WO2002070719A2 - Regulatable gene expression system - Google Patents

Abstract

An improved tet-repressible system is described in which the transgene is expressed under the control of a promoter which is activated upon binding of a fusion protein composed of a reverse tet repressor/activation domain to tet operator sequences located immediately upstream of a transgene promoter. The tet operator sequences are substantially free of interferon inducible response elements (ISRE). The reverse tet represor is fused to an activation domain which lacks signals for protein clearance, thus expression of the fusion protein. Suitably, the tetO sequences are immediately upstream of a quiet promoter.

Description

REGULATABLE GENE EXPRESSION SYSTEM

This invention was funded, in part, by the National Institutes of Health, NHLBI Grant Number P01 HL59407. The US government may have certain rights in this application.

Background of the Invention This invention relates generally to regulatory elements which control the expression of a gene, and, particularly to regulatable elements which are useful in gene delivery vectors and production of such gene delivery vectors. There are a number of situations in which the control of the expression of individual genes is desirable. Most suitably, such systems mediate not only "on/off, but also permit regulation of the levels of expression.

Prior attempts to control gene activity have included the use of inducible promoters which are responsive to, for example, heavy metal ions, heat shock, or hormones. However, such systems have suffered from leakiness of the inactive state or from pleiotropic effects caused by the inducing agents themselves.

Others have described the use of a control system based on regulatory elements of the Tn O-specified tetracycline-resistance operon of E. coli, in which transcription of resistance-mediating genes is negatively regulated by the tetracycline repressor (tetR). In the presence of the antibiotic tetracycline tetR does not bind to its operators located within the promoter region of the operon and allows transcription. By combining tetR with the C-terminal domain of NP16 from herpes simplex virus (HSN), known to be essential for the transcription of immediate early viral genes, a hybrid transactivator was generated that stimulates minimal promoters fused to tetracycline operator (tetO) sequences. These promoters are virtually silent in the presence of low concentrations of tetracycline, which prevents the tetracycline- controlled transactivator (tTA) from binding to tetO sequences. See, M. Gossen and H. Bujard, Proc. Natl. Acad. Set USA, 89:5547-5551 (June 1992). However, this system has been found to be somewhat unpredictable when used in patients. What is needed is a system which provides predictable "on/off regulation of gene expression and regulation of expression levels.

Summary of the Invention The inventors have recognized that the tetracycline-regulatable system described in the prior art for use in eukaryotic cells does not provide satisfactory regulation of on/off and expression levels in patients under certain circumstances, e.g., where the patient has increased levels of interferon. Advantageously, the inventors provide herewith a number of modifications to the prior art tetracyline-regulatable system which provide better regulatory control of transgene expression. In one aspect, the invention provides an expression vector composed of tetracycline resistance operator sequences and a transgene. The tet operator sequences are substantially free of interferon inducible response elements and assist in regulation of expression of the transgene product.

In another aspect, the invention provides a transactivating vector in which an activation domain is fused in frame to a tetracycline (tet) repressor sequence, where expression of the tet repressor/activating domain fusion protein is under the control of an RSN LTR or tissue-specific promoter. In the absence of a tetracycline family antibiotic, the transactivating vector binds the tet operator sequences of the regulatable expression vector, and functions as an enhancer for the expression of the transgene. In another aspect, the invention provides a transactivating vector in which the activation domain lacks an enzymatic clearance signal. In one particularly desirable embodiment, the activation domain is the p65 activation domain from ΝF-κβ.

In still another aspect, the invention provides a pharmaceutical composition containing a pharmaceutically acceptable carrier and a regulatable expression cassette of the invention.

In a further aspect, the invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a transactivating vector of the invention. In still a further aspect, the invention provides a method of regulating expression of a selected transgene by providing a host cell containing a regulatable expression vector of the invention and a transactivating vector of the invention. In the presence of tetracycline, expression of the transgene is minimized or eliminated. In the absence of tetracycline, expression of transgene is activated.

In yet a further aspect, the invention provides a host cell containing the expression vector, the transactivating vector, or both.

Still other aspects and advantages of the invention will be readily apparent from the detailed description of the invention.

Detailed Description of the Invention

According to the present invention, transgene expression may be regulated by culturing or providing a cell with an expression vector containing the transgene under the control of a transactivating-dependent promoter, including tet operator (tetO) sequences which are free of interfering ISRE sequences, and transactivating sequences carrying the tet repressor (tetR). In the presence of tetracycline, binding of the tet repressor (tetR) to operator sequences is minimized or inhibited, in a manner which is dependent upon the concentration levels of tetracycline. The regulatable expression vector carrying the transgene and/or the transactivating sequences may be provided in trans, or, alternatively, one or both of these may be provided by a stable host cell. Optionally, a stable host cell may contain more than one desired transgene under the control of the regulatable system described herein.

As used herein, the term "tetracycline" is used interchangeably with "tetracycline-family antibiotic". One of skill in the art will readily understand that any suitable member of the tetracycline family of antibiotics, or any other compound which functions in a manner similar to tetracycline to inhibit the binding of the fusion protein containing the tetR to the tetO may be used for the purposes described herein. In one particularly desirable embodiment, the compound used is the antibiotic doxycycline. Other desirable embodiments include other compounds with high affinity binding to the rtTA or TA, and a good pharmacology, e.g., minimal toxicity.

I. Regulatable Expression Vector

In one embodiment, the invention provides a nucleic acid molecule carrying a selected transgene under the control of a transactivating-dependent promoter. This nucleic acid molecule is a vector which is capable of delivering the transgene to a selected host cell. Such a vector can be in the form of any genetic element, e.g., naked DNA, a plasmid, phage, transposon, episome, cosmid, virus, etc. which transfer the sequences carried thereon. The selected vector may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. The methods used to construct this, or any, embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Harbor Press, Cold

Spring Harbor, NY; G. Barony & R. B. Merrifield, THE PEPTIDES: ANALYSIS, SYNTHESIS & BIOLOGY, Academic Press, pp. 3 - 285 (1989)]. When this vector is delivered in trans, viral vectors are particularly desirable. Suitable viral vectors include, retroviruses, lentiviruses, adeno-associated viruses, and adenoviruses. When the vector is provided by a stable host cell, it may be more desirable for the vector to be in the form of an integrated or non-integrated plasmid. However, one of skill in the art can readily select other suitable vectors. This invention is not limited by the selection of the vector.

