US9157127B2 - Monitoring recombinase polymerase amplification mixtures - Google Patents

Monitoring recombinase polymerase amplification mixtures Download PDF


Publication number
US9157127B2 US14183113 US201414183113A US9157127B2 US 9157127 B2 US9157127 B2 US 9157127B2 US 14183113 US14183113 US 14183113 US 201414183113 A US201414183113 A US 201414183113A US 9157127 B2 US9157127 B2 US 9157127B2
Grant status
Patent type
Prior art keywords
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Application number
Other versions
US20150024397A1 (en )
Niall A. Armes
Olaf Piepenburg
Catherine Jean Greenwood
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Alere San Diego Inc
Original Assignee
Alere San Diego Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Grant date




    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6851Quantitative amplification
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • G01N21/00Investigating or analysing materials by the use of optical means, i.e. using infra-red, visible or ultra-violet light
    • G01N21/62Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64Fluorescence; Phosphorescence
    • G01N21/6428Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
    • G01N21/00Investigating or analysing materials by the use of optical means, i.e. using infra-red, visible or ultra-violet light
    • G01N21/62Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64Fluorescence; Phosphorescence
    • G01N21/645Specially adapted constructive features of fluorimeters
    • G01N21/6456Spatial resolved fluorescence measurements; Imaging
    • C12Q2521/00Reaction characterised by the enzymatic activity
    • C12Q2521/50Other enzymatic activities
    • C12Q2521/507Recombinase
    • C12Q2522/00Reaction characterised by the use of non-enzymatic proteins
    • C12Q2522/10Nucleic acid binding proteins
    • C12Q2522/101Single or double stranded nucleic acid binding proteins
    • C12Q2527/00Reactions demanding special reaction conditions
    • C12Q2527/10Reaction conditions characterised by
    • C12Q2527/137Concentration of a component of medium
    • C12Q2563/00Nucleic acid detection characterised by the use of
    • C12Q2563/155Particles of a defined size, e.g. nanoparticles
    • C12Q2563/00Nucleic acid detection characterised by the use of
    • C12Q2563/159Microreactors, e.g. emulsion PCR or sequencing, droplet PCR, microcapsules, i.e. non-liquid containers with a range of different permeability's for different reaction components
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/60Detection means characterised by use of a special device
    • C12Q2565/629Detection means characterised by use of a special device being a microfluidic device
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • G01N21/00Investigating or analysing materials by the use of optical means, i.e. using infra-red, visible or ultra-violet light
    • G01N21/62Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64Fluorescence; Phosphorescence
    • G01N21/6428Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
    • G01N2021/6432Quenching
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
    • Y02A50/50Chemical or biological analysis of biological material for identifying the disease, e.g. blood or urine testing, rapid diagnostic tests [RTDs] or immunological testing
    • Y02A50/53Chemical or biological analysis of biological material for identifying the disease, e.g. blood or urine testing, rapid diagnostic tests [RTDs] or immunological testing the disease being Dengue fever


A process includes providing a mixture that includes a recombinase, a single-strand binding protein, and one or more oligonucleotides; and detecting particles in the reaction mixture.



This application is a continuation and claims priority to U.S. patent application Ser. No. 13/441,411, filed Apr. 6, 2012, which claims priority to U.S. Patent Application Ser. No. 61/472,929, filed Apr. 7, 2011, the entire contents of which are incorporated by reference.


This disclosure relates to methods and compositions for nucleic acid detection, amplification, and quantitation.


Certain isothermal amplification methods are able to amplify template (target) nucleic acid in a specific manner from trace levels to very high and detectable levels within a matter of minutes. Such isothermal methods, e.g., Recombinase Polymerase Amplification (RPA), can broaden the application of nucleic acid based diagnostics into emerging areas such as point-of-care testing, and field and consumer testing. The isothermal nature and broad temperature range of the technologies can allow users to avoid the use of complex power-demanding instrumentation.


This disclosure is based, at least in part, on the observation of particles within RPA mixtures. In some embodiments, these particles can include nucleic acids (e.g., oligonucleotides) and/or protein components of the RPA reaction. This discovery provides for new monitoring and detection methods relating to RPA.

In one aspect, this disclosure features processes that include: (a) providing a mixture that includes one or more of (e.g., two or more of, or all of) a recombinase, a single-stranded DNA binding protein, and one or more nucleic acids (e.g., oligonucleotides) (in any combination); and (b) detecting particles in the reaction mixture. In some embodiments, the mixture includes a crowding agent, e.g., one or more of polyethylene glycol (e.g., PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, PEG compound with molecular weight between 15,000 and 20,000 daltons, or combinations thereof), polyvinyl alcohol, dextran and ficoll. In some embodiments, the crowding agent is present in the reaction mixture at a concentration between 1 to 12% by weight or by volume of the reaction mixture, e.g., between any two concentration values selected from 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, 6.0%, 6.5%, 7.0%, 7.5%, 8.0%, 8.5%, 9.0%, 9.5%, 10.0%, 10.5%, 11.0%, 11.5%, and 12.0%.

In some embodiments of all aspects, the recombinase includes a RecA or UvsX recombinase. In some embodiments of all aspects, the single-stranded DNA binding protein includes a prokaryotic SSB protein or a gp32 protein. In some embodiments of all aspects, at least one of the one or more nucleic acids (e.g., oligonucleotides) includes a detectable label.

In some embodiments of all aspects, the particles include one or more (e.g., two or more, or all) of a recombinase, a single stranded binding protein, and at least one of the one or more nucleic acids (in any combination). In some embodiments of all aspects, the reaction mixture includes a recombinase, a single-stranded binding protein, a polymerase, dNTPs, ATP, a primer, and a template nucleic acid.

In some embodiments of all aspects, the mixture includes one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or all) of a recombinase, a DNA polymerase, a single-stranded binding protein, a recombinase loading protein, ATP, dNTPs or a mixture of dNTPs and ddNTPs, a reducing agent, creatine kinase, a nuclease (e.g., an exonuclease III or endonuclease IV), a reverse transcriptase, a nucleic acid probe, a nucleic acid primer, and a template nucleic acid (in any combination).

In some embodiments of all aspects, the particles include a polymerase, dNTPs, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the particles include a recombinase, a polymerase, dNTPs, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the particles include a recombinase, a single-stranded binding protein, a polymerase, dNTPs, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the particles include a polymerase, dNTPs, and ATP, and one or more (e.g., two, three, four, five, or six) additional agents selected from the group of a probe, a primer, a single-stranded binding protein, ddNTPs, a reducing agent, creatine kinase, a nuclease, and a reverse transcriptase. In some embodiments of all aspects, the particles include a recombinase, a polymerase, a reverse transcriptase, dNTPs, ATP, a primer, and a template nucleic acid.

In some embodiments of all aspects, the particles are about 0.5-20 μm in size, e.g., between about any two sizes selected from 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 18, and 20 μm (e.g., about 1-10 μm in size).

In some embodiments of all aspects, approximately 10 to 5000 particles/nL, e.g., between any two numbers of particles selected from 10, 20, 50, 100, 200, 500, 1000, 2000, and 5000 particles per nL, are detected.

In some embodiments of all aspects, detecting particles in the mixture includes the use of one or more of microscopy, a microfluidic device, flow cytometry, and a camera. In some embodiments of all aspects, the particles are detected using charge-coupled detection (CCD).

In another aspect, the disclosure features a process that includes: (a) providing a recombinase polymerase amplification reaction mixture; (b) maintaining the reaction mixture under conditions that allow for the production of nucleic acid amplification products in the reaction mixture; and (c) detecting particles associated with the nucleic acid amplification products in the reaction mixture. In some embodiments, the detecting is performed within 10 minutes (e.g., within 9, 8, 7, 6, 5, 4, 3, 2, 1.5, or 1 minute) from when the maintaining begins.

In some embodiments of all aspects, the reaction mixture includes a crowding agent, e.g., one or more of polyethylene glycol (e.g., PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, PEG compound with molecular weight between 15,000 and 20,000 daltons, or combinations thereof), polyvinyl alcohol, dextran and ficoll. In some embodiments, the reaction mixture contains polyethylene glycol as a crowding agent (e.g., any of the PEG compounds described herein or known in the art). In some embodiments, the reaction mixture contains polyvinyl alcohol as a crowding agent. In some embodiments, the crowding agent is present in the reaction mixture at a concentration between 1 to 12% by weight or by volume of the reaction mixture, e.g., between any two concentration values selected from 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, 6.0%, 6.5%, 7.0%, 7.5%, 8.0%, 8.5%, 9.0%, 9.5%, 10.0%, 10.5%, 11.0%, 11.5%, and 12.0%. In some embodiments, the crowding agent is present in the reaction mixture at a concentration that is sufficient to increase the amount of amplification in the reaction mixture.

In some embodiments of all aspects, the particles include one or more (e.g., two or more or all) of the recombinase, the single stranded binding protein, and at least one of the one or more nucleic acids (in any combination).

In some embodiments of all aspects, the reaction mixture includes one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or all) of a DNA polymerase, a recombinase loading protein, ATP, dNTPs or a mixture of dNTPs and ddNTPs, a reducing agent, creatine kinase, a nuclease (e.g., an exonuclease III or endonuclease IV), a single-stranded binding protein, a nucleic acid primer, a nucleic acid probe, reverse transcriptase, and a template nucleic acid (in any combination).

In some embodiments of all aspects, the reaction mixture contains a recombinase, a single-stranded binding protein, and one or more oligonucleotides. In some embodiments of all aspects, the reaction mixture includes a recombinase, a single-stranded binding protein, a polymerase, dNTPs, ATP, a primer, and a template nucleic acid.

In some embodiments of all aspects, the reaction mixture includes a polymerase, dNTPs, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the reaction mixture includes a recombinase, a polymerase, dNTPs, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the reaction mixture includes a recombinase, a single-stranded binding protein, a polymerase, dNTPs, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the reaction mixture includes a polymerase, dNTPs, and ATP, and one or more (e.g., two, three, four, five, or six) additional agents selected from the group of a probe, a primer, a single-stranded binding protein, ddNTPs, a reducing agent, creatine kinase, a nuclease, and a reverse transcriptase. In some embodiments of all aspects, the reaction mixture includes a recombinase, a polymerase, a reverse transcriptase, dNTPs, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the particles are about 0.5-20 μm in size, e.g., between about any two sizes selected from 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 18, and 20 μm (e.g., about 1-10 μm in size).

In some embodiments of all aspects, approximately 10 to 5000 particles/nL, e.g., between any two numbers of particles selected from 10, 20, 50, 100, 200, 500, 1000, 2000, and 5000 particles per nL, are detected.

In some embodiments of all aspects, the detecting includes determining a number or proportion of particles associated with nucleic acid amplification products in the reaction mixture and, optionally, determining or estimating the concentration of template nucleic acid in the original mixture thereby. In some embodiments, the detecting includes detecting single particles associated with two or more distinct nucleic acid amplification products.

In another aspect, the disclosure features compositions that include (a) a first population of particles that includes a first recombinase, a first single-stranded DNA binding protein, and a first oligonucleotide; and (b) a second population of particles that includes a second recombinase, a second single-stranded DNA binding protein, and a second oligonucleotide, wherein the first and second oligonucleotides are different. In some embodiments, at least one of the first and second oligonucleotides includes a detectable label. In some embodiments, the first and second oligonucleotides include the same or different detectable labels. The first and second single-stranded DNA binding protein can be the same or different from each other. The first and second recombinase can be the same or different from each other.

In some embodiments of all aspects, the particles are about 0.5-20 μm in size, e.g., between about any two sizes selected from 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 18, and 20 μm (e.g., about 1-10 μm in size).

In some embodiments of all aspects, approximately 10 to 5000 particles/nL, e.g., between any two numbers of particles selected from 10, 20, 50, 100, 200, 500, 1000, 2000, and 5000 particles per nL, are present in the compositions.

In some embodiments of all aspects, the compositions include a crowding agent, e.g., one or more of polyethylene glycol (e.g., PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, PEG compound with molecular weight between 15,000 and 20,000 daltons, or combinations thereof), polyvinyl alcohol, dextran and ficoll. In some embodiments, the crowding agent is present in the composition at a concentration between 1 to 12% by weight or by volume of the reaction mixture, e.g., between any two concentration values selected from 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, 6.0%, 6.5%, 7.0%, 7.5%, 8.0%, 8.5%, 9.0%, 9.5%, 10.0%, 10.5%, 11.0%, 11.5%, and 12.0%.

In some embodiments of all aspects, the compositions further include one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or all) of a DNA polymerase, a recombinase loading protein, ATP, dNTPs or a mixture of dNTPs and ddNTPs, a reducing agent, creatine kinase, a nuclease (e.g., an exonuclease III or endonuclease IV), a nucleic acid probe, and a template nucleic acid (in any combination).

In some aspects, the disclosure features compositions that include one or more oligonucleotides describe herein and variants thereof. In some embodiments, the oligonucleotides can be used as primers and/or detection probes in methods of nucleic acid amplifications (e.g., isothermal nucleic acid amplifications such as RPA). The oligonucleotides described herein can include one or more detectable labels. Where an oligonucleotide is disclosed as including one or more detectable labels, alternative labels may be used at the same positions or at different positions within the oligonucleotide (e.g., at a position within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 bases 5′ or 3′ of the disclosed position). In some embodiments, the oligonucleotides can include one or more abasic site mimics. Where an oligonucleotide includes one or more abasic site mimics, alternative abasic site mimics may be included at the same position or at different positions within the oligonucleotide (e.g., at a position within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 bases 5′ or 3′ of the disclosed position). In some embodiments, a variant of an oligonucleotide described herein has twelve or fewer (e.g., eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, two or fewer, or one or fewer) insertions, deletions, substitutions, and/or additions compared to the disclosed oligonucleotide sequence. In some embodiments, a variant of an oligonucleotide described herein has a sequence at least 80% (e.g., 85%, 90%, or 95%) identical to the disclosed oligonucleotide sequence.

In some embodiments, the particles are detected using fluorescence from the particles.

In certain embodiments, the particles are detected without using fluorescence from the particles.

In some embodiments, the particles are detected using fluorescence from the particles, phase contrast microscopy, luminescent detection, spectral (color) detection, magnetic detection, radioisotopic detection, and/or electrochemical detection. In some embodiments the particles can be detected using a combination of two of more (e.g., two, three, or four) of fluorescence from the particles, phase contrast microscopy, luminescent detection, spectral (color) detection, magnetic detection, radioisotopic detection, and electrochemical detection.

In some embodiments, some of the particles are detected using fluorescence from those particles, and other of the particles are detected without using fluorescence from these other particles. For example, the particles include a first subset of particles and a second subset of particles. The first subset of particles is detected using fluorescence from the first subset of particles, and the second subset of particles are detected without using fluorescence from the second subset of particles (e.g., phase contrast microscopy, luminescent detection, spectral (color) detection, magnetic detection, radioisotopic detection, and/or electrochemical detection).

In another aspect, the disclosure features a population of particles that includes a recombinase, a single-stranded DNA binding protein, and an oligonucleotide, wherein some of the particles are detected using fluorescence from those particles, and other of the particles are detected without using fluorescence from these other particles.

Also provided are kits including a recombinase, a single-stranded DNA binding protein, and an oligonucleotide for use in any of the methods described herein. Also provided are kits including any of the particles or compositions described herein and instructions for performing any of the methods described herein.

The processes and compositions disclosed herein can be used for the detection of nucleic acids, e.g., bacterial nucleic acids, mammalian nucleic acids, viral nucleic acids, fungal nucleic acids, or protozoan nucleic acids, and for the diagnosis of disorders or diseases associated with such nucleic acids.

As used herein the “size” of a particle refers to the largest cross-sectional dimension of the particle.

As used herein, an “oligonucleotide” refers to a nucleic acid polymer containing at least 10 (e.g., at least 12, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, or 100) base units. In some embodiments, the oligonucleotide contains a total of less than 1 kb, 900 base units, 800 base units, 700 base units, 600 base units, 500 base units, 400 base units, 300 base units, 200 base units, or 100 base units. In some embodiments, an oligonucleotide can have 90 or fewer, 80 or fewer, 70 or fewer, 60 or fewer, 50 or fewer, 40 or fewer, 30 or fewer, or 20 or fewer base units. In some embodiments, an oligonucleotide has at least 10, 12, 14, 16, 18, or 20 base units.

