WO1999041393A1 - Insecticidal peptides - Google Patents

Abstract

Insecticidal peptides comprising the amino acid sequence CX?1X2X3RECGSCX4CNX5WKGKCEX6¿ (SEQ ID NO 1), where X?1, X2, X3, X4, X5 and X6¿ are any amino acid; or a fragment thereof, or a homologue or variant or derivative of any of these are described and claimed together with nucleotide sequences encoding these peptides. They may be applied as insecticidal compounds in the form of compositions, or expressed in host cells in particular plant cells. Transgenic plants which express peptides of the invention are described.

Description

- 1 -

INSECTICIDAL PEPTIDES

This invention relates to insecticidal peptides and DNA sequences encoding them, processes for their manufacture and use, and transgenic plants transformed with constructs encoding said peptides. In particular the invention relates to insecticidal peptides isolable from the genus Beauveria.

Many fungi are pathogenic to insects and amongst the best studied is the genus Beauveria (Fungi Imperfecti, Moniliales). Strains of Beauveria bassiana have been used for many years as effective biological control agents and are known to produce a range of insecticidal cyclic depsipeptides such as beauvericin and bassianolide. These toxins are thought to play a role in the pathogenicity of the fungus. Beauveria brongniartiii is another facultative but highly virulent parasite of insects (de Hoog, G.S. (1972) The Genera Beauveria, Isaria, Tritirachium and Acrodontium gen nov. Studies in Mycology 1: 1-41.)

Very little work has, however, been carried out looking for gene-encoded insecticidal peptides from entomopathogenic fungi.

The applicants have now purified new potent orally active insecticidal peptides from strains of Beauveria spp. in particular Beauveria bassiana and Beauveria brongniartii and identified a family of related peptides by molecular genetic techniques.

The present invention provides an insecticidal peptide comprising the amino acid sequence

CX1X2X3RECGSCX4CNX5 WKGKCEX6 (SEQ ID NO 1 )

where XI, X², X³, X⁴, X⁵ and X⁶ are any amino acid; or a fragment thereof, or a homologue, variant or derivative of any of these.

Suitably χι is A or T.

X² is suitably T or S.

Examples of X³ include D or N.

X4 is suitably H or S. Suitably X5 is N or S.

Particular examples of X⁶ include N or E. - 2 -

The peptide suitably has at least seven additional amino acids at the 5' end thereof, and these are of sequence

FCPVGKT (SEQ ID NO 2) or a fragment thereof, or a homologue, variant or derivative of any of these.

In a preferred embodiment, there is provided an insecticidal peptide comprising the amino acid sequence

FCPVGKTCATDRECGSCHCNNWKGKCEN (SEQ ID NO 3)

or a fragment thereof, or a homologue, variant or derivative of any of these. SEQ ID NO 3 is a peptide derivable from Beauveria bassiana which has been designated EF40.

In a further preferred embodiment, the insecticidal peptide comprises the amino acid sequence X7χsχ9χιoχι ιχi²X-³CSSNRECGSCSCNSWKGKCEE (SEQ ID NO 4) or a fragment thereof, or a homologue, variant or derivative of any of these, where χ7χ8χ9χιoχnχi2χi3 comprises SEQ ID NO 2 or a homologue, variant or derivative thereof. SEQ ID NO 4 is a peptide derivable from Beauveria brongniartii which has been designated EF40'. As used herein the expression "fragment" refers to any portion of the given amino acid sequence which has insecticidal activity either alone or when combined with other portions of the amino acid sequence.

The expression "homologues" as used herein refers to any peptide which has some amino acids in common with the given sequence. Suitably at least 60% of the amino acids will be similar, more suitably at least 70%, preferably at least 80%, more preferably at least

90% and most preferably at least 95% of amino acids will be similar to the corresponding amino acid in the given sequence.

As used herein the term "similar" is used to denote sequences which when aligned have similar (identical or conservatively replaced) amino acids in like positions or regions, where identical or conservatively replaced amino acids are those which do not alter the activity or function of the protein as compared to the starting protein. For example, two - 3 -

amino acid sequences with at least 85% similarity to each other have at least 85% similar (identical or conservatively replaced amino acid residues) in a like position when aligned optimally allowing for up to 3 gaps, with the proviso that in respect of the gaps a total of not more than 15 amino acid resides is affected. The degree of similarity may be determined using methods well known in the art (see, for example, Wilbur, W.J. and Lipman, D.J. "Rapid Similarity Searches of Nucleic Acid and Protein Data Banks." Proceedings of the National Academy of Sciences USA 80, 726-730 (1983) and Myers E.and Miller W. "Optimal Alignments in Linear Space". Comput. Appl. Biosci. 4:11-17(1988)). One programme which may be used in determining the degree of similarity is the MegAlign Lipman-Pearson one pair method (using default parameters) which can be obtained from DNAstar Inc, 1228, Selfpark Street, Madison, Wisconsin, 53715, USA as part of the Lasergene system.

Amino acids which differ from the basic sequence may be conservatively or non- conservatively substituted. A conservative substitution is to be understood to mean that the amino acid is replaced with an amino acid with broadly similar chemical properties. In particular conservative substitutions may be made between amino acids with the following groups:

(i) Alanine, Serine, Glycine and Threonine;

(ii) Glutamic acid and Aspartic acid; (iii) Arginine and Lysine;

(iv) Asparagine and Glutamine;

(v) Isoleucine, Leucine, Valine and Methionine;

(vi) Phenylalanine, Tyrosine and Tryptophan.

In general, more conservative than non-conservative substitutions will be possible without destroying the insecticidal properties of the compounds. Suitable homologues may be determined by testing insecticidal properties of the peptide using routine methods, for example as illustrated hereinafter.

The term "variant" as used herein includes experimentally generated variants or members of a family of related naturally-occurring peptides as may be identified by molecular genetic techniques. Such techniques are described for example in US Patent No. 5,605,793, US Patent No. 5,811,238 and US Patent No 5,830,721, the content of which is - 4 -

incorporated herein by reference. In essence this technique involves expression of the parental gene in a microbial expression system such as Escherichia coli. The particular system selected must be validated and calibrated to ensure that biologically active peptides are expressed, which may be readily achieved using a in vivo bioassay. The gene, or preferably a collection of related genes from different species, may be subject to mutagenic polymerase chain reaction (PCR) as is known in the art. Fragmentation of the products and subsequent repair using PCR leads to a series of chimeric genes reconstructed from parental variants. These chimeras are then expressed in the microbial system which can be screened in the usual way to determine active mutants, which may then be isolated and sequenced. Reiteration of this molecular evolution DNA shuffling cycle may lead to progressive enhancement of the desired gene properties. The advantage of a technique of this nature is that it allows a wide range of different mutations, including multi-mutation block exchanges, to be produced and screened.

Particular variants are those derivable from peptides of SEQ ID NO 1 when preceded by SEQ ID NO 2 or homologues thereof, in particular those isolable from Beauveria spp. . Other particular variants are those which are experimentally generated using for example the molecular evolution techniques. Preferably such variants will have improved insecticidal activity or function as compared to the native sequences. Suitable improvements may be in relation to the intrinsic specific activity of the protein, the specificity or target range against which the peptide is active or by altering a physical property such as stability.

In a further aspect, the invention provides the use of a peptide or peptides comprising SEQ ID NO 1, and in particular SEQ ID NO 1 preceded by SEQ ID NO 2, in the production of other insecticidal variants using molecular evolution and/or DNA shuffling methods. Other variants may be identified or defined using bioinformatics systems. An example of such a system is the FASTA method of W.R. Pearson and D.J. Lipman PNAS (1988) 85:2444-2488. This method provides a rapid and easy method for comparing protein sequences and detecting levels of similarity and is a standard tool, used by molecular biologists. Such similar sequences may be obtained from natural sources, through molecular evolution or by synthetic methods and comparisons made using this method to arrive at "opt scores" which are indicative of the level of similarity between the proteins. - 5 -

Particular variants of the invention will comprise insecticidal peptides with an amino acid sequence with a FASTA opt score (as defined in accordance with FASTA version 3.0t82 November 1, 1997) against SEQ ID NO 3 of greater than 102, for example in excess of 130, more preferably in excess of 150 and most preferably in excess of 190. Other variants of the invention will comprise insecticidal peptides with an amino acid sequence with a FASTA opt score (as defined in accordance with FASTA version 3.0t82 November 1, 1997) against SEQ ID NO 4 of greater than 89, for example in excess of 130, more preferably in excess of 150 and most preferably in excess of 190.

