors are able to stably propagate large nucleic acid fragments.
  • the mixed population of the specific nucleic acid sequence is cloned into a vector it can be clonally amplified by inserting each vector into a host cell and allowing the host cell to amplify the vector.
  • This i ⁇ referred to a ⁇ clonal amplification because while the absolute number of nucleic acid sequences increases, the number of mutants does not increase.
  • sequences in exces ⁇ of 50 kb can be amplified.
  • Whole genes and whole plasmid ⁇ can be assembled in a single tube from synthetic oligonucleotides by parallel PCR. Sequences can be randomly mutagenized at various levels by random fragmentation and reas ⁇ embly of the fragments by mutual priming. Site-specific mutations can be introduced into long sequence ⁇ by random fragmentation of the template followed by rea ⁇ sembly of the fragments in the presence of mutagenic oligonucleotides.
  • a particularly useful application of parallel PCR is called sexual PCR.
  • DNA shuffling In sexual PCR, also called DNA shuffling, parallel PCR is used to perform in vitro recombination on a pool of DNA sequence ⁇ .
  • a mixture of related but not identical DNA sequences (typically PCR products, restriction fragments or whole plasmids) is randomly fragmented, for example by DNAsel treatment. These random fragments are then reassembled by parallel PCR. As the random fragments and their PCR products prime each other, the average size of the fragments increases with the number of PCR cycles. Recombination, or crossover, occur ⁇ by template switching, such as when a DNA fragment derived from one template primes on the homologou ⁇ position of a related but different template.
  • sexual PCR can be used to construct libraries of chimaeras of genes from different species ('zoo libraries') .
  • Sexual PCR is useful for in vitro evolution of DNA sequences.
  • the libraries of new mutant combinations that are obtained by sexual PCR are ⁇ elected for the be ⁇ t recombinant ⁇ equences at the DNA, RNA, protein or ⁇ mall molecule level.
  • Thi ⁇ proce ⁇ of recombination, ⁇ election and amplification is repeated for as many cycle ⁇ as necessary to obtain a desired property or function.
  • the DNA shuffling method of this invention can be performed blindly on a pool of unknown sequences.
  • any sequence mixture can be incorporated at any ⁇ pecific position into another sequence mixture.
  • mixtures of synthetic oligonucleotides, PCR fragment ⁇ or even whole gene ⁇ can be mixed into another sequence library at defined positions.
  • the insertion of one sequence (mixture) is independent from the insertion of a sequence in another part of the template.
  • the degree of recombination, the homology required, and the diversity of the library can be independently and simultaneously varied along the length of the reassembled DNA.
  • This approach of mixing two genes may be useful for the humanization of antibodies from murine hybridomas.
  • the approach of mixing two genes or inserting mutant sequences into genes may be useful for any therapeutically used protein, for example, interleukin I, antibodies, tPA, growth hormone, etc.
  • the approach may also be useful in any nucleic acid for example, promoters or introns or 3' untranslated region or 5' untranslated regions of genes to increa ⁇ e expression or alter specificity of expression of proteins.
  • the approach may also be used to mutate ribozymes or aptamer ⁇ .
  • Shuffling requires the presence of homologous regions separating regions of diversity. If the sequences to be shuffled are not substantially identical, it is typically preferable to employ intron-based shuffling and/or ⁇ ite- ⁇ pecific recombination. Scaffold-like protein ⁇ tructures may be particularly suitable for shuffling.
  • the conserved scaffold determines the overall folding by self-association, while displaying relatively unrestricted loops that mediate the specific binding. Examples of such scaffold ⁇ are the immunoglobulin beta-barrel, and the four-helix bundle (24) .
  • Thi ⁇ shuffling can be u ⁇ ed to create scaffold-like proteins with various combinations of mutated sequence ⁇ for binding.
  • the equivalent ⁇ of some standard genetic matings may al ⁇ o be performed by ⁇ huffling in vitro .
  • a 'molecular backcross' can be performed by repeated mixing of the mutant' ⁇ nucleic acid with the wild-type nucleic acid while selecting for the mutations of interest.
  • this approach can be used to combine phenotype ⁇ from different sources into a background of choice. It i ⁇ useful, for example, for the removal of neutral mutations that affect unselected characteristics (i.e. immunogenicity) .
  • unselected characteristics i.e. immunogenicity
  • the method of thi ⁇ invention can be u ⁇ ed for the in vitro amplification of a whole genome from a single cell as is needed for a variety of research and diagnostic applications.
  • DNA amplification by PCR is in practice limited to a length of about 40 kb.
  • Amplification of a whole genome such as that of E . coli (5,000 kb) by PCR would require about 250 primers yielding 125 forty kb fragments. This approach is not practical due to the unavailability of sufficient sequence data.
  • random digestion of the genome with DNAsel, followed by gel purification of small fragments will provide a multitude of possible primers.
  • 100 fold amplification in the copy number and an average fragment size of greater than 50 kb may be obtained when only random fragments are used (see Example 2) . It is thought that the larger concatemer is generated by overlap of many smaller fragments.
  • the quality of specific PCR products obtained using ⁇ ynthetic primer ⁇ will be indistinguishable from the product obtained from unamplified DNA. It is expected that this approach will be useful for the mapping of genomes.
  • the polynucleotide to be shuffled can be fragmented randomly or non-randomly, at the discretion of the practitioner.
  • the mixed population of the specific nucleic acid sequence is introduced into bacterial (e.g., Archeaebacteria) or eukaryotic cells under conditions such that at least two different nucleic acid sequence ⁇ are pre ⁇ ent in each host cell.
  • the fragments can be introduced into the host cells by a variety of different methods.
  • the host cells can be transformed with the fragments using methods known in the art, for example treatment with calcium chloride. If the fragments are inserted into a phage genome, the host cell can be transfected with the recombinant phage genome having the specific nucleic acid sequences.
  • the nucleic acid sequence ⁇ can be introduced into the host cell using electroporation, natural competence, transduction, transfection, lipofection, biolistics, conjugation, and the like or other suitable method of introducing a polynucleotide sequence into a cell.
  • the specific nucleic acids sequences will be present in vectors which are capable of stably replicating the sequence in the host cell.
  • the vectors will encode a marker gene such that host cells having the vector can be selected or screened. This ensure ⁇ that the mutated specific nucleic acid sequence can be recovered after introduction into the host cell.
  • the entire mixed population of the specific nucleic acid sequences need not be present on a vector sequence. Rather only a sufficient number of sequences need be cloned into vectors to en ⁇ ure that after introduction of the fragment ⁇ into the ho ⁇ t cells each ho ⁇ t cell contain ⁇ two vector species having at least one related-sequence nucleic acid sequence present therein. It is also contemplated that rather than having a subset of the population of the specific nucleic acids sequences cloned into vectors, this subset may be already stably integrated into the host cell. It ha ⁇ been found that when two fragments which have region ⁇ of identity are inserted into the host cells, homologous recombination occurs between the two fragments. Such recombination between the two mutated specific nucleic acid sequences will result in the production of substantially all combinations of all or most of the mutations (as limited by library size and propagation efficiency, etc.).
  • the frequency of recombination i ⁇ increased if some of the mutated ⁇ pecific nucleic acid sequences are present on linear nucleic acid molecules. Therefore, in a preferred embodiment, some of the specific nucleic acid sequences are present on linear nucleic acid fragments.
  • the nucleic acid molecules are single-stranded or substantially single-stranded, such as single- ⁇ tranded phage genomes which may or may not comprise heterologous sequences.
  • M13 phage is an example of a suitable s ⁇ DNA template, and M13 ha ⁇ the advantage that the M13 virus can be shuffled in prokaryotic cells (e.g., E. coli), and then u ⁇ ed to transfer DNA into mammalian cells.
  • the host cell transformants are placed under selection to identify those ho ⁇ t cell tran ⁇ formants which contain mutated specific nucleic acid sequences having the qualities desired. For example, if increased resistance to a particular drug is desired then the transformed host cells may be subjected to increa ⁇ ed concentrations of the particular drug and those transformants producing mutated proteins able to confer increased drug resistance will be selected. If the enhanced ability of a particular protein to bind to a receptor is desired, then expression of the protein can be induced from the transformants and the resulting protein assayed in a ligand binding as ⁇ ay by methods known in the art to identify that subset of the mutated population which show ⁇ enhanced binding to the ligand. Alternatively, the protein can be expressed in another system to ensure proper processing.
  • the recombined specific nucleic acid sequences may be mixed with the original mutated specific nucleic acid sequence ⁇ (parent ⁇ equences) and the cycle repeated as described above. In this way a set of second recombined specific nucleic acids sequences can be identified which have enhanced characteristics or encode for proteins having enhanced properties. This cycle can be repeated a number of times as desired.
  • a backcross can be performed in the ⁇ econd or ⁇ ub ⁇ equent recombination cycle.
  • a molecular backcro ⁇ s can be performed by mixing the desired specific nucleic acid sequences with a large number of the wild-type sequence, such that at least one wild-type nucleic acid sequence and a mutated nucleic acid sequence are present in the same host cell after transformation. Recombination with the wild-type specific nucleic acid sequence will eliminate those neutral or weakly contributory mutations that may affect unselected characteristics such as immunogenicity but not the selected characteristics.
  • a ⁇ ubset of the specific nucleic acid sequences can be fragmented prior to introduction into the host cell.
  • the size of the fragments must be large enough to contain some regions of identity with the other sequences so as to homologously recombine with the other sequences.
  • These fragments, ssDNA or dsDNA can be coated with RecA in vitro to promote hybridization and/or integration into the host DNA.
  • the size of the fragments will range from 0.03 kb to 100 kb more preferably from 0.2 kb to 10 kb.
  • nucleic acid sequence ⁇ other than the sequence ⁇ ⁇ elected from the previou ⁇ round may be cleaved into fragments prior to introduction into the host cells.
  • “Cleavage” may be by nuclease dige ⁇ tion, PCR amplification (via partial exten ⁇ ion or stuttering) , or other suitable means for generating partial length polynucleotides of parent sequence(s) .
  • Sequences can be accomplished by a variety of methods known in the art.
  • the sequences can be randomly fragmented or fragmented at specific sites in the nucleic acid sequence. Random fragments can be obtained by breaking the nucleic acid or exposing it to harsh physical treatment (e.g., shearing or irradiation) or harsh chemical agents (e.g., by free radical ⁇ ; metal ions; acid treatment to depurinate and cleave) . Random fragments can also be obtained, in the case of DNA by the use of DNase or like nuclease, or by other means as discu ⁇ sed herein.
  • the sequences can be cleaved at specific site ⁇ by the use of re ⁇ triction enzymes.
  • the fragmented sequences can be single- ⁇ tranded or double- ⁇ tranded. If the ⁇ equence ⁇ were originally ⁇ ingle- ⁇ tranded they can be denatured with heat, chemical ⁇ or enzymes prior to insertion into the host cell.
  • the reaction conditions suitable for separating the strands of nucleic acid are well known in the art.
  • partial PCR extension, PCR stuttering, and other related methods for producing partial length copies of a parental sequence can be used to effect "fragmentation", e.g., to obtain a hybrid product which contains segments derived from different parental sequences.
  • steps of this proces ⁇ can be repeated indefinitely, being limited only by the number of po ⁇ sible mutants which can be achieved. After a certain number of cycles, all pos ⁇ ible mutant ⁇ will have been achieved and further cycles are redundant. In an embodiment the same mutated template nucleic acid is repeatedly recombined and the resulting recombinants selected for the desired characteristic.
  • the initial pool or population of mutated template nucleic acid is cloned into a vector capable of replicating in bacteria such as E . coli .
  • the particular vector is not essential, so long as it is capable of autonomous replication in E. coli or integration into a host chromosome.
  • the vector is designed to allow the expres ⁇ ion and production of any protein encoded by the mutated specific nucleic acid linked to the vector. It is also preferred that the vector contain a gene encoding for a selectable marker.
  • the population of vectors containing the pool of mutated nucleic acid sequences is introduced into the E. coli host cells.
  • the vector nucleic acid sequences may be introduced by transformation, transfection or infection in the case of phage.
  • the concentration of vectors used to transform the bacteria is such that a number of vectors is introduced into each cell. Once present in the cell, the efficiency of homologous recombination is such that homologous recombination occurs between the various vectors. This results in the generation of mutants (daughters) having a combination of mutations which differ from the original parent mutated ⁇ equence ⁇ .
  • the host cells are then replicated, typically clonally, and selected for the marker gene present on the vector. Only those cells having a plasmid will grow under the selection.
  • the host cells which contain a vector are then tested for the presence of favorable mutations. Such testing may consist of placing the cells under selective pressure, for example, if the gene to be selected is an improved drug resistance gene. If the vector allows expres ⁇ ion of the protein encoded by the mutated nucleic acid sequence, then such selection may include allowing expression of the protein so encoded, isolation of the protein and testing of the protein to determine whether, for example, it binds with increased efficiency to the ligand of interest. Once a particular pool of daughter mutated nucleic acid sequence has been identified which confers the desired characteristics, the nucleic acid is isolated either already linked to the vector or separated from the vector. This nucleic acid is then recombined with itself or with similarly selected pools) and the cycle is repeated; optionally parental sequences can be used for sub ⁇ equent rounds of recombination, in place of or in addition to other selected daughter specie ⁇ .
  • nucleic acid sequences having enhanced desired properties can be selected.
  • the first generation of mutant ⁇ are retained in the cell ⁇ and the fir ⁇ t generation of mutant ⁇ equences are added again to the cells. Accordingly, the first cycle of Embodiment I is conducted as described above. However, after the daughter nucleic acid ⁇ equences are identified, the host cells containing the ⁇ e ⁇ equences are retained.
  • the daughter mutated specific nucleic acid population is introduced into the host cell ⁇ already containing the daughter nucleic acid ⁇ . Recombination i ⁇ allowed to occur in the cells and the next generation of recombinants, or granddaughter ⁇ are ⁇ elected by the method ⁇ described above.
  • This cycle can be repeated a number of time ⁇ until the nucleic acid or peptide having the desired characteristic ⁇ i ⁇ obtained. It i ⁇ contemplated that in ⁇ ubsequent cycles, the population of mutated sequences which are added to the preferred mutants may come from the parental mutants or any subsequent generation.
  • the invention provides a method of conducting a "molecular" backcross of the obtained recombinant specific nucleic acids (one ⁇ pecies or a pool of several speceis) in order to eliminate any neutral mutations.
  • Neutral mutations are those mutations which do not confer onto the nucleic acid or peptide the desired properties. Such mutations may however confer on the nucleic acid or peptide undesirable characteristics. Accordingly, it i ⁇ desirable to eliminate such neutral mutations.
  • the methods of this invention provide a means of doing so.
  • the nucleic acid after the mutant nucleic acid, having the de ⁇ ired characteri ⁇ tic ⁇ , i ⁇ obtained by the method ⁇ of the embodiment ⁇ , the nucleic acid, the vector having the nucleic acid or the host cell, tissue, or individual organism containing the vector and nucleic acid is isolated.
  • the nucleic acid or vector is then introduced into the host cell with a large exces ⁇ of the wild-type nucleic acid.
  • the nucleic acid of the mutant and the nucleic acid of the wild-type sequence are allowed to recombine.
  • the resulting recombinants are placed under the same selection as the mutant nucleic acid.
  • the methods of this invention can be used in a molecular backcross to eliminate unneces ⁇ ary, weakly contributing, and/or silent mutations.
  • the in vivo recombination method of this invention can be performed blindly on a pool of unknown mutants or alleles of a specific nucleic acid fragment or sequence, or family of diverse but related ⁇ equence ⁇ or ⁇ equence ⁇ which ⁇ hare one or more recombinogenic sequences (e.g., a site- ⁇ pecific recombination site, a localized segment of sequence homology having substantial identity for homoloogus recombination, a homologous recombination
  • recombinogenic sequences e.g., a site- ⁇ pecific recombination site, a localized segment of sequence homology having substantial identity for homoloogus recombination, a homologous recombination
  • hotspot sequence, a restriction site, etc. suitable for recursive recombination.
  • the approach of using recombination within a mixed population of genes can be u ⁇ eful for the generation of any useful proteins, for example, interleukin I, antibodies, tPA, growth hormone, etc. This approach may be used to generate proteins having altered specificity or activity.
  • the approach may also be useful for the generation of mutant nucleic acid sequences, for example, promoter regions, introns, exons, enhancer sequence ⁇ , 3' untranslated regions or 5' untranslated regions of genes. Thus this approach may be used to generate genes having increased rates of expres ⁇ ion.
  • Thi ⁇ approach may al ⁇ o be u ⁇ eful in the study of repetitive DNA sequence ⁇ .
  • this approach may be useful to mutate ribozymes or aptamers.
  • Scaffold-like region ⁇ ⁇ eparating regions of diversity in proteins may be particularly suitable for the methods of this invention.
  • the conserved scaffold determine ⁇ the overall folding by self-a ⁇ ociation, while di ⁇ playing relatively unrestricted loops that mediate the specific binding.
  • Examples of such scaffolds are the immunoglobulin beta barrel, and the four-helix bundle.
  • the methods of this invention can be used to create scaffold-like protein ⁇ with various combinations of mutated sequence ⁇ for binding.
  • the equivalents of some standard genetic matings may also be performed by the methods of this invention. For example, a "molecular" backcross can be performed by repeated mixing of the mutant's nucleic acid with the wild-type nucleic acid while selecting for the mutation ⁇ of interest.
  • this approach can be used to combine phenotypes from different source ⁇ into a background of choice. It is useful, for example, for the removal of neutral mutations that affect unselected characteristic ⁇ (i.e. immunogenicity) . Thu ⁇ it can be useful to determine which mutations in a protein are involved in the enhanced biological activity and which are not.
  • the present method can be used to shuffle, by in vitro and/or in vivo recombination by any of the disclo ⁇ ed methods, and in any combination, polynucleotide sequences selected by peptide display methods, wherein an a ⁇ ociated polynucleotide encodes a displayed peptide which is screened for a phenotype (e.g., for affinity for a predetermined receptor (ligand) .
  • a phenotype e.g., for affinity for a predetermined receptor (ligand)
  • peptide structures including the primary amino acid sequences, of peptides or peptidomimetics that interact with biological macromolecules.
  • each bacteriophage particle or cell serves as an individual library member displaying a single specie ⁇ of di ⁇ played peptide in addition to the natural bacteriophage or cell protein sequences.
  • Each bacteriophage or cell contains the nucleotide sequence information encoding the particular displayed peptide sequence; thus, the displayed peptide sequence can be ascertained by nucleotide sequence determination of an isolated library member.
  • a well-known peptide display method involves the presentation of a peptide sequence on the surface of a filamentous bacteriophage, typically as a fusion with a bacteriophage coat protein.
  • the bacteriophage library can be incubated with an immobilized, predetermined macromolecule or small molecule (e.g., a receptor) so that bacteriophage particlf which present a peptide sequence that binds to the immobiliz-. macromolecule can be differentially partitioned from those that do not present peptide sequences that bind to the predetermined macromolecule.
  • the bacteriophage particles i.e., library members
  • the bacteriophage particles which are bound to the immobilized macromolecule are then recovered and replicated to amplify the selected bacteriophage subpopulation for a subsequent round of affinity enrichment and phage replication.
  • the bacteriophage library members that are thus selected are isolated and the nucleotide sequence encoding the displayed peptide sequence is determined, thereby identifying the sequence(s) of peptide ⁇ that bind to the predetermined macromolecule (e.g. , receptor) .
  • the predetermined macromolecule e.g. , receptor
  • the fusion protein/vector DNA complexes can be screened against a predetermined macromolecule in much the ⁇ a e way a ⁇ bacteriophage particles are screened in the phage-based display system, with the replication and sequencing of the DNA vectors in the selected fusion protein/vector DNA complexes serving as the ba ⁇ is for identification of the selected library peptide sequence( ⁇ ).
  • RNA molecule ⁇ with the ability to bind a predetermined protein or a predetermined dye molecule were ⁇ elected by alternate rounds of selection and PCR amplification (Tuerk and Gold (1990) Science 249: 505; Ellington and Szo ⁇ tak (1990) Nature 346: 818) .
  • library members comprise a fusion protein having a first polypeptide portion with DNA binding activity and a second polypeptide portion having the library member unique peptide sequence; such methods are suitable for use in cell-free in vitro selection formats, among others.
  • a variation of the method is recursive sequence recombination performed by intron-based recombination, wherein the sequences to be recombined are present as exon ⁇ (e.g., in the form of exons, whether naturally occurring or artificial) which may share substantial, little, or no sequence identity and which are separated by one or more introns (which may be naturally occurring intronic sequence ⁇ or not) which share sufficient sequence identity to support homologous recombination . between introns.
  • a population of polynucleotides comprises library members wherein each library member has one or more copies of a first set of exons linked via a first set of introns to one or more copies of a second set of exons linked via a second set of introns to one or more copies of a third set of exons.
  • Each of the members of the first set of exons may share substantial, little, or no sequence identity with each other or with members of the second or third sets of exons.
  • each of the members of the second ⁇ et of exons may share substantial, little, or no sequence identity with each other or with members of the first or third sets of exons.
  • each of the members of the third set of exons may share sub ⁇ tantial, little, or no ⁇ equence identity with each other or with members of the first or second sets of exons.
  • Each of the members of the each set (first, second, third, etc.) of introns shares sufficient sequence identity with the other members of the set to support recombination (homologous or site- specific recombination, including restriction site-mediated recombination) between members of the same intron set, but typically not with members of other intron sets (e.g., the second or third sets) , such that intra-set recombination between introns of the library members occurs and generates a pool of recombined library members wherein the first set of exons, second set of exons, and third set of exons are effectively shuffled with each other.
  • the displayed peptide sequences can be of varying lengths, typically from 3-5000 amino acids long or longer, frequently from 5-100 amino acids long, and often from about 8-15 amino acids long.
  • a library can comprise library members having varying lengths of displayed peptide sequence, or may comprise library members having a fixed length of displayed peptide ⁇ equence. Portion ⁇ or all of the displayed peptide sequence(s) can be random, pseudorandom, defined set kernal, fixed, or the like.
  • the present display methods include methods for in vitro and in vivo display of single-chain antibodies, such as nascent scFv on poly ⁇ ome ⁇ or ⁇ cFv di ⁇ played on phage, which enable large- scale screening of scFv libraries having broad diversity of variable region sequences and binding specificities.
  • the present invention also provides random, pseudorandom, and defined sequence framework peptide libraries and methods for generating and screening those libraries to identify useful compounds (e.g., peptides, including single-chain antibodies) that bind to receptor molecules or epitopes of interest or gene product ⁇ that modify peptides or RNA in a desired fa ⁇ hion.
  • useful compounds e.g., peptides, including single-chain antibodies
  • the random, p ⁇ eudorandom, and defined ⁇ equence framework peptides are produced from libraries of peptide library members that comprise displayed peptides or displayed single- chain antibodie ⁇ attached to a polynucleotide template from which the displayed peptide was synthesized.
  • the mode of attachment may vary according to the specific embodiment of the invention ⁇ elected, and can include encap ⁇ idation in a phage particle or incorporation in a cell.
  • a method of affinity enrichment allow ⁇ a very large library of peptide ⁇ and single-chain antibodies to be screened and the polynucleotide sequence encoding the desired peptide(s) or single-chain antibodie ⁇ to be ⁇ elected.
  • the pool of polynucleotides can then be isolated and shuffled to recombine co binatorially the amino acid sequence of the selected peptide(s) (or predetermined portions thereof) or single-chain antibodies (or just V H , V L , or CDR portions thereof) .
  • a peptide or single-chain antibody as having a desired binding affinity for a molecule and can exploit the proces ⁇ of ⁇ huffling to converge rapidly to a de ⁇ ired high-affinity peptide or ⁇ cFv.
  • the peptide or antibody can then be ⁇ ynthe ⁇ ized in bulk by conventional mean ⁇ for any suitable use (e.g., as a therapeutic or diagnostic agent) .
  • a significant advantage of the present invention is that no prior information regarding an expected ligand structure is required to isolate peptide ligands or antibodies of interest.
  • the peptide identified can have biological activity, which is meant to include at lea ⁇ t specific binding affinity for a selected receptor molecule and, in some instances, will further include the ability to block the binding of other compounds, to ⁇ timulate or inhibit metabolic pathways, to act as a signal or messenger, to stimulate or inhibit cellular activity, and the like.
  • the present invention also provides a method for shuffling a pool of polynucleotide sequences selected by affinity screening a library of polysome ⁇ displaying nascent peptides (including ⁇ ingle-chain antibodies) for library members which bind to a predetermined receptor (e.g. , a mammalian proteinaceous receptor such a ⁇ , for example, a peptidergic hormone receptor, a cell surface receptor, an intracellular protein which bind ⁇ to other protein(s) to form intracellular protein complexes such as heterodimers and the like) or epitope (e.g. , an immobilized protein, glycoprotein, oligosaccharide, and the like) .
  • a predetermined receptor e.g. , a mammalian proteinaceous receptor such a ⁇ , for example, a peptidergic hormone receptor, a cell surface receptor, an intracellular protein which bind ⁇ to other protein(s) to form intracellular protein complexes such as heterodimers and the like
  • Polynucleotide ⁇ equence ⁇ ⁇ elected in a fir ⁇ t ⁇ election round are pooled and the pool( ⁇ ) i ⁇ /are shuffled by in vitro and/or in vivo recombination to produce a shuffled pool comprising a population of recombined selected polynucleotide sequences.
  • the recombined selected polynucleotide sequences are ⁇ ubjected to at lea ⁇ t one ⁇ ubsequent selection round.
  • the polynucleotide sequence ⁇ ⁇ elected in the subsequent selection round(s) can be used directly (as a pool or in individual clones) , sequenced, and/or subjected to one or more additional round ⁇ of ⁇ huffling and subsequent selection. Selected sequences can also be backcrossed with polynucleotide sequences encoding neutral sequence ⁇ (i.e., having insubstantial functional effect on binding) , such as for example by backcrossing with a wild-type or naturally-occurring sequence substantially identical to a selected sequence to produce native ⁇ like functional peptides, which may be less immunogenic.
  • the sequences Prior to or concomitant with the shuffling of selected sequences, the sequences can be mutagenized.
  • selected library members are cloned in a prokaryotic vector (e.g., plasmid, phagemid, or bacteriophage) wherein a collection of individual colonies (or plaques) representing discrete library members are produced.
  • Individual selected library members can then be manipulated (e.g., by site-directed mutagenesis, cas ⁇ ette mutagene ⁇ i ⁇ , chemical utagene ⁇ i ⁇ , PCR mutagene ⁇ is, and the like) to generate a collection of library member ⁇ representing a kernal of ⁇ equence diversity based on the sequence of the selected library member.
  • sequence of an individual selected library member or pool can be manipulated to incorporate random mutation, pseudorandom mutation, defined kernal mutation (i.e., comprising variant and invariant residue positions and/or comprising variant residue positions which can comprise a residue selected from a defined subset of amino acid residues) , codon-based mutation, and the like, either segmentally or over the entire length of the individual selected library member sequence.
  • the mutagenized selected library members are then shuffled by in vitro and/or in vivo recombinatorial shuffling a ⁇ disclosed herein.
  • the invention also provides peptide libraries comprising a plurality of individual library members of the invention, wherein (1) each individual library member of said plurality comprises a sequence produced by shuffling of a pool of selected sequences, and (2) each individual library member comprises a variable peptide segment sequence or single-chain antibody segment sequence which is distinct from the variable peptide segment sequences or single-chain antibody sequence ⁇ of other individual library member ⁇ in said plurality (although some library members may be present in more than one copy per library due to uneven amplification, stochastic probability, or the like) .
  • the invention also provides a product-by-process, wherein selected polynucleotide sequences having (or encoding a peptide having) a predetermined binding specificity are formed by the process of: (1) screening a displayed peptide or displayed single-chain antibody library against a predetermined receptor (e.g., ligand) or epitope (e.g., antigen macromolecule) and identifying and/or enriching library members which bind to the predetermined receptor or epitope to produce a pool of selected library members, (2) shuffling by recombination of the selected library members (or amplified or cloned copies thereof) which binds the predetermined epitope and has been thereby isolated and/or enriched from the library to generate a shuffled library, and (3) screening the shuffled library against the predetermined receptor (e.g., ligand) or epitope (e.g., antigen macromolecule) and identifying and/or enriching shuffled library members which bind to the predetermined receptor or
  • the present method can be used to shuffle, by in vitro and/or in vivo recombination by any of the disclosed methods, and in any combination, polynucleotide sequences selected by antibody display method ⁇ , wherein an a ⁇ sociated polynucleotide encodes a displayed antibody which is screened for a phenotype (e.g., for affinity for binding a predetermined antigen (ligand).
  • a phenotype e.g., for affinity for binding a predetermined antigen (ligand).
  • variable (V) segment genes located upstream of a tandem array of diversity (D) segment genes, which are themselves located upstream of a tandem array of joining (J) region genes, which are located upstream of the constant (C H ) region genes.
  • V-D-J rearrangement occurs wherein a heavy chain variable region gene (V H ) is formed by rearrangement to form a fused D-J segment followed by rearrangement with a V ⁇ egment to form a V-D-J joined product gene which, if productively rearranged, encodes a functional variable region (V H ) of a heavy chain.
  • V H heavy chain variable region gene
  • V ⁇ egment V-D-J joined product gene which, if productively rearranged, encodes a functional variable region (V H ) of a heavy chain.
  • light chain loci rearrange one of several V segments with one of several J segment ⁇ to form a gene encoding the variable region (V L ) of a light chain.
  • the va ⁇ t repertoire of variable regions po ⁇ ible in immunoglobulins derives in part from the numerous combinatorial pos ⁇ ibilities of joining V and J segments (and, in the case of heavy chain loci, D segments) during rearrangement in B cell development. Additional sequence diversity in the heavy chain variable regions arises from non-uniform rearrangements of the D segments during V-D-J joining and from N region addition. Further, antigen-selection of specific B cell clones selects for higher affinity variants having nongermline mutations in one or both of the heavy and light chain variable regions; a phenomenon referred to as "affinity maturation" or "affinity sharpening". Typically, these "affinity sharpening" mutations cluster in specific areas of the variable region, most commonly in the complementarity-determining regions (CDRs) .
  • CDRs complementarity-determining regions
  • Combinatorial libraries of antibodies have been generated in bacteriophage lambda expression sy ⁇ tems which may be screened as bacteriophage plaques or as colonies of lysogens (Huse et al. (1989) Science 246: 1275; Caton and Koprowski (1990) Proc. Natl. Acad. Sci. (U.S.A.) 87: 6450; Mullinax et al (1990) Proc. Natl. Acad. Sci. (U.S.A.) 87: 8095; Persson et al. (1991) Proc. Natl. Acad. Sci. (U.S.A.) 88: 2432) .
  • a bacteriophage antibody display library is screened with a receptor (e.g., polypeptide, carbohydrate, glycoprotein, nucleic acid) that is immobilized (e.g., by covalent linkage to a chromatography resin to enrich for reactive phage by affinity chromatography) and/or labeled (e.g., to screen plaque or colony lifts) .
  • a receptor e.g., polypeptide, carbohydrate, glycoprotein, nucleic acid
  • immobilized e.g., by covalent linkage to a chromatography resin to enrich for reactive phage by affinity chromatography
  • labeled e.g., to screen plaque or colony lifts
  • the first step generally involves obtaining the genes encoding V H and V L domains with desired binding properties; these V genes may be isolated from a specific hybridoma cell line, selected from a combinatorial V-gene library, or made by V gene synthesis.
  • Fv is formed by connecting the component V genes with an oligonucleotide that encodes an appropriately designed linker peptide, such as (Gly-Gly-Gly-Gly-Ser) 3 or equivalent linker peptide(s) .
  • the linker bridges the C-terminus of the first V region and N-terminus of the second, ordered as either V H -linker-V L or V L -linker-V H .
  • the scFv binding site can faithfully replicate both the affinity and specificity of its parent antibody combining site.
  • scFv fragments are comprised of V H and V L domains linked into a single polypeptide chain by a flexible linker peptide.
  • the scFv genes are assembled, they are cloned into a phagemid and expressed at the tip of the M13 phage (or similar filamentous bacteriophage) as fusion proteins with the bacteriophage pill (gene 3) coat protein. Enriching for phage expressing an antibody of interest is accomplished by panning the recombinant phage displaying a population scFv for binding to a predetermined epitope (e.g., target antigen, receptor).
  • a predetermined epitope e.g., target antigen, receptor
  • the linked polynucleotide of a library member provide ⁇ the basis for replication of the library member after a screening or selection procedure, and also provides the basis for the determination, by nucleotide sequencing, of the identity of the displayed peptide sequence or V H and V L amino acid sequence.
  • the displayed peptide(s) or single-chain antibody (e.g., scFv) and/or its V H and V L domains or their CDRs can be cloned and expres ⁇ ed in a ⁇ uitable expression system.
  • polynucleotides encoding the isolated V H and V L domains will be ligated to polynucleotides encoding constant regions (C H and C L ) to form polynucleotides encoding complete antibodies (e.g., chimeric or fully-human), antibody fragments, and the like.
  • polynucleotides encoding the isolated CDRs will be grafted into polynucleotides encoding a suitable variable region framework (and optionally constant regions) to form polynucleotides encoding complete antibodie ⁇ (e.g., humanized or fully-human), antibody fragments, and the like.
  • Antibodies can be u ⁇ ed to i ⁇ olate preparative quantitie ⁇ of the antigen by immunoaffinity chromatography.
  • Various other uses of such antibodies are to diagnose and/or stage disease (e.g., neoplasia) , and for therapeutic application to treat disease, such as for example: neoplasia, autoimmune disease, AIDS, cardiovascular disease, infections, and the like.
  • V H and V L cassettes can themselves be diversified, such as by random, pseudorandom, or directed mutagenesis.
  • V H and V L cassettes are diversified in or near the complementarity-determining regions (CDRs) , often the third CDR, CDR3.
  • Enzymatic inverse PCR mutagenesis has been shown to be a simple and reliable method for constructing relatively large libraries of scFv site-directed mutants (Stemmer et al. (1993) Biotechniques 14 : 256), a ⁇ has error-prone PCR and chemical mutagenesis (Deng et al. (1994) J. Biol. Chem. 269: 9533) .
  • Riechmann et al. (1993) Biochemistry 32: 8848 showed semirational de ⁇ ign of an antibody ⁇ cFv fragment using site- directed randomization by degenerate oligonucleotide PCR and sub ⁇ equent phage di ⁇ play of the resultant scFv mutants.
  • CDR randomization has the potential to create approximately 1 x 10 20 CDRs for the heavy chain CDR3 alone, and a roughly similar number of variants of the heavy chain CDR1 and CDR2, and light chain CDR1-3 variants.
  • the combinatorics of CDR randomization of heavy and/or light chains requires generating a prohibitive number of bacteriophage clones to produce a clone library representing all pos ⁇ ible combinations, the vast majority of which will be non- binding. Generation of such large numbers of primary transformants is not feasible with current transformation technology and bacteriophage display sy ⁇ te s. For example,
  • bacteriophage display of scFv has already yielded a variety of u ⁇ eful antibodies and antibody fusion proteins.
  • a bispecific single chain antibody has been shown to mediate efficient tumor cell lysis (Gruber et al. (1994) J. Immunol. 152: 5368) .
  • Intracellular expression of an anti-Rev scFv has been shown to inhibit HIV-l virus replication in vitro (Duan et al. (1994) Proc. Natl. Acad. Sci.
  • a second polypeptide such as a toxin or fibrinolytic activator protein