As used herein, “cytometry” refers to methods and compositions for detecting, visualizing, and analyzing the properties of particles. The term as used herein does not denote the presence of cells. However, methods and compositions used for detecting, visualizing, and analyzing the properties of cells can be applied to the particles described herein.

As used herein, an “abasic site mimic” refers to a subunit position within a nucleic acid polymer in which a sugar or modified sugar moiety (e.g., glucose or deoxyglucose) is present, and the 1′ carbon of the sugar or modified sugar moiety is not covalently bonded to a cyclic base structure (e.g., adenine, guanine, cytsosine, thymine, uracil, or modified versions thereof). In some embodiments, the 1′ carbon of the sugar or modified sugar moiety is covalently bonded to a hydrogen (e.g., tetrahydrofuran). In some embodiments, the 1′ carbon of the sugar or modified sugar moiety is covalently bonded to another carbon that is not present in a cyclic base structure. In some embodiments, the 1′ carbon of the sugar or modified sugar moiety is covalently bonded to a non-cyclic linker structure. In some embodiments, an abasic site mimic is recognized by an enzyme which processes and modifies abasic site mimics due to structural similarity to an abasic site (i.e. lack of a bulky base group attached to the sugar).

Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Other features and advantages of the invention will be apparent from the following detailed description, and from the claims


The patent or application file contains at least one drawing executed in color (FIGS. 1A-C, 2A-C, 3A-H, 4A-F, 5A-H, 6A-C, 7A-F, 8A-F, 9-11, 12A-D, and 13A-D). Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

FIGS. 1A-1C are micrographs depicting a single field of a mixture including particles. The scale bar indicates 100 μm. 1A, differential interference contrast (DIC). 1B, fluorescence. 1C, merge.

FIGS. 2A-2C are micrographs depicting a single field of a mixture including particles and a template nucleic acid. The scale bar indicates 100 μm. 2A, DIC. 2B, fluorescence. 2C, merge.

FIGS. 3A-3H are fluorescence micrographs depicting mixtures including the indicated concentrations of polyethylene glycol (PEG).

FIGS. 4A-4F are micrographs depicting mixtures including particles. 4A and 4B are a standard mixture. 4C and 4D are the standard mixture excluding UvsX. 4E and 4F are the standard mixture excluding gp32. 4A, 4C, 4E, DIC. 4B, 4D, 4F, fluorescence.

FIGS. 5A-5H are micrographs depicting mixtures including particles. 5A and 5B are the standard mixture as in 4A and 4B, but excluding UvsY. 5C and 5D are the standard mixture excluding polymerase. 5E and 5F are the standard mixture excluding creatine kinase. 5G and 5H are the standard mixture excluding exonuclease III. 5A, 5C, 5E, 5G, DIC. 5B, 5D, 5F, 5H, fluorescence.

FIGS. 6A-6C are sets of micrographs depicting mixtures. 6A, two fields showing complete mixture. 6B, two fields showing complete mixture excluding gp32 and UvsY. 6C, two fields showing complete mixture excluding gp32, UvsY, and Emix (50 mM Phosphocreatine, 2.5 mM ATP). For each set: top, DIC; bottom, fluorescence.

FIGS. 7A-7F are micrographs depicting a mixture including particles prepared with two labeled oligonucleotides. 7A, Texas red fluorescence. 7B, merge DIC and Texas red. 7C, FAM fluorescence. 7D, merge DIC and FAM. 7E, DIC. 7F, merge Texas red and FAM.

FIGS. 8A-8F are micrographs depicting a mixture including two sets of particles with two labeled oligonucleotides prepared independently and then mixed. 8A, Texas red fluorescence. 8B, merge DIC and Texas red. 8C, FAM fluorescence. 8D, merge DIC and FAM. 8E, DIC. 8F, merge Texas red and FAM.

FIG. 9 is a time course of micrographs depicting particles during an amplification reaction.

FIG. 10 is a time course of micrographs depicting particles during an amplification reaction.

FIG. 11 is a time course of micrographs depicting particles during an amplification reaction, visualized by DIC/FAM and DIC/Texas Red.

FIGS. 12A-12D are sets of micrographs depicting mixtures including particles at 20× magnification. 12A, mixture including T6 H66S UvsX and UvsY. 12B, mixture including T6 H66S UvsX without UvsY. 12C, mixture including T6 UvsX and UvsY. 12D, mixture including T6 UvsX without UvsY. For each set: top, DIC; bottom, fluorescence.

FIGS. 13A-13D are sets of micrographs depicting mixtures including particles at 40× magnification. 13A, mixture including T6 H66S UvsX and UvsY. 13B, mixture including T6 H66S UvsX without UvsY. 13C, mixture including T6 UvsX and UvsY. 13D, mixture including T6 UvsX without UvsY. For each set: top, DIC; bottom, fluorescence.

FIGS. 14A-14B are line graphs depicting amplification reactions in mixtures including T6 H66S UvsX and UvsY (std UvsX+UvsY), T6 H66S UvsX without UvsY (std UvsX−UvsY), T6 UvsX and UvsY (T6 UvsX+UvsY), and T6 UvsX without UvsY (T6 UvsX−UvsY). 14A, 500 copies template. 14B, 50 copies of template.

FIG. 15 is a line graph depicting amplification reactions in mixtures including T6 H66S UvsX and UvsY (std UvsX+UvsY), T6 H66S UvsX without UvsY (std UvsX−UvsY), T6 UvsX and UvsY (T6 UvsX+UvsY), and T6 UvsX without UvsY (T6 UvsX−UvsY).

FIGS. 16A-16B are line graphs depicting amplification reactions in mixtures including T6 H66S UvsX and UvsY (std UvsX+UvsY), T6 H66S UvsX without UvsY (std UvsX−UvsY), T6 UvsX and UvsY (T6 UvsX+UvsY), and T6 UvsX without UvsY (T6 UvsX−UvsY).


On microscopic observation, structures with the appearance of particles were observed within RPA mixtures. During the progress of the RPA nucleic acid amplification reaction, the particles are associated with loci of active amplification.

The particles observed were typically in the range of 1-10 μm in size, and were present at approximately 100-500 particles/nL. The particles were found to contain oligonucleotides present in the mixtures. Formation of the particles did not require the presence of magnesium. However, particles formed in the absence of a recombinase or a single-stranded DNA binding protein had an altered morphology. Formation of the particles in the absence of other agents, such as recombinase loading protein, DNA polymerase, creatine kinase, or exonucleases, did not significantly affect particle morphology. Additionally, particle formation was more efficient in the presence of crowding agents.

The particles were observed to be relatively stable in solution. Separate populations of particles could be mixed and remain distinct for a period of time following mixing.

Recombinase Polymerase Amplification

RPA is a method for amplification (e.g., isothermal amplification) of nucleic acids. In general, in a first step of RPA a recombinase is contacted with a first and a second nucleic acid primer to form first and second nucleoprotein primers. In general, in a second step the first and second nucleoprotein primers are contacted to a double stranded template nucleic acid to form a first double stranded structure at a first portion of the first strand of the template nucleic acid, and a second double stranded structure at a second portion of the second strand of the template nucleic acid, such that the 3′ ends of the first nucleic acid primer and the second nucleic acid primer are oriented towards each other on a given DNA molecule. In general, in a third step the 3′ end of the first and the second nucleoprotein primers are extended by DNA polymerases to generate first and second double stranded nucleic acids, and first and second displaced strands of nucleic acid. Generally, the second and third steps can be repeated until a desired degree of amplification is reached.

As described herein, RPA employs enzymes, known as recombinases, that are capable of pairing oligonucleotide primers with homologous sequences in template double-stranded DNA. In this way, DNA synthesis is directed to defined points in a template double-stranded DNA. Using two or more sequence-specific (e.g., gene-specific) primers, an exponential amplification reaction is initiated if the template nucleic acid is present. The reaction progresses rapidly and results in specific amplification of a sequence present within the template double-stranded DNA from just a few copies of the template DNA to detectable levels of the amplified products within minutes. RPA methods are disclosed, e.g., in U.S. Pat. Nos. 7,270,981; 7,399,590; 7,666,598; 7,435,561; US 2009/0029421; and WO 2010/141940, all of which are incorporated herein by reference.

RPA reactions contain a blend of proteins and other factors that support both the activity of the recombination element of the system, as well as those which support DNA synthesis from the 3′ ends of oligonucleotides paired to complementary substrates. In some embodiments, the RPA reaction contains a mixture of a recombinase, a single-stranded binding protein, a polymerase, dNTPs, ATP, a primer, and a template nucleic acid. In some embodiments, a RPA reaction can include one or more of the following (in any combination): at least one recombinase; at least one single-stranded DNA binding protein; at least one DNA polymerase; dNTPs or a mixture of dNTPs and ddNTPs; a crowding agent; a buffer; a reducing agent; ATP or ATP analog; at least one recombinase loading protein; a first primer and optionally a second primer; a probe; a reverse transcriptase; and a template nucleic acid molecule, e.g., a single-stranded (e.g., RNA) or double stranded nucleic acid. In some embodiments, the RPA reactions can contain, e.g., a reverse transcriptase. Additional non-limiting examples of RPA reaction mixtures are described herein.

In some embodiments, the RPA reactions can contain a UvsX protein, a gp32 protein, and a UvsY protein. Any of the processes, compositions or particles described herein can contain, in part, e.g., a UvsX protein, a gp32 protein, and a UvsY protein. For example, any of the processes, compositions, or particles described herein can contain, in part, T6H66S UvsX, Rb69 gp32, and Rb69 UvsY.

In some embodiments, the RPA reactions can contain a UvsX protein and a gp32 protein. For example, any of the processes, compositions, or particles described herein can contain, in part, e.g., a UvsX protein and a gp32 protein.

One protein component of an RPA reaction is a recombinase, which may originate from prokaryotic, viral or eukaryotic origin. Exemplary recombinases include RecA and UvsX (e.g., a RecA protein or UvsX protein obtained from any species), and fragments or mutants thereof, and combinations thereof. The RecA and UvsX proteins can be obtained from any species. RecA and UvsX fragments or mutant proteins can also be produced using the available RecA and UvsS protein and nucleic acids sequences, and molecular biology techniques (see, e.g., the mutant forms of UvsX described in U.S. Pat. No. 8,071,308). Exemplary UvsX proteins include those derived from myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi-1, Rb16, Rb43, Phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. Additional exemplary recombinase proteins include archaebacterial RADA and RADB proteins and eukaryotic (e.g., plant, mammal, and fungal) Rad51 proteins (e.g., RAD51, RAD51B, RAD51C, RAD51D, DMC1, XRCC2, XRCC3, and recA) (see, e.g., Lin et al., Proc. Natl. Acad. Sci. U.S.A. 103:10328-10333, 2006).

In any process of this disclosure, the recombinase (e.g., UvsX) may be a mutant or hybrid recombinase. In some embodiments, the mutant UvsX is an Rb69 UvsX that includes at least one mutation in the Rb69 UvsX amino acid sequence, wherein the mutation is selected from the group consisting of (a) an amino acid which is not histidine at position 64, a serine at position 64, the addition of one or more glutamic acid residues at the C-terminus, the addition of one or more aspartic acid residues at the C-terminus, and a combination thereof. In other embodiments, the mutant UvsX is a T6 UvsX having at least one mutation in the T6 UvsX amino acid sequence, wherein the mutation is selected from the group consisting of (a) an amino acid which is not histidine at position 66; (b) a serine at position 66; (c) the addition of one or more glutamic acid residues at the C-terminus; (d) the addition of one or more aspartic acid residues at the C-terminus; and (e) a combination thereof. Where a hybrid recombinase protein is used, the hybrid protein may, for example, be a UvsX protein that includes at least one region that includes an amino acid sequence derived from a different UvsX species. The region may be, for example, the DNA-binding loop-2 region of UvsX.

Additionally, one or more single-stranded DNA binding proteins can be used to stabilize nucleic acids during the various exchange reactions that are ongoing in the reaction. The one or more single-stranded DNA binding proteins can be derived or obtained from any species, e.g., from a prokaryotic, viral or eukaryotic species. Non-limiting exemplary single-stranded DNA binding proteins include E. coli SSB and those derived from myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi-1, Rb16, Rb43, Phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. Additional examples of single-stranded DNA binding proteins include A. denitrificans Alide2047, Burkholderia thailandensis BthaB33951, Prevotella pallens HMPREF91440124, and eukaryotic single-stranded DNA binding protein replication protein A.

The DNA polymerase may be a eukaryotic or prokaryotic polymerase. Examples of eukaryotic polymerases include pol-alpha, pol-beta, pol-delta, pol-epsilon, and mutants or fragments thereof, or combinations thereof. Examples of prokaryotic polymerase include E. coli DNA polymerase I (e.g., Klenow fragment), bacteriophage T4 gp43 DNA polymerase, Bacillus stearothermophilus polymerase I large fragment, Phi-29 DNA polymerase, T7 DNA polymerase, Bacillus subtilis Pol I, Staphylococcus aureus Pol I, E. coli DNA polymerase I, E. coli DNA polymerase II, E. coli DNA polymerase III, E. coli DNA polymerase IV, E. coli DNA polymerase V, and mutants or fragments thereof, or combinations thereof. In some embodiments, the DNA polymerase lacks 3′-5′ exonuclease activity. In some embodiments, the DNA polymerase has strand-displacing properties, e.g., large fragments of prokaryotic polymerases of class I or pol V.

Any of the process of this disclosure may be performed in the presence of a crowding agent. In some embodiments, the crowding agent may include one or more of polyethylene glycol, polyethylene oxide, polyvinyl alcohol, polystyrene, Ficoll, dextran, poly(vinylpyrrolidone) (PVP), and albumin. In some embodiments, the crowding agent has a molecular weight of less than 200,000 daltons. Further, the crowding agent may be present, e.g., in an amount of about 0.5% to about 15% weight to volume (w/v).

If a recombinase loading protein is used, the recombinase loading protein may be of prokaryotic, viral or eukaryotic origin. Exemplary recombinase loading proteins include E. coli RecO, E. coli RecR, UvsY, and mutants or fragments thereof, or combinations thereof. Exemplary UvsY proteins include those derived from myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi-1, Rb16, Rb43, Phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. In any of the processes of this disclosure, the recombinase loading agent may be derived from a myoviridae phage. The myoviridae phage may be, for example, T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi-1, Rb16, Rb43, Phage 31, phage 44RR2.8t, Rb49, phage Rb3, or phage LZ2.

Further, any of the processes of this disclosure may be performed with a blocked primer. A blocked primer is a primer which does not allow elongation with a polymerase. Where a blocked primer is used, an unblocking agent can be used to unblock the primer to allow elongation. The unblocking agent may be an endonuclease or exonuclease which can cleave the blocking group from the primer. Exemplary unblocking agents include E. coli exonuclease III and E. coli endonuclease IV.

In some embodiments, the processes of this disclosure can include: contacting a recombinase with a first and a second nucleic acid primer and a third extension blocked primer which contains one or more noncomplementary or modified internal residue to form a first, second, and third nucleoprotein primer; contacting the first and second nucleoprotein primers to the double stranded target nucleic acid to form a first double stranded structure between the first nucleoprotein primer and the first strand of DNA at a first portion of the first strand (forming a D loop) and a second double stranded structure between the second nucleoprotein primer and the second strand of DNA at a second portion of the second strand (forming a D loop), such that the 3′ ends of the first nucleoprotein primer and the second nucleoprotein primer are oriented toward each other on the same target nucleic acid molecule with a third portion of target nucleic acid present between the 5′ ends of the first and second primer; and extending the 3′ end of the first nucleoprotein primer and second nucleoprotein primer with one or more polymerases and dNTPs to generate a first amplified target nucleic acid; contacting the first amplified target nucleic acid to the third nucleoprotein primer to form a third double stranded structure in the first amplified target nucleic acid (forming a D loop) in the presence of a nuclease, wherein the nuclease specifically cleaves the noncomplementary internal residue only after the formation of the third double-stranded structure to form a third 5′ primer and a third 3′ extension blocked primer; and extending the 3′ end of the third 5′ primer with one or more polymerase and dNTP to generate a second double-stranded amplified nucleic acid.