A. Transactivating-dependent promoter The vector of the invention contains a transgene which is expressed under the control of a promoter which is activated by a transactivating sequence, as described below. Such a promoter contains tet operator (tetO) sequences immediately upstream of minimal promoter sequences. Optionally, the tetO sequences can be located elsewhere in the construct, taking into consideration such factors as the desired activation or repression domain fused to the tetR or reverse TetR. For example, using an activator of the acidic protein class, e.g., VP16 or p65AD or NFκ-β, the transactivator can function at a distance from the TATA box. [See, e.g., Cress and Trigenberg, Science, 251:87-90 (1990); Ballard et al, Proc. Natl. Acad. Set, 89: 1875-1879 (1992); Seipel et al, EMBO J, 11:4961-4968 (1992); Taneka , Proc. Natl. Acad. Set USA, 93: 4311-4315 (1996); Das et al, Nature, 374: 657-660 (1995); Blau J. et al, Mol. Cell. Biol, 16:2044-2055 (1996).] Other suitable activators can be readily selected. In contrast to the prior art, which describes tetO sequences which are associated with multiple (about 7) copies of interferon inducible response elements (ISRE) upstream of the promoter and transgene, the tetO sequences of the invention (and the expression vector of the invention) are free of functioning ISRE sequences. Thus, in contrast to prior art constructs, the presence of interferon does not interfere with the regulation of transgene transcription. 1. Tet Operon Sequences

Thus, the vector of the invention contains sufficient tetracycline resistance operator sequences to bind to the tetR or reverse tetR (rtetR) sequences described below. In one embodiment, the tetO sequences include at least one copy of the O-l and O-2 sequences of the tetO. These sequences lack the site for binding the tet rep or the reverse tet rep proteins. In another embodiment, the vector contains multiple copies of these sequence in tandem arrangement, e.g., one copy of the O-l and O-2 sequences, followed by another copy of the O-l and O-2 sequences. In one desirable embodiment, the vector contains three tandem copies of the O-l arid O-2 sequences in tandem. However, one of skill in the art can readily generate a vector containing more than three copies of these tetO sequences. For a discussion of the tet operator sequences, see, e.g., I. Kaffenberger, J Biol. Chem., 257:6805-6813 (1982); W. Hillen et al, J Mol. Biol, 172:185-201 (1984); G. Klock et al, J Bacteriology, 161:326-332 (1985); C. Kleinschmidt et al, Biochem., 27: 1094-1104 (1988), and more recently, P. Orth et al, Nature Struct. Biol., 7:215-219 (2000)].

In one particularly desirable embodiment, the tet operator sequences are: SEQ ID NO: 1 : ACTCCCTATCAGTGATAGAGA. Most suitably, these sequences may be generated using conventional chemical synthesis techniques

[Barony & Merrifield, cited above]. However, one of skill in the art may obtain these sequences using any suitable technique, e.g., polymerase chain reaction, recombinant DNA technology, or other genetic engineering techniques. Further, suitable technique are known which permit modification of these sequences as needed or desired. For example, point mutations may be desired in order to improve expression in the selected vector and/or host system. 2. Promoter

Suitably, the vector of the invention contains a promoter located upstream of the transgene and immediately downstream of the operon sequences. In a particularly desirable embodiment, the vector contains a quiet promoter upstream of the transgene. As used herein, a "quiet" promoter is a promoter to has no or minimal instrinsic detectable transcription activity. The presence or absence of detectable transcription activity can be readily determined by one of ordinary skill in the art using a conventional transient transcription assay, such as that described by G.P. Gao et al, J Virol., 70:8934-8943 (1996)]. Examples of such "quiet" promoter sequences include the TATA box of the adeno virus Elb promoter and that of the human interleukin-2 promoter.

However, where desired, other suitable promoters may be selected for use in the vector of the invention. In certain embodiments, high-level constitutive promoters may be desired. Examples of such promoters include, without limitation, the retroviral Rous sarcoma virus (RSN) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530 (1985)], the SN40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the β-active promoter linked to the enhancer derived from the cytomegalovirus (CMN) immediate early (IE) promoter, the phosphoglycerol kinase (PGK) promoter, and the EFlα promoter [Invitrogen]. Inducible promoters are regulated by exogenously supplied compounds, including, the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system [WO 98/10088]; the ecdysone insect promoter [No et al, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)], the tetracycline-repressible system [Gossen et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)], the tetracycline-inducible system [Gossen et al, Science, 268:1766-1769 (1995); see also Harvey et al, Curr. Opin. Chem. Biol, 2:512-518 (1998)], the RU486-inducible system [Wang et al, Nat. Biotech., 15:239-243 (1997) and Wang et al, Gene Ther., 4:432-441 (1997)] and the rapamycin-inducible system [Magari et al, J Clin. Invest., 100:2865-2872 (1997)]. Other types of inducible promoters which may be useful in this invention are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only.