  • the in vitro and in vivo shuffling methods of the invention are used to recombine CDRs which have been obtained (typically via PCR amplification or cloning) from nucleic acids obtained from selected displayed antibodies.
  • Such displayed antibodies can be displayed on cells, on bacteriophage particles, on polysomes, or any suitable antibody display system wherein the antibody is as ⁇ ociated with it ⁇ encoding nucleic acid( ⁇ ) .
  • the CDR ⁇ are initially obtained from mRNA (or cDNA) from antibody-producing cell ⁇ (e.g., plasma cells/ ⁇ plenocyte ⁇ from an immunized wild-type mouse, a human, or a transgenic mouse capable of making a human antibody as in WO92/03918, W093/12227, and W094/25585) , including hybridomas derived therefrom.
  • antibody-producing cell ⁇ e.g., plasma cells/ ⁇ plenocyte ⁇ from an immunized wild-type mouse, a human, or a transgenic mouse capable of making a human antibody as in WO92/03918, W093/12227, and W094/25585
  • Polynucleotide sequences selected in a first selection round are pooled and the pool(s) is/are shuffled by in vitro and/or in vivo recombination, especially shuffling of CDRs (typically shuffling heavy chain CDRs with other heavy chain CDRs and light chain CDRs with other light chain CDRs) to produce a shuffled pool comprising a population of recombined selected polynucleotide sequences.
  • the recombined selected polynucleotide sequences are expressed in a selection format as a displayed antibody and subjected to at least one ⁇ ub ⁇ equent ⁇ election round.
  • the polynucleotide ⁇ equences selected in the sub ⁇ equent ⁇ election round( ⁇ ) can be used directly, sequenced, and/or subjected to one or more additional rounds of shuffling and subsequent selection until an antibody of the desired binding affinity is obtained.
  • Selected sequences can also be backcrossed with polynucleotide sequences encoding neutral antibody framework sequence ⁇ (i.e., having insubstantial functional effect on antigen binding) , such as for example by backcrossing with a human variable region framework to produce human-like sequence antibodies.
  • neutral antibody framework sequence ⁇ i.e., having insubstantial functional effect on antigen binding
  • the valency of the target epitope may be varied to control the average binding affinity of selected scFv library members.
  • the target epitope can be bound to a surface or substrate at varying densities, such as by including a competitor epitope, by dilution, or by other method known to those in the art.
  • a high density (valency) of predetermined epitope can be used to enrich for scFv library members which have relatively low affinity, whereas a low density (valency) can preferentially enrich for higher affinity scFv library members.
  • a collection of synthetic oligonucleotides encoding random, pseudorandom, or a defined sequence kernal set of peptide sequences can be inserted by ligation into a predetermined site (e.g., a CDR).
  • a predetermined site e.g., a CDR
  • the sequence diversity of one or more CDR ⁇ of the ⁇ ingle-chain antibody ca ⁇ sette( ⁇ ) can be expanded by mutating the CDR(s) with site-directed mutagenesis, CDR-replacement, and the like.
  • the resultant DNA molecules can be propagated in a ho ⁇ t for cloning and amplification prior to ⁇ huffling, or can be used directly (i.e., may avoid loss of diversity which may occur upon propagation in a host cell) and the selected library members subsequently shuffled.
  • Displayed peptide/polynucleotide complexes which encode a variable segment peptide sequence of interest or a single-chain antibody of interest are selected from the library by an affinity enrichment technique. This is accomplished by means of a immobilized macromolecule or epitope specific for the peptide sequence of interest, such as a receptor, other macromolecule, or other epitope species. Repeating the affinity ⁇ election procedure provide ⁇ an enrichment of library members encoding the desired sequences, which may then be isolated for pooling and shuffling, for sequencing, and/or for further propagation and affinity enrichment. The library members without the desired specificity are removed by washing.
  • the degree and stringency of washing required will be determined for each peptide sequence or single- chain antibody of interest and the immobilized predetermined macromolecule or epitope.
  • a certain degree of control can be exerted over the binding characteristics of the nascent peptide/DNA complexes recovered by adjusting the conditions of the binding incubation and the subsequent washing.
  • the temperature, pH, ionic strength, divalent cation ⁇ concentration, and the volume and duration of the wa ⁇ hing will select for nascent peptide/DNA complexes within particular ranges of affinity for the immobilized macromolecule. Selection based on slow dissociation rate, which is usually predictive of high affinity, is often the most practical route.
  • affinities of some peptides are dependent on ionic strength or cation concentration. This is a useful characteristic for peptides that will be used in affinity purification of various proteins when gentle conditions for removing the protein from the peptides are required.
  • One variation involves the use of multiple binding target ⁇ (multiple epitope species, multiple receptor species), such that a scFv library can be simultaneously screened for a multiplicity of scFv which have different binding specificities.
  • multiple binding target ⁇ multiple epitope species, multiple receptor species
  • a scFv library can be simultaneously screened for a multiplicity of scFv which have different binding specificities.
  • multiple target epitope species each encoded on a separate bead (or subset of beads)
  • a polysome-display scFv library under suitable binding conditions.
  • the collection of beads, comprising multiple epitope species can then be used to isolate, by affinity selection, scFv library members.
  • subsequent affinity screening rounds can include the same mixture of beads, subset ⁇ thereof, or beads containing only one or two individual epitope species. This approach affords efficient screening, and is compatible with laboratory automation, batch proce ⁇ sing, and high throughput screening methods.
  • a variety of techniques can be used in the present invention to diversify a peptide library or single-chain antibody library, or to diversify, prior to or concomitant with shuffling, around variable segment peptides or V H , V L , or CDRs found in early rounds of panning to have sufficient binding activity to the predetermined macromolecule or epitope.
  • the po ⁇ itive ⁇ elected peptide/polynucleotide complexes are sequenced to determine the identity of the active peptides.
  • Oligonucleotides are then synthe ⁇ ized based on these active peptide sequences, employing a low level of all bases incorporated at each step to produce slight variations of the primary oligonucleotide sequences. This mixture of (slightly) degenerate oligonucleotides is then cloned into the variable segment sequences at the appropriate locations. This method produces systematic, controlled variations of the starting peptide sequences, which can then be shuffled. It requires, however, that individual positive nascent peptide/polynucleotide complexes be sequenced before mutagenesis, and thus is useful for expanding the diversity of small numbers of recovered complexes and selecting variants having higher binding affinity and/or higher binding specificity.
  • mutagenic PCR amplification of positive selected peptide/polynucleotide complexes is done prior to sequencing.
  • the same general approach can be employed with single-chain antibodies in order to expand the diversity and enhance the binding affinity/specificity, typically by diversifying CDR ⁇ or adjacent framework region ⁇ prior to or concomitant with ⁇ huffling.
  • shuffling reactions can be spiked with mutagenic oligonucleotides capable of in vitro recombination with the selected library members.
  • mixtures of synthetic oligonucleotides and PCR fragments can be added to the in vitro shuffling mix and be incorporated into resulting shuffled library members (shufflants) .
  • the present invention of shuffling enables the generation of a vast library of CDR-variant single-chain antibodies.
  • One way to generate such antibodies is to insert synthetic CDRs into the single-chain antibody and/or CDR randomization prior to or concomitant with shuffling.
  • the sequences of the synthetic CDR cassettes are selected by referring to known sequence data of human CDR and are selected in the discretion of the practitioner according to the following guidelines: synthetic CDRs will have at least 40 percent positional sequence identity to known CDR sequences, and preferably will have at least 50 to 70 percent positional sequence identity to known CDR sequences.
  • a collection of ⁇ ynthetic CDR sequences can be generated by synthesizing a collection of oligonucleotide sequences on the basis of naturally-occurring human CDR sequences listed in Kabat et al. (1991) op.cit. ; the pool(s) of synthetic CDR sequences are calculated to encode CDR peptide sequences having at least 40 percent sequence identity to at least one known naturally- occurring human CDR sequence.
  • a collection of naturally-occurring CDR sequences may be compared to generate consen ⁇ us sequences so that amino acids used at a residue position frequently (i.e., in at least 5 percent of known CDR sequences) are incorporated into the synthetic CDRs at the corresponding position(s) .
  • oligonucleotide ⁇ encoding CDR peptide sequences encompassing all or most permutations of the observed natural sequence variations is synthesized.
  • a collection of human V H CDR sequence ⁇ have carboxy-terminal amino acids which are either Tyr, Val, Phe, or Asp, then the pool(s) of synthetic CDR oligonucleotide ⁇ equence ⁇ are de ⁇ igned to allow the carboxy-terminal CDR re ⁇ idue to be any of these amino acids.
  • residues other than those which naturally-occur at a residue position in the collection of CDR sequences are incorporated: conservative amino acid substitutions are frequently incorporated and up to 5 residue positions may be varied to incorporate non-conservative amino acid substitutions as compared to known naturally-occurring CDR sequences.
  • Such CDR sequence ⁇ can be used in primary library members (prior to first round screening) and/or can be used to spike m vitro ⁇ huffling reaction ⁇ of selected library member sequences. Construction of such pools of defined and/or degenerate sequence ⁇ will be readily accomplished by those of ordinary skill in the art.
  • the collection of synthetic CDR sequences comprises at least one member that is not known to be a naturally-occurring CDR sequence. It is within the discretion of the practitioner to include or not include a portion of random or pseudorandom sequence corresponding to N region addition in the heavy chain CDR; the N region sequence ranges from 1 nucleotide to about 4 nucleotides occurring at V-D and D-J junctions.
  • a collection of synthetic heavy chain CDR sequences comprises at least about 100 unique CDR ⁇ equences, typically at least about 1,000 unique CDR sequences, preferably at least about 10,000 unique CDR sequences, frequently more than 50,000 unique CDR sequences; however, usually not more than about 1 x IO 6 unique CDR sequences are included in the collection, although occasionally 1 x IO 7 to 1 x IO 8 unique CDR sequence ⁇ are present, especially if con ⁇ ervative amino acid substitutions are permitted at positions where the conservative amino acid substituent is not present or is rare (i.e., less than 0.1 percent) in that position in naturally-occurring human CDR ⁇ .
  • the number of unique CDR ⁇ equence ⁇ included in a library generally should not exceed the expected number of primary tran ⁇ formants in the library by more than a factor of 10.
  • Such single-chain antibodies generally bind to a predetermined antigen (e.g., the immunogen) with an affinity of about at least 1 x IO 7 M "1 , preferably with an affinity of about at least 5 x IO 7 M "1 , more preferably with an affinity of at least 1 x IO 8 M -1 to 1 x IO 9 M -1 or more, sometimes up to 1 x 10 10 M -1 or more.
  • the predetermined antigen is a human protein, such a ⁇ for example a human cell ⁇ urface antigen (e.g., CD4, CD8, IL-2 receptor, EGF receptor, PDGF receptor) , other human biological macromolecule (e.g., thrombomodulin, protein C, carbohydrate antigen, ⁇ ialyl Lewis antigen, L-selectin) , or nonhuman disease as ⁇ ociated macromolecule (e.g., bacterial LPS, virion cap ⁇ id protein or envelope glycoprotein) and the like.
  • a human cell ⁇ urface antigen e.g., CD4, CD8, IL-2 receptor, EGF receptor, PDGF receptor
  • other human biological macromolecule e.g., thrombomodulin, protein C, carbohydrate antigen, ⁇ ialyl Lewis antigen, L-selectin
  • nonhuman disease as ⁇ ociated macromolecule e.g., bacterial LPS, virion cap ⁇ id protein or envelope glycoprotein
  • High affinity single-chain antibodies of the desired specificity can be engineered and expressed in a variety of systems.
  • scFv have been produced in plants (Firek et al. (1993) Plant Mol. Biol. 23: 861) and can be readily made in prokaryotic ⁇ ystems (Owens RJ and Young RJ (1994) J. Immunol. Meth. 168: 149; John ⁇ on S and Bird RE (1991) Method ⁇ Enzymol. 203: 88) .
  • the single-chain antibodie ⁇ can be used as a basis for constructing whole antibodies or various fragments thereof (Kettleborough et al. (1994) Eur. J. Immunol. 24 : 952).
  • variable region encoding sequence may be isolated (e.g., by PCR amplification or subcloning) and spliced to a sequence encoding a desired human constant region to encode a human sequence antibody more suitable for human therapeutic uses where immunogenicity is preferably minimized.
  • the polynucleotide(s) having the resultant fully human encoding sequence( ⁇ ) can be expressed in a host cell (e.g., from an expression vector in a mammalian cell) and purified for pharmaceutical formulation.
  • the DNA expression constructs will typically include an expression control DNA sequence operably linked to the coding sequences, including naturally-associated or heterologous promoter regions.
  • the expression control sequences will be eukaryotic promoter sy ⁇ tems in vectors capable of transforming or transfecting eukaryotic host cells.
  • the DNA sequence ⁇ will be expressed in hosts after the sequences have been operably linked to an expression control sequence (i.e. , positioned to ensure the transcription and translation of the structural gene) .
  • expression control sequence i.e. , positioned to ensure the transcription and translation of the structural gene.
  • These expression vectors are typically replicable in the host organisms either as episome ⁇ or a ⁇ an integral part of the host chromosomal DNA.
  • expression vectors will contain selection markers, e.g.. tetracycline or neomycin, to permit detection of those cells transformed with the desired DNA sequences (see, e.g. , U.S. Patent 4,704,362, which is incorporated herein by reference) .
  • mammalian tis ⁇ ue cell culture may also be u ⁇ ed to produce the polypeptide ⁇ of the pre ⁇ ent invention (see, Winnacker, "From Genes to Clones," VCH Publisher ⁇ , N.Y., N.Y. (1987), which is incorporated herein by reference) .
  • Eukaryotic cell ⁇ are actually preferred, because a number of suitable host cell lines capable of secreting intact immunoglobulins have been developed in the art, and include the CHO cell lines, various COS cell lines, HeLa cells, myeloma cell lines, etc, but preferably transformed B- cell ⁇ or hybridoma ⁇ .
  • Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer (Queen et al. (1986) Immunol. Rev. 89: 49) , and necessary processing information site ⁇ , such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequence ⁇ .
  • Preferred expression control sequences are promoters derived from immunoglobulin genes, cytomegaloviru ⁇ , SV40, Adenovirus, Bovine Papilloma Viru ⁇ , and the like. Eukaryotic DNA transcription can be increased by inserting an enhancer sequence into the vector.
  • Enhancers are cis-acting sequence ⁇ of between 10 to 300bp that increa ⁇ e transcription by a promoter. Enhancers can effectively increase transcription when either 5' or 3' to the transcription unit. They are also effective if located within an intron or within the coding sequence itself. Typically, viral enhancers are used, including SV40 enhancers, cytomegalovirus enhancers, polyoma enhancers, and adenovirus enhancers. Enhancer sequences from mammalian system ⁇ are al ⁇ o commonly u ⁇ ed, such as the mouse immunoglobulin heavy chain enhancer.
  • Mammalian expression vector systems will also typically include a selectable marker gene.
  • suitable markers include, the dihydrofolate reductase gene (DHFR) , the thymidine kinase gene (TK) , or prokaryotic genes conferring drug resi ⁇ tance.
  • DHFR dihydrofolate reductase gene
  • TK thymidine kinase gene
  • prokaryotic genes conferring drug resi ⁇ tance.
  • the first two marker genes prefer the use of mutant cell lines that lack the ability to grow without the addition of thymidine to the growth medium. Transformed cells can then be identified by their ability to grow on non-supplemented media.
  • prokaryotic drug resi ⁇ tance gene ⁇ useful as markers include genes conferring resistance to G418, mycophenolic acid and hygromycin.
  • the vectors containing the DNA segment ⁇ of intere ⁇ t can be transferred into the host cell by well-known methods, depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment. lipofection, or electroporation may be used for other cellular host ⁇ . Other methods used to transform mammalian cell ⁇ include the use of Polybrene, protoplast fusion, liposomes, electroporation, and microinjection (see, generally, Sambrook et al., supra) .
  • the antibodies, individual mutated immunoglobulin chains, mutated antibody fragments, and other immunoglobulin polypeptide ⁇ of the invention can be purified according to standard procedures of the art, including ammonium sulfate precipitation, fraction column chromatography, gel electrophoresis and the like (see, generaliv. Scope ⁇ , R. , Protein Purification, Springer-Verlag, N.Y. (1982)) .
  • the polypeptides may then be used therapeutically or in developing and performing assay procedures, immunofluorescent stainings, and the like (see. generally, Immunological Methods. Vols. I and II, Ed ⁇ . Lefkovits and Pernis, Academic Press, New York, N.Y. (1979 and 1981)).
  • the antibodies generated by the method of the present invention can be used for diagnosis and therapy.
  • they can be used to treat cancer, autoimmune diseases, or viral infections.
  • the antibodies will typically bind to an antigen expressed preferentially on cancer cells, such a ⁇ erbB-2, CEA, CD33, and many other antigens and binding members well known to those skilled in the art.
  • Shuffling can also be used to recombinatorially diversify a pool of selected library members obtained by screening a two-hybrid screening system to identify library members which bind a predetermined polypeptide seguence.
  • the selected library members are pooled and ⁇ huffled by in vitro and/or in vivo recombination.
  • the shuffled pool can then be screened in a yeast two hybrid system to select library members which bind said predetermined polypeptide sequence (e.g. , and SH2 domain) or which bind an alternate predetermined polypeptide sequence (e.g., an SH2 domain from another protein specie ⁇ ) .
  • Polynucleotides encoding two hybrid proteins, one consisting of the yeast Gal4 DNA-binding domain fused to a polypeptide sequence of a known protein and the other consisting of the Gal4 activation domain fused to a polypeptide sequence of a second protein, are constructed and introduced into a yeast host cell. Intermolecular binding between the two fusion proteins reconstitutes the Gal4 DNA-binding domain with the Gal4 activation domain, which leads to the transcriptional activation of a reporter gene (e.g., lacZ, HIS3 ) which is operably linked to a Gal4 binding ⁇ ite.
  • a reporter gene e.g., lacZ, HIS3
  • the two-hybrid method i ⁇ u ⁇ ed to identify novel polypeptide ⁇ equence ⁇ which interact with a known protein
  • an E. coli/BCCP interactive screening sy ⁇ tem can be used to identify interacting protein sequences (i.e., protein sequence ⁇ which heterodimerize or form higher order heteromultimers) .
  • Sequences selected by a two- hybrid system can be pooled and shuffled and introduced into a two-hybrid system for one or more subsequent rounds of screening to identify polypeptide sequences which bind to the hybrid containing the predetermined binding sequence.
  • the sequences thus identified can be compared to identify consensus sequence(s) and con ⁇ ensus sequence kernals.
  • the improved shuffling method includes the addition of at least one additive which enhances the rate or extent of reannealing or recombination of related-sequence polynucleotides.
  • additives which increa ⁇ e hybrid stability of mismatched sequences can be used to enhance the frequency of generating substantially mutated library members (i.e., having a greater mutational density) .
  • modulation of the ionic strength e.g., Na + and/or K + ion concentration
  • increa ⁇ ed ⁇ alt concentration can increase the frequency of mismatched hybrids and contribute to formation of library members having multiple mutations.
  • the additive is polyethylene glycol (PEG) , typically added to a shuffling reaction to a final concentration of 0.1 to 25 percent, often to a final concentration of 2.5 to 15 percent, to a final concentration of about 10 percent.
  • the additive is dextran sulfate, typically added to a shuffling reaction to a final concentration of 0.1 to 25 percent, often at about 10 percent.
  • the additive is an agent which reduces sequence specificity of reannealing and promotes promiscuou ⁇ hybridization and/or recombination in vitro.
  • the additive is an agent which increases sequence specificity of reannealing and promotes high fidelity hybridization and/or recombination in vitro.
  • Other long-chain polymers which do not interfere with the reaction may also be used (e.g., polyvinylpyrrolidone, etc.) .
  • the improved shuffling method includes the addition of at least one additive which is a cationic detergent.
  • suitable cationic detergents include but are not limited to: cetyltrimethylammonium bromide (CTAB) , dodecyltrimethylammonium bromide (DTAB) , and tetramethy1ammonium chloride (TMAC) , and the like.
  • CTAB cetyltrimethylammonium bromide
  • DTAB dodecyltrimethylammonium bromide
  • TMAC tetramethy1ammonium chloride
  • the improved shuffling method includes the addition of at least one additive which is a recombinogenic protein that catalzyes or non-catalytically enhances homologous pairing and/or strand exchange in vitro. Examples of suitable recombinogenic proteins include but are not limited to: E .
  • coli recA protein the T4 uvsX protein, the reel protein from Ustilago maydis, other recA family recombinases from other species, single strand binding protein (SSB) , ribonucleoprotein Al, and the like. Nucleases and proofreading polymerases are often included to improve the maintenance of 3' end integrity.
  • SSB single strand binding protein
  • Nucleases and proofreading polymerases are often included to improve the maintenance of 3' end integrity.
  • Each of these protein additives can themselve ⁇ be improved by multiple round ⁇ of recursive sequence recombination and selection and/or screening.
  • the invention embraces such improved additives and their use to further enhance shuffling.
  • Recombinases are proteins that, when included with an exogenous targeting polynucleotide, provide a measurable increase in the recombination frequency and/or localization frequency between the targeting polynucleotide and an endogenous predetermined DNA sequence.
  • recombinase refers to a family of RecA-like recombination proteins all having essentially all or most of the same functions, particularly: (i) the recombinase protein's ability to properly bind to and position targeting polynucleotides on their homologous targets and (ii) the ability of recombinase protein/targeting polynucleotide complexes to efficiently find and bind to complementary endogenous sequence ⁇ .
  • recA803 The best characterized recA protein is from E. coli , in addition to the wild-type protein a number of mutant recA-like proteins have been identified (e.g., recA803) . Further, many organisms have recA- like recombinases with strand-transfer activities (e.g. , Fugisawa et al., (1985) Nucl. Acids Res. 13: 7473; Hsieh et al., (1986) Cell 44: 885; Hsieh et al., (1989) J. Biol. Chem. 264: 5089; Fi ⁇ hel et al., (1988) Proc. Natl. Acad. Sci.
  • RecA may be purified from E . coli strains, such as E . coli strains JC12772 and JC15369 (available from A.J. Clark and M. Madiraju, University of California-Berkeley) .
  • the recA803 protein is a high- activity mutant of wild-type recA.
  • the art teaches several examples of recombinase proteins, for example, from Drosophila, yeast, plant, human, and non-human mammalian cells, including protein ⁇ with biological propertie ⁇ ⁇ imilar to recA (i.e., recA- like recombinases) .
  • RecA protein is typically obtained from bacterial strains that overproduce the protein: wild-type E. coli recA protein and mutant recA803 protein may be purified from such strain ⁇ .
  • recA protein can also be purcha ⁇ ed from, for example, Pharmacia (Piscataway, NJ) .
  • RecA protein forms a nucleoprotein filament when it coats a single- ⁇ tranded DNA.
  • this nucleoprotein filament one monomer of recA protein is bound to about 3 nucleotides.
  • This property of recA to coat single-stranded DNA is essentially sequence independent, although particular sequences favor initial loading of recA onto a polynucleotide (e.g., nucleation sequences) .
  • the nucleoprotein filament(s) can be formed on essentially any sequence-related polypeptide to be suffled and can be formed in cells (e.g., bacterial, yeast, or mammalian cells) , forming complexes with both single-stranded and double- stranded DNA.
  • Site-specific recombination can be used to accomplish recursive sequence recombination.
  • sequences to be shuffled are flanked by one or more ⁇ ite- ⁇ pecific recombination ⁇ equences, such as for example a FLP recombination target site (FRT) often consisting of the two inverted 13 base repeats and an 8 bp spacer (O'Gorman et al. (1991) Science 251: 1351; Par ⁇ ons et al. (1990) J. Biol. Chem. 265: 4527; Amin et al. (1991) Mol. Cell. Biol. 11: 4497, incorporated herein by reference) .
  • FLP recombination target site often consisting of the two inverted 13 base repeats and an 8 bp spacer
  • the FLP recombinase is typically also employed, either in vitro or expressed in a host cell wherein the sequences to be recombined are introduced or are already present.
  • Alternatives to the FLP/FRT ⁇ ystem include, but are not limited to, the cre/lox sy ⁇ tem of phage Pl (Hoe ⁇ and Abrem ⁇ ki (1985) J. Mol. Biol. 181: 351), the y/ ⁇ re ⁇ olvase (Steitz et al. (1990) Quarterly Rev. Biophys. 23: 205) , the attB/attP system of ⁇ (Nunes-Duby et al.
  • the improved shuffling method includes the addition of at least one additive which is an enzyme having an exonuclease activity which is active at removing non-templated nucleotides introduced at 3 ' ends of product polynucleotides in shuffling amplification reactions catalyzed by a non-proofreading polymerase.
  • an enzyme having an exonuclease activity includes but is not limited to Pfu polymerase.
  • exonucleases are:
  • the improved shuffling method comprises the modification wherein at least one cycle of amplification (i.e., extension with a polymerase) of reannealed fragmented library member polynucleotide ⁇ i ⁇ conducted under condition ⁇ which produce a substantial fraction, typically at least 20 percent or more, of incompletely extended amplification products.
  • the amplification products, including the incompletely extended amplification products are denatured and subjected to at least one additional cycle of reannealing and amplification.
  • the improved shuffling method comprises the modification wherein at least one cycle of amplification is conducted using a collection of overlapping single-stranded DNA fragments of varying lengths corresponding to a first polynucleotide species or set of related-sequence polynucleotide ⁇ pecie ⁇ , wherein each overlapping fragment can each hybridize to and prime polynucleotide chain exten ⁇ ion from a ⁇ econd polynucleotide ⁇ pecie ⁇ serving a ⁇ a template, thus forming sequence-recombined polynucleotides, wherein said sequence- recombined polynucleotides comprise a portion of at least one first polynucleotide species with an adjacent portion of the second polynucleotide species which serves as a template.
  • the second polynucleotide specie ⁇ ⁇ erving a ⁇ a template contain ⁇ uracil (i.e., a Kunkel-type template) and i ⁇ substantially non-replicable in cells.
  • This aspect of the invention can also comprise at least two recursive cycles of this variation.
  • recursive cycles of shuffling using the method of Levitchkin et al. (1995) Mol. Biol. 29: 572, which produces partial extension PCR fragments is used to generate chimeras from a pool of parental sequences which are recursively shuffled.
  • the improved shuffling method comprise ⁇ the modification wherein at lea ⁇ t one cycle of amplification is conducted with an additive or polymerase in suitable conditions which promote template switching.
  • an additive or polymerase in suitable conditions which promote template switching.
  • addition of recA or other polymerase ⁇ enhances template switching.
  • Template- switching can also be increased by increasing the DNA template concentration, among other means known by those skilled in the art.
  • librarie ⁇ of ⁇ equence-recombined polynucleotides are generated from sequence- related polynucleotides which are naturally-occurring gene ⁇ or allele ⁇ of a gene.
  • thi ⁇ a ⁇ pect at lea ⁇ t three naturally- occurring gene ⁇ and/or allele ⁇ which compri ⁇ e region ⁇ of at lea ⁇ t 50 consecutive nucleotides which have at least 70 percent sequence identity, prefereably at least 90 percent sequence identity, are selected from a pool of gene seguence ⁇ , such as by hybrid selection or via computerized sequence analysis using sequence data from a database.
  • the selected sequences are obtained as polynucleotides, either by cloning or via DNA synthesis, and shuffled by any of the various embodiments of the invention.
  • the method comprises the further step of removing non-shuffled products (e.g., parental sequences) from sequence-recombined polynucleotides produced by any of the disclo ⁇ ed shuffling methods.
  • Non-shuffled product ⁇ can be removed or avoided by performing amplification with: (1) a first PCR primer which hybridizes to a fir ⁇ t parental polynucleotide species but does not sub ⁇ tantially hybridize to a ⁇ econd parental polynucleotide species, and (2) a second PCR primer which hybridize ⁇ to a second parental polynucleotide species but does not sub ⁇ tantially hybridize to the first parental polynucleotide species, such that amplification occurs on from templates comprising the portion of the first parental sequence which hybridizes to the first PCR primer and also comprising the portion of the second parental ⁇ equence which hybridize ⁇ to the ⁇ econd PCR primer, thus only sequence-recombined polynucleotides are amplified.
  • bridging genes can be synthesized. If two or more parental polynucelotides (e.g., genes) lack satisfactory sequence similarity for efficient homologous recombination or for efficient cross-priming for PCR amplification, intermediate (or "bridging") genes can be synthe ⁇ ized which share sufficient sequence identity with the parental sequences.
  • the bridging gene need not be active or confer a phenotype or selectable property, it need only provide a template having sufficient sequence identity to accomplish shuffling of the parental sequences.
  • the intermediate homology of the bridging gene, and the necessary sequence(s) can be determined by computer or manually.
  • the invention also provides additional formats for performing recursive recombination in vivo, either in procaryotic or eucaryotic cells.
  • the ⁇ e formats include recombination between plasmids, recombination between viruse ⁇ , recombination between plasmid and virus, recombination between a chromosome and plasmid or virus and intramolecular recombination (e.g., between two sequence ⁇ on a plasmid) .
  • Recursive recombination can be performed entirely in vivo whereby successive rounds of in vivo recombination are interspersed by rounds of selection or screening.
  • In vivo formats can also be used in combination with in vitro formats.
  • the various in vivo formats are now considered in turn.
  • the initial substrate ⁇ for recombination are a collection of polynucleotides comprising variant forms of a gene.
  • the variant forms usually show sub ⁇ tantial ⁇ equence identity to each other sufficient to allow homologous recombination between substrates.
  • the diversity between the polynucleotides can be natural (e.g., allelic or species variants) , induced (e.g., error-prone PCR, synthetic genes, codon-usage altered sequence variants) , or the result of in vitro recombination.
  • the diverse substrates are incorporated into plasmids.
  • the plasmids are often standard cloning vectors, e.g. , bacterial multicopy plasmids.
  • the plasmids include MOB functions.
  • the substrates can be incorporated into the same or different plasmids. Often at least two different types of plasmid having different types of selection marker are used to allow selection for cells containing at least two types of vector.
  • the different plasmids can come from two distinct incompatibility groups to allow stable co-existence of two different plasmids within the cell. Nevertheless, plasmid ⁇ from the same incompatibility group can still co-exist within the same cell for sufficient time to allow homologous recombination to occur.
  • Plasmids containing diverse substrate ⁇ are initially introduced into cells by any transfection methods (e.g. , chemical transformation, naturalcompetence, transduction, electroporation or biolistics) . Often, the plasmids are present at or near saturating concentration (with respect to maximum transfection capacity) to increase the probability of more than one plasmid entering the same cell.
  • the plasmid ⁇ containing the variou ⁇ substrate ⁇ can be tran ⁇ fected ⁇ imultaneously or in multiple rounds. For example, in the latter approach cells can be transfected with a first aliquot of plasmid, tran ⁇ fectant ⁇ selected and propagated, and then infected with a second aliquot of plasmid.
  • recombination between sub ⁇ trates to generate recombinant genes occurs within cells containing multiple different plasmids merely by propagating the cells.
  • cell ⁇ that receive only one pla ⁇ mid are le ⁇ able to participate in recombination and the potential contribution of ⁇ ubstrates on such plasmids to evolution is wasted.
  • the rate of evolution can be increased by allowing all substrates to participate in recombination. Such can be achieved by subjecting transfected cells to electroporation.
  • the conditions for electroporation are the same as those conventionally used for introducing exogenous DNA into cells (e.g., 1,000-2,500 volts, 400 ⁇ F and a 1-2 mM gap).
  • plasmids are exchanged between cells allowing all substrates to participate in recombination.
  • the products of recombination can undergo further round ⁇ of recombination with each other or with the original ⁇ ubstrate.
  • the rate of evolution can also be increased by use of conjugative transfer.
  • sub ⁇ trates can be cloned into plasmids having MOB genes and tra genes are also provided in cis or in trans to the MOB genes.
  • conjugative tran ⁇ fer i ⁇ very similar to electroporation in that it allow ⁇ pla ⁇ mid ⁇ to move between cells and allows recombination between any sub ⁇ trate, and the product ⁇ of previous recombination to occur merely by propagating the culture.
  • the details of how conjugative transfer is exploited in these vectors are discu ⁇ sed in more detail below.
  • the rate of evolution can also be increased by use of mutator host cells (e.g., Mut L, S, D, T, H; human ataxia telengiectasia cells) .
  • the time for which cells are propagated and recombination is allowed to occur varies with the cell type but i ⁇ generally not critical, becau ⁇ e even a ⁇ mall degree of recombination can ⁇ ubstantially increase diversity relative to the starting materials.
  • Cells bearing plasmids containing recombined genes are subject to ⁇ creening or selection for a desired function. For example, if the sub ⁇ trate being evolved contains a drug re ⁇ i ⁇ tance gene, one would ⁇ elect for drug re ⁇ istance.
  • Cells surviving ⁇ creening or ⁇ election can be subjected to one or more rounds of screening/ ⁇ election followed by recombination or can be subjected directly to an additional round of recombination.
  • the next round of recombination can be achieved by several different formats independently of the previous round.
  • a further round of recombination can be effected simply by resuming the electroporation or conjugation-mediated intercellular transfer of plasmids described above.
  • a fresh sub ⁇ trate or ⁇ ub ⁇ trates can be transfected into cells surviving selection/screening.
  • the new substrates are included in plasmid vector ⁇ bearing a different ⁇ elective marker and/or from a different incompatibility group than the original plasmids.
  • cells ⁇ urviving ⁇ election/ ⁇ creening can be subdivided into two subpopulations, plasmid DNA extracted from one subpopulation and tran ⁇ fected into the other, where the sub ⁇ trates from the plasmids from the two subpopulations undergo a further round of recombination.
  • the rate of evolution can be increased by employing electroporation, conjugation or mutator cells, a ⁇ described above.
  • DNA from cells surviving screening/selection can be extracted and subjected to in vitro DNA shuffling.
  • a second round of ⁇ creening/ ⁇ election i ⁇ performed, preferably under condition ⁇ of increased stringency. If desired, further rounds of recombination and selection/screening can be performed using the same strategy as for the second round. With succe ⁇ ive round ⁇ of recombination and selection/screening, the surviving recombined sub ⁇ trates evolve toward acquisition of a desired phenotype.
  • the final product of recombination that has acquired the desired phenotype differs from starting substrates at 0.1%-25% of positions and has evolved at a rate orders of magnitude in excess (e.g., by at least 10-fold, 100- fold, 1000-fold, or 10,000 fold) of the rate of naturally acquired mutation of about 1 mutation per 10 ⁇ 9 position ⁇ per generation (see Ander ⁇ on & Hughe ⁇ , Proc . Natl . Acad . Sci . USA 93, 906-907 (1996)).
  • Fig. 26 shows an exemplary scheme of pla ⁇ mid-pla ⁇ mid recombination.
  • Panel A of the figure ⁇ how ⁇ a library of variant genes cloned into a plasmid. The library is then introduced into cells. Some cells take up a single plasmid and other cell ⁇ take up two plasmids as ⁇ hown in panel B. For cell ⁇ having taken up two pla ⁇ mid ⁇ , the pla ⁇ mids recombine to give the products ⁇ hown in panel C. Plasmids can then be transferred between cells by electroporation or conjugation as shown in panel D, and further recombination can occur to give the products shown in panel E.
  • Virus-Plasmid Recombination The strategy used for plasmid-plasmid recombination can also be used for virus-pla ⁇ mid recombination; u ⁇ ually, phage-pla ⁇ mid recombination. However, ⁇ ome additional comments particular to the use of viruse ⁇ are appropriate.
  • the initial ⁇ ubstrate ⁇ for recombination are cloned into both plasmid and viral vectors. It is usually not critical which substrate(s) are inserted into the viral vector and which into the plasmid, although usually the viral vector should contain different substrate(s) from the plasmid. As before, the plasmid typically contains a ⁇ elective marker.
  • the plasmid and viral vectors can both be introduced into cells by tran ⁇ fection as described above. However, a more efficient procedure i ⁇ to tran ⁇ fect the cells with plasmid, ⁇ elect tran ⁇ fectants and infect the tran ⁇ fectant ⁇ with virus. Because the efficiency of infection of many viruse ⁇ approache ⁇ 100% of cell ⁇ , mo ⁇ t cell ⁇ transfected and infected by this route contain both a plasmid and virus bearing different substrate ⁇ .
  • Homologou ⁇ recombination occurs between plasmid and virus generating both recombined plasmid ⁇ and recombined viru ⁇ .
  • ⁇ ome viru ⁇ e ⁇ ⁇ uch as filamentous phage, in which intracellular DNA exists in both double-stranded and single-stranded forms, both can participate in recombination.
  • recombination can be augmented by use of electroporation or conjugation to transfer plasmids between cells.
  • Recombination can also be augmented for some types of virus by allowing the progeny virus from one cell to reinfect other cells.
  • virus infected-cells show resistance to superinfection. However, such resistance can be overcome by infecting at high multiplicity and/or using mutant strain ⁇ of the viru ⁇ in which resistance to superinfection is reduced.