In some embodiments, the processes include a first and second primer to amplify a first portion present within a double-stranded target nucleic acid to generate a first amplified product, and at least one additional primer that can be used to amplify a contiguous sequence present within the first amplified product (e.g., an additional third primer that can be used in combination with, e.g., the first or the second primer, to amplify a contiguous sequence present within the first amplified product). In some embodiments, the processes include a first and second primer to amplify a first portion present within a double-stranded target nucleic acid to generate a first amplified product, and a third and fourth primer that can be used to amplify a contiguous sequence present within the first amplified product.

In some embodiments, the processes can include, e.g., a forward primer and a reverse primer. In some embodiments, the processes can include at least one blocked primer which comprises one or more noncomplementary or modified internal residues (e.g., one or more noncomplementary or modified internal residues that can be recognized and cleaved by a nuclease, e.g., DNA glycosylase, AP endonuclease, fpg, Nth, MutY, MutS, MutM, E. coli. MUG, human MUG, human Ogg1, a vertebrate Nei-like (Neil) glycosylase, Nfo, exonuclease III, or uracil glycosylase). Additional non-limiting examples of nucleic acids (e.g., primers and probes) that can be included in a process are described herein.

In some embodiments, the processes can include a primer or probe that is nuclease resistant, e.g., a primer or probe that contains at least one (e.g., at least two, three, four, five, six, seven, or eight) phosphorothioate linkages.

Any of the processes of this disclosure may be performed in the presence of heparin. Heparin may serve as an agent to reduce the level of non-specific primer noise, and to increase the ability of E. coli exonuclease III or E. coli endonuclease IV to rapidly polish 3′ blocking groups or terminal residues from recombination intermediates.

Based on the particular type of reaction, the mixture can also contain one or more of buffers, salts, and nucleotides. The reaction mixture can be maintained at a specific temperature or temperature range appropriate to the reaction. In some embodiments, the temperature is maintained at or below 80° C., e.g., at or below 70° C., at or below 60° C., at or below 50° C., at or below 40° C., at or below 37° C., at or below 30° C., or at or below room temperature. In some embodiments, the temperature is maintained at or above 4° C., at or above 10° C., at or above 15° C., at or above 20° C., at or above room temperature, at or above 25° C., at or above 30° C., at or above 37° C., at or above 40° C., at or above 50° C., at or above 60° C., or at or above 70° C. In some embodiments, the reaction mixture is maintained at room or ambient temperature. In some embodiments, the Celsius-scale temperature of the mixture is varied by less than 25% (e.g., less than 20%, less than 15%, less than 10%, or less than 5%) throughout the reaction time and/or the temperature of the mixture is varied by less than 15° C. (e.g., less than 10° C., less than 5° C., less than 2° C., or less than 1° C.) throughout the reaction time.

Detection of amplification, e.g., in real time, may be performed by any method known in the art. In some embodiments, one or more primers or probes (e.g., molecular beacon probes) are labeled with one or more detectable labels. Exemplary detectable labels include enzymes, enzyme substrates, coenzymes, enzyme inhibitors, fluorescent markers, quenchers, chromophores, magnetic particles or beads, redox sensitive moieties (e.g., electrochemically active moieties), luminescent markers, radioisotopes (including radionucleotides), and members of binding pairs. More specific examples include fluorescein, phycobiliprotein, tetraethyl rhodamine, and beta-galactosidase. Binding pairs may include biotin/avidin, biotin/strepavidin, antigen/antibody, ligand/receptor, and analogs and mutants of the binding pairs.

It should be noted that a fluorescence quencher is also considered a detectable label. For example, the fluorescence quencher may be contacted to a fluorescent dye and the amount of quenching is detected.

Particle Detection

Detection and monitoring of the particles can be performed using any suitable method. Exemplary methods include microscopy, light scattering, flow cytometry, and microfluidic methods.

In some embodiments, the particles can be detected using microscopy, e.g., differential interference contrast or fluorescence microscopy, to directly observe the particles at high magnification. With the aid of a computer, microscope images can be automatically obtained and analyzed. Additionally, microscopy can allow for continual or frequent monitoring of at least a portion of a mixture containing particles.

In some embodiments, the particles can be detected using flow cytometry. In flow cytometry, one or more beams of light, e.g., each of a single wavelength, are directed onto a hydrodynamically-focused stream of fluid. Suspended particles passing through the beams scatter the light, and fluorescent chemicals found in the particle or attached to the particle may be excited. The scattered and/or fluorescent light is picked up by detectors within the device, from which information about particle size and fluorescence can be determined. Modern flow cytometers can analyze several thousand particles every second, in “real time,” and can actively separate and isolate particles having specified properties.

In some embodiments, the particles can be detected using cytometry methods, devices, and systems as disclosed in US 2009/0079963, US 2010/0179068, and WO 2009/112594.

In some embodiments, the particles can be detected using microfluidic methods, devices, and systems. For example, the particles can be detected using a lab-on-a-chip device or system, or the like. See, e.g., U.S. Patent Application Publication Nos. 2009/0326903 and 2009/0297733

In some embodiments, the particles can be detected using a device or system suitable for point-of-care, field, or consumer use. For example, a device (e.g., a lap-on-a-chip device) can include a recombinase, a polymerase, a single-stranded binding protein, ATP, dNTPs, and a primer or probe. In some embodiments, a device can be provided that contains a recombinase, a polymerase, a single-stranded binding protein, ATP, dNTPs, and a primer or probe, where one of the recombinase, the polymerase, the primer or probe, or recombinase is covalently attached or non-covalently bound (e.g., through use of an affinity tag) to a surface. In some embodiments, particles can be placed in multiple single wells in a multi-well plate.

In any of the disclosed methods, where desired the particles may be fixed prior to detection. For example, the particles can be fixed by treatment with an aldehyde (e.g., formaldehyde, paraformaldehyde, or glutaraldehyde) to cross-link proteins and nucleic acids in the sample, effectively stopping the progress of reactions in the mixture and allowing for observation of the particles in the state at which the reaction was stopped. By fixing the mixtures, the particles may be detected at a later point in time, potentially simplifying processing and detection.


Oligonucleotides as disclosed herein may serve as amplification primers and/or detection probes. In some embodiments, the oligonucleotides are provided as a set of two or more (e.g., two, three, four, or more) oligonucleotides, e.g., for use in an amplification method (e.g., as described herein).

Oligonucleotides can be synthesized according to standard phosphoroamidate chemistry, or otherwise. Modified bases and/or linker backbone chemistries may be desirable and functional in some cases and can be incorporated during synthesis. Additionally oligonucleotides may be modified with groups that serve various purposes e.g. fluorescent groups, quenchers, protecting (blocking) groups (reversible or not), magnetic tags, proteins etc.

In some embodiments, the oligonucleotide used herein can contain a contiguous sequence (e.g., at least 10 base units) that is at least 90% identical (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) to a contiguous sequence present within a target nucleic acid. The percent identity or homology between two sequences can be determined using a mathematical algorithm. A non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA, 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA, 90:5873-77. Such an algorithm is incorporated into the NBLAST program of Altschul, et al., (1990); J. Mol. Biol. 215:403-410. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the NBLAST program can be used. See online at

The oligonucleotides may include one or more detectable labels. The detectable label may be a fluorophore, an enzyme, a quencher, an enzyme inhibitor, a radioactive label, a redox sensitive moiety (e.g., an electrochemically active moiety) one member of a binding pair and a combination thereof. In some embodiments, the oligonucleotides can include both a fluorophore and a quencher. The quencher may be close to the fluorophore to suppress the fluorescence of the fluorophore. For example, the separation between the fluorophore and the quencher may be 0 to 2 bases, 0 to 5 bases, 0 to 8 bases, 0 to 10 bases, 3 to 5 bases, 6 to 8 bases, and 8 to 10 bases. The fluorophore and quencher may be any fluorophore and quencher known to work together including, but not limited to, the fluorophore and quenchers any of the fluorophores described in this disclosure. Where the detectable label is a fluorophore or a quencher, it may be attached to the oligonucleotide by a fluorophore-dT amidite residue or quencher-dT amidite residue respectively. Other attachments are possible and widely known.

In another aspect, either the fluorophore or the quencher may be attached to a modified internal residue and the fluorophore and quencher can be separated following cleavage of the modified internal residue by the nuclease.

While any fluorophore may function for the methods of the invention, fluorescein, FAM, TAMRA, and Texas Red are exemplary fluorophores. Exemplary quenchers include a dark quencher which may be, for example, Dark Quencher 1, Dark Quencher 2, Black Hole Quencher 1 or Black Hole Quencher 2.

In some embodiments, the oligonucleotides can include a modified internal residue. The modified internal residue may be any chemical structure (residue) that cannot form a Watson-Crick base pairing structure with its corresponding base in a double stranded nucleic acid structure. The term “modified internal residue,” also includes, at least, any residue not normally found in DNA—that is any residue which is not an “A”, “G”, “C” or “T” such as, for example uracil or inosine. In some embodiments, the modified internal residue is inosine, uracil, 8-oxoguanine, thymine glycol, or an abasic site mimic. Preferred abasic site mimics include a tetrahydrofuran residue or D-spacer (which can be produced as a product of employing a 5′-O-Dimethoxytrityl-1′,2′-Dideoxyribose-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite during oligonucleotide synthesis.

In some embodiments, the oligonucleotides are extension blocked. An extension blocked oligonucleotide is blocked at its 3′ end so that it cannot normally be elongated by polymerase and dNTP even in the presence of a complimentary template. Methods of blocking an oligonucleotide are well known and include, at least, the inclusion of a blocked 3′ nucleotide. The blocked 3′ nucleotide may contain, for example, a blocking group that prevents polymerase extension. Generally, the blocking groups are attached to the 3′ or 2′ site of the 3′ sugar residue but other locations of attachments are possible. One of the most common 3′ blocking methods is to place a dideoxy sugar at the 3′ end of an oligonucleotide. The blocking group may be, for example, a detectable label.

In some embodiments, the oligonucleotides disclosed herein may be modified by incorporation of one or more detectable labels, modified residues (e.g., modified internal residues), and blocking groups. When the oligonucleotide disclosed herein includes one or more detectable labels, modified residues (e.g., modified internal residues), and blocking groups, the oligonucleotide without such modifications or with additional modifications is also included in the disclosure. Additionally, an oligonucleotide as disclosed herein that includes one or more detectable labels, modified residues (e.g., modified internal residues), and blocking groups may have such a moiety replaced by another detectable label, modified residue (e.g., modified internal residue), or blocking group, e.g., a detectable label, modified residue (e.g., modified internal residue), or blocking group as disclosed herein.


The methods and compositions disclosed herein can be used, for example, to detect the number of copies of a target nucleic acid and to monitor amplification of a sequence present within a target nucleic acid. In some embodiments of the present methods, the target nucleic acids can be detected at low copy numbers and in relatively crude samples. In some embodiments, the detected nucleic acid is a bacterial nucleic acid, e.g., from a bacterium selected from Chlamydia trachomatis, Neisseria gonorrhea, Group A Streptococcus, Group B Streptococcus, Clostridium difficile, Escherichia coli, Mycobacterium tuberculosis, Helicobacter pylori, Gardnerella vaginalis, Mycoplasma hominis, Mobiluncus spp., Prevotella spp., and Porphyromonas spp, or from another bacterium described herein or known in the art. In some embodiments, the detected nucleic acid is a mammalian nucleic acid, e.g., a nucleic acid is associated with tumor cells. In some embodiments, the detected nucleic acid is a viral nucleic acid, e.g., from HIV, influenza virus, or dengue virus, or from another virus. In some embodiments, the detected nucleic acid is a fungal nucleic acid, e.g., from Candida albicans or another fungus. In some embodiments, the detected nucleic acid is a protozoan nucleic acid, e.g., from Trichomonas or another protozoan. The methods and compositions disclosed herein can be used in the diagnosis of a disorder or state associated with a detected nucleic acid, e.g., a bacterial nucleic acid, mammalian nucleic acid, viral nucleic acid, fungal nucleic acid, or protozoan nucleic acid (e.g., as disclosed herein). For example, the methods and compositions provided herein can be used to diagnose a bacterial infection, a viral infection, a fungal infection, or a parasitic infection. In some embodiments, the detected nucleic acid is a nucleic acid from: influenza A or a variant thereof, influenza B or a variant thereof, methicillin-resistant Staphylococcus aureus (MRSA), C. difficile, M. tuberculosis, Chlamydia species (e.g., Chlamydia trachomatis), N. gonorrhoeae, Treponema pallidum, human papilloma virus (HPV) (e.g., HPV variants type 16 and type 18), hepatitis virus (e.g., hepatitis A, B, and C), or a circulating cancer cell. In some embodiments, the methods and compositions provided herein can be used to diagnose MRSA infection, C. difficile infection, tuberculosis, chlamydia infection, gonorrhea, syphilis, HPV infection, hepatitis viral infection, or HPV infection. The methods and compositions disclosed herein can be used in quantification of nucleic acids. “Digitalization” of nucleic acid amplification/detection reactions is a recent approach to allow for accurate counting of template molecules (see, e.g., Vogelstein, 1999, Proc. Natl. Acad. Sci. USA, 96:9236). Typically in these methods, spatial separation of the reaction mixture into the required micro-compartments (typically in the nanoliter range) is achieved by physically splitting an amplification reaction, e.g. by pressing it under pressure into suitable microfluidic cassettes or by dispersing it in a suitable emulsion. Without wishing to be bound by theory, if the particles disclosed herein are active centers of amplification, then the presence of the particles constitutes an inherent compartmentalization of the reaction mixture that may be used in quantification. For example, by counting the number of “active” RPA particles (e.g., those associated with the generation of a fluorescent signal) one can measure or estimate the number of template nucleic acid molecules present in the reaction mixture.

The methods can also be used to detect the physical linkage of two or more nucleic acids. In many molecular biology applications the detection of physical linkage of two different genetic markers present in a given sample is important. For example, the mere presence of a bacterial species marker and an antibiotic-resistance marker in a given sample does not deliver information about whether both markers are present in the same bacteria (e.g., on the same nucleic acid), or whether the markers are present in separate co-colonizing bacteria species. Demonstrating that the two markers are linked on a single piece of genomic DNA associates the antibiotic resistance with a particular pathogen. The co-localization of the two markers can deliver vital diagnostic information in this scenario.

The methods and compositions described herein can be used to demonstrate that the sites or locations of two amplification events for two nucleic acids are overlapping, providing information about the physical linkage of the nucleic acids. In contrast, separable amplification events can indicate the presence of both nucleic acids, but on separate segments of DNA (e.g., in two co-colonizing species of bacteria). In some embodiments, the linkage of two nucleic acid sequences can be detected by observing active amplification products of both localized to a single particle in a reaction mixture. In other embodiments, the linkage of two nucleic acid sequences on a single segment of DNA can be detected by observing “tethering” of two particles, each amplifying one of the nucleic acids, by the DNA segment.

In some embodiments, observation of the particles disclosed herein can be used in methods of quality control. For example, a relationship between particle appearance (number, size, density) and RPA performance can be used to generate an analytical parameter to predict RPA reaction quality prior to amplification. This could be used for general quality control purposes (e.g., to check what type/number of particles are present in a given reaction mixture), or to monitor the effect of changes in production procedures (e.g., stabilization processes) or in storage conditions, etc.

In some embodiments, the methods and compositions disclosed herein can be used to obtain results of amplification reactions within minutes (e.g., within 8, 7, 6, 5, 4, 3, 2, 1.5, or 1 minute) from the start of the reaction. Typically, monitoring amplification reactions by detecting the accumulation of fluorescence signal is performed “in bulk”, i.e. the signals generated by individual template molecules is integrated over the entire given reaction volume, producing a detectable fluorescence response in 5-8 minutes. In contrast, observing the fluorescence signal generated at RPA particles may also in principle be used to shorten the time to result in a reaction. This result is due, at least in part, to higher sensitivity of detection under high magnification in defined loci (e.g., particles).