In another embodiment, the native promoter for the transgene will be used. The native promoter may be preferred when it is desired that expression of the gene should mimic the native expression. The native promoter may be used when expression of the gene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to specific transcriptional stimuli. In a further embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression. In another embodiment, the transgene product or other desirable product to be expressed is operably linked to a tissue-specific promoter. For instance, if expression in skeletal muscle is desired, a promoter active in muscle should be used. These include the promoters from genes encoding skeletal α-actin, myosin light chain 2A, dystrophin, muscle creatine kinase, as well as synthetic muscle promoters with activities higher than naturally-occurring promoters [see Li et al., Nat. Biotech, 17:241-245 (1999)]. Examples of promoters that are tissue-specific are known for liver [albumin, Miyatake et al. J Virol, 71:5124-32 (1997); hepatitis B virus core promoter, Sandig et al, Gene Ther., 3:1002-9 (1996); and alpha-fetoprotein (AFP), Arbuthnot et al, Hum. Gene Ther, 7:1503-14 (1996)], bone [osteocalcin, Stein et al, Mol. Biol. Rep., 24:185-96 (1997); and bone sialoprotein, Chen et al, J Bone Miner. Res., 11:654-64 (1996)], lymphocytes [CD2, Hansal et al., J Immunol, 161:1063-8 (1998); immunoglobulin heavy chain; T cell receptor α chain], neuronal [neuron-specific enolase (NSE) promoter, Andersen et al. Cell. Mol. Neurobiol, 13:503-15 (1993); neurofilament light-chain gene, Piccioli et al, Proc. Natl. Acad.

Sci. USA, 88:5611-5 (1991); and the neuron-specific vgf gene, Piccioli et al, Neuron_^ 15:373-84 (1995)]; among others. B. Introns

In one desirable embodiment, the vector of the invention further contains an intron, desirably located between the promoter/enhancer sequence and the transgene. Suitably, the intron is a nucleic acid molecule which does not express any products, and which is about 25 bp to about 250 bp, more preferably about 50 bp to 200 bp, and most preferably, about 75 bp to about 150 bp in length. In one desirable embodiment, the intron is about 100 bp in length and is derived from human α globin [Invitrogen, derived from plasmid pCI]. One possible intron sequence is also derived from SV-40, and is referred to as the SV-40 T intron sequence. Alternatively, the intron may be a chemical compound or other moiety which provides a spacing function similar to that provided by the nucleic acid molecule. In other embodiments, the introns intrinsic to the selected gene may be utilized. C. Other Vector Elements

In addition to the elements described above, the transgene-carrying vector of the invention also contains other expression control sequences such as transcription initiation, termination and enliancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance protein processing and/or secretion. A great number of expression control sequences ~ native, constitutive, inducible and/or tissue-specific ~ are lαiown in the art and may be utilized to drive expression of the gene, depending upon the type of expression desired. For eukaryotic cells, expression control sequences typically include a promoter, an enhancer, such as one derived from an immunoglobulin gene, SN40, cytomegalovirus, etc., and a polyadenylation sequence which may include splice donor and acceptor sites. The polyadenylation sequence generally is inserted following the transgene sequences and before the 3' end of the vector sequence. In one embodiment, the bovine growth hormone polyA used. Another element that may be used in the vector is an internal ribosome entry site (IRES). An IRES sequence, or other suitable systems as are discussed above, may be used to produce more than one polypeptide from a single gene transcript. An IRES (or other suitable sequence) is used to produce a protein that contains more than one polypeptide chain or to express two different proteins from or within the same cell.

Another suitable sequence includes the woodchuck hepatitis virus post- transcriptional element [See, e.g., J.E. Loeb et al, Hum Gene Ther., 10(14):2295-2305 (Sep. 20, 1999); R. Zufferey et al, J. Virol, 73(4):2886-2892 (1999)], which may be used to enhance transgene expression.

Additional sequences which may be desirable include insulator sequences, which serve to stabilize the function of the sequences in the constructs described herein. A variety of insulator sequences are well known and may be readily selected. See, e.g., DS Steinwaerder and A. Lieber, Gene Ther., 7(7):556-567 (Apr 2000); S. Rivella et al., J Virol, 74(10):4679-4687 (May 2000); T. Inoue et al, J Hum Genet, 44(3):152-162 (1999); and T. Νeff et al., Stem Cells, 15 Suppl 1:265- 271 (1997).

Selection of these and other common vector and regulatory elements are conventional and many such sequences are available [see, e.g., Sambrook et al, and references cited therein at, for example, pages 3.18-3.26 and 16.17-16.27 and Ausubel et al., Current Protocols in Molecular Biology. John Wiley & Sons, New York, 1989].

After following one of the methods for packaging the transgene and regulatory elements taught in this specification, or as taught in the art, one may infect suitable cells in vitro or in vivo. The number of copies of the transgene in the cell may be monitored by Southern blotting or quantitative polymerase chain reaction (PCR). The level of RNA expression may be monitored by Northern blotting or quantitative reverse transcriptase (RT)-PCR. The level of protein expression may be monitored by Western blotting, immunohistochemistry, ELISA, RIA, or tests of the transgene' s encoded product's biological activity. Thus, one may easily assay whether a particular expression control sequence is suitable for a specific transgene, and choose the expression control sequence most appropriate for expression of the desired transgene. Suitable methods for detecting the presence of other heterologous molecules delivered via the vector of the invention are lαiown to those of skill in the art and are not a limitation of the present invention. D. Transgene

As used herein, the transgene is a nucleic acid sequence, heterologous to the vector sequences, which encodes a polypeptide, protein, enzyme, transcript, or other product, of interest. The transgene is operatively linked to the regulatory elements described herein in a manner which permits transgene transcription. "Operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. The composition of the transgene sequence will depend upon the use to which the vector will be put. One type of transgene encodes a product useful in production of a vector which will be used for gene delivery. For example, it may be desirable for the transgene sequences to encode rep proteins and/or adenoviral helper functions (e.g., adenovirus E4 ORF6, El a, Elb or E2a) in a cell used for packaging adeno-associated viral vectors.

Another type of transgene sequence includes a reporter sequence, which upon expression produces a detectable signal. Such reporter sequences include without limitation, DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane bound proteins including, for example, CD2, CD4, CD8, the influenza hemagglutinin protein, and others well lαiown in the art, to which high affinity antibodies directed thereto exist or can be produced by conventional means, and fusion proteins comprising a membrane bound protein appropriately fused to an antigen tag domain from, among others, hemagglutinin or Myc. These sequences, when associated with regulatory elements which drive their expression, provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescent activating cell sorting assays and immunological assays, including enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and immunohistochemistry. For example, where the marker sequence is the LacZ gene, the presence of virus is detected by assays for beta-galactosidase activity. Where the transgene is luciferase, the virus may be measured by light production in a luminometer.

