US20190060425A1 - Aadc polynucleotides for the treatment of parkinson's disease - Google Patents
Aadc polynucleotides for the treatment of parkinson's disease Download PDFInfo
- Publication number
- US20190060425A1 US20190060425A1 US16/184,466 US201816184466A US2019060425A1 US 20190060425 A1 US20190060425 A1 US 20190060425A1 US 201816184466 A US201816184466 A US 201816184466A US 2019060425 A1 US2019060425 A1 US 2019060425A1
- Authority
- US
- United States
- Prior art keywords
- seq
- aav
- pat
- aavhu
- aavrh
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/51—Lyases (4)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
- A61K35/761—Adenovirus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/20—Hypnotics; Sedatives
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
- C12N15/864—Parvoviral vectors, e.g. parvovirus, densovirus
- C12N15/8645—Adeno-associated virus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/01—Carboxy-lyases (4.1.1)
- C12Y401/01028—Aromatic-L-amino-acid decarboxylase (4.1.1.28), i.e. tryptophane-decarboxylase
Definitions
- compositions particularly nucleic acid molecules, e.g., polynucleotides encoding AADC, for use in the treatment of Parkinson's disease.
- AADC polynucleotides may be encoded by or within recombinant adeno-associated viruses (AAVs).
- AAVs adeno-associated viruses
- Aromatic L-amino acid decarboxylase is a homodimeric pyridoxal phosphate-dependent enzyme responsible for the synthesis of dopamine and serotonin.
- the encoded protein catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (L-DOPA or levodopa) to dopamine; L-5-hydroxytryptophan to serotonin; and L-tryptophan to tryptamine.
- AADCD aromatic L-amino-acid decarboxylase deficiency
- Parkinson's Disease is a progressive neurodegenerative disease of the central nervous system (CNS) producing sensory and motor symptoms.
- Dopamine replacement i.e., levodopa
- the benefit of dopamine therapy becomes less marked over time, due, in part, to the progressive death of dopamine-generating cells and corresponding loss of AADC activity.
- systemic administration of high-dose dopamine is complicated by side effects, such as fluctuations in motor performance, dyskinesias, and hallucinations, resulting from dopaminergic stimulation of the mesolimbic system.
- One strategy to restore dopaminergic function and minimize side effects is the use of gene therapy to deliver AADC directly to a targeted region of the CNS.
- AAV adeno-associated virus
- the present disclosure provides such improved nucleic acid constructs, e.g., polynucleotides, for use with AAV-derived vectors comprising dopa carboxylase (“DDC”) gene sequence which encodes a full-length AADC protein for the purpose of gene therapy in the treatment of Parkinson's Disease.
- DDC dopa carboxylase
- nucleic acid constructs described herein comprise at least a 5′-ITR and a 3′-ITR, each or both of which may be derived from an AAV, positioned about a DDC gene sequence, as well as additional components required for gene expression and clone selection.
- compositions, methods, processes, kits and devices for the design, preparation, manufacture and/or formulation of AADC polynucleotides are Described herein.
- AADC polynucleotides may be encoded by or contained within plasmids or vectors or recombinant adeno-associated viruses (AAV).
- AAV adeno-associated viruses
- FIG. 1 is a schematic of a viral genome of the disclosure.
- AAVs Adeno-Associated Viruses
- AAV Particles Adeno-Associated Viruses
- Viruses of the Parvoviridae family are small non-enveloped icosahedral capsid viruses characterized by a single stranded DNA genome.
- Parvoviridae family viruses consist of two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect invertebrates. Due to its relatively simple structure, easily manipulated using standard molecular biology techniques, this virus family is useful as a biological tool.
- the genome of the virus may be modified to contain a minimum of components for the assembly of a functional recombinant virus, or viral particle, which is loaded with or engineered to express or deliver a desired payload, which may be delivered to a target cell, tissue, organ, or organism.
- parvoviruses and other members of the Parvoviridae family are generally described in Kenneth I. Berns, “Parvoviridae: The Viruses and Their Replication,” Chapter 69 in FIELDS VIROLOGY (3d Ed. 1996), the contents of which are incorporated by reference in their entirety.
- the Parvoviridae family comprises the Dependovirus genus which includes adeno-associated viruses (AAV) capable of replication in vertebrate hosts including, but not limited to, human, primate, bovine, canine, equine, and ovine species.
- AAV adeno-associated viruses
- the vector genome is a linear, single-stranded DNA (ssDNA) molecule approximately 5,000 nucleotides (nt) in length.
- the AAV viral genome can comprise a payload region and at least one inverted terminal repeat (ITR) or ITR region. ITRs traditionally flank the coding nucleotide sequences for the non-structural proteins (encoded by Rep genes) and the structural proteins (encoded by capsid genes or Cap genes). While not wishing to be bound by theory, an AAV viral genome typically comprises two ITR sequences.
- the vector genome comprises a characteristic T-shaped hairpin structure defined by the self-complementary terminal 145 nt of the 5′ and 3′ ends of the ssDNA which form an energetically stable double stranded region.
- the double stranded hairpin structures comprise multiple functions including, but not limited to, acting as an origin for DNA replication by functioning as primers for the endogenous DNA polymerase complex of the host viral replication cell.
- AAV particles may comprise the viral genome, in whole or in part, of any naturally occurring and/or recombinant AAV serotype nucleotide sequence or variant.
- AAV variants may have sequences of significant homology at the nucleic acid (genome or capsid) and amino acid levels (capsids), to produce constructs which are generally physical and functional equivalents, replicate by similar mechanisms, and assemble by similar mechanisms. Chiorini et al., J. Vir. 71: 6823-33 (1997); Srivastava et al., J. Vir. 45:555-64 (1983); Chiorini et al., J. Vir.
- AAV particles of the present disclosure are recombinant AAV particles which are replication defective, lacking sequences encoding functional Rep and Cap proteins within their viral genome. These defective AAV particles may lack most or all parental coding sequences and essentially carry only one or two AAV ITR sequences and the nucleic acid of interest for delivery to a cell, a tissue, an organ or an organism.
- the viral genome of the AAV particles of the present disclosure comprise at least one control element which provides for the replication, transcription and translation of a coding sequence encoded therein. Not all of the control elements need always be present as long as the coding sequence is capable of being replicated, transcribed and/or translated in an appropriate host cell.
- expression control elements include sequences for transcription initiation and/or termination, promoter and/or enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation signals, sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficacy (e.g., Kozak consensus sequence), sequences that enhance protein stability, and/or sequences that enhance protein processing and/or secretion.
- AAV particles for use in therapeutics and/or diagnostics comprise a virus that has been distilled or reduced to the minimum components necessary for transduction of a nucleic acid payload or cargo of interest.
- AAV particles are engineered as vehicles for specific delivery while lacking the deleterious replication and/or integration features found in wild-type viruses.
- AAV particles of the present disclosure may be produced recombinantly and may be based on adeno-associated virus (AAV) parent or reference sequences.
- AAV adeno-associated virus
- a “vector” is any molecule or moiety which transports, transduces or otherwise acts as a carrier of a heterologous molecule such as the nucleic acids described herein.
- scAAV particles contain DNA strands which anneal together to form double stranded DNA. By skipping second strand synthesis, scAAVs allow for rapid expression in the cell.
- the AAV particle of the present disclosure is an scAAV.
- the AAV particle of the present disclosure is an ssAAV.
- AAV particles may be modified to enhance the efficiency of delivery. Such modified AAV particles can be packaged efficiently and be used to successfully infect the target cells at high frequency and with minimal toxicity.
- the capsids of the AAV particles are engineered according to the methods described in US Publication Number US 20130195801, the contents of which are incorporated herein by reference in their entirety.
- the AAV particles comprising a payload region encoding the polypeptides of the disclosure may be introduced into mammalian cells.
- AAV particles of the present disclosure may comprise or be derived from any natural or recombinant AAV serotype.
- the AAV particles may utilize or be based on a serotype selected from any of the following PHP.B, PHP.A, AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12, AAV42-lb, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, A
- AAV52/hu. 19 AAV52.1/hu.20, AAV58.2/hu.25, AAVA3.3, AAVA3.4, AAVA3.5, AAVA3.7, AAVC1, AAVC2, AAVC5, AAV-DJ, AAV-DJ8, AAVF3, AAVF5, AAVH2, AAVrh.72, AAVhu.8, AAVrh.68, AAVrh.70, AAVpi.1, AAVpi.3, AAVpi.2, AAVrh.60, AAVrh.44, AAVrh.65, AAVrh.55, AAVrh.47, AAVrh.69, AAVrh.45, AAVrh.59, AAVhu.12, AAVH6, AAVLK03, AAVH-1/hu.
- the AAV serotype may be, or have, a modification as described in United States Publication No. US 20160361439, the contents of which are herein incorporated by reference in their entirety, such as but not limited to, Y252F, Y272F, Y444F, Y500F, Y700F, Y704F, Y730F, Y275F, Y281F, Y508F, Y576F, Y612G, Y673F, and Y720F of the wild-type AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and hybrids thereof.
- the AAV serotype may be, or have, a mutation as described in U.S. Pat. No. 9,546,112, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, at least two, but not all the F129L, D418E, K531E, L584F, V598A and H642N mutations in the sequence of AAV6 (SEQ ID NO:4 of U.S. Pat. No. 9,546,112), AAV1 (SEQ ID NO:6 of U.S. Pat. No. 9,546,112), AAV2, AAV3, AAV4, AAV5, AAV7, AAV9, AAV10 or AAV11 or derivatives thereof.
- the AAV serotype may be, or have, an AAV6 sequence comprising the K531E mutation (SEQ ID NO:5 of U.S. Pat. No. 9,546,112).
- the AAV serotype may be, or have, a mutation in the AAV1 sequence, as described in in United States Publication No. US 20130224836, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, at least one of the surface-exposed tyrosine residues, preferably, at positions 252, 273, 445, 701, 705 and 731 of AAV1 (SEQ ID NO: 2 of US 20130224836) substituted with another amino acid, preferably with a phenylalanine residue.
- the AAV serotype may be, or have, a mutation in the AAV9 sequence, such as, but not limited to, at least one of the surface-exposed tyrosine residues, preferably, at positions 252, 272, 444, 500, 700, 704 and 730 of AAV2 (SEQ ID NO: 4 of US 20130224836) substituted with another amino acid, preferably with a phenylalanine residue.
- the tyrosine residue at position 446 of AAV9 (SEQ ID NO: 6 US 20130224836) is substituted with a phenylalanine residue.
- the serotype may be AAV2 or a variant thereof, as described in International Publication No. WO2016130589, herein incorporated by reference in its entirety.
- the amino acid sequence of AAV2 may comprise N587A, E548A, or N708A mutations.
- the amino acid sequence of any AAV may comprise a V708K mutation.
- the AAV serotype may be, or have, a sequence as described in United States Publication No. US20030138772, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV1 (SEQ ID NO: 6 and 64 of US20030138772), AAV2 (SEQ ID NO: 7 and 70 of US20030138772), AAV3 (SEQ ID NO: 8 and 71 of US20030138772), AAV4 (SEQ ID NO: 63 of US20030138772), AAV5 (SEQ ID NO: 114 of US20030138772), AAV6 (SEQ ID NO: 65 of US20030138772), AAV7 (SEQ ID NO: 1-3 of US20030138772), AAV8 (SEQ ID NO: 4 and 95 of US20030138772), AAV9 (SEQ ID NO: 5 and 100 of US20030138772), AAV10 (SEQ ID NO: 117 of US20030138772), AAV10 (SEQ
- the AAV serotype may be, or have, a sequence as described in United States Publication No. US20150159173, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV2 (SEQ ID NO: 7 and 23 of US20150159173), rh20 (SEQ ID NO: 1 of US20150159173), rh32/33 (SEQ ID NO: 2 of US20150159173), rh39 (SEQ ID NO: 3, 20 and 36 of US20150159173), rh46 (SEQ ID NO: 4 and 22 of US20150159173), rh73 (SEQ ID NO: 5 of US20150159173), rh74 (SEQ ID NO: 6 of US20150159173), AAV6.1 (SEQ ID NO: 29 of US20150159173), rh.8 (SEQ ID NO: 41 of US20150159173), rh.48.1 (SEQ ID NO: 44 of US20150159
- the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 7,198,951, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV9 (SEQ ID NO: 1-3 of U.S. Pat. No. 7,198,951), AAV2 (SEQ ID NO: 4 of U.S. Pat. No. 7,198,951), AAV1 (SEQ ID NO: 5 of U.S. Pat. No. 7,198,951), AAV3 (SEQ ID NO: 6 of U.S. Pat. No. 7,198,951), and AAV8 (SEQ ID NO: 7 of US7198951).
- AAV9 SEQ ID NO: 1-3 of U.S. Pat. No. 7,198,951
- AAV2 SEQ ID NO: 4 of U.S. Pat. No. 7,198,951
- AAV1 SEQ ID NO: 5 of U.S. Pat. No. 7,198,951
- AAV3 S
- the AAV serotype may be, or have, a mutation in the AAV9 sequence as described by N Pulichla et al. (Molecular Therapy 19(6): 1070-1078 (2011), herein incorporated by reference in its entirety), such as but not limited to, AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.
- the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 6,156,303, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV3B (SEQ ID NO: 1 and 10 of U.S. Pat. No. 6,156,303), AAV6 (SEQ ID NO: 2, 7 and 11 of U.S. Pat. No. 6,156,303), AAV2 (SEQ ID NO: 3 and 8 of U.S. Pat. No. 6,156,303), AAV3A (SEQ ID NO: 4 and 9, of U.S. Pat. No. 6,156,303), or derivatives thereof.
- AAV3B SEQ ID NO: 1 and 10 of U.S. Pat. No. 6,156,303
- AAV6 SEQ ID NO: 2, 7 and 11 of U.S. Pat. No. 6,156,303
- AAV2 SEQ ID NO: 3 and 8 of U.S. Pat. No. 6,156,303
- AAV3A SEQ
- the AAV serotype may be, or have, a sequence as described in United States Publication No. US20140359799, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV8 (SEQ ID NO: 1 of US20140359799), AAVDJ (SEQ ID NO: 2 and 3 of US20140359799), or variants thereof.
- the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al. (Journal of Virology 82(12): 5887-5911 (2008), herein incorporated by reference in its entirety).
- the amino acid sequence of AAVDJ8 may comprise two or more mutations in order to remove the heparin binding domain (HBD).
- HBD heparin binding domain
- 7,588,772 may comprise two mutations: (1) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (2) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).
- K406R where lysine (K; Lys) at amino acid 406 is changed to arginine (R; Arg)
- R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln)
- R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).
- the AAV serotype may be, or have, a sequence of AAV4 as described in International Publication No. WO1998011244, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAV4 (SEQ ID NO: 1-20 of WO1998011244).
- the AAV serotype may be, or have, a mutation in the AAV2 sequence to generate AAV2G9 as described in International Publication No. WO2014144229 and herein incorporated by reference in its entirety.
- the AAV serotype may be, or have, a sequence as described in International Publication No. WO2005033321, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAV3-3 (SEQ ID NO: 217 of WO2005033321), AAV1 (SEQ ID NO: 219 and 202 of WO2005033321), AAV106.1/hu.37 (SEQ ID No: 10 of WO2005033321), AAV114.3/hu.40 (SEQ ID No: 11 of WO2005033321), AAV127.2/hu.41 (SEQ ID NO:6 and 8 of WO2005033321), AAV128.3/hu.44 (SEQ ID No: 81 of WO2005033321), AAV130.4/hu.48 (SEQ ID NO: 78 of WO2005033321), AAV145.1/hu.53 (SEQ ID No: 176 and 177 of WO2005033321), AAV14
- Non limiting examples of variants include SEQ ID NO: 13, 15, 17, 19, 24, 36, 40, 45, 47, 48, 51-54, 60-62, 64-77, 79, 80, 82, 89, 90, 93-95, 98, 100, 101, 109-113, 118-120, 124, 126, 131, 139, 142, 151, 154, 158, 161, 162, 165-183, 202, 204-212, 215, 219, 224-236, of WO2005033321, the contents of which are herein incorporated by reference in their entirety.
- the AAV serotype may be, or have, a sequence as described in International Publication No. WO2015168666, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAVrh8R (SEQ ID NO: 9 of WO2015168666), AAVrh8R A586R mutant (SEQ ID NO: 10 of WO2015168666), AAVrh8R R533A mutant (SEQ ID NO: 11 of WO2015168666), or variants thereof.
- AAVrh8R SEQ ID NO: 9 of WO2015168666
- AAVrh8R A586R mutant SEQ ID NO: 10 of WO2015168666
- AAVrh8R R533A mutant SEQ ID NO: 11 of WO2015168666
- the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 9,233,131, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAVhE1.1 (SEQ ID NO:44 of U.S. Pat. No. 9,233,131), AAVhEr1.5 (SEQ ID NO:45 of U.S. Pat. No. 9,233,131), AAVhER1.14 (SEQ ID NO:46 of U.S. Pat. No. 9,233,131), AAVhEr1.8 (SEQ ID NO:47 of U.S. Pat. No. 9,233,131), AAVhEr1.16 (SEQ ID NO:48 of U.S. Pat. No.
- AAVhEr1.18 SEQ ID NO:49 of U.S. Pat. No. 9,233,131
- AAVhEr1.35 SEQ ID NO:50 of U.S. Pat. No. 9,233,131
- AAVhEr1.7 SEQ ID NO:51 of U.S. Pat. No. 9,233,131
- AAVhEr1.36 SEQ ID NO:52 of U.S. Pat. No. 9,233,131
- AAVhEr2.29 SEQ ID NO:53 of U.S. Pat. No. 9,233,131
- AAVhEr2.4 SEQ ID NO:54 of US9233131
- AAVhEr2.16 SEQ ID NO:55 of U.S. Pat. No.
- AAVhEr2.30 SEQ ID NO:56 of U.S. Pat. No. 9,233,131
- AAVhEr2.31 SEQ ID NO:58 of U.S. Pat. No. 9,233,131
- AAVhEr2.36 SEQ ID NO:57 of U.S. Pat. No. 9,233,131
- AAVhER1.23 SEQ ID NO:53 of U.S. Pat. No. 9,233,131
- AAVhEr3.1 SEQ ID NO:59 of US9233131
- AAV2.5T SEQ ID NO:42 of U.S. Pat. No. 9,233,131
- the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150376607, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV-PAEC (SEQ ID NO:1 of US20150376607), AAV-LK01 (SEQ ID NO:2 of US20150376607), AAV-LK02 (SEQ ID NO:3 of US20150376607), AAV-LK03 (SEQ ID NO:4 of US20150376607), AAV-LK04 (SEQ ID NO:5 of US20150376607), AAV-LK05 (SEQ ID NO:6 of US20150376607), AAV-LK06 (SEQ ID NO:7 of US20150376607), AAV-LK07 (SEQ ID NO:8 of US20150376607), AAV-LK08 (SEQ ID NO:9 of US20150376607), AAV-LK09 (SEQ ID NO:10 of US2015
- the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 9,163,261, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV-2-pre-miRNA-101 (SEQ ID NO: 1 U.S. Pat. No. 9,163,261), or variants thereof.
- the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150376240, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV-8h (SEQ ID NO: 6 of US20150376240), AAV-8b (SEQ ID NO: 5 of US20150376240), AAV-h (SEQ ID NO: 2 of US20150376240), AAV-b (SEQ ID NO: 1 of US20150376240), or variants thereof.
- AAV-8h SEQ ID NO: 6 of US20150376240
- AAV-8b SEQ ID NO: 5 of US20150376240
- AAV-h SEQ ID NO: 2 of US20150376240
- AAV-b SEQ ID NO: 1 of US20150376240
- the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20160017295, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV SM 10-2 (SEQ ID NO: 22 of US20160017295), AAV Shuffle 100-1 (SEQ ID NO: 23 of US20160017295), AAV Shuffle 100-3 (SEQ ID NO: 24 of US20160017295), AAV Shuffle 100-7 (SEQ ID NO: 25 of US20160017295), AAV Shuffle 10-2 (SEQ ID NO: 34 of US20160017295), AAV Shuffle 10-6 (SEQ ID NO: 35 of US20160017295), AAV Shuffle 10-8 (SEQ ID NO: 36 of US20160017295), AAV Shuffle 100-2 (SEQ ID NO: 37 of US20160017295), AAV SM 10-1 (SEQ ID NO: 38 of US20160017295), AAV SM 10-8 (SEQ ID NO: 39 of US2016
- the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150238550, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, BNP61 AAV (SEQ ID NO: 1 of US20150238550), BNP62 AAV (SEQ ID NO: 3 of US20150238550), BNP63 AAV (SEQ ID NO: 4 of US20150238550), or variants thereof.
- the AAV serotype may be or may have a sequence as described in United States Patent Publication No. US20150315612, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAVrh.50 (SEQ ID NO: 108 of US20150315612), AAVrh.43 (SEQ ID NO: 163 of US20150315612), AAVrh.62 (SEQ ID NO: 114 of US20150315612), AAVrh.48 (SEQ ID NO: 115 of US20150315612), AAVhu.19 (SEQ ID NO: 133 of US20150315612), AAVhu.11 (SEQ ID NO: 153 of US20150315612), AAVhu.53 (SEQ ID NO: 186 of US20150315612), AAV4-8/rh.64 (SEQ ID No: 15 of US20150315612), AAVLG-9/hu.39 (SEQ ID No: 24 of US20150315612), AAV54.5
- the AAV serotype may be, or have, a sequence as described in International Publication No. WO2015121501, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, true type AAV (ttAAV) (SEQ ID NO: 2 of WO2015121501), “UPenn AAV10” (SEQ ID NO: 8 of WO2015121501), “Japanese AAV10” (SEQ ID NO: 9 of WO2015121501), or variants thereof.
- true type AAV ttAAV
- UPenn AAV10 SEQ ID NO: 8 of WO2015121501
- Japanese AAV10 Japanese AAV10
- AAV capsid serotype selection or use may be from a variety of species.
- the AAV may be an avian AAV (AAAV).
- the AAAV serotype may be, or have, a sequence as described in U.S. Pat. No. 9,238,800, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAAV (SEQ ID NO: 1, 2, 4, 6, 8, 10, 12, and 14 of U.S. Pat. No. 9,238,800), or variants thereof.
- the AAV may be a bovine AAV (BAAV).
- BAAV serotype may be, or have, a sequence as described in U.S. Pat. No. 9,193,769, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, BAAV (SEQ ID NO: 1 and 6 of U.S. Pat. No. 9,193,769), or variants thereof.
- BAAV serotype may be or have a sequence as described in U.S. Pat. No. 7,427,396, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, BAAV (SEQ ID NO: 5 and 6 of U.S. Pat. No. 7,427,396), or variants thereof.
- the AAV may be a caprine AAV.
- the caprine AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 7,427,396, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, caprine AAV (SEQ ID NO: 3 of U.S. Pat. No. 7,427,396), or variants thereof.
- the AAV may be engineered as a hybrid AAV from two or more parental serotypes.
- the AAV may be AAV2G9 which comprises sequences from AAV2 and AAV9.
- the AAV2G9 AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20160017005, the contents of which are herein incorporated by reference in its entirety.
- the AAV may be a serotype generated by the AAV9 capsid library with mutations in amino acids 390-627 (VP1 numbering) as described by Pulichla et al. (Molecular Therapy 19(6): 1070-1078 (2011), the contents of which are herein incorporated by reference in their entirety.
- the serotype and corresponding nucleotide and amino acid substitutions may be, but is not limited to, AAV9.1 (G1594C; D532H), AAV6.2 (T1418A and T1436X; V473D and I479K), AAV9.3 (T1238A; F413Y), AAV9.4 (T1250C and A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A; F411I), AAV9.9 (G1203A, G1785T; W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720T; N457H, T574S), AAV9.14 (
- the AAV serotype may be, or have, a sequence as described in International Publication No. WO2016049230, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAVF 1/HSC1 (SEQ ID NO: 2 and 20 of WO2016049230), AAVF2/HSC2 (SEQ ID NO: 3 and 21 of WO2016049230), AAVF3/HSC3 (SEQ ID NO: 5 and 22 of WO2016049230), AAVF4/HSC4 (SEQ ID NO: 6 and 23 of WO2016049230), AAVF5/HSC5 (SEQ ID NO: 11 and 25 of WO2016049230), AAVF6/HSC6 (SEQ ID NO: 7 and 24 of WO2016049230), AAVF7/HSC7 (SEQ ID NO: 8 and 27 of WO2016049230), AAVF8/HSC8 (SEQ ID NO: 9 and 28 of WO2016049230),
- the AAV serotype may be, or have, a sequence as described in U.S. Pat. No. 8,734,809, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV CBr-E1 (SEQ ID NO: 13 and 87 of U.S. Pat. No. 8,734,809), AAV CBr-E2 (SEQ ID NO: 14 and 88 of U.S. Pat. No. 8,734,809), AAV CBr-E3 (SEQ ID NO: 15 and 89 of U.S. Pat. No. 8,734,809), AAV CBr-E4 (SEQ ID NO: 16 and 90 of U.S. Pat. No.
- AAV CBr-E5 (SEQ ID NO: 17 and 91 of U.S. Pat. No. 8,734,809), AAV CBr-e5 (SEQ ID NO: 18 and 92 of U.S. Pat. No. 8,734,809), AAV CBr-E6 (SEQ ID NO: 19 and 93 of U.S. Pat. No. 8,734,809), AAV CBr-E7 (SEQ ID NO: 20 and 94 of U.S. Pat. No. 8,734,809), AAV CBr-E8 (SEQ ID NO: 21 and 95 of U.S. Pat. No. 8,734,809), AAV CLv-D1 (SEQ ID NO: 22 and 96 of U.S.
- AAV CLv-D2 (SEQ ID NO: 23 and 97 of U.S. Pat. No. 8,734,809), AAV CLv-D3 (SEQ ID NO: 24 and 98 of U.S. Pat. No. 8,734,809), AAV CLv-D4 (SEQ ID NO: 25 and 99 of U.S. Pat. No. 8,734,809), AAV CLv-D5 (SEQ ID NO: 26 and 100 of U.S. Pat. No. 8,734,809), AAV CLv-D6 (SEQ ID NO: 27 and 101 of U.S. Pat. No. 8,734,809), AAV CLv-D7 (SEQ ID NO: 28 and 102 of U.S. Pat.
- AAV CLv-D8 (SEQ ID NO: 29 and 103 of U.S. Pat. No. 8,734,809), AAV CLv-E1 (SEQ ID NO: 13 and 87 of U.S. Pat. No. 8,734,809), AAV CLv-R1 (SEQ ID NO: 30 and 104 of U.S. Pat. No. 8,734,809), AAV CLv-R2 (SEQ ID NO: 31 and 105 of U.S. Pat. No. 8,734,809), AAV CLv-R3 (SEQ ID NO: 32 and 106 of U.S. Pat. No. 8,734,809), AAV CLv-R4 (SEQ ID NO: 33 and 107 of U.S. Pat.
- AAV CLv-R5 (SEQ ID NO: 34 and 108 of U.S. Pat. No. 8,734,809), AAV CLv-R6 (SEQ ID NO: 35 and 109 of U.S. Pat. No. 8,734,809), AAV CLv-R7 (SEQ ID NO: 36 and 110 of U.S. Pat. No. 8,734,809), AAV CLv-R8 (SEQ ID NO: X and X of U.S. Pat. No. 8,734,809), AAV CLv-R9 (SEQ ID NO: X and X of U.S. Pat. No. 8,734,809), AAV CLg-F1 (SEQ ID NO: 39 and 113 of U.S.
- AAV CLg-F2 (SEQ ID NO: 40 and 114 of U.S. Pat. No. 8,734,809), AAV CLg-F3 (SEQ ID NO: 41 and 115 of U.S. Pat. No. 8,734,809), AAV CLg-F4 (SEQ ID NO: 42 and 116 of U.S. Pat. No. 8,734,809), AAV CLg-F5 (SEQ ID NO: 43 and 117 of U.S. Pat. No. 8,734,809), AAV CLg-F6 (SEQ ID NO: 43 and 117 of U.S. Pat. No. 8,734,809), AAV CLg-F7 (SEQ ID NO: 44 and 118 of U.S.
- AAV CLg-F8 (SEQ ID NO: 43 and 117 of U.S. Pat. No. 8,734,809), AAV CSp-1 (SEQ ID NO: 45 and 119 of U.S. Pat. No. 8,734,809), AAV CSp-10 (SEQ ID NO: 46 and 120 of U.S. Pat. No. 8,734,809), AAV CSp-11 (SEQ ID NO: 47 and 121 of U.S. Pat. No. 8,734,809), AAV CSp-2 (SEQ ID NO: 48 and 122 of U.S. Pat. No. 8,734,809), AAV CSp-3 (SEQ ID NO: 49 and 123 of U.S. Pat. No.
- AAV CSp-4 (SEQ ID NO: 50 and 124 of U.S. Pat. No. 8,734,809), AAV CSp-6 (SEQ ID NO: 51 and 125 of U.S. Pat. No. 8,734,809), AAV CSp-7 (SEQ ID NO: 52 and 126 of U.S. Pat. No. 8,734,809), AAV CSp-8 (SEQ ID NO: 53 and 127 of U.S. Pat. No. 8,734,809), AAV CSp-9 (SEQ ID NO: 54 and 128 of U.S. Pat. No. 8,734,809), AAV CHt-2 (SEQ ID NO: 55 and 129 of U.S. Pat. No.
- AAV CHt-3 SEQ ID NO: 56 and 130 of U.S. Pat. No. 8,734,809
- AAV CKd-1 SEQ ID NO: 57 and 131 of U.S. Pat. No. 8,734,809
- AAV CKd-10 SEQ ID NO: 58 and 132 of U.S. Pat. No. 8,734,809
- AAV CKd-2 SEQ ID NO: 59 and 133 of U.S. Pat. No. 8,734,809
- AAV CKd-3 SEQ ID NO: 60 and 134 of U.S. Pat. No. 8,734,809
- AAV CKd-4 SEQ ID NO: 61 and 135 of U.S. Pat. No.
- AAV CKd-6 (SEQ ID NO: 62 and 136 of U.S. Pat. No. 8,734,809), AAV CKd-7 (SEQ ID NO: 63 and 137 of U.S. Pat. No. 8,734,809), AAV CKd-8 (SEQ ID NO: 64 and 138 of U.S. Pat. No. 8,734,809), AAV CLv-1 (SEQ ID NO: 35 and 139 of U.S. Pat. No. 8,734,809), AAV CLv-12 (SEQ ID NO: 66 and 140 of U.S. Pat. No. 8,734,809), AAV CLv-13 (SEQ ID NO: 67 and 141 of U.S. Pat. No.
- AAV CLv-2 (SEQ ID NO: 68 and 142 of U.S. Pat. No. 8,734,809), AAV CLv-3 (SEQ ID NO: 69 and 143 of U.S. Pat. No. 8,734,809), AAV CLv-4 (SEQ ID NO: 70 and 144 of U.S. Pat. No. 8,734,809), AAV CLv-6 (SEQ ID NO: 71 and 145 of U.S. Pat. No. 8,734,809), AAV CLv-8 (SEQ ID NO: 72 and 146 of U.S. Pat. No. 8,734,809), AAV CKd-B1 (SEQ ID NO: 73 and 147 of U.S. Pat. No.
- AAV CKd-B2 (SEQ ID NO: 74 and 148 of U.S. Pat. No. 8,734,809), AAV CKd-B3 (SEQ ID NO: 75 and 149 of U.S. Pat. No. 8,734,809), AAV CKd-B4 (SEQ ID NO: 76 and 150 of U.S. Pat. No. 8,734,809), AAV CKd-B5 (SEQ ID NO: 77 and 151 of U.S. Pat. No. 8,734,809), AAV CKd-B6 (SEQ ID NO: 78 and 152 of U.S. Pat. No.
- AAV CKd-B7 (SEQ ID NO: 79 and 153 of U.S. Pat. No. 8,734,809), AAV CKd-B8 (SEQ ID NO: 80 and 154 of U.S. Pat. No. 8,734,809), AAV CKd-H1 (SEQ ID NO: 81 and 155 of U.S. Pat. No. 8,734,809), AAV CKd-H2 (SEQ ID NO: 82 and 156 of U.S. Pat. No. 8,734,809), AAV CKd-H3 (SEQ ID NO: 83 and 157 of U.S. Pat. No.
- AAV CKd-H4 (SEQ ID NO: 84 and 158 of U.S. Pat. No. 8,734,809), AAV CKd-H5 (SEQ ID NO: 85 and 159 of U.S. Pat. No. 8,734,809), AAV CKd-H6 (SEQ ID NO: 77 and 151 of U.S. Pat. No. 8,734,809), AAV CHt-1 (SEQ ID NO: 86 and 160 of U.S. Pat. No. 8,734,809), AAV CLv1-1 (SEQ ID NO: 171 of U.S. Pat. No. 8,734,809), AAV CLv1-2 (SEQ ID NO: 172 of U.S. Pat. No.
- AAV CLv1-3 SEQ ID NO: 173 of U.S. Pat. No. 8,734,809
- AAV CLv1-4 SEQ ID NO: 174 of U.S. Pat. No. 8,734,809
- AAV Clv1-7 SEQ ID NO: 175 of U.S. Pat. No. 8,734,809
- AAV Clv1-8 SEQ ID NO: 176 of US8734809
- AAV Clv1-9 SEQ ID NO: 177 of US8734809
- AAV Clv1-10 SEQ ID NO: 178 of U.S. Pat. No. 8,734,809)
- AAV.VR-355 SEQ ID NO: 181 of U.S. Pat. No. 8,734,809
- AAV.hu.48R3 SEQ ID NO: 183 of U.S. Pat. No. 8,734,809, or variants or derivatives thereof.
- the AAV serotype may be, or have, a sequence as described in International Publication No. WO2016065001, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAV CHt-P2 (SEQ ID NO: 1 and 51 of WO2016065001), AAV CHt-P5 (SEQ ID NO: 2 and 52 of WO2016065001), AAV CHt-P9 (SEQ ID NO: 3 and 53 of WO2016065001), AAV CBr-7.1 (SEQ ID NO: 4 and 54 of WO2016065001), AAV CBr-7.2 (SEQ ID NO: 5 and 55 of WO2016065001), AAV CBr-7.3 (SEQ ID NO: 6 and 56 of WO2016065001), AAV CBr-7.4 (SEQ ID NO: 7 and 57 of WO2016065001), AAV CBr-7.5 (SEQ ID NO: 8 and 58 of WO2016065001), AAV CBr-7.5 (
- the AAV serotype may be, or have, a modification as described in United States Publication No. US 20160361439, the contents of which are herein incorporated by reference in their entirety, such as but not limited to, Y252F, Y272F, Y444F, Y500F, Y700F, Y704F, Y730F, Y275F, Y281F, Y508F, Y576F, Y612G, Y673F, and Y720F of the wild-type AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and hybrids thereof.
- the AAV serotype may be, or have, a mutation as described in U.S. Pat. No. 9,546,112, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, at least two, but not all the F129L, D418E, K531E, L584F, V598A and H642N mutations in the sequence of AAV6 (SEQ ID NO:4 of U.S. Pat. No. 9,546,112), AAV1 (SEQ ID NO:6 of U.S. Pat. No. 9,546,112), AAV2, AAV3, AAV4, AAV5, AAV7, AAV9, AAV10 or AAV11 or derivatives thereof.
- the AAV serotype may be, or have, an AAV6 sequence comprising the K531E mutation (SEQ ID NO:5 of U.S. Pat. No. 9,546,112).
- the AAV serotype may be, or have, a mutation in the AAV1 sequence, as described in in United States Publication No. US 20130224836, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, at least one of the surface-exposed tyrosine residues, preferably, at positions 252, 273, 445, 701, 705 and 731 of AAV1 (SEQ ID NO: 2 of US 20130224836) substituted with another amino acid, preferably with a phenylalanine residue.
- the AAV serotype may be, or have, a mutation in the AAV9 sequence, such as, but not limited to, at least one of the surface-exposed tyrosine residues, preferably, at positions 252, 272, 444, 500, 700, 704 and 730 of AAV2 (SEQ ID NO: 4 of US 20130224836) substituted with another amino acid, preferably with a phenylalanine residue.
- the tyrosine residue at position 446 of AAV9 (SEQ ID NO: 6 US 20130224836) is substituted with a phenylalanine residue.
- the serotype may be AAV2 or a variant thereof, as described in International Publication No. WO2016130589, herein incorporated by reference in its entirety.
- the amino acid sequence of AAV2 may comprise N587A, E548A, or N708A mutations.
- the amino acid sequence of any AAV may comprise a V708K mutation.
- the AAV may be a serotype selected from any of those found in Table 1.
- the AAV may comprise a sequence, fragment or variant thereof, of the sequences in Table 1.
- the AAV may be encoded by a sequence, fragment or variant as described in Table 1.
- AAV Serotypes SEQ ID Serotype NO Reference Information AAVPHP.B or 1 WO2015038958 SEQ ID NO: 8 G2B-26 and 13 AAVPHP.B 2 WO2015038958 SEQ ID NO: 9 AAVG2B-13 3 WO2015038958 SEQ ID NO: 12 AAVTH1.1-32 4 WO2015038958 SEQ ID NO: 14 AAVTH1.1-35 5 WO2015038958 SEQ ID NO: 15 AAV1 6 US20150159173 SEQ ID NO: 11, US20150315612 SEQ ID NO: 202 AAV1 7 US20160017295 SEQ ID NO: 1US20030138772 SEQ ID NO: 64, US20150159173 SEQ ID NO: 27, US20150315612 SEQ ID NO: 219, U.S.
- the AAV serotype may be, or may have a sequence as described in International Patent Publication WO2015038958, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV9 (SEQ ID NO: 2 and 11 of WO2015038958 or SEQ ID NO: 132 and 131 respectively herein), PHP.B (SEQ ID NO: 8 and 9 of WO2015038958 or SEQ ID NO: 1 and 2 herein), G2B-13 (SEQ ID NO: 12 of WO2015038958 or SEQ ID NO: 3 herein), G2B-26 (SEQ ID NO: 13 of WO2015038958 or SEQ ID NO: 1 herein), TH1.1-32 (SEQ ID NO: 14 of WO2015038958 or SEQ ID NO: 4 herein), TH1.1-35 (SEQ ID NO: 15 of WO2015038958 or SEQ ID NO: 5 herein) or variants thereof.
- AAV9 SEQ ID NO: 2 and 11 of WO2015
- any of the targeting peptides or amino acid inserts described in WO2015038958 may be inserted into any parent AAV serotype, such as, but not limited to, AAV9 (SEQ ID NO: 131 for the DNA sequence and SEQ ID NO: 132 for the amino acid sequence).
- the amino acid insert is inserted between amino acids 586-592 of the parent AAV (e.g., AAV9).
- the amino acid insert is inserted between amino acids 588-589 of the parent AAV sequence.