Variants which give FASTA scores in excess of 199 when compared with either SEQ ID NO 3 or SEQ ID NO 4 are particularly preferred.

With these constraints in mind, a skilled person would be able to isolate other members of the family of peptides, for example by designing probes or primers based upon the sequences based upon SEQ ID NO 3 or NO 4 but modified within the limits of the FASTA opt score range. These probes could then be used to screen libraries such as cDNA or genomic libraries using conventional methods, in particular those derived from fungal species, in order to isolate other family members. Hybridisation conditions used during these screening exercises are either low or high stringency, preferably high stringency conditions as are routinely used in the art (see for example "Molecular Cloning, A Laboratory Manual" by Sanbrook et al, Cold Spring Harbor Laboratory Press, N.Y. ) and include the conditions described below in relation to the isolation of naturally occuring variants.

Once found other family members could also be subject to molecular evolution techniques or DNA shuffling as described herein, in order to improve the properties thereof. All peptides obtained in this way should be regarded as a variant within the ambit of the present invention.

The term "derivative" relates to peptides which have been modified for example by using known chemical or biological methods.

In particular, in this case, the insecticidal peptides of SEQ ID NO 1 combined with SEQ ID NO 2 contains 6 cysteine residues all of which are believed to be involved in forming 3 intramolecular disulphide bonds. Thus the arrangement of the cysteine residues may be important in conferring insecticidal activity on the peptide. Therefore, homologues or variants suitably retain the cysteine residues of the combination of SEQ ID NO 1 with SEQ ID NO 2. Thus the invention encompasses peptides which may be represented as -AA₁-Cys-AA₃-AA₄-AA₅-AA₆-AA₇-Cys-AA₉-AA₁₀-AA₁₁-AA_I2-AA₁₃-Cys-AA₁₅-AA₁₆-Cys- AA₁₈-Cys-AA₂₀-AA₂,-AA₂₂-AA₂₃-AA₂₄-AA₂₅-Cys-AA₂₇-AA₂₈ (SEQ ID NO 5) or a fragment thereof, wherein AA, -AA₂₈ refer to any amino acid other than cysteine. In this formula, at least some and preferably a substantial portion of AA, to AA₂₈ will be the same as in the corresponding amino acids in SEQ ID NO 1 above. In particular, it would be expected that at least 85% of the amino acids corresponding to AAj to AA₂₈ of SEQ ID NO 1, are either identical or conservatively substituted as defined above.

Peptides of the invention may be used alone or they may be fused to other peptides or proteins so as to form chimeric peptides or proteins. Suitably, the other peptide or protein of the chimera will have some insecticidal effect of its own, or will act as a targeting sequence to target the insecticidal peptide to a particular site in the target pest. The above described peptides may be prepared in various ways. For example, they may be extracted and purified from Beauveria isolates. However, since the peptide sequence is known, it may be more convenient to manufacture the peptides, either by chemical synthesis using a standard peptide synthesiser, or using recombinant DNA technology to express the peptide or variants of that peptide in suitable host cells. Suitable cells include prokaryotic or eukaryotic organisms, in particular micro-organisms such as E. coli,

Saccharomyces cerevisiae or Pichiapastoris. Nucleic acids encoding the peptides, as well as vectors, host cells and methods of producing the peptides form further aspects of the invention.

In particular, the invention further provides a nucleic acid which encodes an insecticidal peptide as described above. The nucleic acid sequence may be a DNA or RNA sequence. In particular the DNA may be a cDNA sequence or a genomic sequence, and may be derived from a cDNA clone, a genomic DNA clone or DNA manufactured using a standard nucleic acid synthesiser.

The DNA sequence may be predicted from the known amino acid sequence and DNA encoding the peptide may be manufactured using a standard nucleic acid synthesiser. Alternatively, the DNA sequence may be isolated from fungal-derived DNA libraries. Suitable oligonucleotide probes may be derived from the known amino acid sequence and used to screen a cDNA library for cDNA clones encoding some or all of the peptide.

The natural coding sequence for EF40 and EF40' from a strain of Beauveria bassiana (designated strain CRW 148wa(l) /IMI 379823) and a strain Beauveria brongniartii (designated IMI 379918 by the International Mycological Institute, UK) respectively were obtained through reverse transcription of RNA from these fungi and Rapid Amplification of cDNA Ends (RACE) by Polymerase Chain Reaction (PCR). The 3' region of the cDNA was isolated first, using the N-terminal amino acid sequence of the EF40 mature peptide for degenerate primer design. The specific sequence obtained from the 3 'RACE EF40 fragment was then used to design specific primers for amplification of the 5' region of the corresponding cDNA. Similar techniques could be employed for EF40' or any other member of the EF40 gene family.

The sequence of the deduced EF40 cDNA is shown in Figure 8 (SEQ ID NO 6) hereinafter and this sequence or fragments thereof, or variants of either of these, which encode insecticidal peptides such as EF40 form a preferred aspect of the invention. The natural EF40 gene or related genes such as the EF40' gene may contain introns which would interrupt the integrity of the coding sequences.

Variants of the nucleic acid sequence (SEQ ID NO 6) include sequences which ' encode homologues to EF40 or EF40' as defined above. These include DNA which hybridizes to the sequence of Figure 8 or fragments thereof. Preferably, such hybridization occurs at, or between, low and high stringency conditions. In general terms, low stringency conditions can be defined as 3 x SCC at about ambient temperature to about 65°C, and high stringency conditions as 0.1 x SSC at about 65°C. SSC is the name of a buffer of 0.15M NaCl, 0.015M trisodium citrate. 3 x SSC is three time as strong as lx SSC and so on. Particular homologues to EF40 or EF40' are homologues identified in other insecticidal fungi either by protein purification and sequence analysis or by amplification from fungal genomes and/or cDNA preparations using PCR primers based on the sequence of EF40 and related protein sequences e.g. the protein sequence of the EF40-related protein identified from Beauveria brongniartii strain by 3' RACE. EF40 is a secreted peptide and therefore DNA encoding EF40 isolated from

Beauveria spp is likely to contain a signal sequence in addition to the DNA sequence - 8 -

encoding the mature peptide. It may also contain other sequences which are not present in the mature peptide (e.g. a pro-domain) and which are removed during processing and secretion.

Oligonucleotide probes or cDNA clones may be used to isolate the gene or genes which encode the insecticidal peptide by screening genomic DNA libraries.

The DNA sequence encoding the insecticidal peptide may be incorporated into a DNA construct or vector in combination with suitable regulatory sequences (promoter, terminator, etc). The DNA sequence may be placed under the control of a constitutive or an inducible promoter (stimulated by, for example, environmental conditions, presence of a pest, presence of a chemical). Such a DNA construct may be cloned or transformed into a biological system which allows expression of the encoded peptide. Suitable biological systems include micro-organisms (for example, bacteria such as Escherichia coli, Pseudomonas and endophytes such as Clavibacter xyli subsp. cynodontis (Cxc); yeasts such as Saccharomyces cerevisiae and Pichia pas tor is; viruses; bacteriophages; etc), cultured cells (such as insect cells, mammalian cells) and plants. The expressed peptide may be isolated and if necessary formulated, for use. Alternatively, the peptide may be expressed in situ or in vivo under circumstances where they will be directly brought into contact with the target pests.

It has been found that the peptides of the invention are insecticidal whether applied to pests either orally or by injection. Pests affected in this way include lepidopteran pests, for example as illustrated hereinafter and dipteran species such as the fruit fly Drosophila melanogaster. Thus the invention further provides a method of killing or controlling insect pests which comprises administering to said pests or to the environment thereof, a peptide as described above. For agricultural applications, the insecticidal peptide may be used to improve the pest insect-resistance or pest insect-tolerance of crops either during the life of the plant or for post-harvest crop protection. Pests exposed to the peptides are inhibited. The insecticidal peptide may eradicate a pest already established on the plant or may protect the plant from future pest attack. Exposure of an insect pest to an insecticidal peptide of the invention may be achieved in various ways, for example: - 9 -

(a) a composition comprising peptide may be applied to the insect or to the environment in which they live, in particular, to plant parts or the surrounding soil, using standard agricultural techniques (such as spraying);

(b) a composition comprising a micro-organism such as an insect virus, genetically modified to express the insecticidal peptide may be applied to a plant or the soil in which a plant grows;

(c) an endophyte genetically modified to express the insecticidal peptide may be introduced into the plant tissue (for example, via a seed treatment process);

[An endophyte is defined as a micro-organism having the ability to enter into non-pathogenic endosymbiotic relationships with a plant host. A method of endophyte-enhanced protection of plants has been described in a series of patent applications by Crop Genetics International Corporation (for example, International Application Publication Number WO90/13224, European Patent Publication Number EP-125468-B1, International Application Publication Number WO91/10363, International Application Publication Number WO87/03303). The endophyte may be genetically modified to produce agricultural chemicals. International Patent Application Publication Number WO94/ 16076 (ZENECA Limited) describes the use of endophytes which have been genetically modified to express a plant-derived insecticidal peptide].