However, desirably, the transgene is a non-marker sequence encoding a product which is useful in biology and medicine, such as proteins, peptides, anti-sense nucleic acids (e.g., RNAs), enzymes, or catalytic RNAs. The transgene may be used to correct or ameliorate gene deficiencies, which may include deficiencies in which normal genes are expressed at less than normal levels or deficiencies in which the functional gene product is not expressed. A preferred type of transgene sequence encodes a therapeutic protein or polypeptide which is expressed in a host cell. The invention further includes using multiple transgenes, e.g., to correct or ameliorate a gene defect caused by a multi-subunit protein. In certain situations, a different transgene may be used to encode each subunit of a protein, or to encode different peptides or proteins. This is desirable when the size of the DNA encoding the protein subunit is large, e.g., for an immunoglobulin, the platelet-derived growth factor, or a dystrophin protein. In order for the cell to produce the multi-subunit protein, a cell is infected with the recombinant virus containing each of the different subunits. In another embodiment, different subunits of a protein may be encoded by the same transgene. In this case, a single transgene includes the DNA encoding each of the subunits, with the DNA for each subunit separated by an internal ribozyme entry site (IRES). This is desirable when the size of the DNA encoding each of the subunits is small, e.g., total of the DNA encoding the subunits and the IRES is less than five kilobases. Alternatively, other methods which do not require the use of an IRES may be used for co-expression of proteins. Such other methods may involve the use of a second internal promoter, an alternative splice signal, a co- or post-translational proteolytic cleavage strategy, among others which are known to those of skill in the art.

However, the selected transgene may encode any product desirable for study. The selection of the transgene sequence is not a limitation of this invention.

Other useful products encoded by the transgene include hormones and growth and differentiation factors including, without limitation, insulin, glucagon, growth hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (NEGF), angiopoietins, angiostatin, granulocyte colony stimulating factor (GCSF), erythropoietin (EPO), connective tissue growth factor (CTGF), basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), transforming growth factor α (TGFα), platelet-derived growth factor (PDGF), insulin growth factors I and II (IGF-I and IGF-II), any one of the transforming growth factor β superfamily, including TGF β, activins, inhibins, or any of the bone morphogenic proteins (BMPs) 1-15, any one of the heregluin/neuregulin/ARIA/neu differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins NT-3 and NT-4/5, ciliary neurotrophic factor (CNTF), glial cell line derived neurotrophic factor (GDNF), neurturin, agrin, any one of the family of semaphorins/collapsins, netrin-1 and netrin-2, hepatocyte growth factor (HGF), ephrins, noggin, sonic hedgehog and tyrosine hydroxylase. Other useful transgene products include proteins that regulate the immune system including, without limitation, cytokines and lymphokines such as thrombopoietin (TPO), interleukins (IL) IL-1 tlirough IL-17, monocyte chemoattractant protein, leukemia inhibitory factor, granulocyte-macrophage colony stimulating factor, Fas ligand, tumor necrosis factors α and β, interferons α, β, and γ, stem cell factor, flk-2/flt3 ligand. Gene products produced by the immune system are also useful in the invention. These include, without limitations, immunoglobulins IgG, IgM, IgA, IgD and IgE, chimeric immunoglobulins, humanized antibodies, single chain antibodies, T cell receptors, chimeric T cell receptors, single chain T cell receptors, class I and class II MHC molecules, as well as engineered immunoglobulins and MHC molecules. Useful gene products also include complement regulatory proteins such as complement regulatory proteins, membrane cofactor protein (MCP), decay accelerating factor (DAF), CR1, CF2 and CD59.

Still other useful gene products include any one of the receptors for the hormones, growth factors, cytokines, lymphokines, regulatory proteins and immune system proteins. The invention encompasses receptors for cholesterol regulation, including the low density lipoprotein (LDL) receptor, high density lipoprotein (HDL) receptor, the very low density lipoprotein (VLDL) receptor, and the scavenger receptor. The transgene also encompasses genes encoding products such as members of the steroid hormone receptor superfamily including glucocorticoid receptors and estrogen receptors, Vitamin D receptors and other nuclear receptors. In addition, useful gene products include transcription factors such as un, fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin, ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C/EBP, SP1, CCAAT-box binding proteins, interferon regulation factor (IRF-1), Wilms tumor protein, ETS-binding protein, STAT, GATA-box binding proteins, e.g., GATA-3, and the forkhead family of winged helix proteins.

Other useful gene products include, carbamoyl synthetase I, ornithine transcarbamylase, arginosuccinate synthetase, arginosuccinate lyase, arginase, fumarylacetacetate hydrolase, phenylalanine hydroxylase, alpha- 1 antitrypsin, glucose- 6-phosphatase, porphobilinogen deaminase, factor NIII, factor IX, cystathione beta- synthase, branched chain ketoacid decarboxylase, albumin, isovaleryl-coA dehydrogenase, propionyl CoA carboxylase, methyl malonyl CoA mutase, glutaryl CoA dehydrogenase, insulin, beta-glucosidase, pyruvate carboxylate, hepatic phosphorylase, phosphorylase kinase, glycine decarboxylase, H-protein, T-protein, a cystic fibrosis transmembrane regulator (CFTR) sequence, and a dystrophin cDΝA sequence.

Other useful gene products include, non-naturally occurring polypeptides, such as chimeric or hybrid polypeptides having a non-naturally occurring amino acid sequence containing insertions, deletions or amino acid substitutions. For example, single-chain engineered immunoglobulins could be useful in certain immunocompromised patients. Other types of non-naturally occurring gene sequences include antisense molecules and catalytic nucleic acids, such as ribozymes, which could be used to reduce overexpression of a gene. Other suitable transgenes may be readily selected by one of skill in the art.

Currently, for therapeutic use, the transgene is selected from among growth hormone and interferons, for which regulatable expression is particularly desired. However, the selection of the transgene is not considered to be a limitation of this invention.