- the amino acid insert may be, but is not limited to, any of the following amino acid sequences, TLAVPFK (SEQ ID NO: 1 of WO2015038958; herein SEQ ID NO: 876), KFPVALT (SEQ ID NO: 3 of WO2015038958; herein SEQ ID NO: 877), LAVPFK (SEQ ID NO: 31 of WO2015038958; herein SEQ ID NO: 878), AVPFK (SEQ ID NO: 32 of WO2015038958; herein SEQ ID NO: 879), VPFK (SEQ ID NO: 33 of WO2015038958; herein SEQ ID NO: 880), TLAVPF (SEQ ID NO: 34 of WO2015038958; herein SEQ ID NO: 881), TLAVP (SEQ ID NO: 35 of WO2015038958; herein SEQ ID NO: 882), TLAV (SEQ ID NO: 36 of WO2015038958; herein SEQ ID NO: 883),
- Non-limiting examples of nucleotide sequences that may encode the amino acid inserts include the following, AAGTTTCCTGTGGCGTTGACT (for SEQ ID NO: 3 of WO2015038958; herein SEQ ID NO: 892), ACTTTGGCGGTGCCTTTTAAG (SEQ ID NO: 24 and 49 of WO2015038958; herein SEQ ID NO: 893), AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 25 of WO2015038958; herein SEQ ID NO: 894), TTTACGTTGACGACGCCTAAG (SEQ ID NO: 26 of WO2015038958; herein SEQ ID NO: 895), ATGAATGCTACGAAGAATGTG (SEQ ID NO: 27 of WO2015038958; herein SEQ ID NO: 896), CAGTCGTCGCAGACGCCTAGG (SEQ ID NO: 48 of WO2015038958; herein SEQ ID NO: 897), ATTCTGGGGACTGGTACTTC
- the AAV serotype may be, or may have a sequence as described in International Patent Publication WO2017100671, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV9 (SEQ ID NO: 45 of WO2017100671, herein SEQ ID NO: 875), PHP.N (SEQ ID NO: 46 of WO2017100671, herein SEQ ID NO: 873), PHP.S (SEQ ID NO: 47 of WO2017100671, herein SEQ ID NO: 874), or variants thereof.
- AAV9 SEQ ID NO: 45 of WO2017100671, herein SEQ ID NO: 875
- PHP.N SEQ ID NO: 46 of WO2017100671, herein SEQ ID NO: 873
- PHP.S SEQ ID NO: 47 of WO2017100671, herein SEQ ID NO: 874
- any of the targeting peptides or amino acid inserts described in WO2017100671 may be inserted into any parent AAV serotype, such as, but not limited to, AAV9 (SEQ ID NO: 127 or SEQ ID NO: 875).
- the amino acid insert is inserted between amino acids 586-592 of the parent AAV (e.g., AAV9).
- the amino acid insert is inserted between amino acids 588-589 of the parent AAV sequence.
- the amino acid insert may be, but is not limited to, any of the following amino acid sequences, AQTLAVPFKAQ (SEQ ID NO: 1 of WO2017100671; herein SEQ ID NO: 902), AQSVSKPFLAQ (SEQ ID NO: 2 of WO2017100671; herein SEQ ID NO: 903), AQFTLTTPKAQ (SEQ ID NO: 3 in the sequence listing of WO2017100671; herein SEQ ID NO: 904), DGTLAVPFKAQ (SEQ ID NO: 4 in the sequence listing of WO2017100671; herein SEQ ID NO: 905), ESTLAVPFKAQ (SEQ ID NO: 5 of WO2017100671; herein SEQ ID NO: 906), GGTLAVPFKAQ (SEQ ID NO: 6 of WO2017100671; herein SEQ ID NO: 907), AQTLATPFKAQ (SEQ ID NO: 7 and 33 of WO2017100671; herein SEQ ID NO: 90
- Non-limiting examples of nucleotide sequences that may encode the amino acid inserts include the following, GATGGGACTTTGGCGGTGCCTTTTAAGGCACAG (SEQ ID NO: 54 of WO2017100671; herein SEQ ID NO: 963), GATGGGACGTTGGCGGTGCCTTTTAAGGCACAG (SEQ ID NO: 55 of WO2017100671; herein SEQ ID NO: 964), CAGGCGGTTAGGACGTCTTTG (SEQ ID NO: 56 of WO2017100671; herein SEQ ID NO: 965), CAGGTCTTCACGGACTCAGACTATCAG (SEQ ID NO: 57 and 78 of WO2017100671; herein SEQ ID NO: 966), CAAGTAAAACCTCTACAAATGTGGTAAAATCG (SEQ ID NO: 58 of WO2017100671; herein SEQ ID NO: 967), ACTCATCGACCAATACTTGTACTATCTCTAGAAC (SEQ ID NO: 54
- the AAV serotype may be, or may have a sequence as described in U.S. Pat. No. 9,624,274, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV1 (SEQ ID NO: 181 of U.S. Pat. No. 9,624,274), AAV6 (SEQ ID NO: 182 of U.S. Pat. No. 9,624,274), AAV2 (SEQ ID NO: 183 of U.S. Pat. No. 9,624,274), AAV3b (SEQ ID NO: 184 of U.S. Pat. No. 9,624,274), AAV7 (SEQ ID NO: 185 of U.S. Pat. No.
- 9,624,274 may be inserted into, but not limited to, 1-453 and 1-587 of any parent AAV serotype, such as, but not limited to, AAV2 (SEQ ID NO: 183 of U.S. Pat. No. 9,624,274).
- the amino acid insert may be, but is not limited to, any of the following amino acid sequences, VNLTWSRASG (SEQ ID NO: 50 of U.S. Pat. No. 9,624,274; herein SEQ ID NO: 1375), EFCINHRGYWVCGD (SEQ ID NO:55 of U.S. Pat. No. 9,624,274; herein SEQ ID NO: 1376), EDGQVMDVDLS (SEQ ID NO: 85 of U.S. Pat. No.
- SSRTPSDKPVAHWANPQAE SEQ ID NO: 116 of U.S. Pat. No. 9,624,274; herein SEQ ID NO: 1410
- SRTPSDKPVAHWANP SEQ ID NO: 117 of U.S. Pat. No. 9,624,274; herein SEQ ID NO: 1411
- SSRTPSDKP SEQ ID NO: 118 of U.S. Pat. No. 9,624,274; herein SEQ ID NO: 1412
- NADGNVDYHMNSVP SEQ ID NO: 119 of U.S. Pat. No.
- the AAV serotype may be, or may have a sequence as described in U.S. Pat. No. 9,475,845, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV capsid proteins comprising modification of one or more amino acids at amino acid positions 585 to 590 of the native AAV2 capsid protein. Further the modification may result in, but not limited to, the amino acid sequence RGNRQA (SEQ ID NO: 3 of U.S. Pat. No. 9,475,845; herein SEQ ID NO: 1418), SSSTDP (SEQ ID NO: 4 of U.S. Pat. No.
- SEQ ID NO: 1434 SQNTTA (SEQ ID NO: 21 of U.S. Pat. No. 9,475,845; herein SEQ ID NO: 1435), QQDTAP (SEQ ID NO: 22 of U.S. Pat. No. 9,475,845; herein SEQ ID NO: 1436), QTNTGP (SEQ ID NO: 23 of U.S. Pat. No. 9,475,845; herein SEQ ID NO: 1437), QTNGAP (SEQ ID NO: 24 of U.S. Pat. No. 9,475,845; herein SEQ ID NO: 1438), QQNAAP (SEQ ID NO: 25 of U.S. Pat. No.
- the amino acid modification is a substitution at amino acid positions 262 through 265 in the native AAV2 capsid protein or the corresponding position in the capsid protein of another AAV with a targeting sequence.
- the targeting sequence may be, but is not limited to, any of the amino acid sequences, NGRAHA (SEQ ID NO: 38 of U.S. Pat. No. 9,475,845; herein SEQ ID NO: 1441), QPEHSST (SEQ ID NO: 39 and 50 of U.S. Pat. No.
- the AAV serotype may be, or may have a sequence as described in United States Publication No. US 20160369298, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, site-specific mutated capsid protein of AAV2 (SEQ ID NO: 97 of US 20160369298; herein SEQ ID NO: 1560) or variants thereof, wherein the specific site is at least one site selected from sites R447, G453, S578, N587, N587+1, S662 of VP1 or fragment thereof.
- any of the mutated sequences described in US 20160369298, may be or may have, but not limited to, any of the following sequences SDSGASN (SEQ ID NO: 1 and SEQ ID NO: 231 of US20160369298; herein SEQ ID NO: 1561), SPSGASN (SEQ ID NO: 2 of US20160369298; herein SEQ ID NO: 1562), SHSGASN (SEQ ID NO: 3 of US20160369298; herein SEQ ID NO: 1563), SRSGASN (SEQ ID NO: 4 of US20160369298; herein SEQ ID NO: 1564), SKSGASN (SEQ ID NO: 5 of US20160369298; herein SEQ ID NO: 1565), SNSGASN (SEQ ID NO: 6 of US20160369298; herein SEQ ID NO: 1566), SGSGASN (SEQ ID NO: 7 of US20160369298; herein SEQ ID NO: 1567), SASGASN (SEQ ID NO: 1
- Non-limiting examples of nucleotide sequences that may encode the amino acid mutated sites include the following, AGCVVMDCAGGARSCASCAAC (SEQ ID NO: 97 of US20160369298; herein SEQ ID NO: 1706), AACRACRRSMRSMAGGCA (SEQ ID NO: 98 of US20160369298; herein SEQ ID NO: 1707), CACRRGGACRRCRMSRRSARSTTT (SEQ ID NO: 99 of US20160369298; herein SEQ ID NO: 1708), TATTTCTTGAGCAGAACAAACRVCVVSRSCGGAMNCVHSACGMHSTCAVVSCTTVDSTT TTCTCAGSBCRGSGCG (SEQ ID NO: 100 of US20160369298; herein SEQ ID NO: 1709), TCAAMAMMAVNSRVCSRSAACAACAACAGTRASTTCTCGTGGMMAGGA (SEQ ID NO: 101 of US20160369298; herein SEQ ID NO: 1710), AAGSAARRCRSCR
- the AAV serotype may comprise an ocular cell targeting peptide as described in International Patent Publication WO2016134375, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to SEQ ID NO: 9, and SEQ ID NO:10 of WO2016134375.
- any of the ocular cell targeting peptides or amino acids described in WO2016134375 may be inserted into any parent AAV serotype, such as, but not limited to, AAV2 (SEQ ID NO:8 of WO2016134375; herein SEQ ID NO: 1729), or AAV9 (SEQ ID NO: 11 of WO2016134375; herein SEQ ID NO: 1730).
- modifications such as insertions are made in AAV2 proteins at P34-A35, T138-A139, A139-P140, G453-T454, N587-R588, and/or R588-Q589.
- insertions are made at D384, G385, 1560, T561, N562, E563, E564, E565, N704, and/or Y705 of AAV9.
- the ocular cell targeting peptide may be, but is not limited to, any of the following amino acid sequences, GSTPPPM (SEQ ID NO: 1 of WO2016134375; herein SEQ ID NO: 1731), or GETRAPL (SEQ ID NO: 4 of WO2016134375; herein SEQ ID NO: 1732).
- the AAV serotype may be modified as described in the United States Publication US 20170145405 the contents of which are herein incorporated by reference in their entirety.
- AAV serotypes may include, modified AAV2 (e.g., modifications at Y444F, Y500F, Y730F and/or S662V), modified AAV3 (e.g., modifications at Y705F, Y731F and/or T492V), and modified AAV6 (e.g., modifications at S663V and/or T492V).
- the AAV serotype may be modified as described in the International Publication WO2017083722 the contents of which are herein incorporated by reference in their entirety.
- AAV serotypes may include, AAV1 (Y705+731F+T492V), AAV2 (Y444+500+730F+T491V), AAV3 (Y705+731F), AAV5, AAV 5 (Y436+693+719F), AAV6 (VP3 variant Y705F/Y731F/T492V), AAV8 (Y733F), AAV9, AAV9 (VP3 variant Y731F), and AAV10 (Y733F).
- the AAV serotype may comprise, as described in International Patent Publication WO2017015102, the contents of which are herein incorporated by reference in their entirety, an engineered epitope comprising the amino acids SPAKFA (SEQ ID NO: 24 of WO2017015102; herein SEQ ID NO: 1733) or NKDKLN (SEQ ID NO:2 of WO2017015102; herein SEQ ID NO: 1734).
- the epitope may be inserted in the region of amino acids 665 to 670 based on the numbering of the VP1 capsid of AAV8 (SEQ ID NO:3 of WO2017015102) and/or residues 664 to 668 of AAV3B (SEQ ID NO:3).
- the AAV serotype may be, or may have a sequence as described in International Patent Publication WO2017058892, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV variants with capsid proteins that may comprise a substitution at one or more (e.g., 2, 3, 4, 5, 6, or 7) of amino acid residues 262-268, 370-379, 451-459, 472-473, 493-500, 528-534, 547-552, 588-597, 709-710, 716-722 of AAV1, in any combination, or the equivalent amino acid residues in AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAVrh32.33, bovine AAV or avian AAV.
- AAV variants with capsid proteins that may comprise a substitution at one or more (e.g., 2, 3, 4, 5, 6, or 7)
- the amino acid substitution may be, but is not limited to, any of the amino acid sequences described in WO2017058892.
- the AAV may comprise an amino acid substitution at residues 256L, 258K, 259Q, 261S, 263A, 264S, 265T, 266G, 272H, 385S, 386Q, S472R, V473D, N500E 547S, 709A, 710N, 716D, 717N, 718N, 720L, A456T, Q457T, N458Q, K459S, T492S, K493A, S586R, S587G, S588N, T589R and/or 722T of AAV1 (SEQ ID NO: 1 of WO2017058892) in any combination, 244N, 246Q, 248R, 249E, 2501, 251K, 252S, 253G, 254S, 255V, 256D, 263Y, 3
- the AAV may include a sequence of amino acids at positions 155, 156 and 157 of VP1 or at positions 17, 18, 19 and 20 of VP2, as described in International Publication No. WO 2017066764, the contents of which are herein incorporated by reference in their entirety.
- sequences of amino acid may be, but not limited to, N-S-S, S-X-S, S-S-Y, N-X-S, N-S-Y, S-X-Y and N-X-Y, where N, X and Y are, but not limited to, independently non-serine, or non-threonine amino acids, wherein the AAV may be, but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12.
- the AAV may include a deletion of at least one amino acid at positions 156, 157 or 158 of VP1 or at positions 19, 20 or 21 of VP2, wherein the AAV may be, but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12.
- ITRs Inverted Terminal Repeats
- the AAV particles of the present disclosure comprise a viral genome with at least one ITR region and a payload region.
- the viral genome has two ITRs. These two ITRs flank the payload region at the 5′ and 3′ ends.
- the ITRs function as origins of replication comprising recognition sites for replication.
- ITRs comprise sequence regions which can be complementary and symmetrically arranged.
- ITRs incorporated into viral genomes of the disclosure may be comprised of naturally occurring polynucleotide sequences or recombinantly derived polynucleotide sequences.
- the ITRs may be derived from the same serotype as the capsid, selected from any of the serotypes listed in Table 1, or a derivative thereof.
- the ITR may be of a different serotype than the capsid.
- the AAV particle has more than one ITR.
- the AAV particle has a viral genome comprising two ITRs.
- the ITRs are of the same serotype as one another.
- the ITRs are of different serotypes.
- Non-limiting examples include zero, one or both of the ITRs having the same serotype as the capsid.
- both ITRs of the viral genome of the AAV particle are AAV2 ITRs.
- each ITR may be about 100 to about 150 nucleotides in length.
- An ITR may be about 100-105 nucleotides in length, 106-110 nucleotides in length, 111-115 nucleotides in length, 116-120 nucleotides in length, 121-125 nucleotides in length, 126-130 nucleotides in length, 131-135 nucleotides in length, 136-140 nucleotides in length, 141-145 nucleotides in length or 146-150 nucleotides in length.
- the ITRs are 140-142 nucleotides in length.
- Non-limiting examples of ITR length are 102, 140, 141, 142, 145 nucleotides in length, and those having at least 95% identity thereto.
- the payload region of the viral genome comprises at least one element to enhance the transgene target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are herein incorporated by reference in its entirety).
- elements to enhance the transgene target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (PolyA) signal sequences and upstream enhancers (USEs), CMV enhancers and introns.
- a specific promoter including but not limited to, a promoter that is species specific, inducible, tissue-specific, or cell cycle-specific (Parr et al., Nat. Med. 3:1145-9 (1997); the contents of which are herein incorporated by reference in their entirety).
- the promoter is deemed to be efficient when it drives expression of the polypeptide(s) encoded in the payload region of the viral genome of the AAV particle.
- that polypeptide is AADC.
- the promoter is a promoter deemed to be efficient when it drives expression in the cell being targeted.
- the promoter is a promoter having a tropism for the cell being targeted.
- the promoter drives expression of the payload for a period of time in targeted tissues.
- Expression driven by a promoter may be for a period of 1 hour, 2, hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months,
- Expression may be for 1-5 hours, 1-12 hours, 1-2 days, 1-5 days, 1-2 weeks, 1-3 weeks, 1-4 weeks, 1-2 months, 1-4 months, 1-6 months, 2-6 months, 3-6 months, 3-9 months, 4-8 months, 6-12 months, 1-2 years, 1-5 years, 2-5 years, 3-6 years, 3-8 years, 4-8 years or 5-10 years.
- the promoter is a weak promoter for sustained expression of a payload in nervous tissues.
- the promoter drives expression of the polypeptides of the disclosure for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 21 years, 22 years, 23 years, 24 years, 25 years, 26 years, 27 years, 28 years, 29 years, 30 years, 31 years, 32 years, 33 years, 34 years, 35 years, 36 years, 37 years, 38 years, 39 years, 40 years, 41 years, 42 years, 43 years, 44 years, 45 years, 46 years, 47 years, 48 years, 49 years, 50 years, 55 years, 60 years, 65 years, or more than 65 years.
- Promoters may be naturally occurring or non-naturally occurring.
- Non-limiting examples of promoters include viral promoters, plant promoters and mammalian promoters.
- the promoters may be human promoters.
- the promoter may be truncated.
- Promoters which drive or promote expression in most tissues include, but are not limited to, human elongation factor 1 ⁇ -subunit (EF1 ⁇ ), cytomegalovirus (CMV) immediate-early enhancer and/or promoter, chicken ⁇ -actin (CBA) and its derivative CAG, ⁇ glucuronidase (GUSB), or ubiquitin C (UBC).
- EF1 ⁇ human elongation factor 1 ⁇ -subunit
- CMV cytomegalovirus
- CBA chicken ⁇ -actin
- GUSB ⁇ glucuronidase
- UBC ubiquitin C
- Tissue-specific expression elements can be used to restrict expression to certain cell types such as, but not limited to, muscle specific promoters, B cell promoters, monocyte promoters, leukocyte promoters, macrophage promoters, pancreatic acinar cell promoters, endothelial cell promoters, lung tissue promoters, astrocyte promoters, or nervous system promoters which can be used to restrict expression to neurons, astrocytes, or oligodendrocytes.
- muscle specific promoters such as, but not limited to, muscle specific promoters, B cell promoters, monocyte promoters, leukocyte promoters, macrophage promoters, pancreatic acinar cell promoters, endothelial cell promoters, lung tissue promoters, astrocyte promoters, or nervous system promoters which can be used to restrict expression to neurons, astrocytes, or oligodendrocytes.
- Non-limiting examples of muscle-specific promoters include mammalian muscle creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, mammalian troponin I (TNNI2) promoter, and mammalian skeletal alpha-actin (ASKA) promoter (see, e.g. U.S. Patent Publication US 20110212529, the contents of which are herein incorporated by reference in their entirety).
- MCK mammalian muscle creatine kinase
- DES mammalian desmin
- TNNI2 mammalian troponin I
- ASKA mammalian skeletal alpha-actin
- tissue-specific expression elements for neurons include neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B-chain (PDGF- ⁇ ), synapsin (Syn), methyl-CpG binding protein 2 (MeCP2), Ca 2+ /calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), neurofilament light (NFL) or heavy (NFH), ⁇ -globin minigene np32, preproenkephalin (PPE), enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2) promoters.
- NSE neuron-specific enolase
- PDGF platelet-derived growth factor
- PDGF- ⁇ platelet-derived growth factor B-chain
- Syn synapsin
- MeCP2 methyl-CpG binding protein 2
- MeCP2 Ca 2+ /calmodulin-dependent protein kin
- tissue-specific expression elements for astrocytes include glial fibrillary acidic protein (GFAP) and EAAT2 promoters.
- GFAP glial fibrillary acidic protein
- EAAT2 EAAT2 promoters
- a non-limiting example of a tissue-specific expression element for oligodendrocytes includes the myelin basic protein (MBP) promoter.
- the promoter may be less than 1 kb.
- the promoter may have a length of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 or more than 800 nucleotides.
- the promoter may have a length between 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800 or 700-800.
- the promoter may be a combination of two or more components of the same or different starting or parental promoters such as, but not limited to, CMV and CBA.
- Each component may have a length of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 or more than 800.
- Each component may have a length between 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800 or 700-800.
- the promoter is a combination of a 382 nucleotide CMV-enhancer sequence and a 260 nucleotide CBA-promoter sequence.
- the viral genome comprises a ubiquitous promoter.
- ubiquitous promoters include CMV, CBA (including derivatives CAG, CBh, etc.), EF-1 ⁇ , PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B1-CBX3).
- Yu et al. (Molecular Pain 2011, 7:63; the contents of which are herein incorporated by reference in their entirety) evaluated the expression of eGFP under the CAG, EFI ⁇ , PGK and UBC promoters in rat DRG cells and primary DRG cells using lentiviral vectors and found that UBC showed weaker expression than the other 3 promoters and only 10-12% glial expression was seen for all promoters.
- Soderblom et al. (E. Neuro 2015; the contents of which are herein incorporated by reference in its entirety) evaluated the expression of eGFP in AAV8 with CMV and UBC promoters and AAV2 with the CMV promoter after injection in the motor cortex.
- NSE 1.8 kb
- EF EF
- NSE 0.3 kb
- GFAP GFAP
- CMV CMV
- hENK PPE
- NFL NFH
- NFH 920 nucleotide promoter which are both absent in the liver but NFH is abundant in the sensory proprioceptive neurons, brain and spinal cord and NFH is present in the heart.
- SCN8A is a 470 nucleotide promoter which expresses throughout the DRG, spinal cord and brain with particularly high expression seen in the hippocampal neurons and cerebellar Purkinje cells, cortex, thalamus and hypothalamus (See e.g., Drews et al. Identification of evolutionary conserved, functional noncoding elements in the promoter region of the sodium channel gene SCN 8 A , Mamm Genome (2007) 18:723-731; and Raymond et al. Expression of Alternatively Spliced Sodium Channel a - subunit genes , Journal of Biological Chemistry (2004) 279(44) 46234-46241; the contents of each of which are herein incorporated by reference in their entireties).
- the promoter is not cell specific.
- the promoter is an ubiquitin c (UBC) promoter.
- UBC ubiquitin c
- the UBC promoter may have a size of 300-350 nucleotides.
- the UBC promoter is 332 nucleotides.
- the promoter is a ⁇ -glucuronidase (GUSB) promoter.
- the GUSB promoter may have a size of 350-400 nucleotides.
- the GUSB promoter is 378 nucleotides.
- the promoter is a neurofilament light (NFL) promoter.
- the NFL promoter may have a size of 600-700 nucleotides. As a non-limiting example, the NFL promoter is 650 nucleotides.
- the promoter is a neurofilament heavy (NFH) promoter.
- the NFH promoter may have a size of 900-950 nucleotides.
- the NFH promoter is 920 nucleotides.
- the promoter is a SCN8A promoter.
- the SCN8A promoter may have a size of 450-500 nucleotides.
- the SCN8A promoter is 470 nucleotides.
- the promoter is a frataxin (FXN) promoter.
- FXN frataxin
- the FXN promoter may also be referred to as the FRDA promoter.
- the promoter is a phosphoglycerate kinase 1 (PGK) promoter.
- PGK phosphoglycerate kinase 1
- the promoter is a chicken ⁇ -actin (CBA) promoter.
- the promoter is a cytomegalovirus (CMV) promoter.
- CMV cytomegalovirus
- the promoter is a H1 promoter.
- the promoter is an engineered promoter.
- the promoter is a liver or a skeletal muscle promoter.
- liver promoters include human ⁇ -1-antitrypsin (hAAT) and thyroxine binding globulin (TBG).
- hAAT human ⁇ -1-antitrypsin
- TSG thyroxine binding globulin
- skeletal muscle promoters include Desmin, MCK or synthetic C5-12.
- the promoter is a RNA pol III promoter.
- the RNA pol III promoter is U6.
- the RNA pol III promoter is H1.
- the viral genome comprises two promoters.
- the promoters are an EF1a promoter and a CMV promoter.
- the viral genome comprises an enhancer element, a promoter and/or a 5′UTR intron.
- the enhancer element also referred to herein as an “enhancer,” may be, but is not limited to, a CMV enhancer
- the promoter may be, but is not limited to, a CMV, CBA, UBC, GUSB, NSE, Synapsin, MeCP2, and GFAP promoter
- the 5′UTR/intron may be, but is not limited to, SV40, and CBA-MVM.
- the enhancer, promoter and/or intron used in combination may be: (1) CMV enhancer, CMV promoter, SV40 5′UTR intron; (2) CMV enhancer, CBA promoter, SV 40 5′UTR intron; (3) CMV enhancer, CBA promoter, CBA-MVM 5′UTR intron; (4) UBC promoter; (5) GUSB promoter; (6) NSE promoter; (7) Synapsin promoter; (8) MeCP2 promoter and (9) GFAP promoter.
- the viral genome comprises an engineered promoter.
- the viral genome comprises a promoter from a naturally expressed protein.
- a region located approximately ⁇ 5 kb upstream of the first exon of the payload in order to allow for expression of the payload with the promoter See e.g., Puspasari et al. Long Range Regulation of Human FXN Gene Expression , PLOS ONE, 2011; the contents of which is herein incorporated by reference in its entirety; a 17 bp region located approximately 4.9 kb upstream of the first exon of the frataxin gene in order to allow for expression with the FRDA promoter).
- the vector genome may comprise a promoter such as, but not limited to, CMV or U6.
- a promoter for the AAV particles comprising the payload of the present disclosure is a CMV promoter.
- the promoter for the AAV particles comprising the payload of the present disclosure is a U6 promoter.
- the vector genome may comprise a CMV and a U6 promoter.
- the vector genome may comprise a CBA promoter.
- UTRs Untranslated Regions
- wild type untranslated regions of a gene are transcribed but not translated.
- the 5′ UTR starts at the transcription start site and ends at the start codon and the 3′ UTR starts immediately following the stop codon and continues until the termination signal for transcription.
- UTRs features typically found in abundantly expressed genes of specific target organs may be engineered into UTRs to enhance the stability and protein production.
- a 5′ UTR from mRNA normally expressed in the liver e.g., albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII
- albumin serum amyloid A
- Apolipoprotein A/B/E transferrin
- alpha fetoprotein erythropoietin
- Factor VIII Factor VIII
- wild-type 5′ untranslated regions include features which play roles in translation initiation.
- Kozak sequences which are commonly known to be involved in the process by which the ribosome initiates translation of many genes, are usually included in 5′ UTRs.
- Kozak sequences have the consensus CCR(A/G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG), which is followed by another ‘G’.
- the 5′UTR in the viral genome includes a Kozak sequence.
- the 5′UTR in the viral genome does not include a Kozak sequence.
- AU rich elements can be separated into three classes (Chen et al, 1995, the contents of which are herein incorporated by reference in its entirety): Class I AREs, such as, but not limited to, c-Myc and MyoD, contain several dispersed copies of an AUUUA motif within U-rich regions.
- Class II AREs such as, but not limited to, GM-CSF and TNF-a, possess two or more overlapping UUAUUUA(U/A)(U/A) nonamers.
- Class III ARES such as, but not limited to, c-Jun and Myogenin, are less well defined. These U rich regions do not contain an AUUUA motif.
- Most proteins binding to the AREs are known to destabilize the messenger, whereas members of the ELAV family, most notably HuR, have been documented to increase the stability of mRNA.
- HuR binds to AREs of all the three classes. Engineering the HuR specific binding sites into the 3′ UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of the message in vivo.
- AREs 3′ UTR AU rich elements
- AREs can be used to modulate the stability of polynucleotides.
- polynucleotides e.g., payload regions of viral genomes
- one or more copies of an ARE can be introduced to make polynucleotides less stable and thereby curtail translation and decrease production of the resultant protein.
- AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein.
- the 3′ UTR of the viral genome may include an oligo(dT) sequence for templated addition of a poly-A tail.
- the viral genome may include at least one miRNA seed, binding site or full sequence.
- microRNAs are 19-25 nucleotide noncoding RNAs that bind to the sites of nucleic acid targets and down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation.
- a microRNA sequence comprises a “seed” region, i.e., a sequence in the region of positions 2-8 of the mature microRNA, which sequence has perfect Watson-Crick complementarity to the miRNA target sequence of the nucleic acid.
- the viral genome may be engineered to include, alter or remove at least one miRNA binding site, sequence or seed region.
- any UTR from any gene known in the art may be incorporated into the viral genome of the AAV particle. These UTRs, or portions thereof, may be placed in the same orientation as in the gene from which they were selected or they may be altered in orientation or location.
- the UTR used in the viral genome of the AAV particle may be inverted, shortened, lengthened, made with one or more other 5′ UTRs or 3′ UTRs known in the art.
- the term “altered” as it relates to a UTR means that the UTR has been changed in some way in relation to a reference sequence.
- a 3′ or 5′ UTR may be altered relative to a wild type or native UTR by the change in orientation or location as taught above or may be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides.
- the viral genome of the AAV particle comprises at least one artificial UTRs which is not a variant of a wild type UTR.
- the viral genome of the AAV particle comprises UTRs which have been selected from a family of transcripts whose proteins share a common function, structure, feature or property.
- Viral Genome Component Polyadenylation Sequence
- the viral genome of the AAV particles of the present disclosure comprise at least one polyadenylation sequence.
- the viral genome of the AAV particle may comprise a polyadenylation sequence between the 3′ end of the payload coding sequence and the 5′ end of the 3′ITR.
- the polyadenylation sequence or “polyA sequence” may range from absent to about 500 nucleotides in length.
- the polyadenylation sequence may be, but is not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102,
- the polyadenylation sequence is 50-100 nucleotides in length.
- the polyadenylation sequence is 50-150 nucleotides in length.
- the polyadenylation sequence is 50-160 nucleotides in length.
- the polyadenylation sequence is 50-200 nucleotides in length.
- the polyadenylation sequence is 60-100 nucleotides in length.
- the polyadenylation sequence is 60-150 nucleotides in length.
- the polyadenylation sequence is 60-160 nucleotides in length.
- the polyadenylation sequence is 60-200 nucleotides in length.
- the polyadenylation sequence is 70-100 nucleotides in length.
- the polyadenylation sequence is 70-150 nucleotides in length.
- the polyadenylation sequence is 70-160 nucleotides in length.
- the polyadenylation sequence is 70-200 nucleotides in length.
- the polyadenylation sequence is 80-100 nucleotides in length.
- the polyadenylation sequence is 80-150 nucleotides in length.
- the polyadenylation sequence is 80-160 nucleotides in length.
- the polyadenylation sequence is 80-200 nucleotides in length.
- the polyadenylation sequence is 90-100 nucleotides in length.
- the polyadenylation sequence is 90-150 nucleotides in length.
- the polyadenylation sequence is 90-160 nucleotides in length.
- the polyadenylation sequence is 90-200 nucleotides in length.
- the payload region comprises at least one element to enhance the expression such as one or more introns or portions thereof.
- introns include, MVM (67-97 bps), F.IX truncated intron 1 (300 bps), ⁇ -globin SD/immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice donor/immunoglobin splice acceptor (500 bps), SV40 late splice donor/splice acceptor (19S/16S) (180 bps) and hybrid adenovirus splice donor/IgG splice acceptor (230 bps).
- the intron or intron portion may be 100-500 nucleotides in length.
- the intron may have a length of 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 or 500.
- the intron may have a length between 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250, 80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500, 300-400, 300-500, or 400-500.
- the vector genome comprises at least one element to enhance the transgene target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are herein incorporated by reference in its entirety) such as an intron.
- Non-limiting examples of introns include, MVM (67-97 bps), F.IX truncated intron 1 (300 bps), ⁇ -globin SD/immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice donor/immunoglobin splice acceptor (500 bps), SV40 late splice donor/splice acceptor (19S/16S) (180 bps) and hybrid adenovirus splice donor/IgG splice acceptor (230 bps).
- the intron may be 100-500 nucleotides in length.
- the intron may have a length of 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 or 500.
- the intron may have a length between 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250, 80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500, 300-400, 300-500, or 400-500.
- the viral genome comprises one or more filler sequences.
- the viral genome comprises one or more filler sequences in order to have the length of the viral genome be the optimal size for packaging.
- the viral genome comprises at least one filler sequence in order to have the length of the viral genome be about 2.3 kb.
- the viral genome comprises at least one filler sequence in order to have the length of the viral genome be about 4.6 kb.
- the viral genome is a single stranded (ss) viral genome and comprises one or more filler sequences which have a length about between 0.1 kb-3.8 kb, such as, but not limited to, 0.1 kb, 0.2 kb, 0.3 kb, 0.4 kb, 0.5 kb, 0.6 kb, 0.7 kb, 0.8 kb, 0.9 kb, 1 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb, 1.7 kb, 1.8 kb, 1.9 kb, 2 kb, 2.1 kb, 2.2 kb, 2.3 kb, 2.4 kb, 2.5 kb, 2.6 kb, 2.7 kb, 2.8 kb, 2.9 kb, 3 kb, 3.1 kb, 3.2 kb, 3.3 kb, 3.4 kb,
- the total length filler sequence in the vector genome is 3.1 kb.
- the total length filler sequence in the vector genome is 2.7 kb.
- the total length filler sequence in the vector genome is 0.8 kb.
- the total length filler sequence in the vector genome is 0.4 kb.
- the length of each filler sequence in the vector genome is 0.8 kb.
- the length of each filler sequence in the vector genome is 0.4 kb.
- the viral genome is a self-complementary (sc) viral genome and comprises one or more filler sequences which have a length about between 0.1 kb-1.5 kb, such as, but not limited to, 0.1 kb, 0.2 kb, 0.3 kb, 0.4 kb, 0.5 kb, 0.6 kb, 0.7 kb, 0.8 kb, 0.9 kb, 1 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, or 1.5 kb.
- the total length filler sequence in the vector genome is 0.8 kb.
- the total length filler sequence in the vector genome is 0.4 kb.
- the length of each filler sequence in the vector genome is 0.8 kb.
- the length of each filler sequence in the vector genome is 0.4 kb
- the viral genome comprises any portion of a filler sequence.
- the viral genome may comprise 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of a filler sequence.
- the viral genome is a single stranded (ss) viral genome and comprises one or more filler sequences in order to have the length of the viral genome be about 4.6 kb.
- the viral genome comprises at least one filler sequence and the filler sequence is located 3′ to the 5′ ITR sequence.
- the viral genome comprises at least one filler sequence and the filler sequence is located 5′ to a promoter sequence.
- the viral genome comprises at least one filler sequence and the filler sequence is located 3′ to the polyadenylation signal sequence.
- the viral genome comprises at least one filler sequence and the filler sequence is located 5′ to the 3′ ITR sequence.
- the viral genome comprises at least one filler sequence, and the filler sequence is located between two intron sequences.
- the viral genome comprises at least one filler sequence, and the filler sequence is located within an intron sequence.
- the viral genome comprises two filler sequences, and the first filler sequence is located 3′ to the 5′ ITR sequence and the second filler sequence is located 3′ to the polyadenylation signal sequence.
- the viral genome comprises two filler sequences, and the first filler sequence is located 5′ to a promoter sequence and the second filler sequence is located 3′ to the polyadenylation signal sequence.
- the viral genome comprises two filler sequences, and the first filler sequence is located 3′ to the 5′ ITR sequence and the second filler sequence is located 5′ to the 5′ ITR sequence.
- the viral genome is a self-complementary (sc) viral genome and comprises one or more filler sequences in order to have the length of the viral genome be about 2.3 kb.
- the viral genome comprises at least one filler sequence and the filler sequence is located 3′ to the 5′ ITR sequence.
- the viral genome comprises at least one filler sequence and the filler sequence is located 5′ to a promoter sequence.
- the viral genome comprises at least one filler sequence and the filler sequence is located 3′ to the polyadenylation signal sequence.
- the viral genome comprises at least one filler sequence and the filler sequence is located 5′ to the 3′ ITR sequence.
- the viral genome comprises at least one filler sequence, and the filler sequence is located between two intron sequences.
- the viral genome comprises at least one filler sequence, and the filler sequence is located within an intron sequence.
- the viral genome comprises two filler sequences, and the first filler sequence is located 3′ to the 5′ ITR sequence and the second filler sequence is located 3′ to the polyadenylation signal sequence.
- the viral genome comprises two filler sequences, and the first filler sequence is located 5′ to a promoter sequence and the second filler sequence is located 3′ to the polyadenylation signal sequence.
- the viral genome comprises two filler sequences, and the first filler sequence is located 3′ to the 5′ ITR sequence and the second filler sequence is located 5′ to the 5′ ITR sequence.
- the viral genome may comprise one or more filler sequences between one of more regions of the viral genome.
- the filler region may be located before a region such as, but not limited to, a payload region, an inverted terminal repeat (ITR), a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, a multiple cloning site (MCS) region, and/or an exon region.
- ITR inverted terminal repeat
- MCS multiple cloning site
- the filler region may be located after a region such as, but not limited to, a payload region, an inverted terminal repeat (ITR), a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, a multiple cloning site (MCS) region, and/or an exon region.
- the filler region may be located before and after a region such as, but not limited to, a payload region, an inverted terminal repeat (ITR), a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, a multiple cloning site (MCS) region, and/or an exon region.
- the viral genome may comprise one or more filler sequences which bifurcates at least one region of the viral genome.
- the bifurcated region of the viral genome may comprise 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the of the region to the 5′ of the filler sequence region.
- the filler sequence may bifurcate at least one region so that 10% of the region is located 5′ to the filler sequence and 90% of the region is located 3′ to the filler sequence.
- the filler sequence may bifurcate at least one region so that 20% of the region is located 5′ to the filler sequence and 80% of the region is located 3′ to the filler sequence.
- the filler sequence may bifurcate at least one region so that 30% of the region is located 5′ to the filler sequence and 70% of the region is located 3′ to the filler sequence.
- the filler sequence may bifurcate at least one region so that 40% of the region is located 5′ to the filler sequence and 60% of the region is located 3′ to the filler sequence.
- the filler sequence may bifurcate at least one region so that 50% of the region is located 5′ to the filler sequence and 50% of the region is located 3′ to the filler sequence.
