WO2009134681A2

WO2009134681A2 - Aav7 viral vectors for targeted delivery of rpe cells

Info

Publication number: WO2009134681A2
Application number: PCT/US2009/041606
Authority: WO
Inventors: James M. Wilson; Luc H. Vandenberghe; Jean Bennett; Karen Kozarsky; Peter Ertl
Original assignee: The Trustees Of The University Of Pennsylvania; Smithkline Beecham Corporation
Priority date: 2008-04-30
Filing date: 2009-04-24
Publication date: 2009-11-05
Also published as: WO2009134681A3

Abstract

A method for specifically targeting a gene product to a retinal pigment epithelial cell is provided, along with adeno-associated viruses (AAVs) useful therein. The method involves delivering to a subject's eye a dose of about 10⁹ genome copies of an AAV7 viral vector and a minigene comprising sequences encoding the gene product targeted to the RPE cells. A synthetic RPE gene 65 is also described. Suitably, this synthetic RPE gene is under the control of regulatory control sequences which direct expression of the RPE65 protein in RPE cells and is delivered via the AAV7 viral vector.

Description

AAV7 VIRAL VECTORS FOR TARGETED DELIVERY TO RPE CELLS

BACKGROUND OF THE INVENTION

The invention relates generally to the use of recombinant viruses to deliver a desired transgene to the eye of subjects suffering from ocular disorders.

Leber congenital amaurosis (LCA) is a severe childhood-onset blinding disease which can be caused by mutations in the retinal pigment epithelium (RPE)-specific gene, RPE65. LCA causes near total blindness from an early stage in life.

Mutations in the gene encoding an RPE protein, RPE65, are among the molecular causes of LCA. RPE65 is an evolutionarily-conserved 65kDa membrane-associated protein [Redmond, T. & Hamel, C. 2000 Meth. En∑ymol 317: 705-724 and Bavik, C. et al, 1992 J. Biol Chem. 267: 23035-23042], which is important in retinoid metabolism (Saari, J. 2000 Invest Ophthalmol Vis 5c/ 41 : 337-348; Ma_: J.-X. et al, 1998 J Biol Chem 1443: 255-261 ; and Simon, A. et al, 1995 J Biol Chem 270: 1107-1112). A mouse model for RPE65 deficiency has been described. [Redmond, T., et al.1998 Nat.

Genet 20: 344-351 and Van Hooser, J.P., et al 2000 Proc. Natl Acad Sci USA 97: 8623-8628]. A naturally-occurring large animal model of an analogous severe disease of retinal degenerations is the RPE65 mutant dog.

Viral vectors for delivery of the RPE gene have been described for treating ocular disorders. See, e.g., Reichel et al, Opthalmotge, 96: 570-577 (1999), which describes subretinal injection of an adenovirus or adeno-associated viral vector carrying RPE65 gene. The use of adeno-associated virus-2 for delivery of the gene has been described. See, e.g., International Patent Application Publication No. WO 02/082904 and US Published Patent Application No. 2007/077228. There remains a need in the art for effective constructs for targeting retinal pigment epithelium cells.

SUMMARY OF THE INVENTION

The present invention provides a method for specifically targeting a gene product to retinal pigment epithelial cells by delivering to a subject's eye a low dose of an adeno-associated virus (AAV) having an AAV 7 capsid. The present invention is particularly well adapted for delivery of a retinal pigment epithelial (RPE) 65 gene under the control of regulatory control sequences which direct expression of the RPE65 protein in RPE cells. In one embodiment, the invention provides a synthetic RPE65 gene encoding human RPE65, which is termed herein AL65. The synthetic gene has the nucleic acid sequence of SEQ ID NO: 2. Also provided are nucleic acid molecules, vectors, pharmaceutical compositions and host cells containing this synthetic gene.

In another embodiment, the invention provides an AAV7 viral vector containing a minigene comprising a 5' ITR, a promoter, the AL65 gene, a rabbit globin polyadenylation signal, and a 3' ITR.

In still another embodiment, a method for treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells is provided. The method involves administering to said subject an AAV7 AL65 adeno-associated virus (AAV).

Other aspects and advantages of the present invention are described further in the following detailed description of the preferred embodiments thereof.

BRIEF DESCRIPTION OF THE DRAWINGS Figs. IA - ID provide an alignment of the wild-type human RPE65 nucleic acid (middle line, "Org") [SEQ ID NO: 4] and the synthetic RPE65 sequence (AL65) (lower line; "A65") [SEQ ID NO: 2]. The amino acid sequence of human RPE65 (upper line; ORF") is provided, using single letter amino acid code [SEQ ID NO: 3].