The fluorescence signal strength of standard RPA reactions, typically performed and monitored ‘in bulk’, does profit from mixing steps performed during the incubation, especially if very low amounts of starting template material are used. Observing amplification reactions directly at particles can reduce any variation introduced by mixing.

EXAMPLES Example 1 Particles in Recombinase Polymerase Amplification Mixtures

This example describes the observation of particles containing oligonucleotides within RPA mixtures. Freeze dried mixtures of RPA reaction components including FAM labeled oligonucleotides were obtained by preparing a mixture containing 2.96 μg Creatine Kinase, 13.1 μg Rb69 gp32, 18.1 μg T6 H66S UvsX, 5.15 μg Rb69 UvsY, 5.38 μg Exonuclease III and 5.0 μg DNA Polymerase (large fragment of S. aureus polymerase I) in 80 μl 9.38 mM Tris Acetate, pH 8.3, 3.13 mM DTT, 2.5% PEG, 3.75% trehalose, 31.3 mM phosphocreatine, 1.56 mM ATP, 750 μM dNTPmix (188 μM each of dATP, dTTP, dCTP and dGTP), 388 nM Spy1258F2 (CACAGACACTCGACAAG TCCTCAATCAAACCTTG; SEQ ID NO:1), 363 nM Spy1258R2 (CAGAAATCCT TGATGAGTTGCGGAAATTTGAGGT; SEQ ID NO:2) and 75 nM Spy1258exoP1 (CCTTGTCCTACCTTATAGAACATAGAGAATQTHFAACCGCACTCGCTAC; F=FAM-dT, H=THF (abasic site mimic), Q=BHQ-1-dT, 3′=block c3spacer; SEQ ID NO:3) and freeze-drying the mixture in 0.2-mL tubes. The dried reagents were resuspended in 46.5 μL rehydration buffer (48 mM Tris acetate, 133.8 mM KOAc, 2% PEG) +3.5 μL water and vortexed. These mixtures did not contain nucleic acid template or magnesium. Ten microliters of the mixture was transferred to a microscope slide and imaged using differential interference contrast (DIC) and fluorescence microscopy at 40× magnification (FIGS. 1A-1C). Particles of about 1-10 microns in size were observed using DIC (FIG. 1A) or fluorescence (FIG. 1B), and when the two images were merged (FIG. 1C). Approximately 100-500 particles/nL were observed (field of view at 40× magnification was equivalent to 1.55 nL of the mixture).

In a separate experiment, mixtures were prepared as above but substituting 2.5 μL water and 1 μL of a Streptococcus pyogenes genomic DNA preparation (100 copies/μl) for the 3.5 μL water. The mixture was vortexed and imaged as above (FIGS. 2A-2C). Similar particles as above were observed using DIC (FIG. 2A) or fluorescence (FIG. 2B), and when the two images were merged (FIG. 2C).

This example demonstrates that particles are formed in RPA mixtures, and that the particles are not dependent upon the inclusion of template or magnesium.

Example 2 Crowding Agents Stimulate Particle Formation

To determine the effects of crowding agents on particle formation, fresh RPA mixtures were prepared containing 2.96 μg Creatine Kinase, 13.1 μg Rb69 gp32, 18.8 μg T6 H66S UvsX, 2.5 μg Rb69 UvsY, 5.38 μg Exonuclease III and 5.0 μg DNA Polymerase in 50 mM Tris Acetate, pH 8.3, 100 mM KOAc, 5 mM DTT, 1.2 mM dNTP mix (300 μM each of dATP, dTTP, dCTP and dGTP), 50 mM phosphocreatine, 2.5 mM ATP, 6% trehalose, 14 mM MgAc, 30 nM HIV p2LFtexas (Texas red-labeled oligo AGAATTACAAAAACAAATTACAAAAATTCA5AATTTTCGGGTTT; 3′ dA blocked, 5′ Texas Red, 5=dSpacer; SEQ ID NO:4), 420 nM Spy1258F2 (CACAGACACTCGACAAGTCCTCAATCAAACCTTG; SEQ ID NO:5), and 390 nM Spy1258R2 (CAGAAATCCTTGATGAGTTGCGGAAATTTGAGGT; SEQ ID NO:6). PEG was included in each mixture at 0%, 2%, 2.5%, 3%, 3.5%, 4%, 5.5%, or 8%. The mixtures were mixed by pipette and 10 μL of each was transferred to a microscope slide. Imaging was performed using differential interference contrast (DIC) and fluorescence microscopy at 40× magnification. The number of particles observed increased with increasing PEG concentration up to 5.5% (FIGS. 3A-3G). Fewer particles were observed at 8% PEG (FIG. 3H).

This example demonstrates that PEG can enhance formation of particles in RPA mixtures.

Example 3 Contribution of Mixture Components to Particle Formation

To determine the contribution of the RPA mixture components to particle formation, mixtures were prepared as in Example 2 with 5.5% PEG, except that individual components were excluded in each reaction. The mixtures were imaged as above using DIC and fluorescence microscopy. When all the components were present, particles formed in the mixture as described above (FIGS. 4A-4B). Particles formed in the absence of UvsX appeared different in size from those formed in the presence of UvsX and were not easily observable by DIC (FIGS. 4C-4D). Particles formed in the absence of gp32 appeared different in shape and size from those formed in the presence of gp32 (FIGS. 4E-4F). Structures formed in the absence of other RPA components (UvsY, DNA polymerase, creatine kinase, or exonuclease III) appeared similar to those formed in a complete RPA reaction (FIGS. 5A-5H). The absence of UvsY did appear to lead to a slight decrease in the number of the particles and an increase in the particle size (FIGS. 5A-5B).

Additional mixtures were prepared excluding two or three reaction components. A control RPA mixture was prepared containing 2.96 μg Creatine Kinase, 13.1 μg Rb69 gp32, 18.8 μg T6 H66S UvsX, 5.15 μg UvsY, 8.26 μg Exonuclease III and 5.0 μg DNA Polymerase in 50 mM Tris Acetate, pH 8.3, 100 mM KOAc, 5 mM DTT, 1.2 mM dNTP mix (300 μM each of dATP, dTTP, dCTP and dGTP), 50 mM phosphocreatine, 2.5 mM ATP, 6% trehalose, 14 mM MgAc, 5.5% PEG, 120 nM M2intFAM (FAM-labeled probe 5′-tcctcatatccattctgTcgaatatcatcaaaagc-3′; T=carboxyfluorescein-dT; SEQ ID NO:19), 420 nM each SpaF3 (CGCTTTGTTGATCTTTGTTGAAGTTATTTTGTTGC; SEQ ID NO:7) and SpaR10+1 (TTAAAGATGATCCAAGCCAAAGTCCTAACGTTTTA; SEQ ID NO:8). Parallel mixtures were prepared that lacked (i) gp32 and UvsY; (ii) UvsX and UvsY; (iii) UvsX and gp32; (iv) UvsX, UvsY, and gp32; or (iv) gp32, UvsY, and Emix (phosphocreatine and ATP). No particles were observed in the mixtures lacking UvsX and at least one other component. In the mixtures lacking gp32 and UvsY, large, irregular fluorescent bodies were observed (FIGS. 6A-6C).

This example demonstrates that exclusion of UvsX or gp32 has the largest effect on particle morphology, followed by an intermediate effect of exclusion of UvsY, with no significant effect observed on exclusion of DNA polymerase, creatine kinase, or exonuclease III. Exclusion of two or more components had increased effects.

Example 4 Separate Populations of Particles Remain Distinct when Mixed

Two freeze-dried mixtures were prepared as described in Example 1, except that each mixture included different oligonucleotides and 18.8 μg UvsX. Reagent Mix 1 contained 296 nM SpaF3 (SEQ ID NO:7), 298 nM SpaR10+1 (SEQ ID NO:8) and 149 nM SpaProbe1 (CATCAGCTTTTGGAGCTTGAGAGTCAT9 A8G6TTTTGAGCTTCAC; 3′ biotin, 6=BHQ-2 dT, 8=dSpacer, 9=TMR dT; SEQ ID NO:9). Reagent Mix 2 contained 299 nM MecF9-8+2 (CCCTCAAACAGGTGAA TTATTAGCACTTGT; SEQ ID NO:10), 300 nM MecR1a(CTTGTTGAGCAGAGG TTCTTTTTTATCTTC; SEQ ID NO:11) and 150 nM MecProbe1 (ATGACGTCTAT CCATTTATGTATGGCAFGHGQAACGAAGAATATA; 3′ biotinTEG, Q=BHQ-1 dT, H=THF (abasic site mimic), F=FAM-dT; SEQ ID NO:12). Equal volumes of the two reagent mixtures were combined, and 80 μL was dispensed into 0.2-mL tubes and freeze-dried. The dried mixtures were resuspended in 46.5 μl rehydration buffer (see Example 1), 1 μL water, and 2.5 μL 280 mM MgAc. The mixture was vortexed and 10 μL was transferred to a microscope slide for imaging using DIC and fluorescence. The particles observed contained both red (TMR) and green (FAM) fluorescence, indicating that both labeled oligonucleotides were present in the particles (FIGS. 7A-7F).

In another experiment, two separate freeze-dried mixtures were prepared as above, one including only the TMR labeled Spa RPA probe (Reagent Mix 1, above), and the other including only the FAM-labeled MecA RPA probe (Reagent Mix 2, above). Following reconstitution, the two reconstituted mixtures were combined and imaged using DIC and fluorescence. Distinct particles that contained predominantly one fluorophore or the other were observed in the mixture (FIGS. 8A-8F). This indicates that the particles including each probe can remain distinct from each other after mixing.

To determine the stability of mixed populations of particles over time, two primer-free freeze-dried reactions were reconstituted in rehydration buffer with MgAc and oligonucleotides as below. One mixture included 30 nM HIV p2LFtexas (Texas Red labeled), 420 nM Spy1258F2 (SEQ ID NO:1, unlabeled), and 390 nM Spy1258R2 (SEQ ID NO:2, unlabeled). The other mixture included 50 nM M2intFAM oligo (SEQ ID NO:19, FAM labeled), 420 nM Spy1258F2 (SEQ ID NO:1, unlabeled), and 390 nM Spy1258R2 (SEQ ID NO:2, unlabeled). Five microliters of each mixture were pipetted onto a microscope slide and mixed, and the combination was imaged at 2, 7, and 13 minutes (FIG. 9). Images of the mixture following the 12-minute period are shown in FIG. 9. After 13 minutes, particles including predominantly Texas Red or FAM fluorescence were observable.

This example demonstrates that particles remain relatively stable in solution and can be independently labeled. This observation can be useful in monitoring two or more RPA reactions simultaneously, occurring on different particle subsets.

Example 5 RPA Reactions are Observed Localized to Particles

Freeze dried mixtures of RPA reaction components including a FAM labeled oligonucleotide probe, as in Example 1, were reconstituted with 46.5 μl rehydration buffer, and an amplification reaction was begun by addition of 1 μL 50,000 copies/4 S. pyogenes genomic DNA and 2.5 μL 280 mM MgAc. The reaction was mixed by pipetting and transferred to a microscope slide for imaging by DIC and fluorescence starting at about 2 minutes, 40 seconds after initiation and then at 8, 12, 14, 15, 16, 18, 20, and 22 minutes (FIG. 10). An increase in fluorescence (indicating amplification) was observed, which was at least initially localized to individual particles.

In another experiment, freeze-dried primer-free mixtures of reaction components (prepared by mixing a 50 μl volume of 2.96 μg Creatine Kinase, 9.88 μg Rb69 gp32, 18.8 μg T6 H66S UvsX, 5.38 μg UvsY, 5.38 μg Exonuclease III and 5.34 μg DNA Polymerase in 25 mM Tris Acetate, pH 8.3, 5 mM DTT, 2.28% PEG, 5.7% trehalose, 50 mM phosphocreatine, 2.5 mM ATP, 1200 μM dNTPmix (300 μM each of dATP, dTTP, dCTP and dGTP and freeze drying in 0.2-mL tubes) were reconstituted with 29.5 μl primer-free rehydration buffer (41.7 mM Tris Acetate, 167.5 mM Potassium Acetate, 5.4% PEG, pH 8.3), 3.5 μL of 6 μM Spa F3 (SEQ ID NO:7), 3.5 μL of 6 μM Spa R10+1 (SEQ ID NO:8), 1 μL of 6 μM TMR-labeled Spa Probe 1 (SEQ ID NO:9), 1 μL of 0.6 μM M2intFAM oligo (SEQ ID NO:19, used as a fluorescent marker of particles and not involved in the RPA reaction), and 8 μL water. The reaction was initiated by addition of 1 μL 50,000 copies/4 Group A Streptococcus purified genomic template DNA and 2.5 μL 280 mM MgAc and mixing by pipette. Ten microliters of the mixture were transferred to a microscope slide, and imaging was begun about 3 minutes after initiation of the reaction. A time course of the reaction mixture at 3, 8, 15, 18, 22, and 26 minutes (FIG. 11) showed an increase in red fluorescence (indicating amplification), which was at least initially localized to individual particles.

This example demonstrates that nucleic acid amplification products can be observed colocalized with particles.

Example 6 Effects of UvsX Variants

To investigate the effects of different UvsX variants, mixtures were set up at room temperature containing 2.96 μg Creatine Kinase, 13.1 μg Rb69 gp32, 8.26 μg Exonuclease III, 5.0 μg Polymerase in 50 mM Tris Acetate, pH 8.3, 100 mM KOAc, 5 mM DTT, 1.2 mM dNTP mix (300 μM each of dATP, dTTP, dCTP and dGTP), 50 mM phosphocreatine, 2.5 mM ATP, 6% trehalose, 14 mM MgAc, 5.5% PEG, 120 nM M2intFAM (SEQ ID NO:19), 420 nM each SpaF3 and SpaR10+1 (50 μl final volume). Four different mixtures were prepared, containing either 18.8 μg T6H66S UvsX or 17.6 μg T6 UvsX, and with or without 5.15 μg Rb69 UvsY. Ten microliters of each mixture were transferred to a microscope slide and imaged at 20× magnification about 5-20 minutes after set-up (FIGS. 12A-12D) and also at 40× magnification about 50-60 minutes after set-up (FIGS. 13A-13D). In general, more particles were observed in the T6H66S UvsX mixture than with T6 UvsX. Additionally the T6H66S UvsX particles were often different in shape than those with T6 UvsX, including more comet-like shapes, whereas the T6 UvsX particles were more spherical. The T6H66S UvsX mixtures lacking UvsY had has more diffuse particles and diffuse “halos” or “doughnuts” that lacked signal in the middle. With T6 UvsX the opposite effect was often observed. Without UvsY, the particles were bright small spheres, but with UvsY they were less bright and more smeary and small.

The effect of UvsY on RPA reaction kinetics using T6H66S UvsX and T6 UvsX was investigated. Reactions were prepared as above, with T6H66S UvsX or T6 UvsX, and with or without Rb69 UvsY. Three separate experiments were performed using different primer sets and templates. In the first experiment, the primers were 420 nM FluAPAFNA507 (AACCTGGGACCTTTGATCTTGGGGGGCTATATG; SEQ ID NO:13) and FluAPARNA106 (ATGTGTTAGGAAGGAGTTGAACCAAGAAGCATT; SEQ ID NO:14), with 120 nM probe FluAPAexoP2.2 (GATCTTGGGGGGCTATATGAA GCAATYGAGGAGFHCQTGATTAATGAT; F=FAM-dT, H=THF (abasic site mimic), Q=BHQ-1-dT, 3′=block c3spacer; SEQ ID NO:15). Five hundred or 50 copies of influenza A template RNA were used in each reaction. RPA reactions were assembled containing 2.96 μg Creatine Kinase, 13.1 μg Rb69 gp32, 18.8 μg T6H66S UvsX or 17.6 ug T6 UvsX, 8.26 μg Exonuclease III, 5.0 μg Polymerase, 1.79 μg Reverse Transcriptase, 5.15 μg UvsY (when present) in 50 mM Tris Acetate, pH 8.3, 100 mM KOAc, 5 mM DTT, 0.2 units/4 Ribolock™ RNAse Inhibitor (Fermentas), 1.2 mM dNTP mix (300 μM each of dATP, dTTP, dCTP and dGTP), 50 mM phosphocreatine, 2.5 mM ATP, 6% trehalose, 5.5% PEG. The above components were assembled in a 46.5 μL volume in a 0.2-mL tube, and reactions were started by addition of 2.5 μL of 280 mM MgOAc and 1 μL of 500 or 50 copies/4 influenza A template RNA. Reactions were vortexed, briefly centrifuged and transferred to a Twista instrument (ESE) and the fluorescence monitored every 20 seconds for 20 minutes at 40° C. with a mixing step (vortex and brief centrifuge) at 5 minutes. Inclusion of UvsY with T6H66S UvsX led to a delay in amplification relative to the reaction without UvsY, and the opposite was seen for T6 UvsX (FIGS. 14A-14B). When only 50 copies of the template were present, the reactions lacking UvsY generated less signal overall (FIGS. 14A-14B). A similar effect on reaction kinetics was observed in a second experiment using as primers 420 nM SpaF3 and SpaR10, with 120 nM SpaProbe1.2 and 1000 copies of group A streptococcus purified genomic template DNA (FIG. 15).