Making use of the vector elements described herein, one of skill in the art can readily generate an expression vector which is activated by transactivating sequences. Desirably, the transgene-carrying regulatable expression vector contains tetO sequences which are substantially free of ISRE sequences. Most suitably, the vector contains a quiet promoter such as the Elb tata promoter immediately downstream of the operator sequences, an intron, and the transgene sequences.

II. Transactivating Sequences In another embodiment, the invention provides transactivating sequences which contain an activation domain fused in frame to a tetracycline repressor (tetR) sequence or a reverse tetR sequence (xTetR). In these transactivating sequences, expression of the tetR/activating fusion protein or rtetR/activating domain fusion protein is under the control of regulatory elements which control expression of the fusion protein in a host cell. In one desirable embodiment, the invention may utilize the rtetR sequences. Alternatively, the invention may utilize tetR sequences. In this embodiment, when a tetracycline family antibiotic is not present, the transactivating sequences bind the tetO sequences of the expression vector and function as an enhancer for the expression of the transgene. Conversely, in the presence of a tetracycline family antibiotic, the protein no longer binds to the tetO sequence and expression is terminated.

A. Tet Repressor Sequences

The tet repressor (tetR) sequences can be derived from any suitable gram negative bacteria using lαiown techniques [See, e.g., M. Gossen and H. Bujard, Proc Natl Acad. Sci. USA, 89:3547-3551 (1992)]. E. coli is a particularly convenient source of tetR sequences. The tetR sequences of one E. coli strain is provided in K. Postle et al, Nucl. Acids Res., 12:4849-4863 (1984). Optionally, these tetR sequences, as well as tetR sequences obtained from other sources may be modified and/or mutated for convenience, or as needed or desired. One such modification has been described which provides the reverse tetR sequences [M. Gossen et al, Science, 268:1768-1769 (1995]. Alternatively, the tetR or modified tetR sequences (e.g., the rtetR sequences) useful in the invention may be generated using chemical synthesis or other suitable techniques. The source of these sequences and the method by which they are obtained are not limitations of the present invention. In order to function in the regulatable expression system of the invention, the tetR or reverse tetR (rtetR) sequences are fused in frame to a suitable activation domain. For convenience throughout this application, reference is made to the rtetR sequences. However, it will be understood that constructs could be made using modifications thereof or tetR sequences or modifications thereof.

B. Activation Domain

In a preferred embodiment, the activation domain lacks sequences which are signals for enzymatic degradation. In one embodiment, the activation domain is derived from an activation domain from a protein in which the ubiquitous signal is located outside of the activation domain. In certain embodiments, it may be particularly desirable to select an activation domain from a human source. However, the invention is not so limited. As one example, the activation domain is derived from the p65 activation domain from NF-κβ [M. Schmitz et al, J Biol Chem. , 269:25613-25620 (1994)]. Advantageously, this activation domain avoids the disadvantage of the tet repressible system described in the prior art, which utilizes the NP16 of HSN, which contains a signal for ubiquitin clearance of the protein. Thus, expression levels of the fusion protein of the invention remains at detectable levels for a longer period of time.

However, in certain embodiments, it may be desirable to utilize other activation domains such as the VP16 of HSV, which contain degradation signals.

C. Other Vector Elements

Suitably, the fusion protein formed of the rtetR/activation domain is expressed under the control of suitable regulatory elements. Such expression control elements include promoters, enhancers, and other suitable elements such as are discussed above in connection with transgene expression. In one particularly preferred embodiment, this fusion protein is expressed from the RSV LTR promoter or from a tissue-specific promoter. For instance, it may be desirable to use a promoter active in muscle. Such promoters may be obtained from genes encoding skeletal α-actin, myosin light chain 2A, dystrophin, muscle creatine kinase, as well as synthetic muscle promoters with activities higher than naturally-occurring promoters [see Li et al., Nat. Biotech, 17:241-245 (1999)]. Examples of promoters that are tissue-specific are lαiown for liver [albumin, Miyatake et al. J Virol, 71:5124-32 (1997); hepatitis B virus core promoter, Sandig et al, Gene Ther., 3:1002-9 (1996); alpha-fetoprotein (AFP), Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996); thyroid binding globulin promoter linked to two copies of the αj-mimoglobulin/bikunin enhancer, C. Ill et al, Blood Coagul Fibronolysis, 2:S23-30 (1997) ], neuronal [neuron-specific enolase (ΝSE) promoter, Andersen et al. Cell Mol. Neurobiol, 13:503-15 (1993); neurofilament light-chain gene, Piccioli et al., Proc. Natl Acad. Sci. USA, 88:5611-5 (1991); the neuron-specific vgf gene, Piccioli et al, Neuron, 15:373-84 (1995)]; and the retinal-specific interphotoreceptor retinoid-binding protein gene [Y. Fei et al, J Biochem., 125:1189-1199 (1999)], among others.

Further, a preferred embodiment of the invention utilizes an intron between the promoter and the fusion protein which aids in protein expression. One particularly desirable intron is a β-globin fused to a heavy chain immunoglobulin (Ig), which is about 120 bp in length (Invitrogen). Also desirable for use in the transactivating vector of the invention are a bovine growth hormone polyA, and the woodchuck hepatitis virus post-transcriptional element. However, other suitable regulatory elements may be readily selected from among the promoters, enhancers, introns, poly A, and other elements described above in connection with transgene expression control sequences.