  • viruses such as filamentous phage, stably exist with a plasmid in the cell and also extrude progeny phage from the cell.
  • cells containing recombinant plasmids and virus can be screened/selected using the same approach as for plasmid-pla ⁇ mid recombination.
  • Progeny virus extruded by cells surviving selection/ ⁇ creening can also be collected and u ⁇ ed a ⁇ ⁇ ub ⁇ trates in sub ⁇ equent rounds of recombination.
  • recombinant genes resulting from recombination reside only in the progeny virus.
  • the recombinant genes should be transferred from the progeny virus to another vector, e.g., a pla ⁇ id vector, and retran ⁇ fected into cells before selection/ ⁇ creening is performed.
  • a pla ⁇ id vector e.g., a pla ⁇ id vector
  • the products of recombination are present in both cells surviving recombination and in phage extruded from the ⁇ e cells.
  • the dual source of recombinant products provides some additional options relative to the plasmid-plasmid recombination. For example, DNA can be isolated from phage particles for use in a round of in vitro recombination.
  • the progeny phage can be u ⁇ ed to transfect or infect cells surviving a previous round of screening/selection, or fresh cells transfected with fresh substrates for recombination.
  • the invention employs recombination between multiple single- ⁇ tranded specie ⁇ , such as single-stranded bacteriophages and/or phagemids.
  • Fig. 27 illu ⁇ trate ⁇ a scheme for virus-plasmid recombination.
  • Panel A shows a library of variant forms of gene cloned into plasmid and viral vector ⁇ .
  • the pla ⁇ mids are then introduced into cell ⁇ as shown in panel B.
  • the viral genomes are packaged in vitro and used to infect the cells in panel B.
  • the viral genomes can undergo replication within the cell, a ⁇ ⁇ hown in panel C.
  • the viral genome ⁇ undergo recombination with plasmid genomes generating the pla ⁇ mid and viral form ⁇ shown in panel D. Both plasmid ⁇ and viral genome ⁇ can undergo further rounds of replication and recombination generating the structures shown in panels E and F.
  • Screening/selection identifie ⁇ cells containing plasmid and/or viral genome ⁇ having gene ⁇ that have evolved be ⁇ t to allow ⁇ urvival of the cell in the screening/selection proce ⁇ , as ⁇ hown in panel G. These viral genomes are also present in viruses extruded by such cells.
  • the principle ⁇ described for plasmid-pla ⁇ mid and plasmid- viral recombination can be applied to virus-viru ⁇ recombination with a few modifications.
  • the initial sub ⁇ trate ⁇ for recombination are cloned into a viral vector.
  • the same vector is used for all substrates.
  • viral genomes are usually packaged in vitro .
  • the packaged viruses are u ⁇ ed to infect cells at high multiplicity such that there is a high probability that a cell will receive multiple viruses bearing different sub ⁇ trates.
  • ⁇ teps depend on the nature of infection as discussed in the previous section. For example, if the viruses have phagemid genomes such as lambda cosmids or M13, Fl or Fd phagemids, the phagemids behave as plasmid ⁇ within the cell and undergo recombination ⁇ i ply by propagating the cell ⁇ . Recombination is particularly efficient between single- ⁇ tranded forms of intracellular DNA. Recombination can be augmented by electroporation of cells.
  • cosmids containing recombinant genes can be recovered from surviving cells (e.g., by heat induction of a cos " lysogenic host cell) , repackaged in vitro , and used to infect fresh cells at high multiplicity for a further round of recombination.
  • viru ⁇ e ⁇ are filamentou ⁇ phage
  • recombination of replicating form DNA occur ⁇ by propagating the culture of infected cell ⁇ .
  • Selection/ ⁇ creening identifie ⁇ colonie ⁇ of cells containing viral vectors having recombinant genes with improved properties, together with phage extruded from such cells.
  • Subsequent options are essentially the same as for plasmid-viral recombination.
  • Fig. 28 show ⁇ an example of virus-viru ⁇ recombination.
  • a library of diverse genes is cloned into a lambda cosmid.
  • the recombinant cosmid DNA is packaged in vitro and used to infect host cells at high multiplicitity such that many cosmid ⁇ bearing different inserts enter the same cell.
  • the cell cho ⁇ en i ⁇ a cos " lambda lysogen, which on induction, packages cosmid DNA without packaging lysogenic DNA. Cosmids recombine within the cell. Recombination can be accelerated by the use of host cells that are MutD, MutS, MutL and/or express a modified recA. Induction of the lysogen results in release of packaged recombinant cosmids, having greater diversity than the starting materials.
  • Thi ⁇ format can be u ⁇ ed to evolve both the chromosomal and plasmid-borne substrates.
  • the format is particularly useful in situation ⁇ in which many chromo ⁇ omal gene ⁇ contribute to a phenotype or one does not know the exact location of the chromosomal gene(s) to be evolved.
  • the initial substrates for recombination are cloned into a plasmid vector. If the chromosomal gene(s) to be evolved are known, the substrate ⁇ con ⁇ titute a family of sequences showing a high degree of sequence identity but ⁇ ome divergence from the chromo ⁇ omal gene.
  • the initial substrates usually constitute a library of DNA ⁇ egment ⁇ of which only a small number show sequence identity to the gene or gene(s) to be evolved. Divergence between plasmid-borne substrate and the chromosomal gene(s) can be induced by mutagenesis or by obtaining the plasmid-borne substrates from a different species than that of the cells bearing the chromo ⁇ ome.
  • the pla ⁇ mid ⁇ bearing sub ⁇ trate ⁇ for recombination are tran ⁇ fected into cells having chromosomal gene(s) to be evolved. Evolution can occur simply by propagating the culture, and can be accelerated by transferring plasmid ⁇ between cell ⁇ by conjugation or electroporation. Evolution can be further accelerated by use of mutator host cells or by seeding a culture of nonmutator host cells being evolved with mutator host cells and inducing intercellular transfer of plas id ⁇ by electroporation or conjugation.
  • mutator ho ⁇ t cells used for seeding contain a negative ⁇ election marker to facilitate i ⁇ olation of a pure culture of the nonmutator cell ⁇ being evolved. Selection/ ⁇ creening identifie ⁇ cell ⁇ bearing chromo ⁇ ome ⁇ and/or pla ⁇ mids that have evolved toward acqui ⁇ ition of a desired function.
  • plasmid-plasmid recombination proceeds in similar fashion to those described for plasmid-plasmid recombination.
  • further recombination can be effected by propagating cells surviving recombination in combination with electroporation or conjugative transfer of plasmid ⁇ .
  • plasmids bearing additional sub ⁇ trates for recombination can be introduced into the ⁇ urviving cells.
  • such plasmids are from a different incompatibility group and bear a different selective marker than the original plasmids to allow selection for cells containing at least two different plasmids.
  • plasmid and/or chromosomal DNA can be isolated from a subpopulation of surviving cells and transfected into a second subpopulation. Chromosomal DNA can be cloned into a plasmid vector before transfection.
  • Fig. 29 illu ⁇ trate ⁇ a ⁇ cheme for plasmid-chromosome shuffling.
  • Panel A shows variant forms of a gene cloned into a plasmid vector.
  • the plasmids are introduced into cells as shown in panel B.
  • the plasmid ⁇ replicate and undergo recombination with a chromosomal copy of the gene, as shown in panel C.
  • Exchange of plasmids between cells can be effected by electroporation or conjugation as shown in panel D.
  • the chromosomal genes in the two cells shown in panel D have evolved to different variant forms. Screening/selection identifies the cell bearing the chromosomal gene that has evolved that has acquired a desired property that allows the cell to survive screening/ ⁇ election, as shown in panel E.
  • the virus is u ⁇ ually one that doe ⁇ not kill the cell ⁇ , and is often a phage or phagemid.
  • the procedure is sub ⁇ tantially the ⁇ a e a ⁇ for plasmid-chromosome recombination.
  • Substrate ⁇ for recombination are cloned into the vector.
  • Vector ⁇ including the ⁇ ubstrates can then be transfected into cells or in vitro packaged and introduced into cells by infection. Viral genomes recombine with host chromosomes merely by propagating a culture.
  • Evolution can be accelerated by allowing intercellular transfer of viral genomes by electroporation, or reinfection of cells by progeny virions. Screening/selection identifies cells having chromosomes and/or viral genomes that have evolved toward acquisition of a desired function.
  • viral genomes can be transferred between cells surviving selection/recombination by electroporation.
  • viru ⁇ e ⁇ extruded from cells ⁇ urviving ⁇ election/ ⁇ creening can be pooled and u ⁇ ed to ⁇ uperinfect the cell ⁇ at high multiplicity.
  • fresh sub ⁇ trates for recombination can be introduced into the cells, either on plasmid or viral vector ⁇ .
  • DNA can be accelerated by allowing transfer of pla ⁇ mids between cells by conjugation.
  • Conjugation is the transfer of DNA occurring during contact between cells. See Guiney (1993) in: Bacterial Conjugation (Clewell, ed., Plenum Pre ⁇ , New York) , pp. 75-104; Reimmann & Haa ⁇ in Bacterial Conjugation (Clewell, ed. , Plenum Press, New York 1993) , at pp.137-188 (incorporated by reference in their entirety for all purposes) . Conjugation occurs between many types of gram negative bacteria, and some types of gram positive bacteria.
  • Conjugative transfer is also known between bacteria and plant cells (Agrobacterium tumefaciens) or yea ⁇ t. As di ⁇ cussed in copending application attorney docket no. 16528J- 014612, the gene ⁇ responsible for conjugative transfer can themselves be evolved to expand the range of cell types (e.g., from bacteria to mammals) between which such transfer can occur. Conjugative transfer is effected by an origin of transfer (oriT) and flanking genes (MOB A, B and C) , and 15-25 genes, termed tra, encoding the structures and enzyme ⁇ nece ⁇ sary for conjugation to occur. The transfer origin is defined as the site required in ci ⁇ for DNA tran ⁇ fer.
  • oriT origin of transfer
  • MOB A, B and C flanking genes
  • Tra gene ⁇ include tra A, B, C, D, E, F, G, H, I, J, K, L, M, N, P, Q, R, S, T, U, V, W, X, Y, Z, vir AB (allele ⁇ 1-11), C, D, E, G, IHF, and FinOP.
  • OriT i ⁇ ⁇ ometime ⁇ also designated as a tra gene.
  • Other cellular enzymes including those of the RecBCD pathway, RecA, SSB protein, DNA gyrase, DNA poll, and DNA ligase, are also involved in conjugative tran ⁇ fer. RecE or recF pathway ⁇ can sub ⁇ titute for RecBCD.
  • the tra genes and MOB genes can be expressed in cis or trans to oriT.
  • Vectors undergoing conjugation also have an origin of replication which is classified as belonging to an incompatibility group such as Ine A, B, C, D, E, F (I-VI) , H (I, Y) , i (1, 2, 5, ALPHA), J, K, L, M, N, P (ALPHA, BETA, 1 ALPHA, 3, 7, 10, 13) Q, R (HI, H2, H3) S, T, U, W, X, Z.
  • an incompatibility group such as Ine A, B, C, D, E, F (I-VI) , H (I, Y) , i (1, 2, 5, ALPHA), J, K, L, M, N, P (ALPHA, BETA, 1 ALPHA, 3, 7, 10, 13) Q, R (HI, H2, H3) S, T, U, W, X, Z.
  • One structural protein encoded by a tra gene is the ⁇ ex pilu ⁇ , a filament con ⁇ tructed of an aggregate of a ⁇ ingle polypeptide protruding from the cell ⁇ urface.
  • the ⁇ ex pilus binds to a polysaccharide on recipient cells and forms a conjugative bridge through which DNA can transfer.
  • This proces ⁇ activates a ⁇ ite- ⁇ pecific nuclea ⁇ e encoded by a MOB gene, which ⁇ pecifically cleave ⁇ DNA to be transferred at oriT.
  • the cleaved DNA is then threaded through the conjugation bridge by the action of other tra enzymes. DNA is tran ⁇ ferred more efficiently between cells when present as a component of the mobilizable vector.
  • mobilizable vector ⁇ integrate into the ho ⁇ t chromo ⁇ ome and thereby mobilize adjacent gene ⁇ from the chromosome.
  • the F plasmid of E. coli for example, integrates into the chromosome at high frequency and mobilizes genes unidirectional from the site of integration.
  • Other mobilizable vectors do not spontaneou ⁇ ly integrate into a host chromosome at high efficiency but can be induced to do by growth under particular conditions (e.g., treatment with a mutagenic agent, growth at a nonpermissive temperature for plasmid replication) . See Reimann & Haas in Bacterial Conjugation (ed. Clewell, Plenum Press, NY 1993) , Ch. 6.
  • Conjugation provides a means of recombining gene(s) in vivo to generate diverse recombinant forms of the gene(s) .
  • iterative cycles of recombination and selection/ ⁇ creening can be used to evolve the gene(s) toward acquisition of a new or improved property.
  • the first step is to generate a library of diverse forms of the gene or genes to be evolved.
  • the diverse forms can be the result of natural diversity, the application of traditional mutagenesis methods (e.g., error-prone PCR or cas ⁇ ette mutagenesis) or the result of any of the other recombination formats discussed in this application, or any combination of these.
  • the number of diverse forms can vary widely from about 10 to 100, 10 4 , IO 6 , IO 8 or 10 10 .
  • the gene(s) of interest are mutagenized as discrete units.
  • initial diversity can be generated by in situ mutagenesis of a chromosome containing the gene(s) .
  • the library of diverse forms of a gene or gene(s) is introduced into cells containing the apparatus necessary for conjugative transfer (assuming that the library i ⁇ not already contained in ⁇ uch cell ⁇ ) , usually in an arrangement such that the genes can be expressed.
  • the gene(s) are mutagenized in the absence of essential regulatory seguence ⁇ ⁇ uch as promoter, these sequence ⁇ are reattached before introduction into cell ⁇ .
  • the mutagene ⁇ i ⁇ product ⁇ are usually reas ⁇ ociated with unchanged flanking sequences before being introduced into cells.
  • the apparatus necessary for conjugative transfer comprises a vector having an origin of transfer together with the mob and tra genes whose expres ⁇ ion i ⁇ necessary for conjugative transfer to occur. These genes can be included in the vector, in one or more different vectors, or in the chromosome.
  • the library of diverse forms of the gene to be evolved is usually inserted into the vector containing the origin of transfer (see Fig. 30) . However, in some situations the library of diverse forms of the gene can be present in the chromosome or a second vector, as well as, or instead of in the vector containing the origin of transfer.
  • the library of diverse forms can be inserted in different places in different cells.
  • a vector bearing a library of variant forms contains at least one origin of replication. If transfer between different cell types is contemplated, the vector can contain two origins of replication, one functional in each cell type (i.e., a shuttle vector) . Alternatively, if it is intended that transferred genes should integrate into the chromosome of recipient cells, it is preferable that the vector not contain an origin of replication functional in the recipient cells (i.e., a suicide vector) .
  • the oriT site and/or MOB genes can be introduced into a vector by cloning or transposing the RK2/RP4 MOB function (Guiney, J . Mol . Biol . 162, 699-703 (1982)), or by cointegrate formation with a MOB-containing plasmid.
  • 'Tn5-Mob' which is the Tn5 transpo ⁇ on containing the oriT of RP4.
  • pUC-like mobilizable vectors pK18 and pK19 are suitable starting vectors for cloning the tra gene library to be evolved.
  • recombination i ⁇ ⁇ ometime ⁇ facilitated by in ⁇ erting the diverse gene library into two different kinds of vectors having different incompatibility origins.
  • Each vector should have an oriT and the cell should expres ⁇ MOB and tra function ⁇ ⁇ uitable for mobilization of both vectors.
  • Use of two such kinds of vectors allows stable coexistence of multiple vectors within the same cell and increase ⁇ the efficiency of recombination between the vector ⁇ .
  • the collection of cells is propagated in any suitable media to allow gene expression to occur. Tra and mob genes are expre ⁇ ed and mediate tran ⁇ fer of the mobilizable vector between cells. If the diverse library is cloned into a mobilizable vector, its members are transferred as component ⁇ of the vector.
  • the diver ⁇ e library, or certain element ⁇ of the library are in tran ⁇ to the mobilizable vector, they are tran ⁇ ferred only if the mobilizable vector integrate ⁇ into or proximate to the elements.
  • a ⁇ di ⁇ cu ⁇ sed above integration frequently occurs spontaneously for the E. coli F plasmid and can be induced for other mobilizable vectors.
  • ⁇ ome of the cells come to contain more than one member of the diverse library. The multiple members undergo recombination within such cells generating still further diversity in a library of recombinant forms. In general, the longer cells are propagated the more recombinant forms are generated.
  • recombination results in more than one recombination product within the same cell. If both recombination products are on vector ⁇ and the vector ⁇ are from the same incompatibility group, one of the vectors i ⁇ lo ⁇ t as the cell ⁇ are propagated. Thi ⁇ process occurs faster if the cells are propagated on selective media in which one or other of the recombinant products confers a selective advantage. After a suitable period of recombination, which depends on the cell type and its growth cycle time, the recombinant forms are ⁇ ubject to ⁇ creening or ⁇ election.
  • thi ⁇ format for recombination is particularly amenable to alternation with cycles of in vivo screening or selection.
  • the conditions for screening or selection depend on the property which it is desired that the gene(s) being evolved acquire or improve in. For example, if the property is drug resi ⁇ tance, recombinant forms having the best drug resi ⁇ tance can be ⁇ elected by expo ⁇ ure to the drug.
  • cells bearing recombinant clusters of the genes can be screened by overlaying colonies of cell bearing recombinant clu ⁇ ter with a lawn of cell ⁇ that are ⁇ en ⁇ itive to the drug. Colonies having recombinant clusters resulting in production of the best drug are identified from holes in the lawn. If the gene being evolved confers enhanced growth characteristics, cells bearing the be ⁇ t gene ⁇ can be selected by growth competition. Antibiotic production can be a growth rate advantage if cells are competing with other cell types for growth.
  • Screening/selection produces a subpopulation of cells expres ⁇ ing recombinant form ⁇ of gene( ⁇ ) that have evolved toward acquisition of a desired property. These recombinant forms can then be subjected to further rounds of recombination and screening/selection in any order. For example, a second round of screening/selection can be performed analogous to the first resulting in greater enrichment for genes having evolved toward acquisition of the de ⁇ ired property.
  • the stringency of ⁇ election can be increased between rounds (e.g., if selecting for drug resi ⁇ tance, the concentration of drug in the media can be increased) .
  • Further rounds of recombination can also be performed by an analogous strategy to the first round generating further recombinant forms of the gene(s) .
  • further rounds of recombination can be performed by any of the other molecular breeding formats discus ⁇ ed.
  • a recombinant form of the gene(s) is generated that has fully acquired the desired property.
  • Fig. 30 provides an example of how a drug resistance gene can be evolved by conjugative transfer.
  • Panel A show ⁇ a library of diverse genes cloned into a mobilizable vector bearing as oriT.
  • the vector ⁇ are pre ⁇ ent in cells containing a second vector which provide ⁇ tra function ⁇ .
  • Conjugative transfer result ⁇ in movement of the mobilizable vectors between cells, such that different vectors bearing different variant forms of a gene occupy the same cell, as shown in panel B.
  • the different forms of the gene recombine to give the products shown in panel C.
  • cells are selected to identify those containing the recombined genes, as shown in panel D.
  • the alternative shuffling method includes the use of intra-plasmidic recombination, wherein librarie ⁇ of ⁇ equence-recombined polynucleotide sequences are obtained by genetic recombination in vivo of direct sequence repeat ⁇ located on the same plasmid.
  • the sequences to be recombined are flanked by ⁇ ite- ⁇ pecific recombination sequences and the polynucleotides are present in a site-specific recombination sy ⁇ tem, ⁇ uch a ⁇ an integron (Hall and Collin ⁇ (1995) Mol. Microbiol. 15: 593, incorporated herein by reference) .
  • mutator strains of host cells are used to enhance recombination of more highly mismatched sequence-related polynucleotides.
  • Bacterials ⁇ trains such as MutL, MutS, or MutH or other cells expressing the Mut protein ⁇ (XL-lred; Stratagene, San Diego, CA) can be u ⁇ ed as host cells for shuffling of ⁇ equence-related polynucleotide ⁇ by in vivo recombination.
  • Other mutation-prone ho ⁇ t eel type ⁇ can also be used, such a ⁇ those having a proofreading-defective polymerase (Fo ⁇ ter et al. (1995) Proc. Natl. Acad. Sci.
  • in vivo mutagenic format ⁇ can be employed, including admin ⁇ tering chemical or radiological mutagen ⁇ to ho ⁇ t cell ⁇ .
  • mutagens include but are not limited to: ENU, MMNG, nitro ⁇ ourea, BuDR, and the like.
  • Shuffling can be u ⁇ ed to evolve poly era ⁇ es capable of incorporation of base analogs in PCR or PCR-like amplification reactions.
  • a DNA polymerase which is evolved to u ⁇ e base analogs can be used to copy DNA by PCR into a chemical form which gives more resolvable fragmentation patterns in mass spectrometry, such a ⁇ for ma ⁇ spectrometry DNA sequencing.
  • the base analogs can have fewer and/or more favorable fragmentation sites to enhance or facilitate the interpretation of the mass spectrum patterns.
  • Variant polymerases can also be evolved by recursive sequence recombination to incorporate non-natural nucleotides or nucleotide analogs, such as phosphorothioate nucleotides.
  • Phosphorothioate nucleotides made with such variant polymerases can provide many uses, including naked DNA gene therapy vectors which are resistant to nuclease degradation.
  • Other examples of properties of polymerases which can be modified via recursive sequence recombination include, but are not limited to, processivity, error rate, proofreading, thermal stability, oxidation resistance, nucleotide preferences, template specificity, and the like, among others.
  • fluorescence-activated cell sorting or analogous methodology is used to screen for host cells, typically mammalian cells, insect cells, or bacterial cells, comprising a library member of a recursively recombined sequence library, wherein the host cell having a library member conferring a desired phenotype can be selected on the basis of fluorescence or optical density at one or more detection wavelengths.
  • each library member typically encodes an enzyme, which may be secreted from the cell or may be intracellular, and the enzyme catalyzes conversion of a chromogenic or fluorogenic sub ⁇ trate, which may be capable of diffu ⁇ ing into the host cell (e.g., if ⁇ aid enzyme i ⁇ not secreted) .
  • Ho ⁇ t cell ⁇ containing library member ⁇ are contained in fluid drops or gel drop ⁇ and pa ⁇ sed by a detection apparatus where the drops are illuminated with an excitation wavelength and a detector measures either fluorescent emission wavelength radiation and/or measure ⁇ optical den ⁇ ity (ab ⁇ option) at one or more excitatory wavelength( ⁇ ) .
  • the cells suspended in drops are passed across a sample detector under conditions wherein only about one individual cell is present in a sample detection zone at a time.
  • a source illuminates each cell and a detector, typically a photomultiplier or photodiode, detects emitted radiation.
  • the detector controls gating of the cell in the detection zone into one of a plurality of sample collection regions on the basi ⁇ of the signal(s) detected.
  • X-gal 5-bromo-4-chloro-3-indolyl-/3-D-galactoside
  • DNAsel deoxyribonuclease
  • PBS phosphate buffered saline
  • CDR complementarity determining regions
  • the sub ⁇ trate for the rea ⁇ embly reaction was the dsDNA polymerase chain reaction ("PCR") product of the wild-type LacZ alpha gene from pUC18.
  • PCR dsDNA polymerase chain reaction
  • the primer sequence ⁇ were 5 'AAAGCGTCGATTTTTGTGAT3 ' (SEQ ID NO:l) and 5'ATGGGGTTCCGCGCACATTT3 ' (SEQ ID NO:2) .
  • the free primer ⁇ were removed from the PCR product by Wizard PCR prep (Promega, Madison WI) according to the manufacturer's directions. The removal of the free primers was found to be important.
  • DNA substrate was digested with 0.15 units of DNAsel (Sigma, St. Louis MO) in 100 ⁇ l of [50 mM Tris-HCl pH 7.4, 1 mM MgCl 2 ], for 10-20 minutes at room temperature.
  • the digested DNA was run on a 2% low melting point agarose gel. Fragment ⁇ of 10-70 ba ⁇ epair ⁇ (bp) were purified from the 2% low melting point agarose gel ⁇ by electrophoresis onto DE81 ion exchange paper (Whatman, Hillsborough OR) . The DNA fragments were eluted from the paper with 1 M NaCl and ethanol precipitated.
  • the purified fragment ⁇ were re ⁇ uspended at a concentration of 10 - 30 ng/ ⁇ l in PCR Mix (0.2 mM each dNTP, 2.2 mM MgCl 2 , 50 mM KCl, 10 mM Tris-HCl pH 9.0, 0.1% Triton X-100, 0.3 ⁇ l Taq DNA polymerase, 50 ⁇ l total volume) . No primer ⁇ were added at this point.
  • a reassembly program of 94°C for 60 seconds, 30-45 cycles of [94°C for 30 second ⁇ , 50-55°C for 30 seconds, 72°C for 30 seconds] and 5 minutes at 72°C was used in an MJ Research (Watertown MA) PTC-150 thermocycler.
  • the PCR reassembly of small fragments into larger sequences was followed by taking samples of the reaction after 25, 30, 35 ,40 and 45 cycles of reassembly (Fig. 2) .
  • reassembly of 100-200 bp fragments can yield a single PCR product of the correct size
  • 10-50 base fragments typically yield some product of the correct size, as well as products of heterogeneous molecular weights. Most of this size heterogeneity appears to be due to single-stranded sequences at the ends of the products, since after restriction enzyme digestion a single band of the correct size is obtained.
  • the PCR product from step 4 above was digested with the terminal restriction enzymes BamHI and Eco0109 and gel purified as described above in step 2.
  • the reassembled fragments were ligated into pUC18 digested with BamHI and £co0109.
  • E . coli were transformed with the ligation mixture under standard conditions as recommended by the manufacturer (Stratagene, San Diego CA) and plated on agar plates having 100 ⁇ g/ml ampicillin, 0.004% X-gal and 2mM IPTG.
  • the resulting colonies having the HinOlll-Nhel fragment which is diagnostic for the ++ recombinant were identified because they appeared blue.
  • the DNA encoding the LacZ gene from the resulting LacZ " colonies was sequenced with a sequencing kit (United States Biochemical Co., Cleveland OH) according to the manufacturer's instructions and the genes were found to have point mutations due to the reassembly process (Table 1) . 11/12 types of substitutions were found, and no frameshifts.
  • Cros ⁇ over between two markers separated by 75 bases was measured using two LacZ gene construct ⁇ . Stop codon ⁇ were inserted in two separate areas of the LacZ alpha gene to serve as negative markers. Each marker is a 25 bp non-homologous sequence with four stop codons, of which two are in the LacZ gene reading frame. The 25 bp non-homologou ⁇ sequence is indicated in Figure 3 by a large box. The stop codons are either boxed or underlined.
  • a 1:1 mixture of the two 1.0 kb LacZ templates containing the +- and -+ versions of the LacZ alpha gene (Fig. 3) was dige ⁇ ted with DNAsel and 100-200 bp fragments were purified as described in Example 1.
  • Oligonucleotides that are mixed into the shuffling mixture can be incorporated into the final product based on the homology of the flanking ⁇ equence ⁇ of the oligonucleotide to the template DNA (Fig. 4) .
  • the LacZ " stop codon mutant (pUC18 -+) described above was used as the DNAsel digested template.
  • a 66 mer oligonucleotide, including 18 bases of homology to the wild-type LacZ gene at both ends wa ⁇ added into the reaction at a 4-fold molar excess to correct stop codon mutations present in the original gene.
  • the shuffling reaction was conducted under conditions similar to those in step 2 above.
  • the resulting product was digested, ligated and inserted into E . coli as described above.
  • ssDNA appeared to be more efficient than d ⁇ DNA, pre ⁇ umably due to competitive hybridization.
  • the degree of incorporation can be varied over a wide range by adju ⁇ ting the molar excess, annealing temperature, or the length of homology.
  • Plasmid pUC18 was digested with restriction enzymes coRI,
  • the ⁇ e fragments were electrophoresed and ⁇ eparately purified from a 2% low melting point agarose gel (the
  • Each fragment was digested with DNAsel as described in Example 1, and fragments of 50-130 bp were purified from a 2% low melting point agarose gel for each of the original fragments.
  • PCR mix (as described in Example 1 above) wa ⁇ added to the purified dige ⁇ ted fragment ⁇ to a final concentration of 10 ng/ ⁇ l of fragment ⁇ . No primer ⁇ were added.
  • a rea ⁇ embly reaction wa ⁇ performed for 75 cycle ⁇ [94°C for 30 ⁇ econds, 60°C for 30 second ⁇ ] separately on each of the three digested DNA fragment mixture ⁇ , and the products were analyzed by agaro ⁇ e gel electrophoresis.
  • This example illustrate ⁇ that cro ⁇ sovers based on homologies of le ⁇ s than 15 bases may be obtained.
  • a human and a murine IL-l ⁇ gene were shuffled.
  • a murine ILl- ⁇ gene (BBG49) and a human ILl- ⁇ gene with E . coli codon usage (BBG2; R&D System ⁇ , Inc., Minneapoli ⁇ MN) were used a ⁇ template ⁇ in the ⁇ huffling reaction.
  • BSG4 murine ILl- ⁇ gene
  • BSG2 human ILl- ⁇ gene with E . coli codon usage
  • the areas of complete homology between the human and the murine IL-l ⁇ sequences are on average only 4.1 bases long (Fig. 5, regions of heterology are boxed) .
  • the first 15 cycles of the shuffling reaction were performed with the Klenow fragment of DNA polymerase I, adding 1 unit of fresh enzyme at each cycle.
  • the DNA was added to the PCR mix of Example 1 which mix lacked the polymerase.
  • the manual program was 94°C for 1 minute, and then 15 cycles of: [95°C for 1 minute, 10 seconds on dry ice/ethanol (until frozen) , incubate about 20 seconds at 25°C , add IU of Klenow fragment and incubate at 25°C for 2 minutes] .
  • the tube was rapidly cooled in dry ice/ethanol and reheated to the annealing temperature. Then the heat-labile polymera ⁇ e was added.
  • the reaction was then diluted 20-fold.
  • the following primers were added to a final concentration of 0.8 ⁇ M: 5 'AACGCCGCATGCAAGCTTGGATCCTTATT3 ' (SEQ ID NO:5) and 5 'AAAGCCCTCTAGATGATTACGAATTCATAT3 ' (SEQ ID NO: 6) and a PCR reaction was performed as described above in Example 1.
  • the second primer pair differed from the first pair only because a change in restriction sites was deemed necessary.
  • crossovers were found by DNA sequencing of nine colonies. Some of the crossovers were based on only 1-2 bases of uninterrupted homology.
  • TEM-1 betalactamase is a very efficient enzyme, limited in its reaction rate primarily by diffusion. This example determines whether it is pos ⁇ ible to change its reaction specificity and obtain resistance to the drug cefotaxime that it normally does not hydrolyze.
  • the minimum inhibitory concentration (MIC) of cefotaxime on bacterial cells lacking a plasmid was determined by plating 10 ⁇ l of a 10 ⁇ 2 dilution of an overnight bacterial culture (about 1000 cfu) of E. coli XLl-blue cells (Stratagene, San Diego CA) on plates with varying levels of cefotaxime (Sigma, St. Louis MO) , followed by incubation for 24 hours at 37°C.
  • a pUC18 derivative carrying the bacterial TEM-1 betalactama ⁇ e gene was used (28) .
  • the TEM-1 betalactamase gene confers resi ⁇ tance to bacteria against approximately 0.02 ⁇ g/ml of cefotaxime.
  • Sfil restriction site ⁇ were added 5' of the promoter and 3 ' of the end of the gene by PCR of the vector sequence with two primers:
  • the two reaction product ⁇ were dige ⁇ ted with Sfil , mixed, ligated and used to transform bacteria.
  • the resulting plasmid was pUC182Sfi. This pla ⁇ mid contain ⁇ an Sfil fragment carrying the TEM-1 gene and the P-3 promoter.
  • the minimum inhibitory concentration of cefotaxime for E . coli XLl-blue (Stratagene, San Diego CA) carrying thi ⁇ plasmid was 0.02 ⁇ g/ml after 24 hours at 37°C.
  • the sub ⁇ trate for the fir ⁇ t shuffling reaction was dsDNA of 0.9 kb obtained by PCR of pUC182Sfi with primers C and D, both of which contain a Sfil site.
  • the free primers from the PCR product were removed by Wizard PCR prep (Promega, Madison WI) at every cycle.
  • DNA substrate(s) was dige ⁇ ted with 0.15 units of DNAsel (Sigma, St. Loui ⁇ MO) in 100 ⁇ l of 50 mM Tri ⁇ -HCl pH 7.4, 1 mM MgCl 2/ for 10 min at room temperature. Fragments of 100-300 bp were purified from 2% low melting point agaro ⁇ e gel ⁇ by electrophoresis onto DE81 ion exchange paper (Whatman, Hillsborough OR) , elution with 1 M NaCl and ethanol precipitation by the method described in Example 1.
  • the purified fragments were resu ⁇ pended in PCR mix (0.2 mM each dNTP, 2.2 mM MgCl 2 , 50 mM KCl, 10 mM Tris-HCl pH 9.0, 0.1% Triton X-100) , at a concentration of 10 - 30 ng/ ⁇ l. No primers were added at this point.
  • a reassembly program of 94°C for 60 seconds, then 40 cycles of [94°C for 30 seconds, 50-55°C for 30 second ⁇ , 72°C for 30 seconds] and then 72°C for 5 minutes was used in an MJ Research (Watertown MA) PTC-150 thermocycler.
  • the 900 bp product was ligated into the vector pUC182Sfi at the unique Sfil site with T4 DNA ligase (BRL, Gaithersburg MD) .
  • the mixture was electroporated into E. coli XLl-blue cells and plated on LB plates with 0.32-0.64 ⁇ g/ml of cefotaxime (Sigma, St. Louis MO). The cells were grown for up to 24 hours at 37°C and the resulting colonies were scraped off the plate as a pool and used as the PCR template for the next round of shuffling.
  • the reassembly products were dige ⁇ ted and ligated into pUC182Sfi as described in step (5) above.
  • the mixture was electroporated into E. coli XLl-blue cell ⁇ and plated on LB plate ⁇ having 5-10 ⁇ g/ml of cefotaxime. Colonies obtained at 5-10 ⁇ g/ml were used for a third round similar to the first and second rounds except the cells were plated on LB plates having 80-160 ⁇ g/ml of cefotaxime.
  • the plasmid of selected clones wa ⁇ tran ⁇ ferred back into wild-type E . coli XLl-blue cell ⁇ (Stratagene, San Diego CA) to en ⁇ ure that none of the mea ⁇ ured drug re ⁇ i ⁇ tance wa ⁇ due to chromosomal mutations.
  • All the base numbers correspond to the revised pBR322 sequence (29) , and the amino acid numbers corre ⁇ pond to the ABL ⁇ tandard numbering scheme (30) .
  • the amino acids are designated by their three letter codes and the nucleotides by their one letter codes.
  • G4205A means that nucleotide 4205 was changed from guanidine to adenine.
  • G4205A is located between the -35 and -10 sites of the betalactamase P3 promoter (31) .
  • the promoter up-mutant observed by Chen and Clowes (31) is located outside of the Sfil fragment used here, and thus could not have been detected.
  • Four mutation ⁇ were ⁇ ilent (A3689G, G3713A, G3934A and T3959A) , and four re ⁇ ulted in an amino acid change (C3448T resulting in Gly238Ser, A3615G resulting in Metl82Thr, C3850T resulting in Glul04Lys, and G4107A resulting in Alal ⁇ Val) . 8) Molecular Backcross
  • This backcross shuffling wa ⁇ repeated with DNA from colonies from the first backcros ⁇ round in the pre ⁇ ence of a fold excess of wild-type TEM-1 DNA. Small DNA fragments (30- 0 bp) were used to increase the efficiency of the backcross. The second round of backcrossed mutants were again selected on LB plate ⁇ with 80-160 ⁇ g/ml of cefotaxime.
  • the resulting tran ⁇ formant ⁇ were plated on 160 ⁇ g/ml of cefotaxime, and a pool of colonies was replated on increasing level ⁇ of cefotaxime up to 1,280 ⁇ g/ml. The largest colony obtained at 1,280 ⁇ g/ml was replated for single colonies.
  • the DNA ⁇ equence of the Sfil in ⁇ ert of the backcro ⁇ sed mutant was determined using a dideoxy DNA sequencing kit (United States Biochemical Co. , Cleveland OH) according to the manufacturer's instructions (Table 3) .
  • the mutant had 9 single base pair mutations. A ⁇ expected, all four of the previou ⁇ ly identified silent mutations were lost, reverting to the sequence of the wild-type gene.
  • the promoter mutation (G4205A) as well as three of the four amino acid mutation ⁇ (Glul04Ly ⁇ , Metl82Thr, and Gly238Ser) remained in the backcro ⁇ ed clone, ⁇ ugge ⁇ ting that they are e ⁇ ential for high level cefotaxime resistance.
  • Both the backcro ⁇ ed and the non-backcro ⁇ ed mutants have a promoter mutation (which by it ⁇ elf or in combination re ⁇ ult ⁇ in a 2-3 fold increase in expres ⁇ ion level) as well as three common amino acid change ⁇ (Glul04Ly ⁇ , Metl82Thr and Gly238Ser) .
  • Glul04Lys and Gly238Ser are mutation ⁇ that are present in several cefotaxime resi ⁇ tant or other TEM-1 derivatives (Table 4) . 9) Expression Level Comparison
  • TEM-1 betalactamase (Sigma, St. Louis MO) was u ⁇ ed a ⁇ a molecular weight ⁇ tandard, and E. coli XLl-blue cells lacking a plasmid were used as a negative control.
  • the mutant and the backcro ⁇ ed mutant appeared to produce a 2-3 fold higher level of the betalactamase protein compared to the wild-type gene.
  • the promoter mutation appeared to result in a 2-3 times increase in betalactamase.
  • Example 6 Con ⁇ truction of mutant combination ⁇ of the TEM-1 betalactamase gene To determine the resistance of different combinations of mutations and to compare the new mutants to published mutant ⁇ , several mutants were constructed into an identical plasmid background. Two of the mutations, Glul04Ly ⁇ and Gly238Ser, are known a ⁇ cefotaxime mutants. All mutant combinations constructed had the promoter mutation, to allow comparison to selected mutant ⁇ . The results are shown in Table 4.
  • Gly238Ser and Arg2 lHis (combined) : (SEQ ID NO:23) ATGCTCACTGGCTCCAGATTTATCAGCAAT and (SEQ ID NO:24) TCTGGAGCCAGTGAGCATGGGTCTCGCGGTATCATT; G4205A: (SEQ ID NO:25) AACCTGTCCTGGCCACCATGGCCTAAATACAATCAAA TATGTATCCGCTTATGAGACAATAACCCTGATA.
  • PCR fragments were gel purified away from the ⁇ ynthetic oligonucleotide ⁇ . 10 ng of each fragment were combined and a reassembly reaction was performed at 94°C for 1 minute and then 25 cycles; [94°C for 30 sec, 50°C for 30 second ⁇ and 72°C for 45 ⁇ econd ⁇ ] .
  • PCR wa ⁇ performed on the rea ⁇ e bly product for 25 cycle ⁇ in the presence of the Sfil-containing out ⁇ ide primers (primers C and D from Example 5) .
  • the DNA was digested with Sfil and inserted into the wild-type pUC182Sfi vector. The following mutant combination ⁇ were obtained (Table 4) .
  • All of the ⁇ e mutant ⁇ additionally contain the G4205A promoter mutation.
  • Glul04Lys alone was shown to result only in a doubling of the MIC to 0.08 ⁇ g/ml, and Gly238Ser (in several contexts with one additional amino acid change) resulted only in a MIC of 0.16 ⁇ g/ml (26) .
  • the double mutant Glul04Ly ⁇ /Gly238Ser ha ⁇ a MIC of 10 ⁇ g/ml. This mutant corresponds to TEM-15.
  • Glul04Lys and Gly238Ser mutations in combination with Gln39Lys (TEM-3) or Thr263Met (TEM-4) re ⁇ ult in a high level of resi ⁇ tance (2-32 ⁇ g/ml for TEM-3 and 8-32 ⁇ g/ml for TEM-4 (34, 35) .
  • a mutant containing the three amino acid change ⁇ that were conserved after the backcro ⁇ s also had a MIC of 10 ⁇ g/ml. This meant that the mutations that each of the new selected mutant ⁇ had in addition to the three known mutation ⁇ were re ⁇ pon ⁇ ible for a further 32 to 64-fold increa ⁇ e in the resistance of the gene to cefotaxime.
  • TEM-1-19 The naturally occurring, clinical TEM-1-derived enzymes (TEM-1-19) each contain a different combination of only 5-7 identical mutations (reviews) . Since these mutations are in well separated locations in the gene, a mutant with high cefotaxime resi ⁇ tance cannot be obtained by ca ⁇ ette mutagene ⁇ i ⁇ of a single area. This may explain why the maximum MIC that was obtained by the standard cassette mutagenesis approach is only 0.64 ⁇ g/ml (26) . For example, both the Glul04Lys as well as the Gly238Ser mutations were found ⁇ eparately in thi ⁇ study to have MICs below 0.16 ⁇ g/ml. Use of DNA shuffling allowed combinatoriality and thus the Glul04Lys/Gly238Ser combination was found, with a MIC of 10 ⁇ g/ml.
  • An important limitation of this example is the use of a single gene as a starting point. It is contemplated that better combinations can be found if a large number of related, naturally occurring gene ⁇ are ⁇ huffled. The diversity that is present in such a mixture is more meaningful than the random mutations that are generated by mutagenic shuffling. For example, it is contemplated that one could use a repertoire of related genes from a single specie ⁇ , ⁇ uch a ⁇ the pre-existing diversity of the immune system, or related genes obtained from many different species.