In the second experiment, the primers used were 420 nM FluBNSF1007 (CATCGGATCCTCAACTCACTCTTCGAGCGT; SEQ ID NO:16) and FluBNSR705 (GACCAAATTGGGATAAGACTCCCACCGCAGTTTC; SEQ ID NO:17), with 120 nM probe FluBNSexoP1 (CATCGGATCCTCAAYTCACTCTTCGAGCGFHTQAA TGAAGGACATTC; F=FAM-dT, H=THF (abasic site mimic), Q=BHQ-1-dT, 3′=block c3spacer; SEQ ID NO:18). Five hundred copies of PCR-amplified influenza B template DNA were used in each reaction. In these reactions, no amplification was observed with T6H66S UvsX lacking UvsY (FIGS. 16A-16B). The opposite effect was observed with T6 UvsX (FIGS. 16A-16B).

This example demonstrates that different UvsX variants can have different requirements for UvsY with regard to particle morphology and amplification reaction kinetics. Additionally, particle morphology appears to be correlated to the kinetics and/or progress of the amplification reaction.

Example 7 Quantification of Nucleic Acids

The methods disclosed herein can be used for the quantification of nucleic acids. In one experiment, dilutions of a template nucleic acid are combined with an RPA reaction mixture as disclosed in Example 5. The number of particles in a specified volume of the reaction that are associated with sites of nucleic acid amplification is determined at each dilution. Within a range, the number of particles associated with sites of nucleic acid amplification varies with the concentration of template nucleic acid in the reaction. For example, the number of particles associated with nucleic acid amplification can be proportional to the concentration of template nucleic acid, or the number of particles associated with nucleic acid amplification can be equivalent to the number of template nucleic acid molecules in the same volume. Using this information regarding the correlation between number of active particle and template nucleic acid concentration, the concentration of template nucleic acid in an experimental sample can be determined.

Other Embodiments

A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.

Claims (20)

What is claimed is:
1. A composition comprising:
a mixture comprising
(a) a first population of particles comprising a recombinase, a single-strand DNA binding protein (SSB), and a first oligonucleotide comprising a first detectable label; and
(b) a second population of particles comprising a recombinase, a single-strand DNA binding protein (SSB) and a second oligonucleotide comprising a second detectable label, wherein:
the first and second oligonucleotides are different,
the first and second detectable labels are different, and
the first and second population of particles can be independently detected in the mixture.
2. The composition of claim 1, wherein the single-strand DNA binding protein (SSB) comprises a prokaryotic SSB protein or a SSB derived from a myoviridae phage.
3. The composition of claim 1, wherein the recombinase comprises a RecA or UvsX protein.
4. The composition of claim 1, wherein the single-strand DNA binding protein SSB) comprises a myoviridae phage derived gp32 protein or E. coli SSB.
5. The composition of claim 1, wherein the particles are about 0.5-20 μm in size.
6. The composition of claim 1, wherein the particles are about 1-10 μm in size.
7. The composition of claim 1, wherein the particles are present in the range 10 to 5000 particles/nL.
8. The composition of claim 1, wherein the particles are present in the range 100 to 2000 particles/nL.
9. The composition of claim 1, wherein the first and second detectable labels are fluorescent markers and the particles can be detected using fluorescence from the particles.
10. The composition of 9, wherein the particles can be detected without using fluorescence from the particles.
11. The composition of claim 1, wherein the particles can be detected by microscopy, a microfluidic device, flow cytometry, a camera, or a charge coupled device.
12. The composition of claim 1, wherein the particles comprise a first subset of particles and a second subset of particles, the first subset of particles can be detected using fluorescence from the first subset of particles, and the second subset of particles can be detected without using fluorescence from the second subset of particles.
13. The composition of claim 1, wherein the mixture further comprises one or more of a DNA polymerase, a recombinase loading protein, dNTPs or a mixture of dNTPs and ddNTPs, a reducing agent, creatine kinase, a nuclease, a nucleic acid probe, a reverse transcriptase, and a template nucleic acid.
14. The composition of claim 1, wherein the mixture further comprises a crowding agent.
15. The composition of claim 14, wherein the crowding agent comprises polyethylene glycol, polyvinyl alcohol, dextran and/or Ficoll.
16. The composition of claim 15, wherein the polyethylene glycol is selected from the group consisting of PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000.
17. The composition of claim 1, wherein the mixture further comprises a template nucleic acid.
18. The composition of claim 1, wherein the particles comprise one or more of the recombinase, the single-strand binding protein, at least one of the one or more oligonucleotides, and a template nucleic acid.
19. The composition of claim 1, wherein first detectable label or the second detectable label comprises an enzyme, an enzyme substrate, a coenzyme, an enzyme inhibitor, a fluorescent marker, a quencher, a chromophore, a magnetic panicle or bead, a redox sensitive moiety, a luminescent marker, a radioisotope, and members of binding pairs.
20. The composition of claim 1, wherein the first and second detectable labels are fluorescent markers selected from the group consisting of fluorescein, FAM, TAMRA (tetramethylrhodamine) and Texas Red.
US14183113 2011-04-07 2014-02-18 Monitoring recombinase polymerase amplification mixtures Active US9157127B2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US201161472919 true 2011-04-07 2011-04-07
US201161472929 true 2011-04-07 2011-04-07
US13441411 US8809021B2 (en) 2011-04-07 2012-04-06 Monitoring recombinase polymerase amplification mixtures
US14183113 US9157127B2 (en) 2011-04-07 2014-02-18 Monitoring recombinase polymerase amplification mixtures

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US14183113 US9157127B2 (en) 2011-04-07 2014-02-18 Monitoring recombinase polymerase amplification mixtures
US14841203 US9719132B2 (en) 2011-04-07 2015-08-31 Monitoring recombinase polymerase amplification mixtures

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US13441411 Continuation US8809021B2 (en) 2011-04-07 2012-04-06 Monitoring recombinase polymerase amplification mixtures

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14841203 Continuation US9719132B2 (en) 2011-04-07 2015-08-31 Monitoring recombinase polymerase amplification mixtures

Publications (2)

Publication Number Publication Date
US20150024397A1 true US20150024397A1 (en) 2015-01-22
US9157127B2 true US9157127B2 (en) 2015-10-13



Family Applications (3)

Application Number Title Priority Date Filing Date
US13441411 Active 2032-05-16 US8809021B2 (en) 2011-04-07 2012-04-06 Monitoring recombinase polymerase amplification mixtures
US14183113 Active US9157127B2 (en) 2011-04-07 2014-02-18 Monitoring recombinase polymerase amplification mixtures
US14841203 Active US9719132B2 (en) 2011-04-07 2015-08-31 Monitoring recombinase polymerase amplification mixtures

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US13441411 Active 2032-05-16 US8809021B2 (en) 2011-04-07 2012-04-06 Monitoring recombinase polymerase amplification mixtures

Family Applications After (1)

Application Number Title Priority Date Filing Date
US14841203 Active US9719132B2 (en) 2011-04-07 2015-08-31 Monitoring recombinase polymerase amplification mixtures

Country Status (6)

Country Link
US (3) US8809021B2 (en)
EP (2) EP3202918A1 (en)
JP (2) JP5961247B2 (en)
CN (2) CN103476940B (en)
CA (1) CA2831140C (en)
WO (1) WO2012138989A1 (en)

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9399217B2 (en) 2010-10-04 2016-07-26 Genapsys, Inc. Chamber free nanoreactor system
US9184099B2 (en) 2010-10-04 2015-11-10 The Board Of Trustees Of The Leland Stanford Junior University Biosensor devices, systems and methods therefor
US9926596B2 (en) 2011-05-27 2018-03-27 Genapsys, Inc. Systems and methods for genetic and biological analysis
GB2499340B (en) 2010-10-04 2015-10-28 Genapsys Inc Methods for sequencing nucleic acids
EP2652148B1 (en) 2010-12-17 2016-11-30 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US9309566B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US9309557B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Nucleic acid amplification
US9334531B2 (en) 2010-12-17 2016-05-10 Life Technologies Corporation Nucleic acid amplification
US9274077B2 (en) 2011-05-27 2016-03-01 Genapsys, Inc. Systems and methods for genetic and biological analysis
EP2971141A4 (en) 2013-03-15 2016-11-23 Genapsys Inc Systems and methods for biological analysis
WO2015161054A3 (en) 2014-04-18 2015-12-17 Genapsys, Inc. Methods and systems for nucleic acid amplification
CN104830820A (en) * 2015-05-07 2015-08-12 浙江泰晶生物科技有限公司 Protease and detection method for rapidly detecting ribonucleic acid at constant room temperature
WO2016201142A1 (en) 2015-06-09 2016-12-15 Life Technologies Corporation Methods, systems, compositions, kits, apparatus and computer-readable media for molecular tagging
WO2017062343A1 (en) 2015-10-06 2017-04-13 Pierce Biotechnology, Inc. Devices and methods for producing nucleic acids and proteins
WO2017123921A1 (en) * 2016-01-13 2017-07-20 The Trustees Of The University Of Pennsylvania Multiple stage isothermal enzymatic amplification
WO2017147486A1 (en) * 2016-02-26 2017-08-31 Alere San Diego Inc. Redox labeled oligonucleotide probes and their use
WO2017172699A1 (en) * 2016-03-28 2017-10-05 Illumina, Inc. Recombinase mutants

Citations (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
WO1991017267A1 (en) 1990-05-07 1991-11-14 Sri International Process for nucleic acid hybridization and amplification
WO1993005178A1 (en) 1990-05-07 1993-03-18 Daikin Industries, Ltd. Diagnostic applications of double d-loop formation
US5273881A (en) 1990-05-07 1993-12-28 Daikin Industries, Ltd. Diagnostic applications of double D-loop formation
US5326692A (en) 1992-05-13 1994-07-05 Molecular Probes, Inc. Fluorescent microparticles with controllable enhanced stokes shift
EP0624643A2 (en) 1993-05-11 1994-11-17 Becton Dickinson and Company Decontamination of nucleic acid amplification reactions
US5418149A (en) 1990-07-24 1995-05-23 Hoffmann-La Roche Inc. Reduction of non-specific amplification glycosylase using DUTP and DNA uracil
EP0702090A2 (en) 1994-09-15 1996-03-20 JOHNSON & JOHNSON CLINICAL DIAGNOSTICS, INC. Coamplification of target nucleic acids using volume exclusion agent, in reaction composition, test kit and test device useful therefor
WO1997020078A1 (en) 1995-11-30 1997-06-05 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US5656430A (en) 1995-06-07 1997-08-12 Trevigen, Inc. Oscillating signal amplifier for nucleic acid detection
US5665572A (en) 1991-08-30 1997-09-09 Research Development Corporation Of Japan Polymerase chain reaction amplification method using a single primer which randomly anneals
EP0810436A1 (en) 1989-02-17 1997-12-03 Unilever Plc Solid-phase analytical device
WO1998008975A1 (en) 1996-08-29 1998-03-05 Daikin Industries, Ltd. Methods for targeting, enriching, detecting and/or isolating target nucleic acid sequence using reca-like recombinase
US5792607A (en) 1990-01-26 1998-08-11 Abbott Laboratories Method and kits for amplifying target nucleic acids applicable to both polymerase and ligase chain reactions
US5849547A (en) 1993-07-26 1998-12-15 Bio Merieux Method for nucleic acid amplification by transcription using displacement, and reagents and kit therefor
US5858652A (en) 1988-08-30 1999-01-12 Abbott Laboratories Detection and amplification of target nucleic acid sequences
US6087112A (en) 1998-12-30 2000-07-11 Oligos Etc. Inc. Arrays with modified oligonucleotide and polynucleotide compositions
WO2000041524A2 (en) 1999-01-11 2000-07-20 President And Fellows Of Harvard College Isothermal amplification of dna
US6251600B1 (en) 1996-07-26 2001-06-26 Edward E. Winger Homogeneous nucleotide amplification and assay
US20010044111A1 (en) 2000-03-20 2001-11-22 Brian Carr Method for generating recombinant DNA molecules in complex mixtures
US6379899B1 (en) 2001-03-13 2002-04-30 Discoverx Isothermal exponential RNA amplification in complex mixtures
US6387621B1 (en) 1999-04-27 2002-05-14 University Of Utah Research Foundation Automated analysis of real-time nucleic acid amplification
US20020061530A1 (en) 2000-07-31 2002-05-23 Belotserkovskii Boris P. Enhanced targeting of DNA sequences by recombinase protein and single-stranded homologous DNA probes using DNA analog activation
US20020155573A1 (en) 2000-01-12 2002-10-24 Biotec Asa Cod uracil-DNA glycosylase, gene coding therefore, recombinant DNA containing said gene or operative parts thereof, a method for preparing said protein and the use of said protein or said operative parts thereof in monitoring or controlling PCR
WO2002086167A1 (en) 2001-04-20 2002-10-31 The Penn State Research Foundation Methods for nucleic acid manipulation
WO2003027640A2 (en) 2001-09-28 2003-04-03 University Of Delaware Polymorphism detection and separation
WO2003038053A2 (en) 2001-11-01 2003-05-08 Gene Check, Inc. Reca assisted detection of mutations, single nucleotide polymorphisms and specific sequences
CA2476481A1 (en) 2002-02-21 2003-09-04 Asm Scientific, Inc. Recombinase polymerase amplification
US20030228611A1 (en) 2002-05-01 2003-12-11 President And Fellows Of Harvard College Nucleic acid memory device
WO2004007078A1 (en) 2002-07-12 2004-01-22 British Biocell International Limited Lateral flow assay device and method
US6699693B1 (en) 1999-02-04 2004-03-02 Sloan-Kettering Institute For Cancer Research Process for DNA replication
WO2004027025A2 (en) 2002-09-20 2004-04-01 New England Biolabs, Inc. Helicase dependent amplification of nucleic acids
EP1420069A1 (en) 2001-08-20 2004-05-19 Takara Bio Inc. Nucleic acid amplification methods
US20040101893A1 (en) 2002-08-21 2004-05-27 Epoch Biosciences, Inc. Abasic site endonuclease assay
US20040137456A1 (en) 2002-04-04 2004-07-15 Hiroki Yokota Method for identifying and characterizing individual dna molecules
US20040224336A1 (en) 2003-03-11 2004-11-11 Gene Check, Inc. RecA-assisted specific oligonucleotide extension method for detecting mutations, SNPs and specific sequences
US20050112631A1 (en) 2002-02-21 2005-05-26 Olaf Piepenburg Recombinase polymerase amplification
US20050136443A1 (en) 2003-10-10 2005-06-23 Aisin Seiki Kabushiki Kaisha Nucleic acid amplification method
EP1564306A2 (en) 2004-02-17 2005-08-17 Affymetrix, Inc. Methods for fragmenting and labeling DNA
WO2005118853A2 (en) 2004-06-01 2005-12-15 Asm Scientific, Inc. Recombinase polymerase amplification
US20060110765A1 (en) 2004-11-23 2006-05-25 Wang Xiao B Detection of nucleic acid variation by cleavage-amplification (CleavAmp) method
US20070054296A1 (en) 2005-07-25 2007-03-08 Olaf Piepenburg Methods for multiplexing recombinase polymerase amplification
US20070154914A1 (en) 2004-06-28 2007-07-05 Roche Molecular Systems, Inc. 2'-Terminator related pyrophosphorolysis activated polymerization
US20070265198A1 (en) 2003-05-15 2007-11-15 Vincent Fischetti Nucleic Acids and Polypeptides of C1 Bacteriophage and Uses Thereof
WO2008035205A2 (en) 2006-05-04 2008-03-27 Asm Scientific, Inc. Recombinase polymerase amplification
WO2009105648A2 (en) 2008-02-22 2009-08-27 Great Basin Scientific Systems and methods for point-of care amplification and detection of polynucleotides
US20100311127A1 (en) 2002-02-21 2010-12-09 TwistDix, Inc. Recombinase polymerase amplification