Suitably, the rtetR/transactivating sequences may be engineered onto any suitable vector (e.g., plasmid) and delivered to a host cell by any suitable means, such as described herein. In one embodiment, the rtetR/transactivating sequences are supplied to the host cell on a viral vector separately from the vector (e.g., rAAV) carrying the transgene. In another embodiment, rtetR/transactivating sequences are supplied to the host cell on the same vector which carries the transgene. Typically such vectors are those which are capable of carrying large inserts, e.g., retroviruses, rAd vectors, or plasmids. However, other vectors may be utilized. III. Regulation by Tetracycline

In one embodiment, the invention provides a method of regulating expression of a selected transgene by delivering to a host cell a regulatable expression vector as described herein and a transactivating vector. In the absence of tetracycline (or a tetracycline family antibiotic), the tet repressor/activation domain fusion protein binds to the tetO sequences and activates expression of the transgene. However, in the presence of tetracycline, binding of the fusion protein to the tetO sequences is inhibited in a manner which is dependent upon the concentration of the tetracycline. More particularly, partial inactivation of the transactivating sequences is achieved with tetracycline concentrations of about 0.0001 μg/ml to about 1 μg/ml. Within these ranges, regulation of expression can be achieved, in that a stepwise reduction of the tetracycline concentration increases transgene expression. Thus, if low levels of transgene expression are desired, one may adjust tetracycline concentrations to about 0.05 μg/ml; whereas if higher levels of transgene expression are desired, one may adjust tetracycline concentrations to about 0.005 μg/ml or lower. More complete inactivation is achieved with tetracycline concentrations of about 0.05 μg/ml to 1 μg/ml, and about 0.1 to about 0.5 μg/ml, or higher. Depending upon the selected member of the tetracycline family, the desired concentration may be adjusted. For example, one particularly desirable antibiotic for use in this method is doxycycline.

When transgene expression is regulated in vivo, tetracycline (or another member of its family) may be administered to the human or non-human mammalian patient by any suitable route, including oral, intravenous, intramuscular, or the like. Currently, oral administration is preferred. However, the experiments described below utilize intravenous delivery. The invention is not limited to the formulation of tetracycline or route of delivery. Suitable doses of tetracycline or a related member of the tetracycline family, corresponding to the concentrations identified above, may be readily determined by one of skill in the art taking into consideration such factors as route of delivery, bioavailability, the member of the tetracycline family utilized, and the weight of the patient. Generally, suitable oral doses of doxycycline are in the range of about 1 μg to about 1000 mg, and more preferably, about 1 mg to about 500 mg, and most preferably, about 50 mg to about 250 mg for an 80 kg mammal. However, other suitable doses are readily selected by one of skill in the art.

IV. Regulatable Transgene Expression

The vector constructs of the invention are useful for transgene expression in vitro, ex vivo, and in vivo.

For in vitro production, a desired protein may be obtained from a desired culture following transfection or infection of host cells with an expression vector containing the transgene encoding the desired product, transfection or infection with the transactivating vector and culturing the cell culture under conditions which permit expression. The expressed protein may then be purified and isolated, as desired. Suitable techniques for transfection, cell culturing, purification, and isolation are lαiown to those of skill in the art. The host cell itself may be selected from any biological organism, including prokaryotic (e.g., bacterial) cells, and eukaryotic cells, including, insect cells, yeast cells and mammalian cells. Particularly desirable host cells are selected from among any mammalian species, including, without limitation, cells such as A549, WEHI, 3T3, 10T1/2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO, WI38, HeLa, 293 cells (which express functional adenoviral El), Saos, C2C12, L cells, HT1080, Chinese Hamster Ovary (CHO) cells, HepG2 and primary fibroblast, hepatocyte and myoblast cells derived from mammals including human, monkey, mouse, rat, rabbit, and hamster. The selection of the species providing the cells is not a limitation of this invention; nor is the type of cell, i.e., fibroblast, hepatocyte, tumor cell, etc.

Optionally, the host cell may stably carry an expression vector and/or the transactivating vector. For example, a host cell may carry a tTA-dependent expression vector of the invention which carries rep and/or cap, or helper functions for use in packaging rAAV vectors. Alternatively, other suitable stable host cells may utilize the regulatable expression system of the invention. In one suitable embodiment, the ratio of expression vector to transactivating sequences is in the range of from 1 :100 to 100:1, 1 :20 to 20:1, 1:10 to 10:1, or from 1 :1 expression vector to transactivating sequences. However, one of skill in the art may readily determine the optimal ratio of the expression vector to transactivating sequences, taking into consideration such factors as the biology of the gene under regulation, the character and stability of the transactivators in the particular cell or tissue, and the vector system used. Alternatively, both the expression cassette and transactivating cassette described herein could be provided as a single linear sequence, which is generated using methods lαiown in the art.

For ex vivo therapies, the expression vector and transactivating sequences are mixed with cells obtained from the patient, the host cells are contacted with the vectors of the invention, cultured using conventional methodologies, and the transduced cells are re-infused into the patient. The ratio of expression vector to transactivating sequences is within the ranges described above.

Alternatively, the expression vector and transactivating vector, preferably suspended in a physiologically compatible carrier, may be administered (alone or separately) to a human or non-human mammalian patient. Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the expression vector and/or transactivating vector is directed. For example, one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline). Other aqueous and non-aqueous isotonic sterile injection solutions and aqueous and non-aqueous sterile suspensions known to be pharmaceutically acceptable carriers and well known to those of skill in the art may be employed for this purpose. Still other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The selection of the carrier is not a limitation of the present invention. Optionally, the compositions of the invention may contain, in addition to the vector(s) of the invention and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

The vectors are administered in sufficient amounts to provide sufficient levels of gene transfer and expression to provide a therapeutic benefit without undue adverse effects, or with medically acceptable physiological effects, which can be determined by those skilled in the medical aits. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the liver, intranasal, intravenous, intramuscular, subcutaneous, intradermal, oral and other parental routes of administration. Routes of administration may be combined, if desired. Dosages of the expression vector will depend primarily on factors such as the condition being treated, the age, weight and health of the patient, and may thus vary among patients. For example, therapeutically effective human doses of a viral expression and/or transactivating vector are generally in the range of from about 1 ml to 100 ml, 5 to 50 ml, or 10 to 25 ml of saline solution containing concentrations of from about 1 x 10⁹ to 1 x 10¹⁶ genomes/ml, preferably about 10¹³ to 10¹⁵ genomes/ml virus vector. A preferred adult mammalian dosage (e.g., about 80 kg in weight) may be about 1 x 10¹³ AAV genomes/ml. A preferred adult mammalian dosage may be about lxlO¹⁰ to about lxlO¹¹ Ad genomes/ml. Suitable doses of other vectors may be readily determined. The dosage will be adjusted to balance the therapeutic benefit against any side effects. Such dosages may vary depending upon the therapeutic application for which the vector is employed. The levels of expression of the transgene can be monitored to determine the frequency of dosage of viral vectors. Optionally, dosage regimens similar to those described for therapeutic purposes may be utilized for immunization using the compositions of the invention.