(d) DNA encoding an insecticidal peptide may be introduced into the plant genome so that the peptide is expressed within the plant body (the DNA may be cDNA, genomic DNA or DNA manufactured using a standard nucleic acid synthesiser).

Where method (a) or (b) above is used, the peptide or microorganism is generally applied in the form of an insecticidal composition. Such compositions, which form a further aspect of the invention, will generally further comprise an agriculturally acceptable carrier or diluent as is known in the art. Suitable carriers or diluents are solids or liquids. Concentrates in the form of solids or liquids may be prepared, which require dilution in water prior to application, for example by spraying.

Preferably, the peptides of the invention are administered in accordance with method

(d) above. Thus in a preferred embodiment, nucleic acids of the invention utilize codons which are particularly preferred in plants. - 10 -

Examples of preferred codon usage from cotton and tobacco plants is set out in Table

1.

Table 1

Amino Acid Cotton preference Tobacco preference

Alanine GCT GCT

Arginine AGG AGA

Asparagine AAC AAT

Aspartic Acid GAT GAT

Cysteine TGC TGT

Glutamine CAA CAA

Glutamic Acid GAG GAA

Glycine GGT GGT

Histidine CAT CAT

Isoleucine ATT ATT

Leucine CTT CTT

Lysine AAG AAG

Methionine ATG ATG

Phenylalanine TTC TTT

Pro line CCT CCA

Serine TCT TCT

Threonine ACT ACT

Tryptophan TGG TGG

Tyrosine TAC TAT

Valine GTT GTT

The table shows that the codon usage for these two species is very similar, and even those preferred codons which differ are fairly compatible (e.g. they are the second most preferred codon). Thus a codon optimized DNA coding sequence for tobacco (and cotton) in respect of SEQ ID NO 3 above might read: - 1 1 -

Phe Cys Pro Val Gly Lys Thr Cys Ala Thr Asp Arg Glu Cys Gly TTT TGT CCA GTT GGT AAG ACT TGT GCT ACT GAT AGA GAA TGT GGT Ser Cys His Cys Asn Asn Tip Lys Gly Lys Cys Glu Asn TCT TGT CAT TGT AAT AAT TGG AAG GGT AAG TGT GAA AAT

wherein the nucleotide sequence forms SEQ ID No 7.

Plant cells may be transformed with recombinant DNA constructs according to a variety of known methods (Agrobacterium Ti plasmids, electroporation, microinjection, microprojectile gun, etc). The transformed cells may then in suitable cases be regenerated into whole plants in which the new nuclear material is stably incorporated into the genome. Both transformed monocotyledonous and dicotyledonous plants may be obtained in this way, although the latter are usually more easy to regenerate. Some of the progeny of these primary transformants will inherit the recombinant DNA encoding the insecticidal peptide(s). Thus the invention further provides a plant containing recombinant DNA which expresses an insecticidal peptide according to the invention. Such a plant may be used as a parent in standard plant breeding crosses to develop hybrids and lines having improved insect resistance.

Suitably the recombinant DNA is incorporated such that it is expressed in a region of the plant which is subject to pest attack (such as the leaves) and is therefore ingested by the pest. The DNA may comprise sequences which enhance or control this or which are necessary for the mature peptide to fold correctly. For example, the nucleotide sequence encoding the peptide may be under the control of a promoter which is expressed particularly in the desired tissues. Other methods of targeting the peptide are possible. For example, the nucleic acid may further comprise a signal sequence which targets the peptide to the apoplast (extra-cellular space) as a general expression location in the plant. Suitable signal sequences include those derived for example from the Beauveria EF40 gene itself (see Figure 8), from the Dahlia antifungal peptide Dm- AMP- 1 and the Radish antifungal peptide Rs- AFP1, the latter two of which are as follows: Dahlia: SEQ ID NO 9: -Met Val Asn Arg Ser Val Ala Phe Ser Ala Phe Val SEQ ID NO 8:- ATG GTT AAT AGA TCT GTT GCT TTT TCT GCT TTT GTT - 12 -

Leu He Leu Phe Val Leu Ala He Ser Asp He Ala CTT ATT CTT TTT GTT TTG GCT ATT TCA GAT ATT GCT Ser Val Ser Gly TCT GTT TCA GGA Radish:

SEQ ID NO l l :-Met Ala Lys Phe Ala Ser He He Ala Leu Leu Phe SEQ ID NO 10:-ATG GCT AAG TTT GCT TCT ATT ATT GCT CTT TTG TTT Ala Ala Leu Val Leu Phe Ala Ala Phe Glu Ala Pro GCT GCA CTT GTT TTG TTT GCT GCA TTT GAA GCT CCA Thr Met Val Glu Ala

ACT ATG GTT GAA GCT

These or other signal sequences can be used as pre-protein signals and the sequence encoding the insecticidal peptide of the invention may then be placed at the C-terminal end of the chimeric protein. The EF40 signal sequence is novel and forms a further aspect of the invention.

Transgenic plants in accordance with the invention show improved resistance or enhanced tolerance to an insect pest when compared to a wild-type plant. Resistance may vary from a slight increase in tolerance to the effects of the pest (where the peptide pest in partially inhibited) to total resistance so that the plant is unaffected by the presence of pest (where the pest is severely inhibited or killed). An increased level of resistance against a particular pest or resistance against a wider spectrum of pests may both constitute an improvement in resistance. Transgenic plants (or plants derived therefrom) showing improved resistance are selected following plant transformation or subsequent crossing. Examples of genetically modified plants which may be produced include field crops, cereals, fruits and vegetables such as canola, sunflower, tobacco, barley, sorghum, tomato, mango, peach, apple, pear, strawberry, banana, melon, potato, carrot, lettuce, cabbage, onion, etc. Particularly preferred genetically modified plants are sugar beet, cotton, maize, wheat, rice, soya spp, sugar cane, pea, field beans, poplar, grape, citrus, alfalfa, rye, oats, turf and forage grasses, flax and oilseed rape, and nut producing plants. - 13 -

EF40 has been successfully expressed in both tobacco and tomato leaves using synthetic chimeric expression constructs as illustrated hereinafter.

As the insecticidal peptides of the invention are very active against some of the major cotton pests, it would be particularly advantageous to transform cotton plants with constructs encoding said peptides. Alternatively, the peptides may be supplied to cotton plants by any other suitable method.

The invention still further includes the progeny of the plants of the preceding paragraph, which progeny comprises the said polynucleotide, or functionally sufficient parts thereof, stably incorporated into its genome and heritable in a Mendelian manner and the seeds of such plants and such progeny.

Plant transformation, selection and regeneration techniques, which may require routine modification in respect of a particular plant species, are well known to the skilled man.

The insecticidal peptides of the invention may be employed alone or in combination with other agrochemicals such as herbicides, fungicides or, most suitably, other insecticidal compounds such as insecticidal peptides and proteins. Thus insecticidal compositions in accordance with the invention may comprise additional agrochemical compounds. Where the other compounds are peptides or proteins, nucleic acids encoding these may be included in the composition in the form of expression vectors. Where these are used, the additional nucleic acids may be in the same vector as the peptide of the invention, or in additional vectors.