- the filler sequence may bifurcate at least one region so that 60% of the region is located 5′ to the filler sequence and 40% of the region is located 3′ to the filler sequence.
- the filler sequence may bifurcate at least one region so that 70% of the region is located 5′ to the filler sequence and 30% of the region is located 3′ to the filler sequence.
- the filler sequence may bifurcate at least one region so that 80% of the region is located 5′ to the filler sequence and 20% of the region is located 3′ to the filler sequence.
- the filler sequence may bifurcate at least one region so that 90% of the region is located 5′ to the filler sequence and 10% of the region is located 3′ to the filler sequence.
- the viral genome comprises a filler sequence after the 5′ ITR.
- the viral genome comprises a filler sequence after the promoter region. In one embodiment, the viral genome comprises a filler sequence after the payload region. In one embodiment, the viral genome comprises a filler sequence after the intron region. In one embodiment, the viral genome comprises a filler sequence after the enhancer region. In one embodiment, the viral genome comprises a filler sequence after the polyadenylation signal sequence region. In one embodiment, the viral genome comprises a filler sequence after the MCS region. In one embodiment, the viral genome comprises a filler sequence after the exon region.
- the viral genome comprises a filler sequence before the promoter region. In one embodiment, the viral genome comprises a filler sequence before the payload region. In one embodiment, the viral genome comprises a filler sequence before the intron region. In one embodiment, the viral genome comprises a filler sequence before the enhancer region. In one embodiment, the viral genome comprises a filler sequence before the polyadenylation signal sequence region. In one embodiment, the viral genome comprises a filler sequence before the MCS region. In one embodiment, the viral genome comprises a filler sequence before the exon region.
- the viral genome comprises a filler sequence before the 3′ ITR.
- a filler sequence may be located between two regions, such as, but not limited to, the 5′ ITR and the promoter region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the 5′ ITR and the payload region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the 5′ ITR and the intron region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the 5′ ITR and the enhancer region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the 5′ ITR and the polyadenylation signal sequence region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the 5′ ITR and the MCS region.
- a filler sequence may be located between two regions, such as, but not limited to, the 5′ ITR and the exon region.
- a filler sequence may be located between two regions, such as, but not limited to, the promoter region and the payload region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the promoter region and the intron region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the promoter region and the enhancer region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the promoter region and the polyadenylation signal sequence region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the promoter region and the MCS region.
- a filler sequence may be located between two regions, such as, but not limited to, the promoter region and the exon region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the promoter region and the 3′ ITR.
- a filler sequence may be located between two regions, such as, but not limited to, the payload region and the intron region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the payload region and the enhancer region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the payload region and the polyadenylation signal sequence region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the payload region and the MCS region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the payload region and the exon region.
- a filler sequence may be located between two regions, such as, but not limited to, the payload region and the 3′ ITR.
- a filler sequence may be located between two regions, such as, but not limited to, the intron region and the enhancer region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the intron region and the polyadenylation signal sequence region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the intron region and the MCS region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the intron region and the exon region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the intron region and the 3′ ITR.
- a filler sequence may be located between two regions, such as, but not limited to, the enhancer region and the polyadenylation signal sequence region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the enhancer region and the MCS region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the enhancer region and the exon region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the enhancer region and the 3′ ITR.
- a filler sequence may be located between two regions, such as, but not limited to, the polyadenylation signal sequence region and the MCS region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the polyadenylation signal sequence region and the exon region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the polyadenylation signal sequence region and the 3′ ITR.
- a filler sequence may be located between two regions, such as, but not limited to, the MCS region and the exon region. In one embodiment, a filler sequence may be located between two regions, such as, but not limited to, the MCS region and the 3′ ITR.
- a filler sequence may be located between two regions, such as, but not limited to, the exon region and the 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the promoter region and payload region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the promoter region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the promoter region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the promoter region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the promoter region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the promoter region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the promoter region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the payload region and intron region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the payload region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the intron region and enhancer region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the intron region and MCS region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the intron region and exon region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the enhancer region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the promoter region and payload region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the promoter region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the promoter region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the promoter region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the promoter region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the promoter region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the promoter region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the payload region and intron region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the payload region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the intron region and enhancer region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and payload region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the promoter region and payload region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the promoter region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the promoter region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the promoter region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the promoter region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the promoter region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the promoter region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the payload region and intron region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the payload region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the intron region and enhancer region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the intron region and MCS region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the intron region and exon region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the enhancer region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the promoter region and payload region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the promoter region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the promoter region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the promoter region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the promoter region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the promoter region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the promoter region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the payload region and intron region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the payload region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the intron region and enhancer region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the intron region and MCS region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the intron region and exon region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the enhancer region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and enhancer region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the promoter region and payload region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the promoter region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the promoter region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the promoter region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and promoter region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the promoter region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the promoter region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the payload region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the payload region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and intron region and MCS region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and exon region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and polyadenylation signal sequence region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the promoter region and payload region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the promoter region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the promoter region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the promoter region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the promoter region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the promoter region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the promoter region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the payload region and intron region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the payload region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the enhancer region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and MCS region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the promoter region and payload region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the promoter region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the promoter region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the promoter region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the promoter region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the promoter region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the promoter region and 3′ ITR. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the payload region and intron region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the payload region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the intron region and MCS region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the intron region and exon region. In one embodiment, a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the 5′ ITR and exon region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the payload region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the payload region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and payload region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the payload region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the payload region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and intron region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the payload region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the payload region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and enhancer region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the payload region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the payload region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and polyadenylation signal sequence region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the payload region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the payload region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and exon region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the payload region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the payload region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and MCS region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the payload region and intron region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the payload region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the payload region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the payload region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the payload region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the payload region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the promoter region and 3′ITR, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and intron region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and enhancer region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and polyadenylation signal sequence region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and MCS region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and exon region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the intron region and enhancer region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the intron region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the intron region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the intron region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the intron region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the payload region and 3′ ITR region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and enhancer region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and enhancer region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and enhancer region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and enhancer region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and enhancer region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and enhancer region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and enhancer region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and enhancer region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and enhancer region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and enhancer region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and polyadenylation signal sequence region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and polyadenylation signal sequence region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and polyadenylation signal sequence region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and polyadenylation signal sequence region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and MCS region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and MCS region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and MCS region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and MCS region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and MCS region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and MCS region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and MCS region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and exon region, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and exon region, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and exon region, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and exon region, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and exon region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and exon region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and exon region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and 3′ITR, and the second filler sequence may be located between the enhancer region and polyadenylation signal sequence region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and 3′ITR, and the second filler sequence may be located between the enhancer region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and 3′ITR, and the second filler sequence may be located between the enhancer region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and 3′ITR, and the second filler sequence may be located between the enhancer region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and 3′ITR, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and 3′ITR, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and 3′ITR, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and 3′ITR, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and 3′ITR, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the intron region and 3′ITR, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and polyadenylation signal sequence region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and polyadenylation signal sequence region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and polyadenylation signal sequence region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and polyadenylation signal sequence region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and MCS region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and MCS region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and MCS region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and MCS region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and exon region, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and exon region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and exon region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and exon region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and 3′ ITR, and the second filler sequence may be located between the polyadenylation signal sequence region and MCS region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and 3′ ITR, and the second filler sequence may be located between the polyadenylation signal sequence region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and 3′ ITR, and the second filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and 3′ ITR, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and 3′ ITR, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the enhancer region and 3′ ITR, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the polyadenylation signal sequence region and MCS region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the polyadenylation signal sequence region and MCS region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the polyadenylation signal sequence region and MCS region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the polyadenylation signal sequence region and exon region, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the polyadenylation signal sequence region and exon region, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the polyadenylation signal sequence region and exon region, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR, and the second filler sequence may be located between the MCS region and exon region.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR, and the second filler sequence may be located between the MCS region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the polyadenylation signal sequence region and 3′ ITR, and the second filler sequence may be located between the exon region and 3′ ITR.
- a viral genome may comprise two filler sequences, the first filler sequence may be located between the MCS region and exon region, and the second filler sequence may be located between the exon region and 3′ ITR.
- the present disclosure provides methods for the generation of parvoviral particles, e.g. AAV particles, by viral genome replication in a viral replication cell.
- parvoviral particles e.g. AAV particles
- the viral genome comprising a payload region will be incorporated into the AAV particle produced in the viral replication cell.
- Methods of making AAV particles are well known in the art and are described in e.g., U.S. Pat. No. 6,204,059, U.S. Pat. No. 5,756,283, U.S. Pat. No. 6,258,595, U.S. Pat. No. 6,261,551, U.S. Pat. No. 6,270,996, U.S. Pat. No. 6,281,010, U.S. Pat. No. 6,365,394, U.S. Pat. No. 6,475,769, U.S. Pat. No. 6,482,634, U.S. Pat. No.
- the AAV particles are made using the methods described in WO2015191508, the contents of which are herein incorporated by reference in their entirety.
- Viral replication cells commonly used for production of recombinant AAV particles include but are not limited to 293 cells, COS cells, HeLa cells, KB cells, and other mammalian cell lines as described in U.S. Pat. No. 6,156,303, U.S. Pat. No. 5,387,484, U.S. Pat. No. 5,741,683, U.S. Pat. No. 5,691,176, and U.S. Pat. No. 5,688,676; U.S. patent publication No. 2002/0081721, and International Patent Publication Nos. WO 00/47757, WO 00/24916, and WO 96/17947, the contents of each of which are herein incorporated by reference in their entireties.
- the present disclosure provides a method for producing an AAV particle having enhanced (increased, improved) transduction efficiency comprising the steps of: 1) co-transfecting competent bacterial cells with a bacmid vector and either a viral construct vector and/or AAV payload construct vector, 2) isolating the resultant viral construct expression vector and AAV payload construct expression vector and separately transfecting viral replication cells, 3) isolating and purifying resultant payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, 4) co-infecting a viral replication cell with both the AAV payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, and 5) harvesting and purifying the AAV particle comprising a viral genome.
- the present disclosure provides a method for producing an AAV particle comprising the steps of 1) simultaneously co-transfecting mammalian cells, such as, but not limited to HEK293 cells, with a payload region, a construct expressing rep and cap genes and a helper construct, 2) harvesting and purifying the AAV particle comprising a viral genome.
- the viral genome of the AAV particle of the disclosure optionally encodes a selectable marker.
- the selectable marker may comprise a cell-surface marker, such as any protein expressed on the surface of the cell including, but not limited to receptors, CD markers, lectins, integrins, or truncated versions thereof.
- selectable marker reporter genes as described in International application No. WO 96/23810; Heim et al., Current Biology 2:178-182 (1996); Heim et al., Proc. Natl. Acad. Sci. USA (1995); or Heim et al., Science 373:663-664 (1995); WO 96/30540, the contents of each of which are incorporated herein by reference in their entireties).
- the AAV particle which comprises a payload described herein may be single stranded or double stranded vector genome.
- the size of the vector genome may be small, medium, large or the maximum size.
- the vector genome may comprise a promoter and a polyA tail.
- the vector genome which comprises a payload described herein may be a small single stranded vector genome.
- a small single stranded vector genome may be 2.7 to 3.5 kb in size such as about 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, and 3.5 kb in size.
- the small single stranded vector genome may be 3.2 kb in size.
- the vector genome may comprise a promoter and a polyA tail.
- the vector genome which comprises a payload described herein may be a small double stranded vector genome.
- a small double stranded vector genome may be 1.3 to 1.7 kb in size such as about 1.3, 1.4, 1.5, 1.6, and 1.7 kb in size.
- the small double stranded vector genome may be 1.6 kb in size.
- the vector genome may comprise a promoter and a polyA tail.
- the vector genome which comprises a payload described herein may be a medium single stranded vector genome.
- a medium single stranded vector genome may be 3.6 to 4.3 kb in size such as about 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2 and 4.3 kb in size.
- the medium single stranded vector genome may be 4.0 kb in size.
- the vector genome may comprise a promoter and a polyA tail.
- the vector genome which comprises a payload described herein may be a medium double stranded vector genome.
- a medium double stranded vector genome may be 1.8 to 2.1 kb in size such as about 1.8, 1.9, 2.0, and 2.1 kb in size.
- the medium double stranded vector genome may be 2.0 kb in size.
- the vector genome may comprise a promoter and a polyA tail.
- the vector genome which comprises a payload described herein may be a large single stranded vector genome.
- a large single stranded vector genome may be 4.4 to 6.0 kb in size such as about 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9 and 6.0 kb in size.
- the large single stranded vector genome may be 4.7 kb in size.
- the large single stranded vector genome may be 4.8 kb in size.
- the large single stranded vector genome may be 6.0 kb in size.
- the vector genome may comprise a promoter and a polyA tail.
- the vector genome which comprises a payload described herein may be a large double stranded vector genome.
- a large double stranded vector genome may be 2.2 to 3.0 kb in size such as about 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 and 3.0 kb in size.
- the large double stranded vector genome may be 2.4 kb in size.
- the vector genome may comprise a promoter and a polyA tail.
- the AAV particles of the present disclosure comprise at least one payload region.
- payload or “payload region” refers to one or more polynucleotides or polynucleotide regions encoded by or within a viral genome or an expression product of such polynucleotide or polynucleotide region, e.g., a transgene, a polynucleotide encoding a polypeptide or multi-polypeptide or a modulatory nucleic acid or regulatory nucleic acid.
- Payloads of the present disclosure typically encode polypeptides or fragments or variants thereof.
- the payload region may be constructed in such a way as to reflect a region similar to or mirroring the natural organization of an mRNA.
- the payload region may comprise a combination of coding and non-coding nucleic acid sequences.
- the AAV payload region may encode a coding or non-coding RNA.
- the AAV particle comprises a viral genome with a payload region comprising nucleic acid sequences encoding more than one polypeptide of interest.
- a viral genome encoding more than one polypeptide may be replicated and packaged into a viral particle.
- a target cell transduced with a viral particle comprising more than one polypeptide may express each of the polypeptides in a single cell.
- the payload region may comprise the components as shown in FIG. 1 .
- the payload region 110 is located within the viral genome 100.
- At the 5′ and/or the 3′ end of the payload region 110 there may be at least one inverted terminal repeat (ITR) 120.
- ITR inverted terminal repeat
- the polypeptide may be a peptide or protein.
- the viral genomes encoding polypeptides described herein may be useful in the fields of human disease, viruses, infections veterinary applications and a variety of in vivo and in vitro settings.
- the AAV particles are useful in the field of medicine for the treatment, prophylaxis, palliation or amelioration of neurological diseases and/or disorders.
- the AAV particles are useful in the field of medicine for the treatment, prophylaxis, palliation or amelioration of Parkinson's Disease.
- the AAV particles are useful in the field of medicine for the treatment, prophylaxis, palliation or amelioration of diseases of the central nervous system.
- amino acid sequences encoded by payload regions of the viral genomes of the disclosure may be translated as a whole polypeptide, a plurality of polypeptides or fragments of polypeptides, which independently may be encoded by one or more nucleic acids, fragments of nucleic acids or variants of any of the aforementioned.
- polypeptide means a polymer of amino acid residues (natural or unnatural) linked together most often by peptide bonds.
- the term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. In some instances, the polypeptide encoded is smaller than about 50 amino acids and the polypeptide is then termed a peptide.
- polypeptide is a peptide, it will be at least about 2, 3, 4, or at least 5 amino acid residues long.
- polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing.
- a polypeptide may be a single molecule or may be a multi-molecular complex such as a dimer, trimer or tetramer. They may also comprise single chain or multichain polypeptides and may be associated or linked.
- the term polypeptide may also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.
- polypeptide variant refers to molecules which differ in their amino acid sequence from a native or reference sequence.
- the amino acid sequence variants may possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence, as compared to a native or reference sequence.
- variants will possess at least about 50% identity (homology) to a native or reference sequence, and preferably, they will be at least about 80%, more preferably at least about 90% identical (homologous) to a native or reference sequence.
- variant mimics are provided.
- the term “variant mimic” is one which contains one or more amino acids which would mimic an activated sequence.
- glutamate may serve as a mimic for phosphoro-threonine and/or phosphoro-serine.
- variant mimics may result in deactivation or in an inactivated product containing the mimic, e.g., phenylalanine may act as an inactivating substitution for tyrosine; or alanine may act as an inactivating substitution for serine.
- amino acid sequence variant refers to molecules with some differences in their amino acid sequences as compared to a native or starting sequence.
- the amino acid sequence variants may possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence.
- “Native” or “starting” sequence should not be confused with a wild type sequence.
- a native or starting sequence is a relative term referring to an original molecule against which a comparison may be made.
- “Native” or “starting” sequences or molecules may represent the wild-type (that sequence found in nature) but do not have to be the wild-type sequence.
- variants will possess at least about 70% homology to a native sequence, and preferably, they will be at least about 80%, more preferably at least about 90% homologous to a native sequence.
- “Homology” as it applies to amino acid sequences is defined as the percentage of residues in the candidate amino acid sequence that are identical with the residues in the amino acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology. Methods and computer programs for the alignment are well known in the art. It is understood that homology depends on a calculation of percent identity but may differ in value due to gaps and penalties introduced in the calculation.
- homologs as it applies to amino acid sequences is meant the corresponding sequence of other species having substantial identity to a second sequence of a second species.
- Analogs is meant to include polypeptide variants which differ by one or more amino acid alterations, e.g., substitutions, additions or deletions of amino acid residues that still maintain the properties of the parent polypeptide.
- Sequence tags or amino acids can be added to the peptide sequences of the disclosure (e.g., at the N-terminal or C-terminal ends). Sequence tags can be used for peptide purification or localization. Lysines can be used to increase peptide solubility or to allow for biotinylation. Alternatively, amino acid residues located at the carboxy and amino terminal regions of the amino acid sequence of a peptide or protein may optionally be deleted providing for truncated sequences. Certain amino acids (e.g., C-terminal or N-terminal residues) may alternatively be deleted depending on the use of the sequence, as for example, expression of the sequence as part of a larger sequence which is soluble, or linked to a solid support.
- amino acids e.g., C-terminal or N-terminal residues
- substitutional variants when referring to proteins are those that have at least one amino acid residue in a native or starting sequence removed and a different amino acid inserted in its place at the same position.
- the substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule.
- conservative amino acid substitution refers to the substitution of an amino acid that is normally present in the sequence with a different amino acid of similar size, charge, or polarity.
- conservative substitutions include the substitution of a non-polar (hydrophobic) residue such as isoleucine, valine and leucine for another non-polar residue.
- conservative substitutions include the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, and between glycine and serine.
- substitution of a basic residue such as lysine, arginine or histidine for another, or the substitution of one acidic residue such as aspartic acid or glutamic acid for another acidic residue are additional examples of conservative substitutions.
- non-conservative substitutions include the substitution of a non-polar (hydrophobic) amino acid residue such as isoleucine, valine, leucine, alanine, methionine for a polar (hydrophilic) residue such as cysteine, glutamine, glutamic acid or lysine and/or a polar residue for a non-polar residue.
- “Insertional variants” when referring to proteins are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in a native or starting sequence. “Immediately adjacent” to an amino acid means connected to either the alpha-carboxy or alpha-amino functional group of the amino acid.
- “Deletional variants” when referring to proteins, are those with one or more amino acids in the native or starting amino acid sequence removed. Ordinarily, deletional variants will have one or more amino acids deleted in a particular region of the molecule.
- derivative is used synonymously with the term “variant” and refers to a molecule that has been modified or changed in any way relative to a reference molecule or starting molecule.
- derivatives include native or starting proteins that have been modified with an organic proteinaceous or non-proteinaceous derivatizing agent, and post-translational modifications. Covalent modifications are traditionally introduced by reacting targeted amino acid residues of the protein with an organic derivatizing agent that is capable of reacting with selected side-chains or terminal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells.
- the resultant covalent derivatives are useful in programs directed at identifying residues important for biological activity, for immunoassays, or for the preparation of anti-protein antibodies for immunoaffinity purification of the recombinant glycoprotein. Such modifications are within the ordinary skill in the art and are performed without undue experimentation.
- Certain post-translational modifications are the result of the action of recombinant host cells on the expressed polypeptide.
- Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Either form of these residues may be present in the proteins used in accordance with the present disclosure.
- post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the alpha-amino groups of lysine, arginine, and histidine side chains (T. E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)).
- proteins when referring to proteins are defined as distinct amino acid sequence-based components of a molecule.
- Features of the proteins of the present disclosure include surface manifestations, local conformational shape, folds, loops, half-loops, domains, half-domains, sites, termini or any combination thereof.
- surface manifestation refers to a polypeptide based component of a protein appearing on an outermost surface.
- local conformational shape means a polypeptide based structural manifestation of a protein which is located within a definable space of the protein.
- fold means the resultant conformation of an amino acid sequence upon energy minimization.
- a fold may occur at the secondary or tertiary level of the folding process.
- secondary level folds include beta sheets and alpha helices.
- tertiary folds include domains and regions formed due to aggregation or separation of energetic forces. Regions formed in this way include hydrophobic and hydrophilic pockets, and the like.
- turn as it relates to protein conformation means a bend which alters the direction of the backbone of a peptide or polypeptide and may involve one, two, three or more amino acid residues.
- loop refers to a structural feature of a peptide or polypeptide which reverses the direction of the backbone of a peptide or polypeptide and comprises four or more amino acid residues. Oliva et al. have identified at least 5 classes of protein loops (J. Mol Biol 266 (4): 814-830; 1997).
- domain refers to a motif of a polypeptide having one or more identifiable structural or functional characteristics or properties (e.g., binding capacity, serving as a site for protein-protein interactions).
- sub-domains may be identified within domains or half-domains, these subdomains possessing less than all of the structural or functional properties identified in the domains or half domains from which they were derived. It is also understood that the amino acids that comprise any of the domain types herein need not be contiguous along the backbone of the polypeptide (i.e., nonadjacent amino acids may fold structurally to produce a domain, half-domain or subdomain).
- site As used herein when referring to proteins the terms “site” as it pertains to amino acid based embodiments is used synonymous with “amino acid residue” and “amino acid side chain”.
- a site represents a position within a peptide or polypeptide that may be modified, manipulated, altered, derivatized or varied within the polypeptide based molecules of the present disclosure.
- terminal or terminus when referring to proteins refers to an extremity of a peptide or polypeptide. Such extremity is not limited only to the first or final site of the peptide or polypeptide but may include additional amino acids in the terminal regions.
- the polypeptide based molecules of the present disclosure may be characterized as having both an N-terminus (terminated by an amino acid with a free amino group (NH2)) and a C-terminus (terminated by an amino acid with a free carboxyl group (COOH)).
- NH2 free amino acid with a free amino group
- COOH free carboxyl group
- Proteins of the disclosure are in some cases made up of multiple polypeptide chains brought together by disulfide bonds or by non-covalent forces (multimers, oligomers). These sorts of proteins will have multiple N- and C-termini.
- the termini of the polypeptides may be modified such that they begin or end, as the case may be, with a non-polypeptide based moiety such as an organic conjug
- any of the features have been identified or defined as a component of a molecule of the disclosure, any of several manipulations and/or modifications of these features may be performed by moving, swapping, inverting, deleting, randomizing or duplicating. Furthermore, it is understood that manipulation of features may result in the same outcome as a modification to the molecules of the disclosure. For example, a manipulation which involves deleting a domain would result in the alteration of the length of a molecule just as modification of a nucleic acid to encode less than a full length molecule would.
- Modifications and manipulations can be accomplished by methods known in the art such as site directed mutagenesis.
- the resulting modified molecules may then be tested for activity using in vitro or in vivo assays such as those described herein or any other suitable screening assay known in the art.
- aromatic L-amino acid decarboxylase (AADC; also known as dopa decarboxylase and DDC) polynucleotides are provided which function alone or in combination with additional nucleic acid sequence(s) to encode the AADC protein.
- AADC polynucleotide is any nucleic acid polymer which encodes an AADC protein and when present in a vector, plasmid or translatable construct, expresses such AADC protein in a cell, tissue, organ or organism.
- AADC polynucleotides include precursor molecules which are processed inside the cell.
- AADC polynucleotides or the processed forms thereof may be encoded in a plasmid, vector, genome or other nucleic acid expression vector for delivery to a cell.
- AADC polynucleotides are designed as components of AAV viral genomes and packaged in AAV particles which are processed within the cell to produce the wild type AADC protein.
- the AADC polynucleotide may be the payload of the AAV particle.
- the wild type AADC protein may be any of the naturally occurring isoforms or variants from the DDC gene. Multiple alternatively spliced transcript variants encoding different isoforms of AADC have been identified. Specifically, the DDC gene produces seven transcript variants that encode six distinct isoforms. DDC transcript variants 1 and 2 both encode AADC isoform 1. In some embodiments, the AADC polynucleotides encode DDC transcript variant 2, thereby encoding a native AADC isoform 1 (NCBI Reference Sequence: NP_000781.1). This sequence is given here:
- AADC polynucleotides of the disclosure may be engineered to contain modular elements and/or sequence motifs assembled to create AADC polynucleotide constructs.
- AADC polynucleotides comprise nucleic acid polymers which comprise a region of linked nucleosides encoding one or more isoforms or variants of the AADC protein.
- the AADC polynucleotide comprises a codon optimized transcript encoding an AADC protein.
- the AADC polynucleotide comprises a sequence region encoding one or more wild type isoforms or variants of an AADC protein.
- Such polynucleotides may also comprise a sequence region encoding any one or more of the following: a 5′ ITR, a cytomegalovirus (CMV) Enhancer, a CMV Promoter, an ie1 exon 1, an ie1 intron1, an hbBglobin intron2, an hBglobin exon 3, a 5′ UTR, a 3′ UTR, an hGH poly(A) signal, and/or a 3′ ITR.
- CMV cytomegalovirus
- the AADC polynucleotide comprises a SEQ ID NO: 979 or a fragment or variant thereof.
- the AADC polynucleotide comprises a sequence which has a percent identity to any of SEQ ID NO: 979 or a fragment or variant thereof.
- the AADC polynucleotide may have 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity to any of SEQ ID NO: 979 or a fragment or variant thereof.
- the AADC polynucleotide may have 1-10%, 10-20%, 30-40%, 50-60%, 50-70%, 50-80%, 50-90%, 50-99%, 50-100%, 60-70%, 60-80%, 60-90%, 60-99%, 60-100%, 70-80%, 70-90%, 70-99%, 70-100%, 80-85%, 80-90%, 80-95%, 80-99%, 80-100%, 90-95%, 90-99%, or 90-100% to any of SEQ ID NO: 979 or a fragment or variant thereof.
- the AADC polynucleotide comprises a sequence which as 80% identity to any of SEQ ID NO: 979 or a fragment or variant thereof.
- the AADC polynucleotide comprises a sequence which as 85% identity to any of SEQ ID NO: 979 or a fragment or variant thereof.
- the AADC polynucleotide comprises a sequence which as 90% identity to any of SEQ ID NO: 979 or a fragment or variant thereof.
- the AADC polynucleotide comprises a sequence which as 95% identity to any of SEQ ID NO: 979 or a fragment or variant thereof.
- the AADC polynucleotide comprises a sequence which as 99% identity to any of SEQ ID NO: 979 or a fragment or variant thereof.
- the coding region of the AADC polynucleotide is 1440 nucleotides in length.
- Such an AADC polynucleotide may be codon optimized over all or a portion of the polynucleotide.
- the AADC polynucleotide comprises any of SEQ ID NO: 979 or a fragment or variant thereof but lacking the 5′ and/or 3′ ITRs.
- Such a polynucleotide may be incorporated into a plasmid or vector and utilized to express the encoded AADC protein.
- the AADC polynucleotides may be produced in insect cells (e.g., Sf9 cells).
- the AADC polynucleotides may be produced using triple transfection.
- the AADC polynucleotide may comprise a codon optimized open reading frame of an AADC mRNA, at least one 5′ITR and at least one 3′UTR where the one or more of the 5′ITRs may be located at the 5′end of the promoter region and one or more 3′ ITRs may be located at the 3′ end of the poly(A) signal.
- the AADC mRNA may comprise a promoter region, a 5′untranslated region (UTR), a 3′UTR and a poly(A) signal.
- the promoter region may include, but is not limited to, enhancer element, a promoter element, a first exon region, a first intron region, a second intron region and a second exon region.
- the enhancer element and the promoter element are derived from CMV.
- the first exon region is ie1 exon 1 or fragments thereof
- the first intron region is ie1 intron 1 or fragments thereof
- the second intron region is hbBglobin intron 2 or fragments thereof
- the second exon region is hbBglobin exon 3 or fragments thereof.
- the poly(A) signal is derived from human growth hormone.
- At least one element may be used with the AADC polynucleotides described herein to enhance the transgene target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are herein incorporated by reference in its entirety).
- elements to enhance the transgene target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (PolyA) signal sequences and upstream enhancers (USEs), CMV enhancers and introns.
- At least one element may be used with the AADC polynucleotides described herein to enhance the transgene target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are herein incorporated by reference in its entirety) such as promoters.
- the AADC polynucleotide is encoded in a plasmid or vector, which may be derived from an adeno-associated virus (AAV).
- the AAV may comprise a capsid serotype such as, but not limited to, PHP.B, PHP.A, AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12, AAV42-lb, AAV42-2, AAV42-3a, AAV42-3b, AAV
- the AAV particles may be prepared as pharmaceutical compositions. It will be understood that such compositions necessarily comprise one or more active ingredients and, most often, a pharmaceutically acceptable excipient.
- Relative amounts of the active ingredient may vary, depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route by which the composition is to be administered.
- the composition may comprise between 0.1% and 99% (w/w) of the active ingredient.
- the composition may comprise between 0.1% and 100%, e.g., between 0.5 and 50%, between 1-30%, between 5-80%, at least 80% (w/w) active ingredient.
- the AAV particle pharmaceutical compositions described herein may comprise at least one payload.
- the pharmaceutical compositions may contain an AAV particle with 1, 2, 3, 4 or 5 payloads.
- compositions are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals.
- compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation.
- Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and/or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, rats, birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and/or turkeys.
- compositions are administered to humans, human patients or subjects.
- Formulations of the present disclosure can include, without limitation, saline, liposomes, lipid nanoparticles, polymers, peptides, proteins, cells transfected with AAV particles (e.g., for transfer or transplantation into a subject) and combinations thereof.
- Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology.
- pharmaceutical composition refers to compositions comprising at least one active ingredient and optionally one or more pharmaceutically acceptable excipients.
- such preparatory methods include the step of associating the active ingredient with an excipient and/or one or more other accessory ingredients.
- active ingredient generally refers either to an AAV particle carrying a payload region encoding the polypeptides of the disclosure or to the end product encoded by a viral genome of by an AAV particle as described herein.
- Formulations of the AAV particles and pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, dividing, shaping and/or packaging the product into a desired single- or multi-dose unit.
- a pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses.
- a “unit dose” refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient.
- the amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
- the AAV particles of the disclosure may be formulated in PBS with 0.001% of pluronic acid (F-68) at a pH of about 7.0.
- the AAV formulations described herein may contain sufficient AAV particles for expression of at least one expressed functional payload.
- the AAV particles may contain viral genomes encoding 1, 2, 3, 4 or 5 functional payloads.
- AAV particles may be formulated for CNS delivery.
- Agents that cross the brain blood barrier may be used.
- some cell penetrating peptides that can target molecules to the brain blood barrier endothelium may be used for formulation (e.g., Mathupala, Expert Opin Ther Pat., 2009, 19, 137-140; the content of which is incorporated herein by reference in its entirety).
- the AAV particles of the disclosure can be formulated using one or more excipients or diluents to (1) increase stability; (2) increase cell transfection or transduction; (3) permit the sustained or delayed release of the payload; (4) alter the biodistribution (e.g., target the viral particle to specific tissues or cell types); (5) increase the translation of encoded protein; (6) alter the release profile of encoded protein and/or (7) allow for regulatable expression of the payload of the disclosure.
- a pharmaceutically acceptable excipient may be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure.
- an excipient is approved for use for humans and for veterinary use.
- an excipient may be approved by United States Food and Drug Administration.
- an excipient may be of pharmaceutical grade.
- an excipient may meet the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and/or the International Pharmacopoeia.
- Excipients include, but are not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired.
- Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, Md., 2006; incorporated herein by reference in its entirety).
- any conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.
- Exemplary diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch, powdered sugar, etc., and/or combinations thereof.
- the AAV particles may be formulated in a hydrogel prior to administration.
- Hydrogels have a degree of flexibility which is similar to natural tissue as a result of their significant water content.
- a hydrogel may be administered to a subject prior to the administration of an AAV particle formulation.
- the site of administration of the hydrogel may be within 3 inches (e.g., within 2.9, 2.8, 2.7, 2.6, 2.5, 2.4, 2.3, 2.2., 2.1, 2.0, 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1.0, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1 or less than 0.1 inches) of the site of administration of the AAV particle formulation.
- AAV particle formulations may comprise at least one inactive ingredient.
- active ingredient refers to one or more agents that do not contribute to the activity of the active ingredient of the pharmaceutical composition included in formulations.
- all, none or some of the inactive ingredients which may be used in the formulations of the present disclosure may be approved by the US Food and Drug Administration (FDA).
- FDA US Food and Drug Administration
- the AAV particle pharmaceutical compositions comprise at least one inactive ingredient such as, but not limited to, 1,2,6-Hexanetriol; 1,2-Dimyristoyl-Sn-Glycero-3-(Phospho-S-(1-Glycerol)); 1,2-Dimyristoyl-Sn-Glycero-3-Phosphocholine; 1,2-Dioleoyl-Sn-Glycero-3-Phosphocholine; 1,2-Dipalmitoyl-Sn-Glycero-3-(Phospho-Rac-(1-Glycerol)); 1,2-Distearoyl-Sn-Glycero-3-(Phospho-Rac-(1-Glycerol)); 1,2-Distearoyl-Sn-Glycero-3-Phosphocholine; 1-O-Tolylbiguanide; 2-Ethyl-1,6-Hexanediol; Acetic Acid; Acetic Acid, Glacial
- Rf 451 Fluorochlorohydrocarbons; Formaldehyde; Formaldehyde Solution; Fractionated Coconut Oil; Fragrance 3949-5; Fragrance 520a; Fragrance 6.007; Fragrance 91-122; Fragrance 9128-Y; Fragrance 93498g; Fragrance Balsam Pine No. 5124; Fragrance Bouquet 10328; Fragrance Chemoderm 6401-B; Fragrance Chemoderm 6411; Fragrance Cream No.
- composition formulations of AAV particles disclosed herein may include cations or anions.
- the formulations include metal cations such as, but not limited to, Zn2+, Ca2+, Cu2+, Mn2+, Mg+ and combinations thereof.
- formulations may include polymers and complexes with a metal cation (See e.g., U.S. Pat. Nos. 6,265,389 and 6,555,525, each of which is herein incorporated by reference in its entirety).
- Formulations of the disclosure may also include one or more pharmaceutically acceptable salts.
- pharmaceutically acceptable salts refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid).
- suitable organic acid examples include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like.
- Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate
- alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like.
- the pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids.
- the pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods.
- such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred.
- Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P. H. Stahl and C. G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1-19 (1977); the content of each of which is incorporated herein by reference in their entirety.
- solvate means a compound of the disclosure wherein molecules of a suitable solvent are incorporated in the crystal lattice.
- a suitable solvent is physiologically tolerable at the dosage administered.
- Solvates may be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof.
- Suitable solvents are ethanol, water (for example, mono-, di-, and tri-hydrates), N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N,N′-dimethylformamide (DMF), N,N′-dimethylacetamide (DMAC), 1,3-dimethyl-2-imidazolidinone (DMEU), 1,3-dimethyl-3,4,5,6-tetrahydro-2-(1H)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like.
- NMP N-methylpyrrolidinone
- DMSO dimethyl sulfoxide
- DMF N,N′-dimethylformamide
- DMAC N,N′-dimethylacetamide
- DMEU 1,3-dimethyl-2-imidazolidinone
- DMPU
- the AAV particle may be administered to a subject (e.g., to the CNS of a subject) in a therapeutically effective amount to reduce the symptoms of the disease of the central nervous system (e.g., Parkinson's Disease) of a subject (e.g., determined using a known evaluation method).
- a subject e.g., to the CNS of a subject
- a therapeutically effective amount to reduce the symptoms of the disease of the central nervous system (e.g., Parkinson's Disease) of a subject (e.g., determined using a known evaluation method).
- the AAV particles of the present disclosure may be administered by any delivery route which results in a therapeutically effective outcome.
- these include, but are not limited to, enteral (into the intestine), gastroenteral, epidural (into the dura mater), oral (by way of the mouth), transdermal, intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into a vein), intravenous bolus, intravenous drip, intra-arterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraparenchymal (into brain tissue), intraperitoneal, (infusion or injection into the peritoneum), intravesical infusion, intravitreal, (through the eye
- compositions may be administered in a way which allows them to cross the blood-brain barrier, vascular barrier, or other epithelial barrier.
- the AAV particles of the present disclosure may be administered in any suitable form, either as a liquid solution or suspension, as a solid form suitable for liquid solution or suspension in a liquid solution.
- the AAV particles may be formulated with any appropriate and pharmaceutically acceptable excipient.
- the AAV particles of the present disclosure may be delivered to a subject via a single route administration.
- the AAV particles of the present disclosure may be delivered to a subject via a multi-site route of administration.
- a subject may be administered at 2, 3, 4, 5 or more than 5 sites.
- a subject may be administered the AAV particles of the present disclosure using a bolus infusion.
- a subject may be administered the AAV particles of the present disclosure using sustained delivery over a period of minutes, hours or days.
- the infusion rate may be changed depending on the subject, distribution, formulation or another delivery parameter.
- the AAV particles of the present disclosure may be delivered by intramuscular delivery route.
- intramuscular delivery route See, e.g., U.S. Pat. No. 6,506,379; the content of which is incorporated herein by reference in its entirety).
- intramuscular administration include an intravenous injection or a subcutaneous injection.
- the AAV particles of the present disclosure may be delivered by oral administration.
- oral administration include a digestive tract administration and a buccal administration.
- the AAV particles of the present disclosure may be delivered by intraocular delivery route.
- intraocular administration include an intravitreal injection.
- the AAV particles of the present disclosure may be delivered by intranasal delivery route.
- intranasal delivery include administration of nasal drops or nasal sprays.
- the AAV particles that may be administered to a subject by peripheral injections include intraperitoneal, intramuscular, intravenous, conjunctival or joint injection. It was disclosed in the art that the peripheral administration of AAV particles can be transported to the central nervous system, for example, to the motor neurons (e.g., U. S. Patent Publication Nos. 20100240739; and 20100130594; the content of each of which is incorporated herein by reference in their entirety).
- the AAV particles may be delivered by injection into the CSF pathway.
- delivery to the CSF pathway include intrathecal and intracerebroventricular administration.
- the AAV particles may be delivered by systemic delivery.
- the systemic delivery may be by intravascular administration.