  • Example 7 Improvement of antibody A10B bv DNA shuffling of a library of all six mutant CDR ⁇ .
  • the A10B ⁇ cFv antibody a mouse anti-rabbit IgG, was a gift from Pharmacia (Milwaukee WI) .
  • Pharmacia Pharmacia (Milwaukee WI) .
  • Pharmacia phage display system which uses the pCANTAB5 phage display vector.
  • the original AlOB antibody reproducibly had only a low avidity, since clones that only bound weakly to immobilized antigen (rabbit IgG) , (as measured by phage ELISA (Pharmacia a ⁇ ay kit) or by phage titer) were obtained.
  • the concentration of rabbit IgG which yielded 50% inhibition of the AlOB antibody binding in a competition a ⁇ ay was 13 picomolar.
  • the observed low avidity may also be due to instability of the AlOB clone.
  • AlOB scFv DNA was sequenced (United States Biochemical Co., Cleveland OH) according to the manufacturer's instruction ⁇ . The sequence was similar to existing antibodies, based on comparison to Kabat (33) .
  • Phage DNA having the AlOB wild-type antibody gene (10 ul) was incubated at 99°C for 10 min, then at 72°C for 2 min.
  • PCR mix 50 mM KCl, 10 mM Tri ⁇ -HCl pH 9.0, 0.1% Triton X-100, 200 ⁇ M each dNTP, 1.9 mM MgCl
  • 0.6 ⁇ m of each primer and 0.5 ⁇ l Taq DNA Polymerase was added to the phage DNA.
  • a PCR program was run for 35 cycles of [30 seconds at 94°C, 30 second ⁇ at 45°C, 45 ⁇ econd ⁇ at 72°C].
  • the primer ⁇ u ⁇ ed were: 5' ATGATTACGCCAAGCTTT 3' (SEQ ID NO:26) and 5' TTGTCGTCTTTCCAGACGTT 3' (SEQ ID NO:27) .
  • the 850 bp PCR product was then electrophoresed and purified from a 2% low melting point agarose gel.
  • CDR H means a CDR in the heavy chain
  • CDR L means a CDR in the light chain of the antibody.
  • CDR H2 ( SEQ ID NO : 35 ) 5 ' ACAGGGACTTGAGTGGATTGGAATCACAGTCAAGCTTATCCTTTATCTCAGGTCTCGAGT
  • the CDR oligo ⁇ were added to the purified AlOB antibody DNA fragment ⁇ of between 50 to 200 bp from step (2) above at a 10 fold molar excess.
  • the PCR mix 50 mM KCl, 10 mM Tris-HCl pH
  • Triton X-100 9.0, 0.1% Triton X-100, 1.9 mM MgCl, 200 ⁇ m each dNTP, 0.3 ⁇ l
  • Taq DNA polymerase (Promega, Madison WI) , 50 ⁇ l total volume) was added and the shuffling program run for 1 min at 9 °C, 1 min at 72°C, and then 35 cycles: 30 seconds at 94°C, 30 second ⁇ at 55°C,
  • 1 ⁇ l of the shuffled mixture was added to 100 ⁇ l of a PCR mix (50 mM KCl, 10 mM Tris-HCl pH 9.0, 0.1% Triton X-100, 200 ⁇ m each dNTP, 1.9 mM MgCl, o.6 ⁇ M each of the two out ⁇ ide primers (SEQ ID NO:26 and 27, see below), 0.5 ⁇ l Taq DNA polymerase) and the PCR program was run for 30 cycles of [30 ⁇ econd ⁇ at 94°C, 30 ⁇ econd ⁇ at 45°C, 45 ⁇ econd ⁇ at 72°C]. The resulting mixture of
  • DNA fragments of 850 basepair size was phenol/chloroform extracted and ethanol precipitated.
  • the outside primers were:
  • the 850 bp PCR product was digested with the restriction enzymes Sfil and NotI , purified from a low melting point agarose gel, and ligated into the pCANTAB ⁇ expres ⁇ ion vector obtained from Pharmacia, Milwaukee WI.
  • the ligated vector was electroporated according to the method set forth by Invitrogen (San Diego CA) into TGI cells (Pharmacia, Milwaukee WI) and plated for single colonies.
  • the DNA from the resulting colonies was added to 100 ⁇ l of a PCR mix (50 mM KCl, 10 mM Tris-HCl pH 9.0, 0.1% Triton X-100, 200 ⁇ m each dNTP, 1.9 mM MgCl, o.6 ⁇ M of Outside primer 1 (SEQ ID No. 27; see below) six inside primers (SEQ ID NOS:40-45; see below) , and 0.5 ⁇ l Taq DNA polymerase) and a PCR program was run for 35 cycles of [30 second ⁇ at 94°C, 30 ⁇ econds at 45°C, 45 seconds at 72°C] .
  • H 2 (SEQ ID NO: 41) 5 GCTTATCCTTTATCTCAGGTC 3 ' ,
  • CDRs Mutant Complementarity Determining Region ⁇
  • CDR H2 ( SEQ ID NO : 29 ) 5 ' ACAGGGACTTGAGTGGATTGGATGGATTTTTCCTGGAGAGGGTGGTACTGAATACAATGA
  • a 10 fold molar excess of the CDR mutant oligos were added to the purified AlOB antibody DNA fragments between 50 to 200 bp in length from step (2) above.
  • the PCR mix 50 mM KCl, 10 mM Tris-HCl pH 9.0, 0.1% Triton x-100, 1.9 mM MgCl, 200 ⁇ m each dNTP, 0.3 ⁇ l Taq DNA polymerase (Promega, Madison WI) , 50 ⁇ l total volume) wa ⁇ added and the shuffling program run for 1 min at 94°C, 1 min at 72°C, and then 35 cycles: [30 second ⁇ at 94°C,
  • the library that was generated in this fashion was screened for the presence of improved antibodies, using six cycles of selection.
  • the best clone has an approximately 100-fold improved expre ⁇ ion level compared with the wild-type AlOB when te ⁇ ted by the Western assay.
  • the concentration of the rabbit IgG which yielded 50% inhibition in a competition as ⁇ ay with the best clone was 1 picomolar.
  • the best clone was reproducibly specific for rabbit antigen. The number of copies of the antibody displayed by the phage appears to be increased.
  • Example 8 In vivo recombination via direct repeats of partial genes
  • a plasmid was constructed with two partial, inactive copies of the same gene (beta-lactamase) to demonstrate that recombination between the common areas of these two direct repeats leads to full-length, active recombinant genes.
  • the TEM-l betalactamase gene confer ⁇ re ⁇ istance to bacteria against approximately 0.02 ⁇ g/ml of cefotaxime. Sfil restriction sites were added 5' of the promoter and 3 ' of the end of the betalactamase gene by PCR of the vector sequence with two primers:
  • Primer A (SEQ ID NO: 46) 5' TTCTATTGACGGCCTGTCAGGCCTCATATATACTTTAGATTGATTT 3'
  • cefotaxime for E. coli XLl-blue (Stratagene, San Diego CA) carrying pUC182Sfi-Bla- Sfi was 0.02 ⁇ g/ml after 24 hours at 37°C.
  • the tetracycline gene of pBR322 was cloned into pUCl ⁇ Sfi- Bla-Sfi using the homologous areas, resulting in pBR322TetSfi- Bla-Sfi.
  • the TEM-l gene was then deleted by restriction digestion of the pBR322TetSfi-Bla-Sfi with Sspl and Fspl and blunt-end ligation, resulting in pUC322TetSfi-sfi.
  • Overlapping regions of the TEM-l gene were amplified using standard PCR techniques and the following primers: Primer 2650 (SEQ ID NO: 50) 5' TTCTTAGACGTCAGGTGGCACTT 3' Primer 2493 (SEQ ID NO: 51) 5' TTT TAA ATC AAT CTA AAG TAT 3' P r i m e r 2 6 5 1 ( S E Q I D N O : 5 2 ) 5 ' TGCTCATCCACGAGTGTGGAGAAGTGGTCCTGCAACTTTAT 3, 'and Primer 2652 (SEQ ID NO: 53) ACCACTTCTCCACACTCGTGGATGAGCACTTTTAAAGTT
  • the two resulting DNA fragments were digested with Sfil and BstXl and ligated into the Sfi site of pBR322TetSfi-Sfi.
  • the resulting plasmid was called pBR322Sfi-BL-LA-Sfi.
  • a map of the plasmid as well as a schematic of intraplasmidic recombination and reconstitution of functional beta-lactamase is ⁇ hown in Figure 9.
  • the plasmid wa ⁇ electroporated into either TG-1 or JC8679 E . coli cell ⁇ .
  • E . coli JC8679 i ⁇ RecBC ⁇ bcA (Oliner et al., 1993, NAR 21:5192).
  • the cell ⁇ were plated on solid agar plates containing tetracycline. Those colonies which grew, were then plated on solid agar plates containing 100 ⁇ g/ml ampicillin and the number of viable colonies counted.
  • the beta-lactamase gene insert ⁇ in tho ⁇ e transformants which exhibited ampicillin resi ⁇ tance were amplified by standard PCR technigues using Primer 2650 (SEQ ID NO: 50) 5' TTCTTAGACGTCAGGTGGCACTT 3' and Primer 2493 (SEQ ID NO: 51) 5' TTTTAAATCAATCTAAAGTAT 3' and the length of the insert measured.
  • the pre ⁇ ence of a 1 kb insert indicates that the gene was ⁇ ucce ⁇ fully recombined, as shown in Fig. 9 and Table 5.
  • Example 9 In vivo recombination via direct repeats of full-length genes.
  • the two alleles of the beta-lactama ⁇ e gene were con ⁇ tructed as follows. Two PCR reactions were conducted with pUC18Sfi-Bla-
  • Primer 2650 (SEQ ID NO: 50) 5' TTCTTAGACGTCAGGTGGCACTT 3'
  • Primer 2649 (SEQ ID NO: 51) 5' ATGGTAGTCCACGAGTGTGGTAGTGACAGGCCGGTCTGACAGTTA
  • the second PCR reaction was conducted with the following primers:
  • the plasmid was electroporated into E . coli cells.
  • the cells were plated on solid agar plates containing 15 ⁇ g/ml tetracycline. Those colonies which grew, were then plated on solid agar plates containing 100 ⁇ g/ml ampicillin and the number of viable colonies counted.
  • the Bla insert ⁇ in those transformants which exhibited ampicillin resistance were amplified by standard PCR techniques using the method and primers described in Example 8. The pre ⁇ ence of a 1 kb insert indicated that the duplicate genes had recombined, as indicated in Table 6. TABLE 6
  • Colony PCR confirmed that the tandem repeat was efficiently recombined to form a single recombinant gene.
  • Example 10 Multiple cycles of direct repeat recombination - Interpla ⁇ midic In order to determine whether multiple cycle ⁇ of recombination could be used to produce resistant cells more quickly, multiple cycles of the method described in Example 9 were performed.
  • the tetracycline marker was used to equalize the number of colonies that were selected for cefotaxime resi ⁇ tance in each round, to compen ⁇ ate for ligation efficiencies.
  • pBR322TetSfi-Bla-Sfi was digested with .Ecrl and subject to PCR with a 1:1 mix (1 ml) of normal and Cadwell PCR mix (Cadwell and Joyce (1992) PCR Method ⁇ and Application ⁇ 2: 28-33) for error prone PCR.
  • the PCR program was 70°C for 2 minutes initially and then 30 cycle ⁇ of 94°C for 30 seconds, 52°C for 30 second and 72°C for 3 minutes and 6 seconds per cycle, followed by 72°C for 10 minutes.
  • the primers used in the PCR reaction to create the one Bla gene control pla ⁇ mid were Primer 2650 (SEQ ID NO: 50) and Primer 2719 (SEQ ID NO: 55) 5' TTAAGGGATTTTGGTCATGAGATT 3'. This resulted in a mixed population of amplified DNA fragments, de ⁇ ignated collectively as Fragment #59. These fragments had a number of different mutations.
  • the primers used in two different PCR reactions to create the two Bla gene plasmids were Primer 2650 (SEQ ID NO: 50) and Primer 2649 (SEQ ID NO: 51) for the first gene and Primers 2648 (SEQ ID NO: 54) and Primer 2719 (SEQ ID NO: 55) for the second gene.
  • a number of different mutation ⁇ had been introduced the mixed population of each of the fragment ⁇ .
  • the population of amplified DNA fragments #90 and #89 was digested with Sfil and BstXl at 50°C, and ligated into pBR322TetSfi-Sfi to create a mixed population of the plasmid pBR322TetSfi-2Bla-Sfi 1 (Fig. 10).
  • the plasmid ⁇ pBR322Sfi-Bla-Sfi 1 and pBR322Sfi-2Bla-Sfi 1 were electroporated into E. coli JC8679 and placed on agar plate ⁇ having differing concentrations of cefotaxime to select for resistant strains and on tetracycline plates to titre.
  • Example 11 In vivo recombination via electroporation of fragments Competent E. coli cells containing pUC18Sfi-Bla-Sfi were prepared as described. Plasmid pUCl ⁇ Sfi-Bla-Sfi contains the standard TEM-l beta-lactamase gene as described, supra .
  • the complete plasmid pUCl ⁇ Sfi-cef- Sfi DNA was electroporated into E. coli cells having the plasmid pUCl ⁇ Sfi-Bla-Sfi.
  • the DNA fragment containing the cefotaxime gene from pUCl ⁇ Sfi-cef-Sfi was amplified by PCR using the primer ⁇ 2650 (SEQ ID NO: 50) and 2719 (SEQ ID NO: 55) .
  • the resulting 1 kb PCR product was digested into DNA fragments of ⁇ 100 bp by DNase and these fragments were electroporated into the competent E . coli cells which already contained pUCl ⁇ Sfi-Bla-Sfi.
  • competent E. coli cells having the plasmid pUCl ⁇ Sfi-Kan-Sfi were also used. DNA fragments from the digestion of the PCR product of pUC18Sfi-cef-Sfi were electroporated into these cells. There is no homology between the kanamycin gene and the beta-lactamase gene and thus recombination should not occur.
  • This experiment was designed to determine which format of recombination generated the most recombinants per cycle.
  • the vector pUCl ⁇ Sfi-Bla-Sfi was amplified with PCR primer ⁇ to generate a large and small fragment.
  • the large fragment had the plasmid and ends having portions of the Bla gene, and the small fragment coded for the middle of the Bla gene.
  • a third fragment having the complete Bla gene was created using PCR by the method in Example 8.
  • the larger plasmid fragment and the fragment containing the complete Bla gene were electroporated into 27. coli JC8679 cells at the same time by the method described above and the transformants plated on differing concentrations of cefotaxime.
  • the vector pUCl ⁇ Sfi-Bla-Sfi was amplified to produce the large plasmid fragment isolated as in approach 1 above.
  • the two fragments each comprising a portion of the complete Bla gene, such that the two fragments together spanned the complete Bla gene werealso obtained by PCR.
  • the large plasmid fragment and the two Bla gene fragment ⁇ were all electroporated into competent E . coli JC8679 cells and the transformants plated on varying concentrations of cefotaxime.
  • both the vector and the plasmid were electroporated into E. coli JC8679 cells and the tran ⁇ formant ⁇ were plated on varying concentrations of cefotaxime.
  • the complete Bla gene wa ⁇ electroporated into E . coli JC8679 cell ⁇ already containing the vector pUCSfi-Sfi and the tran ⁇ for ant ⁇ were plated on varying concentrations of cefotaxime.
  • the E . coli JC8679 cells were electroporated with either the complete Bla gene or the vector alone.
  • a kit comprising a variety of cassettes which can be shuffled, and optimized shufflants can be selected.
  • Figure 12 shows ⁇ ⁇ chematically one embodiment, with each loci having a plurality of cassettes.
  • Figure 13 shows example cassettes that are used at the respective loci.
  • Each cas ⁇ ette of a given locu ⁇ e.g.
  • all promoters in this example are flanked by substantially identical sequence ⁇ capable of overlapping the flanking sequence( ⁇ ) of cas ⁇ ette ⁇ of an adjacent locu ⁇ and preferably also capable of participating in homologous recombination or non-homologous recombination (e.g., lox/cre or flp/frt ⁇ y ⁇ tem ⁇ ) , so as to afford ⁇ huffling of cassettes within a locus but substantially not between loci.
  • homologous recombination or non-homologous recombination e.g., lox/cre or flp/frt ⁇ y ⁇ tem ⁇
  • Ca ⁇ ette ⁇ are supplied in the kit as PCR fragment ⁇ , which each ca ⁇ sette type or individual cassette species packaged in a separate tube.
  • Vector libraries are created by combining the content ⁇ of tube ⁇ to a ⁇ semble whole plasmids or substantial portions thereof by hybridization of the overlapping flanking sequences of cassettes at each locus with cassettes at the adjacent loci.
  • the assembled vector is ligated to a predetermined gene of interest to form a vector library wherein each library member comprise ⁇ the predetermined gene of interest and a combination of cassettes determined by the as ⁇ ociation of cassette ⁇ .
  • the vectors are transferred into a suitable host cell and the cells are cultured under condition ⁇ suitable for expression, and the desired phenotype is selected.
  • GFP Protein
  • GFP Green fluorescent protein
  • GFP is a polypeptide derived from an apopeptide having 238 amino acid residues and a molecular weight of approximately 27,000.
  • GFP contains a chromophore formed from amino acid re ⁇ idue ⁇ 65 through 67.
  • the chromophore of GFP is activated by energy transfer from coelenterazine complexed with the photoprotein aequorin, with GFP exhibiting green fluorescence at 510 nm.
  • GFP Upon irradiation with blue or UV light, GFP exhibits green fluorescence at approximately 510 nm.
  • Aeguorea victoria is a very u ⁇ eful reporter for gene expre ⁇ ion and regulation (Pra ⁇ her et al. (1992) Gene 111: 229; Pra ⁇ her et al. (1995) Trends In Genetics 11: 320; Chalfie et al. (1994) Science 263: 802, incorporated herein by reference) .
  • W095/21191 disclo ⁇ es a polynucleotide sequence encoding a 238 amino acid GFP apoprotein which contain ⁇ a chromophore formed from amino acids 65 through 67.
  • W095/21191 disclose that a modification of the cDNA for the apopeptide of A.
  • Green fluorescent protein has rapidly become a widely used reporter of gene regulation.
  • the goal was to improve the whole cell fluorescence of GFP for use as a reporter for gene regulation for E . coli and mammalian cell ⁇ .
  • the improvement of GFP by rational de ⁇ ign appeared difficult because the quantum yield of GFP i ⁇ already 0.7-0.8 (Ward et al. (1982) Photochem. Photobiol. 35: 803) and the expre ⁇ ion level of GFP in a ⁇ tandard E . coli construct was already about 75% of total protein.
  • GFP Improvement of GFP was performed first by synthesis of a GFP gene with improved codon usage.
  • the GFP gene was then further improved by the disclosed method(s), consi ⁇ ting of recur ⁇ ive cycles of DNA shuffling or sexual PCR of the GFP gene, combined with visual selection of the brightest clones.
  • the whole cell fluorescence signal in E. coli was optimized and selected mutants were then assayed to determine performance of the best GFP mutants in eukaryotic ceils.
  • a synthetic gene was synthesized having improved codon usage and having a 2.8-fold improvement of the E . coli whole cell fluorescence signal compared to the industry standard GFP construct (Clontech, Palo Alto, CA) .
  • GFP vectors and sequences can be obtained from the GenBank database, such as via Internet World Wide Web, a ⁇ file ⁇ : CVU36202, CVU36201, XXP35SGFP, XXU19282, XXU19279, XXU19277, XXU19276, AVGFP2 , AVGFP1, XXU19281, XXU19280, XXU19278, AEVGFP, and XXU17997, which are incorporated herein by reference to the same extent as if the sequence files and comments were printed and inserted herein.
  • the Xbal-EcoRI fragment of Alpha+GFP containing the whole GFP gene, was subcloned into the prokaryotic expression vector pBADl ⁇ (Guzman et al. (1995) J. Bacteriol. 177: 4121), resulting in the bacterial expression vector pBADl ⁇ -GFP (Fig. 14).
  • GFP gene expression is under the control of the arabinose promoter/repressor (araBAD) , which is inducible with arabinose (0.2%) . Because this is the only construct with the original amino acid sequence, it is referred to as wildtype GFP ('wt').
  • a GFP-expressing bacterial vector was obtained from Clontech (Palo Alto, CA) , which is referred to herein as •Clontech' construct. GFP expression from the 'Clontech' construct requires IPTG induction.
  • GFP gene wa ⁇ obtained from the PBAD-GFP vector by PCR with primers 5' -TAGCGGATCCTACCTGACGC (near Nhel site) and 5'GAAAATCTTCTCTCATCCG (near EcoRI ⁇ ite) and purified by Wizard PCR prep (Promega, Madison, WI) .
  • This PCR product was dige ⁇ ted into random fragment ⁇ with DNase I (Sigma) and 50-300 bp fragments were purified from 2% low melting point agarose gels.
  • the purified fragment ⁇ were re ⁇ uspended at 10-30 ng/ul in PCR mixture (Promega, Madison, WI; 0.2 mM each dNTP/2.2 mM MgCl 2 /50 MM KCl/10 mM Tris-HCl, pH 9.0/0.1% Triton-X-100) with Taq DNA polymerase (Promega) and assembled (without primers) using a PCR program of 35 cycles of 94°C 30s, 45°C 30s, 72°C 30s, as described in Stem er, WPC (1994) Nature 370: 389, incorporated herein by reference.
  • DNA sequencing was performed on an Applied Biosystem ⁇ 391 DNA sequencer.
  • CHO cell expression of GFP The wildtype and the cycle 2 and 3 mutant ver ⁇ ion ⁇ of the GFP gene were tran ⁇ ferred into the eukaryotic expression vector Alpha+ (16) as an EcoRI-Xbal fragment.
  • the plasmids were transfected into CHO cells by electroporation of IO 7 cells in 0.8 ml with 40 ⁇ g of plasmed at 400V and 250 ⁇ F. Tran ⁇ formants were selected using 1 mg/ml G418 for 10-12 days. FACS analysis was carried out on a Becton Dickinson
  • E. coli expressing the synthetic GFP construct ('wt') with altered codon usage yielded a nearly 3-fold greater whole cell fluorescence signal than cells expressing the 'Clontech' construct (Fig. 15A) .
  • the comparison was performed at full induction and at equal OD 600 .
  • the expres ⁇ ion vectors and GFP promoters are quite different. The cause of the improved fluorescence signal is not enhanced expres ⁇ ion level, it is improved protein performance.
  • native GFP has a hydrophobic ⁇ ite on it ⁇ ⁇ urface by which it normally bind ⁇ to Aequorin, or to another protein.
  • the hydrophobic site may cau ⁇ e aggregation and prevent autocatalytic activation of the chromophore.
  • the three hydrophilic mutation ⁇ may counteract the hydrophobic site, resulting in reduced aggregation and increased chromophore activation.
  • Pulse chase experiments with whole bacteria at 37°C showed that the T 1/2 for fluorophore formation was 95 minutes for both the 'wt' and the •cycle 3' mutant GFP.
  • CHO cells Improvements in autonomous characteristics such as self-folding can be tranferable to different cellular environments.
  • the 'cycle 3' mutant GFP was transferred into the eukaryotic Alpha+ vector and expressed in Chinese ham ⁇ ter ovary cell ⁇ (CHO) .
  • CHO Chinese ham ⁇ ter ovary cell ⁇
  • the 'cycle 3' construct gave a 16-l ⁇ -fold stronger signal than the 'wt' con ⁇ truct
  • fluore ⁇ cence spectroscopy of CHO cells expres ⁇ ing the 'cycle 3' mutant ⁇ howed a 42-fold greater whole cell fluore ⁇ cence signal than the 'wt' construct under identical conditions (Fig. 18A) .
  • FACS sorting confirmed that the average fluorescence signal of CHO cell clones expres ⁇ ing 'cycle 3' was 46-fold greater than cells expressing the 'wt' construct (Fig. 18B) .
  • the addition of 2 mM sodium butyrate was found to increase the fluorescence signal about 4-8 fold.
  • Suitable methods include site-directed mutagenesis, cas ⁇ ette mutagene ⁇ i ⁇ , and error-prone PCR.
  • DNA shuffling The di ⁇ closed method for generating mutations . in vitro is known as DNA shuffling.
  • genes are broken into small, random fragments with DNase I, and then reassembled in a PCR-like reaction, but typically without any primers.
  • the process of reassembling can be mutagenic in the absence of a proof-reading polymerase, generating up to about 0.7% error rate.
  • These mutations consist of both transitions and transversion, often randomly distributed over the length of the reassembled segment.
  • Second generation libraries of displayed peptides and antibodies were generated and isolated phage with improved (i.e., 3-1000 fold) apparent binding strength were produced.
  • improved (i.e., 3-1000 fold) apparent binding strength were produced.
  • An oligonucleotide is designed such that can it base-pair to a target DNA, while differing in one or more bases near the center of the oligonucleotide.
  • this oligonucleotide i ⁇ ba ⁇ e-paired to the ⁇ ingle- ⁇ tranded template DNA the heteroduplex i ⁇ converted into double-stranded DNA in vitro; in this manner one ⁇ trand of the product will carry the nucleotide ⁇ equence ⁇ pecific by the mutagenic oligonucleotide.
  • These DNA molecules are then propagated in vivo and the desired recombinant i ⁇ ultimately identified among the population of tran ⁇ formant ⁇ .
  • the oligonucleotide should be synthesized with a 5'P0 4 group, as it improves the efficiency of the mutagenesis procedure; this group can al ⁇ o be added enzymatically with T4 polynucleotide kinase.
  • this group can al ⁇ o be added enzymatically with T4 polynucleotide kinase.
  • Cas ⁇ ette mutagene ⁇ is A convenient means of introducing mutations at a particular site within a coding region is by cassette mutagenesis.
  • the "cassette” can be generated several different ways: A) by annealing two oligonucleotides together and converting them into double stranded DNA; B) by first amplifying segments of DNA with oligonucleotides that carry randomized sequences and then reamplifying the DNA to create the cassette for cloning; C) by first amplifying each half of the DNA segment with oligonucleotides that carry randomized sequence ⁇ , and then heating the two pieces together to create the cas ⁇ ette for cloning; and D) by error-prone PCR.
  • the ca ⁇ ette ⁇ formed by the ⁇ e four procedures are fixed in length and coding frame, but have codons which are unspecified at a low frequency.
  • cloning and expre ⁇ sion of the cassettes will generate a plurality of peptides or proteins that have one or more mutant residues along the entire length of the cas ⁇ ette.
  • two types of mutagenesis ⁇ cheme can be u ⁇ ed.
  • certain residue ⁇ in a phage-displayed protein or peptide can be completely randomized.
  • the codons at these positions can be NNN, NNK, or NNS which use 32 codons to encode all 20 residue ⁇ .
  • oligonucleotides can al ⁇ o be ⁇ ynthe ⁇ ized a ⁇ preformed triplets or by mixing oligonucleotides synthesized by the split-re ⁇ in method which together cover all 20 codon ⁇ at each de ⁇ ired po ⁇ ition. Conversely, a sub ⁇ et of codons can be used to favor certain amino acids and exclude others. Second, all of the codons in the cassette can have some low probability of being mutated. This is accompli ⁇ hed by synthesized oligonucleotides with bottles "spiked" with the other three bases or by altering the ratio of oligonucleotides mixed together by the split-resin method.
  • ca ⁇ sette mutagenesis with synthetic oligonucleotide is generally preferred. More than one cassette can be used at a time to alter several regions simultaneously. This approach i ⁇ preferred when creating a library of mutant antibodie ⁇ , where all six complementarity determining regions (CDR) are altered concurrently.
  • CDR complementarity determining regions
  • oligonucleotide synthesizer deliver equimolar amounts of each base for N, guanosine and cytosine for K, guanosine and thymidine for S. "Spiked" codons
  • the doping ratio can also differ based on the average amino acid use in natural globular proteins or other algorithms.
  • CyberDope which can be u ⁇ ed to aid in determining the ba ⁇ e mixture ⁇ for ⁇ ynthesizing oligonudeotides with particular doping schemes.
  • a demonstration copy of the CyberDope program can be obtained by sending an email reque ⁇ t to cyberdope@aol.com.
  • Directed codon ⁇ 1. De ⁇ ign oligonucleotides with both fixed and mutated position ⁇ . The fixed po ⁇ ition ⁇ ⁇ hould correspond to the cloning sites and those coding regions presumed to be essential for binding or function. One method has been de ⁇ cribed for in ⁇ erting a set of oligonucleotides at a specific restriction enzyme site that encodes all twenty amino acids (Kegler-Ebo et al. (1994) Nucl. Acids Res. 22: 1593, incorporated herein by reference). 2. During synthesis of the oligonucleotide split the resin at each codon.
  • the PCR reaction is optionally monitored by gel electrophoresi ⁇ .
  • the PCR product is dige ⁇ ted with the appropriate re ⁇ triction enzyme( ⁇ ) to generate sticky end ⁇ .
  • the restriction fragments can be gel purified.
  • the DNA segment is cloned into a suitable vector by ligation and introduced into host cells.
  • DNA Shuffling In DNA shuffling, genes are broken into small, random fragments with a phosphodiester bond lytic agent, such as DNa ⁇ e I, and then rea ⁇ embled in a PCR-like reaction, but without requirement for any added primers. The process of reassembling can be mutagenic in the absence of a proof-reading polymerase, generating up to approximately 0.7% error when 10-50 bp fragments are used. 1. PCR amplify the fragment to be shuffled. Often it is convenient to PCR from a bacterial colony or plaque.
  • a phosphodiester bond lytic agent such as DNa ⁇ e I
  • the desired DNA fragment size range is gel purified from a 2% low melting point agarose gel or equivalent.
  • a preferred method is to insert a small piece of Whatman DE-81 ion- exchange paper just in front of the DNA, run the DNA into the paper, put the paper in 0.5 ml 1.2 M NaCl in TE, vortex 30 sec, then carefully spin out all the paper, transfer the supernatant and add 2 volumes of 100% ethanol to precipitate the DNA; no cooling of the sample should be necessary. The DNA pellet is then washed with 70% ethanol to remove traces of salt.
  • the DNA pellet is resu ⁇ pended in PCR mix (Promega, Madison, WI) containing 0.2 mM each DNTP, 2.2 mM MgCl 2 ,50 mM KCl, 10 mM Tris-HCl, pH 9.0, 0.1% Triton X100, at a concentration of about 10-30 ng of fragments per ⁇ l of PCR mix (typically 100-600 ng per 10-20 ⁇ l PCR reaction) . Primers are not required to be added in thi ⁇ PCR reaction.
  • Taq DNA polymera ⁇ e (Promega, Madi ⁇ on, WI) alone can be u ⁇ ed if a ⁇ ub ⁇ tantial rate of mutagene ⁇ i ⁇ (up to 0.7% with 10-50 bp DNA fragment ⁇ ) is desired.
  • the inclu ⁇ ion of a proof-reading polymerase such as a 1:30 (vol/vol) mixture of Taq and Pfu DNA polymerase (Stratagene, San Diego, CA) is expected to yield a lower error rate and allows the PCR of very long sequences.
  • a program of 30-45 cycles of 30 sec 94°C, 30 sec 45-50°C, 30 sec 72°C, hold at 4°C is used in an MJ Research PTC-150 minicycler (Cambridge, MA) .
  • the maximal ⁇ of the a ⁇ embly can be checked by gel analysis.
  • the PCR product at this point contains the correct size product in a ⁇ mear of larger and ⁇ maller ⁇ ize ⁇ .
  • the correctly reassembled product of this fir ⁇ t PCR is amplified in a second PCR reaction which contains outside primer ⁇ .
  • Aliquot ⁇ of 7.5 ⁇ l of the PCR rea ⁇ e bly are diluted 40x with PCR mix containing O. ⁇ pM of each primer.
  • a PCR program of 20 cycles of 30 sec 94°C, 30 sec 50°C, and 30-45 sec at 72°C is run, with 5 min at 72°C at the end.
  • the desired PCR product is then digested with terminal restriction enzymes, gel purified, and cloned back into a vector, which is often introduced into a ho ⁇ t cell.
  • Site-specific recombination can also be u ⁇ ed, for example, to ⁇ huffie heavy and light antibody chains in ⁇ ide infected bacterial cells as a means of increasing the binding affinity and specificity of antibody molecules. It is possible to use the Cre/lox sy ⁇ tem (Waterhou ⁇ e et al. (1993) Nucl. Acid ⁇ Re ⁇ . 21: 2265; Griffith ⁇ et al. (1994) EMBO J. 12: 3245, incorporated by reference) and the int system.
  • Arsenic detoxification is important for goldmining of arsenopyrite containing gold ores and other uses, such as environmental remediation.
  • Pla ⁇ mid pGJ103, containing an operon encoding ar ⁇ enate detoxification operon Wang et al. (1989)
  • Bacteriol. 171: 83, incorporated herein by reference) wa ⁇ obtained from Prof. Simon Silver (U. of Illinois, Chicago, IL) .
  • E. coli TGI containing pJG103 containing the pl258 ars operon cloned into pUC19, had a MIC (minimum inhibitory concentration) of 4 ⁇ g/ml on LB amp plates.
  • the whole 5.5 kb plasmid was fragmented with DNAse I into fragments of 100-1000 bp, and reas ⁇ embled by PCR u ⁇ ing the Perkin Elmer XL-PCR reagents. After as ⁇ embling, the plasmid was digested with the unique restriction enzyme BamHI.
  • the full length monomer was purified from the agarose gel, ligated and electroporated into E . coli TGI cells.
  • the tranformed cells were plates on a range of sodium arsenate concentrations (2, 4, 8, 16 mM in round 1), and approx. 1000 colonies from the plates with the highest arsenate levels were pooled by scraping the plates.
  • the cells were grown in liquid in the presence of the same concentration of arsenate, and plasmid was prepared from this culture.
  • Round 2 and 3 were identical to round 1, except that the cells were plated at higher arsenate levels. 8, 16, 32, 64 mM were used for round 2; and 32, 64, 12 ⁇ , 256 mM were used for selection of round 3.
  • One of the improved strain ⁇ showed that the TGI (wildtype pGGJ103) grew in liquid at up to 10 mM, whereas the shuffled TGI(mutant pGJ103) grew at up to 150 mM arsenate concentration.
  • PCR program for the assembly was 94°C 20s, 50x(94°C 15s, 50°C 1 min, 72°C 30s+2s/cycle) , u ⁇ ing a circular PCR format without primer ⁇ .
  • Figure 19 shows enhancement of resistance to arsenate toxicity as a result of ⁇ huffling the pGJ103 plasmid containing the arsenate detoxification pathway operon.
  • Plasmid pYW333 containing an operon for mercury detoxification i ⁇ a 15.5 kb plasmid containing at least ⁇ genes encoding a pathway for mercury detoxification (Wang et al. (19 ⁇ 9) Bacteriol. 171: ⁇ 3, incorporated herein by reference), was obtained from Prof. Simon Silver (Univ. Illinois, Chicago, IL) . 400-1500 bp fragments were obtained as de ⁇ cribed ⁇ upra and a ⁇ sembled with the XL-PCR reagents. After direct electroporation of the as ⁇ embled DNA into to E.
  • the cell ⁇ were plated on a range of levels of mercury chloride (Sigma) under a similar protocol as that described for arsenate in Example 15.
  • the initial MIC of mercury was 50-70 ⁇ M.
  • Four cycle ⁇ of whole plasmid shuffling were performed and increased the detoxification measured a ⁇ bacterial re ⁇ istance to mercury from about 50-70 ⁇ M to over 1000 ⁇ M, a 15-20 fold improvement.
  • Example 18 Seguence Shuffling via PCR Stuttering
  • Stuttering is fragmentation by incomplete polymerase extension of templates.
  • a recombination format based on very short PCR extension times was employed to create partial PCR products, which continue to extend off a different template in the next (and sub ⁇ equent) cycle(s).
  • This format has significant limitations for the application to complex pools. If used with a rapid cycler such as the aircycler, this format may work better.
  • PCR programs used for PCR stuttering were 100 cycles of (94°C 15 sec, 60°C 15 sec) . Two separate PCR reactions were run to obtain 1 kb PCR fragments containing the each of two GFP- negative recombination assay substrates (GFPstopl and GFP stop2) . GFP-positive recombinants can only be obtained by recombination of these two template ⁇ .
  • the oligonucleotide primers used at the 5' end is 5 'TAGCGGATCCTACCTACCTGACGC, containing an Nhel site, and the oligo at the 3' end is 5'GAAAATCTTCTCTCATCC, containing an EcoRI site.
  • a PCR reaction was ⁇ et up with a Ing of each GFP- negative gene as a template.
  • Taq PCR reagents can be used, but the use of error-prone PCR conditions (Leung, 1989; Cadwell and Joyce, 1992) which reduce the processivity, can increa ⁇ e the percentage of GFP-positive recombinants.
  • the stuttered PCR product was digested with Nhel and Eco RI and cloned back into pBAD18 vector digested with Nhel and EcoRI and electroporated into E. coli and plated on amp plates.
  • GFP- positive colonies ari ⁇ e by recombination between the two gFP- negative DNA sequences and were detected.
  • the percentage of GFP- positive colonies obtained by stuttering was between 0.1-10%, depending on conditions.
  • a synthetic gene was designed for each protein, using the identical (optimal E.coli) codon usage based on the native amino acid sequence.
  • Each of the four gene ⁇ was a ⁇ sembled from 30 60 mer oligo ⁇ and 6 40 mers. The assembly was performed by a ⁇ sembly PCR as described by Stemmer et al (1995; Gene 164:49-53). After assembling, the genes were cloned into Sfi 1 sites of the vector pUC322 Sfi-BLA- Sfi (Stemmer et al (1995) Gene 164:49-53), and plated on a selective media.
  • Cefotaxime was one of the antibiotics that was selected for optimization against.
  • the four genes were shuffled by pooling 1 ug of the CR product of each gene, followed by DNAsel digestion of the pool and purification of 100-300 bp fragments from agarose gels. The purified fragments were reas ⁇ embled by ⁇ exual PCR initially without outside primer ⁇ , and then the full-length product wa ⁇ amplified in the presence of the out ⁇ ide primers.
  • the resulting full-length genes were digested with Sfil and ligated into fresh pUC322Sfi-Sfi vector and electroporated into fresh E. coli cells, and plated on increasing concentration of several antibiotics, including cefotaxime, as described previously by Stemmer (1994) Nature 370:369-391.
  • a manual shuffling PCR protocol is preferred for the mixing of genes that are less than 80-90% homologous.
  • the manual PCR uses a heat-labile DNA polymerase, such as DNA poll Klenow fragment.
  • V H 251-V L A25 was obtained from an Ab-phage library constructed from naive human mRNA by selection for binding to diptheria toxin.
  • This scFv framework was used to construct a naive Ab-phage library containing six synthetically mutated CDRs based on the germline sequences. The degree of mutagenesis of each residue was similar to its naturally occurring variability within its V- region family.
  • a PCR product containing the scFv gene was randomly fragmented with DNasel dige ⁇ tion and fragment ⁇ of 50-100 bp were purified. Synthetic oligonucleotides, each containing a mutated CDR flanked by 19 bp of homology to the scFv template, were added to the random fragments at a 10:1 molar ratio. A library of full length, mutated scFV genes was reassembled from the fragments by ⁇ exual PCR. Cloning into the pill protein of M13 phage yielded an Ab-phage library of 4 X 10 7 plaque-forming unit ⁇ .
  • mutant and native CDR ⁇ were characterized by colony PCR with primers specific for the native CDRs (see. Fig. 7) . All six mutated CDRs were incorporated with 32-65% efficiency and a wide variety of combinations. Sequencing of the mutated CDRs showed that the observed mutation rate matched the expected rate.
  • This Ab-phage library was panned for two rounds in microtiter plates for binding to ten human protein targets, and seven of these targets yielded ELISA-positive clones.
  • One target which resulted in positive clones was the human G-CSF receptor.
  • the G-CSF receptor positive clones were ⁇ ubjected to a second round and one quarter of second round phage clones were ELISA- positive for binding to the G-CSF receptor.
  • This diverse pool was used to evaluate the suitability of three different sequence optimization strategie ⁇ (conventional PCR, error-prone PCR, and DNA shuffling) . After a single cycle of each of these alternatives, the DNA shuffling showed a seven-
  • neutral or weakly contributing mutation ⁇ were removed by two cycle ⁇ of backcro ⁇ sing, with a 40-fold excess of a synthetically constructed germline scFv gene, followed by stringent panning.
  • the backcrossed Ab phage clones were shown to bind strongly and with excellent specificity to the human G-CSF receptor. Fig.
  • Fig. 33 show ⁇ the relative recovery rates of phage, by panning with BSA, Ab 179, or G-CSF receptor, after conventional PCR ("non-shuffled”) , error-prone PCR, or recursive sequence recombination (“shuffled”) .
  • the plasmid vector pCMV-GFP which encode ⁇ GFP and expresses it under the control of a CMV promoter, was grown in TGI cells and used to transfect CHO cells for transient expres ⁇ ion as ⁇ ays.
  • Plasmid was rescued from FACS selected transiently expressing TGI cells by a proteinase K method or a PreTaq method (Gibco/BRL) . Ba ⁇ ically, the FACS collected cell ⁇ were pelleted by centrifugation, freeze-thawed repetitively, incubated with either proteinase K or PreTaq, phenol/chloroform extracted, ethanol precipitated, used to transform E. coli which were then plated on Amp plates. The re ⁇ ults were:
  • Proteina ⁇ e K method input - 5 x IO 4 rescued 3 x IO 4
  • PreTaq method input - 5 x 10 4 rescued 2 x IO 4
  • the re ⁇ cued plasmid was grown up and 5 ⁇ g was partially digested with DNAsel and 50 to 700 bp fragments were gel purified, ethanol precipitated, and resuspended in 330 ⁇ l of 3.3x PCR buffer, 44 ⁇ l Mg(OAc) 2 (Perkin-Elmer), 193 ⁇ l 40% PEG, 80 ⁇ l 10 mM dNTPs, 20 ⁇ l Tth polymerase, 2 ⁇ l Pfu polymerase, 7 ⁇ l TMAC (Sigma) , and 367 ⁇ l H 2 0.
  • PCR wa ⁇ conducted on a MJ Research PTC- 150 minicycler for 40 cycle ⁇ (94°C, 30 sec; 50°C, 30 sec, 72°C, 60 ⁇ ec) with three ⁇ ets of primers, which yielded three end- overlapping PCR fragments, which together and after digestion and ligation reconstituted the entire plasmid.
  • the PCR fragments were digested with AlwNl and the fragments were gel purified, ligated, and electroporated into TGI cells.
  • Plasmid DNA wa ⁇ prepared and electroporated into CHO cells, which were screened by FACS for the cells transiently expressing the brightest GFP signals.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Analytical Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Ecology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Saccharide Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
PCT/US1996/019256 1995-02-17 1996-12-02 Methods for generating polynucleotides having desired characteristics by iterative selection and recombination Ceased WO1997020078A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
EP96940934A EP0876509B2 (en) 1995-11-30 1996-12-02 Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
AT96940934T ATE205877T1 (de) 1995-11-30 1996-12-02 Verfahren zur herstellung von polynukleotiden mit gewünschten eigenschaften durch iterative selektion und rekombination
AU10873/97A AU713952B2 (en) 1995-11-30 1996-12-02 Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
IL12467596A IL124675A0 (en) 1995-11-30 1996-12-02 Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
DE0876509T DE876509T1 (de) 1995-11-30 1996-12-02 Verfahren zur herstellung von polynukleotiden mit gewünschten eigenschaftendurch iterative selektion und rekombination
DK96940934.1T DK0876509T4 (da) 1995-11-30 1996-12-02 Fremgangsmåder til dannelse af polynukleotider med ønskede egenskaber ved hjælp af gentagen selektion og rekombination
DE69615406T DE69615406T3 (de) 1995-11-30 1996-12-02 Verfahren zur herstellung von polynukleotiden mit gewünschten eigenschaften durch iterative selektion und rekombination
JP52074497A JP4015193B2 (ja) 1995-11-30 1996-12-02 反復的選択および組換えにより所望の特徴を有するポリヌクレオチドを作製する方法
CA002239099A CA2239099C (en) 1995-11-30 1996-12-02 Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US08/769,062 US6335160B1 (en) 1995-02-17 1996-12-18 Methods and compositions for polypeptide engineering