Examples of possible mixture partners include insecticidal lectins, insecticidal protease inhibitors and insectidal proteins derived from species of the Bacillus thurigiensis ,

Xenorhadus nematophilus, or Photorabdus luminescens. The invention will now be described by way of example only with reference to the drawings, in which:

Figure 1 shows a map of a vector useful in cloning the gene encoding peptides of the invention;

Figure 2 is a diagram illustrating a synthetic gene production strategy; Figure 3 shows the sequence of key elements of the vector of Figure 1 (SEQ ID NO 50); - 14 -

Figure 4 shows a nucleotide sequence which encodes a peptide of the invention and a dahlia

AFP signal sequence;

Figure 5 shows a nucleotide sequence which encodes a peptide of the invention and a radish

AFP signal sequence; Figure 6 shows a nucleic acid sequence which encodes a peptide of the invention and a dahlia AFP signal sequence, and a restriction map thereof;

Figure 7 shows an alternative nucleotide sequence which encodes a peptide of the invention and a radish AFP signal sequence, and a restriction map thereof ;

Figure 8 shows the sequence of the natural EF40 gene from Beauveria bassiana: Figure 9 shows the primers used in the determination of the native sequence of Figure 8;

Figure 10 illustrates cleavage sites in the sequence;

Figure 11 shows the naturally occuring coding sequence for EF40 and EF40';

Figure 12 is a restriction map of a plant expression gene construct, designated pVB6EF40r, which includes a synthetic gene encoding a polypeptide of the invention; and Figure 13 is a restriction map of an alternative plant expression gene construct, designated pVB6EF40d, which includes a synthetic gene encoding a polypeptide of the invention.

Example 1

Recovery of isolates of Beauveria bassiana Beauveria bassiana isolates were recovered directly from soil samples collected in

Iowa, USA using a modification of the Warcup isolation method (Warcup, J.H., 1950, 'The soil plate method for isolation of fungi from soil', Nature, 166, 117-118). Soil samples were ground into small particles using a mortar and pestle and 15 mg placed in the centre of a Petri dish. To this 75 μl of sterile water was added. A selective agar (Doberski and Tribe, 1980, 'Isolation of entomopathogenous fungi from elm bark and soil with reference to ecology of Beauveria bassiana and Metarhizium anisopliae ', Trans. Br. Mycol. Soc, 74, 95-100) was then added from above and the plate rotated to allow even dispersion of the particles. Isolation plates were kept in the dark at 24°C and monitored daily. Isolates of interest were picked off and dilution streaked onto Saboraud Dextrose Agar (SDA) plates. This dilution streaking was repeated until a pure culture of the strain was obtained. Isolates were maintained on SDA slopes at 4°C. - 15 -

Example 2

Production of culture filtrates for screening

41 individual isolates were screened for insecticidal activity against the Heliothis virescens. Isolates grown on SDA plates were used to inoculate 100 ml cultures of Saboraud Dextrose Broth (SDB) which were incubated at 24°C, 180 rpm on a shaking platform. 20 ml of culture was removed after 3 and 7 days, mycelium removed by centrifugation and the remaining culture supernatant concentrated approximately 10-fold using Amicon Centriprep 10 spin columns. This concentrated culture supernatant was bioassayed by directly applying 10 μl to small cotton leaf discs and allowing neonate Heliothis virescens larvae to fed on the leaf discs. Of the 41 isolates screened 10 showed significant levels of insecticidal activity.

Example 3

Purification of Insecticidal Peptide from isolate CRW148Wa A spore suspension was produced from an isolate designated CRW148Wa

(subsequently confirmed to be Beauveria bassiana by typing and assigned IMI no. 379823 vt the International Mycological Institute) grown on a single SDA plates by adding sterile water and scraping with a sterile spatula. This was then used to inoculate 4 x 500 ml SDB medium in 1 L flasks which in turn were incubated at 24°C with shaking at 180 rpm. After 3 days the flasks were harvested and mycelium growth removed by filtering through Whatman GF/B paper. The resulting supernatant was diluted to 4 litres (2-fold dilution) and equilibrated to 20 mM ammonium acetate (NH₄Ac), pH 9.0 by adding the appropriate volume of 1 M buffer and adjusting to pH 9.0 with dilute ammonia. The supernatant was then passed over a Q- Sepharose (Pharmacia Biotech) column previously equilibrated in 20 mM NH₄Ac, pH 9.0 and the unbound basic peptide fraction collected.

The flow-through from this anion exchange column was lowered to pH 6.0 using concentrated acetic acid and 1000 ml per run passed over a S-Sepharose XK26/10 column (Pharmacia Biotech) equilibrated in 20 mM NH₄Ac, pH 6. Unbound material was washed through the column with 2 column volumes of low salt buffer and bound material eluted with a linear gradient of 20 mM - 2 M NH₄Ac, pH 6.0. The eluate was monitored for peptide by online measurement of absorbance at 280 nm. 10 ml fractions were collected and freeze- - 16 -

dried to remove salt and to concentrate them. Each fraction was resuspended in 1 ml water and bioassayed against H virescens. A broad peak of activity was identified as eluting around 200 mM NΗ₄Ac. These fractions were pooled and further purified by reversed phase chromatography (RPC-HPLC). RPC-HPLC was carried out on a Pharmacia AKTA Explorer using a 3 ml Resource

RPC column (Pharmacia Biotech). 1 ml of sample from the active fraction from the cation exchange chromatography was loaded on to the column and bound peptide eluted with a linear gradient of 0.1% trifluoroacetic acid (TFA) to 49.9% acetonitrile, 0.1% TFA over 20 column volumes. The eluate was monitored for absorbance at 210 and 280 nm. A single well resolved peak of absorbance was eluted at approximately 17% acetonitrile and this fraction retained the insecticidal activity. This fraction was designated EF40. Yields of the fraction were estimated at approximately 50 mg / litre of culture.

Example 4

Characterization of Insecticidal Peptide

a) Molecular Structure

MALDI-TOF mass spectroscopy was used to determine the molecular weight of the active peptide of EF40 which was 3083 +/- 1 Da. b) Amino Acid Sequencing of Insecticidal peptide

Cysteine residues were modified by S-pyridylation using the method of Fullmer (1984, Anal. Biochem., 142, 336-341). Reagents were removed by HPLC on a Sephacil C18 column (Pharmacia) and the modified peptide recovered by eluting with a linear gradient of 0.1% TFA to 49.9% acetonitrile, 0.1% TFA. The resulting peptide fraction was subjected to standard amino acid sequence analysis in a 477A Protein Sequencer (Applied Biosystems) with on-line detection of phenylthiohydantoin amino acid derivatives in a 120 A Analyser (Applied Biosystems).

Using this method the complete sequence for the insecticidal peptide EF40 was determined and is shown in SEQ ID NO 3. EF40 is 28 amino acids in length and contains 6 cysteine residues all of which are involved in forming 3 intramolecular disulphide bonds. - 17 -

Example 5

Construction of a Synthetic EF40 Gene for Plant Expression a) Gene Design and Assembly

A synthetic EF40 gene was designed, which comprised: Restriction site(s) to aid cloning - upstream (5') of the gene

Kozac sequence (Lϋtcke et al. The EMBO Journal (1987) 6(1), 43-48)- immediately 5' of the translation initiation codon to promote efficient expression of the EF40 containing product

A signal sequence to direct the mature protein to a particular part of the plant The EF40 gene sequence itself A Stop Codon Restriction site(s) to aid cloning - downstream (3') of the gene

A two step cloning approach was used to insert the EF40 gene directly into a pUc based vector (pSIN) (see Figure 3) which carries a promoter (CaMN 35S-boxed in Figure 3) and terminator (ΝOS 3'- also boxed in Figure 3). pSIΝ has 5 unique restriction sites for gene cloning between the promoter and terminator as illustrated in Figure 1. After sequencing the gene to check both its orientation and full nucleic acid sequence, it was excised from the pSIΝ background as a cassette, complete with promoter and terminator, using the Agel sites which flank the 35S promoter and ΝOS terminator, and inserted into a binary plant transformation vector pVB6, also with a unique Agel site.