- the AAV particles of the present disclosure may be administered to a subject by intracranial delivery (See, e.g., U.S. Pat. No. 8,119,611; the content of which is incorporated herein by reference in its entirety).
- the AAV particles of the present disclosure may be administered by injection.
- the AAV particles of the present disclosure may be administered to a subject by injection.
- the AAV particles of the present disclosure may be administered by muscular injection.
- the AAV particles of the present disclosure may be administered to a subject by muscular administration.
- the AAV particles of the present disclosure may be administered by intramuscular administration.
- the AAV particles of the present disclosure may be administered to a subject by intramuscular administration.
- the AAV particles of the present disclosure are administered to a subject and transduce muscle of a subject.
- the AAV particles are administered by intramuscular administration.
- the AAV particles of the present disclosure may be administered via intraparenchymal injection.
- the AAV particles of the present disclosure may be administered to a subject by intraparenchymal administration.
- the AAV particles of the present disclosure may be administered by intravenous administration.
- the AAV particles of the present disclosure may be administered to a subject by intravenous administration.
- the AAV particles of the present disclosure may be administered via intravenous delivery.
- the AAV particles of the present disclosure may be administered via a single dose intravenous delivery.
- the single dose intravenous delivery may be a one-time treatment.
- the single dose intravenous delivery can produce durable relief for subjects with central nervous system (e.g., Parkinson's Disease) and/or related symptoms.
- the relief may last for minutes such as, but not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 minutes or more than 59 minutes; hours such as, but not limited to, 1, 2, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or more than 48 hours; days such as, but not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or more than 31 days; weeks such as, but not limited to, 1, 2, 3, 4, 5, 6,
- the AAV particles of the present disclosure may be administered via intravenous delivery to the DRG nociceptive neurons.
- the AAV particles of the present disclosure may be administered via a single dose intravenous delivery to the DRG nociceptive neurons.
- the single dose intravenous delivery may be a one-time treatment.
- the single dose intravenous delivery can produce durable relief for subjects with diseases of the central nervous system (e.g., Parkinson's Disease) and/or related symptoms.
- the relief may last for minutes such as, but not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 minutes or more than 59 minutes; hours such as, but not limited to, 1, 2, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or more than 48 hours; days such as, but not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or more than 31 days; weeks such as, but not limited to, 1, 2, 3, 4, 5, 6,
- the AAV particles of the present disclosure may be administered by intrathecal injection.
- the AAV particles of the present disclosure may be administered by intrathecal injection.
- the AAV particle may be administered to the cisterna magna in a therapeutically effective amount to transduce spinal cord motor neurons and/or astrocytes.
- the AAV particle may be administered intrathecally.
- the AAV particle may be administered using intrathecal infusion in a therapeutically effective amount to transduce spinal cord motor neurons and/or astrocytes.
- the AAV particles of the present disclosure may be administered via a single dose intrathecal injection.
- the single dose intrathecal injection may be a one-time treatment.
- the single dose intrathecal injection can produce durable relief for subjects with diseases of the central nervous system (e.g., Parkinson's Disease) and/or related symptoms.
- the relief may last for minutes such as, but not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 minutes or more than 59 minutes; hours such as, but not limited to, 1, 2, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or more than 48 hours; days such as, but not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or more than 31 days; weeks such as, but not limited to, 1, 2, 3, 4, 5, 6,
- the AAV particles of the present disclosure may be administered via intrathecal injection to the DRG nociceptive neurons.
- the AAV particles of the present disclosure may be administered via a single dose intrathecal injection to the DRG nociceptive neurons.
- the single dose intrathecal injection may be a one-time treatment.
- the single dose intrathecal injection can produce durable relief for subjects with diseases of the central nervous system (e.g., Parkinson's Disease) and/or related symptoms.
- the relief may last for minutes such as, but not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 minutes or more than 59 minutes; hours such as, but not limited to, 1, 2, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or more than 48 hours; days such as, but not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or more than 31 days; weeks such as, but not limited to, 1, 2, 3, 4, 5, 6,
- the AAV particle described herein is administered via intrathecal (IT) infusion at C1.
- the infusion may be for 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more than 15 hours.
- the AAV particles of the present disclosure may be administered by intraparenchymal injection.
- the AAV particles of the present disclosure may be administered to a subject by intraparenchymal injection.
- the AAV particle may be administered to the cisterna magna in a therapeutically effective amount to transduce spinal cord motor neurons and/or astrocytes.
- the AAV particle may be administered intraparenchymal injection.
- the AAV particles of the present disclosure may be administered by intraparenchymal injection and intrathecal injection.
- the AAV particles of the present disclosure may be administered via intraparenchymal injection and intrathecal injection.
- the AAV particles of the present disclosure may be administered by subcutaneous injection.
- the AAV particles may be administered to a subject by subcutaneous injection.
- the AAV particles of the present disclosure may be administered topically.
- the AAV particles of the present disclosure may be administered to a subject topically.
- the AAV particles may be delivered by direct injection into the brain.
- the brain delivery may be by intrastriatal administration.
- the AAV particles of the present disclosure may be administered via intrastriatal injection.
- the AAV particles of the present disclosure may be administered via intrastriatal injection and another route of administration described herein.
- the AAV particles may be delivered by more than one route of administration.
- AAV particles may be delivered by intrathecal and intracerebroventricular, or by intravenous and intraparenchymal administration.
- the AAV particle may be administered to the CNS in a therapeutically effective amount to improve function and/or survival for a subject with diseases of the central nervous system (e.g., Parkinson's Disease).
- the vector may be administered by direct infusion into the striatum.
- the AAV particle may be administered in a “therapeutically effective” amount, i.e., an amount that is sufficient to alleviate and/or prevent at least one symptom associated with the disease, or provide improvement in the condition of the subject.
- the catheter may be located at more than one site in the spine for multi-site delivery.
- the AAV particle may be delivered in a continuous and/or bolus infusion.
- Each site of delivery may be a different dosing regimen or the same dosing regimen may be used for each site of delivery.
- the sites of delivery may be in the cervical and the lumbar region.
- the sites of delivery may be in the cervical region.
- the sites of delivery may be in the lumbar region.
- a subject may be analyzed for spinal anatomy and pathology prior to delivery of the AAV particle described herein.
- a subject with scoliosis may have a different dosing regimen and/or catheter location compared to a subject without scoliosis.
- the orientation of the spine of the subject during delivery of the AAV particle may be vertical to the ground.
- orientation of the spine of the subject during delivery of the AAV particle may be horizontal to the ground.
- the spine of the subject may be at an angle as compared to the ground during the delivery of the AAV particle.
- the angle of the spine of the subject as compared to the ground may be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 or 180 degrees.
- the delivery method and duration is chosen to provide broad transduction in the spinal cord.
- intrathecal delivery is used to provide broad transduction along the rostral-caudal length of the spinal cord.
- multi-site infusions provide a more uniform transduction along the rostral-caudal length of the spinal cord.
- prolonged infusions provide a more uniform transduction along the rostral-caudal length of the spinal cord.
- administration occurs by a posterior (e.g., back of the head) surgical delivery approach to the putamen.
- a posterior e.g., back of the head
- the average putaminal coverage is 50% with posterior delivery and the surgical time is less than 10 hours.
- administration occurs by a transfrontal (e.g., top of the head) surgical delivery approach to the putamen.
- a transfrontal surgical delivery approach e.g., top of the head
- the average putaminal coverage less than 50% with posterior delivery and the surgical time is more than 10 hours.
- compositions, AAV particles of the present disclosure may be administered parenterally.
- Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and/or elixirs.
- liquid dosage forms may comprise inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
- inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl
- oral compositions can include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and/or perfuming agents.
- adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and/or perfuming agents.
- compositions are mixed with solubilizing agents such as CREMOPHOR®, alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and/or combinations thereof.
- surfactants are included such as hydroxypropylcellulose.
- Injectable preparations for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing agents, wetting agents, and/or suspending agents.
- Sterile injectable preparations may be sterile injectable solutions, suspensions, and/or emulsions in nontoxic parenterally acceptable diluents and/or solvents, for example, as a solution in 1,3-butanediol.
- the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P., and isotonic sodium chloride solution.
- Sterile, fixed oils are conventionally employed as a solvent or suspending medium.
- any bland fixed oil can be employed including synthetic mono- or diglycerides.
- Fatty acids such as oleic acid can be used in the preparation of injectables.
- Injectable formulations may be sterilized, for example, by filtration through a bacterial-retaining filter, and/or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
- Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues.
- compositions, AAV particles of the present disclosure are formulated in depots for extended release.
- specific organs or tissues (“target tissues”) are targeted for administration.
- compositions, AAV particles of the present disclosure are spatially retained within or proximal to target tissues.
- methods of providing pharmaceutical compositions, AAV particles, to target tissues of mammalian subjects by contacting target tissues (which comprise one or more target cells) with pharmaceutical compositions, AAV particles, under conditions such that they are substantially retained in target tissues, meaning that least 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.99 or greater than 99.99% of the composition is retained in the target tissues.
- retention is determined by measuring the amount of pharmaceutical compositions, AAV particles, that enter one or more target cells.
- compositions, AAV particles, administered to subjects are present intracellularly at a period of time following administration.
- intramuscular injection to mammalian subjects may be performed using aqueous compositions comprising pharmaceutical compositions, AAV particles of the present disclosure and one or more transfection reagents, and retention is determined by measuring the amount of pharmaceutical compositions, AAV particles, present in muscle cells.
- Certain aspects of the disclosure are directed to methods of providing pharmaceutical compositions, AAV particles of the present disclosure to a target tissues of mammalian subjects, by contacting target tissues (comprising one or more target cells) with pharmaceutical compositions, AAV particles under conditions such that they are substantially retained in such target tissues.
- compositions, AAV particles comprise enough active ingredient such that the effect of interest is produced in at least one target cell.
- pharmaceutical compositions, AAV particles generally comprise one or more cell penetration agents, although “naked” formulations (such as without cell penetration agents or other agents) are also contemplated, with or without pharmaceutically acceptable carriers.
- delivery of the pharmaceutical compositions comprising AAV particles to cells of the central nervous system comprises infusion of up to 1 mL.
- delivery of the pharmaceutical compositions comprising AAV particles to cells of the central nervous system may comprise infusion of 0.001, 0.002, 0.003, 0.004, 0.005, 0.010, 0.015, 0.020, 0.025, 0.030, 0.040, 0.050, 0.060, 0.070, 0.080, 0.090, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, or 0.9 mL.
- delivery of pharmaceutical composition comprising AAV particles to cells of the central nervous system comprises infusion of between about 1 mL to about 120 mL.
- delivery of pharmaceutical composition comprising AAV particles to cells of the central nervous system may comprise infusion of 0.1, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78
- delivery of AAV particles to cells of the central nervous system comprises infusion of at least 3 mL. In one embodiment, delivery of AAV particles to cells of the central nervous system (e.g., parenchyma) consists of infusion of 3 mL. In one embodiment, delivery of AAV particles to cells of the central nervous system (e.g., parenchyma) comprises infusion of at least 10 mL. In one embodiment, delivery of AAV particles to cells of the central nervous system (e.g., parenchyma) consists of infusion of 10 mL.
- the volume of the pharmaceutical composition comprising AAV particles delivered to the cells of the central nervous system (e.g., parenchyma) of a subject is 50 ul, 100 ul, 200 ul, 300 ul, 400 ul, 500 ul, 600 ul, 700 ul, 800 ul, 900 ul, 1000 ul, 1100 ul, 1200 ul, 1300 ul, 1400 ul, 1500 ul, 1600 ul, 1700 ul, 1800 ul, 1900 ul, 2000 ul or more than 2000 ul.
- the volume of the pharmaceutical composition comprising AAV particles delivered to a region in both hemispheres of a subject brain is 50 ul, 100 ul, 200 ul, 300 ul, 400 ul, 500 ul, 600 ul, 700 ul, 800 ul, 900 ul, 1000 ul, 1100 ul, 1200 ul, 1300 ul, 1400 ul, 1500 ul, 1600 ul, 1700 ul, 1800 ul, 1900 ul, 2000 ul or more than 2000 ul.
- the volume delivered to a region in both hemispheres is 200 ul.
- the volume delivered to a region in both hemispheres is 900 ul.
- the volume delivered to a region in both hemispheres is 1800 ul.
- the volume of the pharmaceutical composition comprising AAV particles delivered to the putamen in both hemispheres of a subject brain is 50 ul, 100 ul, 200 ul, 300 ul, 400 ul, 450 ul, 500 ul, 600 ul, 700 ul, 800 ul, 900 ul, 1000 ul, 1100 ul, 1200 ul, 1300 ul, 1400 ul, 1500 ul, 1600 ul, 1700 ul, 1800 ul, 1900 ul, 2000 ul or more than 2000 ul.
- the volume delivered to the putamen in both hemispheres is 100 ul.
- the volume delivered to the putamen in both hemispheres is 200 ul.
- the volume delivered to the putamen in both hemispheres is 300 ul.
- the volume delivered to the putamen in both hemispheres is 450 ul.
- the volume delivered to the putamen in both hemispheres is 900 ul.
- the volume delivered to the putamen both hemispheres is 1800 ul.
- the volume of the pharmaceutical composition comprising AAV particles delivered to a subject is 900 ul to each putamen.
- the volume of the pharmaceutical composition comprising AAV particles delivered to a subject is 450 ul to each putamen.
- the total volume delivered to a subject may be split between one or more administration sites e.g., 1, 2, 3, 4, 5 or more than 5 sites.
- the total volume is split between administration to the left and right putamen.
- the total volume is split between two sites of administration to each of the left and right putamen.
- the pharmaceutical composition comprising AAV particles is administered using a fenestrated needle.
- fenestrated needles are described in U.S. Pat. Nos. 8,333,734, 7,135,010, 7,575,572, 7,699,852, 4,411,657, 6,890,319, 6,613,026, 6,726,659, 6,565,572, 6,520,949, 6,382,212, 5,848,996, 5,759,179, 5,674,267, 5,588,960, 5,484,401, 5,199,441, 5,012,818, 4,474,569, 3,766,907, 3,552,394, the contents of each of which are herein incorporated by reference in its entirety.
- a composition comprises at least one payload described herein and the payloads are components of a viral genome packaged in an AAV particle.
- the percent (%) ratio of AAV particles comprising the payload to the AAV particles without the payload (also referred to herein as empty capsids) in the composition may be 0:100, 1:99, 0:90, 15:85, 25:75, 30:70, 50:50, 70:30, 85:15, 90:10, 99:1 or 100:0.
- the percent ratio of AAV particles comprising the payload to empty capsids is 50:50.
- the percent ratio of AAV particles comprising the payload to empty capsids is 70:30.
- the percent ratio of AAV particles comprising the payload to empty capsids is 85:15.
- the percent ratio of AAV particles comprising the payload to empty capsids is 100:0.
- the composition described herein comprises at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 51, 52, 53, 54, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or greater than 99% AAV particles comprising the payload.
- the composition comprises at least 50% AAV particles comprising the payload.
- the composition comprises at least 52% AAV particles comprising the payload.
- the composition comprises at least 58% AAV particles comprising the payload.
- the composition comprises at least 70% AAV particles comprising the payload. As another non-limiting example, the composition comprises at least 83% AAV particles comprising the payload. As another non-limiting example, the composition comprises at least 85% AAV particles comprising the payload. As another non-limiting example, the composition comprises at least 99% AAV particles comprising the payload. As another non-limiting example, the composition comprises 100% AAV particles comprising the payload.
- the composition described herein comprises 1-10%, 10-20%, 30-40%, 50-60%, 50-70%, 50-80%, 50-90%, 50-99%, 50-100%, 60-70%, 60-80%, 60-90%, 60-99%, 60-100%, 70-80%, 70-90%, 70-99%, 70-100%, 80-85%, 80-90%, 80-95%, 80-99%, 80-100%, 90-95%, 90-99%, or 90-100% AAV particles comprising the payload.
- the composition described herein comprises 50-100% AAV particles comprising the payload.
- the composition described herein comprises 50-60% AAV particles comprising the payload.
- the composition described herein comprises 80-99% AAV particles comprising the payload. As another non-limiting example, the composition described herein comprises 80-90% AAV particles comprising the payload. As a non-limiting example, the composition described herein comprises 80-95% AAV particles comprising the payload. As a non-limiting example, the composition described herein comprises 80-85% AAV particles comprising the payload.
- the composition described herein comprises less than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 51, 52, 53, 54, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% empty particles.
- the composition comprises less than 50% empty particles.
- the composition comprises less than 45% empty particles.
- the composition comprises less than 40% empty particles.
- the composition comprises less than 35% empty particles.
- the composition comprises less than 30% empty particles.
- the composition comprises less than 25% empty particles. As a non-limiting example, the composition comprises less than 20% empty particles. As a non-limiting example, the composition comprises less than 15% empty particles. As a non-limiting example, the composition comprises less than 10% empty particles. As a non-limiting example, the composition comprises less than 5% empty particles. As a non-limiting example, the composition comprises less than 1% empty particles.
- composition described herein comprises 1-10%, 10-20%, 30-40%, 50-60%, 50-70%, 50-80%, 50-90%, 50-99%, 50-100%, 60-70%, 60-80%, 60-90%, 60-99%, 60-100%, 70-80%, 70-90%, 70-99%, 70-100%, 80-85%, 80-90%, 80-95%, 80-99%, 80-100%, 90-95%, 90-99%, or 90-100% empty particles.
- the composition described herein comprises 30-40% empty particles.
- the composition described herein comprises 30-50% empty particles.
- the composition described herein comprises 30-60% empty particles.
- the composition described herein comprises 30-70% empty particles.
- the composition described herein comprises 30-80% empty particles.
- the composition described herein comprises 30-90% empty particles.
- the ratio of distribution volume in the parenchyma of an area of a subject to the infusion volume of an area of a subject may be 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0 or more than 6.0.
- the ratio of distribution volume in the parenchyma to infusion volume was 1.6 in the caudate nucleus.
- the ratio of distribution volume in the parenchyma to infusion volume was 3.1 in the putamen.
- the distribution of the AAV particles in the putamen may be 2-3 times the volume infused.
- the effectiveness of the dose, route of administration and/or volume of administration may be evaluated using various methods described herein such as, but not limited to, PET imaging, L-DOPA challenge test (e.g., see Forsayeth et al. 2006, Mol. Ther. 14(4): 571-577), UPDRS scores and patient diaries (e.g., Hauser diary).
- a subject may have decreased dyskinesia or periods of decreased dyskinesia after administration of the Pharmaceutical composition comprising AAV particles.
- a subject may have a decrease in Parkinson's Disease related symptoms including limited mobility and dyskinesia.
- a subject may show improvement in off time and motor fluctuations.
- the improvement may be at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or greater than 90%.
- the improvement may last for minutes (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 or more than 55), hours (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or more than 24), days (e.g., 1, 2, 3, 4, 5, 6 or more than 7), weeks (1, 2, 3, 4, 5, 6, 7 or more than 7), months (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or more than 11) or years (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or more than 9).
- minutes e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 or more than 55
- hours e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
- the selection of subjects for administration of the AAV particles described herein and/or the effectiveness of the dose, route of administration and/or volume of administration may be evaluated using imaging of the perivascular spaces (PVS) which are also known as Virchow-Robin spaces.
- PVS surround the arterioles and venules as they perforate brain parenchyma and are filled with cerebrospinal fluid (CSF)/interstitial fluid.
- CSF cerebrospinal fluid
- PVS are common in the midbrain, BG, and centrum semiovale. While not wishing to be bound by theory, PVS may play a role in the normal clearance of metabolites and have been associated with worse cognition and several disease states including Parkinson's disease.
- PVS are usually normal in size but they can increase in size in a number of disease states.
- Potter et al. (Cerebrovasc Dis. 2015 January; 39(4): 224-231; the contents of which are herein incorporated by reference in its entirety) developed a grading method where they studied a full range of PVS and rated basal ganglia, centrum semiovale and midbrain PVS. They used the frequency and range of PVS used by Mac and Lullich et al. (J Neurol Neurosurg Psychiatry. 2004 November; 75(11):1519-23; the contents of which are herein incorporated by reference in its entirety) and Potter et al.
- the selection of subjects for administration of the AAV particles described herein and/or the effectiveness of the dose, route of administration and/or volume of administration may be evaluated using positron emission tomography (PET) measurements of neuroimaging biomarkers such as, but not limited to [ 18 F]FDOPA.
- Neuroimaging biomarkers such as [ 18 F]FDOPA may be used to identify affected individuals and/or may be used to detect a nigrostriatal defect prior to the onset of clinical manifestations.
- PET-based criteria may be used to categorize subjects based on their nigrostriatal neuronal integrity (e.g., abnormal, normal or uncertain nigrostriatal neuronal integrity) (Rachette et al. Am J Med Genet B Neuropsychiatr Genet. 2006 Apr. 5; 141B(3): 245-249; the contents of which are herein incorporated by reference in its entirety).
- a subject who may be administered a dose of the AAV particles described herein may have advanced PD and still respond to levodopa therapy but the subject also experiences medically refractory motor complications (e.g., sever motor fluctuations and/or dyskinesias that occur during levodopa and other dopaminergic therapies despite adjustments in and optimization of medication).
- the subject may be healthy enough to undergo a neurosurgical procedure which may be determined by methods known in the art.
- the subject may meet the selection criteria for deep brain stimulation (DBS).
- DBS deep brain stimulation
- the subject may have idiopathic PD, younger than 69 years of age, have pronounced responses to levodopa, have medication-refractory symptoms (e.g., motor fluctuation and/or dyskinesia) and/or have little or no cognitive dysfunction.
- medication-refractory symptoms e.g., motor fluctuation and/or dyskinesia
- a subject who may be administered a dose of the AAV particles described herein may also suffer from dementia or cognitive impairment.
- a subject who may be administered a dose of the AAV particles described herein may have been previously treated with the same or similar therapeutic.
- a subject may have been treated with a therapeutic which has been shown to reduce the symptoms of Parkinson's Disease.
- a subject who may be administered a dose of the AAV particles described herein may have failed to derive adequate benefit from standard medical therapy.
- the subject may not have responded to treatment.
- a subject may have residual disability despite treatment.
- a subject who may be administered a dose of the AAV particles described herein may undergo testing to evaluate the levels of neurotransmitter analytes to determine the effectiveness of the dose.
- CSF neurotransmitters, plasma AADC activity and/or urine VLA may be analyzed.
- a subject who may be administered a dose of the AAV particles described herein may be videotaped or recorded in order to monitor the progress of the subject during the course of treatment.
- the AAV particles may be administered to the right putamen and/or the left putamen.
- the administration may be at one or more sites in the putamen such as, but not limited to, 2 sites, 3 sites, 4 sites or more than 4 sites.
- the AAV particles are delivered to 2 sites in the left putamen and 2 sites in the right putamen.
- the administration of the formulation of the AAV particles to a subject provides coverage of the putamen of a subject (e.g., the left and/or right putamen).
- the administration of the AAV particles may provide at least 8%, 9%, 10%, 13%, 14%, 15%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95% to the left and/or right putamen of a subject.
- the coverage is at least 20%.
- the coverage is at least 40%.
- the administration of the AAV particles may provide at least 8%, 9%, 10%, 13%, 14%, 15%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95% coverage of the surface area of the left and/or right putamen of a subject.
- the total coverage is at least 20%.
- the total coverage is at least 40%.
- the administration of the AAV particles may provide 10-40%, 20-40%, 20-30%, 20-35%, 20-50%, 30-40%, 35-40%, 30-60%, 40-70%, 50-80% or 60-90% coverage to the left and/or right putamen of a subject or to the total surface area of the left and/or right putamen of a subject.
- the administration of the formulation of the AAV particles to a subject provides coverage of the posterior putamen of a subject (e.g., the left and/or right posterior putamen).
- the administration of the AAV particles may provide at least 10%, 15%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%,51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95% to the left and/or right posterior putamen of a subject.
- the coverage is at least 20%.
- the coverage is at least 40%.
- the administration of the AAV particles may provide at least 10%, 15%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95% coverage of the surface area of the left and/or right posterior putamen of a subject.
- the total coverage is at least 20%. As a non-limiting example, the total coverage is at least 40%.
- the administration of the AAV particles may provide 10-40%, 20-50%, 30-60%, 40-70%, 50-80% or 60-90% coverage to the left and/or right posterior putamen of a subject or to the total surface area of the left and/or right putamen of a subject.
- the AAV particles described herein may be administered using acute bilateral placement of catheters into each putamen.
- the placement may use magnetic resonance image (MRI)-guided stereotactic neurosurgical techniques known in the art or described herein.
- MRI magnetic resonance image
- a contrast agent such as, but not limited to a gadolinium based contrast agent (e.g., PROHANCE®) may be used in the formulation to monitor and confirm the distribution of the formulation.
- PROHANCE® gadolinium based contrast agent
- a subject may be administered the AAV particles in a bilateral stereotactic CED-assisted step infusion into the putamen (e.g., the post commissural putamen).
- a bilateral stereotactic CED-assisted step infusion into the putamen e.g., the post commissural putamen.
- a subject may be administered the AAV particles of the present disclosure at a dose of 4.5 ⁇ 10 12 vector genomes at a volume of 900 ul per putamen.
- a subject may be administered the AAV particles of the present disclosure at a dose of 1.5 ⁇ 10 12 vector genomes at a volume of 900 ul per putamen.
- a subject may be administered the AAV particles of the present disclosure at a dose of 7.5 ⁇ 10 11 vector genomes at a volume of 450 ul per putamen.
- a subject may be administered the AAV particles with a bilateral surgical infusion into at least one putamen using a posterior (i.e., back of the head) surgical delivery approach.
- the number of posterior bilateral surgical infusions may be one or more such as, but not limited to, 1 infusion, 2 infusions, 3 infusions, 4 infusions or more than 4 infusions.
- the AAV particles are delivered in the left putamen with one posterior bilateral surgical infusion.
- the AAV particles are delivered in the right putamen with one posterior bilateral surgical infusion.
- the AAV particles are delivered in the left putamen with two posterior bilateral surgical infusions.
- the AAV particles are delivered in the right putamen with two posterior bilateral surgical infusions.
- the AAV particles are delivered in the right and left putamen with two posterior bilateral surgical infusions.
- the AAV particles are delivered in the left putamen with three posterior bilateral surgical infusions.
- the AAV particles are delivered in the right putamen with three posterior bilateral surgical infusions.
- the AAV particles are delivered in the right and left putamen with three posterior bilateral surgical infusions.
- the AAV particles are delivered in the left putamen with four posterior bilateral surgical infusions.
- the AAV particles are delivered in the right putamen with four posterior bilateral surgical infusions.
- the AAV particles are delivered in the right and left putamen with four posterior bilateral surgical infusions.
- a subject may be administered the AAV particles with a bilateral surgical infusion into at least one putamen using a transfrontal (i.e., top of the head) surgical delivery approach.
- the number of bilateral surgical infusions may be two or more such as, but not limited to, 2 infusions, 3 infusions, 4 infusions or more than 4 infusions.
- the AAV particles are delivered in the left putamen with 2 posterior bilateral surgical infusions.
- the AAV particles are delivered in the right putamen with 2 posterior bilateral surgical infusions.
- the AAV particles are delivered in the left and right putamen with 2 posterior bilateral surgical infusions.
- a subject may be administered the AAV particles of the present disclosure safely delivered to substantia nigra pars compacta (SNpc) and ventral tegmental area (VTA) via bilateral infusions, or alternatively, intrastriatally (into the caudate nucleus and putamen), or into the subthalamic nucleus (STN).
- SNpc substantia nigra pars compacta
- VTA ventral tegmental area
- STN subthalamic nucleus
- the present disclosure provides methods of administering AAV particles in accordance with the disclosure to a subject in need thereof.
- the pharmaceutical, diagnostic, or prophylactic AAV particles and compositions of the present disclosure may be administered to a subject using any amount and any route of administration effective for preventing, treating, managing, or diagnosing diseases, disorders and/or conditions.
- the exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like.
- the subject may be a human, a mammal, or an animal.
- Compositions in accordance with the disclosure are typically formulated in unit dosage form for ease of administration and uniformity of dosage.
- compositions of the present disclosure may be decided by the attending physician within the scope of sound medical judgment.
- the specific therapeutically effective, prophylactically effective, or appropriate diagnostic dose level for any particular individual will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific payload employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific AAV particle employed; the duration of the treatment; drugs used in combination or coincidental with the specific AAV particle employed; and like factors well known in the medical arts.
- delivery of the AAV particles of the present disclosure results in minimal serious adverse events (SAEs) as a result of the delivery of the AAV particles.
- SAEs serious adverse events
- the AAV particle may be delivered a multi-dose regimen.
- the multi-dose regimen may be 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 doses.
- the AAV particle may be delivered to a subject via a multi-site route of administration.
- a subject may be administered the AAV particle at 2, 3, 4, 5 or more than 5 sites.
- AAV particle pharmaceutical compositions in accordance with the present disclosure may be administered at dosage levels sufficient to deliver from about 0.0001 mg/kg to about 100 mg/kg, from about 0.001 mg/kg to about 0.05 mg/kg, from about 0.005 mg/kg to about 0.05 mg/kg, from about 0.001 mg/kg to about 0.005 mg/kg, from about 0.05 mg/kg to about 0.5 mg/kg, from about 0.01 mg/kg to about 50 mg/kg, from about 0.1 mg/kg to about 40 mg/kg, from about 0.5 mg/kg to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, or from about 1 mg/kg to about 25 mg/kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic, diagnostic, or prophylactic, effect. It will be understood that the above dosing concentrations may be converted to vg or viral genomes per kg or into total viral genomes administered by one of
- AAV particle pharmaceutical compositions in accordance with the present disclosure may be administered at about 10 to about 600 ⁇ l/site, 50 to about 500 ⁇ l/site, 100 to about 400 ⁇ l/site, 120 to about 300 ⁇ l/site, 140 to about 200 ⁇ l/site, about 160 ⁇ l/site.
- AAV particles may be administered at 50 ⁇ l/site and/or 150 ⁇ l/site.
- delivery of compositions in accordance with the present disclosure to cells may comprise a total concentration per subject between about 1 ⁇ 10 6 VG and about 1 ⁇ 10 16 VG.
- delivery may comprise a composition concentration of about 1 ⁇ 10 6 , 2 ⁇ 10 6 , 3 ⁇ 10 6 , 4 ⁇ 10 6 , 5 ⁇ 10 6 , 6 ⁇ 10 6 , 7 ⁇ 10 6 , 8 ⁇ 10 6 , 9 ⁇ 10 6 , 1 ⁇ 10 7 , 2 ⁇ 10 7 , 3 ⁇ 10 7 , 4 ⁇ 10 7 , 5 ⁇ 10 7 , 6 ⁇ 10 7 , 7 ⁇ 10 7 , 8 ⁇ 10 7 , 9 ⁇ 10 7 , 1 ⁇ 10 8 , 2 ⁇ 10 8 , 3 ⁇ 10 8 , 4 ⁇ 10 8 , 5 ⁇ 10 8 , 6 ⁇ 10 8 , 7 ⁇ 10 8 , 8 ⁇ 10 8 , 9 ⁇ 10 8 , 1 ⁇ 10 9 , 2 ⁇ 10 9 , 3 ⁇ 10 9 , 4 ⁇ 10 9 , 5 ⁇ 10 9 , 6 ⁇ 10 8 , 7 ⁇ 10 8 , 8
- the concentration of the AAV particle in the composition is 1 ⁇ 10 13 VG/subject. In one embodiment, the concentration of the AAV particle in the composition is 3 ⁇ 10 12 VG/subject. As a non-limiting example, the composition administered to the subject has a concentration of about 3 ⁇ 10 11 VG/subject. As a non-limiting example, the composition administered to the subject has a concentration of about 9 ⁇ 10 11 VG/subject. In one embodiment, the concentration of the AAV particle in the composition is 2.3 ⁇ 10 11 VG/subject. In one embodiment, the concentration of the AAV particle in the composition is 7.2 ⁇ 10 11 VG/subject. In one embodiment, the concentration of the AAV particle in the composition is 7.5 ⁇ 10 11 VG/subject.
- the concentration of the AAV particle in the composition is 1.4 ⁇ 10 12 VG/subject. In one embodiment, the concentration of the AAV particle in the composition is 4.8 ⁇ 10 12 VG/subject. In one embodiment, the concentration of the AAV particle in the composition is 8.8 ⁇ 10 12 VG/subject. In one embodiment, the concentration of the AAV particle in the composition is 2.3 ⁇ 10 12 VG/subject.
- delivery of compositions in accordance with the present disclosure to cells may comprise a total concentration per subject between about 1 ⁇ 10 6 VG/kg and about 1 ⁇ 10 16 VG/kg.
- delivery may comprise a composition concentration of about 1 ⁇ 10 6 , 2 ⁇ 10 6 , 3 ⁇ 10 6 , 4 ⁇ 10 6 , 5 ⁇ 10 6 , 6 ⁇ 10 6 , 7 ⁇ 10 6 , 8 ⁇ 10 6 , 9 ⁇ 10 6 , 1 ⁇ 10 7 , 2 ⁇ 10 7 , 3 ⁇ 10 7 , 4 ⁇ 10 7 , 5 ⁇ 10 7 , 6 ⁇ 10 7 , 7 ⁇ 10 7 , 8 ⁇ 10 7 , 9 ⁇ 10 7 , 1 ⁇ 10, 2 ⁇ 10, 3 ⁇ 10 8 , 4 ⁇ 10 8 , 5 ⁇ 10, 6 ⁇ 10, 7 ⁇ 10, 8 ⁇ 10, 9 ⁇ 10 8 , 1 ⁇ 10 9 , 2 ⁇ 10 9 , 3 ⁇ 10 9 , 4 ⁇ 10 9 , 5 ⁇ 10 9 , 6 ⁇ 10 9 , 7 ⁇ 10 9 , 7 ⁇ 10 9 , 8 ⁇ 10
- delivery of AAV particles to cells of the central nervous system may comprise a total dose between about 1 ⁇ 10 6 VG and about 1 ⁇ 10 16 VG.
- delivery may comprise a total dose of about 1 ⁇ 10 6 , 2 ⁇ 10 6 , 3 ⁇ 10 6 , 4 ⁇ 10 6 , 5 ⁇ 10 6 , 6 ⁇ 10 6 , 7 ⁇ 10 6 , 8 ⁇ 10 6 , 9 ⁇ 10 6 , 1 ⁇ 10 7 , 2 ⁇ 10 7 , 3 ⁇ 10 7 , 4 ⁇ 10 7 , 5 ⁇ 10 7 , 6 ⁇ 10 7 , 7 ⁇ 10 7 , 8 ⁇ 10 7 , 9 ⁇ 10 7 , 1 ⁇ 10 8 , 2 ⁇ 10 8 , 3 ⁇ 10 8 , 4 ⁇ 10 8 , 5 ⁇ 10, 6 ⁇ 10, 7 ⁇ 10, 8 ⁇ 10, 9 ⁇ 10 8 , 1 ⁇ 10 9 , 2 ⁇ 10 9 , 3 ⁇ 10 9 , 4 ⁇ 10 9 , 5 ⁇ 10 9 , 6 ⁇ 10 9 , 6 ⁇ 10 9 , 3 ⁇ 10 9 , 4 ⁇ 10 9 ,
- about 10 5 to 10 6 viral genome (unit) may be administered per dose.
- delivery of the compositions in accordance with the present disclosure to cells may comprise a total concentration between about 1 ⁇ 10 6 VG/mL and about 1 ⁇ 10 16 VG/mL.
- delivery may comprise a composition concentration of about 1 ⁇ 10 6 , 2 ⁇ 10 6 , 3 ⁇ 10 6 , 4 ⁇ 10 6 , 5 ⁇ 10 6 , 6 ⁇ 10 6 , 7 ⁇ 10 6 , 8 ⁇ 10 6 , 9 ⁇ 10 6 , 1 ⁇ 10 7 , 2 ⁇ 10 7 , 3 ⁇ 10 7 , 4 ⁇ 10 7 , 5 ⁇ 10 7 , 6 ⁇ 10 7 , 7 ⁇ 10 7 , 8 ⁇ 10 7 , 9 ⁇ 10 7 , 1 ⁇ 10 8 , 2 ⁇ 10 8 , 3 ⁇ 10 8 , 4 ⁇ 10 8 , 5 ⁇ 10 8 , 6 ⁇ 10 8 , 7 ⁇ 10 8 , 8 ⁇ 10 8 , 9 ⁇ 10 8 , 1 ⁇ 10 9 , 2 ⁇ 10 9 , 3 ⁇ 10 9 , 4 ⁇ 10 9 , 5 ⁇ 10 9 , 6 ⁇ 10 8 , 7 ⁇
- the concentration of the AAV particle in the composition is 1 ⁇ 10 13 VG/mL. In one embodiment, the concentration of the AAV particle in the composition is 3 ⁇ 10 12 VG/mL. In one embodiment, the concentration of the AAV particle in the composition is 1.1 ⁇ 10 12 VG/mL. In one embodiment, the concentration of the AAV particle in the composition is 3.7 ⁇ 10 12 VG/mL. In one embodiment, the concentration of the AAV particle in the composition is 8 ⁇ 10 11 VG/mL. In one embodiment, the concentration of the AAV particle in the composition is 2.6 ⁇ 10 12 VG/mL. In one embodiment, the concentration of the AAV particle in the composition is 4.9 ⁇ 10 12 VG/mL.
- the concentration of the AAV particle in the composition is 0.8 ⁇ 10 12 VG/mL. In one embodiment, the concentration of the AAV particle in the composition is 0.83 ⁇ 10 12 VG/mL. In one embodiment, the concentration of the AAV particle in the composition is the maximum final dose which can be contained in a vial.
- delivery of AAV particles to cells of the central nervous system may comprise a composition concentration between about 1 ⁇ 10 6 VG/mL and about 1 ⁇ 10 16 VG/mL.
- delivery may comprise a composition concentration of about 1 ⁇ 10 6 , 2 ⁇ 10 6 , 3 ⁇ 10 6 , 4 ⁇ 10 6 , 5 ⁇ 10 6 , 6 ⁇ 10 6 , 7 ⁇ 10 6 , 8 ⁇ 10 6 , 9 ⁇ 10 6 , 1 ⁇ 10 7 , 2 ⁇ 10 7 , 3 ⁇ 10 7 , 4 ⁇ 10 7 , 5 ⁇ 10 7 , 6 ⁇ 10 7 , 7 ⁇ 10 7 , 8 ⁇ 10 7 , 9 ⁇ 10 7 , 1 ⁇ 10 8 , 2 ⁇ 10 8 , 3 ⁇ 10 8 , 4 ⁇ 10 8 , 5 ⁇ 10 8 , 6 ⁇ 10 8 , 7 ⁇ 10 8 , 8 ⁇ 10 8 , 9 ⁇ 10 8 , 1 ⁇ 10 9 , 2 ⁇ 10 9 , 3 ⁇ 10 9 , 4 ⁇ 10 9
- the desired dosage of the AAV particles of the present disclosure may be delivered only once, three times a day, two times a day, once a day, every other day, every third day, every week, every two weeks, every three weeks, or every four weeks.