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US08/564,955 1995-11-30
US08/564,955 US5811238A (en) 1994-02-17 1995-11-30 Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US08/621,859 US6117679A (en) 1994-02-17 1996-03-25 Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US08/621,859 1996-03-25

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US08/769,062 Continuation-In-Part US6335160B1 (en) 1994-02-17 1996-12-18 Methods and compositions for polypeptide engineering

Publications (1)

Publication Number Publication Date
WO1997020078A1 true WO1997020078A1 (en) 1997-06-05

Family

ID=27073702

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/019256 Ceased WO1997020078A1 (en) 1995-02-17 1996-12-02 Methods for generating polynucleotides having desired characteristics by iterative selection and recombination

Country Status (11)

Country Link
US (8) US6117679A (https=)
EP (4) EP1138763A3 (https=)
JP (3) JP4015193B2 (https=)
AT (2) ATE205877T1 (https=)
AU (1) AU713952B2 (https=)
CA (1) CA2239099C (https=)
DE (4) DE911396T1 (https=)
DK (2) DK0876509T4 (https=)
ES (2) ES2164929T5 (https=)
IL (1) IL124675A0 (https=)
WO (1) WO1997020078A1 (https=)

Cited By (269)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998039483A1 (en) * 1997-03-04 1998-09-11 Ventana Genetics, Inc. Methods for identifying nucleic acid sequences encoding agents that affect cellular phenotypes
WO1998058080A1 (en) * 1997-06-16 1998-12-23 Bioinvent International Ab A method for in vitro molecular evolution of protein function
DE19725371A1 (de) * 1997-06-16 1998-12-24 Bornholdt Stefan Dr Verfahren zur Beschleunigung der evolutiven Optimierung von Biopolymeren und zur Verbesserung der damit hergestellten Biopolymere
EP0906418A4 (https=) * 1996-03-25 1999-05-06
WO1999024562A1 (en) * 1997-11-12 1999-05-20 Genencor International, Inc. Method of increasing efficiency of directed evolution of a gene using phagemid
WO1999012033A3 (de) * 1997-08-28 1999-06-10 Otogene Biotechnologische Fors Verfahren und kit zur identifizierung von wechselwirkungen zwischen proteinen bzw. peptiden
EP0932670A4 (https=) * 1996-03-25 1999-08-04
WO1999041407A1 (de) * 1998-02-11 1999-08-19 Otogene Aktiengesellschaft Verfahren zur entwicklung eines pharmazeutischen wirkstoffes
WO1999041393A1 (en) * 1998-02-17 1999-08-19 Zeneca Limited Insecticidal peptides
WO1999041383A1 (en) * 1998-02-11 1999-08-19 Maxygen, Inc. Antigen library immunization
WO1999029882A3 (en) * 1997-12-10 1999-09-16 Pioneer Hi Bred Int Methods for altering the nutritional value of a plant protein, vegetative storage protein, vsp, by altering the amino acid content of proteins
WO1999041369A3 (en) * 1998-02-11 1999-09-23 Maxygen Inc Genetic vaccine vector engineering
WO2000009682A1 (en) * 1998-08-12 2000-02-24 Maxygen, Inc. Dna shuffling of monooxygenase genes for production of industrial chemicals
US6046925A (en) * 1997-04-14 2000-04-04 The Regents Of The University Of California Photochromic fluorescent proteins and optical memory storage devices based on fluorescent proteins
WO2000009727A3 (en) * 1998-08-12 2000-05-18 Maxygen Inc Dna shuffling to produce herbicide selective crops
EP1007727A1 (en) 1996-07-09 2000-06-14 Diversa Corporation Method of dna shuffling with polynucleotides produced by blockingor interrupting a synthesis or amplification process
WO2000006718A3 (en) * 1998-07-28 2000-06-15 California Inst Of Techn Expression of functional eukaryotic proteins
WO2000042559A1 (en) * 1999-01-18 2000-07-20 Maxygen, Inc. Methods of populating data structures for use in evolutionary simulations
WO2000020573A3 (en) * 1998-10-07 2000-07-20 Maxygen Inc Dna shuffling to produce nucleic acids for mycotoxin detoxification
WO2000031246A3 (en) * 1998-11-19 2000-08-17 S I S S A Scuola Internazional Methods for the preparation by in vivo recombination of nucleic acid and polypeptide libraries and uses thereof
US6117679A (en) * 1994-02-17 2000-09-12 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6132970A (en) * 1994-02-17 2000-10-17 Maxygen, Inc. Methods of shuffling polynucleotides
WO2000042560A3 (en) * 1999-01-19 2000-11-23 Maxygen Inc Methods for making character strings, polynucleotides and polypeptides
US6153410A (en) * 1997-03-25 2000-11-28 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
US6159687A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
US6165793A (en) * 1996-03-25 2000-12-26 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
WO2000053744A3 (en) * 1999-03-09 2001-01-18 Diversa Corp End selection in directed evolution
WO2001004287A1 (en) * 1999-07-07 2001-01-18 Maxygen Aps A method for preparing modified polypeptides
EP1009858A4 (en) * 1997-06-16 2001-03-07 Diversa Corp HIGH-THROUGHPUT SCREENING FOR NEW ENZYMES
EP0946755A4 (en) * 1996-12-18 2001-03-07 Maxygen Inc METHOD AND COMPOSITION FOR MANIPULATING POLYPEPTIDES
US6238884B1 (en) 1995-12-07 2001-05-29 Diversa Corporation End selection in directed evolution
DE19953854A1 (de) * 1999-11-09 2001-06-28 Max Planck Gesellschaft Verfahren zur Herstellung von Biopolymeren mit veränderten Eigenschaften
WO2001000234A3 (en) * 1999-06-25 2001-08-02 Maxygen Inc Methods and compositions for engineering of attenuated vaccines
EP1030861A4 (en) * 1997-10-31 2001-09-05 Maxygen Inc MODIFICATION OF VIRUSTROPISMIUS AND THE ECONOMIC SPECTRUM BY VIRAL GENOM MIXING
US6287862B1 (en) 1997-01-17 2001-09-11 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
EP1092041A4 (en) * 1999-03-26 2001-09-19 Diversa Corp EXONUCLEASE-MEDIATED ASSEMBLY OF NUCLEIC ACIDS IN THE DIRECT EVOLUTION
US6309883B1 (en) 1994-02-17 2001-10-30 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6319714B1 (en) 1999-01-19 2001-11-20 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
WO2001023401A3 (en) * 1999-09-28 2001-12-06 Maxygen Inc Use of codon-varied oligonucleotide synthesis for synthetic sequence recombination
WO2001032829A3 (en) * 1999-11-05 2001-12-13 Novozymes As Methods to screen microorganisms or gene libraries for products secreted from a cell
US6337186B1 (en) 1998-06-17 2002-01-08 Maxygen, Inc. Method for producing polynucleotides with desired properties
WO2002016625A2 (en) 2000-08-25 2002-02-28 Basf Plant Science Gmbh Plant polynucleotides encoding prenyl proteases
US6352842B1 (en) 1995-12-07 2002-03-05 Diversa Corporation Exonucease-mediated gene assembly in directed evolution
US6352859B1 (en) 1997-01-17 2002-03-05 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6358740B1 (en) 1999-03-05 2002-03-19 Maxygen, Inc. Recombination of insertion modified nucleic acids
US6358709B1 (en) 1995-12-07 2002-03-19 Diversa Corporation End selection in directed evolution
US6358712B1 (en) 1999-01-05 2002-03-19 Trustee Of Boston University Ordered gene assembly
US6361974B1 (en) 1995-12-07 2002-03-26 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
US6399383B1 (en) 1997-10-28 2002-06-04 Maxygen, Inc. Human papilloma virus vectors
WO2001051663A3 (en) * 2000-01-11 2002-06-13 Maxygen Inc Integrated systems and methods for diversity generation and screening
GB2370038A (en) * 2000-12-12 2002-06-19 Bioinvent Int Ab A method for in vitro molecular evolution of protein function
JP2002519038A (ja) * 1998-06-29 2002-07-02 フィロス インク. 多様性の高いライブラリーを製造する方法
WO2001075767A3 (en) * 2000-03-30 2002-07-04 Maxygen Inc In silico cross-over site selection
WO2002004630A3 (en) * 2000-07-10 2002-08-29 Ambion Inc Methods for recombinatorial nucleic acid synthesis
US6483011B1 (en) 1998-11-10 2002-11-19 Maxygen, Inc. Modified ADP-glucose pyrophosphorylase for improvement and optimization of plant phenotypes
US6500617B1 (en) 1998-05-01 2002-12-31 Maxygen, Inc. Optimization of pest resistance genes using DNA shuffling
WO2002022810A3 (en) * 2000-09-15 2003-02-27 Diversa Corp Combinatorial screening of mixed populations of organisms
US6531316B1 (en) 1999-03-05 2003-03-11 Maxyag, Inc. Encryption of traits using split gene sequences and engineered genetic elements
US6537776B1 (en) 1999-06-14 2003-03-25 Diversa Corporation Synthetic ligation reassembly in directed evolution
US6562594B1 (en) 1999-09-29 2003-05-13 Diversa Corporation Saturation mutagenesis in directed evolution
US6566057B1 (en) 1997-02-14 2003-05-20 Deltagen Proteomics, Inc. Methods and compositions for peptide libraries displayed on light-emitting scaffolds
WO2003075129A2 (en) 2002-03-01 2003-09-12 Maxygen, Inc. Methods, systems, and software for identifying functional bio-molecules
US6623922B1 (en) 1997-02-14 2003-09-23 Deltagen Proteomics Methods for identifying, characterizing, and evolving cell-type specific CIS regulatory elements
WO2003078583A2 (en) 2002-03-09 2003-09-25 Maxygen, Inc. Optimization of crossover points for directed evolution
US6632673B1 (en) 1999-08-12 2003-10-14 Pfizer, Inc. Directing the ratio of B2:B1 avermectins in Streptomyces avermitilis host cells
WO2003087313A2 (en) 2002-04-08 2003-10-23 Pioneer Hi-Bred International, Inc. Enhanced silk exsertion under stress
GB2388604A (en) * 2002-05-17 2003-11-19 Alligator Bioscience Ab Molecular evolution in vitro
JP2003536117A (ja) * 1999-01-18 2003-12-02 マキシジェン, インコーポレイテッド 進化シュミレーションにおける使用のためにデータ構造を居住させる方法
US6686515B1 (en) 1999-11-23 2004-02-03 Maxygen, Inc. Homologous recombination in plants
US6713279B1 (en) 1995-12-07 2004-03-30 Diversa Corporation Non-stochastic generation of genetic vaccines and enzymes
US6713281B2 (en) 1995-12-07 2004-03-30 Diversa Corporation Directed evolution of thermophilic enzymes
WO2004016649A3 (de) * 2002-07-19 2004-04-22 Amaxa Gmbh Verfahren zur herstellung eines künstlichen polypeptids und nach diesem verfahren hergestelltes künstliches protein
US6740506B2 (en) 1995-12-07 2004-05-25 Diversa Corporation End selection in directed evolution
US6764835B2 (en) 1995-12-07 2004-07-20 Diversa Corporation Saturation mutageneis in directed evolution
WO2004090099A2 (en) 2003-04-04 2004-10-21 Diversa Corporation Pectate lyases, nucleic acids encoding them and methods for making and using them
US6808904B2 (en) 1994-06-16 2004-10-26 Syngenta Participations Ag Herbicide-tolerant protox genes produced by DNA shuffling
EP1476563A2 (en) 2002-02-26 2004-11-17 E.I. Du Pont De Nemours And Company Method for the recombination of genetic elements
US6846635B1 (en) 1999-07-30 2005-01-25 Large Scale Proteomics Corp. Microarrays and their manufacture
US6858422B2 (en) 2000-07-13 2005-02-22 Codexis, Inc. Lipase genes
WO2005021714A2 (en) 2003-08-11 2005-03-10 Diversa Corporation Laccases, nucleic acids encoding them and methods for making and using them
EP1341909B1 (en) * 2000-12-12 2005-05-18 Alligator Bioscience AB A method for in vitro molecular evolution of protein function
US6902918B1 (en) 1998-05-21 2005-06-07 California Institute Of Technology Oxygenase enzymes and screening method
EP1518927A3 (en) * 1998-02-11 2005-06-22 Maxygen, Inc. Optimization of immunomodulatory properties of genetic vaccines
US6917882B2 (en) 1999-01-19 2005-07-12 Maxygen, Inc. Methods for making character strings, polynucleotides and polypeptides having desired characteristics
US6939689B2 (en) 1995-12-07 2005-09-06 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
US6951719B1 (en) 1999-08-11 2005-10-04 Proteus S.A. Process for obtaining recombined nucleotide sequences in vitro, libraries of sequences and sequences thus obtained
US6958213B2 (en) 2000-12-12 2005-10-25 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function
US6961664B2 (en) 1999-01-19 2005-11-01 Maxygen Methods of populating data structures for use in evolutionary simulations
WO2005123929A2 (en) 2004-06-09 2005-12-29 Pioneer Hi-Bred International, Inc. Plastid transit peptides
US6989250B2 (en) 1997-01-24 2006-01-24 Bioinvent International Ab Method for in vitro molecular evolution of protein function
WO2006009676A2 (en) 2004-06-16 2006-01-26 Diversa Corporation Compositions and methods for enzymatic decolorization of chlorophyll
US6991922B2 (en) 1998-08-12 2006-01-31 Proteus S.A. Process for in vitro creation of recombinant polynucleotide sequences by oriented ligation
US6995017B1 (en) 1994-02-17 2006-02-07 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US7018793B1 (en) 1995-12-07 2006-03-28 Diversa Corporation Combinatorial screening of mixed populations of organisms
US7024312B1 (en) 1999-01-19 2006-04-04 Maxygen, Inc. Methods for making character strings, polynucleotides and polypeptides having desired characteristics
US7074590B2 (en) 2000-06-23 2006-07-11 Maxygen, Inc. Chimeric promoters
US7074606B2 (en) 1996-07-10 2006-07-11 Lonza Ag Process for the preparation of (S) - or (R) -3,3,3-trifluoro-2-hydroxy-2-methylpropionic acid
US7083931B2 (en) 2003-04-04 2006-08-01 Stratagene California Renilla GFP mutants with increased fluorescent intensity and spectral shift
WO2006081976A1 (de) * 2005-02-05 2006-08-10 Bayer Healthcare Ag MUTANTEN DES FLUORESZIERENDEN PROTEINS CGFPs, SOWIE DEREN VERWENDUNG
US7094875B2 (en) 2000-06-23 2006-08-22 Maxygen, Inc. Co-stimulatory polypeptides
US7098010B1 (en) 2000-05-16 2006-08-29 California Institute Of Technology Directed evolution of oxidase enzymes
WO2006101584A2 (en) 2005-03-15 2006-09-28 Diversa Corporation Cellulases, nucleic acids encoding them and methods for making and using them
US7115712B1 (en) 1999-12-02 2006-10-03 Maxygen, Inc. Cytokine polypeptides
WO2006124667A2 (en) 2005-05-12 2006-11-23 Zymogenetics, Inc. Compositions and methods for modulating immune responses
US7148054B2 (en) 1997-01-17 2006-12-12 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US7153655B2 (en) 1998-06-16 2006-12-26 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function involving the use of exonuclease enzyme and two populations of parent polynucleotide sequence
US7166466B2 (en) 1997-12-08 2007-01-23 California Institute Of Technology Method for creating polynucleotide and polypeptide sequences
EP1749888A2 (en) 2000-04-05 2007-02-07 ZymoGenetics, Inc. Soluble zalpha11 cytokine receptors
US7179638B2 (en) 1999-07-30 2007-02-20 Large Scale Biology Corporation Microarrays and their manufacture by slicing
US7220563B2 (en) 2002-02-27 2007-05-22 California Institute Of Technology Glucose 6-oxidases
US7226768B2 (en) 2001-07-20 2007-06-05 The California Institute Of Technology Cytochrome P450 oxygenases
WO2007095398A2 (en) 2006-02-14 2007-08-23 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
US7262012B2 (en) 2002-05-17 2007-08-28 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function using varied exonuclease digestion in two polynucleotide populations
US7262042B2 (en) 2001-12-20 2007-08-28 Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) Alkaline protease from Bacillus gibsonii (DSM 14393) and washing and cleaning products comprising said alkaline protease
EP1073710A4 (en) * 1999-02-04 2007-12-19 Verenium Corp NON-STOCHASTIC DEVELOPMENT OF GENETIC VACCINES AND ENZYMES
EP1555316A3 (en) * 1998-02-11 2008-01-30 Maxygen, Inc. Antigen library immunization
WO2008036863A2 (en) 2006-09-21 2008-03-27 Verenium Corporation Phospholipases, nucleic acids encoding them and methods for making and using them
US7354734B2 (en) 2003-08-25 2008-04-08 Funzyme Biotechnologies Sa Fungal proteins and nucleic acids encoding same
US7384387B1 (en) 1999-02-11 2008-06-10 Maxygen, Inc. High throughput mass spectrometry
US7388085B2 (en) 2002-02-12 2008-06-17 Pfizer Inc Streptomyces avermitilis gene directing the ratio of B2:B1 avermectins
US7390619B1 (en) 1998-02-11 2008-06-24 Maxygen, Inc. Optimization of immunomodulatory properties of genetic vaccines
WO2008080093A2 (en) 2006-12-21 2008-07-03 Verenium Corporation Amylases and glucoamylases, nucleic acids encoding them and methods for making and using them
DE102007003143A1 (de) 2007-01-16 2008-07-17 Henkel Kgaa Neue Alkalische Protease aus Bacillus gibsonii und Wasch- und Reinigungsmittel enthaltend diese neue Alkalische Protease
WO2008095033A2 (en) 2007-01-30 2008-08-07 Verenium Corporation Enzymes for the treatment of lignocellulosics, nucleic acids encoding them and methods for making and using them
WO2008098198A2 (en) 2007-02-08 2008-08-14 The California Institute Of Technology Alkane oxidation by modified hydroxylases
EP1961293A2 (en) 2001-09-27 2008-08-27 Pioneer Hi-Bred International, Inc. Phytate polynucleotides and methods of use
WO2008105797A2 (en) 2006-06-30 2008-09-04 Bristol-Myers Squibb Company Polynucleotides encoding novel pcsk9 variants
US7430477B2 (en) 1999-10-12 2008-09-30 Maxygen, Inc. Methods of populating data structures for use in evolutionary simulations
US7435570B2 (en) 2003-08-11 2008-10-14 California Institute Of Technology Thermostable peroxide-driven cytochrome P450 oxygenase variants and methods of use
US7439021B2 (en) 1999-01-05 2008-10-21 Trustees Of Boston University Nucleic acid cloning
EP1982732A2 (en) 2000-02-11 2008-10-22 Maxygen Holdings Ltd. Factor VII or VIIA-like molecules
US7449187B2 (en) 2001-12-20 2008-11-11 Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) Alkaline protease from Bacillus gibsonii (DSM 14391) and washing and cleaning products comprising said alkaline protease
US7465567B2 (en) 2001-04-16 2008-12-16 California Institute Of Technology Peroxide-driven cytochrome P450 oxygenase variants
WO2009045627A2 (en) 2007-10-03 2009-04-09 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
WO2009046407A2 (en) 2007-10-04 2009-04-09 Zymogenetics, Inc. B7 FAMILY MEMBER zB7H6 AND RELATED COMPOSITIONS AND METHODS
US7524664B2 (en) 2003-06-17 2009-04-28 California Institute Of Technology Regio- and enantioselective alkane hydroxylation with modified cytochrome P450
DE102007051092A1 (de) 2007-10-24 2009-04-30 Henkel Ag & Co. Kgaa Subtilisin aus Becillus pumilus und Wasch- und Reinigungsmittel enthaltend dieses neue Subtilisin
WO2009059379A1 (en) 2007-11-07 2009-05-14 Dynamic Microbials Limited Antimicrobial compositions, formulations and uses thereof
WO2009067580A2 (en) 2007-11-20 2009-05-28 Pioneer Hi-Bred International, Inc. Maize ethylene signaling genes and modulation of same for improved stress tolerance in plants
WO2009065934A1 (en) * 2007-11-22 2009-05-28 Novozymes A/S Polypeptides having ferulic acid esterase activity and polynucleotides encoding same
US7544859B2 (en) 2000-02-09 2009-06-09 Basf Aktiengesellschaft Elongase gene and method for producing multiple-unsaturated fatty acids
WO2009088949A1 (en) 2008-01-03 2009-07-16 Verenium Corporation Transferases and oxidoreductases, nucleic acids encoding them and methods for making and using them
US7569226B2 (en) 2001-12-22 2009-08-04 Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) Alkaline protease from Bacillus sp. (DSM 14392) and washing and cleaning products comprising said alkaline protease
EP2105446A2 (en) 1998-09-23 2009-09-30 ZymoGenetics, Inc. Cytokine receptor zalpha11
WO2009127729A1 (en) * 2008-04-17 2009-10-22 Novozymes A/S Polypeptides having ferulic acid esterase activity and polynucleotides encoding same
EP2112227A1 (en) 2006-03-07 2009-10-28 Cargill, Incorporated Aldolases, nucleic acids encoding them and methods for making and using them
EP2130919A1 (en) 2001-11-05 2009-12-09 ZymoGenetics, Inc. IL-21 antagonists
EP2133098A1 (en) 2000-01-10 2009-12-16 Maxygen Holdings Ltd G-CSF conjugates
WO2010025395A2 (en) 2008-08-29 2010-03-04 Verenium Corporation Hydrolases, nucleic acids encoding them and methods for making and using them
EP2192132A2 (en) 2005-02-08 2010-06-02 ZymoGenetics, Inc. Anti-IL-20, anti-IL22 and anti-IL-22RA antibodies and binding partners and methods of using in inflammation
EP2194133A2 (en) 2003-03-06 2010-06-09 Verenium Corporation Amylases, nucleic acids encoding them and methods for making and using them
EP2194130A1 (en) 1999-12-23 2010-06-09 ZymoGenetics, L.L.C. Cytokine ZCYTO18
WO2010065867A1 (en) 2008-12-04 2010-06-10 Pioneer Hi-Bred International, Inc. Methods and compositions for enhanced yield by targeted expression of knotted1
EP2213681A1 (en) 2002-03-22 2010-08-04 Bayer BioScience N.V. Novel Bacillus thuringiensis insecticidal proteins
EP2216403A2 (en) 2006-02-02 2010-08-11 Verenium Corporation Esterases and related nucleic acids and methods
JP2010178757A (ja) * 1999-01-19 2010-08-19 Maxygen Inc オリゴヌクレオチド媒介核酸組換え
WO2010101818A1 (en) 2009-03-02 2010-09-10 Pioneer Hi-Bred International, Inc. Nac transcriptional activators involved in abiotic stress tolerance
US7795030B2 (en) 1994-02-17 2010-09-14 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
EP2230299A1 (en) 2002-01-18 2010-09-22 ZymoGenetics, Inc. Novel cytokine ZCYTOR17 ligand
EP2241623A2 (en) 1999-07-07 2010-10-20 ZymoGenetics, Inc. Monoclonal antibody against a human cytokine receptor
WO2010135588A2 (en) 2009-05-21 2010-11-25 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2256199A1 (en) 1999-01-07 2010-12-01 ZymoGenetics, Inc. Therapeutic uses of BR43X2 soluble receptors
EP2258725A2 (en) 2000-06-26 2010-12-08 ZymoGenetics, L.L.C. Cytokine receptor zcytor17
EP2275536A1 (en) 2002-08-06 2011-01-19 Verdia, Inc. AP1 amine oxidase variants
WO2011017492A2 (en) 2009-08-05 2011-02-10 Pioneer Hi-Bred International, Inc. Novel eto1 genes and use of same for reduced ethylene and improved stress tolerance in plants
WO2011022597A1 (en) 2009-08-20 2011-02-24 Pioneer Hi-Bred International, Inc. Functional expression of shuffled yeast nitrate transporter (ynti) in maize to improve nitrate uptake under low nitrate environment
EP2289525A1 (en) 2002-06-07 2011-03-02 ZymoGenetics, Inc. Use of IL-21 for expanding lymphoid cells and for anticancer adoptive immunotherapy
EP2295577A2 (en) 1999-03-09 2011-03-16 ZymoGenetics, Inc. Human cytokine as ligand of the z-alpha receptor and uses thereof
EP2295455A1 (en) 2002-04-19 2011-03-16 ZymoGenetics, L.L.C. Cytokine receptor
EP2298871A1 (en) 2002-04-19 2011-03-23 Verenium Corporation Phospholipases, nucleic acids encoding them and methods for making and using them
WO2011046815A1 (en) 2009-10-16 2011-04-21 Bunge Oils, Inc. Oil degumming methods
WO2011046812A1 (en) 2009-10-16 2011-04-21 Verenium Corporation Phospholipases, nucleic acids encoding them and methods for making and using them
EP2322629A2 (en) 2003-04-29 2011-05-18 Pioneer Hi-Bred International Inc. Novel glyphosate-n-acetyltransferase (GAT) genes
EP2338910A1 (en) 2002-01-18 2011-06-29 ZymoGenetics, Inc. Cytokine receptor Zcytor17 multimers
US8017339B2 (en) 2002-02-21 2011-09-13 Alere San Diego, Inc. Compositions and kits for recombinase polymerase amplification
US8026085B2 (en) 2006-08-04 2011-09-27 California Institute Of Technology Methods and systems for selective fluorination of organic molecules
US8030000B2 (en) 2002-02-21 2011-10-04 Alere San Diego, Inc. Recombinase polymerase amplification
EP2385108A1 (en) 2006-03-07 2011-11-09 Verenium Corporation Aldolases, nucleic acids encoding them and methods for making and using them
US8062850B2 (en) 2005-07-25 2011-11-22 Alere San Diego, Inc. Methods for multiplexing recombinase polymerase amplification
US8071308B2 (en) 2006-05-04 2011-12-06 Alere San Diego, Inc. Recombinase polymerase amplification
WO2011156356A1 (en) 2010-06-09 2011-12-15 Zymogenetics, Inc. Dimeric vstm3 fusion proteins and related compositions and methods
EP2397486A1 (en) 2006-09-21 2011-12-21 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2404930A1 (en) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
US8106013B2 (en) 2006-05-19 2012-01-31 Georgia Tech Research Corporation ABC transporter ligand GATX1
EP2415864A1 (en) 2006-02-10 2012-02-08 Verenium Corporation Oligomerase-2 (or beta-xylosidase) enzymes, nucleic acids encoding them and methods for making and using them
WO2012021785A1 (en) 2010-08-13 2012-02-16 Pioneer Hi-Bred International, Inc. Compositions and methods comprising sequences having hydroxyphenylpyruvate dioxygenase (hppd) activity
EP2444413A1 (en) 2006-08-04 2012-04-25 Verenium Corporation Methods for oil or gas well drilling, washing and/or fracturing
US8178333B2 (en) 2008-06-24 2012-05-15 Codexis, Inc. Biocatalytic processes for the preparation of substantially stereomerically pure fused bicyclic proline compounds
US8252559B2 (en) 2006-08-04 2012-08-28 The California Institute Of Technology Methods and systems for selective fluorination of organic molecules
US8273554B2 (en) 2008-08-29 2012-09-25 Codexis, Inc. Ketoreductase polypeptides for the stereoselective production of (4S)-3-[(5S)-5-(4-fluorophenyl)-5-hydroxypentanoyl]-4-phenyl-1,3-oxazolidin-2-one
US8288131B2 (en) 2008-08-27 2012-10-16 Codexis, Inc. Ketoreductase polypeptides and uses thereof
US8288141B2 (en) 2008-08-27 2012-10-16 Codexis, Inc. Ketoreductase polypeptides for the production of 3-aryl-3-hydroxypropanamine from a 3-aryl-3-ketopropanamine
US8324158B2 (en) 2006-07-14 2012-12-04 Georgia Tech Research Corporation Methods for inhibiting CLC-2 channel with GATX2
EP2559702A1 (en) 2007-02-08 2013-02-20 Domantis Limited Antibody single variable domains against serum albumin
US8383346B2 (en) 2008-06-13 2013-02-26 Codexis, Inc. Combined automated parallel synthesis of polynucleotide variants
US8426178B2 (en) 2008-08-27 2013-04-23 Codexis, Inc. Ketoreductase polypeptides for the production of a 3-aryl-3-hydroxypropanamine from a 3-aryl-3-ketopropanamine
WO2013063006A1 (en) 2011-10-25 2013-05-02 Pioneer Hi-Bred International, Inc. Methods to alter plant cell wall composition for improved biofuel production and silage digestibility
US8460875B2 (en) 2002-02-21 2013-06-11 Alere San Diego, Inc. Recombinase polymerase amplification
EP2602263A2 (en) 2007-11-21 2013-06-12 Roskilde Universitet Polypeptides comprising an ice-binding activity
AU2009212959B2 (en) * 1999-06-14 2013-08-15 Bp Corporation North America Inc. Synthetic ligation reassembly in directed evolution
WO2013166113A1 (en) 2012-05-04 2013-11-07 E. I. Du Pont De Nemours And Company Compositions and methods comprising sequences having meganuclease activity
WO2013177400A1 (en) 2012-05-24 2013-11-28 Iowa State University Research Foundation, Inc. Arabidopsis nonhost resistance gene(s) and use thereof to engineer disease resistant plants
US8603949B2 (en) 2003-06-17 2013-12-10 California Institute Of Technology Libraries of optimized cytochrome P450 enzymes and the optimized P450 enzymes
US8653020B2 (en) 2008-01-25 2014-02-18 Aarhus Universitet Selective exosite inhibition of PAPP-A activity against IGFBP-4
EP2706122A2 (en) 2008-01-03 2014-03-12 Verenium Corporation Isomerases, nucleic acids encoding them and methods for making and using them
US8715962B2 (en) 2010-03-31 2014-05-06 Codexis, Inc. Production of geranyl diphosphate
US8715996B2 (en) 2009-02-26 2014-05-06 Codexis, Inc. Beta-glucosidase variant enzymes and related polynucleotides
WO2014088693A1 (en) * 2012-12-06 2014-06-12 Agilent Technologies, Inc. Molecular fabrication
US8796002B2 (en) 2009-06-22 2014-08-05 Codexis, Inc. Polypeptides for a ketoreductase-mediated stereoselective route to alpha chloroalcohols
WO2014120821A1 (en) 2013-01-31 2014-08-07 Codexis, Inc. Methods, systems, and software for identifying bio-molecules using models of multiplicative form
US8809021B2 (en) 2011-04-07 2014-08-19 Alere San Diego Inc. Monitoring recombinase polymerase amplification mixtures
WO2014153242A1 (en) 2013-03-14 2014-09-25 Pioneer Hi-Bred International, Inc. Compositions having dicamba decarboxylase activity and methods of use
WO2014152507A2 (en) 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Modulation of acc deaminase expression
WO2014150914A2 (en) 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Phi-4 polypeptides and methods for their use
WO2014153234A1 (en) 2013-03-14 2014-09-25 Pioneer Hi-Bred International, Inc. Compositions having dicamba decarboxylase activity and methods of use
WO2014202089A2 (en) 2013-06-18 2014-12-24 Roskilde Universitet Variants of anti-freeze polypeptides
WO2015023846A2 (en) 2013-08-16 2015-02-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2015038734A2 (en) 2013-09-13 2015-03-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP2853593A1 (en) 2003-03-07 2015-04-01 DSM IP Assets B.V. Hydrolases, nucleic acids encoding them and mehods for making and using them
US9005946B2 (en) 2009-03-17 2015-04-14 Codexis, Inc. Variant endoglucanases and related polynucleotides
US9040262B2 (en) 2010-05-04 2015-05-26 Codexis, Inc. Biocatalysts for ezetimibe synthesis
US9057097B2 (en) 2009-06-05 2015-06-16 Alere San Diego Inc. Recombinase polymerase amplification reagents and kits
EP2886658A1 (en) 2005-03-10 2015-06-24 BASF Enzymes LLC Lyase enzymes, nucleic acids encoding them and methods for making and using them
US9080192B2 (en) 2010-02-10 2015-07-14 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US9102959B2 (en) 2009-08-19 2015-08-11 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
WO2015120276A1 (en) 2014-02-07 2015-08-13 Pioneer Hi Bred International Inc Insecticidal proteins and methods for their use
WO2015120270A1 (en) 2014-02-07 2015-08-13 Pioneer Hi Bred International, Inc. Insecticidal proteins and methods for their use
US9221902B2 (en) 2008-11-07 2015-12-29 Fabrus, Inc. Combinatorial antibody libraries and uses thereof
WO2016061206A1 (en) 2014-10-16 2016-04-21 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
US9322007B2 (en) 2011-07-22 2016-04-26 The California Institute Of Technology Stable fungal Cel6 enzyme variants
WO2016114973A1 (en) 2015-01-15 2016-07-21 Pioneer Hi Bred International, Inc Insecticidal proteins and methods for their use
WO2016144688A1 (en) 2015-03-11 2016-09-15 Pioneer Hi Bred International Inc Insecticidal combinations of pip-72 and methods of use
US9469867B2 (en) 2009-05-20 2016-10-18 Alere San Diego, Inc. DNA glycosylase/lyase and AP endonuclease substrates
WO2016186986A1 (en) 2015-05-19 2016-11-24 Pioneer Hi Bred International Inc Insecticidal proteins and methods for their use
EP3115459A2 (en) 2008-05-23 2017-01-11 E. I. du Pont de Nemours and Company Novel dgat genes for increased seed storage lipid production and altered fatty acid profiles in oilseed plants
WO2017023486A1 (en) 2015-08-06 2017-02-09 Pioneer Hi-Bred International, Inc. Plant derived insecticidal proteins and methods for their use
WO2017044424A1 (en) 2015-09-08 2017-03-16 Theripion, Inc. Apoa-1 fusion polypeptides and related compositions and methods
WO2017046594A1 (en) * 2015-09-15 2017-03-23 Labgenius Ltd Compositions and methods for polynucleotide assembly
AU2015203225B2 (en) * 2004-06-01 2017-05-04 Abbott Diagnostics Scarborough, Inc. Recombinase Polymerase Amplification
WO2017105987A1 (en) 2015-12-18 2017-06-22 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP3190182A1 (en) 2004-03-08 2017-07-12 DSM IP Assets B.V. Phospholipases, nucleic acids encoding them and methods for making and using them
WO2017192560A1 (en) 2016-05-04 2017-11-09 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018005411A1 (en) 2016-07-01 2018-01-04 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
US9920102B2 (en) 2015-05-15 2018-03-20 Albert Einstein College Of Medicine, Inc. Fusion tags for protein expression
WO2018084936A1 (en) 2016-11-01 2018-05-11 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018111551A1 (en) 2016-12-14 2018-06-21 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018118811A1 (en) 2016-12-22 2018-06-28 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018136163A2 (en) 2016-12-09 2018-07-26 Theripion, Inc. Tandem apoa-1 fusion polypeptides
WO2018148001A1 (en) 2017-02-08 2018-08-16 Pioneer Hi-Bred International Inc Insecticidal combinations of plant derived insecticidal proteins and methods for their use
WO2018208882A1 (en) 2017-05-11 2018-11-15 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018226880A1 (en) * 2017-06-06 2018-12-13 Zymergen Inc. A htp genomic engineering platform for improving escherichia coli
EP3418929A1 (en) 2013-09-27 2018-12-26 Codexis, Inc. Automated screening of enzyme variants
WO2018226893A3 (en) * 2017-06-06 2019-01-10 Zymergen Inc. HIGH PERFORMANCE GENOMIC ENGINEERING PLATFORM (HTP) FOR THE IMPROVEMENT OF SACCHAROPOLYSPORA SPINOSA
EP2336361B1 (en) * 2004-06-01 2019-01-23 Alere San Diego, Inc. Kit for recombinase polymerase amplification
WO2019040335A1 (en) 2017-08-19 2019-02-28 University Of Rochester MICHELOLID DERIVATIVES, PREPARATION METHODS AND THEIR USE AS ANTICANCER AND ANTI-INFLAMMATORY AGENTS
EP3450549A1 (en) 2012-10-29 2019-03-06 University Of Rochester Artemisinin derivatives, methods for their preparation and their use as antimalarial agents
EP3460061A1 (en) 2008-09-26 2019-03-27 Tocagen Inc. Recombinant replication competent murine leukemia gamma-retrovirus (mlv) for the expression of heat-stabilized cytosine deaminase
WO2019178038A1 (en) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2019178042A1 (en) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
US10435674B2 (en) 2012-12-21 2019-10-08 Codexis, Inc. Engineered biocatalysts and methods for synthesizing chiral amines
WO2020198731A2 (en) 2019-03-28 2020-10-01 Danisco Us Inc Engineered antibodies
EP3579867A4 (en) * 2017-02-13 2021-03-10 Codexis, Inc. MANIPULATED PHENYLALANINE AMMONIA LYASE POLYPEPTIDES
WO2021142393A1 (en) 2020-01-10 2021-07-15 The Regents Of The University Of California Biosynthetic platform for the production of olivetolic avid and analogues of olivetolic acid
US11214817B2 (en) 2005-03-28 2022-01-04 California Institute Of Technology Alkane oxidation by modified hydroxylases
WO2022015619A2 (en) 2020-07-14 2022-01-20 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2022178078A1 (en) 2021-02-19 2022-08-25 Theripion, Inc. Paraoxonase fusion polypeptides and related compositions and methods
EP4122945A1 (en) 2013-12-23 2023-01-25 University of Rochester Methods and compositions for ribosomal synthesis of macrocyclic peptides
WO2023173084A1 (en) 2022-03-11 2023-09-14 University Of Rochester Cyclopeptibodies and uses thereof
WO2024259220A1 (en) 2023-06-15 2024-12-19 Theripion, Inc. Pon3 and evolved pon1 fusion polypeptides