Synthetic genes comprising the EF40 coding sequence and the radish AFP and dahlia AFP signal sequences described above may be prepared, using the optimal codon usage for tobacco, Nicotiana tabacum and/or cotton. For example: four shorter, overlapping oligos corresponding to the EF40 sequence as illustrated in Figure 2 were prepared. These comprised:

DEF40/a

5' TTGGTACCCGGGAACAATGGTTAATAGATCTGTTGCTTTTTCTGCTTTTGTTCTT

ATTCTTTTTG 3 ' (65-mer) (SEQ ID NO 12)

DEF40/b

5' CCAACTGGACAAAATCCTGAAACAGAAGCAATATCTGAAATAGCCAAAACAAAAAGAATA

AGAACAAAAGCAGA 3' (74-mer) (SEQ ID NO 13) - 18 -

DEF40 /C

5'GTTTCAGGATTTTGTCCAGTTGGTAAGACTTGTGCTACTGATAGAGAATGTGGTTCTTGT CATTGTA 3 ' (67-mer) (SEQ ID NO 14) EF40/d

5 ' AGAGCCCGGGCTGCAGTTATCAATTTTCACACTTACCCTTCCAATTATTACAATGACAAG AACCACATTCTC 3' (72-mer) (SEQ ID NO 15)

REF40/a 5 ' TTGGTACCCGGGAACAATGGCTAAGTTTGCTTCTATTATTGCTCTTTTGTTTGCTGCACT TGTTTTGTTTG 3 ' (71-mer) (SEQ ID NO 16)

REF40/b

5 ' CCAACTGGACAAAAAGCTTCAACCATAGTTGGAGCTTCAAATGCAGCAAACAAAACAAGT GCAGCAAACA 3 ' (70-mer) (SEQ ID NO 17)

REF40/C

5 ' GTTGAAGCTTTTTGTCCAGTTGGTAAGACTTGTGCTACTGATAGAGAATGTGGTTCTTGT CATTGTA 3 ' (67-mer) (SEQ ID NO 18)

where "D" refers to Dahlia and "R" Radish - EF40 sequences. No prefix, D or R, indicates that the sequence is the same in both synthetic genes.

A short 5 cycle PCR was used with mixtures of oligonucleotides DEF40/a,

DEF40/b, DEF40/C and EF40d, and REF40/a, REF40/d, REF40/c and EF40/d to fill in the missing nucleotides (Step 2 of Figure 2), and PCR primers based specifically on the ends of the gene sequence used to synthesize numerous copies of full length EF40 synthetic gene by

PCR (Step 3). Suitable primer sequences are: For Dahlia-EF40 sequences

(SEQ ID NO 19)

DEF40-pcrF: TTGGTACCCGGGAACAATGGT (SEQ ID NO 20)

EF40-pcrR: AGAGCCCGGGCTGCAGTTATC

For Radish-EF40 sequences the reverse primer is the same (SEQ ID NO 20) whereas the forward primer is: (SEQ ID NO 21)

REF40-pcrF: TTGGTACCCGGGAACAATGGC

Since the synthetic gene sequence was flanked with restriction sites, including Pstl, BamHI, Smal, Xmal and Kpnl, any of these could have been used for sub-cloning provided - 19 -

that these sites were not found within the gene or signal sequence used or were inconveniently positioned within the host vector. For a synthetic gene based upon SEQ ID NO 5 and SEQ ID NO 7 or 9 given above, flanking Xmal restriction sites allowed direct cloning into the Xmal site in pSIN. In the synthetic gene design phase this Xmal restriction sequence CCGGG was flanked with 4 extra nucleotides up and downstream for optimal cleavage efficiency. These promote greater than 90% cleavage in a 2 hour digestion.

In a alternative strategy however, two different restriction sites may be used, such as Kpnl and Pstl , or Xmal and Pstl so that the gene may be forced to insert in only the correct orientation. Kpnl cleaves more efficiently when flanked by at least two nucleotides, and Pstl cleaves best when preceded by at least two and followed by up to 10 nucleotides. Thus, sequential digestion with Pstl and then Xmal suits both of these enzymes well in terms of cleavage. Conveniently, the last 2 nucleotides of the Kpnl sequence, CC, are the same as the beginning 2 of the Xmal recognition sequence.

The restriction sites at the ends of the synthetic gene are now:

Kpnl Xmal Pstl Xmal

Start TTGGTACCCGGG End CTGCAGCCCGGGCTCT

(SEQ ID NO 22) (SEQ ID NO 23)

Suitably a plant Kozac sequence (Lϋtcke et al, supra.): AACAATGGC is included upstream of the ATG initiation codon in order to enhance protein expression, and a double termination codon e.g. TAATAA used, although an alternative sequence would be TGATAA.

Drawing together all the above factors together, suitable sequences for Dahlia and Radish AFP signal EF40 genes are SEQ ID NOS 27, 28, 29 and 24 and 30 and 25 illustrated in Figures 4 - 7. The sequences of the dahlia and radish signal peptides are shown in bold type on Figures 4 and 5 respectively. In (SEQ ID NO 28) of Figure 5, the last two nucleotides of the Kozac sequence, GC, have been removed and the relevant signal sequence located immediately following the ATG initiation codon. As it happens, the first two bases of the radish sequence are GC, thus resulting in a fully correct Kozac, and that of Figure 4 (SEQ ID NO 27 - Dahlia) is GT thus only changing one nucleotide of the Kozac sequence. - 20 -

The thus obtained vectors pVB6-EF40d and pVB6-EF40r, may be used to transform tobacco cells using known methods.

Example 6 Characterization of the natural EF40 coding sequence

RNA Extraction

EF40 strain CRW 148wa(l) (IMI No. 379823)(50ml) was grown in Sabouraud Dextrose Broth (Difco Laboratories: lOg Bacto Neopeptone and 20g Bacto Dextrose per litre water)for 5 days at 24°C with shaking at 180 rpm. The culture was then spun down (8000rpm for 10 minutes)and the resulting pellet ground to a fine powder using a pestle and mortar under liquid nitrogen. RNA was extracted from lOOmg samples of fungal pellet using the Qiagen RNeasy kit, according to the manufacturers' specifications.

The RNA fraction was eluted from RNeasy purification column in lOOμl water, stored at -70°C.

b First Strand cDNA Synthesis

The following reaction mixtures were treated with the ClonTech Advantage RT-for- PCR kit (following the manufacturers' specifications)

0.15μg, 0.5μg, lμg or 5μg total CRW 148wa(l) (IMI No. 379823) RNA

4 μl 5 x reaction buffer

0.5 μl RNase inhibitor

1 μl MMLV reverse transcriptase l μl lOmM dNTP 3 μl Anchor Primer (SEQ ID NO 31) (20pmol) - 3'RACE Anchor 1, (see Figure 9)

RNase free Water to 20 μl.

These mixtures were incubated at 42°C for 1 hour, then at 94°C for 5 min to terminate the reactions before finally adding 80μl water. To estimate cDNA yields in the above reactions, α³²P dCTP (lOμCi per reaction) was added to the above reaction mixtures (dNTP containing only 5mM dCTP) for radioactive - 21 -

tracing. The labelling reaction was carried out in parallel with actual cDNA synthesis reactions, on 1 μg total RNA. After the steps above were completed:

3μl of each reaction mixture was spotted onto duplicate Whatman DE81 filters and dried at 50°C. DE-81 filters are positively charged and strongly adsorb and retain nucleic acids but not unincorporated nucleotides.

One of the filters was washed with 0.5M NajHP , for 3 x 5 minutes to remove unincorporated nucleotides before scintillation counting to obtain estimates of cDNA yields.

By comparison of scintillation counts of washed and unwashed filters, cDNA yield was calculated to be 1.1% of total RNA input.

cl 3' RACE PCR

5 μl of the reaction mix from the first strand cDNA synthesis step above was used as a template with various primer set combinations to amplify the 3' end of EF40 coding cDNA. The primers used are shown in Figure 9 hereinafter. Forward primers, designated EF40-F were designed on the basis of the known amino acid sequence of the N-terminal end of mature EF40 to allow for selective amplification.

The best result was produced using primers Anchor 1-PCRl (SEQ ID NO 32) and EF40-F2a (SEQ ID NO 35), producing a discrete band of approximately 400 bp.

The PCR components and cycling conditions used were as follows: cDNA template 5 μl reaction mix from cDNA synthesis step

Forward Primer 25 pmole

Reverse Primer 25pmole dNTP's (lOmM each of dATP, dGTP, dCTP & TTP) 4μl

PCR Buffer (GibcoBRL) 2.5μl

MgCl₂ (1.2mM) 0.75μl

T4 Taq polymerase (GibcoBRL) 0.25μl

Water 15.6μl Total 25μl 22

Cycle Conditions

94 °C 1 min

I

94°C 1 min ⁴-

I

55 °C 45 sec 25 cycles

72 °C l mm- i 72 °C 5 min

Discrete PCR products were then cloned into pCR2.1 TOPO using the Invitrogen TOPO TA cloning kit according to the manufacturers' specification. Each reaction was set up as follows:- lμl PCR product

1 μl pCR2.1 TOPO vector (lOng)

3 μl water and was then incubated for 5 minutes at room temperature. Each ligation mix (3 μl) was then transformed into TOPI Of competent cells by heat shock at 42°C for 30 seconds.