- the desired dosage may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations).
- split dosing regimens such as those described herein may be used.
- a “split dose” is the division of “single unit dose” or total daily dose into two or more doses, e.g., two or more administrations of the “single unit dose”.
- a “single unit dose” is a dose of any therapeutic administered in one dose/at one time/single route/single point of contact, i.e., single administration event.
- the desired dosage of the AAV particles of the present disclosure may be administered as a “pulse dose” or as a “continuous flow”.
- a “pulse dose” is a series of single unit doses of any therapeutic administered with a set frequency over a period of time.
- a “continuous flow” is a dose of therapeutic administered continuously for a period of time in a single route/single point of contact, i.e., continuous administration event.
- a total daily dose, an amount given or prescribed in 24 hour period may be administered by any of these methods, or as a combination of these methods, or by any other methods suitable for a pharmaceutical administration.
- delivery of the AAV particles of the present disclosure to a subject provides regulating activity of AADC in a subject.
- the regulating activity may be an increase in the production of AADC in a subject.
- the regulating activity can be for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years or more than 10 years.
- the AAV particle of the present disclosure may be administered to a subject using a single dose, one-time treatment.
- the dose of the one-time treatment may be administered by any methods known in the art and/or described herein.
- a “one-time treatment” refers to a composition which is only administered one time. If needed, a booster dose may be administered to the subject to ensure the appropriate efficacy is reached.
- a booster may be administered 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 24 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or more than 10 years after the one-time treatment.
- the AAV particles or pharmaceutical compositions of the present disclosure may be administered or delivered using the methods for treatment of disease described in U.S. Pat. No. 8,999,948, or International Publication No. WO2014178863, the contents of which are herein incorporated by reference in their entirety.
- the AAV particles or pharmaceutical compositions of the present disclosure may be administered or delivered using the methods for delivering gene therapy in Alzheimer's Disease or other neurodegenerative conditions as described in US Application No. 20150126590, the contents of which are herein incorporated by reference in their entirety.
- the AAV particles or pharmaceutical compositions of the present disclosure may be administered or delivered using the methods for delivery of a CNS gene therapy as described in U.S. Pat. Nos. 6,436,708, and 8,946,152, and International Publication No. WO2015168666, the contents of which are herein incorporated by reference in their entirety.
- the AAV particle comprising an AADC polynucleotide may be administered or delivered using the methods for the delivery of AAV virions described in European Patent Application No. EP1857552, the contents of which are herein incorporated by reference in its entirety.
- the AAV particle or pharmaceutical compositions of the present disclosure may be administered or delivered using the methods for delivering proteins using AAV particles described in European Patent Application No. EP2678433, the contents of which are herein incorporated by reference in their entirety.
- the AAV particle comprising an AADC polynucleotide may be administered or delivered using the methods for delivering DNA molecules using AAV particles described in U.S. Pat. No. 5,858,351, the contents of which are herein incorporated by reference in its entirety.
- the AAV particle or pharmaceutical compositions of the present disclosure may be administered or delivered using the methods for delivering DNA to the bloodstream described in U.S. Pat. No. 6,211,163, the contents of which are herein incorporated by reference in their entirety.
- the AAV particle or pharmaceutical compositions of the present disclosure may be administered or delivered using the methods for delivering a payload to the central nervous system described in U.S. Pat. No. 7,588,757, the contents of which are herein incorporated by reference in their entirety.
- the AAV particle may be administered or delivered using the methods for delivering AAV virions described in U.S. Pat. No. 6,325,998, the contents of which are herein incorporated by reference in its entirety.
- the AAV particle or pharmaceutical compositions of the present disclosure may be administered or delivered using the methods for delivering a payload described in U.S. Pat. No. 8,283,151, the contents of which are herein incorporated by reference in their entirety.
- the AAV particle or pharmaceutical compositions of the present disclosure may be administered or delivered using the methods for delivering a payload using a glutamic acid decarboxylase (GAD) delivery vector described in International Patent Publication No. WO2001089583, the contents of which are herein incorporated by reference in their entirety.
- GAD glutamic acid decarboxylase
- the AAV particle or pharmaceutical compositions of the present disclosure may be administered or delivered using the methods for delivering a payload to neural cells described in International Patent Publication No. WO2012057363, the contents of which are herein incorporated by reference in their entirety.
- the present disclosure provides a method of delivering to a cell or tissue any of the above-described AAV particles, comprising contacting the cell or tissue with said AAV particle or contacting the cell or tissue with a formulation comprising said AAV particle, or contacting the cell or tissue with any of the described compositions, including pharmaceutical compositions.
- the method of delivering the AAV particle to a cell or tissue can be accomplished in vitro, ex vivo, or in vivo.
- the present disclosure additionally provides a method of delivering to a subject, including a mammalian subject, any of the above-described AAV particles comprising administering to the subject said AAV particle, or administering to the subject a formulation comprising said AAV particle, or administering to the subject any of the described compositions, including pharmaceutical compositions.
- the AAV particles may be used in combination with one or more other therapeutic, prophylactic, research or diagnostic agents.
- Compositions can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and/or on a time schedule determined for that agent.
- the present disclosure encompasses the delivery of pharmaceutical, prophylactic, research, or diagnostic compositions in combination with agents that may improve their bioavailability, reduce and/or modify their metabolism, inhibit their excretion, and/or modify their distribution within the body.
- the AAV particles described herein may be administered to a subject who is also undergoing levodopa therapy.
- the subject may have a positive response to levodopa therapy and at least one symptom of PD is reduced.
- the subject may have a response to levodopa therapy where the symptoms of PD experienced by the subject are stable.
- the subject may have a negative response to levodopa therapy where the symptoms of PD experienced by the subject are increasing.
- the dose of levodopa administered to the subject prior to the AAV articles is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more than 25 mg/kg.
- the dose is 3 mg/kg.
- the dose is 10 mg/kg.
- the dose is 20 mg/kg.
- the subject's response (e.g., behavioral response) to levodopa may be assessed prior to administration of the AAV particles.
- the subject may be administered levodopa again after the administration of the AADC polynucleotides (e.g., 1 week, 2, weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year or more than 1 year after the administration of AAV particles).
- the behavioral response can be re-assessed and compared to the initial response to determine the effects of the AAV particles.
- the subject may have 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% behavioral improvement.
- Levodopa may be administered multiple times after the administration of the AAV particles.
- Levodopa may be administered on a repeating schedule (e.g., every 5 days, weekly, every 10 days, every 15 days, every 30 days, monthly, bimonthly, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months or yearly) or as symptoms arise.
- a repeating schedule e.g., every 5 days, weekly, every 10 days, every 15 days, every 30 days, monthly, bimonthly, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months or yearly
- 3 years post administration of AADC polynucleotides a subject may have 1-10%, 5-15%, 10-20%, 15-30%, 20-40%, 25-50%, 30-50%, 40-50%, 40-60%, 50-70%, 50-80%, 60-70%, 60-75%, 60-80%, 60-90%, 70-80%, 70-90%, 75-90%, 80-90%, 90-100% of the striatal neurons within the infused region of the putamen to be AADC-immunoreactive.
- a subject may have 1-10%, 5-15%, 10-20%, 15-30%, 20-40%, 25-50%, 30-50%, 40-50%, 40-60%, 50-70%, 50-80%, 60-70%, 60-75%, 60-80%, 60-90%, 70-80%, 70-90%, 75-90%, 80-90%, 90-100% of the striatal neurons within the infused region of the putamen to be AADC-immunoreactive.
- 9 years post administration of AADC polynucleotides a subject may have 1-10%, 5-15%, 10-20%, 15-30%, 20-40%, 25-50%, 30-50%, 40-50%, 40-60%, 50-70%, 50-80%, 60-70%, 60-75%, 60-80%, 60-90%, 70-80%, 70-90%, 75-90%, 80-90%, 90-100% of the striatal neurons within the infused region of the putamen to be AADC-immunoreactive.
- a subject who may be administered the AAV particles described herein have a documented response to levodopa therapy but have medically refractory fluctuations and are considered good surgical candidates.
- the determination if a subject is a good surgical candidate may be made by the physician treating the subject for PD or the physician administering the AAV particles who takes into consideration the overall risk to benefit ratio for the patient for the surgical intervention required for delivery of the AAV particles.
- Payloads from viral genomes may be determined using various methods known in the art such as, but not limited to immunochemistry (e.g., IHC), in situ hybridization (ISH), enzyme-linked immunosorbent assay (ELISA), affinity ELISA, ELISPOT, flow cytometry, immunocytology, surface plasmon resonance analysis, kinetic exclusion assay, liquid chromatography-mass spectrometry (LCMS), high-performance liquid chromatography (HPLC), BCA assay, immunoelectrophoresis, Western blot, SDS-PAGE, protein immunoprecipitation, and/or PCR.
- immunochemistry e.g., IHC
- ISH in situ hybridization
- ELISA enzyme-linked immunosorbent assay
- affinity ELISA affinity ELISA
- ELISPOT enzyme-linked immunosorbent assay
- flow cytometry immunocytology
- surface plasmon resonance analysis e.g., surface plasmon resonance analysis
- kinetic exclusion assay e.g., kinetic exclusion as
- compositions of AAV particles described herein may be characterized by one or more of bioavailability, therapeutic window and/or volume of distribution.
- the AAV particles when formulated into a composition with a delivery agent as described herein, can exhibit an increase in bioavailability as compared to a composition lacking a delivery agent as described herein.
- bioavailability refers to the systemic availability of a given amount of AAV particle or expressed payload administered to a mammal. Bioavailability can be assessed by measuring the area under the curve (AUC) or the maximum serum or plasma concentration (C max ) of the composition following. AUC is a determination of the area under the curve plotting the serum or plasma concentration of a compound (e.g., AAV particles or expressed payloads) along the ordinate (Y-axis) against time along the abscissa (X-axis).
- AUC area under the curve
- C max maximum serum or plasma concentration
- the AUC for a particular compound can be calculated using methods known to those of ordinary skill in the art and as described in G. S. Banker, Modern Pharmaceutics, Drugs and the Pharmaceutical Sciences, v. 72, Marcel Dekker, New York, Inc., 1996, the contents of which are herein incorporated by reference in its entirety.
- the C max value is the maximum concentration of the AAV particle or expressed payload achieved in the serum or plasma of a mammal following administration of the AAV particle to the mammal.
- the C max value of can be measured using methods known to those of ordinary skill in the art.
- the phrases “increasing bioavailability” or “improving the pharmacokinetics,” as used herein mean that the systemic availability of a first AAV particle or expressed payload, measured as AUC, C max , or C min in a mammal is greater, when co-administered with a delivery agent as described herein, than when such co-administration does not take place.
- the bioavailability can increase by at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%.
- therapeutic window refers to the range of plasma concentrations, or the range of levels of therapeutically active substance at the site of action, with a high probability of eliciting a therapeutic effect.
- the therapeutic window of the AAV particle as described herein can increase by at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%.
- volume of distribution refers to the fluid volume that would be required to contain the total amount of the drug in the body at the same concentration as in the blood or plasma: V dist equals the amount of drug in the body/concentration of drug in blood or plasma. For example, for a 10 mg dose and a plasma concentration of 10 mg/L, the volume of distribution would be 1 liter. The volume of distribution reflects the extent to which the drug is present in the extravascular tissue. A large volume of distribution reflects the tendency of a compound to bind to the tissue components compared with plasma protein binding. In a clinical setting, V dist can be used to determine a loading dose to achieve a steady state concentration.
- the volume of distribution of the AAV particles as described herein can decrease at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%.
- the biological effect of the AAV particles delivered to the animals may be categorized by analyzing the payload expression in the animals.
- the payload expression may be determined from analyzing a biological sample collected from a mammal administered the AAV particles of the present disclosure. For example, a protein expression of 50-200 pg/ml for the protein encoded by the AAV particles delivered to the mammal may be seen as a therapeutically effective amount of protein in the mammal.
- the polynucleotides of the present disclosure may be used in the treatment, prophylaxis or amelioration of any disease or disorder characterized by aberrant or undesired target expression.
- the disclosure relates to AAV particles for use in the treatment of Parkinson's disease.
- the AAV particles may be used in the treatment, prophylaxis or amelioration of any disease or disorder characterized by aberrant or undesired target expression wherein the payload, i.e. AADC, is swapped for an alternate payload.
- the payload i.e. AADC
- the present disclosure provides a method for treating a disease, disorder and/or condition in a mammalian subject, including a human subject, comprising administering to the subject AAV particles described herein.
- the disease, disorder and/or condition is a neurological disease, disorder and/or condition.
- the CNS diseases may be diseases that affect any component of the brain (including the cerebral hemispheres, diencephalon, brain stem, and cerebellum) or the spinal cord.
- viral particles of the present disclosure through delivery of a functional payload that is a therapeutic product that can modulate the level or function of a gene product in the CNS, may be used to treat a neurodegenerative diseases and/or diseases or disorders that are characteristic with neurodegeneration, neuromuscular diseases, lysosomal diseases, trauma, bone marrow injuries, pain (including neuropathic pain), cancers of the nervous system, demyelinating diseases, autoimmune diseases of the nervous system, neurotoxic syndromes, sleeping disorders, genetic brain disorders and developmental CNS disorders.
- a neurodegenerative diseases and/or diseases or disorders that are characteristic with neurodegeneration, neuromuscular diseases, lysosomal diseases, trauma, bone marrow injuries, pain (including neuropathic pain), cancers of the nervous system, demyelinating diseases, autoimmune diseases of the nervous system, neurotoxic syndromes, sleeping disorders, genetic brain disorders and developmental CNS disorders.
- a functional payload may alleviate or reduce symptoms that result from abnormal level and/or function of a gene product (e.g., an absence or defect in a protein) in a subject in need thereof or that otherwise confers a benefit to a CNS disorder in a subject in need thereof.
- a gene product e.g., an absence or defect in a protein
- therapeutic products delivered by AAV particles of the present disclosure may include, but are not limited to, growth and trophic factors, cytokines, hormones, neurotransmitters, enzymes, anti-apoptotic factors, angiogenic factors, and any protein known to be mutated in pathological disorders such as the “survival of motor neuron” protein (SMN); antisense RNA or RNAi targeting messenger RNAs coding for proteins having a therapeutic interest in any of CNS diseases discussed herein; or microRNAs that function in gene silencing and post-transcriptionally regulation of gene expression in the CNS (e.g., brain specific Mir-128a, See Adlakha and Saini, Molecular cancer, 2014, 13:33).
- an RNAi targeting the superoxide dismutase enzyme may be packaged by viral particles of the present disclosure, for the treatment of ALS.
- the growth and trophic factors may include, but are not limited to brain-derived growth factor (BDNF), epidermal growth factor (EGF), basic Fibroblast growth factor (bFGF), Ciliary neurotrophic factor (CNTF), corticotropin-releasing factor (CRF), Glial cell line derived growth factor (GDNF), Insulin-like growth factor-1 (IGF-1), nerve growth factor (NGF), neurotrophin-3 (NT-3), neurotrophin-4 (NT-4), and vascular endothelial growth factor (VEGF).
- Cytokines may include interleukin-10 (IL-10), interleukin-6, Interleukin-8, chemokine CXCL12 (SDF-1), TGF-beta, and Growth and differentiation factor (GDF-1/10).
- the neurological disorders may be neurodegenerative disorders including, but not limited to, Alzheimer's Diseases (AD); Amyotrophic lateral sclerosis (ALS); Creutzfeldt-Jakob Disease (CJD); Huntingtin's disease (HD); Friedreich's ataxia (FA); Parkinson Disease (PD); Multiple System Atrophy (MSA); Spinal Muscular Atrophy (SMA), Multiple Sclerosis (MS); Primary progressive aphasia; Progressive supranuclear palsy (PSP); Dementia; Brain Cancer, Degenerative Nerve Diseases, Encephalitis, Epilepsy, Genetic Brain Disorders that cause neurodegeneration, Retinitis pigmentosa (RP), Head and Brain Malformations, Hydrocephalus, Stroke, Prion disease, Infantile neuronal ceroid lipofuscinosis (INCL) (a neurodegenerative disease of children caused by a deficiency in the lysosomal enzyme palmitoyl protein thioesterase-1 (PPT1)), and others.
- AD Alzheimer
- viral particles of the present disclosure may be used to treat diseases that are associated with impairments of the growth and development of the CNS, i.e., neurodevelopmental disorders.
- neurodevelopmental disorders may be caused by genetic mutations, including but not limited to, Fragile X syndrome (caused by mutations in FMR1 gene), Down syndrome (caused by trisomy of chromosome 21), Rett syndrome, Williams syndrome, Angelman syndrome, Smith-Magenis syndrome, ATR-X syndrome, Barth syndrome, Immune dysfunction and/or infectious diseases during infancy such as Sydenham's chorea, Schizophrenia Congenital toxoplasmosis, Congenital rubella syndrome, Metabolic disorders such as diabetes mellitus and phenylketonuria; nutritional defects and/or brain trauma, Autism and autism spectrum.
- Fragile X syndrome caused by mutations in FMR1 gene
- Down syndrome caused by trisomy of chromosome 21
- Rett syndrome Williams syndrome
- Angelman syndrome Smith-Magenis syndrome
- viral particles of the present disclosure may be used to treat a tumor in the CNS, including but not limited to, acoustic neuroma, Astrocytoma (Grades I, II, III and IV), Chordoma, CNS Lymphoma, Craniopharyngioma, Gliomas (e.g., brain stem glioma, ependymoma, optical nerve glioma, subependymoma), Medulloblastoma, Meningioma, Metastatic brain tumors, Oligodendroglioma, Pituitary Tumors, Primitive neuroectodermal (PNET), and Schwannoma.
- acoustic neuroma including but not limited to, acoustic neuroma, Astrocytoma (Grades I, II, III and IV), Chordoma, CNS Lymphoma, Craniopharyngioma, Gliomas (e.g., brain stem glioma, e
- the neurological disorders may be functional neurological disorders with motor and/or sensory symptoms which have neurological origin in the CNS.
- functional neurological disorders may be chronic pain, seizures, speech problems, involuntary movements, and sleep disturbances.
- the neurological disorders may be white matter disorders (a group of diseases that affects nerve fibers in the CNS) including but not limited to, Pelizaeus-Merzbacher disease, Hypomyelination with atrophy of basal ganglia and cerebellum, Aicardi-Goutieres syndrome, Megalencephalic leukoencephalopathy with subcortical cysts, Congenital muscular dystrophies, Myotonic dystrophy, Wilson disease, Lowe syndrome, Sjögren-Larsson syndrome, PIBD or Tay syndrome, Cockayne's disease, erebrotendinous xanthomatosis, Zellweger syndrome, Neonatal adrenoleukodystrophy, Infantile Refsum disease, Zellweger-like syndrome, Pseudo-Zellweger syndrome, Pseudo-neonatal adrenoleukodystrophy, Bifunctional protein deficiency, X-linked adrenoleukodystrophy and
- the neurological disorders may be lysosomal storage disorders (LSDs) caused by the inability of cells in the CNS to break down metabolic end products, including but not limited to Niemann-Pick disease (a LSD resulting from inherited deficiency in acid sphingomyelinase (ASM); Metachromatic leukodystrophy (MLD) (a LSD characterized by accumulation of sulfatides in glial cells and neurons, the result of an inherited deficiency of arylsulfatase A (ARSA)); Globoid-cell leukodystrophy (GLD) (a LSD caused by mutations in galactosylceramidase); Fabry disease (a LSD caused by mutations in the alpha-galactosidase A (GLA) gene); Gaucher disease (caused by mutations in the beta-glucocerebrosidase (GBA) gene); GM1/GM2 gangliosidosis; Mucopolys
- LSD
- the neurological disease, disorder and/or condition is Friedreich's Ataxia.
- the AAV particle used to treat Friedreich's Ataxia comprises a nucleic acid sequence such as, but not limited to, SEQ ID NO: 979 or a fragment or variant thereof, wherein the payload is replaced by Frataxin or any other payload known in the art for treating Friedreich's Ataxia.
- the neurological disease, disorder and/or condition is Amyotrophic lateral sclerosis (ALS).
- the AAV particle used to treat ALS comprises a nucleic acid sequence such as, but not limited to, SEQ ID NO: 979 or a fragment or variant thereof, wherein the payload is replaced by replaced by an shRNA, miRNA, siRNA, RNAi for SOD1 or any other payload known in the art for treating ALS.
- the neurological disease, disorder and/or condition is Huntington's disease.
- the AAV particle used to treat Huntington's disease comprises a nucleic acid sequence such as, but not limited to, SEQ ID NO: 979 or a fragment or variant thereof, wherein the payload is replaced by replaced by an shRNA, miRNA, siRNA, RNAi for Htt or any other payload known in the art for treating Huntington's disease.
- the neurological disease, disorder or condition is spinal muscular atrophy (SMA).
- the neurological disease, disorder and/or condition is Friedreich's Ataxia.
- the AAV particle used to treat SMN comprises a nucleic acid sequence such as, but not limited to, SEQ ID NO: 979 or a fragment or variant thereof, wherein the payload is replaced by Frataxin or any other payload known in the art for treating SMA.
- the neurological disease, disorder and/or condition is Parkinson's disease.
- the AAV particle used to treat Parkinson's disease comprises a payload such as, but not limited to, SEQ ID NO: 979 or a fragment or variant thereof.
- the subject is a human patient who has a minimum motor score of about 30 to a maximum score of about 100, about 10 to a maximum score of about 100, about 20 to a maximum score of about 100 in the Unified Parkinson's Disease Rating Scale.
- the subject has been diagnosed with Parkinson's disease within the past 5 years prior to treatment with the compositions described herein.
- the subject may have been diagnosed with Parkinson's disease within a week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6
- the subject has been diagnosed with Parkinson's disease between 5 and 10 years prior to treatment with the compositions described herein.
- the subject may have been diagnosed with Parkinson's disease 5, 5.5., 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5 or 10 years prior to treatment with the compositions described herein.
- the subject has been diagnosed with Parkinson's disease more than 10 years prior to treatment with the compositions described herein.
- the subject may have been diagnosed with Parkinson's disease 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24 or more than 24 years prior to treatment with the compositions described herein.
- a subject is 50-65 years of age.
- the subject is 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65 years of age.
- the subject is 50 years of age. As a non-limiting example, the subject is 51 years of age. As a non-limiting example, the subject is 52 years of age. As a non-limiting example, the subject is 53 years of age. As a non-limiting example, the subject is 54 years of age. As a non-limiting example, the subject is 55 years of age. As a non-limiting example, the subject is 56 years of age. As a non-limiting example, the subject is 57 years of age. As a non-limiting example, the subject is 58 years of age. As a non-limiting example, the subject is 59 years of age. As a non-limiting example, the subject is 60 years of age.
- the subject is 61 years of age. As a non-limiting example, the subject is 62 years of age. As a non-limiting example, the subject is 63 years of age. As a non-limiting example, the subject is 64 years of age. As a non-limiting example, the subject is 65 years of age.
- a subject is 30 to 50 years of age. As a non-limiting example, the subject is 30 years of age. As a non-limiting example, the subject is 31 years of age. As a non-limiting example, the subject is 32 years of age. As a non-limiting example, the subject is 33 years of age. As a non-limiting example, the subject is 34 years of age. As a non-limiting example, the subject is 35 years of age. As a non-limiting example, the subject is 36 years of age. As a non-limiting example, the subject is 37 years of age. As a non-limiting example, the subject is 38 years of age. As a non-limiting example, the subject is 39 years of age. As a non-limiting example, the subject is 40 years of age.
- the subject is 41 years of age. As a non-limiting example, the subject is 42 years of age. As a non-limiting example, the subject is 43 years of age. As a non-limiting example, the subject is 44 years of age. As a non-limiting example, the subject is 45 years of age. As a non-limiting example, the subject is 46 years of age. As a non-limiting example, the subject is 47 years of age. As a non-limiting example, the subject is 48 years of age. As a non-limiting example, the subject is 49 years of age. As a non-limiting example, the subject is 50 years of age.
- a subject is 65 to 85 years of age.
- the subject is 65 years of age.
- the subject is 66 years of age.
- the subject is 67 years of age.
- the subject is 68 years of age.
- the subject is 69 years of age.
- the subject is 70 years of age.
- the subject is 71 years of age.
- the subject is 72 years of age.
- the subject is 73 years of age.
- the subject is 74 years of age.
- the subject is 75 years of age. As a non-limiting example, the subject is 76 years of age. As a non-limiting example, the subject is 77 years of age. As a non-limiting example, the subject is 78 years of age. As a non-limiting example, the subject is 79 years of age. As a non-limiting example, the subject is 80 years of age. As a non-limiting example, the subject is 81 years of age. As a non-limiting example, the subject is 82 years of age. As 83 years of age. As a non-limiting example, the subject is 84 years of age. As a non-limiting example, the subject is 85 years of age.
- a subject has seen a change in motor symptoms such as tremors and movements prior to administration of the composition described herein.
- tremors include, unilateral or bilateral mild tremors, bilateral or midline moderate tremors or intractable tremors.
- movements include mild bradykinesia, moderate bradykinesia, severe bradykinesia and morning akinesia.
- a subject may have changes in balance such as, but not limited to, impaired balance, impaired righting reflexes, significant balance disorder or falling.
- a subject may have a reduced quality of life.
- the subject may have a moderate impact on their quality of life such as experiencing some limitations to activities of daily living.
- the subject may have a quality of life which has been diminished by illness.
- a subject has seen a change in non-motor symptoms prior to administration of the composition described herein.
- the subject may have mild to moderate cognitive impairment prior to administration to the composition described herein.
- the subject may have significant cognitive impairment such as dementia which may also include behavioral disturbances such as hallucinations.
- a subject may have a satisfactory response with limited fluctuations on one or more dopaminergic medications prior to administration of the compositions described herein.
- a subject may have motor fluctuations causing mild to moderate disability on one or more dopaminergic medications prior to administration of the compositions described herein.
- a subject may have medically refractory motor fluctuations consisting of “wearing off” and/or levodopa-induced dyskinesias causing significant disability prior to administration of the compositions described herein.
- a subject may have mild symptoms associated with Parkinson's disease such as, but not limited to, no cognitive impairment, diagnosed within the past 5 years, satisfactory response with limited fluctuations on one or more dopaminergic medications, unilateral or bilateral mild tremors, little to no impact on the quality of life, and/or no balance impairment.
- Parkinson's disease such as, but not limited to, no cognitive impairment, diagnosed within the past 5 years, satisfactory response with limited fluctuations on one or more dopaminergic medications, unilateral or bilateral mild tremors, little to no impact on the quality of life, and/or no balance impairment.
- a subject may have moderate symptoms associated with Parkinson's disease such as, but not limited to, mild to moderate cognitive impairment, first signs of impaired balance and righting reflexes, motor fluctuations causing mild-moderate disability on one or more dopaminergic medications, diagnosed within the past 5 to 10 years, bilateral or midline moderate tremors, moderate bradykinesia and/or subject experiencing some limitations to activities of daily living.
- Parkinson's disease such as, but not limited to, mild to moderate cognitive impairment, first signs of impaired balance and righting reflexes, motor fluctuations causing mild-moderate disability on one or more dopaminergic medications, diagnosed within the past 5 to 10 years, bilateral or midline moderate tremors, moderate bradykinesia and/or subject experiencing some limitations to activities of daily living.
- a subject may have advanced symptoms associated with Parkinson's disease such as, but not limited to, being diagnosed with Parkinson's more than 10 years, medium refractory motor fluctuations wearing off and/or levodopa-induced dyskinesia causing significant disability, intractable tremors, significant balance disorder and/or falling, significant cognitive impairment (such as dementia with or without behavioral disturbances), sever bradykinesia, quality of life markedly diminished by illness and/or morning akinesia.
- advanced symptoms associated with Parkinson's disease such as, but not limited to, being diagnosed with Parkinson's more than 10 years, medium refractory motor fluctuations wearing off and/or levodopa-induced dyskinesia causing significant disability, intractable tremors, significant balance disorder and/or falling, significant cognitive impairment (such as dementia with or without behavioral disturbances), sever bradykinesia, quality of life markedly diminished by illness and/or morning akinesia.
- a subject has been referred to a movement disorder specialist (MDS) but has not undergone deep brain stimulation.
- MDS movement disorder specialist
- a subject is using DUOPATM in combination with the compositions described herein.
- the subject may have success with using DUOPATM alone.
- the subject may not have any success or limited success using DUOPATM alone.
- a subject is one who was a candidate for surgical intervention including, but not limited to, deep-brain stimulation.
- deep-brain stimulation was suggested due to disabling motor complications despite treatment with optimal anti-Parkinsonian medication.
- a subject has an average on-time of 7.5-14 hours based on the subject diary.
- the average on-time is 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.1, 10.2, 10.3, 10.4, 10.5, 10.6, 10.7, 10.8, 10.9, 11, 11.1, 11.2, 11.3, 11.4, 11.5, 11.6, 11.7, 11.8, 11.9, 12, 12.1, 12.2, 12.3, 12.4, 12.5, 12.6, 12.7, 12.8, 12.9, 13, 13.1, 13.2, 13.3, 13.4, 13.5, 13.6, 13.7, 13.8, 13.9, or 14 hours.
- a subject has an average on-time of 10.5 hours based on the subject diary.
- a subject experiences about 1.5 hours more of diary on-time (without troublesome dyskinesia), as compared to baseline, 6 months after administration of the present disclosure.
- a subject experiences about 1.5 hours more of diary on-time 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 4.5 ⁇ 10 12 vector genome.
- a subject experiences about 2.2 hours more of diary on-time (without troublesome dyskinesia), as compared to baseline, 6 months after administration of the present disclosure.
- a subject experiences about 2.2 hours more of diary on-time 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- a subject experiences about 4 hours more of diary on-time (without troublesome dyskinesia), as compared to baseline, 6 months after administration of the present disclosure.
- a subject experiences about 4 hours more of diary on-time 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- a subject experiences about 1.6 hours more of diary on-time (without troublesome dyskinesia), as compared to baseline, 12 months after administration of the present disclosure.
- a subject experiences about 1.6 hours more of diary on-time 12 months after administration of the present disclosure at a dose volume of up to 450 uL per putamen and a total dose of 7.5 ⁇ 10 11 vector genome.
- a subject experiences about 3.3 hours more of diary on-time (without troublesome dyskinesia), as compared to baseline, 12 months after administration of the present disclosure.
- a subject experiences about 3.3 hours more of diary on-time 12 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- a subject experiences about 4 hours more of diary on-time (without troublesome dyskinesia), as compared to baseline, 12 months after administration of the present disclosure.
- a subject experiences about 4 hours more of diary on-time 12 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- a subject experiences about 2.3 hours more of diary on-time (without troublesome dyskinesia), as compared to baseline, 24 months after administration of the present disclosure.
- a subject experiences about 2.3 hours more of diary on-time 24 months after administration of the present disclosure at a dose volume of up to 450 uL per putamen and a total dose of 7.5 ⁇ 10 11 vector genome.
- a subject has an average off-time of 2-7 hours based on the subject diary.
- the average off-time is 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, or 7.
- a subject has an average off-time of 4.6 hours based on the subject diary.
- a subject experiences about 1.3 hours less of diary off-time, as compared to baseline, 6 months after administration of the present disclosure.
- a subject experiences about 1.3 hours less of diary off-time 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 4.5 ⁇ 10 12 vector genome.
- a subject experiences about 1.1 hours less of diary off-time, as compared to baseline, 6 months after administration of the present disclosure.
- a subject experiences about 1.1 hours less of diary off-time 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- a subject experiences about 0.8 hours less of diary off-time, as compared to baseline, 6 months after administration of the present disclosure.
- a subject experiences about 0.8 hours less of diary off-time 6 months after administration of the present disclosure at a dose volume of up to 450 uL per putamen and a total dose of 7.5 ⁇ 10 11 vector genome.
- a subject experiences about 2.3 hours less of diary off-time, as compared to baseline, 12 months after administration of the present disclosure.
- a subject experiences about 2.3 hours less of diary off-time 12 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- a subject experiences about 1.4 hours less of diary off-time, as compared to baseline, 12 months after administration of the present disclosure.
- a subject experiences about 1.4 hours less of diary off-time 12 months after administration of the present disclosure at a dose volume of up to 450 uL per putamen and a total dose of 7.5 ⁇ 10 11 vector genome.
- a subject experiences about 1.8 hours less of diary off-time, as compared to baseline, 24 months after administration of the present disclosure.
- a subject experiences about 1.8 hours less of diary off-time 24 months after administration of the present disclosure at a dose volume of up to 450 uL per putamen and a total dose of 7.5 ⁇ 10 11 vector genome.
- a subject experiences 10% less diary off-time 6 months after administration of the present disclosure. In one embodiment, a subject experiences 10% less diary off-time 12 months after administration of the present disclosure.
- a subject experiences 20% less diary off-time 6 months after administration of the present disclosure. In one embodiment, a subject experiences 20% less diary off-time 12 months after administration of the present disclosure.
- a subject experiences 30% less diary off-time 6 months after administration of the present disclosure. In one embodiment, a subject experiences 30% less diary off-time 12 months after administration of the present disclosure.
- a subject experiences 40% less diary off-time 6 months after administration of the present disclosure. In one embodiment, a subject experiences 40% less diary off-time 12 months after administration of the present disclosure.
- a subject experiences 50% less diary off-time 6 months after administration of the present disclosure. In one embodiment, a subject experiences 50% less diary off-time 12 months after administration of the present disclosure.
- a subject experiences 60% less diary off-time 6 months after administration of the present disclosure. In one embodiment, a subject experiences 60% less diary off-time 12 months after administration of the present disclosure.
- a subject experiences 70% less diary off-time 6 months after administration of the present disclosure. In one embodiment, a subject experiences 70% less diary off-time 12 months after administration of the present disclosure.
- a subject experiences 80% less diary off-time 6 months after administration of the present disclosure. In one embodiment, a subject experiences 80% less diary off-time 12 months after administration of the present disclosure.
- a subject experiences 90% less diary off-time 6 months after administration of the present disclosure. In one embodiment, a subject experiences 90% less diary off-time 12 months after administration of the present disclosure.
- a subject experiences 95% less diary off-time 6 months after administration of the present disclosure. In one embodiment, a subject experiences 95% less diary off-time 12 months after administration of the present disclosure.
- a subject's UPDRS-3 (or UPDRS-III) medication score is evaluated prior to administration of the present disclosure.
- the subject's UPDRS-3 (or UPDRS-III) medication score prior to administration of the present disclosure is between 1-40, 1-10, 1-15, 1-20, 1-25, 1-30, 1-35, 1-40, 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 10-15, 10-20, 10-25, 10-30, 10-35, 10-40, 15-20, 15-25, 15-30, 15-35, 15-40, 20-25, 20-30, 20-35, 20-40, 25-30, 25-35, 25-40, 30-35, 30-40, or 35-40.
- the subject's UPDRS-3 (or UPDRS-III) medication score prior to administration of the present disclosure is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40.
- the subject's UPDRS-3 (or UPDRS-III) medication score prior to administration of the present disclosure is 10.1, 10.2, 10.3, 10.4, 10.5, 10.6, 10.7, 10.8, 10.9, 11, 11.1, 11.2, 11.3, 11.4, 11.5, 11.6, 11.7, 11.8, 11.9, 12, 12.1, 12.2, 12.3, 12.4, 12.5, 12.6, 12.7, 12.8, 12.9, 13, 13.1, 13.2, 13.3, 13.4, 13.5, 13.6, 13.7, 13.8, 13.9, 14, 14.1, 14.2, 14.3, 14.4, 14.5, 14.6, 14.7, 14.8, 14.9, or 15.
- the subjects UPDRS-3 medication score prior to administration of the present disclosure is 13.5.
- a subject's UPDRS-3 (or UPDRS-III) medication score is reduced after administration of the present disclosure.
- a subject's UPDRS-3 (or UPDRS-III) medication score may be reduced by a percentage such as, but not limited to, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than 95%.
- a subject's UPDRS-3 score is reduced 10% after administration of the present disclosure.
- a subject's UPDRS-3 score is reduced 20% after administration of the present disclosure.
- a subject's UPDRS-3 score is reduced 30% after administration of the present disclosure.
- a subject's UPDRS-3 score is reduced 40% after administration of the present disclosure. As a non-limiting example, a subject's UPDRS-3 score is reduced 50% after administration of the present disclosure. As a non-limiting example, a subject's UPDRS-3 score is reduced 60% after administration of the present disclosure. As a non-limiting example, a subject's UPDRS-3 score is reduced 70% after administration of the present disclosure. As a non-limiting example, a subject's UPDRS-3 score is reduced 80% after administration of the present disclosure. As a non-limiting example, a subject's UPDRS-3 score is reduced 90% after administration of the present disclosure.
- a subject's UPDRS-3 (or UPDRS-III) medication score may change by 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7
- a subject's UPDRS-3 score is changed by 0.4 points.
- a subject's UPDRS-3 score is changed by 1.6 points.
- a subject's UPDRS-3 score is changed by 1.8 points.
- a subject's UPDRS-3 score is changed by 8.6 points.
- a subject's UPDRS-3 score is changed by 9.6 points.
- a subject's UPDRS-3 (or UPDRS-III) medication score may increase by 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7
- a subject's UPDRS-3 score is increased by 0.4 points.
- a subject's UPDRS-3 score is increased by 1.6 points.
- a subject's UPDRS-3 score is increased by 1.8 points.
- a subject's UPDRS-3 score is increased by 8.6 points.
- a subject's UPDRS-3 score is increased by 9.6 points.
- a subject's UPDRS-3 (or UPDRS-III) medication score may decrease by 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7
- a subject's UPDRS-3 score is decreased by 0.4 points.
- a subject's UPDRS-3 score is decreased by 1.6 points.
- a subject's UPDRS-3 score is decreased by 1.8 points.
- a subject's UPDRS-3 score is decrease by 8.6 points.
- a subject's UPDRS-3 score is decreased by 9.6 points.
- a subject's UPDRS-3 (or UPDRS-III) medication score is reduced by 8.6 at 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 4.5 ⁇ 10 12 vector genome.
- a subject's UPDRS-3 (or UPDRS-III) medication score is reduced by 9.6 at 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- a subject's UPDRS-3 (or UPDRS-III) medication score is reduced by 9.6 at 12 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- a subject's average amount of Parkinson's disease medication was about 1500 mg per day prior to administration of the present disclosure.
- the Parkinson's disease medication is levodopa.
- a subject's UPDRS-II score is evaluated prior to administration of the present disclosure.
- the UPDRS-II score of a subject prior to administration of the present disclosure is between 20 and 50, such as, but not limited to, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50.
- a subject's UPDRS-2 (or UPDRS-II) score may change by 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7
- a subject's UPDRS-2 (or UPDRS-II) score may increase by 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7
- a subject's UPDRS-2 (or UPDRS-II) score may decrease by 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7
- a subject's UPDRS-II score is decreased by 2 to 4 points after administration of the present disclosure as compared to the UPDRS-II score prior to administration.