Typically, doses of the transactivating vector will be roughly equivalent to those for the expression vector. However, the doses may be adjusted such that the ratio of tetO to tetR sequences is about 1:1, taking into consideration such factors as the use of different vectors carrying the transactivating sequences versus the expression sequences, the promoters used, and the concentrations of tetracycline (or other member of the tetracycline family) to be delivered. However, this ratio and the doses may be adjusted as needed or required, taking into consideration the factors defined herein and those lαiown in the art.

The following examples are provided to preparation of the tet regulatable system of the invention, as well as uses therefor, and do not limit the scope thereof. One skilled in the art will appreciate that although specific components, reagents and conditions are outlined in the following examples, modifications can be made which are meant to be encompassed by the spirit and scope of the invention.

Example 1 - Tet-regulated transgene expression in murine models for gene therapy using adenovirus-based vectors

In over a dozen of liver and muscle-directed murine experiments, recombinant adeno virus carrying transgenes under the control of the tetracycline regulatable promoter were evaluated for their responses to doxycycline induction, vector dose responses, timing of the induction, repeatability of the induction, and tightness of the promoter. The experiments were divided into two groups: (a) growth hormone (GH) expression regulated by Tet-On system and (b) mouse Epo expression regulated by Tet-On system. The outcome of these experiments demonstrated that the system worked very well in both target tissues and induction peaks were sharper than the Z12/Rap system. The system was quite silent in the absence of Dox but folds of induction were not as high as the Z12/Rap. In addition, induction of transgene expression in liver was at least 10 fold higher than that in muscle.

A. Vector construction^ pAdCMVTet-On shuttle plasmid was construct by isolating the CMVTet-On minigene from pTet-On (Clontech) and subcloning it into pAdLinkl between Ad map units 1 and 9 where adeno virus El genes were deleted. Plasmid AdCMVTet-On shuttle plasmid was co-transfected with Cla I restricted H5.010CMVEGFP (El, E3-deleted) into 293 cells. H5.010CMVTet-On recombinant adenovirus was generated through homologous recombination in 293 cells and isolated by green/white selection [Davis et al, 1998, Gene Therapy, 5(8) : 1148- 1152 (1998)] This recombinant adenovirus contains Ad type 5 map units 0-1 and 9 - 16, a CMV promoter, and a reverse transactivating sequence fused in frame to the p65 activation domain of NF-κβ.

To create recombinant adenovirus vectors for murine Epo (H.OlOTREmEpo), H5.01 OTRErhGHc and H5.010TRErhGHg, a intermediate construct pAdTRElink was first constructed by isolating the TRE-SV40 polyA transcriptional cassette from pTRE (Clontech) and subcloning it into pAdlink. pAdTRErhEpo, pAdTRErhGHc and pAdTRErhGHg were generated by subcloning of rhesus mouse Epo cDNA, rhesus monkey growth hormone cDNA and genomic sequence into pAdTRElink respectively. H5.01 OTRErhEpo, H5.01 OTRErhGHc and H5.010TRErhGHg recombinant viruses were obtained through the same procedure described above. The resulting recombinant adeno viruses contain the following tet operator sequences which are free of ISRE sequences: SEQ ID NO: 1 : ACTCCCTATCAGTGATAGAGA, the adenovirus Elb tata box promoter, an approximately 100 base pair intron (human α-globin), the transgene sequence (i.e., rhEPO, rhGHc, or rhGHg) a woodchuck post-regulatory element (WPRE) and a bovine growth hormone polyA, in an adenovirus backbone deleted in El and E3.

B. In vivo studies 1. H5.010CMVTet-On andH5.010TREmEpo mediated gene transfer to liver and muscle tissues of immune deficient mice.

To study dose responses of the vectors in mouse liver, two vectors were administered to mouse liver by tail vein injections (100 μg per injection) at lxl 0^U (high dose), 6x10¹⁰ (medium dose) and 3xl0¹⁰ (low dose) viral particles of each vector per animal (W-231 studies) The studies utilized NCR nude mice (5 per group, two vehicle controls). Epo expression was induced with Doxycycline (Dox,

120 mg/kg), delivered intravenously at several time points post vector perfusion.

Blood samples were taken for analysis of serum Epo concentrations and hematocrit. For muscle directed Epo gene transfer, high dose is at 5xl0¹⁰ and low dose is at

1.5xl0¹⁰ viral particles of each vector per mouse (Rag-1). Dox induction and sampling were carried out as described above.

In studies utilizing mouse Epo (W-231), the data clearly shows a sharp spike in epo expression levels within days following doxycycline induction and corresponding increases in hemocrit percentage. Following the second dose of doxycycline, hemocrit percentages increased significantly in animal receiving tetOn, in a dose-dependent manner.

2. H5.01 OCMVTet-On, H5.01 OTRErhGHg and H5.01 OTRErhGHc mediated gene transfer to liver and muscle tissues of immune deficient mice. (W150 study). In NCR nude mice (5 experimental and 2 control) which were dosed with doxycycline (120 mg/kg) at day 29, day 78 and day 108 following delivery of the hGH and Ad.tet-On vectors to the liver (1 x 10ⁿ viral particles each) by the routes described in part 1 above, levels of plasma hGH appeared more than 2 fold higher than plasma hGH levels measured following the second and third doses of doxycycline. However, the error base indicates that these peak values are not statistically different.