Transformed cells were then allowed to express beta-lactamase by incubation at 37°C in SOC medium (2% tryptone, 0.5% yeast extract, lOmM NaCl, 2.5mM KC1, lOmM MgCl₂, lOmM MgSO₄, 20mM glucose) for 30 minutes with shaking at 225rpm.

Cells were then plated on Luria-Bertani Agar plates (1.0% tryptone, 0.5% yeast extract, 1.0% NaCl, 15g/L agar, X-gal 0.006%, IPTG 0.15mM) containing 50μg/ml ampicillin for plasmid transformant selection and to enable identification of those containing recombinant (insert containing) TOPO TA isolates. All transformations worked well with approximately 90% white colonies. - 23 -

20 white clones were then selected from different PCR TOPO TA ligation reactions, re-streaked, and grown overnight in 5ml Luria-Bertani medium (1.0% tryptone, 0.5% yeast extract, 1.0% NaCl, dissolved in water, pH 7.0) containing ampicillin (50μg/ml).

Plasmid DNA was extracted from the cultures by Promega' s Wizard miniprep kit according to the manufacturer's recommendations and with a final elution volume of 60μl water. EcoRI digests were prepared to check for inserts :- 3μl DNA lμl EcoR/(Kramel Biotech) lμl Restriction Buffer 6 (Kramel Biotech) 5μl water

Digests were incubated at 37°C for 2 hours and the presence/absence of inserts determined by agarose gel electrophoresis. All 20 clones contained an insert of approximately 300-400 base pairs in length; precise lengths varied due to different primer binding locations.

Based on these analyses, 10 recombinant plasmids were selected for sequencing on a Perkin Elmer ABI 377XL DNA sequencer with the ABI Prism dye terminator cycle sequencing ready reaction kit, according to the protocol provided by Perkin Elmer Applied Biosystems. lμl primer (4 pmol) - M13 Univ or M13 R 4 μl DNA 7 μl water

EF40 coding sequence was then readily identifiable in 7 of the clones by translation of the nucleotide sequence into amino acid sequence in all possible reading frames and comparison of this sequence to the known amino acid sequence of EF40. This analysis used the DNA Star sequence analysis software (SeqMan, EditSeq, Macaw and Vector NTI).

d 5' RACE PCR

In order to define the 5' sequence of EF40 mRNA and hence the sequence of the N- terminal end of the primary EF40 translation product, an anchor-ligation 5' RACE PCR approach was followed. (Troutt, A.B., et al., Proc. Natl Acad. Sci. USA. 89, 9823-9825). This entailed attachment of a specific anchor primer to the 5' end of the 1^st strand cDNAs and use of this sequence together with a specific EF40 mRNA complementary 3' primer, - 24 -

designed on the basis of the 3' RACE results, to allow for selective amplification of the 5' end of EF40 coding cDNA. i. Primer Annealing

'Anchor-3' (SEQ ID NO 46) , which has a 5' terminal phosphate group and a 3' terminal amido group, and 'Anchor-3 Attachment' (SEQ ID NO 47) attachment primer which also has a 3' terminal amido group (see Figure 9) were annealed to one another in equimolar ratio's at three different final concentrations as follows: InM (lμl lOnM of each primer, 8μl water) lOOnM (lμl ImM of each primer, 8μl water) 1 OmM ( 1 μl 1 OOmM of each primer, 8μl water)

The attachment primer is complementary to the anchor primer, but contains a 3 ' extension of 5 additional fully degenerate bases i.e. synthesised with A, G, C and T at each position. This degenerate "tail" allows individual attachment primers to anneal to the 3' terminus of any cDNA molecule. The amido groups block DNA synthesis from the primers but, the phosphate group on the anchor primer allows ligation of the anchor primer to the 3' end of the cDNA molecules to provide a specific recognition sequence for PCR amplification.

Oligonucleotide mixtures were heated to 95 °C and cooled slowly to 45°C in a thermal cycler 95°C 30 sec

I Cool by 1°C every 70 seconds

45°C 30 sec

ii. Ligation of annealed anchor primer to first strand cDNA preparations Reactions were set up using each of the three different concentrations of annealed anchor oligonucleotides (Troutt et al. supra.) - each reaction contained 5 μl reaction mix from first strand cDNA synthesis 30mM Tris HCl (pH 8) 10mM MgCl₂ 1 OmM dithiothreitol - 25 -

0.5mM ATP lμl T4 DNA ligase (4U/μl)

1 μl water lμl annealed anchor primers (to final concentrations of lOOμM, lOnM or ImM) lOμl TOTAL volume

Reactions were then incubated in a thermal cycler overnight as follows:

25°C 5 min

I ^ ramp rate =10

72 cycles completed in 16 hours

4°C 5 min

Reactions were pooled, incubated at 95 °C for 5 minutes and snap frozen in liquid nitrogen

After thawing on ice, excess primers were removed by purification through a Wizard PCR Clean-Up column. cDNAs were eluted in 40μl water.

iii. RACE PCRs

PCR reactions were set up using the anchor linked cDNA as the template, and specific primers based on this anchor sequence and the EF40 gene sequence identified previously by 3' RACE. The best result was produced using primers Anchor3-F2 (SEQ ID NO 38) and reverse primer 5' RACE EF40 R2 (SEQ ID NO 41), producing a discreet fragment approximately 450 - 550 base pairs in size.

The PCR components and cycling conditions used were as follows:

cDNA template 1 μl

Forward Primer (25pmol) 2.2 μl

Reverse Primer (25 pmol) 1.8 μl dNTP's (lOmM) 4 μl

PCR Buffer (GibcoBRL) 2.5 μl MgCl₂ (1.2mM) 0.75 μl 26 -

T4 Taq polymerase (GibcoBRL) 0.25 μl Water 12.5 μ 1

Total 25μl

The PCR cycle conditions were:

94 °C 1 min i

94°C 1 min

I

48 °C l min 30 cycles

I

72 °C l min

I

72 °C 10 min

Resulting PCR products were TOPO cloned as described above. Plasmid DNA was then extracted from the clones carrying candidate recombinant plasmids by Wizard miniprep (Promega) according to manufacturer's specifications, EcoRI digested and sequenced as described above.

The deduced sequence is shown in Figure 8 hereinafter. In that Figure, two candidate start codons and a stop codon are underlined. The sequence which codes for the mature EF40 protein is indicated in bold type (and is illustrated again in Figure 11 as SEQ ID NO 52). Two of the five clones displayed single base pair differences to the previously deduced coding sequence of EF40 (marked in italics in the sequence). Neither of these result in changes to the amino acid sequence. This could be due to the presence of a polymorphic family of EF40 genes, or could be explained by PCR induced errors.

Five out of five independent anchor-primer reaction derived TOPO / EF40 recombinant clones displayed fusion of the anchor primer sequences to the nucleotide sequence ATC AC (SEQ ID NO 54) (76 nucleotides 5' of the first candidate translation - 27 -

initiation site). This indicates either that natural EF40 mRNA has a 76 nucleotide 5' non- coding sequence, or that there is a structural feature with a 5' end coding region which results in the majority of all single strand cDNA synthesis terminating at this point.

This sequence analysis suggests that EF40 is encoded by a pre-pro signal sequence. Potential signal sequence cleavage sites were predicted based in the method of von Heijne, G. (1986). Nucleic Acids Research. 14, 4683. These are illustrated in Figure 10 (SEQ ID NO 51) hereinafter where potential translation initiation sites are underlined, the mature EF40 peptide sequence is shown in bold type and potential cleavage sites are indicated by downward pointing arrows . It is therefore likely that the natural EF40 gene encodes a pre-pro signal sequence.

Again, most probably the first methionine codon noted above is likely to be the translation initiation site (Figure 10). Initial processing would then be by removal of the signal sequence by cleavage at one of the sites indicated by an arrow as pre-pro-EF40 enters the Beauvaria bassiana secretory apparatus. A secondary maturation event them removes the pro-peptide by cleavage between the last amino acid of the signal sequence (arginine) and the first amino acid of the mature peptide (phenylalanine).