Families Citing this family (384)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6395547B1 (en) 1994-02-17 2002-05-28 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6406855B1 (en) 1994-02-17 2002-06-18 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6936289B2 (en) 1995-06-07 2005-08-30 Danisco A/S Method of improving the properties of a flour dough, a flour dough improving composition and improved food products
US5958672A (en) 1995-07-18 1999-09-28 Diversa Corporation Protein activity screening of clones having DNA from uncultivated microorganisms
US20020028443A1 (en) * 1999-09-27 2002-03-07 Jay M. Short Method of dna shuffling with polynucleotides produced by blocking or interrupting a synthesis or amplification process
US6506602B1 (en) 1996-03-25 2003-01-14 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6696251B1 (en) 1996-05-31 2004-02-24 Board Of Trustees Of The University Of Illinois Yeast cell surface display of proteins and uses thereof
US20070009930A1 (en) * 1996-12-18 2007-01-11 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6159688A (en) 1997-03-18 2000-12-12 Novo Nordisk A/S Methods of producing polynucleotide variants
ES2168236T3 (es) 1997-04-09 2005-04-16 Danisco A/S Utilizacion de lipasa para mejorar las pastas de pan y los productos de panaderia.
GB9722131D0 (en) * 1997-10-20 1997-12-17 Medical Res Council Method
US6541011B2 (en) 1998-02-11 2003-04-01 Maxygen, Inc. Antigen library immunization
US6365408B1 (en) 1998-06-19 2002-04-02 Maxygen, Inc. Methods of evolving a polynucleotides by mutagenesis and recombination
ATE231186T1 (de) 1998-07-21 2003-02-15 Danisco Lebensmittel
US20040191772A1 (en) * 1998-08-12 2004-09-30 Dupret Daniel Marc Method of shuffling polynucleotides using templates
US20030092023A1 (en) * 1998-08-12 2003-05-15 Daniel Dupret Method of shuffling polynucleotides using templates
US20030104417A1 (en) * 1998-08-12 2003-06-05 Proteus S.A. Template-mediated, ligation-oriented method of nonrandomly shuffling polynucleotides
BR9915191A (pt) * 1998-11-10 2001-12-11 Maxygen Inc Métodos para obter um polinucleotìdeo isolado epara produzir uma célula recombinante,protoplasto de célula vegetal, coleção deprotoplastos de célula vegetal, vegetal,polinucleotìdeo, biblioteca, um ou mais membros debiblioteca e célula recombinante alvo
US6438561B1 (en) * 1998-11-19 2002-08-20 Navigation Technologies Corp. Method and system for using real-time traffic broadcasts with navigation systems
US20040005673A1 (en) * 2001-06-29 2004-01-08 Kevin Jarrell System for manipulating nucleic acids
US20030054390A1 (en) * 1999-01-19 2003-03-20 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US6368861B1 (en) 1999-01-19 2002-04-09 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US20070065838A1 (en) * 1999-01-19 2007-03-22 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US7873477B1 (en) 2001-08-21 2011-01-18 Codexis Mayflower Holdings, Llc Method and system using systematically varied data libraries
US7702464B1 (en) 2001-08-21 2010-04-20 Maxygen, Inc. Method and apparatus for codon determining
US8457903B1 (en) 1999-01-19 2013-06-04 Codexis Mayflower Holdings, Llc Method and/or apparatus for determining codons
US20090130718A1 (en) * 1999-02-04 2009-05-21 Diversa Corporation Gene site saturation mutagenesis
JP3399518B2 (ja) * 1999-03-03 2003-04-21 インターナショナル・ビジネス・マシーンズ・コーポレーション 半導体構造およびその製造方法
US8148110B2 (en) * 1999-03-15 2012-04-03 The Board Of Trustees Of The Leland Stanford Junior University Detection of molecular interactions by β-lactamase reporter fragment complementation
US20040137515A1 (en) * 1999-06-21 2004-07-15 Gary Lynch Methods and device for in vitro detection and characterization of psychoactives using analysis of repetitive electrical activity in a neuronal sample
US6759527B2 (en) 2001-03-20 2004-07-06 Lexicon Genetics Incorporated Human kinase and polynucleotides encoding the same
US6586230B1 (en) 2000-10-27 2003-07-01 Lexicon Genetics Incorporated Human kinase and polynucleotides encoding the same
US6797510B1 (en) * 2001-05-24 2004-09-28 Lexicon Genetics Incorporated Human kinases and polynucleotides encoding the same
US20080050809A1 (en) * 1999-09-28 2008-02-28 Alejandro Abuin Novel human kinases and polynucleotides encoding the same
US20040002474A1 (en) * 1999-10-07 2004-01-01 Maxygen Inc. IFN-alpha homologues
AU2001241939A1 (en) * 2000-02-28 2001-09-12 Maxygen, Inc. Single-stranded nucleic acid template-mediated recombination and nucleic acid fragment isolation
US7323299B2 (en) * 2000-03-21 2008-01-29 Neugenesis Corporation Methods for in vivo diversification of single genes
US20010049104A1 (en) * 2000-03-24 2001-12-06 Stemmer Willem P.C. Methods for modulating cellular and organismal phenotypes
US6479262B1 (en) 2000-05-16 2002-11-12 Hercules, Incorporated Solid phase enzymatic assembly of polynucleotides
EP1283877A2 (en) * 2000-05-23 2003-02-19 California Institute Of Technology Gene recombination and hybrid protein development
US20030032059A1 (en) * 2000-05-23 2003-02-13 Zhen-Gang Wang Gene recombination and hybrid protein development
US6686188B2 (en) * 2000-05-26 2004-02-03 Amersham Plc Polynucleotide encoding a human myosin-like polypeptide expressed predominantly in heart and muscle
EP1383881A2 (en) 2000-06-26 2004-01-28 Novozymes A/S Lipolytic enzymes from strains of fusarium and acremonium
US7846733B2 (en) * 2000-06-26 2010-12-07 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
AU2001271912A1 (en) * 2000-07-07 2002-01-21 Maxygen, Inc. Molecular breeding of transposable elements
US7087415B2 (en) * 2000-07-31 2006-08-08 Athena Biotechnologies, Inc. Methods and compositions for directed gene assembly
US20020132308A1 (en) * 2000-08-24 2002-09-19 Mpep @ Page 300-M Novel constructs and their use in metabolic pathway engineering
AU2002213183A1 (en) 2000-10-12 2002-04-22 Lexicon Genetics Incorporated Human kinases and polynucleotides encoding the same
US7045283B2 (en) 2000-10-18 2006-05-16 The Regents Of The University Of California Methods of high-throughput screening for internalizing antibodies
US7202070B2 (en) * 2000-10-31 2007-04-10 Biocatalytics, Inc. Method for reductive amination of a ketone using a mutated enzyme
WO2002042438A2 (en) 2000-11-20 2002-05-30 Lexicon Genetics Incorporated Human kinases and polynucleotides encoding the same
CA2431210A1 (en) * 2000-12-12 2002-06-20 Lexicon Genetics Incorporated Novel human kinases and uses thereof
CA2430329A1 (en) 2000-12-13 2002-06-20 Nugen Technologies, Inc. Methods and compositions for generation of multiple copies of nucleic acid sequences and methods of detection thereof
US20020150895A1 (en) * 2000-12-22 2002-10-17 Raymond Wheeler Method and apparatus for filtering and extending RNA alignment coverage
US20020086292A1 (en) 2000-12-22 2002-07-04 Shigeaki Harayama Synthesis of hybrid polynucleotide molecules using single-stranded polynucleotide molecules
WO2002059325A2 (en) * 2000-12-27 2002-08-01 Lexicon Genetics Incorporated Human kinases and polynucleotides encoding the same
EP1407029A2 (en) * 2001-01-23 2004-04-14 Lexicon Genetics Incorporated Novel human kinases and polynucleotides encoding the same
US8008459B2 (en) * 2001-01-25 2011-08-30 Evolva Sa Concatemers of differentially expressed multiple genes
WO2002059297A2 (en) * 2001-01-25 2002-08-01 Evolva Biotech A/S A library of a collection of cells
AU2002249170B2 (en) * 2001-02-02 2007-02-08 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V Method for identifying functional nucleic acids
US20050003354A1 (en) * 2001-02-21 2005-01-06 Maxygen, Inc. Methods for improving or altering promoter/enhancer properties
MXPA02012739A (es) * 2001-03-09 2004-04-20 Nugen Technologies Inc Metodos y composiciones para amplificacion de secuencias de arn.
US20030087254A1 (en) * 2001-04-05 2003-05-08 Simon Delagrave Methods for the preparation of polynucleotide libraries and identification of library members having desired characteristics
CA2443516A1 (en) * 2001-04-06 2002-10-17 Lexicon Genetics Incorporated Novel human kinases and polynucleotides encoding the same
AU2002258997A1 (en) * 2001-04-24 2002-11-05 Li-Cor, Inc. Polymerases with charge-switch activity and methods of generating such polymerases
EP1383887A4 (en) * 2001-05-03 2004-07-07 Rensselaer Polytech Inst NEW PROCEDURES FOR DIRECTED EVOLUTION
JP2004537986A (ja) 2001-05-09 2004-12-24 レキシコン・ジェネティクス・インコーポレーテッド 新規キナーゼおよびそれをコードするポリヌクレオチド
CA2447240C (en) * 2001-05-18 2013-02-19 Wisconsin Alumni Research Foundation Method for the synthesis of dna sequences
BR0209154A (pt) 2001-05-18 2004-07-20 Danisco Processo de preparação de uma massa com uma enzima
EP1390507A2 (en) * 2001-05-21 2004-02-25 Ecopia Biosciences Inc. Genes and proteins involved in the biosynthesis of enediyne ring structures
DK2295544T3 (en) 2001-06-26 2016-09-26 Novozymes As Polypeptides with cellobiohydrolase I activity and the same coding polynucleotides
US20030143612A1 (en) * 2001-07-18 2003-07-31 Pointilliste, Inc. Collections of binding proteins and tags and uses thereof for nested sorting and high throughput screening
AU2002355157A1 (en) * 2001-07-26 2003-02-17 Ecopia Biosciences Inc. Genes and proteins for the biosynthesis of rosaramicin
JP4473573B2 (ja) 2001-07-26 2010-06-02 ストラタジーン カリフォルニア 多部位突然変異誘発
US6833441B2 (en) 2001-08-01 2004-12-21 Abmaxis, Inc. Compositions and methods for generating chimeric heteromultimers
US20040078837A1 (en) * 2001-08-02 2004-04-22 Shannon Mark E. Four human zinc-finger-containing proteins: MDZ3, MDZ4, MDZ7 and MDZ12
US6979733B2 (en) * 2001-08-03 2005-12-27 Diversa Corporation Epoxide hydrolases, nucleic acids encoding them and methods of making and using them
US6943001B2 (en) * 2001-08-03 2005-09-13 Diversa Corporation Epoxide hydrolases, nucleic acids encoding them and methods for making and using them
US6987079B2 (en) * 2001-08-14 2006-01-17 W.R. Grace & Co.-Conn. Supported catalyst systems
US7647184B2 (en) * 2001-08-27 2010-01-12 Hanall Pharmaceuticals, Co. Ltd High throughput directed evolution by rational mutagenesis
DK2093286T3 (da) 2001-10-01 2013-05-13 Dyax Corp Flerkædede, eukaryote displayvektorer og anvendelser deraf
ES2411007T3 (es) 2001-10-10 2013-07-04 Novo Nordisk A/S Remodelación y glicoconjugación de péptidos
US20040005709A1 (en) * 2001-10-24 2004-01-08 Hoogenboom Henricus Renerus Jacobus Mattheus Hybridization control of sequence variation
US7175983B2 (en) * 2001-11-02 2007-02-13 Abmaxis, Inc. Adapter-directed display systems
GB0126887D0 (en) * 2001-11-08 2002-01-02 Univ London Method for producing and identifying soluble protein domains
US20110151438A9 (en) 2001-11-19 2011-06-23 Affymetrix, Inc. Methods of Analysis of Methylation
US7208295B2 (en) 2001-11-19 2007-04-24 Affymetrix, Inc. Multiplex oligonucleotide addition and target amplification
US6768476B2 (en) * 2001-12-05 2004-07-27 Etenna Corporation Capacitively-loaded bent-wire monopole on an artificial magnetic conductor
US20040137547A1 (en) * 2001-12-28 2004-07-15 Medtronic Minimed, Inc. Method for formulating a glucose oxidase enzyme with a desired property or properties and a glucose oxidase enzyme with the desired property
US20040009498A1 (en) * 2002-01-14 2004-01-15 Diversa Corporation Chimeric antigen binding molecules and methods for making and using them
US20040009530A1 (en) * 2002-01-16 2004-01-15 Wilson David S. Engineered binding proteins
WO2003062402A2 (en) * 2002-01-24 2003-07-31 Pointilliste, Inc. Use of collections of binding sites for sample profiling and other applications
EP1472349B1 (en) * 2002-01-25 2008-10-29 Evolva AG Methods for multiple parameter screening and evolution of cells to produce small molecules with multiple functionalities
US20040096826A1 (en) * 2002-01-30 2004-05-20 Evans Glen A. Methods for creating recombination products between nucleotide sequences
NZ534947A (en) 2002-02-22 2008-03-28 Progenics Pharm Inc Anti-CCR5 antibody that binds to CCR5 on the surface of a human cell.
US20030166010A1 (en) * 2002-02-25 2003-09-04 Affholter Joseph A. Custom ligand design for biomolecular filtration and purification for bioseperation
US20030224404A1 (en) * 2002-02-25 2003-12-04 Manuel Vega High throughput directed evolution of nucleic acids by rational mutagenesis
US7747391B2 (en) * 2002-03-01 2010-06-29 Maxygen, Inc. Methods, systems, and software for identifying functional biomolecules
IL163600A0 (en) * 2002-03-01 2005-12-18 Ravgen Inc Methods for detection of genetic disorders
US20050084907A1 (en) 2002-03-01 2005-04-21 Maxygen, Inc. Methods, systems, and software for identifying functional biomolecules
US6977162B2 (en) * 2002-03-01 2005-12-20 Ravgen, Inc. Rapid analysis of variations in a genome
JP2005519621A (ja) * 2002-03-11 2005-07-07 ニューゲン テクノロジーズ, インコーポレイテッド 3’一本鎖部分を含む二本鎖dnaを生成する方法および組換えのためのこれらの複合体の使用
WO2003089587A2 (en) * 2002-04-16 2003-10-30 Promega Corporation Method to enhance homologous recombination
IL164687A0 (en) * 2002-05-02 2005-12-18 Univ North Carolina Cellular libraries and methods for the preparationthereof
FR2839317A1 (fr) * 2002-05-06 2003-11-07 Entomed Procede d'evolution fonctionnelle artificielle de sequences polynucleotidiques, polynucleotides recombines obtenus et peptides, polypeptides et proteines codes par ceux-ci
US7442506B2 (en) * 2002-05-08 2008-10-28 Ravgen, Inc. Methods for detection of genetic disorders
US7727720B2 (en) * 2002-05-08 2010-06-01 Ravgen, Inc. Methods for detection of genetic disorders
US20070178478A1 (en) * 2002-05-08 2007-08-02 Dhallan Ravinder S Methods for detection of genetic disorders
DE60319259T2 (de) * 2002-06-14 2009-03-05 Dyax Corp., Cambridge Rekombination von nukleinsäurebibliotheksmitgliedern
GB0213816D0 (en) * 2002-06-14 2002-07-24 Univ Aston Method of producing DNA and protein libraries
WO2004009814A1 (en) * 2002-07-23 2004-01-29 Nuevolution A/S Gene shuffling by template switching
ATE486931T1 (de) 2002-07-25 2010-11-15 Bio Rad Laboratories Hybridpolymerase-verfahren und -zusammensetzungen
WO2004016791A1 (en) * 2002-08-01 2004-02-26 Evolva Ltd Methods of mixing large numbers of heterologous genes
US7047591B2 (en) * 2002-09-20 2006-05-23 Colgate-Palmolive Company Oral care implement
DE60332358D1 (de) * 2002-09-09 2010-06-10 Hanall Pharmaceutical Co Ltd Protease-resistente modifizierte interferon alpha polypeptide
US20050202438A1 (en) * 2002-09-09 2005-09-15 Rene Gantier Rational directed protein evolution using two-dimensional rational mutagenesis scanning
US20060020396A1 (en) * 2002-09-09 2006-01-26 Rene Gantier Rational directed protein evolution using two-dimensional rational mutagenesis scanning
US7563600B2 (en) 2002-09-12 2009-07-21 Combimatrix Corporation Microarray synthesis and assembly of gene-length polynucleotides
CN1700873B (zh) * 2002-09-20 2010-12-08 高露洁-棕榄公司 带有握持区的牙刷
AU2002951899A0 (en) * 2002-10-04 2002-10-24 Macquarie University Random drift mutagenesis
JP3447009B1 (ja) * 2002-10-29 2003-09-16 實 平垣 構築物用構成体およびその製造方法
US20050042623A1 (en) * 2002-10-30 2005-02-24 Dana Ault-Riche Systems for capture and analysis of biological particles and methods using the systems
US7135290B2 (en) * 2003-04-12 2006-11-14 Solazyme, Inc. Methods and compositions for evolving hydrogenase genes
US7090979B2 (en) * 2002-11-22 2006-08-15 The Regents Of The University Of California Derivatized versions of ligase enzymes for constructing DNA sequences
DE60328715D1 (de) 2002-12-20 2009-09-17 Novozymes As Polypeptide mit cellobiohydrolase ii-aktivität und dafür kodierende polynucleotide
US20050196766A1 (en) * 2003-12-24 2005-09-08 Soe Jorn B. Proteins
DE602004030000D1 (de) 2003-01-17 2010-12-23 Danisco Verfahren zur in-situ-herstellung eines emulgators in einem nahrungsmittel
US7955814B2 (en) 2003-01-17 2011-06-07 Danisco A/S Method
DK1599278T3 (da) 2003-01-17 2011-07-18 Danisco Fremgangsmåde til fremstilling af en hydroxysyreester
JP2007525148A (ja) 2003-01-21 2007-09-06 エコピア バイオサイエンシーズ インク ポリエンポリケチド、その生成方法及び医薬品としての使用[関連出願]本出願は、2003年1月21日出願の米国仮出願第60/441,123号、2003年8月13日出願の米国仮出願第60/494,568号、2003年5月13日出願の米国仮出願第60/469,810号及び2003年8月1日出願の米国仮出願第60/491,516号に対する優先権を主張するものである。
DE102004002243A1 (de) * 2003-02-07 2004-09-16 Trikon Technologies Limited, Newport Elektrostatische Klemmhalterung für dünne Wafer in einer Vakuumkammer zur Plasmabearbeitung
WO2004071641A2 (en) * 2003-02-10 2004-08-26 Pointilliste, Inc. Self-assembling arrays and uses thereof
PL1615945T3 (pl) 2003-04-09 2012-03-30 Ratiopharm Gmbh Sposoby glikopegylacji i białka/peptydy wytwarzane tymi sposobami
US7402386B2 (en) 2003-04-14 2008-07-22 Nugen Technologies, Inc. Global amplification using random priming by a composite primer
US20070073048A1 (en) 2003-05-15 2007-03-29 Ying Lian Hiv polynucleotides and polypeptides derived from botswana mj4
US20050048578A1 (en) * 2003-06-26 2005-03-03 Epitomics, Inc. Methods of screening for monoclonal antibodies with desirable activity
US20050053989A1 (en) * 2003-08-27 2005-03-10 Gil Sharon Libraries of recombinant chimeric proteins
US20070149496A1 (en) * 2003-10-31 2007-06-28 Jack Tuszynski Water-soluble compound
US7906307B2 (en) 2003-12-24 2011-03-15 Danisco A/S Variant lipid acyltransferases and methods of making
US7718408B2 (en) 2003-12-24 2010-05-18 Danisco A/S Method
GB0716126D0 (en) 2007-08-17 2007-09-26 Danisco Process
BRPI0417533B1 (pt) 2003-12-24 2016-03-01 Danisco enzima variante glicolipídio aciltransferase, uso e método para sua produção, método para o preparo de um produto alimentício e produto assado de farinha, processo de refinamento enzimático
WO2008090395A1 (en) 2007-01-25 2008-07-31 Danisco A/S Production of a lipid acyltransferase from transformed bacillus licheniformis cells
JP4891220B2 (ja) 2004-02-25 2012-03-07 ノボザイムス アクティーゼルスカブ 菌類細胞壁分解酵素
KR101225918B1 (ko) 2004-02-25 2013-01-24 파이어니어 하이 부렛드 인터내쇼날 인코포레이팃드 신규한 바실루스 투링기엔시스 결정 폴리펩티드,폴리뉴클레오티드, 및 이의 조성물
GB0405637D0 (en) 2004-03-12 2004-04-21 Danisco Protein
US7622125B2 (en) * 2004-05-05 2009-11-24 Novartis Vaccines And Diagnostics, Inc. Polycistronic HIV vector constructs
AU2005254972B2 (en) * 2004-06-09 2010-11-04 Wisconsin Alumni Research Foundation Rapid production of oligonucleotides
CN101052702B (zh) 2004-07-16 2013-01-09 杜邦营养生物科学有限公司 脂肪分解酶及其在食品工业中的应用
GB0421598D0 (en) 2004-09-29 2004-10-27 Cambridge Advanced Tech Modification of plant development and morphology
JP2008523786A (ja) * 2004-10-18 2008-07-10 コドン デバイシズ インコーポレイテッド 高忠実度合成ポリヌクレオチドのアセンブリ方法
US20060204979A1 (en) * 2004-12-01 2006-09-14 Invitrogen Corporation Reverse two-hybrid system for identification of interaction domains
US20070009928A1 (en) * 2005-03-31 2007-01-11 Lathrop Richard H Gene synthesis using pooled DNA
US8076108B2 (en) * 2005-04-26 2011-12-13 Cargill, Incorporated Polypeptides and biosynthetic pathways for the production of stereoisomers of monatin and their precursors
HUE029021T2 (en) 2005-06-21 2017-02-28 Xoma (Us) Llc IL-1beta-binding antibodies and fragments thereof
CA2621267A1 (en) * 2005-09-07 2007-03-15 Nugen Technologies, Inc. Improved nucleic acid amplification procedure
US20070129290A1 (en) * 2005-11-18 2007-06-07 Or Yat S Metabolite derivatives of the HDAC inhibitor FK228
GB2432366B (en) * 2005-11-19 2007-11-21 Alligator Bioscience Ab A method for in vitro molecular evolution of protein function
EP1973938B1 (en) * 2006-01-11 2011-04-06 Axxam S.P.A. Luminescent stem cells and uses thereof
US20070231805A1 (en) * 2006-03-31 2007-10-04 Baynes Brian M Nucleic acid assembly optimization using clamped mismatch binding proteins
EP2012801A4 (en) * 2006-04-24 2009-08-05 Gloucester Pharmaceuticals Inc GEMCITABINE COMBINATION THERAPY
US8957027B2 (en) * 2006-06-08 2015-02-17 Celgene Corporation Deacetylase inhibitor therapy
US8053191B2 (en) 2006-08-31 2011-11-08 Westend Asset Clearinghouse Company, Llc Iterative nucleic acid assembly using activation of vector-encoded traits
BRPI0721081A8 (pt) 2006-12-20 2015-12-15 Alellyx Sa Móleculas de ácidos nucléicos que codificam proteínas de plantas na família c3hc4 e processos para a alteração do conteúdo de celulose e lignina da planta
BRPI0720468A2 (pt) 2006-12-20 2014-01-14 Alellyx Sa Construtos de ácido nucleico e métodos para alterar o comprimento da fibra da planta e/ou a altura da planta
AU2007342028B2 (en) * 2006-12-29 2013-06-13 Celgene Corporation Purifiction of romidepsin
CN101687010A (zh) * 2006-12-29 2010-03-31 格洛斯特制药公司 制备Romidepsin
EP2118281A2 (en) 2007-02-12 2009-11-18 Codexis, Inc. Structure-activity relationships
EP2769731A1 (en) 2007-02-23 2014-08-27 The Trustees of Columbia University in the City of New York Methods to activate or block the HLA-E/QA-1 restricted CD8+ T cell regulatory pathway to treat immunological disease
HUE027683T2 (en) 2007-10-01 2016-10-28 Codexis Inc Ketoreductase polypeptides for the production of azetidinone
EP2612867A1 (en) 2007-11-01 2013-07-10 Perseid Therapeutics LLC Immunosuppressive polypeptides and nucleic acids
MX2010007014A (es) 2007-12-21 2010-09-30 Danisco Procedimiento para refinacion de aceite comestible utilizando una lipido aciltransferasa.
US8504498B2 (en) 2008-02-12 2013-08-06 Codexis, Inc. Method of generating an optimized, diverse population of variants
US8034568B2 (en) * 2008-02-12 2011-10-11 Nugen Technologies, Inc. Isothermal nucleic acid amplification methods and compositions
EP2250594B1 (en) * 2008-02-12 2017-04-19 Codexis, Inc. Method of generating an optimized, diverse population of variants
WO2009117698A2 (en) 2008-03-21 2009-09-24 Nugen Technologies, Inc. Methods of rna amplification in the presence of dna
GB0807161D0 (en) * 2008-04-18 2008-05-21 Danisco Process
US8357503B2 (en) 2008-08-29 2013-01-22 Bunge Oils, Inc. Hydrolases, nucleic acids encoding them and methods for making and using them
US8153391B2 (en) 2008-08-29 2012-04-10 Bunge Oils, Inc. Hydrolases, nucleic acids encoding them and methods for making and using them
WO2010033237A2 (en) * 2008-09-22 2010-03-25 Calmune Corporation Methods for creating diversity in libraries and libraries, display vectors and methods, and displayed molecules
US8247192B2 (en) 2008-11-10 2012-08-21 Codexis, Inc. Penicillin-G acylases
CN102282155B (zh) 2008-12-02 2017-06-09 日本波涛生命科学公司 磷原子修饰的核酸的合成方法
EP3623374B1 (en) 2008-12-03 2021-09-08 The Scripps Research Institute Stem cell cultures
WO2010080635A2 (en) * 2008-12-18 2010-07-15 Codexis, Inc. Recombinant halohydrin dehalogenase polypeptides
SG172783A1 (en) * 2008-12-25 2011-08-29 Codexis Inc Enone reductases
EP2396344A2 (en) 2009-02-13 2011-12-21 Novartis AG Nucleic acid molecule of a biosynthetic cluster encoding non ribosomal peptide synthases and uses thereof
JP5707344B2 (ja) 2009-02-26 2015-04-30 コデクシス, インコーポレイテッド トランスアミナーゼ生体触媒
US20120093775A1 (en) 2009-03-27 2012-04-19 Proyecto De Biomedicina Cima, S.L. Methods and compositions for the treatment of cirrhosis and liver fibrosis
CA2757040C (en) * 2009-03-31 2016-02-09 Codexis, Inc. Improved endoglucanases
CN102428177B (zh) 2009-05-19 2015-01-14 杜邦营养生物科学有限公司 提高面包耐码垛性的方法及其产品
AR077042A1 (es) 2009-06-12 2011-07-27 Danisco Metodo para tratar una composicion que contiene pirofiofitina
CA2765715A1 (en) 2009-06-16 2010-12-23 Codexis, Inc. .beta.-glucosidase variants
WO2011005477A1 (en) 2009-06-22 2011-01-13 Codexis, Inc. Transaminase reactions
RU2612521C2 (ru) 2009-07-06 2017-03-09 Онтории, Инк. Новые пролекарства нуклеиновых кислот и способы их применения
US8614081B2 (en) 2009-07-23 2013-12-24 Codexis, Inc. Nitrilase biocatalysts
WO2011028708A1 (en) 2009-09-04 2011-03-10 Codexis, Inc. Variant cbh2 cellulases and related polynucleotides
DK2483415T3 (en) 2009-09-30 2015-02-09 Codexis Inc RECOMBINANT C1 B-glucosidase FOR MANUFACTURE OF sugars from cellulosic BIOMASS
US10207240B2 (en) 2009-11-03 2019-02-19 Gen9, Inc. Methods and microfluidic devices for the manipulation of droplets in high fidelity polynucleotide assembly
GB0920089D0 (en) 2009-11-17 2009-12-30 Danisco Method
CA2780974C (en) 2009-11-20 2016-02-02 Codexis, Inc. Mutli-cellulase enzyme compositions for hydrolysis of cellulosic biomass
WO2011066185A1 (en) 2009-11-25 2011-06-03 Gen9, Inc. Microfluidic devices and methods for gene synthesis
MX2012006016A (es) 2009-11-25 2012-06-25 Codexis Inc Variantes de beta-glucosidasa recombinante para produccion de azucares solubles de biomasa celulosica.
CN102884178B (zh) 2009-12-08 2014-12-03 科德克希思公司 拉唑化合物的合成
WO2011085075A2 (en) 2010-01-07 2011-07-14 Gen9, Inc. Assembly of high fidelity polynucleotides
CN102844418B (zh) 2010-03-12 2015-11-25 杜邦营养生物科学有限公司 方法
WO2011114251A1 (en) 2010-03-18 2011-09-22 Danisco A/S Foodstuff
US8759064B2 (en) 2010-05-14 2014-06-24 Codexis, Inc. Cellobiohydrolase variants
WO2011150313A1 (en) 2010-05-28 2011-12-01 Codexis, Inc. Pentose fermentation by a recombinant microorganism
BR112012032176A2 (pt) 2010-06-17 2015-09-08 Dupont Nutrition Biosci Aps processo de tratamento de sementes que contém óleo, método de obtenção de óleo de sementes vegetais, processo de produção de um óleo vegetal refinado e óleo vegetal bruto ou refinado que pode ser obtido por meio de um método ou processo
NZ605526A (en) 2010-07-12 2015-04-24 Celgene Corp Romidepsin solid forms and uses thereof
EP2606139B1 (en) 2010-08-16 2015-07-15 Codexis, Inc. Biocatalysts and methods for the synthesis of (1r,2r)-2-(3,4-dimethoxyphenethoxy)cyclohexanamine
WO2012024662A2 (en) 2010-08-20 2012-02-23 Codexis, Inc. Expression constructs comprising fungal promoters
CA2807702C (en) 2010-08-20 2018-07-24 Codexis, Inc. Use of glycoside hydrolase 61 family proteins in processing of cellulose
US8859502B2 (en) 2010-09-13 2014-10-14 Celgene Corporation Therapy for MLL-rearranged leukemia
JP5868324B2 (ja) 2010-09-24 2016-02-24 株式会社Wave Life Sciences Japan 不斉補助基
US9096871B2 (en) 2010-10-06 2015-08-04 Bp Corporation North America Inc. Variant CBH I polypeptides with reduced product inhibition
WO2012061432A1 (en) 2010-11-02 2012-05-10 Codexis, Inc. Compositions and methods for production of fermentable sugars
ES2604114T3 (es) 2010-11-02 2017-03-03 Codexis, Inc. Cepas de hongos mejoradas
WO2012064975A1 (en) 2010-11-12 2012-05-18 Gen9, Inc. Protein arrays and methods of using and making the same
CN103502448B (zh) 2010-11-12 2017-03-29 Gen9股份有限公司 核酸合成的方法和设备
EP2649187B1 (en) 2010-12-08 2017-11-22 Codexis, Inc. Biocatalysts and methods for the synthesis of armodafinil
BR112013015829A2 (pt) 2010-12-21 2018-05-29 Codexis Inc variantes de endoglucanase
WO2012106579A1 (en) 2011-02-03 2012-08-09 Bristol-Myers Squibb Company Amino acid dehydrogenase and its use in preparing amino acids from keto acids
CA3004088A1 (en) 2011-02-23 2012-08-30 Dupont Nutrition Biosciences Aps Enzymatic treatment of plant oil
CN103797114A (zh) 2011-02-23 2014-05-14 杜邦营养生物科学有限公司 生产能够水解叶绿素或叶绿素衍生物的重组酶的方法
WO2012114232A1 (en) 2011-02-23 2012-08-30 Dupont Nutrition Biosciences Aps Process
US8663962B2 (en) 2011-03-30 2014-03-04 Codexis, Inc. Pentose fermentation by a recombinant microorganism
CA2830579A1 (en) 2011-04-08 2012-10-11 Danisco Us Inc. Compositions
HUE038800T2 (hu) 2011-04-13 2018-11-28 Codexis Inc Biokatalitikus eljárás eszlikarbazepin és ennek analógjai elõállítására
US8778652B2 (en) 2011-06-30 2014-07-15 Codexis, Inc. Pentose fermentation by a recombinant microorganism
CN103796657B (zh) 2011-07-19 2017-07-11 波涛生命科学有限公司 合成官能化核酸的方法
EP2748317B1 (en) 2011-08-22 2017-04-19 Codexis, Inc. Gh61 glycoside hydrolase protein variants and cofactors that enhance gh61 activity
US8945903B2 (en) 2011-08-23 2015-02-03 Codexis, Inc. Cellobiohydrolase variants
LT2944693T (lt) 2011-08-26 2019-08-26 Gen9, Inc. Kompozicijos ir būdai, skirti nukleorūgščių didelio tikslumo sąrankai
WO2013036861A1 (en) 2011-09-08 2013-03-14 Codexis, Inc Biocatalysts and methods for the synthesis of substituted lactams
WO2013048661A1 (en) 2011-09-30 2013-04-04 Codexis, Inc. Fungal proteases
BR112014010580B1 (pt) 2011-11-04 2021-01-12 Zymeworks, Inc. constructo de fc heteromultimérico isolado, composição, uso de um constructo de fc heteromultimérico isolado, composição de ácido nucléico e método para expressar o constructo de fc heteromultimérico isolado
IN2014CN04470A (https=) 2011-11-18 2015-09-04 Codexis Inc
US20140357727A1 (en) 2011-12-20 2014-12-04 Codexis, Inc. Fatty alcohol forming acyl reductase (far) variants and methods of use
BR112014015030A2 (pt) 2011-12-20 2017-06-13 Codexis Inc variantes da endoflucanase 1b (eg1b)
WO2013104660A1 (en) 2012-01-13 2013-07-18 Dupont Nutrition Biosciences Aps Process for treating a plant oil comprising hydrolysing chlorophyll or a chlorophyll derivative and involving partial caustic neutralisation
WO2013104659A2 (en) 2012-01-13 2013-07-18 Dupont Nutrition Biosciences Aps Process
EP2825647A4 (en) * 2012-03-15 2015-10-14 Codexis Inc METHODS OF GENE REARRANGING
US9150853B2 (en) 2012-03-21 2015-10-06 Gen9, Inc. Methods for screening proteins using DNA encoded chemical libraries as templates for enzyme catalysis
CN104508126B (zh) 2012-03-23 2017-06-30 科德克希思公司 用于合成色胺和色胺类似物的衍生物的生物催化剂和方法
US20150133698A1 (en) 2012-04-20 2015-05-14 Codexis, Inc. Production of fatty alcohols from engineered microorganisms
CA2871505C (en) 2012-04-24 2021-10-12 Gen9, Inc. Methods for sorting nucleic acids and multiplexed preparative in vitro cloning
WO2013160372A1 (en) 2012-04-27 2013-10-31 Dupont Nutrition Biosciences Aps Process for treating plant oil involving addition of serial doses of chlorophyll or chlorophyll derivative degrading enzyme
WO2013160374A1 (en) 2012-04-27 2013-10-31 Dupont Nutrition Biosciences Aps Process for refining crude plant oil involving enzymatic hydrolysis and gum recycling
SG11201407295YA (en) 2012-05-08 2014-12-30 Codexis Inc Biocatalysts and methods for hydroxylation of chemical compounds
HUE036947T2 (hu) 2012-05-11 2018-08-28 Codexis Inc Átalakított iminreduktázok és eljárások keton- és aminvegyületek reduktív aminálására
US8980578B2 (en) 2012-06-11 2015-03-17 Codexis, Inc. Fungal beta-xylosidase variants
IL236303B (en) 2012-06-25 2022-07-01 Gen9 Inc Methods for high-throughput nucleic acid assembly and sequencing
CA2879066C (en) 2012-07-13 2019-08-13 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
KR102213609B1 (ko) 2012-07-13 2021-02-08 웨이브 라이프 사이언시스 리미티드 키랄 제어
PL2872485T3 (pl) 2012-07-13 2021-05-31 Wave Life Sciences Ltd. Asymetryczna grupa pomocnicza
US9650655B2 (en) 2012-07-20 2017-05-16 Codexis, Inc. Production of fatty alcohols from engineered microorganisms
WO2014025747A1 (en) 2012-08-07 2014-02-13 Codexis, Inc. Glucose and xylose co-utilization in e. coli
IN2015DN02049A (https=) 2012-08-16 2015-08-14 Bangladesh Jute Res Inst
CN104870640A (zh) 2012-08-16 2015-08-26 孟加拉朱特研究所 来自菜豆壳球孢菌的纤维素和/或半纤维素降解酶及其用途
AU2013202506B2 (en) 2012-09-07 2015-06-18 Celgene Corporation Resistance biomarkers for hdac inhibitors
WO2014063097A1 (en) 2012-10-19 2014-04-24 Danisco Us Inc. Stabilization of biomimetic membranes
AU2013202507B9 (en) 2012-11-14 2015-08-13 Celgene Corporation Inhibition of drug resistant cancer cells
EP2922953A4 (en) 2012-11-20 2016-11-09 Shell Int Research PENTOSEFERMENTATION BY A RECOMBINANT MICROORGANISM
US9512447B2 (en) 2012-12-14 2016-12-06 Codexis, Inc. Modified native beta-ketoacyl-ACP synthases and engineered microorganisms
EP2946006B1 (en) 2013-01-18 2019-04-10 Codexis, Inc. Engineered biocatalysts useful for carbapenem synthesis
DK2954323T3 (da) 2013-02-07 2020-07-20 Univ California Anvendelse af translationsprofilering til identifikation af målmolekyler til terapeutisk behandling
US9617573B2 (en) 2013-02-28 2017-04-11 Codexis, Inc. Engineered transaminase polypeptides for industrial biocatalysis
GB201308828D0 (en) 2013-03-12 2013-07-03 Verenium Corp Phytase
WO2014159850A2 (en) 2013-03-14 2014-10-02 Codexis, Inc. Low-phosphate repressible promoter
GB201308843D0 (en) 2013-03-14 2013-07-03 Verenium Corp Phytase formulation
US10273471B2 (en) * 2013-03-15 2019-04-30 Gen 9, Inc. Compositions and methods for multiplex nucleic acids synthesis
NZ713396A (en) 2013-04-18 2020-06-26 Codexis Inc Engineered phenylalanine ammonia lyase polypeptides
EP3027762A4 (en) 2013-07-25 2017-06-28 BASF Enzymes LLC Phytase
CN106232619B (zh) 2013-11-13 2022-09-09 科德克希思公司 工程化的亚胺还原酶和用于酮和胺化合物的还原胺化的方法
EP3083936B1 (en) 2013-12-19 2018-07-04 Danisco US Inc. Use of hydrophobins to increase gas transfer in aerobic fermentation processes
NZ630311A (en) 2013-12-27 2016-03-31 Celgene Corp Romidepsin formulations and uses thereof
JPWO2015108048A1 (ja) 2014-01-15 2017-03-23 株式会社新日本科学 抗腫瘍作用を有するキラル核酸アジュバンド及び抗腫瘍剤
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
JPWO2015108047A1 (ja) 2014-01-15 2017-03-23 株式会社新日本科学 免疫誘導活性を有するキラル核酸アジュバンド及び免疫誘導活性剤
BR112016016400A2 (pt) 2014-01-16 2017-10-03 Wave Life Sciences Ltd Composições de oligonucleotídeos quiralmente controlados, seu uso, sua composição farmacêutica, e métodos
US20170121741A1 (en) 2014-04-01 2017-05-04 Dupont Nutrition Biosciences Aps Method for increasing crude palm oil yields
WO2015161019A1 (en) 2014-04-16 2015-10-22 Codexis, Inc. Engineered tyrosine ammonia lyase
US9708587B2 (en) 2014-07-09 2017-07-18 Codexis, Inc. P450-BM3 variants with improved activity
US9963687B2 (en) 2014-08-27 2018-05-08 New England Biolabs, Inc. Fusion polymerase and method for using the same
EP3778891A1 (en) 2014-08-27 2021-02-17 New England Biolabs, Inc. Synthon formation
WO2016033296A1 (en) 2014-08-28 2016-03-03 Codexis, Inc. N-substituted 4-aminoquinazoline derivatives and methods of use
US10045987B2 (en) 2014-08-28 2018-08-14 Codexis, Inc. Imidazoyl anilide derivatives and methods of use
US10370648B2 (en) 2014-11-25 2019-08-06 Codexis, Inc. Engineered imine reductases and methods for the reductive amination of ketone and amine compounds
WO2016183532A1 (en) 2015-05-13 2016-11-17 Synlogic, Inc. Bacteria engineered to treat a disease or disorder
LT3237621T (lt) 2014-12-22 2023-09-25 Codexis, Inc. Žmogaus alfa-galaktozidazės variantai
WO2016130412A1 (en) 2015-02-10 2016-08-18 Codexis, Inc. Ketoreductase polypeptides for the synthesis of chiral compounds
WO2016164596A2 (en) 2015-04-07 2016-10-13 Novozymes A/S Methods for selecting enzymes having lipase activity
CN107667177A (zh) 2015-04-07 2018-02-06 诺维信公司 用于选择具有增强活性的酶的方法
CN107531762A (zh) 2015-05-07 2018-01-02 科德克希思公司 青霉素g酰化酶
ES2881683T3 (es) * 2015-05-21 2021-11-30 Full Spectrum Genetics Inc Procedimiento para mejorar las características de las proteínas
WO2016210384A2 (en) 2015-06-25 2016-12-29 Synlogic, Inc. Bacteria engineered to treat metabolic diseases
US9683220B2 (en) 2015-07-07 2017-06-20 Codexis, Inc. P450-BM3 variants with improved activity
BR112018011503A2 (pt) 2015-12-07 2018-12-04 Zymergen Inc promotores da corynebacterium glutamicum
US9988624B2 (en) 2015-12-07 2018-06-05 Zymergen Inc. Microbial strain improvement by a HTP genomic engineering platform
US11208649B2 (en) 2015-12-07 2021-12-28 Zymergen Inc. HTP genomic engineering platform
WO2017123592A1 (en) 2016-01-11 2017-07-20 Synlogic, Inc. Bacteria engineered to treat disorders associated with bile salts
WO2017123418A1 (en) 2016-01-11 2017-07-20 Synlogic, Inc. Bacteria engineered to treat metabolic diseases
WO2017123676A1 (en) 2016-01-11 2017-07-20 Synlogic, Inc. Recombinant bacteria engineered to treat diseases and disorders associated with amino acid metabolism and methods of use thereof
WO2017139708A1 (en) 2016-02-10 2017-08-17 Synlogic, Inc. Bacteria engineered to treat nonalcoholic steatohepatitis (nash)
CN109312333A (zh) 2016-04-07 2019-02-05 诺维信公司 选择具有蛋白酶活性的酶的方法
US10724025B2 (en) 2016-05-05 2020-07-28 Codexis, Inc. Penicillin-G acylases
WO2017213758A1 (en) 2016-06-09 2017-12-14 Codexis, Inc. Biocatalysts and methods for hydroxylation of chemical compounds
MX2018015534A (es) 2016-06-15 2019-03-14 Codexis Inc Beta-glucosidasas dise?adas y metodos de glucosilacion.
WO2017215790A1 (en) 2016-06-17 2017-12-21 National Hellenic Research Foundation Systems for recombinant protein production
EP3478845A4 (en) 2016-06-30 2019-07-31 Zymergen, Inc. METHOD OF GENERATING A GLUCOSE PERMEASE LIBRARY AND USES THEREOF
US10544390B2 (en) 2016-06-30 2020-01-28 Zymergen Inc. Methods for generating a bacterial hemoglobin library and uses thereof
IL264686B2 (en) 2016-08-26 2024-07-01 Codexis Inc Engineered imine reductases and methods for reversible amination of ketone and amine compounds
EP3565893A4 (en) 2017-01-05 2020-12-09 Codexis, Inc. PENICILLIN G ACYLASES
CA3175070A1 (en) 2017-02-03 2018-08-09 Codexis, Inc. Engineered glycosyltransferases and steviol glycoside glucosylation methods
CN110831618B (zh) 2017-04-27 2023-08-25 科德克希思公司 酮还原酶多肽及多核苷酸
ES2887078T3 (es) 2017-05-08 2021-12-21 Codexis Inc Variantes de ligasa diseñadas
US20190016810A1 (en) 2017-05-11 2019-01-17 Cytodyn Inc. Methods for treating or preventing graft-versus-host disease involving the administration of anti-ccr5 receptor agents
EP3638688A4 (en) 2017-06-14 2021-07-07 Codexis, Inc. MODIFIED TRANSAMINASE POLYPEPTIDES INTENDED FOR INDUSTRIAL BIOCATALYSIS
CN117737045A (zh) 2017-06-27 2024-03-22 科德克希思公司 青霉素g酰化酶
EP3645712A4 (en) 2017-06-30 2021-07-07 Codexis, Inc. T7 RNA POLYMERASE VARIANTS
KR20250028535A (ko) 2017-06-30 2025-02-28 코덱시스, 인코포레이티드 T7 rna 폴리머라제 변이체
EP3706780A4 (en) 2017-11-07 2021-12-22 Codexis, Inc. TRANSGLUTAMINASE VARIANTS
JP2021506252A (ja) 2017-12-13 2021-02-22 コデクシス, インコーポレイテッド アミドカップリングのためのカルボキシエステラーゼポリペプチド
US11708571B2 (en) 2018-05-17 2023-07-25 Bp Corporation North America Inc. Production of 2-keto-3-deoxy-d-gluconic acid in filamentous fungi
US10900055B2 (en) 2018-06-12 2021-01-26 Codexis, Inc. Engineered tyrosine ammonia lyase
IL279884B2 (en) 2018-07-09 2026-04-01 Codexis Inc Engineered pantothenate kinase variant enzymes
AU2019302423B2 (en) 2018-07-09 2024-11-21 Codexis, Inc. Engineered purine nucleoside phosphorylase variant enzymes
EP3821015A4 (en) 2018-07-09 2022-07-13 Codexis, Inc. GENETIC DEOXYRIBOSE PHOSPHATE ALDOLASES
EP3821026A4 (en) 2018-07-09 2022-06-01 Codexis, Inc. MANIPULATED ENZYME VARIANTS OF PHOSPHOPENTOMUTASE
SG11202012138XA (en) 2018-07-09 2021-01-28 Codexis Inc Engineered galactose oxidase variant enzymes
JP2021531749A (ja) 2018-07-12 2021-11-25 コデクシス, インコーポレイテッド 操作されたフェニルアラニンアンモニアリアーゼポリペプチド
WO2020028039A1 (en) 2018-07-30 2020-02-06 Codexis, Inc. Engineered glycosyltransferases and steviol glycoside glucosylation methods
CA3110656A1 (en) 2018-09-07 2020-03-12 Basf Plant Science Company Gmbh Improved method for the production of high levels of pufa in plants
US12460221B2 (en) 2018-09-07 2025-11-04 Basf Plant Science Company Gmbh Method for the production of high levels of PUFA in plants
EP3847264A1 (en) 2018-09-07 2021-07-14 Basf Plant Science Company GmbH Improved method for the production of high levels of pufa in plants
AU2019373208A1 (en) 2018-10-29 2021-05-13 Codexis, Inc. Engineered DNA polymerase variants
CA3122524A1 (en) 2018-12-14 2020-06-18 Codexis, Inc. Engineered tyrosine ammonia lyase
AU2019403323B2 (en) 2018-12-20 2026-02-26 Codexis, Inc. Human alpha-galactosidase variants
WO2020142236A1 (en) 2019-01-02 2020-07-09 Intima Bioscience, Inc. Modified adeno-associated viral vectors for use in genetic engineering
CA3126671A1 (en) 2019-01-15 2020-07-23 Codexis, Inc. Engineered transaminase polypeptides
CN114096662B (zh) 2019-05-01 2025-04-15 科德克希思公司 工程化葡萄糖脱氢酶和用于酮和胺化合物的还原胺化的方法
EP3963057A4 (en) 2019-05-01 2023-06-14 Codexis, Inc. MANIPULATED IMINE REDUCTASES AND METHODS FOR THE REDUCTIVE AMINATION OF KETONE AND AMINE COMPOUNDS
AU2020299358A1 (en) 2019-07-02 2021-12-23 Codexis, Inc. Engineered acetate kinase variant enzymes
WO2021003132A1 (en) 2019-07-02 2021-01-07 Codexis, Inc. Engineered sucrose phosphorylase variant enzymes
CA3146474A1 (en) 2019-08-02 2021-02-11 Denis BURGER Methods for treating or preventing cancers involving the administration of anti-ccr5 receptor agents
EP4501403A3 (en) 2019-08-30 2025-05-14 Société des Produits Nestlé S.A. Engineered lipase variants
US12012620B2 (en) 2019-09-12 2024-06-18 Codexis, Inc. Peroxidase activity towards 10-acetyl-3,7-dihydroxyphenoxazine
CN121780457A (zh) 2019-11-26 2026-04-03 科德克希思公司 用于化学化合物的羟基化的生物催化剂和方法
JP2023507575A (ja) 2019-12-20 2023-02-24 コデクシス, インコーポレイテッド 操作された酸性アルファ-グルコシダーゼバリアント
US20230041211A1 (en) 2019-12-20 2023-02-09 Basf Se Decreasing toxicity of terpenes and increasing the production potential in micro-organisms
JP2023512683A (ja) 2020-02-04 2023-03-28 コデクシス, インコーポレイテッド 操作されたロイシンデカルボキシラーゼ
US11045546B1 (en) 2020-03-30 2021-06-29 Cytodyn Inc. Methods of treating coronavirus infection
JP7747337B2 (ja) 2020-04-10 2025-10-01 コデクシス, インコーポレイテッド 速度論的光学分割のためのカルボキシエステラーゼポリペプチド
EP4133064A4 (en) 2020-04-10 2024-07-24 Codexis, Inc. Engineered transaminase polypeptides
AU2021265768B2 (en) 2020-04-27 2023-03-30 4D Molecular Therapeutics Inc. Adeno-associated variants, formulations and methods for pulmonary delivery
BR112022024475A2 (pt) 2020-06-04 2022-12-27 Isobionics B V Beta santaleno sintase sintética, ácido nucleico sintético, cassete de expressão, método para produzir uma composição, célula hospedeira não humana, composição, e, uso de qualquer uma das santaleno sintases sintéticas
AU2021334371A1 (en) 2020-08-28 2023-03-09 Codexis, Inc. Engineered protease variants
CN116897205A (zh) 2020-08-28 2023-10-17 科德克希思公司 工程化淀粉酶变体
US20220186231A1 (en) 2020-12-11 2022-06-16 Willow Biosciences, Inc. Recombinant acyl activating enzyme (aae) genes for enhanced biosynthesis of cannabinoids and cannabinoid precursors
EP4015626A1 (en) 2020-12-18 2022-06-22 Isobionics B.V. Enzymes and methods for fermentative production of monoterpene esters
WO2022133289A2 (en) 2020-12-18 2022-06-23 Codexis, Inc. Engineered uridine phosphorylase variant enzymes
IL305919A (en) 2021-04-02 2023-11-01 Codexis Inc Engineered adenylate kinase variant enzymes
EP4314262A1 (en) 2021-04-02 2024-02-07 Codexis, Inc. Engineered guanylate kinase variant enzymes
CA3215105A1 (en) 2021-04-02 2022-10-06 Codexis, Inc. Engineered acetate kinase variant enzymes
US12180483B2 (en) 2021-04-02 2024-12-31 Codexis, Inc. Engineered cyclic GMP-AMP synthase (cGAS) variant enzymes
CA3220735A1 (en) 2021-05-21 2022-11-24 Codexis, Inc. Engineered methionine gamma lyase variants
CA3227215A1 (en) 2021-07-30 2023-02-02 Trish Choudhary Recombinant prenyltransferase polypeptides engineered for enhanced biosynthesis of cannabinoids
JP2024528957A (ja) 2021-08-02 2024-08-01 ビーエーエスエフ ソシエタス・ヨーロピア イオニリデンエタンシンターゼによる新規な芳香化合物の生成
EP4388088A1 (en) 2021-08-19 2024-06-26 Willow Biosciences, Inc. Recombinant olivetolic acid cyclase polypeptides engineered for enhanced biosynthesis of cannabinoids
US12129495B2 (en) 2021-10-15 2024-10-29 Codexis, Inc. Engineered DNA polymerase variants
CA3234383A1 (en) 2021-10-15 2023-04-27 Codexis, Inc. Engineered terminal deoxynucleotidyl transferase variants
WO2023069921A1 (en) 2021-10-19 2023-04-27 Epimeron Usa, Inc. Recombinant thca synthase polypeptides engineered for enhanced biosynthesis of cannabinoids
JP2024540358A (ja) 2021-11-01 2024-10-31 シンティス バイオ,インコーポレイティド 工学操作ロイシン脱炭酸酵素
CN114015672B (zh) * 2021-12-06 2022-05-31 江南大学 一种Pfu DNA聚合酶
WO2023245171A1 (en) 2022-06-17 2023-12-21 Synlogic Operating Company, Inc. Bacteria engineered to treat diseases associated with bile acid metabolism and methods of use thereof
WO2023245168A1 (en) 2022-06-17 2023-12-21 Synlogic Operating Company, Inc. Bacteria engineered to treat diseases associated with bile acid metabolism and methods of use thereof
CA3260276A1 (en) 2022-06-23 2023-12-28 Michael James Genetically modified recombinant bacteria for treating diseases associated with methionine metabolism and associated methods of use
WO2024040020A1 (en) 2022-08-15 2024-02-22 Absci Corporation Quantitative affinity activity specific cell enrichment
WO2025144700A1 (en) 2023-12-27 2025-07-03 Absci Corporation Nanobody library screening using bacterial surface display
WO2025199112A2 (en) 2024-03-19 2025-09-25 General Biological Corporation Bio-based production of succinic acid using vibrio natriegens
WO2025224232A1 (en) * 2024-04-25 2025-10-30 Danmarks Tekniske Universitet Pcr leaping and applications thereof
WO2025235589A1 (en) 2024-05-08 2025-11-13 Codexis, Inc. Dna polymerase variants
WO2026053219A1 (en) 2024-09-08 2026-03-12 Yeda Research And Development Co. Ltd. Polyphenol oxidase, an amino acid transporter, and a transgenic cell, tissue, and organism comprising same

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5223408A (en) * 1991-07-11 1993-06-29 Genentech, Inc. Method for making variant secreted proteins with altered properties
US5279952A (en) * 1991-08-09 1994-01-18 Board Of Regents, The University Of Texas System PCR-based strategy of constructing chimeric DNA molecules