(W149 study): NCR mice (5 experimental, 2 control) which were dosed with doxycycline (120 mg/kg) at day 2, day 10, day 29, day 78 and day 108 following delivery of the hGH and Ad.tet-On vectors (5 x 10¹⁰ particles of each vector) to the muscle as described in part 1. Induction of hGH expression was observed by a sharp increase in plasma hGH levels immediately following dosing with doxycycline. The highest increase was observed following dosing at day 2, with the lowest increase at day 12, likely due to how closely this dose following the earlier dose. Higher hGH expression levels were observed when dosing was more than 25 days elapsed between induction with doxycycline.

(W164 study): In NCR mice (22, including 2 vehicle control, 5 animals per group) which were dosed with doxycycline (120 mg/kg) at day 14, day 42 and day 72 following delivery of the hGH-G and Ad.Tet-On adenoviral vectors to the muscle as described in Example IBl, plasma hGH levels were detected immediately following induction. Highest levels of plasma hGH-G were detected in the animals which were delivered high levels of TetOn, although those receiving low levels of hGH-G were significantly higher than the animals receiving no AdTet-On plasmid.

Example 2 - Tet-regulated Ervtl ropoietin Expression in Rhesus Monkeys using Recombinant Adeno-associated Viral Vectors A. Vector Construction pAdCMVTet-On shuttle plasmid was constructed as described in Example 1. The CMVTet-On sequence was ligated into psub201 [R.J. Samulski et al, J. Virol, 61(10):3096-3101 (Oct. 1987)] that was deleted of non-structural and structural AAV genes. This vector, pAAVCMVTet-On, was co-transfected with pTrans plasmid into 293 cells. The 293 cells were infected with rAd helper virus to generate AAV. CMVTet-On.

The AAV2.TRErhesus epo was made according the methods described for H5.010TREGHg described above, with the exception that the rhesus epo cDNA was inserted between the tet O7 sequences and an SV40 late polyA signal. This DNA sequence was flanked by a plasmid containing the AAV ITRs. These viruses were isolated by CsCl gradients. B. In vivo study

(99-23) To study dose responses of the vectors in monkey muscle, two vectors were administered to two rhesus monkeys by intramuscular injection at 7.5 x 10¹² viral particles of each AAV2.CMVtet-On and AA V2.TRErhesusEpo per animal. 97E005 is a two year old female weighing 2.4 kg; 97E027 is also a two year old female, weighting 2.55 kg. Epo expression was induced with 4 mg/kg of Doxycycline (Dox), administered intravenously, at several time points post- vector perfusion including day 28, 46, 70 (only to 97E027), 88 (only to 97E027), 95 (only to 97E005), 116, 151, 195 and 243. Blood samples were taken for analysis of serum Epo concentrations and hematocrit.

These data demonstrate that therapeutic levels of epo were detectable in serum levels within days following each induction with doxycycline.

All publications cited in this specification are incoiporated herein by reference. While the invention has been described with reference to a particularly preferred embodiment, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.

Claims

What is claimed is:

1. An expression vector comprising:

(a) tetracycline resistance operator sequences, wherein said sequences are substantially free of interferon inducible response elements; and

(b) a transgene, wherein expression of the transgene product is regulated by activation of the tetracycline operator sequences.

2. The expression vector according to claim 1, wherein the tetracycline operator sequence comprises one or more operator sequences.

3. The expression vector according to claim 1 or claim 2, wherein said transgene is selected from among growth hormone and interferons.

4. The expression vector according to any of claims 1 to 3, further comprising a quiet promoter upstream of the transgene.

5. The expression vector according to claim 4, wherein the quiet promoter is an adenovirus Elb tata promoter.

6. The expression vector according to claim 1, further comprising an intron downstream of the promoter.

7. The expression vector according to claim 6, wherein the intron comprises about 50 to about 250 bps.

8. The expression vector according to any of claims 1 to 7, wherein the vector is a recombinant virus.

9. The expression vector according to claim 8, wherein the recombinant virus is selected from the group consisting of an adenovirus and an adeno-associated virus.

10. The expression vector according to claim 1 , wherein the vector is a plasmid.

11. A transactivating vector, said vector comprising:

(a) a promoter selected from among RSV LTR and tissue-specific promoters;

(b) an activation domain fused in frame to a reverse tetracycline repressor (rtetR)sequence, wherein expression of the rtetR activating domain fusion protein is under the control of said promoter; and

(c) a poly A domain; wherein in the absence of a tetracycline family antibiotic, the vector binds the tet operator sequences of a regulatable expression vector, and functions as an enhancer for the expression of the transgene.

12. The transactivating vector according to claim 11, wherein said activation domain is the p65 activation domain from NF-κβ.

13. The transactivating vector according to claim 11 or claim 12, wherein said poly A is a bovine growth hormone polyA.

14. The transactivating vector according to any of claims 11 to 13, wherein said vector further comprises woodchuck hepatitis virus post-transcriptional element.

15. A transactivating vector, said vector comprising an activation domain fused in frame to a reverse tetracycline (tet) repressor sequence, wherein said activation domain lacks an enzymatic clearance signal.

16. The transactivating vector according to claim 15, wherein said activation domain is the p65 activation domain from NF-κβ.

17. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a regulatable expression cassette according to claim 1.

18. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a transactivating vector according to claim 11 or claim 15.

19. A method of regulating expression of a selected transgene, said method comprising the step of:

(a) delivering to a host cell a regulatable expression cassette according to claim 1 ;

(b) delivering to the host cell a transactivating vector according to claim 11 or claim 15; and

(c) contacting the host cell with a tetracycline family antibiotic to the host cell, wherein in the presence of doxycycline, binding of the reverse tet repressor to the tet operator sequences of the expression cassette is inhibited and expression of the transgene product is inhibited.

20. The method according to claim 19, wherein the antibiotic is doxycycline.

21. The method according to claim 19 or claim 20, wherein the antibiotic is delivered by a route selected from among oral, intramuscular and intravenous routes.

22. The method according to any of claims 19 to 21, wherein the level of expression of said transgene is regulated by the dose of antibiotic delivered to the patient.

23. Use of a regulatable expression cassette according to claim 1 in preparation of a medicament.

24. Use of a transactivating vector according to claim 11 or claim 15 in preparing a medicament.