Example 7

Biological Activity of EF40 Peptide

a) Activity in insect bioassavs

EF40 was bioassayed against a range of insect species using the following method:

Prior to the assay twenty neonate lepidoptera larvae were gently brushed into each of three 'minipots' containers per treatment (i.e. three replicates per treatment). Test peptides were diluted using 0.1% Synperonic™ solution to act as a wetter and aid the spread of the material over the waxy leaf cuticle. In spectrum assays, test materials were made up to a single high concentration, whereas in potency assays vs. H virescens a rate range was tested.

Three freshly excised cotton leaves per treatment had 0.1 ml of the appropriate treatment applied by pipette to the centre of the axial surface of each leaf. The droplet was then spread over a circular area in excess of the diameter of a minipot with a fine artists paint brush (a fresh paint brush being used for each compound to avoid contamination). The 28

leaves were left in a fume cupboard just long enough for the surface deposit to dry but care was taken to avoid excessive leaf wilting.

Once dry the leaves were placed, contaminated surface down over the appropriately labelled minipot and a lid snapped over it. The minipots were placed in plastic trays and held in a controlled temperature at 25-27°C.

After three days the numbers of live larvae remaining were counted and percent mortality determined. In the H virescens potency assay the test data was run through a logit analysis package to establish the LC₅₀. Percent feeding damage to the leaf disc relative to control treatments was also visually estimated.

The results for 4 lepidopteran pests are shown in Table 2.

Table 2

Test Species Rate (ppm) % kill % feeding damage

Heliothis virescens 1000 66.7 20

Helicoverpa zea 1000 28.3 80

Trichoplusa ni 1000 83.8 13

Spodoptera exigua 1000 15 67

Plutella xylostella 1000 63.3 44

Thus, when applied to the leaf at 1 mg/ml (lOOOppm) EF40 caused significant mortality to Heliothis virescens, Plutella xylostella and Trichoplusia ni, and was also active on Helicoverpa zea. In contrast, it had little effect on Spodoptera exigua larvae. With H. virescens a 50% reduction in feeding damage was achieved at approximately 250 μg/ml (Table 3).

Table 3

Treatment Rate (ppn ) % kill % feeding damage

Control 0 6.7 100

EF40 1000 66.7 20

250 25 53.4

62.5 15 66.6

15.6 8.3 73.4

3.9 6.7 80 - 29 -

b) Insecticidal activity via injection

EF40 was also tested for activity via injection using the following method:

Larvae to be tested were mid to late 4th instar stage and weighed approx. lOOmg each. Dilutions of the EF40 to be tested was carried out using sterile double distilled water. Test samples were made up to an appropriate concentration expressed in parts per million (ppm), and applied in terms of μg of peptide per mg of larval body weight (assuming a body weight of lOOmg). Control treatment larvae were injected with sterile double distilled water.

Test larvae were placed, one at a time on an injection platform and held in place, motionless, ready for injection with a sheet of cling film held in place by a gentle vacuum source pulling the sheet down over the larva. A Hamilton microlitre syringe with a 15mm, 33 gauge needle was used to inject. The syringe and needle were cleaned using ethanol and finally distilled water between treatments. Five μl's of test solution were drawn up ready for injection - five larvae being injected per treatment. Larvae were injected in the region between the dorsal line and the lateral line thus avoiding the 'heart' and the spiracles to minimise injury. The needle was positioned over this region, about a third of the larva from the head at a very shallow angle with the needle pointing away from the head. Each larva was injected by carefully pushing the needle through the cling film and cuticle into the haemocoel, penetrating by approx. 3mm before expelling one μl of test solution. The needle was carefully withdrawn after a few seconds (to ensure toxin circulation). The procedure was repeated on the remaining four larvae per treatment. The injected larvae were assessed for mortality and/or symptoms at appropriate intervals post-injection. Blunt forceps were used to gently prod larvae to elicit a response and determine symptomology if any. After the initial assessment immediately post-injection the larvae were placed in individual containers with a thin layer of diet, lidded, and stored in a 25-27°C controlled environment room between assessments.

When injected at O.Olμg/mg body weight, EF40 caused 60% mortality when assessed 4 days after treatment. c) Cell cytotoxicity - 30 -

Two cell lines were used to determine if EF40 was cytotoxic to either mammalian cells (MEL cells) or insect cells (Sf21 cells). MEL cells and Sf21 cells were grown in DMEM and TCI 00 media respectively in 96- well microtitre plates and incubated with the appropriate concentration of peptide. The cells were scored for visible cell death after 24 hours and viability and growth assessed after 3 (MEL cells) or 4 (Sf21) days using the reduction of MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) to form an insoluble purple formazan as a marker for metabolically active cells.

At the highest rate tested (100 μg/ml) EF40 did not inhibit cell growth or cause any cytotoxic effects on either cell line. In contrast a thionin purified from plant seed showed significant cell death at rates as low as 1 μg/ml even after 24 hours.

Example 8

Plant Expression of EF40

The synthetic gene of Example 5 designed to encode the EF40 protein was used to produce plant expression gene constructs called pVB6EF40r and pVB6EF40d (Figures 11 and 12 respectively).

As discussed in Example 5, to allow for secretion, the synthetic EF40 gene had been attached to two different N terminal signal peptides. A signal peptide, after directing a protein to the extracellular matrix, would subsequently be cleaved to release the mature protein. It was expected therefore that the signal peptide will be cleaved during processing of the chimeric Rs-AFP1/EF40 in pre-peptide and that mature EF40 without the signal peptide will accumulate in the extracellular space.

The first signal peptide used was from radish seeds and the second from dahlia seeds (Figure 4 and 5 respectively). Both the radish and the dahlia signal peptides are known to function to direct small antifungal proteins (called RS-AFPl and DM- AMP 1 respectively) to the extracellular space.

The synthetic EF40 gene was placed under the control of the CaMV 35S promoter. The terminator sequence from the 3' end of the Agrobacterium tumefaciens nopaline synthase gene (nos) was used. All expression cassettes were constructed in a Binl 9-based binary vector for transformation by Agrobacterium tumefaciens. The effect gene cassette and selectable 31 -

marker gene cassette were confined to the T-DNA region of the plasmid vector. The selectable marker cassette in each of these plasmids is composed of the AoPRl promoter - neomycin phosphotransferase (npt l) gene - nos terminator. NPTII confers resistance to the antibiotic kanamycin. AoPRl is the Asparagus wound induced promoter.

Agrobacterium mediated transformation of Tobacco was performed with both constructs. Tomato was transformation with pVB6EF40r only.

The host plants varieties used were:

Tobacco NVS

Tomato Ailsa Craig and Money Maker

Construct name signal effect crop number of primary peptide gene transformants pVB6RF40-R radish EF40 tobacco 30 AFP tomato 30

_PVB6RF40-D dahlia EF40 tobacco 30 AFP

Western blot analysis of all plants obtained was performed using an antibody raised against pure EF40. This method can clearly detect EF40 mixed with leaf proteins. Results are described according to band intensity Low, Medium, High and Not Detectable (ND) 70μg total leaf protein per plant were loaded onto the gel for W blot analysis.

Number of primary transformants with given EF40 expression

Plant Construct Total ND Low Medium High

Tobacco EF40 R 30 4 5 7 14

Tomato EF40 R 30 20 7 3 0

Tobacco EF40 D 30 21 3 6 0

- 32 -

The radish construct in tobacco gave higher transgene expression levels than the dahlia in tobacco or even the radish in tomato.

EF40 protein of the correct molecular weight (as determined by W blot analysis) was detected in both radish and dahlia constructs in tobacco and in the tomato radish construct. This indicates that both the radish and the dahlia signal peptides were indeed cleaved from the mature EF40 peptide.

Example 9

Preparation and screening of EF40' A strain of Beauveria brongniartii (Sacc.) Petch. (Identification confirmed by International Mycological Institute and recorded as IMI sample number 379918) was inoculated into 50ml liquid medium (SDB) and grown for 14 days at 24°C with shaking at 180rpm. Extraction buffer (NH₄Ac, pH 9 as described in Example 3) and protease inhibitor cocktail (Sigma P- 2714 - made up in 100ml water, and 1ml added per 25ml supernatant) was added to supernatant. The resultant mixture (30ml) was concentrated in dialysis tubing on polyethylene glycol 10,000 to 2ml ie. 15x concentration.

The resultant material showed insecticidal activity against H.virescens and Drosophila melanogaster.