Family Cites Families (117)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4994379A (en) 1983-03-09 1991-02-19 Cetus Corporation Modified signal peptides
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US5422266A (en) * 1984-12-31 1995-06-06 University Of Georgia Research Foundation, Inc. Recombinant DNA vectors capable of expressing apoaequorin
US4965188A (en) * 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US5176995A (en) * 1985-03-28 1993-01-05 Hoffmann-La Roche Inc. Detection of viruses by amplification and hybridization
DE229046T1 (de) * 1985-03-30 1987-12-17 Marc Genf/Geneve Ballivet Verfahren zum erhalten von dns, rns, peptiden, polypeptiden oder proteinen durch dns-rekombinant-verfahren.
US6492107B1 (en) * 1986-11-20 2002-12-10 Stuart Kauffman Process for obtaining DNA, RNA, peptides, polypeptides, or protein, by recombinant DNA technique
US4959312A (en) * 1985-05-31 1990-09-25 The University Of Tennessee Research Corporation Full spectrum mutagenesis
EP0208491B1 (en) * 1985-07-03 1993-08-25 Genencor International, Inc. Hybrid polypeptides and process for their preparation
US5866363A (en) 1985-08-28 1999-02-02 Pieczenik; George Method and means for sorting and identifying biological information
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
DK311186D0 (da) * 1986-06-30 1986-06-30 Novo Industri As Enzymer
US5824469A (en) 1986-07-17 1998-10-20 University Of Washington Method for producing novel DNA sequences with biological activity
US5418149A (en) * 1990-07-24 1995-05-23 Hoffmann-La Roche Inc. Reduction of non-specific amplification glycosylase using DUTP and DNA uracil
US4994368A (en) * 1987-07-23 1991-02-19 Syntex (U.S.A.) Inc. Amplification method for polynucleotide assays
FR2641793B1 (fr) 1988-12-26 1993-10-01 Setratech Procede de recombinaison in vivo de sequences d'adn presentant des mesappariements de bases
DD282028A5 (de) 1989-02-16 1990-08-29 Akad Wissenschaften Ddr Verfahren zur herstellung einer thermostabilen, hybriden bacillus-beta-1,3-1,4-glukanase
US5043272A (en) * 1989-04-27 1991-08-27 Life Technologies, Incorporated Amplification of nucleic acid sequences using oligonucleotides of random sequence as primers
US5106727A (en) 1989-04-27 1992-04-21 Life Technologies, Inc. Amplification of nucleic acid sequences using oligonucleotides of random sequences as primers
US5556750A (en) * 1989-05-12 1996-09-17 Duke University Methods and kits for fractionating a population of DNA molecules based on the presence or absence of a base-pair mismatch utilizing mismatch repair systems
CA2016842A1 (en) * 1989-05-16 1990-11-16 Richard A. Lerner Method for tapping the immunological repertoire
CA2016841C (en) 1989-05-16 1999-09-21 William D. Huse A method for producing polymers having a preselected activity
IT1231157B (it) * 1989-07-20 1991-11-19 Crc Ricerca Chim Nuovi geni ibridi funzionali di bacillus thuringiensis ottenuti mediante ricombinazione in vivo.
US5574205A (en) 1989-07-25 1996-11-12 Cell Genesys Homologous recombination for universal donor cells and chimeric mammalian hosts
US5023171A (en) * 1989-08-10 1991-06-11 Mayo Foundation For Medical Education And Research Method for gene splicing by overlap extension using the polymerase chain reaction
WO1991006570A1 (en) * 1989-10-25 1991-05-16 The University Of Melbourne HYBRID Fc RECEPTOR MOLECULES
US5071743A (en) * 1989-10-27 1991-12-10 Her Majesty The Queen In Right Of Canada, As Represented By The National Research Council Of Canada Process for conducting site-directed mutagenesis
DE3936258C1 (https=) * 1989-10-31 1991-04-25 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften Ev, 3400 Goettingen, De
AU6886991A (en) * 1989-11-08 1991-06-13 United States of America, as represented by the Secretary, U.S. Department of Commerce, The A method of synthesizing double-stranded dna molecules
US5242937A (en) 1990-03-19 1993-09-07 Research Corporation Technologies, Inc. Topically active ocular thiadiazole sulfonamide carbonic anhydrase inhibitors
CA2079802C (en) * 1990-04-05 2001-09-18 Roberto Crea Walk-through mutagenesis
WO1991016427A1 (en) * 1990-04-24 1991-10-31 Stratagene Methods for phenotype creation from multiple gene populations
US5877402A (en) 1990-05-01 1999-03-02 Rutgers, The State University Of New Jersey DNA constructs and methods for stably transforming plastids of multicellular plants and expressing recombinant proteins therein
US5851813A (en) * 1990-07-12 1998-12-22 President And Fellows Of Harvard College Primate lentivirus antigenic compositions
JP3306063B2 (ja) 1990-08-24 2002-07-24 イグジス, インコーポレイテッド ランダムコドンを有するオリゴヌクレオチドを合成する方法
US5264563A (en) 1990-08-24 1993-11-23 Ixsys Inc. Process for synthesizing oligonucleotides with random codons
IL99553A0 (en) 1990-09-28 1992-08-18 Ixsys Inc Compositions containing oligonucleotides linked to expression elements,a kit for the preparation of vectors useful for the expression of a diverse population of random peptides and methods utilizing the same
US5770434A (en) 1990-09-28 1998-06-23 Ixsys Incorporated Soluble peptides having constrained, secondary conformation in solution and method of making same
US5698426A (en) 1990-09-28 1997-12-16 Ixsys, Incorporated Surface expression libraries of heteromeric receptors
US5871974A (en) 1990-09-28 1999-02-16 Ixsys Inc. Surface expression libraries of heteromeric receptors
US5858725A (en) * 1990-10-10 1999-01-12 Glaxo Wellcome Inc. Preparation of chimaeric antibodies using the recombinant PCR strategy
US5187083A (en) * 1990-11-13 1993-02-16 Specialty Laboratories, Inc. Rapid purification of DNA
US5234824A (en) * 1990-11-13 1993-08-10 Specialty Laboratories, Inc. Rapid purification of DNA
US5489523A (en) * 1990-12-03 1996-02-06 Stratagene Exonuclease-deficient thermostable Pyrococcus furiosus DNA polymerase I
JP3298879B2 (ja) 1990-12-20 2002-07-08 イグジス,インコーポレイテッド 結合タンパク質の最適化
US5098437A (en) 1991-02-13 1992-03-24 Pfizer Hospital Products Group, Inc. Acetabular cup positioning insert
DE4112440C1 (https=) 1991-04-16 1992-10-22 Diagen Institut Fuer Molekularbiologische Diagnostik Gmbh, 4000 Duesseldorf, De
US5795747A (en) * 1991-04-16 1998-08-18 Evotec Biosystems Gmbh Process for manufacturing new biopolymers
US5514568A (en) * 1991-04-26 1996-05-07 Eli Lilly And Company Enzymatic inverse polymerase chain reaction
US5512463A (en) * 1991-04-26 1996-04-30 Eli Lilly And Company Enzymatic inverse polymerase chain reaction library mutagenesis
DE69213112T2 (de) 1991-06-20 1997-04-03 Hoffmann La Roche Verbesserte Methoden zur Nukleinsäure-Amplifizierung
WO1993000103A1 (en) * 1991-06-21 1993-01-07 The Wistar Institute Of Anatomy And Biology Chimeric envelope proteins for viral targeting
US5702931A (en) * 1991-07-01 1997-12-30 Berlex Laboratories, Inc. Mutagenesis methods and compositions
US6071889A (en) * 1991-07-08 2000-06-06 Neurospheres Holdings Ltd. In vivo genetic modification of growth factor-responsive neural precursor cells
GB9115364D0 (en) * 1991-07-16 1991-08-28 Wellcome Found Antibody
EP0605522B1 (en) * 1991-09-23 1999-06-23 Medical Research Council Methods for the production of humanized antibodies
GB9125979D0 (en) * 1991-12-06 1992-02-05 Wellcome Found Antibody
JP3431146B2 (ja) * 1992-01-30 2003-07-28 ジェンザイム・リミテッド 改変した酵素によるキラル合成
US5773267A (en) * 1992-02-07 1998-06-30 Albert Einstein College Of Medicine Of Yeshiva University, A Division Of Yeshiva University D29 shuttle phasmids and uses thereof
GB9202796D0 (en) * 1992-02-11 1992-03-25 Wellcome Found Antiviral antibody
US5843643A (en) 1992-02-21 1998-12-01 Ratner; Paul L. Site-specific transfection of eukaryotic cells using polypeptide-linked recombinant nucleic acid
WO1993018141A1 (en) * 1992-03-02 1993-09-16 Biogen, Inc. Thrombin receptor antagonists
WO1993019170A1 (en) 1992-03-16 1993-09-30 Jacob Nathaniel Wohlstadter Selection methods
US5316935A (en) * 1992-04-06 1994-05-31 California Institute Of Technology Subtilisin variants suitable for hydrolysis and synthesis in organic media
EP0606430A1 (en) * 1992-06-15 1994-07-20 City Of Hope Chimeric anti-cea antibody
BR9306856A (pt) * 1992-07-10 1998-12-08 Energy Biosystems Corp Molécula de dna recombinante dna purificado vetor de dna recombinante vetor de plasmida de dna microrganismo transformado bactéria transformada método para dessulfurar um combustível fóssil sonda de ácido nucleico e proteína recombinante
US6107062A (en) * 1992-07-30 2000-08-22 Inpax, Inc. Antisense viruses and antisense-ribozyme viruses
FR2694754B1 (fr) * 1992-08-12 1994-09-16 Bio Merieux Fragments d'ADN de mycobactéries, amorces d'amplification, sondes d'hybridation, réactifs et procédé de détection de détection de mycobactéries.
EP0627932B1 (en) * 1992-11-04 2002-05-08 City Of Hope Antibody construct
WO1994011496A1 (en) 1992-11-10 1994-05-26 Ixsys, Inc. Soluble peptides having constrained, secondary conformation in solution and method of making same
US5360728A (en) * 1992-12-01 1994-11-01 Woods Hole Oceanographic Institution (W.H.O.I.) Modified apoaequorin having increased bioluminescent activity
ES2156149T3 (es) * 1992-12-04 2001-06-16 Medical Res Council Proteinas de union multivalente y multiespecificas, su fabricacion y su uso.
US5380530A (en) 1992-12-29 1995-01-10 Whitehill Oral Technologies Oral care composition coated gum
IT1264712B1 (it) * 1993-07-13 1996-10-04 Eniricerche Spa Metodo di sintesi biologica di peptidi
US5498531A (en) 1993-09-10 1996-03-12 President And Fellows Of Harvard College Intron-mediated recombinant techniques and reagents
US5556772A (en) * 1993-12-08 1996-09-17 Stratagene Polymerase compositions and uses thereof
DE4343591A1 (de) * 1993-12-21 1995-06-22 Evotec Biosystems Gmbh Verfahren zum evolutiven Design und Synthese funktionaler Polymere auf der Basis von Formenelementen und Formencodes
US5834252A (en) * 1995-04-18 1998-11-10 Glaxo Group Limited End-complementary polymerase reaction
US5928905A (en) 1995-04-18 1999-07-27 Glaxo Group Limited End-complementary polymerase reaction
US5837458A (en) * 1994-02-17 1998-11-17 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6117679A (en) 1994-02-17 2000-09-12 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US5605793A (en) * 1994-02-17 1997-02-25 Affymax Technologies N.V. Methods for in vitro recombination
US6165793A (en) 1996-03-25 2000-12-26 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US5521077A (en) * 1994-04-28 1996-05-28 The Leland Stanford Junior University Method of generating multiple protein variants and populations of protein variants prepared thereby
US5514588A (en) 1994-12-13 1996-05-07 Exxon Research And Engineering Company Surfactant-nutrients for bioremediation of hydrocarbon contaminated soils and water
US5629179A (en) * 1995-03-17 1997-05-13 Novagen, Inc. Method and kit for making CDNA library
DE19612631A1 (de) 1995-03-31 1996-10-02 Mazda Motor Multiplexdatenübermittlungssystem
CA2219136A1 (en) * 1995-04-24 1996-10-31 Chromaxome Corp. Methods for generating and screening novel metabolic pathways
US6030779A (en) 1995-07-18 2000-02-29 Diversa Corporation Screening for novel bioactivities
US5958672A (en) * 1995-07-18 1999-09-28 Diversa Corporation Protein activity screening of clones having DNA from uncultivated microorganisms
US6004788A (en) 1995-07-18 1999-12-21 Diversa Corporation Enzyme kits and libraries
US6057103A (en) 1995-07-18 2000-05-02 Diversa Corporation Screening for novel bioactivities
US6168919B1 (en) 1996-07-17 2001-01-02 Diversa Corporation Screening methods for enzymes and enzyme kits
DE69620766T2 (de) * 1995-08-11 2004-11-18 Novozymes A/S Verfahren zur herstellung von polypeptidabkömmlingen
US5962258A (en) 1995-08-23 1999-10-05 Diversa Corporation Carboxymethyl cellulase fromthermotoga maritima
US6051409A (en) * 1995-09-25 2000-04-18 Novartis Finance Corporation Method for achieving integration of exogenous DNA delivered by non-biological means to plant cells
US5756316A (en) 1995-11-02 1998-05-26 Genencor International, Inc. Molecular cloning by multimerization of plasmids
US6171820B1 (en) 1995-12-07 2001-01-09 Diversa Corporation Saturation mutagenesis in directed evolution
US6238884B1 (en) 1995-12-07 2001-05-29 Diversa Corporation End selection in directed evolution
US5939250A (en) * 1995-12-07 1999-08-17 Diversa Corporation Production of enzymes having desired activities by mutagenesis
US5965408A (en) * 1996-07-09 1999-10-12 Diversa Corporation Method of DNA reassembly by interrupting synthesis
US20030215798A1 (en) 1997-06-16 2003-11-20 Diversa Corporation High throughput fluorescence-based screening for novel enzymes
US5830696A (en) 1996-12-05 1998-11-03 Diversa Corporation Directed evolution of thermophilic enzymes
DK0873398T3 (da) * 1996-01-10 2005-08-15 Novozymes As Fremgangsmåde til in vivo produktion af et mutantbibliotek i celler
US6096548A (en) * 1996-03-25 2000-08-01 Maxygen, Inc. Method for directing evolution of a virus
US5783431A (en) * 1996-04-24 1998-07-21 Chromaxome Corporation Methods for generating and screening novel metabolic pathways
US5763239A (en) 1996-06-18 1998-06-09 Diversa Corporation Production and use of normalized DNA libraries
US6093873A (en) 1996-08-19 2000-07-25 Institut National De La Sante Et De La Recherche Medicale Genetically engineered mice containing alterations in the gene encoding RXR
CN1208456C (zh) * 1996-12-20 2005-06-29 诺维信公司 体内重组
WO1998041653A1 (en) * 1997-03-18 1998-09-24 Novo Nordisk A/S An in vitro method for construction of a dna library
ATE418608T1 (de) * 1997-03-18 2009-01-15 Novozymes As Methode zur herstellung einer bibliothek mittels dna-shuffling
AU738461B2 (en) * 1997-03-18 2001-09-20 Novozymes A/S Shuffling of heterologous DNA sequences
US5948653A (en) 1997-03-21 1999-09-07 Pati; Sushma Sequence alterations using homologous recombination
US6153410A (en) * 1997-03-25 2000-11-28 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
US6051049A (en) 1997-05-29 2000-04-18 Exothermic Distribution Corporation Utilization of strontium aluminate in steelmaking
US6087341A (en) 1998-02-12 2000-07-11 The Board Of Trustees Of The Leland Standford Junior University Introduction of nucleic acid into skin cells by topical application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5223408A (en) * 1991-07-11 1993-06-29 Genentech, Inc. Method for making variant secreted proteins with altered properties
US5279952A (en) * 1991-08-09 1994-01-18 Board Of Regents, The University Of Texas System PCR-based strategy of constructing chimeric DNA molecules

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
FISCH I, ET AL.: "A STRATEGY OF EXON SHUFFLING FOR MAKING LARGE PEPTIDE REPERTOIRES DISPLAYED ON FILAMENTOUS BACTERIOPHAGE", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 93, 1 July 1996 (1996-07-01), US, pages 7761 - 7766, XP002917368, ISSN: 0027-8424, DOI: 10.1073/pnas.93.15.7761 *
HEIM R., PRASHER D. C., TSIEN R. Y.: "WAVELENGTH MUTATIONS AND POSTTRANSLATIONAL AUTOXIDATION OF GREEN FLUORESCENT PROTEIN.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 91., 1 December 1994 (1994-12-01), US, pages 12501 - 12504., XP000574454, ISSN: 0027-8424, DOI: 10.1073/pnas.91.26.12501 *
HO S. N., ET AL.: "SITE-DIRECTED MUTAGENESIS BY OVERLAP EXTENSION USING THE POLYMERASE CHAIN REACTION.", GENE., ELSEVIER, AMSTERDAM., NL, vol. 77., no. 01., 1 January 1989 (1989-01-01), NL, pages 51 - 59., XP000272761, ISSN: 0378-1119, DOI: 10.1016/0378-1119(89)90358-2 *
JONES D H, WINISTORFER S C: "RECOMBINANT CIRCLE PCR AND RECOMBINATION PCR FOR SITE-SPECIFIC MUTAGENESIS WITHOUT PCR PRODUCT PURIFICATION", BIOTECHNIQUES, INFORMA HEALTHCARE, US, vol. 12, no. 04, 1 January 1992 (1992-01-01), US, pages 528 - 530 + 532 + 534/535, XP000983978, ISSN: 0736-6205 *
KIM B, HATHAWAY T R, LOEB L A: "HUMAN IMMUNODEFICIENCY VIRUS REVERSE TRANSCRIPTASE FUNCTIONAL MUTANTS OBTAINED BY RANDOM MUTAGENESIS COUPLED WITH GENETIC SELECTION IN ESCHERICHIA COLI", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, US, vol. 271, no. 09, 1 March 1996 (1996-03-01), US, pages 4872 - 4878, XP000942157, ISSN: 0021-9258, DOI: 10.1074/jbc.271.9.4872 *
R.M. HORTON ET AL.: "Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension", GENE., ELSEVIER, AMSTERDAM., NL, vol. 77., 1 January 1989 (1989-01-01), NL, pages 61 - 68., XP002090392, ISSN: 0378-1119, DOI: 10.1016/0378-1119(89)90359-4 *
RAO A L N, HALL T C: "RECOMBINATION AND POLYMERASE ERROR FACILITATE RESTORATION OF INFECTIVITY IN BROME MOSAIC VIRUS", JOURNAL OF VIROLOGY., THE AMERICAN SOCIETY FOR MICROBIOLOGY., US, vol. 67, no. 02, 1 February 1993 (1993-02-01), US, pages 969 - 979, XP000987155, ISSN: 0022-538X *
STEMMER W P C: "DNA SHUFFLING BY RANDOM FRAGMENTATION AND REASSEMBLY: IN VITRO RECOMBINATION FOR MOLECULAR EVOLUTION", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 91, 1 October 1994 (1994-10-01), US, pages 10747 - 10751, XP002905122, ISSN: 0027-8424, DOI: 10.1073/pnas.91.22.10747 *
STEMMER W P C: "RAPID EVOLUTION OF A PROTEIN IN VITRO BY DNA SHUFFLING", NATURE, NATURE PUBLISHING GROUP, UNITED KINGDOM, vol. 370, 1 January 1994 (1994-01-01), United Kingdom, pages 389 - 391, XP002917367, ISSN: 0028-0836, DOI: 10.1038/370389a0 *