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2560758A1 (en) 2004-04-21 2005-11-03 Toray Industries, Inc. Lab-on-chip substrate
DE102005052752A1 (en) 2005-11-04 2007-05-10 Clondiag Chip Technologies Gmbh Device and method for the detection of molecular interactions
JP5265665B2 (en) 2007-05-03 2013-08-14 クロンデイアグ・ゲーエムベーハー analysis
US8560130B2 (en) 2007-12-04 2013-10-15 Lester F. Ludwig Software controlled lab-on-a-chip emulation
US8906303B2 (en) 2008-03-14 2014-12-09 Clondiag Gmbh Assays
WO2010141940A1 (en) * 2009-06-05 2010-12-09 Alere San Diego, Inc. Recombinase polymerase amplification reagents and kits

Patent Citations (71)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683195B1 (en) 1986-01-30 1990-11-27 Cetus Corp
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US5858652A (en) 1988-08-30 1999-01-12 Abbott Laboratories Detection and amplification of target nucleic acid sequences
EP0810436A1 (en) 1989-02-17 1997-12-03 Unilever Plc Solid-phase analytical device
US5792607A (en) 1990-01-26 1998-08-11 Abbott Laboratories Method and kits for amplifying target nucleic acids applicable to both polymerase and ligase chain reactions
WO1993005178A1 (en) 1990-05-07 1993-03-18 Daikin Industries, Ltd. Diagnostic applications of double d-loop formation
US5223414A (en) 1990-05-07 1993-06-29 Sri International Process for nucleic acid hybridization and amplification
US5273881A (en) 1990-05-07 1993-12-28 Daikin Industries, Ltd. Diagnostic applications of double D-loop formation
WO1991017267A1 (en) 1990-05-07 1991-11-14 Sri International Process for nucleic acid hybridization and amplification
US5670316A (en) 1990-05-07 1997-09-23 Daikin Industries, Ltd. Diagnostic applications of double D-loop formation
US5418149A (en) 1990-07-24 1995-05-23 Hoffmann-La Roche Inc. Reduction of non-specific amplification glycosylase using DUTP and DNA uracil
US5665572A (en) 1991-08-30 1997-09-09 Research Development Corporation Of Japan Polymerase chain reaction amplification method using a single primer which randomly anneals
US5326692A (en) 1992-05-13 1994-07-05 Molecular Probes, Inc. Fluorescent microparticles with controllable enhanced stokes shift
US5326692B1 (en) 1992-05-13 1996-04-30 Molecular Probes Inc Fluorescent microparticles with controllable enhanced stokes shift
EP0624643A2 (en) 1993-05-11 1994-11-17 Becton Dickinson and Company Decontamination of nucleic acid amplification reactions
US5536649A (en) 1993-05-11 1996-07-16 Becton, Dickinson And Company Decontamination of nucleic acid amplification reactions using uracil-N-glycosylase (UDG)
US5849547A (en) 1993-07-26 1998-12-15 Bio Merieux Method for nucleic acid amplification by transcription using displacement, and reagents and kit therefor
EP0702090A2 (en) 1994-09-15 1996-03-20 JOHNSON & JOHNSON CLINICAL DIAGNOSTICS, INC. Coamplification of target nucleic acids using volume exclusion agent, in reaction composition, test kit and test device useful therefor
US5656430A (en) 1995-06-07 1997-08-12 Trevigen, Inc. Oscillating signal amplifier for nucleic acid detection
WO1997020078A1 (en) 1995-11-30 1997-06-05 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6251600B1 (en) 1996-07-26 2001-06-26 Edward E. Winger Homogeneous nucleotide amplification and assay
WO1998008975A1 (en) 1996-08-29 1998-03-05 Daikin Industries, Ltd. Methods for targeting, enriching, detecting and/or isolating target nucleic acid sequence using reca-like recombinase
US6087112A (en) 1998-12-30 2000-07-11 Oligos Etc. Inc. Arrays with modified oligonucleotide and polynucleotide compositions
WO2000041524A2 (en) 1999-01-11 2000-07-20 President And Fellows Of Harvard College Isothermal amplification of dna
US6699693B1 (en) 1999-02-04 2004-03-02 Sloan-Kettering Institute For Cancer Research Process for DNA replication
US6387621B1 (en) 1999-04-27 2002-05-14 University Of Utah Research Foundation Automated analysis of real-time nucleic acid amplification
US20020155573A1 (en) 2000-01-12 2002-10-24 Biotec Asa Cod uracil-DNA glycosylase, gene coding therefore, recombinant DNA containing said gene or operative parts thereof, a method for preparing said protein and the use of said protein or said operative parts thereof in monitoring or controlling PCR
US20010044111A1 (en) 2000-03-20 2001-11-22 Brian Carr Method for generating recombinant DNA molecules in complex mixtures
US20020061530A1 (en) 2000-07-31 2002-05-23 Belotserkovskii Boris P. Enhanced targeting of DNA sequences by recombinase protein and single-stranded homologous DNA probes using DNA analog activation
US6379899B1 (en) 2001-03-13 2002-04-30 Discoverx Isothermal exponential RNA amplification in complex mixtures
WO2002086167A1 (en) 2001-04-20 2002-10-31 The Penn State Research Foundation Methods for nucleic acid manipulation
US6929915B2 (en) 2001-04-20 2005-08-16 The Penn State Research Foundation Methods for nucleic acid manipulation
US20030143525A1 (en) 2001-04-20 2003-07-31 Benkovic Stephen J. Methods for nucleic acid manipulation
US20050059003A1 (en) 2001-08-20 2005-03-17 Tatsuji Enoki Nucleic and amplification methods
EP1420069A1 (en) 2001-08-20 2004-05-19 Takara Bio Inc. Nucleic acid amplification methods
WO2003027640A2 (en) 2001-09-28 2003-04-03 University Of Delaware Polymorphism detection and separation
WO2003038053A2 (en) 2001-11-01 2003-05-08 Gene Check, Inc. Reca assisted detection of mutations, single nucleotide polymorphisms and specific sequences
US20030108936A1 (en) 2001-11-01 2003-06-12 Wagner Robert E. RecA assisted detection of mutations, single nucleotide polymorphisms and specific sequences
US20080293045A1 (en) 2002-02-21 2008-11-27 Olaf Piepenburg Recombinase Polymerase Amplification
US7270981B2 (en) 2002-02-21 2007-09-18 Asm Scientific, Inc. Recombinase polymerase amplification
US7666598B2 (en) 2002-02-21 2010-02-23 Twistdx, Inc. Recombinase polymerase amplification
US20090017462A1 (en) 2002-02-21 2009-01-15 Asm Scientific, Inc. Recombinase polymerase amplification
US20100311127A1 (en) 2002-02-21 2010-12-09 TwistDix, Inc. Recombinase polymerase amplification
US20030219792A1 (en) 2002-02-21 2003-11-27 Armes Niall A. Recombinase polymerase amplification
WO2003072805A2 (en) 2002-02-21 2003-09-04 Asm Scientific, Inc. Recombinase polymerase amplification
CA2476481A1 (en) 2002-02-21 2003-09-04 Asm Scientific, Inc. Recombinase polymerase amplification
US20050112631A1 (en) 2002-02-21 2005-05-26 Olaf Piepenburg Recombinase polymerase amplification
US7399590B2 (en) 2002-02-21 2008-07-15 Asm Scientific, Inc. Recombinase polymerase amplification
US20040137456A1 (en) 2002-04-04 2004-07-15 Hiroki Yokota Method for identifying and characterizing individual dna molecules
US20030228611A1 (en) 2002-05-01 2003-12-11 President And Fellows Of Harvard College Nucleic acid memory device
WO2004007078A1 (en) 2002-07-12 2004-01-22 British Biocell International Limited Lateral flow assay device and method
US7252940B2 (en) 2002-08-21 2007-08-07 Epoch Biosciences, Inc. Abasic site endonuclease assay
US20040101893A1 (en) 2002-08-21 2004-05-27 Epoch Biosciences, Inc. Abasic site endonuclease assay
US7282328B2 (en) 2002-09-20 2007-10-16 New England Biolabs, Inc. Helicase dependent amplification of nucleic acids
WO2004027025A2 (en) 2002-09-20 2004-04-01 New England Biolabs, Inc. Helicase dependent amplification of nucleic acids
US20040224336A1 (en) 2003-03-11 2004-11-11 Gene Check, Inc. RecA-assisted specific oligonucleotide extension method for detecting mutations, SNPs and specific sequences
US20070265198A1 (en) 2003-05-15 2007-11-15 Vincent Fischetti Nucleic Acids and Polypeptides of C1 Bacteriophage and Uses Thereof
US20050136443A1 (en) 2003-10-10 2005-06-23 Aisin Seiki Kabushiki Kaisha Nucleic acid amplification method
EP1564306A2 (en) 2004-02-17 2005-08-17 Affymetrix, Inc. Methods for fragmenting and labeling DNA
WO2005118853A2 (en) 2004-06-01 2005-12-15 Asm Scientific, Inc. Recombinase polymerase amplification
US20070154914A1 (en) 2004-06-28 2007-07-05 Roche Molecular Systems, Inc. 2'-Terminator related pyrophosphorolysis activated polymerization
US20060110765A1 (en) 2004-11-23 2006-05-25 Wang Xiao B Detection of nucleic acid variation by cleavage-amplification (CleavAmp) method
US7435561B2 (en) 2005-07-25 2008-10-14 Asm Scientific, Inc. Methods for multiplexing recombinase polymerase amplification
WO2007096702A2 (en) 2005-07-25 2007-08-30 Asm Scientific, Inc. Methods for multiplexing recombinase polymerase amplification
US20070054296A1 (en) 2005-07-25 2007-03-08 Olaf Piepenburg Methods for multiplexing recombinase polymerase amplification
US8062850B2 (en) 2005-07-25 2011-11-22 Alere San Diego, Inc. Methods for multiplexing recombinase polymerase amplification
WO2008035205A2 (en) 2006-05-04 2008-03-27 Asm Scientific, Inc. Recombinase polymerase amplification
US20090029421A1 (en) 2006-05-04 2009-01-29 Olaf Piepenburg Recombinase polymerase amplification
WO2009105648A2 (en) 2008-02-22 2009-08-27 Great Basin Scientific Systems and methods for point-of care amplification and detection of polynucleotides

Non-Patent Citations (200)