- a subject's UPDRS-II score is decreased by 2 to 3 points 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome, as compared to the UPDRS-II medication score prior to administration.
- a subject's UPDRS-II score is decreased by 2 to 3 points 12 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome, as compared to the UPDRS-II medication score prior to administration.
- a subject's UPDRS-II score is decreased by 3 to 4 points 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 4.5 ⁇ 10 12 vector genome, as compared to the UPDRS-II medication score prior to administration.
- the present disclosure is used to improve a subject's motor function.
- the present disclosure is used to control a subject's motor function and improve their quality of life.
- the present disclosure is used to reduce the dosage of Parkinson's medication a subject needs to take to improve a subject's motor function.
- a single administration of the present disclosure into the putamen of a subject provides improved motor function as compared to motor function prior to treatment.
- a single administration of the present disclosure in to the putamen of a subject provides improved motor function and a reduction in the amount of levodopa the subject requires to manage symptoms.
- a single administration of the present disclosure in to the putamen of a subject provides improved motor function and a reduction in the amount of dopaminergic medication the subject requires to manage symptoms.
- the amount the daily dose of Parkinson's medication is reduced by 10-50% after administration of the present disclosure.
- the reduction is seen 6 months after administration of the present disclosure.
- the reduction is seen 12 months after administration of the present disclosure.
- the amount the daily dose of Parkinson's medication is reduced by 10-20% after administration of the present disclosure.
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication is 10%.
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication is 11%.
- the reduction of Parkinson's medication is 12%.
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication is 14%.
- the reduction of Parkinson's medication is 15%.
- the reduction of Parkinson's medication is 16%.
- the reduction of Parkinson's medication is 17%.
- the reduction of Parkinson's medication is 18%.
- the reduction of Parkinson's medication is 19%.
- the reduction of Parkinson's medication is 20%.
- a 14% reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 6 months after administration of the present disclosure at a dose volume of up to 450 uL per putamen and a total dose of 7.5 ⁇ 10 11 vector genome.
- Parkinson's medication e.g., Levodopa
- a 10% reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 12 months after administration of the present disclosure at a dose volume of up to 450 uL per putamen and a total dose of 7.5 ⁇ 10 11 vector genome.
- Parkinson's medication e.g., Levodopa
- the amount the daily dose of Parkinson's medication is reduced by 20-30% after administration of the present disclosure.
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication is 21%.
- the reduction of Parkinson's medication is 22%.
- the reduction of Parkinson's medication (e.g., Levodopa) is 23%.
- the reduction of Parkinson's medication is 24%.
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication is 25%.
- the reduction of Parkinson's medication is 26%.
- the reduction of Parkinson's medication is 27%.
- the reduction of Parkinson's medication is 28%.
- the reduction of Parkinson's medication is 29%.
- the reduction of Parkinson's medication is 30%.
- a 27% reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 12 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- Parkinson's medication e.g., Levodopa
- a 28% reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 12 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- Parkinson's medication e.g., Levodopa
- a 29% reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 12 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- Parkinson's medication e.g., Levodopa
- the amount the daily dose of Parkinson's medication is reduced by 30-40% after administration of the present disclosure.
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication is 30%.
- the reduction of Parkinson's medication is 31%.
- the reduction of Parkinson's medication is 32%.
- the reduction of Parkinson's medication is 33%.
- the reduction of Parkinson's medication is 34%.
- the reduction of Parkinson's medication is 35%.
- the reduction of Parkinson's medication is 36%.
- the reduction of Parkinson's medication is 37%.
- the reduction of Parkinson's medication is 38%.
- the reduction of Parkinson's medication is 39%.
- the reduction of Parkinson's medication is 40%.
- a 34% reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- Parkinson's medication e.g., Levodopa
- the amount the daily dose of Parkinson's medication is reduced by 40-50% after administration of the present disclosure.
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication is 40%.
- the reduction of Parkinson's medication is 41%.
- the reduction of Parkinson's medication is 42%.
- the reduction of Parkinson's medication is 43%.
- the reduction of Parkinson's medication is 44%.
- the reduction of Parkinson's medication is 45%.
- the reduction of Parkinson's medication is 46%.
- the reduction of Parkinson's medication is 47%.
- the reduction of Parkinson's medication is 48%.
- the reduction of Parkinson's medication is 49%.
- the reduction of Parkinson's medication is 50%.
- a 34% reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 4.5 ⁇ 10 12 vector genome.
- Parkinson's medication e.g., Levodopa
- the amount the daily dose of Parkinson's medication is reduced by 108-641 mg after administration of the present disclosure.
- the reduction is seen 6 months after administration of the present disclosure.
- the reduction is seen 12 months after administration of the present disclosure.
- the amount the daily dose of Parkinson's medication is reduced by 108-339 mg after administration of the present disclosure.
- the reduction of Parkinson's medication is 108 mg.
- the reduction of Parkinson's medication is 134 mg.
- the reduction of Parkinson's medication is 159 mg.
- the reduction of Parkinson's medication is 154 mg.
- the reduction of Parkinson's medication is 208 mg.
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication is 231 mg.
- the reduction of Parkinson's medication is 254 mg.
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication is 276 mg.
- the reduction of Parkinson's medication is 298 mg.
- the reduction of Parkinson's medication is 319 mg.
- the reduction of Parkinson's medication is 339 mg.
- a 208 mg reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 6 months after administration of the present disclosure at a dose volume of up to 450 uL per putamen and a total dose of 7.5 ⁇ 10 11 vector genome.
- Parkinson's medication e.g., Levodopa
- a 108 mg reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 12 months after administration of the present disclosure at a dose volume of up to 450 uL per putamen and a total dose of 7.5 ⁇ 10 11 vector genome.
- Parkinson's medication e.g., Levodopa
- the amount the daily dose of Parkinson's medication is reduced by 339-505 mg after administration of the present disclosure.
- the reduction of Parkinson's medication is 339 mg.
- the reduction of Parkinson's medication is 358 mg.
- the reduction of Parkinson's medication is 377 mg.
- the reduction of Parkinson's medication is 396 mg.
- the reduction of Parkinson's medication is 413 mg.
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication is 430 mg.
- the reduction of Parkinson's medication is 446 mg.
- the reduction of Parkinson's medication is 462 mg.
- the reduction of Parkinson's medication is 477 mg.
- the reduction of Parkinson's medication is 491 mg.
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication is 505 mg.
- a 462 mg reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 12 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- Parkinson's medication e.g., Levodopa
- a 477 mg reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 12 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- Parkinson's medication e.g., Levodopa
- a 491 mg reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 12 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- Parkinson's medication e.g., Levodopa
- the amount the daily dose of Parkinson's medication is reduced by 505-606 mg after administration of the present disclosure.
- the reduction of Parkinson's medication is 505 mg.
- the reduction of Parkinson's medication is 518 mg.
- the reduction of Parkinson's medication is 530 mg.
- the reduction of Parkinson's medication is 542 mg.
- the reduction of Parkinson's medication is 553 mg.
- the reduction of Parkinson's medication is 563 mg.
- the reduction of Parkinson's medication is 573 mg.
- the reduction of Parkinson's medication is 582 mg.
- the reduction of Parkinson's medication is 591 mg.
- the reduction of Parkinson's medication is 599 mg.
- the reduction of Parkinson's medication e.g., Levodopa
- the reduction of Parkinson's medication is 606 mg.
- a 553 mg reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- Parkinson's medication e.g., Levodopa
- the amount the daily dose of Parkinson's medication is reduced by 606-641 mg after administration of the present disclosure.
- the reduction of Parkinson's medication is 606 mg.
- the reduction of Parkinson's medication is 612 mg.
- the reduction of Parkinson's medication is 618 mg.
- the reduction of Parkinson's medication is 623 mg.
- the reduction of Parkinson's medication is 628 mg.
- the reduction of Parkinson's medication is 632 mg.
- the reduction of Parkinson's medication is 635 mg.
- the reduction of Parkinson's medication is 637 mg.
- the reduction of Parkinson's medication is 639 mg.
- the reduction of Parkinson's medication is 641 mg.
- a 553 mg reduction in the amount of the daily dose of Parkinson's medication (e.g., Levodopa) required by a subject to manage symptoms occurs 6 months after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 4.5 ⁇ 10 12 vector genome.
- Parkinson's medication e.g., Levodopa
- the putaminal AADC enzyme activity is increased in a subject after administration with the present disclosure.
- the increase is seen for at least 6 months relative to the baseline.
- the putaminal AADC enzyme activity is increased by 10-20% in a subject after administration of the present disclosure.
- the increase in putaminal AADC enzyme activity is about 10%.
- the increase in putaminal AADC enzyme activity is about 11%.
- the increase in putaminal AADC enzyme activity is about 12%.
- the increase in putaminal AADC enzyme activity is about 13%.
- the increase in putaminal AADC enzyme activity is about 14%.
- the increase in putaminal AADC enzyme activity is about 15%.
- the increase in putaminal AADC enzyme activity is about 16%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 17%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 18%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 19%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 20%.
- the putaminal AADC enzyme activity is increased by about 13% in a subject after administration of the present disclosure at a dose volume of up to 450 uL per putamen and a total dose of 7.5 ⁇ 10 11 vector genome.
- the putaminal AADC enzyme activity is increased by 50-60% in a subject after administration of the present disclosure.
- the increase in putaminal AADC enzyme activity is about 50%.
- the increase in putaminal AADC enzyme activity is about 51%.
- the increase in putaminal AADC enzyme activity is about 52%.
- the increase in putaminal AADC enzyme activity is about 53%.
- the increase in putaminal AADC enzyme activity is about 54%.
- the increase in putaminal AADC enzyme activity is about 55%.
- the increase in putaminal AADC enzyme activity is about 56%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 57%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 58%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 59%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 60%.
- the putaminal AADC enzyme activity is increased by about 56% in a subject after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 1.5 ⁇ 10 12 vector genome.
- the putaminal AADC enzyme activity is increased by 70-85% in a subject after administration of the present disclosure.
- the increase in putaminal AADC enzyme activity is about 70%.
- the increase in putaminal AADC enzyme activity is about 71%.
- the increase in putaminal AADC enzyme activity is about 72%.
- the increase in putaminal AADC enzyme activity is about 73%.
- the increase in putaminal AADC enzyme activity is about 74%.
- the increase in putaminal AADC enzyme activity is about 75%.
- the increase in putaminal AADC enzyme activity is about 76%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 77%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 78%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 79%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 80%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 81%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 82%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 83%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 84%. As a non-limiting example, the increase in putaminal AADC enzyme activity is about 85%.
- the putaminal AADC enzyme activity is increased by about 79% in a subject after administration of the present disclosure at a dose volume of up to 900 uL per putamen and a total dose of 4.5 ⁇ 10 12 vector genome.
- the dopamine level of a subject increased after administration of the present disclosure.
- the amount of dopamine increased by 10-20%, 15-25%, 20-30%, 25-35%, 30-40%, 35-45%, 40-50%, 45-55%, 50-60%, 55-65%, 60-70%, 65-75%, 70-80%, 75-85%, 80-90%, 85-95%, 90-100%, or 95-100%.
- Circadian rhythms are physical, mental and behavioral changes that tend to follow a 24 hour cycle. Circadian rhythms can influence sleep-wake cycles, hormone release, body temperature and other bodily functions. Changes in the circadian rhythm can cause conditions and/or disorder such as, but not limited to sleep disorders (e.g., insomnia), depression, bipolar disorder, seasonal affective disorder, obesity and diabetes.
- sleep disorders e.g., insomnia
- depression e.g., depression
- bipolar disorder e.g., depression
- seasonal affective disorder e.g., obesity and diabetes.
- the AAV particles described herein may be used to treat insomnia.
- the sleep-wake cycle comprises periods of sleep and periods of wake. Generally, in a 24 hour period the total hours of sleep are less than the total hours of wakefulness. As a non-limiting example, the sleep-wake cycle comprises 7-9 hours of sleep and 15-17 hours of wakefulness. As a non-limiting example, the sleep-wake cycle comprises 8 hours of sleep and 16 hours of wakefulness. As a non-limiting example, the sleep-wake cycle comprises 8-10 hours of sleep and 14-16 hours of wakefulness.
- the sleep-wake cycle of a subject is improved by administering to the subject the AAV particles described herein.
- the sleep-wake cycle of a subject is regulated by administering to the subject the AAV particles described herein.
- the regulation may be the correction of more periods of sleep occurring at night and less periods of sleep occurring
- the sleep-wake cycle of a subject administered the AAV particles described herein improves as compared to the sleep-wake cycle of the subject prior to administration of the AAV particles.
- the subject has an increased period of sleep and a decreased period of wakefulness.
- the subject has a decreased period of sleep and an increased period of wakefulness.
- the sleep-wake cycle of a subject administered the AAV particles described herein is regulated as compared to the sleep-wake cycle of the subject prior to administration of the AAV particles.
- the length of the periods of sleep and the periods of wakefulness may be about the same (e.g., +/ ⁇ 1 hour) for at least 2 days.
- the length of the periods of sleep and the periods of wakefulness if a 24 hours period may be within 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 1.5 hours, or 2 hours of the previous 24 hour period.
- the amount of rapid eye movement (REM) sleep a subject experiences in a 24 hour period is altered after the subject is administered the AAV particles described herein.
- REM sleep is generally considered an active period of sleep marked by intense brain activity where brain waves are fast and desynchronized. An adult, on average, spends about 20-25% of their total daily sleep period in REM sleep.
- the amount of REM sleep is decreased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or more than 65%.
- the amount of REM sleep is decreased by 1-10%, 5-10%, 5-15%, 10-15%, 15-20%, 15-25%, 20-25%, 20-30%, 25-30%, 25-35%, 30-35%, 30-40%, 35-40%, 40-50% or 40-60%.
- the amount of REM sleep is increased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or more than 65%.
- the amount of REM sleep is increased by 1-5%, 1-10%, 5-10%, 5-15%, 10-15%, 15-20%, 15-25%, 20-25%, 20-30%, 25-30%, 25-35%, 30-35%, 30-40%, 35-40%, 40-50% or 40-60%.
- NREM sleep is generally characterized by a reduction in physiological activity since as the brain waves, measured by EEG, get slower and have greater amplitude.
- NREM has four stages: Stage 1 is the time of drowsiness or transition from being awake to falling asleep where the brain waves and muscle activity begin to slow; Stage 2 is a period of light sleep during which eye movements stop and brain waves become slower with occasional bursts of rapid waves (sometimes called sleep spindles); Stage 3 and Stage 4 (collectively referred to as slow wave sleep) are characterized by the presence of slow brain waves (delta waves) interspersed with smaller faster waves where there are no eye movements.
- An adult on average, spends about 75-80% of their total daily sleep period in NREM sleep with about half of their total daily sleep time in NREM stage 2 sleep.
- the amount of NREM sleep a subject experiences is altered after the subject is administered the AAV particles described herein.
- the amount of NREM sleep is decreased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or more than 65%.
- the amount of NREM sleep is decreased by 1-10%, 5-10%, 5-15%, 10-15%, 15-20%, 15-25%, 20-25%, 20-30%, 25-30%, 25-35%, 30-35%, 30-40%, 35-40%, 40-50% or 40-60%.
- the amount of NREM sleep is increased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or more than 65%.
- the amount of NREM sleep is increased by 1-5%, 1-10%, 5-10%, 5-15%, 10-15%, 15-20%, 15-25%, 20-25%, 20-30%, 25-30%, 25-35%, 30-35%, 30-40%, 35-40%, 40-50% or 40-60%.
- the amount of NREM Stage 1 sleep a subject experiences is altered after the subject is administered the AAV particles described herein.
- the amount of NREM Stage 1 sleep is decreased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or more than 65%.
- the amount of NREM Stage 1 sleep is decreased by 1-10%, 5-10%, 5-15%, 10-15%, 15-20%, 15-25%, 20-25%, 20-30%, 25-30%, 25-35%, 30-35%, 30-40%, 35-40%, 40-50% or 40-60%.
- the amount of NREM Stage 1 sleep is increased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or more than 65%.
- the amount of NREM Stage 1 sleep is increased by 1-5%, 1-10%, 5-10%, 5-15%, 10-15%, 15-20%, 15-25%, 20-25%, 20-30%, 25-30%, 25-35%, 30-35%, 30-40%, 35-40%, 40-50% or 40-60%.
- the amount of NREM Stage 2 sleep a subject experiences is altered after the subject is administered the AAV particles described herein.
- the amount of NREM Stage 2 sleep is decreased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or more than 65%.
- the amount of NREM Stage 2 sleep is decreased by 1-10%, 5-10%, 5-15%, 10-15%, 15-20%, 15-25%, 20-25%, 20-30%, 25-30%, 25-35%, 30-35%, 30-40%, 35-40%, 40-50% or 40-60%.
- the amount of NREM Stage 2 sleep is increased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or more than 65%.
- the amount of NREM Stage 2 sleep is increased by 1-5%, 1-10%, 5-10%, 5-15%, 10-15%, 15-20%, 15-25%, 20-25%, 20-30%, 25-30%, 25-35%, 30-35%, 30-40%, 35-40%, 40-50% or 40-60%.
- the amount of NREM Stage 3 and 4 sleep a subject experiences is altered after the subject is administered the AAV particles described herein.
- the amount of NREM Stage 3 and 4 sleep is decreased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or more than 65%.
- the amount of NREM Stage 3 and 4 sleep is decreased by 1-10%, 5-10%, 5-15%, 10-15%, 15-20%, 15-25%, 20-25%, 20-30%, 25-30%, 25-35%, 30-35%, 30-40%, 35-40%, 40-50% or 40-60%.
- the amount of NREM Stage 3 and 4 sleep is increased by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or more than 65%.
- the amount of NREM Stage 3 and 4 sleep is increased by 1-5%, 1-10%, 5-10%, 5-15%, 10-15%, 15-20%, 15-25%, 20-25%, 20-30%, 25-30%, 25-35%, 30-35%, 30-40%, 35-40%, 40-50% or 40-60%.
- periods of NREM and REM cycles are more consistent in a subject after the subject is administered the AAV particles described herein.
- NREM and REM cycles alternate every 90 to 110 minutes four to six times per night.
- kits for conveniently and/or effectively carrying out methods of the present disclosure.
- kits will comprise sufficient amounts and/or numbers of components to allow a user to perform multiple treatments of a subject(s) and/or to perform multiple experiments.
- kits may further include reagents and/or instructions for creating and/or synthesizing compounds and/or compositions of the present disclosure.
- kits may also include one or more buffers.
- kits of the disclosure may include components for making protein or nucleic acid arrays or libraries and thus, may include, for example, solid supports.
- kit components may be packaged either in aqueous media or in lyophilized form.
- the container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one kit component, (labeling reagent and label may be packaged together), kits may also generally contain second, third or other additional containers into which additional components may be separately placed. In some embodiments, kits may also comprise second container means for containing sterile, pharmaceutically acceptable buffers and/or other diluents. In some embodiments, various combinations of components may be comprised in one or more vial.
- Kits of the present disclosure may also typically include means for containing compounds and/or compositions of the present disclosure, e.g., proteins, nucleic acids, and any other reagent containers in close confinement for commercial sale.
- Such containers may include injection or blow-molded plastic containers into which desired vials are retained.
- kit components are provided in one and/or more liquid solutions.
- liquid solutions are aqueous solutions, with sterile aqueous solutions being particularly preferred.
- kit components may be provided as dried powder(s). When reagents and/or components are provided as dry powders, such powders may be reconstituted by the addition of suitable volumes of solvent. In some embodiments, it is envisioned that solvents may also be provided in another container means. In some embodiments, labeling dyes are provided as dried powders.
- 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 micrograms or at least or at most those amounts of dried dye are provided in kits of the disclosure.
- dye may then be resuspended in any suitable solvent, such as DMSO.
- kits may include instructions for employing kit components as well the use of any other reagent not included in the kit. Instructions may include variations that may be implemented.
- AAV particles of the present disclosure may be combined with, coated onto or embedded in a device.
- Devices may include, but are not limited to stents, pumps, and/or other implantable therapeutic device. Additionally AAV particles may be delivered to a subject while the subject is using a compression device such as, but not limited to, a compression device to reduce the chances of deep vein thrombosis (DVT) in a subject.
- a compression device such as, but not limited to, a compression device to reduce the chances of deep vein thrombosis (DVT) in a subject.
- the present disclosure provides for devices which may incorporate AAV particles. These devices contain in a stable formulation the AAV particles which may be immediately delivered to a subject in need thereof, such as a human patient.
- Devices for administration may be employed to deliver the AAV particles of the present disclosure according to single, multi- or split-dosing regimens taught herein.
- Method and devices known in the art for multi-administration to cells, organs and tissues are contemplated for use in conjunction with the methods and compositions disclosed herein as embodiments of the present disclosure. These include, for example, those methods and devices having multiple needles, hybrid devices employing for example lumens or catheters as well as devices utilizing heat, electric current or radiation driven mechanisms.
- AAV particles of the present disclosure may be delivered using a device such as, but not limited to, a stent, a tube, a catheter, a pipe, a straw, needle and/or a duct. Methods of using these devices are described herein and are known in the art.
- the AAV particles of the present disclosure may be administered to a subject using delivery systems which integrate image guided therapy and integrate imaging such as, but not limited to, laser, MRgFUS, endoscopic and robotic surgery devices.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Psychology (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Mycology (AREA)
- Anesthesiology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/184,466 US20190060425A1 (en) | 2017-06-15 | 2018-11-08 | Aadc polynucleotides for the treatment of parkinson's disease |
| US16/523,567 US11759506B2 (en) | 2017-06-15 | 2019-07-26 | AADC polynucleotides for the treatment of Parkinson's disease |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762520084P | 2017-06-15 | 2017-06-15 | |
| US201762554155P | 2017-09-05 | 2017-09-05 | |
| PCT/US2018/037437 WO2018232055A1 (en) | 2017-06-15 | 2018-06-14 | Aadc polynucleotides for the treatment of parkinson's disease |
| US16/184,466 US20190060425A1 (en) | 2017-06-15 | 2018-11-08 | Aadc polynucleotides for the treatment of parkinson's disease |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/037437 Continuation WO2018232055A1 (en) | 2017-06-15 | 2018-06-14 | Aadc polynucleotides for the treatment of parkinson's disease |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/523,567 Continuation US11759506B2 (en) | 2017-06-15 | 2019-07-26 | AADC polynucleotides for the treatment of Parkinson's disease |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20190060425A1 true US20190060425A1 (en) | 2019-02-28 |
Family
ID=64659937
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/184,466 Abandoned US20190060425A1 (en) | 2017-06-15 | 2018-11-08 | Aadc polynucleotides for the treatment of parkinson's disease |
| US16/523,567 Active 2040-10-24 US11759506B2 (en) | 2017-06-15 | 2019-07-26 | AADC polynucleotides for the treatment of Parkinson's disease |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/523,567 Active 2040-10-24 US11759506B2 (en) | 2017-06-15 | 2019-07-26 | AADC polynucleotides for the treatment of Parkinson's disease |
Country Status (19)
| Country | Link |
|---|---|
| US (2) | US20190060425A1 (https=) |
| EP (1) | EP3638315A4 (https=) |
| JP (1) | JP2020527333A (https=) |
| KR (1) | KR20200018455A (https=) |
| CN (1) | CN111107879A (https=) |
| AU (2) | AU2018284960B2 (https=) |
| BR (1) | BR112019025122A2 (https=) |
| CA (1) | CA3065471A1 (https=) |
| CL (1) | CL2019003636A1 (https=) |
| CO (1) | CO2019013707A2 (https=) |
| IL (1) | IL270821A (https=) |
| JO (1) | JOP20190269A1 (https=) |
| MA (1) | MA49402A (https=) |
| MX (1) | MX2019014974A (https=) |
| PE (1) | PE20200494A1 (https=) |
| PH (1) | PH12019502793A1 (https=) |
| SG (1) | SG11201912154XA (https=) |
| TW (1) | TW201919713A (https=) |
| WO (1) | WO2018232055A1 (https=) |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020223231A1 (en) * | 2019-04-29 | 2020-11-05 | The Trustees Of The University Of Pennsylvania | Novel aav capsids and compositions containing same |
| US10898585B2 (en) | 2017-04-14 | 2021-01-26 | Ptc Therapeutics .Inc. | Gene therapy for AADC deficiency |
| CN115135347A (zh) * | 2019-12-12 | 2022-09-30 | 梅里特斯英国第二有限公司 | 治疗帕金森病的方法 |
| US20230050187A1 (en) * | 2019-12-12 | 2023-02-16 | Meiragtx Uk Ii Limited | Methods for Treating Parkinson's Disease |
| US20230075314A1 (en) * | 2019-04-29 | 2023-03-09 | Voyager Therapeutics, Inc. | VECTORIZED ANTIBODIES (vAb) AND USES THEREOF |
| US11759506B2 (en) | 2017-06-15 | 2023-09-19 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
| US11975056B2 (en) | 2014-11-05 | 2024-05-07 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
| US12031128B2 (en) | 2021-04-07 | 2024-07-09 | Battelle Memorial Institute | Rapid design, build, test, and learn technologies for identifying and using non-viral carriers |
| US12077783B2 (en) | 2017-12-19 | 2024-09-03 | Akouos, Inc. | AAV-mediated delivery of antibodies to the inner ear |
| US12109223B2 (en) | 2020-12-03 | 2024-10-08 | Battelle Memorial Institute | Polymer nanoparticle and DNA nanostructure compositions and methods for non-viral delivery |
| US12319929B2 (en) | 2018-05-15 | 2025-06-03 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of Parkinson's disease |
| US12365726B2 (en) | 2020-12-01 | 2025-07-22 | Akouos, Inc. | Anti-VEGF antibody constructs |
| US12441996B2 (en) | 2023-12-08 | 2025-10-14 | Battelle Memorial Institute | Use of DNA origami nanostructures for molecular information based data storage systems |
| US12458606B2 (en) | 2023-09-29 | 2025-11-04 | Battelle Memorial Institute | Polymer nanoparticle compositions for in vivo expression of polypeptides |
| TWI910162B (zh) * | 2020-05-05 | 2026-01-01 | 美國公爵大學 | 跨物種相容腺相關病毒組合物及其使用方法 |
Families Citing this family (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB201508026D0 (en) | 2015-05-11 | 2015-06-24 | Ucl Business Plc | Capsid |
| JP2019530737A (ja) | 2016-08-23 | 2019-10-24 | アコーオス インコーポレイテッド | ヒト対象において非加齢性聴力障害を治療するための組成物および方法 |
| US12060567B2 (en) | 2018-06-13 | 2024-08-13 | Voyager Therapeutics, Inc. | Engineered untranslated regions (UTR) for AAV production |
| AU2019310459A1 (en) | 2018-07-24 | 2021-02-18 | Voyager Therapeutics, Inc. | Systems and methods for producing gene therapy formulations |
| WO2020072849A1 (en) | 2018-10-04 | 2020-04-09 | Voyager Therapeutics, Inc. | Methods for measuring the titer and potency of viral vector particles |
| WO2020072844A1 (en) | 2018-10-05 | 2020-04-09 | Voyager Therapeutics, Inc. | Engineered nucleic acid constructs encoding aav production proteins |
| CA3116701A1 (en) | 2018-10-15 | 2020-04-23 | Voyager Therapeutics, Inc. | Expression vectors for large-scale production of raav in the baculovirus/sf9 system |
| CN110437317B (zh) * | 2019-01-30 | 2023-05-02 | 上海科技大学 | 具有变异衣壳蛋白的腺相关病毒及其用途 |
| EP3962536A1 (en) | 2019-04-29 | 2022-03-09 | Voyager Therapeutics, Inc. | Systems and methods for producing baculoviral infected insect cells (biics) in bioreactors |
| WO2021007382A1 (en) * | 2019-07-09 | 2021-01-14 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of parkinson's disease |
| WO2021030125A1 (en) | 2019-08-09 | 2021-02-18 | Voyager Therapeutics, Inc. | Cell culture medium for use in producing gene therapy products in bioreactors |
| TW202122582A (zh) | 2019-08-26 | 2021-06-16 | 美商航海家醫療公司 | 病毒蛋白之控制表現 |
| JP7807380B2 (ja) | 2020-02-21 | 2026-01-27 | アコーオス インコーポレイテッド | ヒト対象において非加齢関連聴力障害を処置するための組成物および方法 |
| WO2022032153A1 (en) | 2020-08-06 | 2022-02-10 | Voyager Therapeutics, Inc. | Cell culture medium for use in producing gene therapy products in bioreactors |
| CA3190059A1 (en) * | 2020-08-17 | 2022-02-24 | Yu TAO | Nucleic acid construct for increasing adeno-associated virus yield, and construction method therefor |
| US20240141378A1 (en) | 2021-03-03 | 2024-05-02 | Voyager Therapeutics, Inc. | Controlled expression of viral proteins |
| US20240141377A1 (en) | 2021-03-03 | 2024-05-02 | Voyager Therapeutics, Inc. | Controlled expression of viral proteins |
| MX2024004217A (es) | 2021-10-08 | 2024-06-26 | Dyno Therapeutics Inc | Variantes de cápside y métodos de uso de estas. |
| CA3238867A1 (en) * | 2021-11-29 | 2023-06-01 | Shanghai Regenelead Therapies Co., Ltd. | Aadc/gdnf polynucleotide, and use thereof in treating parkinson's disease |
| CN118660913A (zh) | 2022-02-21 | 2024-09-17 | 上海瑞宏迪医药有限公司 | Vegf结合分子及其医药用途 |
| US20260085328A1 (en) | 2022-09-08 | 2026-03-26 | Voyager Therapeutics, Inc. | Controlled expression of viral proteins |
| WO2025040166A1 (zh) | 2023-08-23 | 2025-02-27 | 上海瑞宏迪医药有限公司 | 药物组合物及其用途 |
| AU2024337260A1 (en) * | 2023-09-04 | 2026-03-12 | Uniqure Biopharma B.V. | Novel neurotropic recombinant adeno-associated virus particles |
Family Cites Families (456)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2640638B1 (fr) | 1988-12-20 | 1991-02-15 | Commissariat Energie Atomique | Bioreacteur et dispositif pour la culture de cellules animales |
| WO1991018088A1 (en) | 1990-05-23 | 1991-11-28 | The United States Of America, Represented By The Secretary, United States Department Of Commerce | Adeno-associated virus (aav)-based eucaryotic vectors |
| US5173414A (en) | 1990-10-30 | 1992-12-22 | Applied Immune Sciences, Inc. | Production of recombinant adeno-associated virus vectors |
| GB9027917D0 (en) | 1990-12-21 | 1991-02-13 | Ici Plc | Expression systems |
| US5252479A (en) | 1991-11-08 | 1993-10-12 | Research Corporation Technologies, Inc. | Safe vector for gene therapy |
| US5587308A (en) | 1992-06-02 | 1996-12-24 | The United States Of America As Represented By The Department Of Health & Human Services | Modified adeno-associated virus vector capable of expression from a novel promoter |
| US6268213B1 (en) | 1992-06-03 | 2001-07-31 | Richard Jude Samulski | Adeno-associated virus vector and cis-acting regulatory and promoter elements capable of expressing at least one gene and method of using same for gene therapy |
| US5693531A (en) | 1993-11-24 | 1997-12-02 | The United States Of America As Represented By The Department Of Health And Human Services | Vector systems for the generation of adeno-associated virus particles |
| CA2187626C (en) | 1994-04-13 | 2009-11-03 | Michael G. Kaplitt | Aav-mediated delivery of dna to cells of the nervous system |
| US20020159979A1 (en) | 1994-06-06 | 2002-10-31 | Children's Hospital, Inc. | Adeno-associated virus materials and methods |
| US5658785A (en) | 1994-06-06 | 1997-08-19 | Children's Hospital, Inc. | Adeno-associated virus materials and methods |
| US6204059B1 (en) | 1994-06-30 | 2001-03-20 | University Of Pittsburgh | AAV capsid vehicles for molecular transfer |
| EP0722822B1 (en) | 1994-07-15 | 2002-04-10 | Idemitsu Petrochemical Co., Ltd. | Highly rigid polypropylene resin and blow molding product made therefrom |
| US5856152A (en) | 1994-10-28 | 1999-01-05 | The Trustees Of The University Of Pennsylvania | Hybrid adenovirus-AAV vector and methods of use therefor |
| US5652224A (en) | 1995-02-24 | 1997-07-29 | The Trustees Of The University Of Pennsylvania | Methods and compositions for gene therapy for the treatment of defects in lipoprotein metabolism |
| US5741657A (en) | 1995-03-20 | 1998-04-21 | The Regents Of The University Of California | Fluorogenic substrates for β-lactamase and methods of use |