Example 10

Characterisation of the natural EF40' coding sequence

The method of Example 6 was repeated using the strain of Example 9 (Beauveria brongniartii strain IMD 79918) instead of Beauveria bassiana. Similar primers were used in the process. The coding sequence obtained as a result of following this procedure is shown in Figure 11 (SEQ ID NO 53). This is highly homologous but not identical to that of the

EF40 natural coding sequence (SEQ ID NO 52). In Figure 11, the emboldening indicates base changes between the two sequences. Since, the underlined sequence corresponds to that of the primer, the existence of mismatches in this area could not be determined. However, determination of the specific sequence of EF40' could be carried out using routine methods, such as 5 '-RACE as described in Example 6 above. - 33 -

The homology between the two sequences is high (i.e. 71.4% at the amino acid level and 87.3% at the nucleic acid level. This indicates that these sequences form part of a related family of peptides, and that others may be obtainable from other sources using either the methods described above, or other conventional methods. For example, the sequences of EF40 and EF40' can be used to design primers or probes with which DNA or RNA libraries may be searched using known methods.

Example 11

Comparison of known protein sequences to EF40 using the FASTA Algorithm: A FASTA comparative search of EF40 protein sequence to a database of protein sequences was carried out.

The protein sequence of EF40 was compared to all publicly available protein sequences using the FASTA method (FASTA version 3.0t82 November 1, 1997 Reference: W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448). Specifically a large non-redundant protein database, including release 36.0 of

SWISS-PROT, queried on Monday 8th February 1999 returned proteins judged to have some similarity to EF40. The best way to judge similarity using FASTA by those skilled in the art is to use the opt score output. The comparison of EF40 to the non-redundant protein sequence database gave very few proteins and none with a high opt score demonstrating that EF40 is not closely related to any known protein. The 'most similar' was in SWISSPROT and had an opt score of 102.

Example 12

Comparison of known protein sequences to EF40* using the FASTA Algorithm: A FASTA comparative search similar to that described in Example 11 was carried out in respect of the EF40' protein sequence. When an identical query to that described above was run with sequence EF40', again very few proteins were detected and none with a high opt score demonstrating that EF40' is also a member of a unique class of proteins. The 'most similar' protein was in SWISSPROT and had an opt score of 89. - 34 -

Example 13

A FASTA comparison of EF40 protein sequence to EF40'

The protein sequence of EF40 was also compared to the sequence of EF40' and to itself (EF40) using the FASTA method The comparison of EF40 to EF40' gave an opt score of 199. The comparison of EF40 to itself (EF40) gave an opt score of 236. The comparison of EF40' to EF40' gave an opt score of 227. These results are tabulated below.

EF40 vs EF40' opt score 199 comparison EF40 vs EF40 opt score 236 identity for this seq EF40'vs EF40' opt score 227 identity for this seq

The score comparisons have different opt scores due to the algorithm giving different protein residues different weightings. The range of opt scores for these sequences are indicative of the range of opt scores which encompass this family of sequences. Other modifications of the present invention will be apparent to those skilled in the art without departing from the scope of the invention.

Claims

- 35 -

CLAIMS 1. An insecticidal peptide comprising the amino acid sequence

CX'X²X³RECGSCX⁴CNX⁵ WKGKCEX⁶ (SEQ ID NO 1 )

where X¹, X², X³, X⁴, X⁵ and X⁶ are any amino acid; or a fragment thereof, or a homologue, variant or derivative of any of these.

2. An insecticidal peptide wherein the sequence further comprises the sequence FCPVGKT (SEQ ID NO 2) of a homologue, variant or derivative of this sequence directly adjacent the CX'X² end of the peptide.

3 An insecticidal peptide according to claim 1 or claim 2 wherein X¹ is A or T, and/orX² is T or S, and/or X³ is D or N, and/or X is H or S, and/or X5 is N or S, and/or X6 is N or E.

4. An insectidal peptide according to any one of the preceding claims comprising the amino acid sequence

FCPVGKTCATDRECGSCHCNNWKGKCEN (SEQ ID NO 3)

or a fragment thereof, or a homologue, variant or derivative of any of these.

5. An insecticidal peptide according to claim 4 which is of SEQ ID NO 3.

6. An insecticidal peptide according to any one of claims 1 to 3 comprising the amino acid sequence

X7χsχ9χιoχι ιχi2χi3CSSNRECGSCSCNSWKGKCEE (SEQ ID NO 4) - 36 -

or a fragment thereof, or a homologue, variant or derivative of any of these, where χ7χsχ9χιoχι ιχi2χi3 comprises SEQ ID NO 2 as defined in claim 2, or a homologue, variant or derivative thereof.

7. An insecticidal peptide according to claim 6 which is of SEQ ID NO 4.

8. A peptide according to claim 1 which comprises the sequence:

-AA₁-Cys-AA₃-AA₄-AA₅-AA₆-AA₇-Cys-AA₉-AA₁₀-AA_U-AA₁₂-AA₁₃-Cys-AA_I5- AA₁₆-Cys-AA₁₈-Cys-AA₂₀-AA₂₁-AA₂₂-AA₂₃-AA₂₄-A₂₅-Cys-AA₂₇-AA₂₈ (SEQ ID NO 5)

wherein AA, -AA₂₈ refer to any amino acid other than cysteine.

9. An insecticidal peptide having an amino acid sequence which has a FASTA opt score (as defined in accordance with FASTA version 3.0t82 November 1, 1997) of greater than

102 when compared with SEQ ID NO 3.

10. An insecticidal peptide having an amino acid sequence which has a FASTA opt score (as defined in accordance with FASTA version 3.0t82 November 1, 1997) of greater than 98 when compared with SEQ ID NO 4.

11. An insecticidal peptide according to claim 9 or claim 10 wherein the FASTA opt score is in excess of 130.

12. An insectidal peptide according to claim 11 wherein the FASTA opt score is in excess of 150.

13. An insectidal peptide according to claim 12 wherein the FASTA opt score is in excess of 190. - 37 -

14. An insecticidal peptide having an amino acid sequence which has a FASTA opt score (as defined in accordance with FASTA version 3.0t82 November 1, 1997) of greater than 199 when compared with SEQ ID NO 3 or SEQ ID NO 4.

15. A nucleotide sequence which encodes a peptide according to any one of claims 1 to 14.

16. A nucleotide sequence according to claim 15 wherein the codon usage has been selected so that it favours expression in plants.

17. A nucleotide sequence according to claim 16 which comprises SEQ ID NO 7.

18. A nucleotide sequence according to claim 15 which is selected from SEQ ID NO 52 or SEQ ID NO 53.

19. A nucleotide sequence according to claim 15 which encodes a insecticidal peptide and which comprises SEQ ID NO 6 as shown in Figure 8 or a fragment thereof, or a variant of either of these.

20. A nucleotide sequence according to any one of claims 15 to 19 which further comprises a signal sequence.

21. A signal sequence which comprises a fragment of the sequence of Figure 10.

22. A vector comprising a nucleotide sequence according to any one of claims 15 to 21.

23. A vector according to claim 22 which comprises a recominbant insect virus.

24. A vector according to claim 23 wherein the virus is a baculovirus.

25. A cell which has been transformed by a vector according to claim 23. - 38 -

26. A cell according to claim 25 which is a plant cell.

27. A transgenic plant comprising cells according to claim 26, or the progeny of said plants.

28. A plant containing recombinant DNA which expresses an insecticidal peptide according to any one of claims 1 to 15.

29. A method of producing a peptide according to claim 1 which comprises culturing a cell according to claim 25.

30. A method according to claim 29 wherein the cell is a prokaryotic cell.

31. An insecticidal composition comprising a peptide according to any one of claims 1 to 15 or a insect virus according to claim 23 or claim 24 in combination with an agriculturally acceptable carrier.

32. A composition according to claim 31 which further comprises an additional agrochemical compound.

33. A method of killing or controlling insect pests method which comprises applying to the pests or to the environment thereof, a peptide according to any one of claims 1 to 15, or a composition according to claim 31 or claim 32.

34. A method of killing or controlling insect pests which method comprises cultivating a transgenic plant according to 28.

35. The use of a peptide or peptides according to any one of claims 1 to 15 and/or nucleic acids encoding them in the production of other insecticidal variants using molecular evolution and/or DNA shuffling methods. - 39 -

36. An insecticidal peptide obtained by a method according to claim 35.

37. An insecticidal peptide according to claim 36 having insecticidal properties enhanced over that of SEQ ID NO 3.