* Cited by examiner, † Cited by third party
Adams et al., "Dissociation of RecA filaments from duplex DNA by the RuvA and RuvB DNA repair proteins," Proc. Natl. Acad. Sci. USA 91:9901-9905, 1994.
Alexseyev et al., "Genetic Characteristics of New recA Mutants of Escherichia coli K-12," J. Bacteriol., 178:2018-2024, 1996.
Amasino, "Acceleration of Nucleic Acid Hybridization Rate by Polyethylene Glycol," Anal. Biochem., 152:304-307, 1986.
Bains and Smith, "A Novel Method for Nucleic Acid Sequence Determination," J. Theor. Biol., 135:303-307, 1988.
Bar-Ziv and Libchaber, "Effects of DNA sequence and structure on binding of RecA to single-stranded DNA," PNAS USA, 98(16):9068-9073.
Baumann et al., "Purification of human Rad51 protein by selective spermidine precipitation," Mutat. Res., 384:65-72, 1997.
Benedict and Kowalczykowski, "Increase of the DNA Strand Assimiliation Activity of recA Protein by Removal of the C Terminus and Structure-Function Studies of the Resulting Protein Fragment," J. Biol. Chem., 263(30):15513-15520, 1988.
Benkovic et al., "Replisome-Mediated DNA Replication," Annu. Rev. Biochem., 70:181-208, 2001.
Bennett and Holloman, "A RecA Homologue in Ustilago maydis That Is Distinct and Evolutionarily Distant from Rad51 Actively Promotes DNA Pairing Reactions in the Absence of Auxiliary Factors," Biochemistry, 40:2942-2953, 2001.
Better and Helinski, "Isolation and Characterization of the recA Gene of Rhizobium meliloti," J. Bacteriol, 155:311-316, 1983.
Bianco and Weinstock, "Interaction of the RecA protein of Escherichia coli with single-stranded oligodeoxyribonucleotides," Nucleic Acids Research, 24(24):4933-4939, 1996.
Bianco et al., "DNA Strand Exchange Proteins: A Biochemical and Physical Comparison," Frontiers in Bioscience, 3:D570-D603, 1998.
Borjac-Natour et al., "Divergence of the mRNA targets for the Ssb proteins of bacteriophages T4 and RB69," Virology J., 1(4):1-14, 2004.
Bork et al., "RecA Protein Filaments Disassemble in the 5' to 3' Direction on Single-stranded DNA," J. Biol. Chem., 276:45740-45743, 2001.
Bork et al., "RecA Protein Filaments Disassemble in the 5′ to 3′ Direction on Single-stranded DNA," J. Biol. Chem., 276:45740-45743, 2001.
Bork et al., "The RecOR proteins modulate RecA protein function at 5' ends of single-stranded DNA," EMBO J., 20:7313-7322, 2001.
Bork et al., "The RecOR proteins modulate RecA protein function at 5′ ends of single-stranded DNA," EMBO J., 20:7313-7322, 2001.
Butler et al., "Investigating Structural Changes Induced by nucleotide Binding to RecA Using Difference FTIR," Biophysical J., 82(4):2198-2210, 2002.
Byrd and Raney, "Protein displacement by an assembly of helicase molecules aligned along single-stranded DNA," Nat. Struct. Mol. Biol., 11(6):531-538, 2004.
Cai, "An inexpensive and simple nucleic acid dipstick for rapid pathogen detection," LAUR #05-9067 of Los Alamos National Laboratory, Aug. 22, 2006.
Chan et al., "Effects of Polyethylene Glycol on Reverse Transcriptase and Other polymerase Activities," Biochim. Biophys. Acta., 606(2):353-361, 1980.
Compton, "Nucleic acid sequence-based amplification," Nature, 350:91-92, 1991.
Conklin and Drake, "Isolation and Characterization of conditional Alleles of bacteriophage T4 Genes uvsX and uvsY," Genetics, 107:505-523, 1984.
Cox et al., "A Simple and Rapid Procedure for the Large Scale Purification of the recA protein of Escherichia coli," J. Biol. Chem., 256:4676-4678, 1981.
Cox et al., "The importance of repairing stalled replication forks," Nature, 404:37-41, 2000.
Cromie and Leach, "Control of Crossing Over," Mol. Cell., 6:815-826. 2000.
Decker et al., "In Vitro Initiation of DNA Replication in Simian Virus 40 Chromosomes," J. Biol. Chem., 262(22):10863-10872, 1987.
Demidov, "Rolling-circle amplification in DNA diagnostics: the power of simplicity," Expert Rev. Mol. Diagn., 2(6):89-95, 2002.
Digard et al., "The Extreme C Terminus of Herpes Simplex Virus DNA Polymerase Is Crucial for Functional Interaction with Processivity Factor UL42 and for Viral Replication," J. Virol., 67(1):398-406, 1993.
Dillingham and Kowalczykowski, "A Step Backward in Advancing DNA Replication: Rescue of Stalled Replication Forks by RecG," Mol. Cell., 8:734-736, 2001.
Dong et al., "A coupled complex of T4 DNA replication helicase (gp41) and polymerase (gp43) can perform rapid and processive DNA strand-displacement synthesis," Proc. Natl. Acad. Sci. USA, 93:14456-14461, 1996.
Drmanac, et al., "Sequencing of Megabase Plus DNA by Hybridization: Theory of the Method," Genomics, 4:114-128, 1989.
Edwards et al., "Genetic Variation at Five Trimeric and Tetrameric Tandem Repeat Loci in Four Human Population Groups," Genomics, 12:241-253, 1992.
Eggler et al., "The C Terminus of the Escherichia coli RecA Protein Modulates the DNA Binding Competition with Single-stranded DNA-binding Protein," J. Biol. Chem., 278:16389-16396, 2003.
Eggleston and West, "Cleavage of Holliday Junctions by the Escherichia coli RuvABC Complex," J. Biol. Chem., 275:26467-26476, 2000.
Elias-Arnanz and Salas, "Bacteriophage ø29 DNA replication arrest caused by codirectional collisions with the transcription machinery," EMBO J., 16:5775-5783, 1997.
Ellis, "Macromolecular crowding: obvious but underappreciated," Trends in Biochem. Sci., 26(10):597-604, 2001.
Ellouze et al., "Evidence for elongation of the helical pitch of the RecA filament upon ATP and ADP binding using small-angle neutron scattering," Eur. J. Biochem., 23392):579-583, 1995.
Enright et al., The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA), Proc. Natl. Acad. Sci. USA, 99:7687-7692, 2002.
Extended European Search Report in corresponding Application No. 12767452.1, dated Nov. 26, 2014, pp. 1-7.
Fahy et al., "Self-sustained sequence replication (3SR): an isothermal transcription-based amplification system alternative to PCR," Genome Res, 1:25-33, 1991.
Feng Shen et al., "Digital PCR on a SlipChip," Internet Citation, Jan. 1, 2010, pp. 1-10.
Ferrari et al., "Co-operative Binding of Escherichia coli SSB Tetramers to Single-stranded DNA in the (SSB)35 Binding Mode," J. Mol. Biol, 236:106-123, 1994.
Formosa and Alberts, "DNA Synthesis Dependent on Genetic Recombination: Characterization of a Reaction Catalyzed by Purified Bacteriophage T4 Proteins," Cell, 47:793-806, 1986.
Formosa and Alberts, "Purification and Characterization of the T4 Bacteriophage uvsX Protein," J. Biol. Chem., 261:6107-6118, 1986.
Formosa et al., "Affinity purification of bacteriophage T4 proteins essential for DNA replication and genetic recombination," Proc. Natl. Acad. Sci. USA, 80:2442-2446, 1983.
Fu et al., "Dynamics of DNA-tracking by two sliding-clamp proteins," EMBO J., 15(16):4414-4422, 1996.
Fuller et al., "Enzymatic replication of the origin of the Escherichia coli chromosome," Proc. Natl. Acad. Sci. USA, 78(12):7370-7374, 1981.
Giedroc et al., "The Function of Zinc in Gene 32 Protein from T4," Biochem., 26:5251-5259, 1987.
Giedroc et al., "Zn(II) Coordination Domain Mutants of T4 Gene 32 protein," Biochem., 31:765-774, 1992.
Ginocchio, "Life Beyond PCR: Alternative Target Amplification Technologies for the Diagnosis of Infectious Diseases, Part II," Clin. Microbiol. Newsletter, 26(17):129-136, 2004.
Glover and McHenry, "The DNA Polymerase III Holoenzyme: An Asymmetric Dimeric Replicative Complex with Leading and Lagging Strand Polymerases," Cell., 105:925-934.
Goodman et al., "Cloning and expression in Escherichia coli of a recA-like gene from Bacteroides fragilis," Gene, 58:265-271, 1987.
Hacker and Alberts, "Overexpression, Purification, Sequence Analysis, and Characterization of the T4 Bacteriophage dda DNA Helicase," J. Biol. Chem., 267:20674-20681, 1992.
Hammond et al., "Evaluation of 13 Short Tandem Repeat Loci for Use in Personal Identification Applications," Am. J. Hum. Genetics, 55:175-189, 1994.
Harris and Griffith, "Formation of D Loops by the UvsX Protein of T4 Bacteriophage: A Comparison of the Reaction Catalyzed in the Presence or Absence of Gene 32 Protein," Biochem., 27:6954-6959, 1988.
Harris and Griffith, "UvsY Protein of Bacteriophage T4 is an Accessory Protein for in Vitro Catalysis of Strand Exchange," J. Mol. Biol., 206:19-27, 1989.
Harris and Griffith, "Visualization of the Homologous Pairing of DNA Catalyzed by the Bacteriophage T4 UvsX Protein," J. Biol. Chem., 262:9285-9292, 1987.
Harvey et al., "Characterization and applications of CataCleave probe in real-time detection assays," Anal. Biochem., 333(2):246-255, 2004.
Heid et al., "Real time quantitative PCR," Genome Res., 6(10):986-994, 1996.
Heyer and Kolodner, "Purification and Characteirzation of a Protein from Saccharomyces cerevisiae That Binds Tightly to Single-Stranded DNA and Stimulates a cognate Strand Exchange Protein," Biochem. 28:2856-2862, 1989.
Hickson et al., "A Temperature Sensitive RecA Protein of Escherichia coli," Mol. Gen. Genet., 184:68-72, 1981.
Higashimoto et al., "Discriminating between Varicella-Zoster Virus Vaccine and Wild-Type Strains by Loop-Mediated Isothermal Amplification," J. Clin. Microbiol., 46(8):2665-2670, 2008.
Hopp et al., "A Short Polypeptide Marker Sequence Useful for Recombinant Protein Identification and Purification," Biotech., 6:1204-1210, 1988.
Hsieh et al., "The synapsis event in the homologous pairing of DNAs: RecA recognizes and pairs less than one helical repeat of DNA," Proc. Natl. Acad. Sci. USA, 89:6492-6496, 1992.
Huang et al., "Relationship between Bacteriophage T4 and T6 DNA Topoisomerases," J. Biol. Chem., 260(15):8973-8977, 1985.
Huletsky et al., "New Real-Time PCR Assay for Rapid Detection of Methicillin-Resistant Staphylococcus aureus Directly from Specimens Containing a Mixturre of Staphylococci," J. Clin. Microbiol., 42:1875-1884, 2004.
International Search Report and Written Opinion, for the corresponding PCT Application No. PCT/US2012/032508, dated Jul. 6, 2012, Not filed.
Ischenko and Saparbaev, "Alternative nucleotide incision repair pathway for oxidative DNA damage," Nature, 415(6868):183-187, 2002.
Ishmael et al., "Protein-Protein Interactions in the Bacteriophage T4 Replisome," J. Biol. Chem., 278(5):3145-3152, 2003.
Jarvis et al., "'Macromolecular Crowding': Thermodynamic Consequences for Protein-Protein Interactions with in the T4 DNA Replication Complex," J. Biol. Chem., 265(25):15160-15167, 1990.
Kaboord and Benkovic, "Rapid assembly of the bacteriophage T4 core replication complex on a linear primer/template construct," Proc. Natl. Acad. Sci. USA, 90:10881-10885, 1993.
Kaiser et al., "A Comparison of Eubacterial and Archaeal Structure-specific 5′-Exonucleases," J. Biol. Chem., 274(30):21387-21394, 1999.
Kaiser et al., "A Comparison of Eubacterial and Archaeal Structure-specific 5'-Exonucleases," J. Biol. Chem., 274(30):21387-21394, 1999.
Kato and Kuramitsu, "RecA Protein from an Extremely Thermophilic Bacterium, Thermus thermophiles HB8," J. Biochem., 114:926-929, 1993.
Katz and Bryant, "Interdependence of the Kinetics of NTP Hydrolysis and the Stability of the RecA-ssDNA Complex," Biochem., 40:11082-11089, 2001.
Kelman and O'Donnell, "DNA Polymerase III Holoenzyme: Structure and Function of a Chromosomal Replicating Machine," Annu. Rev. Biochem., 64:171-2000.
Khrapko et al., "An oligonucleotide hybridization approach to DNA sequencing," FEBS Lett., 256:118-122, 1989.
Komori et al., "Both RadA and RadB Are Involved in Homologous Recombination in Pyrococcus furiosus," J. Biol. Chem., 275:33782-33790, 2000.
Kool, "Replacing the Nucleobases in DNA with Designer Molecules," Acc. Chem. Res., 35:936-943, 2002.
Kowalczykowski et al., "Effects of the Escherichia coli SSB Protein on the Binding of Escherichia coli RecA Protein to Single-stranded DNA-Demonstration of Competitive Binding and the Lack of a Specific Protein-Protein Interaction," J. Mol. Biol., 193:81-95, 1987.
Kreader, "Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein," Appl. Env. Microbiol., 62:1102-1106, 1996.
Kuil et al., "A Refined Calculation of the Solution Dimensions of the Complex Between gene 32 Protein and Single Stranded DNA Based on Estimates of the Bending Persistence Length," J. Biomol. Struct. Dyn. 7(4):943-957, 1990.
Kuil et al., "The internal dynamics of gene 32 protein-DNA complexes studied by quasi-elastic light scattering," Biophys. Chem., 32:211-227, 1988.
Kuramitsu et al., "A Large-Scale Preparation and Some Physicochemical Properties of RecA Protein," J. Biochem., 90:1033-1045, 1981.
Kurumizaka et al., "A Chimeric RecA Protein Exhibits Altered Double-stranded DNA Binding," J. Biol. Chem., 269:3068-3075, 1994.
Lavery and Kowalczykowski, "A Postsynaptic Role for Single-stranded DNA-binding Protein in recA Protein-promoted DNA Strand Exchange," J. Biol. Chem., 267(13):9315-9320, 1992.
Lavery and Kowalczykowski, "Enhancement of recA Protein-promoted DNA Strand Exchange Activity by Volume-occupying Agents," J. Biol. Chem., 267:9301-9314, 1992.
LeBowitz and McMacken, "The bacteriophage lambda omicron and P protein initiators promote the replication of single-stranded DNA," 12(7):1-20, 1984.
LeBowitz and McMacken, "The bacteriophage λ ο and P protein initiators promote the replication of single-stranded DNA," 12(7):1-20, 1984.
Lerman, "A Transition to a Compact Form of DNA in Polymer Solutions," Proc. Nat. Acad. Sci. USA, 68(8):1886-1890, 1971.
Levin et al., "Homogeneous Escherichia coli Endonuclease IV," J. Biol. Chem., 263:8066-8071, 1988.
Liu et al., "The Ordered Assembly of the øX174-type Primosome," J. Biol. Chem., 271:15656-15661, 1996.
Lohman and Ferrari, "Escherichia coli Single-Stranded DNA-Binding Protein: Multiple DNA-Binding Modes and Cooperativities," Annu. Rev. Biochem., 63:527-570, 1994.
Lovett and Roberts, "Purification of a RecA Protein Analogue from Bacillus subtilis," J. Biol. Chem., 260:3305-3313, 1985.
Lusetti et al., "Magnesium Ion-dependent Activation of the RecA Protein Involves the C Terminus," J. Biol. Chem., 278(18):16381-16388, 2003.
Lutz-Freyermuth et al., "Quantitative determination that one of two potential RNA-binding domains of the A protein component of the U1 small nuclear ribonucleoprotein complex binds with high affinity to stem-loop II of U1 RNA," Proc. Natl. Acad. Sci. USA, 87:6393-6397, 1990.
Lysov et al., "Establishing Nucleotide Sequence of DNA using Oligonucleotide Hydridization. Novel Method," SSSR 303:1508-1511, 1988 (English translation).
Maeshima et al., "Purification and characterization of XRad51.1 protein, Xenopus RAD51 homologue: recombinant XRad51.1 promotes strand exchange reaction," Genes Cells, 1:1057-1068, 1996.
Maki et al., "DNA Polymerase III Holoenzyme of Escherichia coli," J. Biol. Chem., 263(14):6570-6578, 1988.
Malkov and Camerini-Otero, Photocross-links between Single-stranded DNA and Escherichia coli RecA Protein Map to Loops L1 (Amino Acid Residues 157-164) and L2 (Amino Acid Residues 195-209),: J. Biol. Chem., 270(50):30230-30233, 1995.
Marians, "PriA: At the Crossroads of DNA Replication and Recombination," Prog. Nucleic Acid Res. Mol. Biol., 63:39-67, 1999.
Marians, "Prokaryotic DNA Replication," Annu. Rev. Biochem., 61:673-719, 1992.
Marras et al., "Multiplex detection of single-nucleotide variations using molecular beacons," Genet. Anal. Biomolec. Eng., 14:151-156, 1999.
Martin et al., "GAP Domains Responsible for Ras p21-Dependent Inhibition of Muscarinic Atrial K+cchannel Currents," Science, 255:192-194, 1992.
Maxam and Gilbert, "A new method for sequencing DNA," Proc. Natl. Acad. Sci. USA, 74:560-564, 1877.
Mazin and Kowalczykowski, "The function of the secondary DNA-binding site of RecA protein during DNA strand exchange," Proc. Natl. Acad. Sci. USA, 74:560-564, 1977.
McGlynn and Lloyd, "RecG helicase activity at three- and four-strand DNA structures," Nucl. Acid Res., 27:3049-3056, 1999.
McGlynn et al., "Characterisation of the catalytically active form of RecG helicase," Nucl. Acid Res., 28:2324-2332, 2000.
Minton, "The Influence of Macromolecular Crowding and Macromolecular Confinement on Biochemical Reactions in Physiological Media," J. Biol. Chem., 276(14):10577-10580, 2001.
Mitra and Church, "In situ localized amplification and contact replication of many individual DNA molecules," Nucl. Acids Res., 27(24):e34i-e34vi.
Mizuuchi, "In Vitro Transposition of Bacteriophage Mu: A Biochemical Approach to a Novel Replication Reaction," Cell, 35:785-794, 1983.
Morel et al., "Recombination-dependent Repair of DNA Double-strand Breaks with Purified Proteins from Escherichia coli," J. Biol. Chem., 272:17091-17096, 1997.
Morrical and Alberts, "The UvsY Protein of Bacteriophage T4 Modulates Recombination-dependent DNA Synthesis in Vitro," J. Biol. Chem., 265:15096-15103, 1990.
Morrical et al., "Amplification of Snap-back DNA Synthesis Reactions by the uvsX Recombinase of Bacteriophage T4," J. Biol. Chem., 266:14031-14038, 1991.
Morris and Raney, "DNA Helicases Displace Streptavidin from Biotin-Labeled Oligonucleotides," Biochem., 38(16):5164-5171, 1999.
Morrison et al., "Quantificationo f Low-Copy Transcripts by Continuous SYBR Green I Monitoring during Amplification," BioTechniques, 24:954-962, 1998.
Mosig et al., "Two recombination-dependent DNA replication pathways of bacteriophage T4, and their roles in mutagenesis and horizontal gene transfer," Proc. Natl. Acad. Sci. USA, 98:8306-8311, 2011.
Nadeau et al., "Real-Time, Sequence-Specific Detection of Nucleic Acids during Strand Displacement Amplification," Anal. Biochem., 276(2):177-187, 1999.
Nadler et al., "A Novel Function for Zinc(II) in a Nucleic Acid-binding Protein," J. Biol. Chem., 265(18):10389-10394, 1990.
Nagai et al., "Additive Effects of Bovine Serum Albumin, Dithiothreitol, and Glycerol in PCR," 44:157-163, 1998.
Naimushin et al., "Effect of Polyethylene Glycol on the Supercoiling Free Energy of DNA," Biopolymers, 58(2):204-217, 2001.
Ng and Marians, "The Ordered Assembly of the øX174-type Primosome," J. Biol. Chem., 271:15642-15648, 1996.
Ng and Marians, "The Ordered Assembly of the øX174-type Primosome," J. Biol. Chem., 271:15649-15655, 1996.
Okazaki and Kornberg, "Enzymatic Synthesis of Deoxyribonucleic Acid," J. Biol. Chem., 239:259-268, 1964.
Paulus and Bryant, "Time-Dependent Inhibition of recA Protein-Catalyzed ATPHydrolysis by ATPyS: Evidence for a Rate-Determining Isomerization of the recA-ssDNA Complex," Biochem., 36:7832-7838, 1997.
Pevzner, "1-Tuple DNA Sequencing: Computer Analysis," J. Biomol. Struct. Dyn., 7:63-73, 1989.
Pham et al., "A model for SOS-lesion-targeted mutations in Escherichia coli," Nature, 409:366-370, 2001.
Piepenburg et al., "DNA Detection Using Recombination Proteins," PLOS Biology, 4(7):1115-1121, 2006.
Pierre and Paoletti, "Purification and Characterization of recA Protein from Salmonella typhimurium," J. Biol. Chem., 258:2870-2874, 1983.
Podust et al., "Replication Factor C Disengages from Proliferating Cell Nuclear Antigen (PCNA) upon Sliding Clamp Formation, and PCNA Itself Tethers DNA Polymerase δ to DNA," J. Biol. Chem., 273(48):31992-31999, 1998.
Pomp and Medrano, "Organic Solvents as Facilitators of Polymerase chain Reaction," Biotechniques, 10(1):58-59, 1991.
Puthawibool et al., "Detection of shrimp infectious myonecrosis virus by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick," J. Virol. Methods, 156(1-2):27-31, 2009 (Abstract Only).
Qiu and Giedroc, "Effects of Substitution of Proposed Zn(II) Ligand His81 or His64 in Phage T4 Gene 32 Protein: Spectroscopic Evidence for a Novel Zinc Coordination Complex," Biochem., 33(26):8139-8148, 1994.
Raap et al., "Synthesis and Proton-NMR Studies of Oligonucleotides Containing and Apurinic (AP) Site," J. Biom. Structure & Dynamics, 5(2):219-247, 1987.
Raap, "Advances in fluorescence in situ hybridization," Mutation Research, 400:287-298, 1998.
Rashid et al., "RecA/Rad51 Homolog from Thermococcus kodakaraensis KOD1," Methods Enzymol., 334:261-270, 2001.
Reddy et al., "Assembly of a functional replication complex without ATP hydrolysis: A direct interaction of bacteriophage T4 gp45 with T4 DNA polymerase," Proc. Natl. Acad. Sci. USA, 90:3211-3215, 1993.
Reddy et al., "Using Macromolecular Crowding Agents to Identify Weak Interactions within DNA Replication Complexes," Methods Enzymol., 262:466-476, 1995.
Riddles and Lehman, "The Formation of Plectonemic Joints by the recA Protein of Escherichia coli," J. Biol. Chem., 260:170-173, 1985.
Rivas et al., "Life in a crowded world-Workshop on the Biological Implications of Macromolecular Crowding," EMBO Reports, 5(1):23-27, 2004.
Ronaghi et al., "A Sequencing Method Based on Real-Time Pyrophosphate," Science, 281:363-365, 1998.
Rosselli and Stasiak, "Energetics of RecA-mediated Recombination Reactions Without ATP Hydrolysis RecA Can Mediate Polar Strand Exchange But Is Unable to Recycle," J. Mol. Biol., 216:335-352, 1990.
Roux, "Optimization and troubleshooting in PCR," Genome Res., 4:S185-S194, 1995.
Saiki et al., "Primer-Directed Enzymatic Amplification of DNA with a Thermostable DNA Polymerase," Science, 239:487-491, 1988.
Salinas and Benkovic, "Characterization of bacteriophage T4-coordinated leading- and lagging-strand synthesis on a minicircle substrate," PNAS, 97(13):7196-7201, 2000.
Salinas et al., "Homology Dependence of UvsX Protein-catalyzed Joint Molecule Formation," J. Biol. Chem., 270:5181-5186.
Sanders et al., "Dual targets of a transcriptional activator that tracks on DNA," EMBO J., 16(11):3124-3132, 1997.
Sanders et al., "Use of a macromolecular crowding agent to dissect interactions and define functions in transcriptional activation by a DNA-tracking protein: Bacteriphage T4 gene 45 protein and late transcription," Proc. Natl. Acad. Sci. USA, 91:7703-7707, 1994.
Sanger et al., "DNA sequencing with chain-terminating inhibitors," Proc. Natl. Acad. Sci. USA, 75:5463-5467, 1977.
Savva and Pearl, "Cloning and Expression of the Uracil-DNA Glycosylase Inhibitor (UGI) From Bacteriophage PBS-1 and Crystallization of a Uracil-DNA Glycosylase-UGI Complex," Proteins, 22(3):287-289, 1995.
Scheerhagen et al., "Binding Stoichiometry of the Gene 32 Protein of Phage T4 in the Complex with Single Stranded DNA Deduced from Boundary Sedimentation," J. Biomol. Struct. Dyn., 3:887-898, 1986.
Scheerhagen et al., "Hydrodynamic studies of a DNA-protein complex-Dimensions of the complex of single-stranded 145 base DNA with gene 32 protein of phage T4 deduced from quasi-elastic light scattering," FEBS Lett., 184(2):221-225, 1985.
Shan et al., "RecA Protein Filaments: End-dependent Dissociation from ssDNA and Stabilization by RecO and RecR Proteins," J. Mol. Biol., 265:519-540, 1997.
Shibata et al, "Homologous pairing in genetic recombination: Complexes of recA protein and DNA," Proc. Natl. Acad. Sci. USA, 76(10):5100-5104, 1979.
Shibata et al., "Homologous pairing in genetic recombination: Formation of D loops by combined action of recA protein and a helix-destabilizing protein," Proc. Natl. Acad. Sci. USA, 77:2606-2610, 1980.
Shibata et al., "Purified Escherichia coli recA protein catalyzes homologous pairing of superhelical DNA and single-stranded fragments," Proc. Natl. Acad. Sci. USA, 76:1638-1642, 1979.
Singleton et al., "Structural Analysis of DNA Replication Fork Reversal by RecG," Cell, 107:79-89, 2001.
Skinner et al., "Use of the Glu-Glu-Phe C-terminal Epitope for Rapid Purification of the Catalytic Domain of Normal and Mutant ras GTPase-activating Proteins," J. Biol. Chem., 266:14163-14166, 1991.
Southern et al., "Analyzing and Comparing Nucleic Acid sequences by Hybridization to Arrays of Oligonucleotides: Evaluation Using Experimental Models," Genomics, 13:1008-1017, 1992.
Spies et al., "The RadA protein from a hyperthermophilic archaeon Pyrobaculum islandicum is a DNA-dependent ATPase that exhibits two disparate catalytic modes, with a transition temperature at 75° C.," Eur. J. Biochem., 267:1125-1137, 2000.
Steffen and Bryant, "Purification and Characterization of the RecA Protein from Streptococcus pneumoniae," Arch. Biochem. Biophys., 382:303-309, 2000.
Story et al., "Structural Relationship of Bacterial RecA Proteins to Recombination Proteins from Bacteriophage T4 and Yeast," Science, 259(5103):1892-1896, 1993.
Sun and Shamoo, "Biochemical characterization of Interactions between DNA Polymerase and Single-stranded DNA-binding Protein in Bacteriophage RB69," J. Biol. Chem., 278(6):3876-3881.
Takeshita et al., "Oligodeoxynucleotides Containing Synthetic Abasic Sites," J. Biol. Chem., 262:10171-10179, 1987.
Tang et al., "Roles of E. coliDNA polymerases IV and V in lesion-targeted and untargeted SOS mutagenesis," Nature, 404:1014-1018, 2000.
Tinker-Kulberg et al., "A direct interaction between a DNA-tracking protein and a promoter recognition protein: implications for searching DNA sequence," EMBO J., 15(18):5032-5039, 1996.
Tissier et al., "Purification and Characterization of a DNA Strand Transferase from Broccoli," Plant Physiol., 108:379-386, 1995.
Tracy and Kowalczykowski, "In vitro selection of preferred DNA pairing sequences by the Escherichia coli RecA protein," Genes Dev., 10:1890-1903, 1996.
Tsurimoto and Matsubara, "Replication of λ dv plasmid in vitro promoted by purified λ ο and P proteins," Proc. Natl. Acad. Sci. USA, 79:7639-7643, 1982.
Tyagi et al., "Multicolor molecular beacons for allele discrimination," Nature Biotechnol., 16:49-53, 1998.
Van Ness et al., "Isothermal reactions for the amplification of oligonucleotides," Proc. Natl. Acad. Sci. USA, 100(8):4504-4509, 2003.
Villemain et al., "Mutations in the N-terminal Cooperativity Domain of Gene 32 protein Alter Properties of the T4 DNA Replication and Recombination Systems," J. Biol. Chem., 275:31496-31504, 2000.
Vincent et al., "Helicase-dependent isothermal DNA amplification," EMBO Rep., 5:795-800, 2004.
Volodin and Camerini-Otero, "Influence of DNA Sequence on the Positioning of RecA Monomers in RecA-DNA Cofilaments," J. Biol. Chem., 277(2):1614-1618, 2002.
Volodin et al., "Phasing of RecA monomers on quasi-random DNA sequences," FEBS Letters, 546:203-208, 2003.
Voloshin et al., "Homologous DNA Pairing Promoted by a 20-Amino Acid Peptide Derived from RecA," Science, 272:868-872, 1996.
Voloshin et al., "The Homologous Pairing Domain of RecA also Mediates the Allosteric Regulation of DNA Binding and ATP Hydrolysis: A Remarkable Concentration of Functional Residues," J. Mol. Biol., 303(5):709-720, 2000.
Waidner, et al., "Domain effects on the DNA-interactive properties of bacteriophage T4 gene 32 protein," J. Biol. Chem., 276:2509-16 (2001).
Walker et al., "Distantly related sequences in the α- and βsubunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold," EMBO J., 1:945-951, 1982.
Walker et al., "Isothermal in vitro amplification of DNA by a restriction enzyme/DNA polymerase system," Proc. Natl. Acad. Sci. USA, 89:392-396, 1992.
Walker, "Empirical aspects of strand displacement amplification," Genome Res., 3:1-6, 1993.
Wang and Mosbaugh, "Uracil-DNA Glycosylase Inhibitor of Bacteriophage PBS2: Cloning and Effects of Expression of the Inhibitor Gene in Escherichia coli," J. Bacteriol., 170(3):1082-1091, 1988.
Wang et al., "Modular Organization of T4 DNA Polymerase," J. Biol. Chem., 270(44):26558-26564, 1995.
Webb et al., "An Interaction between the Escherichia coli RecF and RecR Proteins Dependent on ATP and Double-stranded DNA," J. Biol. Chem., 270:31397-31404, 1995.
Webb et al., "ATP Hydrolysis and DNA Binding by the Escherichia coli RecF Protein," J. Biol. Chem., 274:15367-15374, 1999.
Webb et al., "Recombinational DNA Repair: The RecF and RecR Proteins Limit the Extension of RecA Filaments beyond Single-Strand DNA Gaps," Cell, 91:347-356, 1997.
West et al., "Purification and Properties of the recA Protein of Proteus mirabilis," J. Biol. Chem., 258:4648-4654, 1983.
Wetmur et al, "Cloning, Sequencing, and Expressiono f RecA Proteins from Three Distantly Related Thermophilic Eubacteria," J. Biol. Chem., 269:25928-25935, 1994.
Wittwer et al., "Continuous Fluorescence Monitoring of Rapid Cycle DNA Amplification," Biotechniques, 22(1):130-1, 134-138, 1997.
Xu and Marians, "A Dynamic RecA Filament Permits DNA Polymerase-catalyzed Extension of the Invading Strand in Recombination Intermediates," J. Biol. Chem., 277:14321-14328, 2002.
Yang et al., "Comparison of Bacteriophage T4 and UvsX and Human Rad51 Filaments Suggests that RecA-like Polymers May Have Evolved Independently," J. Mol. Biol., 312(5):999-1009, 2001.
Yeh et al., "Divergence of DNA Replication Gene Cluster in the T4-Related Bacteriophage RB69," J. Bacteriol., 180(8):2005-2013, 1998.
Yonesaki et al., "Purification and some of the functions of the product of bacteriophage T4 recombination genes, uvsX and uvsY ," Eur. J. Biochem., 148:127-134, 1985.
Young et al., "The Kinetic Mechanism of Formation of the Bacteriophage T4 DNA polymerase Sliding Clamp," J. Mol. Biol., 264:440-452, 1996.
Zhang et al., "Ramification Amplification: A Novel Isothermal DNA Amplification Method," Mol. Diagn., 6:141-150, 2001.
Zimmerman and Harrison, "Macromolecular crowding increases binding of DNA polymerase to DNA: An adaptive effect," Proc. Natl. Acad. Sci. USA, 84(7):1871-1875, 1987.
Zimmerman and Minton, "Macromolecular Crowding: Biochemical, Biophysical, and Physiological Consequences," Annu. Rev. Biophys. Biomol. Struct., 22:27-65, 1993.
Zimmerman and Trach, "Macromolecular crowding extends the range of conditions under which DNA polymerase is functional," Biochim. Biophys. Acta., 949:297-304, 1988.
Zinchenko and Yoshikawa, "Na+Shows a Markedly Higher Potential than K+in DNA Compaction in a Crowded Environment," Biophysical Journal, 88:4118-4123, 2005.