| US6281010B1 (en) | 1995-06-05 | 2001-08-28 | The Trustees Of The University Of Pennsylvania | Adenovirus gene therapy vehicle and cell line |
| US5756283A (en) | 1995-06-05 | 1998-05-26 | The Trustees Of The University Of Pennsylvania | Method for improved production of recombinant adeno-associated viruses for gene therapy |
| US5741683A (en) | 1995-06-07 | 1998-04-21 | The Research Foundation Of State University Of New York | In vitro packaging of adeno-associated virus DNA |
| US5688676A (en) | 1995-06-07 | 1997-11-18 | Research Foundation Of State University Of New York | In vitro packaging of adeno-associated virus DNA |
| US6197293B1 (en) | 1997-03-03 | 2001-03-06 | Calydon, Inc. | Adenovirus vectors specific for cells expressing androgen receptor and methods of use thereof |
| US6676935B2 (en) | 1995-06-27 | 2004-01-13 | Cell Genesys, Inc. | Tissue specific adenoviral vectors |
| AU722196B2 (en) | 1995-08-30 | 2000-07-27 | Genzyme Corporation | Chromatographic purification of adenovirus and AAV |
| US6265389B1 (en) | 1995-08-31 | 2001-07-24 | Alkermes Controlled Therapeutics, Inc. | Microencapsulation and sustained release of oligonucleotides |
| US5858351A (en) | 1996-01-18 | 1999-01-12 | Avigen, Inc. | Methods for delivering DNA to muscle cells using recombinant adeno-associated virus vectors |
| US5846528A (en) | 1996-01-18 | 1998-12-08 | Avigen, Inc. | Treating anemia using recombinant adeno-associated virus virions comprising an EPO DNA sequence |
| US5962313A (en) | 1996-01-18 | 1999-10-05 | Avigen, Inc. | Adeno-associated virus vectors comprising a gene encoding a lyosomal enzyme |
| US5952221A (en) | 1996-03-06 | 1999-09-14 | Avigen, Inc. | Adeno-associated virus vectors comprising a first and second nucleic acid sequence |
| US7026468B2 (en) | 1996-07-19 | 2006-04-11 | Valentis, Inc. | Process and equipment for plasmid purification |
| EP0932418B1 (en) | 1996-09-06 | 2007-12-05 | The Trustees Of The University Of Pennsylvania | Method for recombinant adeno-associated virus-directed gene therapy |
| US20020037867A1 (en) | 1999-02-26 | 2002-03-28 | James M. Wilson | Method for recombinant adeno-associated virus-directed gene therapy |
| AU722624B2 (en) | 1996-09-06 | 2000-08-10 | Trustees Of The University Of Pennsylvania, The | An inducible method for production of recombinant adeno-associated viruses utilizing T7 polymerase |
| US5866552A (en) | 1996-09-06 | 1999-02-02 | The Trustees Of The University Of Pennsylvania | Method for expressing a gene in the absence of an immune response |
| IL128736A0 (en) | 1996-09-06 | 2000-01-31 | Univ Pennsylvania | Methods using cre-lox for production of recombinant adeno-associated viruses |
| WO1998010087A1 (en) | 1996-09-06 | 1998-03-12 | Trustees Of The University Of Pennsylvania | Chimpanzee adenovirus vectors |
| CA2265460A1 (en) | 1996-09-11 | 1998-03-19 | The Government Of The United States Of America, Represented By The Secre Tary, Department Of Health And Human Services | Aav4 vector and uses thereof |
| US7732129B1 (en) | 1998-12-01 | 2010-06-08 | Crucell Holland B.V. | Method for the production and purification of adenoviral vectors |
| ES2278399T3 (es) | 1996-11-20 | 2007-08-01 | Introgen Therapeutics, Inc. | Metodo mejorado para la produccion y purificacion de vectores adenovirales. |
| AU741605B2 (en) | 1996-12-18 | 2001-12-06 | Targeted Genetics Corporation | AAV split-packaging genes and cell lines comprising such genes for use in the production of recombinant AAV vectors |
| US6156303A (en) | 1997-06-11 | 2000-12-05 | University Of Washington | Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom |
| US6710036B2 (en) | 1997-07-25 | 2004-03-23 | Avigen, Inc. | Induction of immune response to antigens expressed by recombinant adeno-associated virus |
| US6251677B1 (en) | 1997-08-25 | 2001-06-26 | The Trustees Of The University Of Pennsylvania | Hybrid adenovirus-AAV virus and methods of use thereof |
| US6995006B2 (en) | 1997-09-05 | 2006-02-07 | Targeted Genetics Corporation | Methods for generating high titer helper-free preparations of released recombinant AAV vectors |
| US6566118B1 (en) | 1997-09-05 | 2003-05-20 | Targeted Genetics Corporation | Methods for generating high titer helper-free preparations of released recombinant AAV vectors |
| CA2303768C (en) | 1997-09-19 | 2009-11-24 | The Trustees Of The University Of Pennsylvania | Methods and vector constructs useful for production of recombinant aav |
| CA2304131A1 (en) | 1997-09-19 | 1999-04-01 | James M. Wilson | Method for gene transfer using bcl2 and compositions useful therein |
| CA2304168A1 (en) | 1997-09-19 | 1999-04-01 | The Trustees Of The University Of Pennsylvania | Methods and cell line useful for production of recombinant adeno-associated viruses |
| US6642051B1 (en) | 1997-10-21 | 2003-11-04 | Targeted Genetics Corporation | Amplifiable adeno-associated virus(AAV) packaging cassettes for the production of recombinant AAV vectors |
| IT1297074B1 (it) | 1997-11-21 | 1999-08-03 | Angeletti P Ist Richerche Bio | Forme ormone-dipendenti delle proteine rep del virus adeno-associato (aav-2), sequenze di dna codificanti per esse, vettori che le |
| JP2001526900A (ja) | 1997-12-23 | 2001-12-25 | イントロヘーネ ベスローテン フェンノートシャップ | 標的細胞の染色体dnaへの外来遺伝子情報の組み込みに有用な、アデノ随伴ウイルスおよびアデノウイルスのキメラ組換えウイルス |
| US6410300B1 (en) | 1998-01-12 | 2002-06-25 | The University Of North Carolina At Chapel Hill | Methods and formulations for mediating adeno-associated virus (AAV) attachment and infection and methods for purifying AAV |
| WO1999043360A1 (en) | 1998-02-26 | 1999-09-02 | The Trustees Of The University Of Pennsylvania | Stable protection from dystrophic sarcolemmal degeneration and restoration of the sarcoglycan complex |
| US6953690B1 (en) | 1998-03-20 | 2005-10-11 | The Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| US6521426B1 (en) | 1998-04-08 | 2003-02-18 | Istituto Di Ricerche Di Biologia Molecolare P. Angeletti S.P.A. | Preparation of recombinant adenovirus carrying a rep gene of adeno-associated virus |
| FR2778413B1 (fr) | 1998-05-07 | 2000-08-04 | Immunotech Sa | Nouveaux reactifs et methode de lyse des erythrocytes |
| EP1078096A1 (en) | 1998-05-11 | 2001-02-28 | Ariad Gene Therapeutics, Inc. | Multiviral compositions and uses thereof |
| EP1849872A1 (en) | 1998-05-20 | 2007-10-31 | University Of Iowa Research Foundation | Adeno-associated virus vectors and uses thereof |
| US6436392B1 (en) | 1998-05-20 | 2002-08-20 | University Of Iowa Research Foundation | Adeno-associated virus vectors |
| EP1082445A2 (en) | 1998-05-27 | 2001-03-14 | Cell Genesys, Inc. | Adeno-associated viral vector-mediated expression of factor viii activity |
| DE69929600T2 (de) | 1998-05-27 | 2006-09-07 | Avigen Inc., Alameda | Konvektion-erhöhte verabreichung aadc-kodierende aav vektoren |
| WO1999061643A1 (en) | 1998-05-27 | 1999-12-02 | University Of Florida | Method of preparing recombinant adeno-associated virus compositions by using an iodixananol gradient |
| EP1621625B1 (en) | 1998-05-27 | 2009-05-13 | Genzyme Corporation | AAV vectors for the manufacture of medicaments for convection enhanced delivery |
| US6984517B1 (en) | 1998-05-28 | 2006-01-10 | The United States Of America As Represented By The Department Of Health And Human Services | AAV5 vector and uses thereof |
| EP1082413B1 (en) | 1998-05-28 | 2008-07-23 | THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES | Aav5 vector and uses thereof |
| GB2338236B (en) | 1998-06-13 | 2003-04-09 | Aea Technology Plc | Microbiological cell processing |
| US6900049B2 (en) | 1998-09-10 | 2005-05-31 | Cell Genesys, Inc. | Adenovirus vectors containing cell status-specific response elements and methods of use thereof |
| WO2000022152A1 (en) | 1998-10-13 | 2000-04-20 | Avigen, Inc. | Compositions and methods for producing recombinant adeno-associated virus |
| US6221349B1 (en) | 1998-10-20 | 2001-04-24 | Avigen, Inc. | Adeno-associated vectors for expression of factor VIII by target cells |
| US6200560B1 (en) | 1998-10-20 | 2001-03-13 | Avigen, Inc. | Adeno-associated virus vectors for expression of factor VIII by target cells |
| AU764130B2 (en) | 1998-10-27 | 2003-08-14 | Crucell Holland B.V. | Improved AAV vector production |
| US6759237B1 (en) | 1998-11-05 | 2004-07-06 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same |
| US6689600B1 (en) | 1998-11-16 | 2004-02-10 | Introgen Therapeutics, Inc. | Formulation of adenovirus for gene therapy |
| US6759050B1 (en) | 1998-12-03 | 2004-07-06 | Avigen, Inc. | Excipients for use in adeno-associated virus pharmaceutical formulations, and pharmaceutical formulations made therewith |
| US6225113B1 (en) | 1998-12-04 | 2001-05-01 | Genvec, Inc. | Use of trans-activation and cis-activation to modulate the persistence of expression of a transgene in an at least E4-deficient adenovirus |
| US6387368B1 (en) | 1999-02-08 | 2002-05-14 | The Trustees Of The University Of Pennsylvania | Hybrid adenovirus-AAV virus and methods of use thereof |
| DE19905501B4 (de) | 1999-02-10 | 2005-05-19 | MediGene AG, Gesellschaft für molekularbiologische Kardiologie und Onkologie | Verfahren zur Herstellung eines rekombinanten Adeno-assoziierten Virus, geeignete Mittel hierzu sowie Verwendung zur Herstellung eines Arzneimittels |
| US6509150B1 (en) | 1999-03-05 | 2003-01-21 | Universite De Nantes | Compositions and methods for recombinant Adeno-Associated Virus production |
| US6258595B1 (en) | 1999-03-18 | 2001-07-10 | The Trustees Of The University Of Pennsylvania | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| JP4693244B2 (ja) | 1999-03-18 | 2011-06-01 | ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア | 組換えアデノ随伴ウイルスのヘルパー無しの生産のための組成物および方法 |
| JP2002542805A (ja) | 1999-04-30 | 2002-12-17 | ユニバーシティ オブ フロリダ | アデノ随伴ウイルス送達リボザイム組成物および使用方法 |
| WO2000075353A1 (en) | 1999-06-02 | 2000-12-14 | Trustees Of The University Of Pennsylvania | Compositions and methods useful for production of recombinant viruses which require helper viruses |
| CA2382483A1 (en) | 1999-08-20 | 2001-03-01 | Johns Hopkins University School Of Medicine | Methods and compositions for the construction and use of fusion libraries |
| US6365394B1 (en) | 1999-09-29 | 2002-04-02 | The Trustees Of The University Of Pennsylvania | Cell lines and constructs useful in production of E1-deleted adenoviruses in absence of replication competent adenovirus |
| AU1071701A (en) | 1999-09-29 | 2001-04-30 | Trustees Of The University Of Pennsylvania, The | Methods for rapid peg-modification of viral vectors, compositions for enhanced gene transduction, compositions with enhanced physical stability, and uses therefor |
| US7241447B1 (en) | 1999-10-07 | 2007-07-10 | University Of Iowa Research Foundation | Adeno-associated virus vectors and uses thereof |
| EP1224313A1 (en) | 1999-10-07 | 2002-07-24 | University of Iowa Research Foundation | Adeno-associated viruses and uses thereof |
| AU1436401A (en) | 1999-10-21 | 2001-05-14 | Board Of Trustees Of The University Of Arkansas, The | RepO-associated virus AAV REP78 major regulatory protein, mutants thereof and uses thereof |
| WO2001036623A2 (en) | 1999-11-05 | 2001-05-25 | Avigen, Inc. | Ecdysone-inducible adeno-associated virus expression vectors |
| AU1775901A (en) | 1999-11-17 | 2001-05-30 | Avigen, Inc. | Recombinant adeno-associated virus virions for the treatment of lysosomal disorders |
| AU1954001A (en) | 1999-12-10 | 2001-06-18 | Ariad Gene Therapeutics, Inc. | Methods for high level expression of genes in primates |
| CA2373110A1 (en) | 2000-03-14 | 2001-09-20 | Neurologix, Inc. | Production of chimeric capsid vectors |
| US7638120B2 (en) | 2000-03-14 | 2009-12-29 | Thomas Jefferson University | High transgene expression of a pseudotyped adeno-associated virus type |
| US6855314B1 (en) | 2000-03-22 | 2005-02-15 | The United States Of America As Represented By The Department Of Health And Human Services | AAV5 vector for transducing brain cells and lung cells |
| US6468524B1 (en) | 2000-03-22 | 2002-10-22 | The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services | AAV4 vector and uses thereof |
| US7048920B2 (en) | 2000-03-24 | 2006-05-23 | Cell Genesys, Inc. | Recombinant oncolytic adenovirus for human melanoma |
| GB0009887D0 (en) | 2000-04-20 | 2000-06-07 | Btg Int Ltd | Cytotoxic agents |
| CA2406743A1 (en) | 2000-04-28 | 2001-11-08 | The Trustees Of The University Of Pennsylvania | Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids |
| AU2001257611A1 (en) | 2000-04-28 | 2001-11-12 | Avigen, Inc. | Polynucleotides for use in recombinant adeno-associated virus virion production |
| US20030013189A1 (en) | 2000-04-28 | 2003-01-16 | Wilson James M. | Compositions and methods useful for non-invasive delivery of therapeutic molecules to the bloodstream |
| US6780409B2 (en) | 2000-05-23 | 2004-08-24 | Thomas Jefferson University | Glutamic acid decarboxylase (GAD) based delivery system |
| US20020106381A1 (en) | 2000-06-13 | 2002-08-08 | High Katherine A. | Methods for administering recombinant adeno-associated virus virions to humans previously exposed to adeno-associated virus |
| ATE364698T1 (de) | 2000-07-18 | 2007-07-15 | Takeda Pharmaceutical | Neues, physiologisch aktives peptid und dessen verwendung |
| US6329181B1 (en) | 2000-08-07 | 2001-12-11 | Neurologix, Inc. | Helper functions for recombinant vector production |
| US6593123B1 (en) | 2000-08-07 | 2003-07-15 | Avigen, Inc. | Large-scale recombinant adeno-associated virus (rAAV) production and purification |
| CA2419245A1 (en) | 2000-08-17 | 2002-02-21 | Keiya Ozawa | Adeno-associated virus-mediated delivery of angiogenic factors |
| DE10044384A1 (de) | 2000-09-08 | 2002-04-18 | Medigene Ag | Wirtszellen zur Verpackung von rekombinantem Adeno-assoziiertem Virus (rAAV), Verfahren zu ihrer Herstellung und deren Verwendung |
| FR2813891B1 (fr) | 2000-09-14 | 2005-01-14 | Immunotech Sa | Reactif multifonctionnel pour erythrocytes mettant en jeu des carbamates et applications |
| GB0024550D0 (https=) | 2000-10-06 | 2000-11-22 | Oxford Biomedica Ltd | |
| JP2002153278A (ja) | 2000-11-22 | 2002-05-28 | Hisamitsu Pharmaceut Co Inc | ウイルスベクターの製造に用いられる細胞、その製法およびその細胞を用いたウイルスベクターの製造方法 |
| WO2002070719A2 (en) | 2001-01-19 | 2002-09-12 | Trustees Of The University Of Pennsylvania | Regulatable gene expression system |
| US7588757B2 (en) | 2001-03-14 | 2009-09-15 | Genzyme Corporation | Methods of treating Parkinson's disease using recombinant adeno-associated virus virions |
| WO2002071843A1 (en) | 2001-03-14 | 2002-09-19 | Genteric, Inc. | Recombinant adeno-assocaited virus-mediated gene transfer via retroductal infusion of virions |
| US6841357B1 (en) | 2001-03-30 | 2005-01-11 | Stratagene California | Method and kits for titering adeno-associated virus vectors |
| US7182944B2 (en) | 2001-04-25 | 2007-02-27 | The United States Of America As Represented By The Department Of Health And Human Services | Methods of increasing distribution of nucleic acids |
| US20030096264A1 (en) | 2001-06-18 | 2003-05-22 | Psychiatric Genomics, Inc. | Multi-parameter high throughput screening assays (MPHTS) |
| ES2375557T3 (es) | 2001-06-22 | 2012-03-02 | The Trustees Of The University Of Pennsylvania | Adenovirus recombinantes que comprenden prote�?nas de adenovirus de simios y usos de los mismos. |
| US20040136963A1 (en) | 2001-06-22 | 2004-07-15 | The Trustees Of The University Of Pennsylvania | Simian adenovirus vectors and methods of use |
| US8241622B2 (en) | 2001-07-13 | 2012-08-14 | University Of Iowa Research Foundation | Adeno-associated virus vectors with intravector heterologous terminal palindromic sequences |
| EP1279740A1 (en) | 2001-07-26 | 2003-01-29 | Vrije Universiteit Brussel | Recombinant vector derived from adeno-associated virus for gene therapy |
| JP2004538005A (ja) | 2001-08-08 | 2004-12-24 | ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア | シアル酸に結合するタンパク質を有するウイルスベクターの精製法 |
| US20030092161A1 (en) | 2001-09-19 | 2003-05-15 | The Trustees Of The University Of Pennsylvania | Compositions and methods for production of recombinant viruses, and uses therefor |
| WO2003042361A2 (en) | 2001-11-09 | 2003-05-22 | Government Of The United States Of America, Department Of Health And Human Services | Production of adeno-associated virus in insect cells |
| US6723551B2 (en) | 2001-11-09 | 2004-04-20 | The United States Of America As Represented By The Department Of Health And Human Services | Production of adeno-associated virus in insect cells |
| NZ532635A (en) | 2001-11-13 | 2007-05-31 | Univ Pennsylvania | A method of identifying unknown adeno-associated virus (AAV) sequences and a kit for the method |
| EP1944043A1 (en) | 2001-11-21 | 2008-07-16 | The Trustees of the University of Pennsylvania | Simian adenovirus nucleic acid and amino acid sequences, vectors containing same, and methods of use |
| EP1453543B1 (en) | 2001-11-21 | 2017-08-30 | The Trustees Of The University Of Pennsylvania | Simian adenovirus nucleic acid and amino acid sequences, vectors containing same, and methods of use |
| EP1453536A4 (en) | 2001-12-12 | 2009-08-26 | Mayne Pharma Int Pty Ltd | COMPOSITION FOR PRESERVING VIRUSES |
| DK2359869T3 (en) | 2001-12-17 | 2019-04-15 | Univ Pennsylvania | Sequences of adeno-associated virus (AAV) serotype 8, vectors containing these, and uses thereof |
| AU2002359284A1 (en) | 2001-12-17 | 2003-06-30 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus (aav) serotype 9 sequences, vectors containing same, and uses therefor |
| WO2003053476A1 (en) | 2001-12-19 | 2003-07-03 | Lijun Wang | Adeno-associated virus-mediated delivery of gdnf to skeletal muscles |
| JP2005538929A (ja) | 2002-01-16 | 2005-12-22 | ダイナル バイオテック エイエスエイ | 単一サンプルからの核酸及びタンパク質の単離方法 |
| EP1504108B1 (en) | 2002-02-01 | 2013-04-17 | Oxford Biomedica (UK) Limited | Lentiviral vector |
| GB0208390D0 (en) | 2002-04-11 | 2002-05-22 | Univ London | Adeno-associated virus producer system |
| US20030198620A1 (en) | 2002-04-16 | 2003-10-23 | Keiya Ozawa | Method of treating amino acid metabolic disorders using recombinant adeno-associated virus virions |
| CA2426283C (en) | 2002-04-29 | 2006-06-27 | The Trustees Of The University Of Pennsylvania | Method for direct rescue and amplification of integrated viruses from cellular dna of tissues |
| CA2482512C (en) | 2002-04-30 | 2011-09-20 | Oncolytics Biotech Inc. | Improved viral purification methods |
| WO2004027019A2 (en) | 2002-05-01 | 2004-04-01 | University Of Florida Research Foundation, Inc. | Improved raav expression systems for genetic modification of specific capsid proteins |
| DE60335672D1 (de) | 2002-05-14 | 2011-02-17 | Merck Sharp & Dohme | Verfahren zur reinigung von adenovirus |
| US7419817B2 (en) | 2002-05-17 | 2008-09-02 | The United States Of America As Represented By The Secretary Department Of Health And Human Services, Nih. | Scalable purification of AAV2, AAV4 or AAV5 using ion-exchange chromatography |
| AU2003274397A1 (en) | 2002-06-05 | 2003-12-22 | University Of Florida | Production of pseudotyped recombinant aav virions |
| WO2004020605A2 (en) | 2002-08-29 | 2004-03-11 | The Board Of Trustees Of The Leland Stanford Junior University | Circular nucleic acid vectors, and methods for making and using the same |
| TW200509968A (en) | 2002-11-01 | 2005-03-16 | Elan Pharm Inc | Prevention and treatment of synucleinopathic disease |
| US7169612B2 (en) | 2002-11-11 | 2007-01-30 | Sanofi-Aventis Deutschland Gmbh | Use of EDG2 receptor in an animal model of heart failure |
| EP1418185A1 (en) | 2002-11-11 | 2004-05-12 | Aventis Pharma Deutschland GmbH | Use of EDG2 receptor in an animal model of heart failure |
| WO2004075861A2 (en) | 2003-02-26 | 2004-09-10 | Children's Hospital, Inc. | Recombinant adeno-associated virus production |
| WO2004083441A2 (en) | 2003-03-19 | 2004-09-30 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Random peptide library displayed on aav vectors |
| WO2004108922A2 (en) | 2003-04-25 | 2004-12-16 | The Trustees Of The University Of Pennsylvania | Use of aav comprising a capsid protein from aav7 or aav8 for the delivery of genes encoding apoprotein a or e genes to the liver |
| WO2005017101A2 (en) | 2003-05-19 | 2005-02-24 | THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH & HUMAN SERVICES, NATIONAL INSTITUTES OF HEALTH | Avian adenoassociated virus (aaav) and uses thereof |
| DE602004030327D1 (de) | 2003-05-21 | 2011-01-13 | Genzyme Corp | Verfahren zur herstellung von präparationen rekombinanter aav-virionen, die weitgehend frei von leeren capsiden sind |
| EP1486567A1 (en) | 2003-06-11 | 2004-12-15 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Improved adeno-associated virus (AAV) vector for gene therapy |
| JP4888876B2 (ja) | 2003-06-13 | 2012-02-29 | 田平 武 | アルツハイマー病の治療のための組換えアデノ随伴ウィルスベクター |
| SI3235827T1 (sl) | 2003-06-19 | 2021-05-31 | Genzyme Corporation | AAV virioni z zmanjšano imunoreaktivnostjo in uporaba za ta namen |
| US7291498B2 (en) | 2003-06-20 | 2007-11-06 | The Trustees Of The University Of Pennsylvania | Methods of generating chimeric adenoviruses and uses for such chimeric adenoviruses |
| WO2005001103A2 (en) | 2003-06-20 | 2005-01-06 | The Trustees Of The University Of Pennsylvania | Methods of generating chimeric adenoviruses and uses for such chimeric adenoviruses |
| US9441244B2 (en) | 2003-06-30 | 2016-09-13 | The Regents Of The University Of California | Mutant adeno-associated virus virions and methods of use thereof |
| ES2391975T3 (es) | 2003-07-25 | 2012-12-03 | Genvec, Inc. | Vacunas a base de vector adenovírico |
| US7683036B2 (en) | 2003-07-31 | 2010-03-23 | Regulus Therapeutics Inc. | Oligomeric compounds and compositions for use in modulation of small non-coding RNAs |
| US20070073264A1 (en) | 2003-09-26 | 2007-03-29 | The Trustees Of The University Of Pennsylvania | Methods, compositions and apparatus for delivering heterologous molecules to cells |
| CN1856576B (zh) | 2003-09-30 | 2011-05-04 | 宾夕法尼亚州立大学托管会 | 腺伴随病毒(aav)进化支、序列、含有这些序列的载体及它们的应用 |
| ATE497785T1 (de) | 2004-04-28 | 2011-02-15 | Univ Pennsylvania | Sequenzielle freisetzung immunogener moleküle über adenoviren und adeno-assoziierte viren vermittelte abgaben |
| WO2005116224A2 (en) | 2004-05-18 | 2005-12-08 | Children's Memorial Hospital | Tetracycline-regulated adeno-associated viral (aav) vectors for gene delivery to the nervous system |
| EP1751275B1 (en) | 2004-06-01 | 2017-08-16 | Avigen, Inc. | Compositions and methods to prevent aav vector aggregation |
| PT1807009E (pt) | 2004-10-05 | 2015-02-25 | Univ California | Cânula escalonada |
| US7901921B2 (en) | 2004-10-22 | 2011-03-08 | Oncolytics Biotech Inc. | Viral purification methods |
| CN1286981C (zh) | 2004-11-30 | 2006-11-29 | 华中科技大学同济医学院附属同济医院 | 表达人类cyp2j2反义基因的重组腺相关病毒及其制备方法 |
| CN101213305A (zh) | 2004-12-09 | 2008-07-02 | 建新公司 | 转基因在哺乳动物中枢神经系统中的可调控型表达 |
| US8614101B2 (en) | 2008-05-20 | 2013-12-24 | Rapid Pathogen Screening, Inc. | In situ lysis of cells in lateral flow immunoassays |
| US7625570B1 (en) | 2005-03-10 | 2009-12-01 | The Regents Of The University Of California | Methods for purifying adeno-associated virus |
| WO2006102072A2 (en) | 2005-03-23 | 2006-09-28 | The Trustees Of The University Of Pennsylvania | Use of a pa131 polypeptide in treatment of atherosclerosis |
| WO2006110689A2 (en) | 2005-04-07 | 2006-10-19 | The Trustees Of The University Of Pennsylvania | Method of increasing the function of an aav vector |
| US8283151B2 (en) | 2005-04-29 | 2012-10-09 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Isolation, cloning and characterization of new adeno-associated virus (AAV) serotypes |
| EP1879624B1 (en) | 2005-05-02 | 2011-09-21 | Genzyme Corporation | Gene therapy for neurometabolic disorders |
| EP3611266B1 (en) | 2005-08-23 | 2022-11-09 | The Trustees of the University of Pennsylvania | Rna containing modified nucleosides and methods of use thereof |
| AU2006283189B2 (en) | 2005-08-23 | 2013-01-31 | The Regents Of The University Of California | Reflux resistant cannula and system for chronic delivery of therapeutic agents using convection-enhanced delivery |
| EP1857552A1 (en) | 2006-05-20 | 2007-11-21 | Cargill Incorporated | Thermostable xylose isomerase enzyme |
| EP2311967B1 (en) | 2005-10-20 | 2017-09-20 | UniQure IP B.V. | Improved AAV vectors produced in insect cells |
| WO2008016391A2 (en) | 2006-01-31 | 2008-02-07 | The Board Of Trustees Of The Leland Stanford Junior University | Self-complementary parvoviral vectors, and methods for making and using the same |
| US7588772B2 (en) | 2006-03-30 | 2009-09-15 | Board Of Trustees Of The Leland Stamford Junior University | AAV capsid library and AAV capsid proteins |
| WO2007127803A2 (en) | 2006-04-25 | 2007-11-08 | The Regents Of The University Of California | Administration of growth factors for the treatment of cns disorders |
| CN101437538A (zh) | 2006-04-28 | 2009-05-20 | 宾夕法尼亚州立大学托管会 | 修饰的腺病毒六邻体蛋白和其应用 |
| WO2008027084A2 (en) | 2006-04-28 | 2008-03-06 | The Trustees Of The University Of Pennsylvania | Modified aav vectors having reduced capsid immunogenicity and use thereof |
| EP2018421B1 (en) | 2006-04-28 | 2012-12-19 | The Trustees of the University of Pennsylvania | Scalable production method for aav |
| US20080003565A1 (en) | 2006-05-02 | 2008-01-03 | Government Of The Us, As Represented By The Secretary, Department Of Health And Human Services | Viral nucleic acid microarray and method of use |
| ES2465996T3 (es) | 2006-05-25 | 2014-06-09 | Sangamo Biosciences, Inc. | Métodos y composiciones para la inactivación genética |
| CA2653974A1 (en) | 2006-05-30 | 2008-02-14 | Mayo Foundation For Medical Education And Research | Detecting and treating dementia |
| WO2007146046A2 (en) | 2006-06-07 | 2007-12-21 | Genzyme Corporation | Gene therapy for amyotrophic lateral sclerosis and other spinal cord disorders |
| EP2848253A1 (en) | 2006-06-19 | 2015-03-18 | Asklepios Biopharmaceutical, Inc. | Modified factor VIII and factor IX genes and vectors for gene therapy |
| KR101589259B1 (ko) | 2006-06-21 | 2016-02-01 | 유니큐어 아이피 비.브이. | 곤충세포 내 aav의 생산에 유용한 aav-rep78의 번역을 위한 변형된 개시 코돈을 갖는 벡터 |
| BRPI0714495B8 (pt) | 2006-07-21 | 2021-05-25 | California Inst Of Techn | lentivírus deficiente para replicação recombinante pseudotipado |
| ES2385679T3 (es) | 2006-08-24 | 2012-07-30 | Virovek, Inc. | Expresión de células de insecto de genes con marcos de lectura abiertos superpuestos, métodos y composiciones de éstos |
| CA2693178C (en) | 2006-11-29 | 2018-12-04 | Nationwide Children's Hospital, Inc. | Myostatin inhibition for enhancing muscle and/or improving muscle function |
| SG178744A1 (en) | 2007-02-02 | 2012-03-29 | Biogen Idec Inc | Use of semaphorin 6a for promoting myelination and oligodendrocyte differentiation |
| US20120322861A1 (en) | 2007-02-23 | 2012-12-20 | Barry John Byrne | Compositions and Methods for Treating Diseases |
| DK2191001T3 (en) | 2007-04-09 | 2016-09-19 | Univ Florida | RAAV VECTOR COMPOSITIONS WITH TYROSIN MODIFIED CAPSIDE PROTEINS AND PROCEDURES FOR USE THEREOF |
| US9611302B2 (en) | 2007-04-09 | 2017-04-04 | University Of Florida Research Foundation, Inc. | High-transduction-efficiency RAAV vectors, compositions, and methods of use |
| US9725485B2 (en) | 2012-05-15 | 2017-08-08 | University Of Florida Research Foundation, Inc. | AAV vectors with high transduction efficiency and uses thereof for gene therapy |
| WO2008128251A1 (en) | 2007-04-17 | 2008-10-23 | The Children's Hospital Of Philadelphia | Humanized viral vectors and methods of use thereof |
| EP2012122A1 (en) | 2007-07-06 | 2009-01-07 | Medigene AG | Mutated parvovirus structural proteins as vaccines |
| US20100203083A1 (en) | 2007-05-31 | 2010-08-12 | Medigene Ag | Mutated structural protein of a parvovirus |
| PL3252161T3 (pl) | 2007-06-06 | 2022-03-07 | Genzyme Corporation | Terapia genowa dla lizosomalnych chorób spichrzeniowych |
| ATE535607T1 (de) | 2007-06-29 | 2011-12-15 | Hoffmann La Roche | Promotor |
| WO2009012176A2 (en) | 2007-07-14 | 2009-01-22 | The University Of Iowa Research Foundation | Methods and compositions for treating brain diseases |
| SI3093345T1 (sl) | 2007-07-26 | 2019-08-30 | Uniqure Ip B.V. | Bakulovirusni vektorji, ki vsebujejo ponavljajoča kodirna zaporedja z različnimi kodonskimi preferencami |
| WO2009030025A1 (en) | 2007-09-04 | 2009-03-12 | Her Majesty The Queen In Right Of Canada As Represented By The Minister Of Health | Porcine adeno-associated viruses |
| JP2010538675A (ja) | 2007-09-19 | 2010-12-16 | アムステルダム モレキュラー セラピューティクス ビー.ブイ. | タンパク質産生の改善のためのaav複製機構の使用 |
| EP2186283A4 (en) | 2007-10-18 | 2011-03-09 | Lg Electronics Inc | METHOD AND SYSTEM FOR TRANSMITTING AND RECEIVING SIGNALS |
| WO2009059192A1 (en) | 2007-11-02 | 2009-05-07 | Cornell University | Materials and methods for gene mediated therapy of psychiatric disorders |
| CA2706257C (en) | 2007-11-28 | 2017-06-06 | The Trustees Of The University Of Pennsylvania | Simian subfamily b adenovirus sadv-28, -27, -29, -32, -33 and -35 and uses thereof |
| EP2463362B1 (en) | 2007-11-28 | 2017-11-08 | The Trustees Of The University Of Pennsylvania | Simian subfamily c adenovirus SAdv-31 and uses thereof |
| MX2010005858A (es) | 2007-11-28 | 2010-06-11 | Univ Pennsylvania | Adenovirus e simianos sadv-39, sadv-25.2, sadv-26, sadv-30, sadv-37 y sadv-38. |
| ES2414804T3 (es) | 2008-01-18 | 2013-07-22 | Genentech, Inc. | Métodos y composiciones que se dirigen a la poliubiquitina |
| DK2242840T3 (da) | 2008-01-29 | 2019-10-21 | Applied Genetic Tech Corporation | Produktion af rekombinant adeno-associeret virus under anvendelse af bhk-celler i suspension |
| EP3257937B1 (en) | 2008-02-19 | 2022-08-03 | uniQure IP B.V. | Optimisation of expression of parvoviral rep and cap proteins in insect cells |
| CA2716928C (en) | 2008-03-04 | 2018-04-10 | The Trustees Of The University Of Pennsylvania | Simian adenoviruses sadv-36,-42.1, -42.2, and -44 and uses thereof |
| WO2009120978A2 (en) | 2008-03-27 | 2009-10-01 | The Ohio State University | Treatment of metabolic-related disorders using hypothalamic gene transfer of bdnf and compositions therfor |
| US8632764B2 (en) | 2008-04-30 | 2014-01-21 | University Of North Carolina At Chapel Hill | Directed evolution and in vivo panning of virus vectors |
| WO2009134681A2 (en) | 2008-04-30 | 2009-11-05 | The Trustees Of The University Of Pennsylvania | Aav7 viral vectors for targeted delivery of rpe cells |
| EP2910637A1 (en) | 2008-05-20 | 2015-08-26 | University of Florida Research Foundation, Inc. | Vectors for delivery of light-sensitive proteins and methods of use |
| US9217155B2 (en) | 2008-05-28 | 2015-12-22 | University Of Massachusetts | Isolation of novel AAV'S and uses thereof |
| WO2009154452A1 (en) | 2008-06-17 | 2009-12-23 | Amsterdam Molecular Therapeutics B.V. | Parvoviral capsid with incorporated Gly-Ala repeat region |
| US8945885B2 (en) | 2008-07-03 | 2015-02-03 | The Board Of Trustees Of The Leland Stanford Junior University | Minicircle DNA vector preparations and methods of making and using the same |
| AU2009297243B2 (en) | 2008-09-29 | 2015-10-29 | Proyecto De Biomedicina Cima S.L. | Porphobilinogen deaminase gene therapy |
| US8940290B2 (en) | 2008-10-31 | 2015-01-27 | The Trustees Of The University Of Pennsylvania | Simian adenoviruses SAdV-43, -45, -46, -47, -48, -49, and -50 and uses thereof |
| CN102369288A (zh) | 2008-11-14 | 2012-03-07 | 生命技术公司 | 用于工程化细胞的组合物和方法 |
| US9415121B2 (en) | 2008-12-19 | 2016-08-16 | Nationwide Children's Hospital | Delivery of MECP2 polynucleotide using recombinant AAV9 |
| EP2396343B1 (en) | 2009-02-11 | 2017-05-17 | The University of North Carolina At Chapel Hill | Modified virus vectors and methods of making and using the same |
| PL2403867T3 (pl) | 2009-03-04 | 2019-12-31 | Deutsches Krebsforschungszentrum | Białko aktywujące składanie (aap) i jego zastosowanie do wytwarzania cząstek parwowirusa zasadniczo składających się z vp3 |
| US20120093775A1 (en) | 2009-03-27 | 2012-04-19 | Proyecto De Biomedicina Cima, S.L. | Methods and compositions for the treatment of cirrhosis and liver fibrosis |
| ES2724122T3 (es) | 2009-04-30 | 2019-09-06 | Univ Pennsylvania | Composiciones para dirigir células de las vías respiratorias de conducción que comprenden construcciones de virus adenoasociado |
| AU2010243489A1 (en) | 2009-05-01 | 2011-12-22 | Redbiotec Ag | Recombinant virus-like particles encoded by multi-gene vector |
| JP5879256B2 (ja) | 2009-05-02 | 2016-03-08 | ジェンザイム・コーポレーション | 神経変性障害のための遺伝子治療 |
| US8476418B2 (en) | 2009-05-28 | 2013-07-02 | Deutsches Krebsforschungszentrum | Modified AAV capsid polypeptides |
| WO2010138263A2 (en) | 2009-05-28 | 2010-12-02 | University Of Massachusetts | Novel aav 's and uses thereof |
| CN102575232B (zh) | 2009-05-29 | 2015-07-22 | 宾夕法尼亚大学托管会 | 猿腺病毒41及其应用 |
| HUE028341T2 (en) | 2009-06-16 | 2016-12-28 | Genzyme Corp | Improved methods for purification of recombinant aav vectors |
| JP2014501097A (ja) | 2009-07-06 | 2014-01-20 | アルナイラム ファーマシューティカルズ, インコーポレイテッド | 生物由来物質の産生を高めるための組成物及び方法 |
| EP2292781A1 (en) | 2009-08-17 | 2011-03-09 | Genethon | Baculovirus-based production of biopharmaceuticals free of contaminating baculoviral virions |
| WO2011038187A1 (en) | 2009-09-25 | 2011-03-31 | The Trustees Of The University Of Pennsylvania | Controlled adeno-associated virus (aav) diversification and libraries prepared therefrom |
| WO2011054976A2 (en) | 2009-11-09 | 2011-05-12 | Genepod Therapeutics Ab | Novel viral vector construct for neuron specific optimized continuous dopa synthesis in vivo |
| WO2011069529A1 (en) | 2009-12-09 | 2011-06-16 | Curevac Gmbh | Mannose-containing solution for lyophilization, transfection and/or injection of nucleic acids |
| ES2683695T3 (es) | 2010-01-12 | 2018-09-27 | The University Of North Carolina At Chapel Hill | Repeticiones terminales invertidas restrictivas para vectores virales |
| WO2011091419A2 (en) | 2010-01-25 | 2011-07-28 | New York Universiy | Recombinant derivatives of botulinum neurotoxins engineered for trafficking studies and neuronal delivery |
| CA2788682C (en) | 2010-02-05 | 2019-03-05 | The University Of North Carolina At Chapel Hill | Compositions and methods for enhanced parvovirus transduction |
| WO2011112089A2 (en) | 2010-03-11 | 2011-09-15 | Amsterdam Molecular Therapeutics (Amt) Ip B.V. | Mutated rep encoding sequences for use in aav production |
| WO2011117258A2 (en) | 2010-03-22 | 2011-09-29 | Association Institut De Myologie | Methods of increasing efficiency of vector penetration of target tissue |
| US20130023033A1 (en) | 2010-03-29 | 2013-01-24 | The Trustees Of The University Of Pennsylvania | Pharmacologically induced transgene ablation system |
| US9315825B2 (en) | 2010-03-29 | 2016-04-19 | The Trustees Of The University Of Pennsylvania | Pharmacologically induced transgene ablation system |
| WO2011122950A1 (en) | 2010-04-01 | 2011-10-06 | Amsterdam Molecular Therapeutics (Amt) Ip B.V. | Monomeric duplex aav vectors |
| EP2826860B1 (en) | 2010-04-23 | 2018-08-22 | University of Massachusetts | CNS targeting AAV vectors and methods of use thereof |
| EP2561075B1 (en) | 2010-04-23 | 2018-06-27 | University of Massachusetts | Aav-based treatment of cholesterol-related disorders |
| WO2011133874A1 (en) | 2010-04-23 | 2011-10-27 | University Of Massachusetts | Multicistronic expression constructs |
| US8927514B2 (en) | 2010-04-30 | 2015-01-06 | City Of Hope | Recombinant adeno-associated vectors for targeted treatment |
| US9839696B2 (en) | 2010-04-30 | 2017-12-12 | City Of Hope | Recombinant adeno-associated vectors for targeted treatment |
| WO2012007458A1 (en) | 2010-07-12 | 2012-01-19 | Universidad Autónoma De Barcelona | Gene therapy composition for use in diabetes treatment |