Cited By (515)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6117679A (en) * 1994-02-17 2000-09-12 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US7795030B2 (en) 1994-02-17 2010-09-14 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6180406B1 (en) 1994-02-17 2001-01-30 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6291242B1 (en) 1994-02-17 2001-09-18 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6309883B1 (en) 1994-02-17 2001-10-30 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6132970A (en) * 1994-02-17 2000-10-17 Maxygen, Inc. Methods of shuffling polynucleotides
US6995017B1 (en) 1994-02-17 2006-02-07 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US8048674B2 (en) 1994-02-17 2011-11-01 Codexis Mayflower Holdings, Llc Methods and compositions for cellular and metabolic engineering
US7288375B2 (en) 1994-02-17 2007-10-30 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6391640B1 (en) 1994-02-17 2002-05-21 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US7105297B2 (en) 1994-02-17 2006-09-12 Maxygen, Inc. Methods and compositions for cellular and metabolic engineering
US6808904B2 (en) 1994-06-16 2004-10-26 Syngenta Participations Ag Herbicide-tolerant protox genes produced by DNA shuffling
US6946296B2 (en) 1995-11-30 2005-09-20 Maxygen, Inc. Methods and compositions for polypeptide engineering
US6361974B1 (en) 1995-12-07 2002-03-26 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
US6764835B2 (en) 1995-12-07 2004-07-20 Diversa Corporation Saturation mutageneis in directed evolution
US6709841B2 (en) 1995-12-07 2004-03-23 Diversa Corporation Exonuclease-mediated gene assembly in directed evolution
US6696275B2 (en) 1995-12-07 2004-02-24 Diversa Corporation End selection in directed evolution
US6713282B2 (en) 1995-12-07 2004-03-30 Diversa Corporation End selection in directed evolution
US6358709B1 (en) 1995-12-07 2002-03-19 Diversa Corporation End selection in directed evolution
US6352842B1 (en) 1995-12-07 2002-03-05 Diversa Corporation Exonucease-mediated gene assembly in directed evolution
US6939689B2 (en) 1995-12-07 2005-09-06 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
US6635449B2 (en) 1995-12-07 2003-10-21 Diversa Corporation Exonuclease-mediated nucleic acid reassembly in directed evolution
US6713279B1 (en) 1995-12-07 2004-03-30 Diversa Corporation Non-stochastic generation of genetic vaccines and enzymes
US6773900B2 (en) 1995-12-07 2004-08-10 Diversa Corporation End selection in directed evolution
US6713281B2 (en) 1995-12-07 2004-03-30 Diversa Corporation Directed evolution of thermophilic enzymes
US6740506B2 (en) 1995-12-07 2004-05-25 Diversa Corporation End selection in directed evolution
US7018793B1 (en) 1995-12-07 2006-03-28 Diversa Corporation Combinatorial screening of mixed populations of organisms
US6238884B1 (en) 1995-12-07 2001-05-29 Diversa Corporation End selection in directed evolution
US6358742B1 (en) 1996-03-25 2002-03-19 Maxygen, Inc. Evolving conjugative transfer of DNA by recursive recombination
EP0906418A4 (https=) * 1996-03-25 1999-05-06
US6165793A (en) * 1996-03-25 2000-12-26 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
EP0932670A4 (https=) * 1996-03-25 1999-08-04
US6096548A (en) * 1996-03-25 2000-08-01 Maxygen, Inc. Method for directing evolution of a virus
US6387702B1 (en) 1996-03-25 2002-05-14 Maxygen, Inc. Enhancing cell competence by recursive sequence recombination
US6482647B1 (en) 1996-03-25 2002-11-19 Maxygen, Inc. Evolving susceptibility of cellular receptors to viral infection by recursive recombination
US6391552B2 (en) 1996-03-25 2002-05-21 Maxygen, Inc. Enhancing transfection efficiency of vectors by recursive recombination
EP1007727A1 (en) 1996-07-09 2000-06-14 Diversa Corporation Method of dna shuffling with polynucleotides produced by blockingor interrupting a synthesis or amplification process
US7553652B2 (en) 1996-07-10 2009-06-30 Lonza Ag Process for the preparation of (S)- or (R)-3,3,3-trifluoro-2-hydroxy-2-methylpropionic acid
US7074606B2 (en) 1996-07-10 2006-07-11 Lonza Ag Process for the preparation of (S) - or (R) -3,3,3-trifluoro-2-hydroxy-2-methylpropionic acid
EP1149905A1 (en) * 1996-12-18 2001-10-31 Maxygen, Inc. Methods and compositions for polypeptide engineering
EP1149904A1 (en) * 1996-12-18 2001-10-31 Maxygen, Inc. Methods and compositions for polypeptide engineering
EP0946755A4 (en) * 1996-12-18 2001-03-07 Maxygen Inc METHOD AND COMPOSITION FOR MANIPULATING POLYPEPTIDES
US6379964B1 (en) 1997-01-17 2002-04-30 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6528311B1 (en) 1997-01-17 2003-03-04 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6287862B1 (en) 1997-01-17 2001-09-11 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6352859B1 (en) 1997-01-17 2002-03-05 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6716631B1 (en) 1997-01-17 2004-04-06 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US7148054B2 (en) 1997-01-17 2006-12-12 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US7629170B2 (en) 1997-01-17 2009-12-08 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6326204B1 (en) 1997-01-17 2001-12-04 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US6335198B1 (en) 1997-01-17 2002-01-01 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US7432083B2 (en) 1997-01-24 2008-10-07 Bioinvent International Ab Method for in vitro molecular evolution of protein function
US6989250B2 (en) 1997-01-24 2006-01-24 Bioinvent International Ab Method for in vitro molecular evolution of protein function
US6579675B2 (en) 1997-02-14 2003-06-17 Deltagen Proteomics, Inc. Methods for identifying nucleic acid sequences encoding agents that effect cellular phenotypes
US6566057B1 (en) 1997-02-14 2003-05-20 Deltagen Proteomics, Inc. Methods and compositions for peptide libraries displayed on light-emitting scaffolds
US5955275A (en) * 1997-02-14 1999-09-21 Arcaris, Inc. Methods for identifying nucleic acid sequences encoding agents that affect cellular phenotypes
US6623922B1 (en) 1997-02-14 2003-09-23 Deltagen Proteomics Methods for identifying, characterizing, and evolving cell-type specific CIS regulatory elements
WO1998039483A1 (en) * 1997-03-04 1998-09-11 Ventana Genetics, Inc. Methods for identifying nucleic acid sequences encoding agents that affect cellular phenotypes
US6541207B1 (en) 1997-03-18 2003-04-01 Novozymes A/S Methods for generating recombined polynucleotides
US6159687A (en) * 1997-03-18 2000-12-12 Novo Nordisk A/S Methods for generating recombined polynucleotides
US6153410A (en) * 1997-03-25 2000-11-28 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
EP0920496A4 (en) * 1997-03-25 2001-05-02 California Inst Of Techn RECOMBINATION OF POLYNUCLEOTIDE SEQUENCES USING RANDOM OR DEFINED PRIMERS
US6177263B1 (en) * 1997-03-25 2001-01-23 California Institute Of Technology Recombination of polynucleotide sequences using random or defined primers
US6046925A (en) * 1997-04-14 2000-04-04 The Regents Of The University Of California Photochromic fluorescent proteins and optical memory storage devices based on fluorescent proteins
AU745150B2 (en) * 1997-06-16 2002-03-14 Alligator Bioscience Ab A method for in vitro molecular evolution of protein function
DE19725371B4 (de) * 1997-06-16 2005-01-20 Bornholdt, Stefan, Dr. Verfahren zur Beschleunigung der evolutiven Optimierung von Biopolymeren und zur Verbesserung der damit hergestellten Biopolymere
DE19725371A1 (de) * 1997-06-16 1998-12-24 Bornholdt Stefan Dr Verfahren zur Beschleunigung der evolutiven Optimierung von Biopolymeren und zur Verbesserung der damit hergestellten Biopolymere
US6872526B2 (en) 1997-06-16 2005-03-29 Diversa Corporation High throughput screening for novel Bioactivities
EP1009858A4 (en) * 1997-06-16 2001-03-07 Diversa Corp HIGH-THROUGHPUT SCREENING FOR NEW ENZYMES
US6495321B1 (en) 1997-06-16 2002-12-17 Bioinvent International Ab Method for in vitro molecular evolution of protein function
US6806048B2 (en) 1997-06-16 2004-10-19 Diversa Corporation Method for high throughput screening of an environmental library
US6602675B2 (en) 1997-06-16 2003-08-05 Diversa Corporation High throughput screening of mycelia for bioactivities or biomolecules
WO1998058080A1 (en) * 1997-06-16 1998-12-23 Bioinvent International Ab A method for in vitro molecular evolution of protein function
WO1999012033A3 (de) * 1997-08-28 1999-06-10 Otogene Biotechnologische Fors Verfahren und kit zur identifizierung von wechselwirkungen zwischen proteinen bzw. peptiden
US6399383B1 (en) 1997-10-28 2002-06-04 Maxygen, Inc. Human papilloma virus vectors
US6596539B1 (en) 1997-10-31 2003-07-22 Maxygen, Inc. Modification of virus tropism and host range by viral genome shuffling
EP1030861A4 (en) * 1997-10-31 2001-09-05 Maxygen Inc MODIFICATION OF VIRUSTROPISMIUS AND THE ECONOMIC SPECTRUM BY VIRAL GENOM MIXING
EP1690868A1 (en) * 1997-10-31 2006-08-16 Maxygen, Inc. Modification of virus tropism and host range by viral genome shuffling
US6156509A (en) * 1997-11-12 2000-12-05 Genencor International, Inc. Method of increasing efficiency of directed evolution of a gene using phagemid
WO1999024562A1 (en) * 1997-11-12 1999-05-20 Genencor International, Inc. Method of increasing efficiency of directed evolution of a gene using phagemid
US7166466B2 (en) 1997-12-08 2007-01-23 California Institute Of Technology Method for creating polynucleotide and polypeptide sequences
WO1999029882A3 (en) * 1997-12-10 1999-09-16 Pioneer Hi Bred Int Methods for altering the nutritional value of a plant protein, vegetative storage protein, vsp, by altering the amino acid content of proteins
US6946589B1 (en) 1997-12-10 2005-09-20 Pioneer Hi-Bred International, Inc. Compositions and methods for altering amino acid content of proteins
US6905877B1 (en) 1997-12-10 2005-06-14 Pioneer Hi-Bred International, Inc. Compositions and methods for altering amino acid content of proteins
US8377681B2 (en) 1998-01-16 2013-02-19 Codexis Mayflower Holdings, Llc Evolution of whole cells and organisms by recursive sequence recombination
US7390619B1 (en) 1998-02-11 2008-06-24 Maxygen, Inc. Optimization of immunomodulatory properties of genetic vaccines
WO1999041368A3 (en) * 1998-02-11 1999-12-16 Maxygen Inc Optimization of immunomodulatory properties of genetic vaccines
WO1999041369A3 (en) * 1998-02-11 1999-09-23 Maxygen Inc Genetic vaccine vector engineering
EP1555316A3 (en) * 1998-02-11 2008-01-30 Maxygen, Inc. Antigen library immunization
WO1999041402A3 (en) * 1998-02-11 1999-11-11 Maxygen Inc Targeting of genetic vaccine vectors
WO1999041407A1 (de) * 1998-02-11 1999-08-19 Otogene Aktiengesellschaft Verfahren zur entwicklung eines pharmazeutischen wirkstoffes
EP1518927A3 (en) * 1998-02-11 2005-06-22 Maxygen, Inc. Optimization of immunomodulatory properties of genetic vaccines
WO1999041383A1 (en) * 1998-02-11 1999-08-19 Maxygen, Inc. Antigen library immunization
WO1999041393A1 (en) * 1998-02-17 1999-08-19 Zeneca Limited Insecticidal peptides
US6500617B1 (en) 1998-05-01 2002-12-31 Maxygen, Inc. Optimization of pest resistance genes using DNA shuffling
US6902918B1 (en) 1998-05-21 2005-06-07 California Institute Of Technology Oxygenase enzymes and screening method
US7153655B2 (en) 1998-06-16 2006-12-26 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function involving the use of exonuclease enzyme and two populations of parent polynucleotide sequence
US6337186B1 (en) 1998-06-17 2002-01-08 Maxygen, Inc. Method for producing polynucleotides with desired properties
JP2002519038A (ja) * 1998-06-29 2002-07-02 フィロス インク. 多様性の高いライブラリーを製造する方法
EP1092039A4 (en) * 1998-06-29 2003-07-02 Phylos Inc METHODS FOR GENERATING EXTREMELY DIVERSIFIED BANKS
WO2000006718A3 (en) * 1998-07-28 2000-06-15 California Inst Of Techn Expression of functional eukaryotic proteins
US7718786B2 (en) 1998-08-12 2010-05-18 Proteus Sa Process for obtaining recombined nucleotide sequences in vitro, libraries of sequences and sequences thus obtained
WO2000009727A3 (en) * 1998-08-12 2000-05-18 Maxygen Inc Dna shuffling to produce herbicide selective crops
US6605430B1 (en) 1998-08-12 2003-08-12 Maxygen, Inc. DNA shuffling of monooxygenase genes for production of industrial chemicals
US6991922B2 (en) 1998-08-12 2006-01-31 Proteus S.A. Process for in vitro creation of recombinant polynucleotide sequences by oriented ligation
WO2000009682A1 (en) * 1998-08-12 2000-02-24 Maxygen, Inc. Dna shuffling of monooxygenase genes for production of industrial chemicals
EP2105446A2 (en) 1998-09-23 2009-09-30 ZymoGenetics, Inc. Cytokine receptor zalpha11
WO2000020573A3 (en) * 1998-10-07 2000-07-20 Maxygen Inc Dna shuffling to produce nucleic acids for mycotoxin detoxification
US6500639B2 (en) 1998-10-07 2002-12-31 Maxygen, Inc. DNA shuffling to produce nucleic acids for mycotoxin detoxification
US6483011B1 (en) 1998-11-10 2002-11-19 Maxygen, Inc. Modified ADP-glucose pyrophosphorylase for improvement and optimization of plant phenotypes
WO2000031246A3 (en) * 1998-11-19 2000-08-17 S I S S A Scuola Internazional Methods for the preparation by in vivo recombination of nucleic acid and polypeptide libraries and uses thereof
US7439021B2 (en) 1999-01-05 2008-10-21 Trustees Of Boston University Nucleic acid cloning
US6358712B1 (en) 1999-01-05 2002-03-19 Trustee Of Boston University Ordered gene assembly
US7579146B2 (en) 1999-01-05 2009-08-25 Trustees Of Boston University Nucleic acid cloning
EP2256199A1 (en) 1999-01-07 2010-12-01 ZymoGenetics, Inc. Therapeutic uses of BR43X2 soluble receptors
WO2000042559A1 (en) * 1999-01-18 2000-07-20 Maxygen, Inc. Methods of populating data structures for use in evolutionary simulations
JP2003536117A (ja) * 1999-01-18 2003-12-02 マキシジェン, インコーポレイテッド 進化シュミレーションにおける使用のためにデータ構造を居住させる方法
US7957912B2 (en) 1999-01-19 2011-06-07 Codexis Mayflower Holdings Llc Methods for identifying and producing polypeptides
JP2010178757A (ja) * 1999-01-19 2010-08-19 Maxygen Inc オリゴヌクレオチド媒介核酸組換え
WO2000042561A3 (en) * 1999-01-19 2000-12-07 Maxygen Inc Oligonucleotide mediated nucleic acid recombination
US6426224B1 (en) 1999-01-19 2002-07-30 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US7058515B1 (en) 1999-01-19 2006-06-06 Maxygen, Inc. Methods for making character strings, polynucleotides and polypeptides having desired characteristics
WO2000042560A3 (en) * 1999-01-19 2000-11-23 Maxygen Inc Methods for making character strings, polynucleotides and polypeptides
EP1108783A3 (en) * 1999-01-19 2001-09-05 Maxygen, Inc. Oligonucleotide-mediated nucleic acid recombination
EP2253704A1 (en) 1999-01-19 2010-11-24 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US6319714B1 (en) 1999-01-19 2001-11-20 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US6423542B1 (en) 1999-01-19 2002-07-23 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US6917882B2 (en) 1999-01-19 2005-07-12 Maxygen, Inc. Methods for making character strings, polynucleotides and polypeptides having desired characteristics
US7421347B2 (en) 1999-01-19 2008-09-02 Maxygen, Inc. Identifying oligonucleotides for in vitro recombination
JP2002534966A (ja) * 1999-01-19 2002-10-22 マキシジェン, インコーポレイテッド オリゴヌクレオチド媒介核酸組換え
US7024312B1 (en) 1999-01-19 2006-04-04 Maxygen, Inc. Methods for making character strings, polynucleotides and polypeptides having desired characteristics
US6479652B1 (en) 1999-01-19 2002-11-12 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US6521453B1 (en) 1999-01-19 2003-02-18 Maxygen, Inc. Oligonucloetide mediated nucleic acid recombination
US6961664B2 (en) 1999-01-19 2005-11-01 Maxygen Methods of populating data structures for use in evolutionary simulations
US7620502B2 (en) 1999-01-19 2009-11-17 Maxygen, Inc. Methods for identifying sets of oligonucleotides for use in an in vitro recombination procedure
EP1073710A4 (en) * 1999-02-04 2007-12-19 Verenium Corp NON-STOCHASTIC DEVELOPMENT OF GENETIC VACCINES AND ENZYMES
US6376246B1 (en) 1999-02-05 2002-04-23 Maxygen, Inc. Oligonucleotide mediated nucleic acid recombination
US7384387B1 (en) 1999-02-11 2008-06-10 Maxygen, Inc. High throughput mass spectrometry
US6413745B1 (en) 1999-03-05 2002-07-02 Maxygen, Inc Recombination of insertion modified nucleic acids
US6531316B1 (en) 1999-03-05 2003-03-11 Maxyag, Inc. Encryption of traits using split gene sequences and engineered genetic elements
US6406910B1 (en) 1999-03-05 2002-06-18 Maxygen, Inc. Recombination of insertion modified nucleic acids
US6365377B1 (en) 1999-03-05 2002-04-02 Maxygen, Inc. Recombination of insertion modified nucleic acids
US6358740B1 (en) 1999-03-05 2002-03-19 Maxygen, Inc. Recombination of insertion modified nucleic acids
EP2295577A2 (en) 1999-03-09 2011-03-16 ZymoGenetics, Inc. Human cytokine as ligand of the z-alpha receptor and uses thereof
WO2000053744A3 (en) * 1999-03-09 2001-01-18 Diversa Corp End selection in directed evolution
EP1092041A4 (en) * 1999-03-26 2001-09-19 Diversa Corp EXONUCLEASE-MEDIATED ASSEMBLY OF NUCLEIC ACIDS IN THE DIRECT EVOLUTION
AU2009212959B2 (en) * 1999-06-14 2013-08-15 Bp Corporation North America Inc. Synthetic ligation reassembly in directed evolution
USRE45349E1 (en) 1999-06-14 2015-01-20 Bp Corporation North America Inc. Synthetic ligation reassembly in directed evolution
US6537776B1 (en) 1999-06-14 2003-03-25 Diversa Corporation Synthetic ligation reassembly in directed evolution
US6605449B1 (en) 1999-06-14 2003-08-12 Diversa Corporation Synthetic ligation reassembly in directed evolution
EP1192280A4 (en) * 1999-06-14 2006-04-05 Diversa Corp SYNTHETIC COMBINATION THROUGH LIGATION IN THE TARGETED EVOLUTION
EP2865754A1 (en) * 1999-06-14 2015-04-29 BP Corporation North America Inc. Synthetic ligation reassembly in directed evolution
WO2001000234A3 (en) * 1999-06-25 2001-08-02 Maxygen Inc Methods and compositions for engineering of attenuated vaccines
EP2241623A2 (en) 1999-07-07 2010-10-20 ZymoGenetics, Inc. Monoclonal antibody against a human cytokine receptor
WO2001004287A1 (en) * 1999-07-07 2001-01-18 Maxygen Aps A method for preparing modified polypeptides
US6846635B1 (en) 1999-07-30 2005-01-25 Large Scale Proteomics Corp. Microarrays and their manufacture
US6887701B2 (en) 1999-07-30 2005-05-03 Large Scale Proteomics Corporation Microarrays and their manufacture
US7179638B2 (en) 1999-07-30 2007-02-20 Large Scale Biology Corporation Microarrays and their manufacture by slicing
US6951719B1 (en) 1999-08-11 2005-10-04 Proteus S.A. Process for obtaining recombined nucleotide sequences in vitro, libraries of sequences and sequences thus obtained
US6632673B1 (en) 1999-08-12 2003-10-14 Pfizer, Inc. Directing the ratio of B2:B1 avermectins in Streptomyces avermitilis host cells
US7858340B2 (en) 1999-08-12 2010-12-28 Pfizer Inc. Polynucleotides and methods of directing the ratio of B2:B1 avermectins in Streptomyces avermitilis host cells
WO2001023401A3 (en) * 1999-09-28 2001-12-06 Maxygen Inc Use of codon-varied oligonucleotide synthesis for synthetic sequence recombination
US6436675B1 (en) 1999-09-28 2002-08-20 Maxygen, Inc. Use of codon-varied oligonucleotide synthesis for synthetic shuffling
US6562594B1 (en) 1999-09-29 2003-05-13 Diversa Corporation Saturation mutagenesis in directed evolution
US7430477B2 (en) 1999-10-12 2008-09-30 Maxygen, Inc. Methods of populating data structures for use in evolutionary simulations
US7873499B2 (en) 1999-10-12 2011-01-18 Codexis, Inc. Methods of populating data structures for use in evolutionary simulations
WO2001032829A3 (en) * 1999-11-05 2001-12-13 Novozymes As Methods to screen microorganisms or gene libraries for products secreted from a cell
DE19953854C2 (de) * 1999-11-09 2002-01-17 Max Planck Gesellschaft Verfahren zur Herstellung von Biopolymeren mit veränderten Eigenschaften
US6821758B1 (en) 1999-11-09 2004-11-23 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Method for the production of biopolymers with modified properties
DE19953854A1 (de) * 1999-11-09 2001-06-28 Max Planck Gesellschaft Verfahren zur Herstellung von Biopolymeren mit veränderten Eigenschaften
US6686515B1 (en) 1999-11-23 2004-02-03 Maxygen, Inc. Homologous recombination in plants
US7115712B1 (en) 1999-12-02 2006-10-03 Maxygen, Inc. Cytokine polypeptides
EP2194130A1 (en) 1999-12-23 2010-06-09 ZymoGenetics, L.L.C. Cytokine ZCYTO18
EP2133098A1 (en) 2000-01-10 2009-12-16 Maxygen Holdings Ltd G-CSF conjugates
US7462469B2 (en) 2000-01-11 2008-12-09 Maxygen, Inc. Integrated system for diversity generation and screening
WO2001051663A3 (en) * 2000-01-11 2002-06-13 Maxygen Inc Integrated systems and methods for diversity generation and screening
US7544859B2 (en) 2000-02-09 2009-06-09 Basf Aktiengesellschaft Elongase gene and method for producing multiple-unsaturated fatty acids
US8933300B2 (en) 2000-02-09 2015-01-13 Basf Aktiengesellschaft Elongase gene, and process for the preparation of polyunsaturated fatty acids
EP1982732A2 (en) 2000-02-11 2008-10-22 Maxygen Holdings Ltd. Factor VII or VIIA-like molecules
EP2319541A1 (en) 2000-02-11 2011-05-11 Bayer HealthCare LLC Factor VII or VIIA-like conjugates
WO2001075767A3 (en) * 2000-03-30 2002-07-04 Maxygen Inc In silico cross-over site selection
EP1749888A2 (en) 2000-04-05 2007-02-07 ZymoGenetics, Inc. Soluble zalpha11 cytokine receptors
US7098010B1 (en) 2000-05-16 2006-08-29 California Institute Of Technology Directed evolution of oxidase enzymes
US7115403B1 (en) 2000-05-16 2006-10-03 The California Institute Of Technology Directed evolution of galactose oxidase enzymes
US7612170B2 (en) 2000-06-23 2009-11-03 Maxygen, Inc. Co-stimulatory polypeptides
US7094875B2 (en) 2000-06-23 2006-08-22 Maxygen, Inc. Co-stimulatory polypeptides
US7074590B2 (en) 2000-06-23 2006-07-11 Maxygen, Inc. Chimeric promoters
EP2258725A2 (en) 2000-06-26 2010-12-08 ZymoGenetics, L.L.C. Cytokine receptor zcytor17
US6994963B1 (en) 2000-07-10 2006-02-07 Ambion, Inc. Methods for recombinatorial nucleic acid synthesis
WO2002004630A3 (en) * 2000-07-10 2002-08-29 Ambion Inc Methods for recombinatorial nucleic acid synthesis
US6858422B2 (en) 2000-07-13 2005-02-22 Codexis, Inc. Lipase genes
US7407786B2 (en) 2000-07-13 2008-08-05 Codexis, Inc. Lipase genes
WO2002016625A2 (en) 2000-08-25 2002-02-28 Basf Plant Science Gmbh Plant polynucleotides encoding prenyl proteases
WO2002022810A3 (en) * 2000-09-15 2003-02-27 Diversa Corp Combinatorial screening of mixed populations of organisms
GB2370038B (en) * 2000-12-12 2003-03-26 Bioinvent Int Ab A method for in vitro molecular evolution of protein function
EP1341909B1 (en) * 2000-12-12 2005-05-18 Alligator Bioscience AB A method for in vitro molecular evolution of protein function
US7282334B2 (en) 2000-12-12 2007-10-16 Alligator Bioscience, Ab Method for in vitro molecular evolution of protein function
US7563578B2 (en) 2000-12-12 2009-07-21 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function
US6958213B2 (en) 2000-12-12 2005-10-25 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function
GB2370038A (en) * 2000-12-12 2002-06-19 Bioinvent Int Ab A method for in vitro molecular evolution of protein function
US7465567B2 (en) 2001-04-16 2008-12-16 California Institute Of Technology Peroxide-driven cytochrome P450 oxygenase variants
US7704715B2 (en) 2001-04-16 2010-04-27 California Institute Of Technology Peroxide-driven cytochrome P450 oxygenase variants
US8076114B2 (en) 2001-07-20 2011-12-13 California Institute Of Technology Cytochrome P450 oxygenases
US7691616B2 (en) 2001-07-20 2010-04-06 California Institute Of Technology Cytochrome P450 oxygenases
US9322001B2 (en) 2001-07-20 2016-04-26 California Institute Of Technology Cytochrome P450 oxygenases
US8722371B2 (en) 2001-07-20 2014-05-13 California Institute Of Technology Cytochrome P450 oxygenases
US7226768B2 (en) 2001-07-20 2007-06-05 The California Institute Of Technology Cytochrome P450 oxygenases
US8367386B2 (en) 2001-07-20 2013-02-05 California Institute Of Technology Cytochrome P450 oxygenases
EP1961293A2 (en) 2001-09-27 2008-08-27 Pioneer Hi-Bred International, Inc. Phytate polynucleotides and methods of use
EP2130919A1 (en) 2001-11-05 2009-12-09 ZymoGenetics, Inc. IL-21 antagonists
US7449187B2 (en) 2001-12-20 2008-11-11 Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) Alkaline protease from Bacillus gibsonii (DSM 14391) and washing and cleaning products comprising said alkaline protease
US7262042B2 (en) 2001-12-20 2007-08-28 Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) Alkaline protease from Bacillus gibsonii (DSM 14393) and washing and cleaning products comprising said alkaline protease
US7569226B2 (en) 2001-12-22 2009-08-04 Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) Alkaline protease from Bacillus sp. (DSM 14392) and washing and cleaning products comprising said alkaline protease
EP2338910A1 (en) 2002-01-18 2011-06-29 ZymoGenetics, Inc. Cytokine receptor Zcytor17 multimers
EP2840089A1 (en) 2002-01-18 2015-02-25 ZymoGenetics, Inc. Cytokine receptor zcytor17 multimers
EP2230299A1 (en) 2002-01-18 2010-09-22 ZymoGenetics, Inc. Novel cytokine ZCYTOR17 ligand
EP2050815A1 (en) 2002-02-12 2009-04-22 Pfizer Products Inc. Streptomyces Avermitilis gene directing the ratio of B2:B1 avermectins
US8008078B2 (en) 2002-02-12 2011-08-30 Pfizer Inc. Streptomyces avermitilis gene directing the ratio of B2:B1 avermectins
US7388085B2 (en) 2002-02-12 2008-06-17 Pfizer Inc Streptomyces avermitilis gene directing the ratio of B2:B1 avermectins
US8030000B2 (en) 2002-02-21 2011-10-04 Alere San Diego, Inc. Recombinase polymerase amplification
US8017339B2 (en) 2002-02-21 2011-09-13 Alere San Diego, Inc. Compositions and kits for recombinase polymerase amplification
US9340825B2 (en) 2002-02-21 2016-05-17 Alere San Diego, Inc. Compositions for recombinase polymerase amplification
US8460875B2 (en) 2002-02-21 2013-06-11 Alere San Diego, Inc. Recombinase polymerase amplification
US10036057B2 (en) 2002-02-21 2018-07-31 Alere San Diego, Inc. Recombinase polymerase amplification
US8574846B2 (en) 2002-02-21 2013-11-05 Alere San Diego, Inc. Recombinase polymerase amplification
US8945845B2 (en) 2002-02-21 2015-02-03 Alere San Diego Inc. Recombinase polymerase amplification
US9309502B2 (en) 2002-02-21 2016-04-12 Alere San Diego Inc. Recombinase polymerase amplification
US9663820B2 (en) 2002-02-21 2017-05-30 Alere San Diego Inc. Recombinase polymerase amplification
US10947584B2 (en) 2002-02-21 2021-03-16 Abbott Diagnostics Scarborough, Inc. Recombinase polymerase amplification
US10329602B2 (en) 2002-02-21 2019-06-25 Alere San Diego, Inc. Recombinase polymerase amplification
US8426134B2 (en) 2002-02-21 2013-04-23 Alere San Diego, Inc. Recombinase polymerase amplification
US8962255B2 (en) 2002-02-21 2015-02-24 Alere San Diego, Inc. Recombinase polymerase amplification
US10329603B2 (en) 2002-02-21 2019-06-25 Alere San Diego Inc. Recombinase polymerase amplification
EP1476563A2 (en) 2002-02-26 2004-11-17 E.I. Du Pont De Nemours And Company Method for the recombination of genetic elements
US7220563B2 (en) 2002-02-27 2007-05-22 California Institute Of Technology Glucose 6-oxidases
EP2390803A1 (en) 2002-03-01 2011-11-30 Codexis Mayflower Holdings, LLC Methods, systems, and software for identifying functional biomolecules
EP2278509A1 (en) 2002-03-01 2011-01-26 Maxygen Inc. Methods, systems, and software for identifying functional biomolecules
WO2003075129A2 (en) 2002-03-01 2003-09-12 Maxygen, Inc. Methods, systems, and software for identifying functional bio-molecules
EP2315145A1 (en) 2002-03-01 2011-04-27 Codexis Mayflower Holdings, LLC Methods, systems, and software for identifying functional biomolecules
WO2003078583A2 (en) 2002-03-09 2003-09-25 Maxygen, Inc. Optimization of crossover points for directed evolution
EP2213681A1 (en) 2002-03-22 2010-08-04 Bayer BioScience N.V. Novel Bacillus thuringiensis insecticidal proteins
EP2360179A1 (en) 2002-03-22 2011-08-24 Bayer BioScience N.V. Novel bacillus thuringiensis insecticidal proteins
WO2003087313A2 (en) 2002-04-08 2003-10-23 Pioneer Hi-Bred International, Inc. Enhanced silk exsertion under stress
EP2298871A1 (en) 2002-04-19 2011-03-23 Verenium Corporation Phospholipases, nucleic acids encoding them and methods for making and using them
EP2295455A1 (en) 2002-04-19 2011-03-16 ZymoGenetics, L.L.C. Cytokine receptor
US7262012B2 (en) 2002-05-17 2007-08-28 Alligator Bioscience Ab Method for in vitro molecular evolution of protein function using varied exonuclease digestion in two polynucleotide populations
GB2388604B (en) * 2002-05-17 2005-01-26 Alligator Bioscience Ab A method for in vitro molecular evolution of protein function
GB2388604A (en) * 2002-05-17 2003-11-19 Alligator Bioscience Ab Molecular evolution in vitro
EP2289525A1 (en) 2002-06-07 2011-03-02 ZymoGenetics, Inc. Use of IL-21 for expanding lymphoid cells and for anticancer adoptive immunotherapy
EP2377549A1 (en) 2002-06-07 2011-10-19 ZymoGenetics, Inc. Use of IL-21 for treating viral infections
EP2377547A1 (en) 2002-06-07 2011-10-19 ZymoGenetics, Inc. Use of IL-21 as an antimicrobial agent
EP2380633A1 (en) 2002-06-07 2011-10-26 ZymoGenetics, Inc. Use of IL-21 in cancer
WO2004016649A3 (de) * 2002-07-19 2004-04-22 Amaxa Gmbh Verfahren zur herstellung eines künstlichen polypeptids und nach diesem verfahren hergestelltes künstliches protein
EP2275536A1 (en) 2002-08-06 2011-01-19 Verdia, Inc. AP1 amine oxidase variants
EP2194133A2 (en) 2003-03-06 2010-06-09 Verenium Corporation Amylases, nucleic acids encoding them and methods for making and using them
EP3508578A1 (en) 2003-03-06 2019-07-10 BASF Enzymes, LLC Amylases, nucleic acids encoding them and methods for making and using them
EP3023498A1 (en) 2003-03-06 2016-05-25 BASF Enzymes LLC Amylases, nucleic acids encoding them and methods for making and using them
EP2853593A1 (en) 2003-03-07 2015-04-01 DSM IP Assets B.V. Hydrolases, nucleic acids encoding them and mehods for making and using them
US7083931B2 (en) 2003-04-04 2006-08-01 Stratagene California Renilla GFP mutants with increased fluorescent intensity and spectral shift
WO2004090099A2 (en) 2003-04-04 2004-10-21 Diversa Corporation Pectate lyases, nucleic acids encoding them and methods for making and using them
EP2341136A1 (en) 2003-04-04 2011-07-06 Verenium Corporation Pectate lyases, Nucleic Acids encoding them and methods for making and using them
EP2322629A2 (en) 2003-04-29 2011-05-18 Pioneer Hi-Bred International Inc. Novel glyphosate-n-acetyltransferase (GAT) genes
EP2535414A1 (en) 2003-04-29 2012-12-19 Pioneer Hi-Bred International Inc. Novel glyphosate-n-acetyltransferase (gat) genes
US9145549B2 (en) 2003-06-17 2015-09-29 The California Institute Of Technology Regio- and enantioselective alkane hydroxylation with modified cytochrome P450
US8343744B2 (en) 2003-06-17 2013-01-01 The California Institute Of Technology Regio- and enantioselective alkane hydroxylation with modified cytochrome P450
US8741616B2 (en) 2003-06-17 2014-06-03 California Institute Of Technology Regio- and enantioselective alkane hydroxylation with modified cytochrome P450
US7524664B2 (en) 2003-06-17 2009-04-28 California Institute Of Technology Regio- and enantioselective alkane hydroxylation with modified cytochrome P450
US7863030B2 (en) 2003-06-17 2011-01-04 The California Institute Of Technology Regio- and enantioselective alkane hydroxylation with modified cytochrome P450
US8603949B2 (en) 2003-06-17 2013-12-10 California Institute Of Technology Libraries of optimized cytochrome P450 enzymes and the optimized P450 enzymes
EP2404931A1 (en) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
EP2404929A1 (en) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
EP2409981A1 (en) 2003-07-02 2012-01-25 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
EP2404928A1 (en) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
EP2404930A1 (en) 2003-07-02 2012-01-11 Verenium Corporation Glucanases, nucleic acids encoding them and methods for making and using them
WO2005021714A2 (en) 2003-08-11 2005-03-10 Diversa Corporation Laccases, nucleic acids encoding them and methods for making and using them
US7435570B2 (en) 2003-08-11 2008-10-14 California Institute Of Technology Thermostable peroxide-driven cytochrome P450 oxygenase variants and methods of use
US7943340B2 (en) 2003-08-25 2011-05-17 Funzyme Biotechnologies Sa Fungal dipeptidyl peptidase IV (DPPIV) enzyme for reagent use
US7468267B2 (en) 2003-08-25 2008-12-23 Funzyme Biotechnologies Sa Fungal proteins and nucleic acids encoding same
US7354734B2 (en) 2003-08-25 2008-04-08 Funzyme Biotechnologies Sa Fungal proteins and nucleic acids encoding same
EP3190182A1 (en) 2004-03-08 2017-07-12 DSM IP Assets B.V. Phospholipases, nucleic acids encoding them and methods for making and using them
EP2336361B1 (en) * 2004-06-01 2019-01-23 Alere San Diego, Inc. Kit for recombinase polymerase amplification
AU2015203225B2 (en) * 2004-06-01 2017-05-04 Abbott Diagnostics Scarborough, Inc. Recombinase Polymerase Amplification
WO2005123929A2 (en) 2004-06-09 2005-12-29 Pioneer Hi-Bred International, Inc. Plastid transit peptides
EP2468853A1 (en) 2004-06-16 2012-06-27 Verenium Corporation Composition and methods for enzymatic decolorization of chlorophyll
WO2006009676A2 (en) 2004-06-16 2006-01-26 Diversa Corporation Compositions and methods for enzymatic decolorization of chlorophyll
WO2006081976A1 (de) * 2005-02-05 2006-08-10 Bayer Healthcare Ag MUTANTEN DES FLUORESZIERENDEN PROTEINS CGFPs, SOWIE DEREN VERWENDUNG
EP2192132A2 (en) 2005-02-08 2010-06-02 ZymoGenetics, Inc. Anti-IL-20, anti-IL22 and anti-IL-22RA antibodies and binding partners and methods of using in inflammation
EP2886658A1 (en) 2005-03-10 2015-06-24 BASF Enzymes LLC Lyase enzymes, nucleic acids encoding them and methods for making and using them
WO2006101584A2 (en) 2005-03-15 2006-09-28 Diversa Corporation Cellulases, nucleic acids encoding them and methods for making and using them
EP2949756A2 (en) 2005-03-15 2015-12-02 BP Corporation North America Inc. Cellulases, nucleic acids encoding them and methods for making and using them
US10648006B2 (en) 2005-03-28 2020-05-12 California Institute Of Technology Alkane oxidation by modified hydroxylases
US11214817B2 (en) 2005-03-28 2022-01-04 California Institute Of Technology Alkane oxidation by modified hydroxylases
US12258605B2 (en) 2005-03-28 2025-03-25 California Institute Of Technology Alkane oxidation by modified hydroxylases
US9963720B2 (en) 2005-03-28 2018-05-08 California Institute Of Technology Alkane oxidation by modified hydroxylases
US9404096B2 (en) 2005-03-28 2016-08-02 California Institute Of Technology Alkane oxidation by modified hydroxylases
US8715988B2 (en) 2005-03-28 2014-05-06 California Institute Of Technology Alkane oxidation by modified hydroxylases
EP3683230A1 (en) 2005-05-12 2020-07-22 ZymoGenetics, Inc. Compositions and methods for modulating immune responses
EP3214095A1 (en) 2005-05-12 2017-09-06 ZymoGenetics, Inc. Compositions and methods for modulating immune responses
EP2399932A1 (en) 2005-05-12 2011-12-28 ZymoGenetics, Inc. Compositions and methods for modulating immune responses
WO2006124667A2 (en) 2005-05-12 2006-11-23 Zymogenetics, Inc. Compositions and methods for modulating immune responses
EP2397493A1 (en) 2005-05-12 2011-12-21 ZymoGenetics, Inc. Compositions and methods for modulating immune responses
US9932577B2 (en) 2005-07-25 2018-04-03 Alere San Diego, Inc. Methods for multiplexing recombinase polymerase amplification
US8062850B2 (en) 2005-07-25 2011-11-22 Alere San Diego, Inc. Methods for multiplexing recombinase polymerase amplification
US10538760B2 (en) 2005-07-25 2020-01-21 Alere San Diego, Inc. Methods for multiplexing recombinase polymerase amplification
US11566244B2 (en) 2005-07-25 2023-01-31 Abbott Diagnostics Scarborough, Inc. Methods for multiplexing recombinase polymerase amplification
US8580507B2 (en) 2005-07-25 2013-11-12 Alere San Diego, Inc. Methods for multiplexing recombinase polymerase amplification
US12577563B2 (en) 2005-07-25 2026-03-17 Abbott Diagnostics Scarborough, Inc. Methods for multiplexing recombinase polymerase amplification
EP2216403A2 (en) 2006-02-02 2010-08-11 Verenium Corporation Esterases and related nucleic acids and methods
EP2415864A1 (en) 2006-02-10 2012-02-08 Verenium Corporation Oligomerase-2 (or beta-xylosidase) enzymes, nucleic acids encoding them and methods for making and using them
EP2450439A1 (en) 2006-02-10 2012-05-09 Verenium Corporation Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them
EP2447363A1 (en) 2006-02-10 2012-05-02 Verenium Corporation Cellucloytic enzymes, nucleic acids encoding them and methods for making and using them
EP2444487A1 (en) 2006-02-10 2012-04-25 Verenium Corporation Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them
EP2444489A1 (en) 2006-02-10 2012-04-25 Verenium Corporation Cellucloytic enzymes, nucleic acids encoding them and methods for making and using them
EP2444490A1 (en) 2006-02-10 2012-04-25 Verenium Corporation Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them
EP2420570A1 (en) 2006-02-10 2012-02-22 Verenium Corporation Arabinofuranosidase enzymes, nucleic acids encoding them and methods for making and using them
EP2444488A1 (en) 2006-02-10 2012-04-25 Verenium Corporation Cellucloytic enzymes, nucleic acids encoding them and methods for making and using them
EP2548955A1 (en) 2006-02-14 2013-01-23 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
EP2548956A1 (en) 2006-02-14 2013-01-23 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
WO2007095398A2 (en) 2006-02-14 2007-08-23 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
EP2548954A1 (en) 2006-02-14 2013-01-23 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
EP2112227A1 (en) 2006-03-07 2009-10-28 Cargill, Incorporated Aldolases, nucleic acids encoding them and methods for making and using them
EP2388316A2 (en) 2006-03-07 2011-11-23 Verenium Corporation Aldolases, nucleic acids encoding them and methods for making and using them
EP2322643A1 (en) 2006-03-07 2011-05-18 Cargill, Incorporated Aldolases, nucleic acids encoding them and methods for making and using them
EP2385108A1 (en) 2006-03-07 2011-11-09 Verenium Corporation Aldolases, nucleic acids encoding them and methods for making and using them
EP3153580A2 (en) 2006-03-07 2017-04-12 BASF Enzymes LLC Aldolases, nucleic acids encoding them and methods for making and using them
EP2316962A1 (en) 2006-03-07 2011-05-04 Cargill, Incorporated Aldolases, nucleic acids encoding them and methods for making and using them
US12227773B2 (en) 2006-05-04 2025-02-18 Abbott Diagnostics Scarborough, Inc. Recombinase polymerase amplification
US11339382B2 (en) 2006-05-04 2022-05-24 Abbott Diagnostics Scarborough, Inc. Recombinase polymerase amplification
US8637253B2 (en) 2006-05-04 2014-01-28 Alere San Diego, Inc. Recombinase polymerase amplification
US10093908B2 (en) 2006-05-04 2018-10-09 Alere San Diego, Inc. Recombinase polymerase amplification
US8071308B2 (en) 2006-05-04 2011-12-06 Alere San Diego, Inc. Recombinase polymerase amplification
US8106013B2 (en) 2006-05-19 2012-01-31 Georgia Tech Research Corporation ABC transporter ligand GATX1
WO2008105797A2 (en) 2006-06-30 2008-09-04 Bristol-Myers Squibb Company Polynucleotides encoding novel pcsk9 variants
EP2639301A2 (en) 2006-06-30 2013-09-18 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
EP2671946A1 (en) 2006-06-30 2013-12-11 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
US8324158B2 (en) 2006-07-14 2012-12-04 Georgia Tech Research Corporation Methods for inhibiting CLC-2 channel with GATX2
US8026085B2 (en) 2006-08-04 2011-09-27 California Institute Of Technology Methods and systems for selective fluorination of organic molecules
US8252559B2 (en) 2006-08-04 2012-08-28 The California Institute Of Technology Methods and systems for selective fluorination of organic molecules
EP2444413A1 (en) 2006-08-04 2012-04-25 Verenium Corporation Methods for oil or gas well drilling, washing and/or fracturing
EP2620495A2 (en) 2006-09-21 2013-07-31 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2397486A1 (en) 2006-09-21 2011-12-21 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617823A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
WO2008036863A2 (en) 2006-09-21 2008-03-27 Verenium Corporation Phospholipases, nucleic acids encoding them and methods for making and using them
EP2617728A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617817A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617816A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617729A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617815A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617821A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617819A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2617820A2 (en) 2006-09-21 2013-07-24 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
WO2008080093A2 (en) 2006-12-21 2008-07-03 Verenium Corporation Amylases and glucoamylases, nucleic acids encoding them and methods for making and using them
EP2479266A1 (en) 2006-12-21 2012-07-25 Verenium Corporation Amylases and glucoamylases, nucleic acids encoding them and methods for making and using them
EP3101128A1 (en) 2006-12-21 2016-12-07 BASF Enzymes LLC Amylases and glucoamylases, nucleic acids encoding them and methods for making and using them
EP2479267A1 (en) 2006-12-21 2012-07-25 Verenium Corporation Amylases and glucoamylases, nucleic acids encoding them and methods for making and using them
EP3540053A1 (en) 2006-12-21 2019-09-18 BASF Enzymes, LLC Amylases and glucoamylases, nucleic acids encoding them and methods for making and using them
DE102007003143A1 (de) 2007-01-16 2008-07-17 Henkel Kgaa Neue Alkalische Protease aus Bacillus gibsonii und Wasch- und Reinigungsmittel enthaltend diese neue Alkalische Protease
WO2008095033A2 (en) 2007-01-30 2008-08-07 Verenium Corporation Enzymes for the treatment of lignocellulosics, nucleic acids encoding them and methods for making and using them
EP2559702A1 (en) 2007-02-08 2013-02-20 Domantis Limited Antibody single variable domains against serum albumin
WO2008098198A2 (en) 2007-02-08 2008-08-14 The California Institute Of Technology Alkane oxidation by modified hydroxylases
EP2559703A1 (en) 2007-02-08 2013-02-20 Domantis Limited Antibody single variable domains against serum albumin
EP2559704A1 (en) 2007-02-08 2013-02-20 Domantis Limited Antibody single variable domains against serum albumin
EP2708602A2 (en) 2007-10-03 2014-03-19 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
WO2009045627A2 (en) 2007-10-03 2009-04-09 Verenium Corporation Xylanases, nucleic acids encoding them and methods for making and using them
EP3241846A1 (en) 2007-10-04 2017-11-08 ZymoGenetics, Inc. B7 family member zb7h6 and related compositions and methods
WO2009046407A2 (en) 2007-10-04 2009-04-09 Zymogenetics, Inc. B7 FAMILY MEMBER zB7H6 AND RELATED COMPOSITIONS AND METHODS
DE102007051092A1 (de) 2007-10-24 2009-04-30 Henkel Ag & Co. Kgaa Subtilisin aus Becillus pumilus und Wasch- und Reinigungsmittel enthaltend dieses neue Subtilisin
WO2009059379A1 (en) 2007-11-07 2009-05-14 Dynamic Microbials Limited Antimicrobial compositions, formulations and uses thereof
WO2009067580A2 (en) 2007-11-20 2009-05-28 Pioneer Hi-Bred International, Inc. Maize ethylene signaling genes and modulation of same for improved stress tolerance in plants
EP2602263A2 (en) 2007-11-21 2013-06-12 Roskilde Universitet Polypeptides comprising an ice-binding activity
WO2009065934A1 (en) * 2007-11-22 2009-05-28 Novozymes A/S Polypeptides having ferulic acid esterase activity and polynucleotides encoding same
EP2865750A2 (en) 2008-01-03 2015-04-29 BASF Enzymes LLC Transferases and oxidoreductases, nucleic acids encoding them and methods for making and using them
WO2009088949A1 (en) 2008-01-03 2009-07-16 Verenium Corporation Transferases and oxidoreductases, nucleic acids encoding them and methods for making and using them
EP2706122A2 (en) 2008-01-03 2014-03-12 Verenium Corporation Isomerases, nucleic acids encoding them and methods for making and using them
US8653020B2 (en) 2008-01-25 2014-02-18 Aarhus Universitet Selective exosite inhibition of PAPP-A activity against IGFBP-4
US9481873B2 (en) 2008-04-17 2016-11-01 Novozymes A/S Polypeptides having ferulic acid esterase activity and polynucleotides encoding same
WO2009127729A1 (en) * 2008-04-17 2009-10-22 Novozymes A/S Polypeptides having ferulic acid esterase activity and polynucleotides encoding same
EP3115459A2 (en) 2008-05-23 2017-01-11 E. I. du Pont de Nemours and Company Novel dgat genes for increased seed storage lipid production and altered fatty acid profiles in oilseed plants
US8383346B2 (en) 2008-06-13 2013-02-26 Codexis, Inc. Combined automated parallel synthesis of polynucleotide variants
US8178333B2 (en) 2008-06-24 2012-05-15 Codexis, Inc. Biocatalytic processes for the preparation of substantially stereomerically pure fused bicyclic proline compounds
US8574876B2 (en) 2008-06-24 2013-11-05 Codexis, Inc. Biocatalytic processes for the preparation of stereomerically pure fused bicyclic proline compounds
US8426178B2 (en) 2008-08-27 2013-04-23 Codexis, Inc. Ketoreductase polypeptides for the production of a 3-aryl-3-hydroxypropanamine from a 3-aryl-3-ketopropanamine
US8455230B2 (en) 2008-08-27 2013-06-04 Codexis, Inc. Polynucleotides encoding engineered ketoreductase polypeptides
US8673607B2 (en) 2008-08-27 2014-03-18 Codexis, Inc. Ketoreductase polypeptides for the production of a 3-aryl-3-hydroxypropanamine from a 3-aryl-3-ketopropanamine
US8288131B2 (en) 2008-08-27 2012-10-16 Codexis, Inc. Ketoreductase polypeptides and uses thereof
US8288141B2 (en) 2008-08-27 2012-10-16 Codexis, Inc. Ketoreductase polypeptides for the production of 3-aryl-3-hydroxypropanamine from a 3-aryl-3-ketopropanamine
US8415126B2 (en) 2008-08-29 2013-04-09 Codexis, Inc. Polynucleotides encoding recombinant ketoreductase polypeptides
US12365881B2 (en) 2008-08-29 2025-07-22 Codexis, Inc. Ketoreductase polypeptides
US8273554B2 (en) 2008-08-29 2012-09-25 Codexis, Inc. Ketoreductase polypeptides for the stereoselective production of (4S)-3-[(5S)-5-(4-fluorophenyl)-5-hydroxypentanoyl]-4-phenyl-1,3-oxazolidin-2-one
US10544401B2 (en) 2008-08-29 2020-01-28 Codexis, Inc. Ketoreductase polypeptides
WO2010025395A2 (en) 2008-08-29 2010-03-04 Verenium Corporation Hydrolases, nucleic acids encoding them and methods for making and using them
US8956840B2 (en) 2008-08-29 2015-02-17 Codexis, Inc. Engineered ketoreductase polypeptides
US10246687B2 (en) 2008-08-29 2019-04-02 Codexis, Inc. Ketoreductase polypeptides
US9139820B2 (en) 2008-08-29 2015-09-22 Codexis, Inc. Ketoreductase polypeptides
US9796964B2 (en) 2008-08-29 2017-10-24 Codexis, Inc. Ketoreductase polypeptides
US10047348B2 (en) 2008-08-29 2018-08-14 Codexis, Inc. Ketoreductase polypeptides
US10988739B2 (en) 2008-08-29 2021-04-27 Codexis, Inc. Ketoreductase polypeptides
US9422530B2 (en) 2008-08-29 2016-08-23 Codexis, Inc. Ketoreductase polypeptides
EP3460061A1 (en) 2008-09-26 2019-03-27 Tocagen Inc. Recombinant replication competent murine leukemia gamma-retrovirus (mlv) for the expression of heat-stabilized cytosine deaminase
US9221902B2 (en) 2008-11-07 2015-12-29 Fabrus, Inc. Combinatorial antibody libraries and uses thereof
US10774138B2 (en) 2008-11-07 2020-09-15 Taurus Biosciences, Llc Combinatorial antibody libraries and uses thereof
WO2010065867A1 (en) 2008-12-04 2010-06-10 Pioneer Hi-Bred International, Inc. Methods and compositions for enhanced yield by targeted expression of knotted1
US8715996B2 (en) 2009-02-26 2014-05-06 Codexis, Inc. Beta-glucosidase variant enzymes and related polynucleotides
WO2010101818A1 (en) 2009-03-02 2010-09-10 Pioneer Hi-Bred International, Inc. Nac transcriptional activators involved in abiotic stress tolerance
US9005946B2 (en) 2009-03-17 2015-04-14 Codexis, Inc. Variant endoglucanases and related polynucleotides
US9464278B2 (en) 2009-03-17 2016-10-11 Codexis, Inc. Variant endoglucanases and related polynucleotides
US9896719B2 (en) 2009-05-20 2018-02-20 Alere San Diego Inc. DNA glycosylase/lyase and AP endonuclease substrates
US9469867B2 (en) 2009-05-20 2016-10-18 Alere San Diego, Inc. DNA glycosylase/lyase and AP endonuclease substrates
WO2010135588A2 (en) 2009-05-21 2010-11-25 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
EP2698374A1 (en) 2009-05-21 2014-02-19 Verenium Corporation Phytases, nucleic acids encoding them and methods for making and using them
US9057097B2 (en) 2009-06-05 2015-06-16 Alere San Diego Inc. Recombinase polymerase amplification reagents and kits
US9029112B2 (en) 2009-06-22 2015-05-12 Codexis, Inc. Ketoreductase-mediated stereoselective route to alpha chloroalcohols
US9404092B2 (en) 2009-06-22 2016-08-02 Codexis, Inc. Ketoreductase-mediated stereoselective route to alpha chloroalcohols
US8796002B2 (en) 2009-06-22 2014-08-05 Codexis, Inc. Polypeptides for a ketoreductase-mediated stereoselective route to alpha chloroalcohols
US9296992B2 (en) 2009-06-22 2016-03-29 Codexis, Inc. Ketoreductase-mediated stereoselective route to alpha chloroalcohols
WO2011017492A2 (en) 2009-08-05 2011-02-10 Pioneer Hi-Bred International, Inc. Novel eto1 genes and use of same for reduced ethylene and improved stress tolerance in plants
US9834758B2 (en) 2009-08-19 2017-12-05 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US11345898B2 (en) 2009-08-19 2022-05-31 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US12031159B2 (en) 2009-08-19 2024-07-09 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US10358631B2 (en) 2009-08-19 2019-07-23 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US10870835B2 (en) 2009-08-19 2020-12-22 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US12480100B2 (en) 2009-08-19 2025-11-25 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US10590396B2 (en) 2009-08-19 2020-03-17 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
US9102959B2 (en) 2009-08-19 2015-08-11 Codexis, Inc. Ketoreductase polypeptides for the preparation of phenylephrine
WO2011022597A1 (en) 2009-08-20 2011-02-24 Pioneer Hi-Bred International, Inc. Functional expression of shuffled yeast nitrate transporter (ynti) in maize to improve nitrate uptake under low nitrate environment
US9512382B2 (en) 2009-10-16 2016-12-06 Bunge Global Innovation, Llc Oil degumming methods
US9045712B2 (en) 2009-10-16 2015-06-02 Bunge Global Innovation, Llc Oil degumming methods
WO2011046815A1 (en) 2009-10-16 2011-04-21 Bunge Oils, Inc. Oil degumming methods
WO2011046812A1 (en) 2009-10-16 2011-04-21 Verenium Corporation Phospholipases, nucleic acids encoding them and methods for making and using them
US10604781B2 (en) 2010-02-10 2020-03-31 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US9080192B2 (en) 2010-02-10 2015-07-14 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US9714439B2 (en) 2010-02-10 2017-07-25 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US9394551B2 (en) 2010-02-10 2016-07-19 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US10196667B2 (en) 2010-02-10 2019-02-05 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US11193157B2 (en) 2010-02-10 2021-12-07 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
US8715962B2 (en) 2010-03-31 2014-05-06 Codexis, Inc. Production of geranyl diphosphate
US9644189B2 (en) 2010-05-04 2017-05-09 Codexis, Inc. Biocatalysts for ezetimibe synthesis
US9040262B2 (en) 2010-05-04 2015-05-26 Codexis, Inc. Biocatalysts for ezetimibe synthesis
US10995320B2 (en) 2010-05-04 2021-05-04 Codexis, Inc. Biocatalysts for Ezetimibe synthesis
US12110512B2 (en) 2010-05-04 2024-10-08 Codexis, Inc. Biocatalysts for ezetimibe synthesis
US9388391B2 (en) 2010-05-04 2016-07-12 Codexis, Inc. Biocatalysts for Ezetimibe synthesis
US10544400B2 (en) 2010-05-04 2020-01-28 Codexis, Inc. Biocatalysts for ezetimibe synthesis
US10053673B2 (en) 2010-05-04 2018-08-21 Codexis, Inc. Biocatalysts for Ezetimibe synthesis
US8822642B2 (en) 2010-06-09 2014-09-02 Zymogenetics, Inc. Dimeric fusion proteins and related compositions and methods
WO2011156356A1 (en) 2010-06-09 2011-12-15 Zymogenetics, Inc. Dimeric vstm3 fusion proteins and related compositions and methods
WO2012021785A1 (en) 2010-08-13 2012-02-16 Pioneer Hi-Bred International, Inc. Compositions and methods comprising sequences having hydroxyphenylpyruvate dioxygenase (hppd) activity
US8809021B2 (en) 2011-04-07 2014-08-19 Alere San Diego Inc. Monitoring recombinase polymerase amplification mixtures
US9157127B2 (en) 2011-04-07 2015-10-13 Alere San Diego Inc. Monitoring recombinase polymerase amplification mixtures
US9719132B2 (en) 2011-04-07 2017-08-01 Alere San Diego Inc. Monitoring recombinase polymerase amplification mixtures
US9322007B2 (en) 2011-07-22 2016-04-26 The California Institute Of Technology Stable fungal Cel6 enzyme variants
WO2013063006A1 (en) 2011-10-25 2013-05-02 Pioneer Hi-Bred International, Inc. Methods to alter plant cell wall composition for improved biofuel production and silage digestibility
WO2013166113A1 (en) 2012-05-04 2013-11-07 E. I. Du Pont De Nemours And Company Compositions and methods comprising sequences having meganuclease activity
WO2013177400A1 (en) 2012-05-24 2013-11-28 Iowa State University Research Foundation, Inc. Arabidopsis nonhost resistance gene(s) and use thereof to engineer disease resistant plants
EP3450549A1 (en) 2012-10-29 2019-03-06 University Of Rochester Artemisinin derivatives, methods for their preparation and their use as antimalarial agents
US10662424B2 (en) 2012-12-06 2020-05-26 Agilent Technologies, Inc. Molecular fabrication
US11549106B2 (en) 2012-12-06 2023-01-10 Agilent Technologies, Inc. Molecular fabrication
WO2014088693A1 (en) * 2012-12-06 2014-06-12 Agilent Technologies, Inc. Molecular fabrication
CN104837994A (zh) * 2012-12-06 2015-08-12 安捷伦科技有限公司 分子制造
US10435674B2 (en) 2012-12-21 2019-10-08 Codexis, Inc. Engineered biocatalysts and methods for synthesizing chiral amines
WO2014120821A1 (en) 2013-01-31 2014-08-07 Codexis, Inc. Methods, systems, and software for identifying bio-molecules using models of multiplicative form
EP4414988A2 (en) 2013-01-31 2024-08-14 Codexis, Inc. Methods, systems, and software for identifying bio-molecules using models of multiplicative form
WO2014120819A1 (en) 2013-01-31 2014-08-07 Codexis, Inc. Methods, systems, and software for identifying bio-molecules with interacting components
EP4398255A2 (en) 2013-01-31 2024-07-10 Codexis, Inc. Methods, systems, and software for identifying bio-molecules with interacting components
WO2014153242A1 (en) 2013-03-14 2014-09-25 Pioneer Hi-Bred International, Inc. Compositions having dicamba decarboxylase activity and methods of use
WO2014153234A1 (en) 2013-03-14 2014-09-25 Pioneer Hi-Bred International, Inc. Compositions having dicamba decarboxylase activity and methods of use
WO2014152507A2 (en) 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Modulation of acc deaminase expression
WO2014150914A2 (en) 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Phi-4 polypeptides and methods for their use
WO2014202089A2 (en) 2013-06-18 2014-12-24 Roskilde Universitet Variants of anti-freeze polypeptides
WO2015023846A2 (en) 2013-08-16 2015-02-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP3692786A1 (en) 2013-09-13 2020-08-12 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP4159028A1 (en) 2013-09-13 2023-04-05 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2015038734A2 (en) 2013-09-13 2015-03-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP3418929A1 (en) 2013-09-27 2018-12-26 Codexis, Inc. Automated screening of enzyme variants
EP4122945A1 (en) 2013-12-23 2023-01-25 University of Rochester Methods and compositions for ribosomal synthesis of macrocyclic peptides
WO2015120270A1 (en) 2014-02-07 2015-08-13 Pioneer Hi Bred International, Inc. Insecticidal proteins and methods for their use
WO2015120276A1 (en) 2014-02-07 2015-08-13 Pioneer Hi Bred International Inc Insecticidal proteins and methods for their use
EP3705489A1 (en) 2014-02-07 2020-09-09 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2016061206A1 (en) 2014-10-16 2016-04-21 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2016114973A1 (en) 2015-01-15 2016-07-21 Pioneer Hi Bred International, Inc Insecticidal proteins and methods for their use
EP4663761A2 (en) 2015-01-15 2025-12-17 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2016144688A1 (en) 2015-03-11 2016-09-15 Pioneer Hi Bred International Inc Insecticidal combinations of pip-72 and methods of use
US9920102B2 (en) 2015-05-15 2018-03-20 Albert Einstein College Of Medicine, Inc. Fusion tags for protein expression
WO2016186986A1 (en) 2015-05-19 2016-11-24 Pioneer Hi Bred International Inc Insecticidal proteins and methods for their use
WO2017023486A1 (en) 2015-08-06 2017-02-09 Pioneer Hi-Bred International, Inc. Plant derived insecticidal proteins and methods for their use
EP3943602A1 (en) 2015-08-06 2022-01-26 Pioneer Hi-Bred International, Inc. Plant derived insecticidal proteins and methods for their use
WO2017044424A1 (en) 2015-09-08 2017-03-16 Theripion, Inc. Apoa-1 fusion polypeptides and related compositions and methods
US10837012B2 (en) 2015-09-15 2020-11-17 Labgenius Ltd Compositions and methods for polynucleotide assembly
WO2017046594A1 (en) * 2015-09-15 2017-03-23 Labgenius Ltd Compositions and methods for polynucleotide assembly
WO2017105987A1 (en) 2015-12-18 2017-06-22 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2017192560A1 (en) 2016-05-04 2017-11-09 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP3960863A1 (en) 2016-05-04 2022-03-02 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP3954202A1 (en) 2016-07-01 2022-02-16 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2018005411A1 (en) 2016-07-01 2018-01-04 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
EP4050021A1 (en) 2016-11-01 2022-08-31 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018084936A1 (en) 2016-11-01 2018-05-11 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018136163A2 (en) 2016-12-09 2018-07-26 Theripion, Inc. Tandem apoa-1 fusion polypeptides
WO2018111551A1 (en) 2016-12-14 2018-06-21 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018118811A1 (en) 2016-12-22 2018-06-28 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018148001A1 (en) 2017-02-08 2018-08-16 Pioneer Hi-Bred International Inc Insecticidal combinations of plant derived insecticidal proteins and methods for their use
EP3579867A4 (en) * 2017-02-13 2021-03-10 Codexis, Inc. MANIPULATED PHENYLALANINE AMMONIA LYASE POLYPEPTIDES
US10995329B2 (en) 2017-02-13 2021-05-04 Codexis, Inc. Engineered phenylalanine ammonia lyase polypeptides
WO2018208882A1 (en) 2017-05-11 2018-11-15 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018226893A3 (en) * 2017-06-06 2019-01-10 Zymergen Inc. HIGH PERFORMANCE GENOMIC ENGINEERING PLATFORM (HTP) FOR THE IMPROVEMENT OF SACCHAROPOLYSPORA SPINOSA
WO2018226880A1 (en) * 2017-06-06 2018-12-13 Zymergen Inc. A htp genomic engineering platform for improving escherichia coli
WO2019040335A1 (en) 2017-08-19 2019-02-28 University Of Rochester MICHELOLID DERIVATIVES, PREPARATION METHODS AND THEIR USE AS ANTICANCER AND ANTI-INFLAMMATORY AGENTS
EP4659582A2 (en) 2018-03-14 2025-12-10 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2019178038A1 (en) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2019178042A1 (en) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2020198731A2 (en) 2019-03-28 2020-10-01 Danisco Us Inc Engineered antibodies
WO2021142393A1 (en) 2020-01-10 2021-07-15 The Regents Of The University Of California Biosynthetic platform for the production of olivetolic avid and analogues of olivetolic acid
WO2022015619A2 (en) 2020-07-14 2022-01-20 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2022178078A1 (en) 2021-02-19 2022-08-25 Theripion, Inc. Paraoxonase fusion polypeptides and related compositions and methods
WO2022178090A2 (en) 2021-02-19 2022-08-25 Theripion, Inc. Dnase fusion polypeptides and related compositions and methods
WO2023173084A1 (en) 2022-03-11 2023-09-14 University Of Rochester Cyclopeptibodies and uses thereof
WO2024259220A1 (en) 2023-06-15 2024-12-19 Theripion, Inc. Pon3 and evolved pon1 fusion polypeptides

Also Published As

Publication number Publication date
EP0876509A1 (en) 1998-11-11
DE69615406T2 (de) 2002-06-20
DE69615411D1 (de) 2001-10-25
US6291242B1 (en) 2001-09-18
JP2004187694A (ja) 2004-07-08
DE911396T1 (de) 2001-04-05
EP0911396A2 (en) 1999-04-28
ES2164929T3 (es) 2002-03-01
EP0876509B1 (en) 2001-09-19
ATE205878T1 (de) 2001-10-15
JP2000500981A (ja) 2000-02-02
JP2000308490A (ja) 2000-11-07
CA2239099C (en) 2004-11-30
DE69615411T2 (de) 2002-06-20
EP0876509B2 (en) 2009-11-11
US6323030B1 (en) 2001-11-27
US6372497B1 (en) 2002-04-16
DK0911396T3 (da) 2002-02-18
DE69615406D1 (de) 2001-10-25
CA2239099A1 (en) 1997-06-05
DK0876509T3 (da) 2002-02-18
EP0911396B1 (en) 2001-09-19
DE876509T1 (de) 2001-04-05
EP1103606A3 (en) 2001-08-22
DE69615406T3 (de) 2010-05-20
EP0911396A3 (en) 1999-05-06
US6573098B1 (en) 2003-06-03
IL124675A0 (en) 1998-12-06
ES2165124T3 (es) 2002-03-01
EP1103606A2 (en) 2001-05-30
EP1138763A2 (en) 2001-10-04
AU713952B2 (en) 1999-12-16
ATE205877T1 (de) 2001-10-15
US6344356B1 (en) 2002-02-05
AU1087397A (en) 1997-06-19
US6413774B1 (en) 2002-07-02
JP4015193B2 (ja) 2007-11-28
EP0876509A4 (en) 1999-04-28
US6180406B1 (en) 2001-01-30
ES2164929T5 (es) 2010-04-12
US6117679A (en) 2000-09-12
DK0876509T4 (da) 2010-04-19
EP1138763A3 (en) 2002-02-27

Similar Documents

Publication Publication Date Title
US6995017B1 (en) Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6395547B1 (en) Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US7868138B2 (en) Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
AU713952B2 (en) Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6506602B1 (en) Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US5811238A (en) Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
AU744681B2 (en) Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
AU2005202165B2 (en) Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
AU1197202A (en) Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
AU2747302A (en) DNA mutagenesis by random fragmentation and reassembly

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2239099

Country of ref document: CA

Ref country code: CA

Ref document number: 2239099

Kind code of ref document: A

Format of ref document f/p: F

Ref country code: JP

Ref document number: 1997 520744

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1996940934

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1996940934

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1996940934

Country of ref document: EP