Also Published As

Publication number Publication date Type
CN103476940B (en) 2016-07-13 grant
CN103476940A (en) 2013-12-25 application
JP2014516512A (en) 2014-07-17 application
CA2831140A1 (en) 2012-10-11 application
JP5961247B2 (en) 2016-08-02 grant
US20150024397A1 (en) 2015-01-22 application
EP2694666A1 (en) 2014-02-12 application
EP2694666B1 (en) 2018-05-23 grant
JP6209638B2 (en) 2017-10-04 grant
JP2016119912A (en) 2016-07-07 application
US20120258456A1 (en) 2012-10-11 application
US20160068898A1 (en) 2016-03-10 application
EP3202918A1 (en) 2017-08-09 application
WO2012138989A1 (en) 2012-10-11 application
CA2831140C (en) 2017-11-07 grant
CN105907846A (en) 2016-08-31 application
US9719132B2 (en) 2017-08-01 grant
US8809021B2 (en) 2014-08-19 grant
EP2694666A4 (en) 2014-12-24 application

Similar Documents

Publication Publication Date Title
Dressman et al. Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations
Malorny et al. Standardization of diagnostic PCR for the detection of foodborne pathogens
Ambrose et al. Single molecule fluorescence spectroscopy at ambient temperature
Li et al. A new class of homogeneous nucleic acid probes based on specific displacement hybridization
Kurata et al. Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer
Hwang et al. Protein induced fluorescence enhancement as a single molecule assay with short distance sensitivity
US7211390B2 (en) Method of sequencing a nucleic acid
Tang et al. Real-time investigation of nucleic acids phosphorylation process using molecular beacons
Knemeyer et al. Probes for detection of specific DNA sequences at the single-molecule level
US20030068629A1 (en) Apparatus and method for sequencing a nucleic acid
Brewer et al. Protamine-induced condensation and decondensation of the same DNA molecule
Weile et al. Current applications and future trends of molecular diagnostics in clinical bacteriology
US20110217712A1 (en) Emulsion chemistry for encapsulated droplets
Kapanidis et al. Alternating-laser excitation of single molecules
US7473767B2 (en) Methods for detection and quantification of analytes in complex mixtures
US20030105320A1 (en) Affinity-shifted probes for quantifying analyte polynucleotides
Nilsson et al. Real‐time monitoring of rolling‐circle amplification using a modified molecular beacon design
US5643728A (en) Method of marking a liquid
van Mameren et al. See me, feel me: methods to concurrently visualize and manipulate single DNA molecules and associated proteins
US8048627B2 (en) Method and compositions for detection and enumeration of genetic variations
US7556922B2 (en) Motion resolved molecular sequencing
US20080305481A1 (en) Systems and methods for multiplex analysis of pcr in real time
Xiao et al. Rapid DNA mapping by fluorescent single molecule detection
Preus et al. Advances in Quantitative FRET‐Based Methods for Studying Nucleic Acids
Spiro et al. A bead-based method for multiplexed identification and quantitation of DNA sequences using flow cytometry

Legal Events

Date Code Title Description
AS Assignment



AS Assignment



Effective date: 20150618

AS Assignment



Effective date: 20151113

CC Certificate of correction
AS Assignment



Effective date: 20171003



Effective date: 20171003



Effective date: 20171003



Effective date: 20171003



Effective date: 20171003



Effective date: 20171003



Effective date: 20171003



Effective date: 20171003