| US8808684B2 (en) | 2010-09-10 | 2014-08-19 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Epidermal growth factor receptor (EGFR) and methods of use in adenoviral-associated virus type 6 (AAV6) transduction |
| US9102943B2 (en) | 2010-10-05 | 2015-08-11 | Takara Bio Inc. | Method for producing virus vector |
| US8663624B2 (en) | 2010-10-06 | 2014-03-04 | The Regents Of The University Of California | Adeno-associated virus virions with variant capsid and methods of use thereof |
| EP2627665B1 (en) | 2010-10-12 | 2015-12-16 | The Children's Hospital Of Philadelphia | Methods and compositions for treating hemophilia B |
| EP2634253B1 (en) * | 2010-10-27 | 2016-05-11 | Jichi Medical University | Adeno-associated virus virions for transferring genes into neural cells |
| US9116157B2 (en) | 2010-11-05 | 2015-08-25 | Brandeis University | Ice-cleaved alpha-synuclein as a biomarker |
| WO2012064920A1 (en) | 2010-11-11 | 2012-05-18 | University Of Miami | Methods, compositions, cells, and kits for treating ischemic injury |
| WO2012071318A2 (en) | 2010-11-23 | 2012-05-31 | The Trustees Of The University Of Pennsylvania | Subfamily e simian adenoviruses a1321, a1325, a1295, a1309, a1316 and a1322 and uses thereof |
| WO2012109570A1 (en) | 2011-02-10 | 2012-08-16 | The University Of North Carolina At Chapel Hill | Viral vectors with modified transduction profiles and methods of making and using the same |
| DK2675902T3 (da) | 2011-02-17 | 2019-06-03 | Univ Pennsylvania | Sammensætninger og fremgangsmåder til at ændre vævsspecificitet og forbedre aav9-medieret genoverførsel |
| GB201103062D0 (en) | 2011-02-22 | 2011-04-06 | Isis Innovation | Method |
| US8865881B2 (en) | 2011-02-22 | 2014-10-21 | California Institute Of Technology | Delivery of proteins using adeno-associated virus (AAV) vectors |
| US20120220648A1 (en) * | 2011-02-24 | 2012-08-30 | National Taiwan University Hospital | Method of Treating Aromatic L-Amino Acid Decarboxylase (AADC) Deficiency Using Adeno-Associated Virus (AAV)-AADC Vector |
| EP2500434A1 (en) | 2011-03-12 | 2012-09-19 | Association Institut de Myologie | Capsid-free AAV vectors, compositions, and methods for vector production and gene delivery |
| CN103476399A (zh) | 2011-04-18 | 2013-12-25 | 独立行政法人国立精神·神经医疗研究中心 | 药剂递送粒子及其制造方法 |
| EP2699688A1 (en) | 2011-04-20 | 2014-02-26 | The Trustees Of The University Of Pennsylvania | Regimens and compositions for aav-mediated passive immunization of airborne pathogens |
| EP3318635A1 (en) | 2011-04-21 | 2018-05-09 | University of Massachusetts | Raav-based compositions and methods for treating alpha-1 anti-trypsin deficiencies |
| HRP20171334T1 (hr) | 2011-04-22 | 2017-11-17 | The Regents Of The University Of California | Virioni adeno-povezanog virusa s kapsid varijantom i postupci njihove upotrebe |
| US9249425B2 (en) | 2011-05-16 | 2016-02-02 | The Trustees Of The University Of Pennslyvania | Proviral plasmids and production of recombinant adeno-associated virus |
| US9598468B2 (en) | 2011-05-18 | 2017-03-21 | University Of Florida Research Foundation, Incorporated | Polypeptides and vectors for targeting HER2/neu expressing cells and uses thereof |
| US20120295960A1 (en) | 2011-05-20 | 2012-11-22 | Oxford Biomedica (Uk) Ltd. | Treatment regimen for parkinson's disease |
| CA2831969A1 (en) | 2011-06-06 | 2012-12-30 | Biocartis S.A. | Selective lysis of cells by ionic surfactants |
| EP2737071B1 (en) | 2011-07-27 | 2017-03-15 | Genethon | Improved baculovirus expression systems |
| PT2744895E (pt) | 2011-09-08 | 2016-02-08 | Uniqure Ip Bv | Remoção de vírus contaminantes de preparações de aav |
| WO2013036889A1 (en) | 2011-09-09 | 2013-03-14 | University Of Washington | Retrograde transport peptide and use of same for delivery to central nervous system |
| US9441206B2 (en) | 2011-10-28 | 2016-09-13 | The University Of North Carolina At Chapel Hill | Cell line for production of adeno-associated virus |
| GB201118636D0 (en) | 2011-10-28 | 2011-12-07 | Oxford Biomedica Ltd | Nucleotide sequence |
| JP6348064B2 (ja) | 2011-11-22 | 2018-06-27 | ザ チルドレンズ ホスピタル オブ フィラデルフィア | 効率の高いトランスジーン送達のためのウイルスベクター |
| US9434928B2 (en) | 2011-11-23 | 2016-09-06 | Nationwide Children's Hospital, Inc. | Recombinant adeno-associated virus delivery of alpha-sarcoglycan polynucleotides |
| WO2013078199A2 (en) | 2011-11-23 | 2013-05-30 | Children's Medical Center Corporation | Methods for enhanced in vivo delivery of synthetic, modified rnas |
| US9611305B2 (en) | 2012-01-06 | 2017-04-04 | Mayo Foundation For Medical Education And Research | Treating cardiovascular or renal diseases |
| CN108310396B (zh) | 2012-02-14 | 2022-07-15 | 加利福尼亚大学董事会 | 用于心血管疾病和其它病况的旁分泌基因的全身性递送和受调节的表达 |
| AU2013221212B2 (en) | 2012-02-17 | 2018-08-09 | The Children's Hospital Of Philadelphia | AAV vector compositions and methods for gene transfer to cells, organs and tissues |
| AU2013249202B2 (en) | 2012-04-18 | 2018-08-09 | The Children's Hospital Of Philadelphia | Composition and methods for highly efficient gene transfer using AAV capsid variants |
| US20140162319A2 (en) | 2012-05-02 | 2014-06-12 | Sangeetha Hareendran | Nucleotide sequences, methods, kit and a recombinant cell thereof |
| US9163259B2 (en) | 2012-05-04 | 2015-10-20 | Novartis Ag | Viral vectors for the treatment of retinal dystrophy |
| EP2847199B1 (en) | 2012-05-08 | 2017-10-25 | Merck Sharp & Dohme Corp. | Permeable glycosidase inhibitors and uses thereof |
| WO2013170078A1 (en) | 2012-05-09 | 2013-11-14 | Oregon Health & Science University | Adeno associated virus plasmids and vectors |
| US10294281B2 (en) | 2012-05-15 | 2019-05-21 | University Of Florida Research Foundation, Incorporated | High-transduction-efficiency rAAV vectors, compositions, and methods of use |
| TWI775096B (zh) | 2012-05-15 | 2022-08-21 | 澳大利亞商艾佛蘭屈澳洲私營有限公司 | 使用腺相關病毒(aav)sflt-1治療老年性黃斑部退化(amd) |
| WO2013173702A2 (en) | 2012-05-18 | 2013-11-21 | The Trustees Of The University Of Pennsylvania | Subfamily e simian adenoviruses a1302, a1320, a1331 and a1337 and uses thereof |
| US9422576B2 (en) | 2012-07-06 | 2016-08-23 | Takara Bio Inc. | Cell capable of producing adeno-associated virus vector |
| BR112015000161A2 (pt) | 2012-07-06 | 2017-06-27 | Univ Iowa Res Found | composições de vetor de vírus adeno-associado modificado |
| AU2013296425B2 (en) | 2012-08-01 | 2018-06-07 | Nationwide Children's Hospital | Intrathecal delivery of recombinant adeno-associated virus 9 |
| AU2013308470B2 (en) | 2012-08-31 | 2017-04-20 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | AAV mediated aquaporin gene transfer to treat Sjogren's syndrome |
| US9636370B2 (en) | 2012-09-28 | 2017-05-02 | The University Of North Carolina At Chapel Hill | AAV vectors targeted to oligodendrocytes |
| WO2014071042A1 (en) | 2012-10-31 | 2014-05-08 | The Trustees Of Columbia University In The City Of New York | Methods for identifying candidates for the treatment of neurodegenerative diseases |
| DK2931897T3 (en) | 2012-12-12 | 2018-02-05 | Broad Inst Inc | CONSTRUCTION, MODIFICATION AND OPTIMIZATION OF SYSTEMS, PROCEDURES AND COMPOSITIONS FOR SEQUENCE MANIPULATION AND THERAPEUTICAL APPLICATIONS |
| EP2940131B1 (en) | 2012-12-25 | 2019-02-20 | Takara Bio Inc. | Aav variant |
| CA2897444A1 (en) | 2013-01-08 | 2014-07-17 | Genzyme Corporation | Use of inos inhibitors to increase viral yield in culture |
| US9066966B2 (en) | 2013-02-01 | 2015-06-30 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Methods and pharmaceutical compositions for the treatment of cardiomyopathy due to friedreich ataxia |
| US9567376B2 (en) | 2013-02-08 | 2017-02-14 | The Trustees Of The University Of Pennsylvania | Enhanced AAV-mediated gene transfer for retinal therapies |
| EP2970946A4 (en) | 2013-03-13 | 2016-09-07 | Philadelphia Children Hospital | ADENOASSOZED VIRUS VECTORS AND METHOD FOR USE THEREOF |
| US9447433B2 (en) | 2013-03-15 | 2016-09-20 | The University Of North Carolina At Chapel Hill | Synthetic adeno-associated virus inverted terminal repeats |
| MX384795B (es) | 2013-03-15 | 2025-03-14 | Childrens Hospital Philadelphia | Vectores que comprenden secuencias de polinucleotidos rellenadoras/de relleno y metodos de uso. |
| AU2014251099B2 (en) | 2013-04-08 | 2019-01-17 | The University Of Kansas | Chimeric adeno-associated virus/ bocavirus parvovirus vector |
| EP2792742A1 (en) | 2013-04-17 | 2014-10-22 | Universitätsklinikum Hamburg-Eppendorf (UKE) | Gene-therapy vectors for treating cardiomyopathy |
| CA2909733C (en) | 2013-04-18 | 2023-10-17 | Fondazione Telethon | Effective delivery of large genes by dual aav vectors |
| KR102413498B1 (ko) | 2013-04-20 | 2022-06-24 | 더 리서치 인스티튜트 앳 네이션와이드 칠드런스 하스피탈 | 엑손 2-표적 U7snRNA 폴리뉴클레오티드 작제물의 재조합형 아데노 부속 바이러스 전달 |
| US9719106B2 (en) | 2013-04-29 | 2017-08-01 | The Trustees Of The University Of Pennsylvania | Tissue preferential codon modified expression cassettes, vectors containing same, and uses thereof |
| CN105377039A (zh) | 2013-05-15 | 2016-03-02 | 明尼苏达大学董事会 | 腺相关病毒介导的基因向中枢神经系统转移 |
| WO2014186746A1 (en) | 2013-05-16 | 2014-11-20 | University Of Florida Research Foundation, Inc. | HAIRPIN mRNA ELEMENTS AND METHODS FOR THE REGULATION OF PROTEIN TRANSLATION |
| US11136557B2 (en) | 2013-05-31 | 2021-10-05 | The Regents Of The University Of California | Adeno-associated virus variants and methods of use thereof |
| WO2014201308A1 (en) | 2013-06-12 | 2014-12-18 | Washington University | Endothelial-targeted adenoviral vectors, methods and uses therefor |
| EP3008191A2 (en) | 2013-06-13 | 2016-04-20 | Shire Human Genetic Therapies, Inc. | Messenger rna based viral production |
| KR20240090694A (ko) | 2013-07-22 | 2024-06-21 | 더 칠드런스 호스피탈 오브 필라델피아 | 변종 aav 및 조성물, 세포, 기관 및 조직으로의 유전자 전이를 위한 방법 및 용도 |
| EP3024497B1 (en) | 2013-07-26 | 2021-01-13 | University of Iowa Research Foundation | Methods and compositions for treating brain diseases |
| ITTO20130669A1 (it) | 2013-08-05 | 2015-02-06 | Consiglio Nazionale Ricerche | Vettore adeno-associato ricombinante muscolo-specifico e suo impiego nel trattamento di patologie muscolari |
| EP3039129B1 (en) | 2013-08-30 | 2018-06-27 | Amgen Inc. | High titer recombinant aav vector production in adherent and suspension cells |
| RS61039B1 (sr) | 2013-09-12 | 2020-12-31 | Biomarin Pharm Inc | Aav vektori koji sadrže gen koji kodira faktor viii |
| US9585971B2 (en) | 2013-09-13 | 2017-03-07 | California Institute Of Technology | Recombinant AAV capsid protein |
| WO2015048534A1 (en) | 2013-09-26 | 2015-04-02 | University Of Florida Research Foundation, Inc. | Synthetic combinatorial aav capsid library for targeted gene therapy |
| US20160354489A1 (en) | 2013-09-26 | 2016-12-08 | Universitat Autònome de Barcelona | Gene therapy compositions for use in the prevention and/or treatment of non-alcoholic fatty liver disease |
| HUE052676T2 (hu) | 2013-10-11 | 2021-05-28 | Massachusetts Eye & Ear Infirmary | Eljárások õsi vírusszekvenciák elõrejelzésére és alkalmazásaik |
| CN120174012A (zh) | 2013-10-24 | 2025-06-20 | 优尼科Ip有限公司 | 用于基因治疗神经疾病的aav-5假型载体 |
| WO2015108610A1 (en) | 2013-11-08 | 2015-07-23 | The Board Of Trustees Of The University Of Arkansas | Adeno-associated virus "x" oncogene |
| WO2015081101A1 (en) | 2013-11-26 | 2015-06-04 | The United States Of America, As Represented By The Secretary Department Of Health And Human Services | Adeno-associated virus vectors for treatment of glycogen storage disease |
| CN105765066B (zh) | 2013-11-29 | 2018-12-14 | 宝生物工程株式会社 | 用于定量腺伴随病毒的方法 |
| EP4674963A3 (en) | 2013-12-09 | 2026-04-29 | Baylor College of Medicine | Hippo and dystrophin complex signaling in cardiomyocyte renewal |
| MX2016007325A (es) | 2013-12-12 | 2017-07-19 | Broad Inst Inc | Composiciones y metodos de uso de sistemas crispr-cas en desordenes debidos a repeticion de nucleotidos. |
| GB201322798D0 (en) | 2013-12-20 | 2014-02-05 | Oxford Biomedica Ltd | Production system |
| CA2934758C (en) | 2014-01-09 | 2022-05-03 | Genethon | Methods for diagnosing or monitoring muscular dystrophies |
| WO2015106273A2 (en) | 2014-01-13 | 2015-07-16 | Trustees Of Boston University | Methods and assays relating to huntingtons disease and parkinson's disease |
| GB201401707D0 (en) | 2014-01-31 | 2014-03-19 | Sec Dep For Health The | Adeno-associated viral vectors |
| GB201403684D0 (en) | 2014-03-03 | 2014-04-16 | King S College London | Vector |
| US10072251B2 (en) | 2014-02-19 | 2018-09-11 | University Of Massachusetts | Recombinant AAVS having useful transcytosis properties |
| BR112016016274A2 (pt) | 2014-02-19 | 2017-10-03 | Hoffmann La Roche | Ponte da barreira hematoencefálica |
| WO2015124546A1 (en) | 2014-02-19 | 2015-08-27 | Fundación Centro Nacional De Investigaciones Cardiovasculares Carlos Iii- Cnic | Aav vectors for the treatment of ischemic and non-ischemic heart disease |
| WO2015126972A1 (en) | 2014-02-21 | 2015-08-27 | University Of Florida Research Foundation, Inc. | Methods and compositions for gene delivery to on bipolar cells |
| US10272117B2 (en) | 2014-02-24 | 2019-04-30 | Celgene Corporation | Methods of using an activator of cereblon for neural cell expansion and the treatment of central nervous system disorders |
| WO2015131076A1 (en) | 2014-02-27 | 2015-09-03 | Yale University | Nlrp6 inflammasome intestinal epithelium mucus secretion |
| ES2768763T3 (es) | 2014-03-04 | 2020-06-23 | Univ Florida | Vectores rAAV mejorados y métodos para la transducción de fotorreceptores y células EPR |
| EP3119415A4 (en) | 2014-03-07 | 2017-11-29 | The Arizona Board of Regents on behalf of the University of Arizona | Non-narcotic crmp2 peptides targeting sodium channels for chronic pain |
| RS60902B1 (sr) | 2014-03-09 | 2020-11-30 | Univ Pennsylvania | Kompozicije korisne u lečenju nedostatka ornitinske transkarbamilaze (otc) |
| WO2015137802A1 (en) | 2014-03-10 | 2015-09-17 | Uniqure Ip B.V. | Further improved aav vectors produced in insect cells |
| US20170114346A1 (en) | 2014-04-03 | 2017-04-27 | Braingene Ab | Gene expression system and regulation thereof |
| EP3556858A3 (en) | 2014-04-09 | 2020-01-22 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating cystic fibrosis |
| EP2933335A1 (en) | 2014-04-18 | 2015-10-21 | Genethon | A method of treating peripheral neuropathies and motor neuron diseases |
| ES2876409T3 (es) | 2014-04-25 | 2021-11-12 | Univ Pennsylvania | Variantes del RLBD y su uso en composiciones para reducir los niveles de colesterol |
| EP3134522B1 (en) | 2014-04-25 | 2021-10-06 | University of Massachusetts | Recombinant aav vectors useful for reducing immunity against transgene products |
| WO2015173436A1 (en) | 2014-05-16 | 2015-11-19 | Vrije Universiteit Brussel | Genetic correction of myotonic dystrophy type 1 |
| WO2015191508A1 (en) | 2014-06-09 | 2015-12-17 | Voyager Therapeutics, Inc. | Chimeric capsids |
| US11207424B2 (en) | 2014-06-13 | 2021-12-28 | Mayo Foundation For Medical Education And Research | Methods and materials for increasing viral vector infectivity |
| US10781459B2 (en) | 2014-06-20 | 2020-09-22 | University Of Florida Research Foundation, Incorporated | Methods of packaging multiple adeno-associated virus vectors |
| EP2960336A1 (en) | 2014-06-27 | 2015-12-30 | Genethon | Efficient systemic treatment of dystrophic muscle pathologies |
| US10526583B2 (en) | 2014-07-02 | 2020-01-07 | University Of Florida Research Foundation, Incorporated | Compositions and methods for purifying recombinant adeno-associated virus |
| EP3168298B1 (en) | 2014-07-10 | 2019-04-17 | Takara Bio Inc. | Production method for non-enveloped virus particles |
| WO2016019144A2 (en) | 2014-07-30 | 2016-02-04 | Sangamo Biosciences, Inc. | Gene correction of scid-related genes in hematopoietic stem and progenitor cells |
| US10392622B2 (en) | 2014-08-01 | 2019-08-27 | The Trustees Of The University Of Pennsylvania | Compositions and methods for self-regulated inducible gene expression |
| WO2016054554A1 (en) | 2014-10-03 | 2016-04-07 | University Of Massachusetts | Heterologous targeting peptide grafted aavs |
| US10711270B2 (en) | 2014-10-03 | 2020-07-14 | University Of Massachusetts | High efficiency library-identified AAV vectors |
| WO2016057975A2 (en) | 2014-10-10 | 2016-04-14 | Research Institute At Nationwide Children's Hospital | Guided injections for aav gene transfer to muscle |
| AU2015335923B2 (en) | 2014-10-21 | 2021-04-29 | University Of Massachusetts | Recombinant AAV variants and uses thereof |
| SG11201703148TA (en) * | 2014-11-05 | 2017-05-30 | Voyager Therapeutics Inc | Aadc polynucleotides for the treatment of parkinson's disease |
| EP3215602B1 (en) | 2014-11-05 | 2019-12-25 | The Research Institute at Nationwide Children's Hospital | Methods and materials for producing recombinant viruses in eukaryotic microalgae |
| SI3221349T1 (sl) | 2014-11-19 | 2021-02-26 | Axon Neuroscience Se | Humanizirano tau protitelo pri alzheimerjevi bolezni |
| WO2016081811A1 (en) | 2014-11-21 | 2016-05-26 | The University Of North Carolina At Chapel Hill | Aav vectors targeted to the central nervous system |
| WO2016081927A2 (en) | 2014-11-21 | 2016-05-26 | University Of Florida Research Foundation, Inc. | Genome-modified recombinant adeno-associated virus vectors |
| FI3224376T4 (fi) | 2014-11-28 | 2023-08-31 | Dna-epäpuhtaudet koostumuksessa, joka käsittää parvovirusvirionin | |
| HK1245326A1 (zh) | 2014-12-12 | 2018-08-24 | Voyager Therapeutics, Inc. | 用於生产scaav的组合物和方法 |
| AU2016206624B2 (en) | 2015-01-14 | 2020-08-06 | The University Of North Carolina At Chapel Hill | Methods and compositions for targeted gene transfer |
| CA2975447C (en) | 2015-01-30 | 2021-02-23 | The Regents Of The University Of California | Spinal subpial gene delivery system |
| WO2016126857A1 (en) | 2015-02-03 | 2016-08-11 | University Of Florida Research Foundation, Inc. | Recombinant aav1, aav5, and aav6 capsid mutants and uses thereof |
| TN2017000353A1 (en) | 2015-02-10 | 2019-01-16 | Genzyme Corp | Enhanced delivery of viral particles to the striatum and cortex |
| EP3262162A4 (en) | 2015-02-23 | 2018-08-08 | Voyager Therapeutics, Inc. | Regulatable expression using adeno-associated virus (aav) |
| CN107635575A (zh) | 2015-03-10 | 2018-01-26 | 纽约市哥伦比亚大学理事会 | 重组glut1腺相关病毒载体构建体以及用于恢复glut1表达的相关方法 |
| JP2018510160A (ja) | 2015-03-20 | 2018-04-12 | ブルーバード バイオ, インコーポレイテッド | ベクター製剤 |
| JP6836999B2 (ja) | 2015-03-24 | 2021-03-03 | ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニアThe Regents Of The University Of California | アデノ随伴ウイルス変異体及びその使用方法 |
| EP3277811B1 (en) | 2015-04-03 | 2020-12-23 | University of Massachusetts | Fully stabilized asymmetric sirna |
| US10081659B2 (en) | 2015-04-06 | 2018-09-25 | The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services | Adeno-associated vectors for enhanced transduction and reduced immunogenicity |
| TWI707951B (zh) | 2015-04-08 | 2020-10-21 | 美商健臻公司 | 過大腺相關載體之製造 |
| CN115074366A (zh) | 2015-04-16 | 2022-09-20 | 埃默里大学 | 用于肝脏中蛋白质表达的重组启动子和载体及其用途 |
| CA3019315A1 (en) | 2015-04-23 | 2016-10-27 | University Of Massachusetts | Modulation of aav vector transgene expression |
| US11046955B2 (en) | 2015-04-24 | 2021-06-29 | University Of Massachusetts | Modified AAV constructs and uses thereof |
| US20160346359A1 (en) | 2015-05-01 | 2016-12-01 | Spark Therapeutics, Inc. | Adeno-associated Virus-Mediated CRISPR-Cas9 Treatment of Ocular Disease |
| US10881548B2 (en) | 2015-05-07 | 2021-01-05 | Massachusetts Eye And Ear Infirmary | Methods of delivering an agent to the eye |
| CA2985347A1 (en) | 2015-05-11 | 2016-11-17 | Alcyone Lifesciences, Inc. | Drug delivery systems and methods |
| JP6805174B2 (ja) | 2015-05-12 | 2020-12-23 | アメリカ合衆国 | 神経成長因子シグナルペプチド及び副甲状腺ホルモンを含むaav分離株及び融合タンパク質 |
| US20170067028A1 (en) | 2015-05-15 | 2017-03-09 | Douglas J. Ballon | Radiolabeling of adeno associated virus |
| WO2016191418A1 (en) | 2015-05-26 | 2016-12-01 | Salk Institute For Biological Studies | Motor neuron-specific expression vectors |
| JP6573991B2 (ja) | 2015-05-28 | 2019-09-11 | コーネル ユニヴァーシティー | 血管性浮腫の治療としてのc1eiのアデノ随伴ウイルス介在性送達 |
| US11027024B2 (en) | 2015-05-29 | 2021-06-08 | University Of Iowa Research Foundation | Methods of delivery of transgenes for treating brain diseases |
| US11542500B2 (en) | 2015-05-29 | 2023-01-03 | The Trustees Of The University Of Pennsylvania | TRIM11 for degradation of protein aggregates |
| WO2016210170A1 (en) | 2015-06-23 | 2016-12-29 | The Children's Hospital Of Philadelphia | Modified factor ix, and compositions, methods and uses for gene transfer to cells, organs and tissues |
| WO2017004514A1 (en) | 2015-07-02 | 2017-01-05 | University Of Florida Research Foundation, Inc. | Recombinant adeno-associated virus vectors to target medullary thyroid carcinoma |
| US10801040B2 (en) | 2015-07-07 | 2020-10-13 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for expressing a polynucleotide of interest in the peripheral nervous system of a subject |
| US20170007669A1 (en) | 2015-07-07 | 2017-01-12 | Mayo Foundation For Medical Education And Research | Peptide-mediated delivery of active agents across the blood-brain barrier |
| WO2017015102A1 (en) | 2015-07-17 | 2017-01-26 | The Trustees Of The University Of Pennsylvania | Compositions and methods for achieving high levels of transduction in human liver cells |
| WO2017019876A1 (en) | 2015-07-28 | 2017-02-02 | University Of Massachusetts | Transgenic expression of dnase i in vivo delivered by an adeno-associated virus vector |
| CA2994160C (en) | 2015-07-30 | 2021-08-10 | Massachusetts Eye And Ear Infirmary | Ancestral virus sequences and uses thereof |
| US20190000940A1 (en) | 2015-07-31 | 2019-01-03 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of aadc deficiency |
| EP3332012A4 (en) | 2015-08-06 | 2019-01-16 | The Trustees of The University of Pennsylvania | GLP-1 AND USE THEREOF IN COMPOSITIONS FOR THE TREATMENT OF METABOLISM DISEASES |
| RU2742352C2 (ru) | 2015-09-24 | 2021-02-05 | Байомарин Фармасьютикал Инк. | Векторы фактора fviii на основе аденоассоциированных вирусов, соответствующие вирусные частицы и содержащие их терапевтические композиции |
| BR112018003665A2 (en) | 2015-09-28 | 2018-09-25 | The University Of North Carolina At Chapel Hill | methods and compositions for antibody evasion viral vectors |
| US11635363B2 (en) | 2015-10-09 | 2023-04-25 | Genzyme Corporation | FLARE (flow cytometry attenuated reporter expression) technology for rapid bulk sorting |
| US10123969B2 (en) | 2015-10-15 | 2018-11-13 | Wisconsin Alumni Research Foundation | Osmotic enhancement of drug/therapeutic delivery to the brain following infusion or injection into the cerebrospinal fluid |
| CA3002980A1 (en) | 2015-10-22 | 2017-04-27 | University Of Massachusetts | Prostate-targeting adeno-associated virus serotype vectors |
| WO2017070525A1 (en) | 2015-10-22 | 2017-04-27 | University Of Massachusetts | Methods and compositions for treating metabolic imbalance in neurodegenerative disease |
| WO2017070476A2 (en) | 2015-10-22 | 2017-04-27 | University Of Florida Research Foundation, Inc. | Synthetic combinatorial aav3 capsid library |
| US20180236105A1 (en) | 2015-10-23 | 2018-08-23 | University Of Iowa Research Foundation | Methods for treating neurodegenerative diseases using gene therapy to delay disease onset and progression while providing cognitive protection |
| HK1257801A1 (zh) | 2015-10-28 | 2019-11-01 | 宾夕法尼亚州大学信托人 | 用於基因治疗的腺伴随病毒载体的鞘内给药 |
| US20180230489A1 (en) | 2015-10-28 | 2018-08-16 | Voyager Therapeutics, Inc. | Regulatable expression using adeno-associated virus (aav) |
| EP3371217B1 (en) | 2015-11-08 | 2025-06-11 | F. Hoffmann-La Roche AG | Methods of screening for multispecific antibodies |
| US10633662B2 (en) | 2015-11-10 | 2020-04-28 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for modulating AAV infection |
| AU2016362317B2 (en) | 2015-12-01 | 2023-03-16 | Spark Therapeutics, Inc. | Scalable methods for producing recombinant Adeno-Associated Viral (AAV) vector in serum-free suspension cell culture system suitable for clinical use |
| WO2017095753A1 (en) | 2015-12-01 | 2017-06-08 | Invivo Therapeutics Corporation | Compositions and methods for preparing an injectable medium for administration into the central nervous system |
| US10406244B2 (en) | 2015-12-02 | 2019-09-10 | The Board Of Trustees Of The Leland Stanford Junior University | AAV vectors with expanded packaging capacity |
| US10385320B2 (en) | 2015-12-02 | 2019-08-20 | The Board Of Trustees Of The Leland Stanford Junior University | Recombinant adeno-associated virus capsids with enhanced human skeletal muscle tropism |
| CN108699135B (zh) | 2015-12-03 | 2022-10-04 | 吉尼松公司 | 用于改善病毒载体效率的组合物和方法 |
| EP3387138B1 (en) | 2015-12-11 | 2022-01-26 | The Trustees Of The University Of Pennsylvania | Scalable purification method for aav9 |
| US11028372B2 (en) | 2015-12-11 | 2021-06-08 | The Trustees Of The University Of Pennsylvania | Scalable purification method for AAVRH10 |
| KR102423442B1 (ko) | 2015-12-11 | 2022-07-20 | 캘리포니아 인스티튜트 오브 테크놀로지 | 아데노-관련 바이러스를 지시하기 위한 타겟팅 펩타이드 |
| US11015173B2 (en) | 2015-12-11 | 2021-05-25 | The Trustees Of The University Of Pennsylvania | Scalable purification method for AAV1 |
| WO2017100676A1 (en) | 2015-12-11 | 2017-06-15 | The Trustees Of The University Of Pennsylvania | Scalable purification method for aav8 |
| EP4659816A3 (en) | 2015-12-14 | 2025-12-31 | The University of North Carolina at Chapel Hill | MODIFIED CAPSID PROTEINS FOR IMPROVED PARVOVIRUS VECTOR DELIVERY |
| US11208630B2 (en) | 2015-12-24 | 2021-12-28 | University Of Florida Research Foundation, Incorporated | AAV production using suspension adapted cells |
| AR108683A1 (es) | 2016-01-13 | 2018-09-19 | Merial Inc | Vectores aav recombinantes que expresan genes osteoprotectores que incluyen has2 y lubricina, de utilidad en el tratamiento de la osteoartritis y afecciones articulares relacionadas en mamíferos |
| JP6924441B2 (ja) | 2016-01-15 | 2021-08-25 | 学校法人自治医科大学 | てんかん治療のためのアデノ随伴ウイルスビリオン |
| WO2017136536A1 (en) | 2016-02-02 | 2017-08-10 | University Of Massachusetts | Method to enhance the efficiency of systemic aav gene delivery to the central nervous system |
| PL3411484T3 (pl) | 2016-02-05 | 2024-02-19 | Emory University | Wstrzykiwanie jednoniciowego lub samokomplementarnego wirusa adenosatelitarnego 9 do płynu mózgowego |
| WO2017139381A1 (en) | 2016-02-08 | 2017-08-17 | University Of Iowa Research Foundation | Methods to produce chimeric adeno-associated virus/bocavirus parvovirus |
| US10179176B2 (en) | 2016-02-16 | 2019-01-15 | The Board Of Trustees Of The Leland Stanford Junior University | Recombinant adeno-associated virus capsids resistant to pre-existing human neutralizing antibodies |
| WO2017147477A1 (en) | 2016-02-26 | 2017-08-31 | University Of Florida Research Foundation, Inc. | Aav heparin mutants that display significantly improved eye and brain transduction |
| WO2017151884A1 (en) | 2016-03-02 | 2017-09-08 | The Children's Hospital Of Philadelphia | Therapy for frontotemporal dementia |
| WO2017152149A1 (en) | 2016-03-03 | 2017-09-08 | University Of Massachusetts | Closed-ended linear duplex dna for non-viral gene transfer |
| CA3198936A1 (en) | 2016-03-07 | 2017-09-14 | University Of Iowa Research Foundation | Aav-mediated expression using a synthetic promoter and enhancer |
| CN116059245A (zh) | 2016-03-23 | 2023-05-05 | 加利福尼亚大学董事会 | 治疗线粒体障碍的方法 |
| WO2017165859A1 (en) | 2016-03-24 | 2017-09-28 | Research Institute At Nationwide Children's Hospital | Modified viral capsid proteins |
| US10899839B2 (en) | 2016-03-28 | 2021-01-26 | Tire Regents of the University of California | Anti-Ryk antibodies and methods of using the same |
| PL3436593T3 (pl) | 2016-03-28 | 2023-03-27 | Ultragenyx Pharmaceutical Inc. | Sposoby inaktywacji termicznej adenowirusów |
| MX2018011928A (es) | 2016-03-30 | 2019-03-28 | Spark Therapeutics Inc | Linea celular para produccion de proteina recombinante y/o vector viral. |
| BR112018070256A2 (pt) | 2016-03-31 | 2019-01-29 | Spark Therapeutics, Inc. | processo de fabricação de raav totalmente escalável à base de colunas |
| WO2017180854A1 (en) | 2016-04-15 | 2017-10-19 | The Trustees Of The University Of Pennsylvania | Novel aav8 mutant capsids and compositions containing same |
| WO2017181162A1 (en) | 2016-04-16 | 2017-10-19 | University Of Florida Research Foundation, Incorporated | Methods of enhancing biological potency of baculovirus system-produced recombinant adeno-associated virus |
| KR20230079511A (ko) | 2016-04-21 | 2023-06-07 | 바이로베크 인코포레이티드 | 곤충 세포에서의 aav 생산, 및 이를 위한 방법 및 조성물 |
| EP3235516B1 (en) | 2016-04-22 | 2019-06-26 | Georg-August-Universität Göttingen Stiftung Öffentlichen Rechts Universitätsmedizin | Regulatable adeno-associated virus (aav) vector |
| EP3449250B1 (en) | 2016-04-28 | 2020-11-04 | Indiana University Research & Technology Corporation | Methods and compositions for resolving components of a virus preparation |
| AU2017261249B2 (en) | 2016-05-03 | 2021-05-06 | Children's Medical Research Institute | Adeno-associated virus polynucleotides, polypeptides and virions |
| WO2017192750A1 (en) | 2016-05-04 | 2017-11-09 | Oregon Health & Science University | Recombinant adeno-associated viral vectors |
| WO2018191450A2 (en) | 2017-04-14 | 2018-10-18 | National Taiwan University Hospital | Gene therapy for aadc deficiency |
| JOP20190269A1 (ar) | 2017-06-15 | 2019-11-20 | Voyager Therapeutics Inc | بولي نوكليوتيدات aadc لعلاج مرض باركنسون |
| SG11202011296VA (en) | 2018-05-15 | 2020-12-30 | Voyager Therapeutics Inc | Compositions and methods for the treatment of parkinson's disease |
-
2017
- 2017-06-16 JO JOP/2019/0269A patent/JOP20190269A1/ar unknown
-
2018
- 2018-06-14 MA MA049402A patent/MA49402A/fr unknown
- 2018-06-14 JP JP2019569267A patent/JP2020527333A/ja active Pending
- 2018-06-14 PE PE2019002526A patent/PE20200494A1/es unknown
- 2018-06-14 CN CN201880052382.9A patent/CN111107879A/zh active Pending
- 2018-06-14 EP EP18816860.3A patent/EP3638315A4/en not_active Withdrawn
- 2018-06-14 MX MX2019014974A patent/MX2019014974A/es unknown
- 2018-06-14 KR KR1020197036981A patent/KR20200018455A/ko not_active Withdrawn
- 2018-06-14 CA CA3065471A patent/CA3065471A1/en not_active Abandoned
- 2018-06-14 SG SG11201912154XA patent/SG11201912154XA/en unknown
- 2018-06-14 AU AU2018284960A patent/AU2018284960B2/en not_active Ceased
- 2018-06-14 WO PCT/US2018/037437 patent/WO2018232055A1/en not_active Ceased
- 2018-06-14 BR BR112019025122-7A patent/BR112019025122A2/pt not_active IP Right Cessation
- 2018-06-15 TW TW107120835A patent/TW201919713A/zh unknown
- 2018-11-08 US US16/184,466 patent/US20190060425A1/en not_active Abandoned
-
2019
- 2019-07-26 US US16/523,567 patent/US11759506B2/en active Active
- 2019-11-21 IL IL270821A patent/IL270821A/en unknown
- 2019-12-05 CO CONC2019/0013707A patent/CO2019013707A2/es unknown
- 2019-12-10 PH PH12019502793A patent/PH12019502793A1/en unknown
- 2019-12-12 CL CL2019003636A patent/CL2019003636A1/es unknown
-
2021
- 2021-04-19 AU AU2021202378A patent/AU2021202378A1/en not_active Abandoned
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11975056B2 (en) | 2014-11-05 | 2024-05-07 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
| US10898585B2 (en) | 2017-04-14 | 2021-01-26 | Ptc Therapeutics .Inc. | Gene therapy for AADC deficiency |
| US12409235B2 (en) | 2017-04-14 | 2025-09-09 | National Taiwan University | Gene therapy for AADC deficiency |
| US11865188B2 (en) | 2017-04-14 | 2024-01-09 | National Taiwan University | Gene therapy for AADC deficiency |
| US11759506B2 (en) | 2017-06-15 | 2023-09-19 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
| US12077783B2 (en) | 2017-12-19 | 2024-09-03 | Akouos, Inc. | AAV-mediated delivery of antibodies to the inner ear |
| US12275960B2 (en) | 2017-12-19 | 2025-04-15 | Akouos, Inc. | AAV-mediated delivery of therapeutic antibodies to the inner ear |
| US12319929B2 (en) | 2018-05-15 | 2025-06-03 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of Parkinson's disease |
| US20230075314A1 (en) * | 2019-04-29 | 2023-03-09 | Voyager Therapeutics, Inc. | VECTORIZED ANTIBODIES (vAb) AND USES THEREOF |
| WO2020223231A1 (en) * | 2019-04-29 | 2020-11-05 | The Trustees Of The University Of Pennsylvania | Novel aav capsids and compositions containing same |
| US12516352B2 (en) | 2019-04-29 | 2026-01-06 | The Trustees Of The University Of Pennsylvania | AAV capsids and compositions containing same |
| US12516351B2 (en) | 2019-04-29 | 2026-01-06 | The Trustees Of The University Of Pennsylvania | AAV capsids and compositions containing same |
| US20230050187A1 (en) * | 2019-12-12 | 2023-02-16 | Meiragtx Uk Ii Limited | Methods for Treating Parkinson's Disease |
| CN115135347A (zh) * | 2019-12-12 | 2022-09-30 | 梅里特斯英国第二有限公司 | 治疗帕金森病的方法 |
| US12577586B2 (en) | 2020-05-05 | 2026-03-17 | Duke University | Cross-species compatible adeno-associated virus compositions and methods of use thereof |
| TWI910162B (zh) * | 2020-05-05 | 2026-01-01 | 美國公爵大學 | 跨物種相容腺相關病毒組合物及其使用方法 |
| US12365726B2 (en) | 2020-12-01 | 2025-07-22 | Akouos, Inc. | Anti-VEGF antibody constructs |
| US12109223B2 (en) | 2020-12-03 | 2024-10-08 | Battelle Memorial Institute | Polymer nanoparticle and DNA nanostructure compositions and methods for non-viral delivery |
| US12433910B2 (en) | 2020-12-03 | 2025-10-07 | Battelle Memorial Institute | Polymer nanoparticle and DNA nanostructure compositions and methods for non-viral delivery |
| US12031128B2 (en) | 2021-04-07 | 2024-07-09 | Battelle Memorial Institute | Rapid design, build, test, and learn technologies for identifying and using non-viral carriers |
| US12458606B2 (en) | 2023-09-29 | 2025-11-04 | Battelle Memorial Institute | Polymer nanoparticle compositions for in vivo expression of polypeptides |
| US12441996B2 (en) | 2023-12-08 | 2025-10-14 | Battelle Memorial Institute | Use of DNA origami nanostructures for molecular information based data storage systems |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111107879A (zh) | 2020-05-05 |
| AU2018284960B2 (en) | 2021-01-21 |
| KR20200018455A (ko) | 2020-02-19 |
| MX2019014974A (es) | 2020-03-24 |
| CA3065471A1 (en) | 2018-12-20 |
| JOP20190269A1 (ar) | 2019-11-20 |
| BR112019025122A2 (pt) | 2020-07-28 |
| EP3638315A4 (en) | 2021-02-24 |
| WO2018232055A1 (en) | 2018-12-20 |
| JP2020527333A (ja) | 2020-09-10 |
| US20190343937A1 (en) | 2019-11-14 |
| PH12019502793A1 (en) | 2020-09-21 |
| IL270821A (en) | 2020-01-30 |
| CL2019003636A1 (es) | 2020-06-12 |
| TW201919713A (zh) | 2019-06-01 |
| MA49402A (fr) | 2020-04-22 |
| AU2018284960A1 (en) | 2020-01-16 |
| EP3638315A1 (en) | 2020-04-22 |
| SG11201912154XA (en) | 2020-01-30 |
| PE20200494A1 (es) | 2020-03-04 |
| CO2019013707A2 (es) | 2020-04-01 |
| US11759506B2 (en) | 2023-09-19 |
| AU2021202378A1 (en) | 2021-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11759506B2 (en) | AADC polynucleotides for the treatment of Parkinson's disease | |
| US11975056B2 (en) | AADC polynucleotides for the treatment of Parkinson's disease | |
| US12305189B2 (en) | Compositions and methods for delivery of AAV | |
| US12319929B2 (en) | Compositions and methods for the treatment of Parkinson's disease | |
| US20210371470A1 (en) | Compositions and methods for delivery of aav | |
| US20190054158A1 (en) | Compositions and methods for the treatment of aadc deficiency | |
| WO2021007382A1 (en) | Compositions and methods for the treatment of parkinson's disease | |
| HK40050637A (en) | Compositions and methods for delivery of aav |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: VOYAGER THERAPEUTICS, INC., MASSACHUSETTS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SCHEEL, MARIA;RAVINA, BERNARD;SIGNING DATES FROM 20180717 TO 20180909;REEL/FRAME:047486/0224 |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS |
|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO PAY ISSUE FEE |
|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO PAY ISSUE FEE |