Fig. 2 provides a schematic map of a cis plasmid, p73ieAAVssAL65. The nucleotide sequence of this plasmid is provided in SEQ ID NO: 1. p73ieAAVssAL65 carries a minigene comprising a synthetic AAV 5' inverted terminal repeat (ITR) sequences (nt 1243-1372 of SEQ ID NO: 1), an immediate-early CMV promoter (nt 1376-1865 of SEQ ID NO: 1), a synthetic RPE65 coding sequence (nt 1994-3595 of SEQ ID NO: 1) operably linked to the ieCMV promoter and a rabbit globin polyadenylation termination signal (nt 3610-3736 of SEQ ID NO: 1), and a synthetic AAV 3' ITR (nt 3747-3876 of the complement of SEQ ID NO: 1). The plasmid backbone is based on pUC19, and further contains a kanamycin resistance gene (nt 1114 - 299 of the complement of SEQ ID NO: 1 ) to better comply with current accepted good manufacturing practice (GMP). An untranslated exon from the CMV ie promoter is located between the promoter and synthetic RPE65 (nt 1866-1985 of SEQ ID NO: 1) to provide an efficient leader sequence. DETAILED DESCRIPTION OF THE INVENTION

In one embodiment, a method is provided for specifically targeting a molecule to RPE65 cells by delivering the molecule via an AAV vector having an AAW capsid. The inventors have found that at low doses, i.e., about 10⁹ genomes, AAV7 specifically transduces RPE cells, avoiding transduction of other cells of the eye (i.e., photoreceptor cells, ganglion cells and/or optic nerve cells). This result was unexpected in view of findings that at higher doses such as 10¹⁰ genome copies and higher, AAV7's high level of expression in RPE cells was similar to several other AAVs. AAV7's specificity and efficiency at a lower dose provide advantages which are designed to include safety, biodistribution and expression from AAV7 for specific delivery to the RPE cells in the eye.

As used herein, an "AAV7 viral vector" refers to a viral particle having an AAV7 capsid in which a minigene or expression cassette is packaged. An AAV7-based viral vector carrying a minigene may be readily constructed using techniques which are known to those of skill in the art. See, e.g., International Patent Application Publication No. WO 03/042397, filed 22 May 2003, which describes the AAV7 sequences and construction of vectors using the AAV7 capsid. The capsid sequence is also provided in the NIH/GenBank database under accession number NC_006260.1 [GP Gao et al, Proc. Natl Acad. Sci. U.S.A. 99(18), 11854-1 1859 (2002)]. The genomic sequences, with the open reading frames also identified in this publication, with reference to GenBank accession number NC 006260. These sequences are incorporated by reference herein.

In another embodiment, a composition is provided which comprises an AAV7 capsid carrying an RPE65 gene under the control of regulatory control sequences which direct its expression in the host cells. When used herein the RPE65 gene can refer to natural or synthetic genes. In one embodiment, the RPE65 gene encodes the human RPE65 protein [SEQ ID NO: 3]. In a further embodiment, a synthetic RPE65 gene is provided [SEQ ID NO: 2] and is termed herein "AL65 ".

The AL65 sequence is provided in Figs IA - ID, in comparison to the wild-type human sequence, spanning nucleotides nt 1 - 1602 of SEQ ID NO: 4. The AL65 sequences has 76% identity at the nucleotide level to the wild-type human RPE65 sequence. The AL65 nucleic acid sequences further encompass the strand which is complementary to the strand provided in Figs. IA-I D and the Sequence Listing, as well as the RNA corresponding to these sequences. Also included in the nucleic acid sequences of the invention are natural variants and engineered modifications of the sequences of Fig. 1 and the Sequence Listing, and their complementary strands. Such modifications include, for example, labels which are known in the art, methylation, and substitution of one or more of the naturally occurring nucleotides with a degenerate nucleotide.

This AL65 gene was designed to provide efficient expression of the encoded human RPE65 protein [SEQ ID NO: 3] in the target host cells. Amongst other advantages, the synthetic gene lacks at least one restriction enzyme site present in the wild-type human sequence and further lacks undesirable alternative splice sites found in the native human gene. In addition, the AL65 sequence has no out-of-frame initiation codons on the sense strand that may give rise to unexpected and potentially immunogenic proteins. ΛL65 is designed to provide improved expression in human cells as compared to the wild-type human RPE65 gene. The synthetic AL65 is also capable of being produced and of expressing its product [human RPE65, SEQ ID NO: 3] in non-human cells. In another embodiment of the invention the wild-type RPE65 gene is included in the AAV7 viral vectors. The sequence of wild-type human RPE65 is reproduced in SEQ ID NO: 4. Alternatively, one may use a commercially available computer program [e.g., Leto (vl .0.18; Entelechon GmbH Germany), using conventional parameters] or other techniques to alter the wild-type human sequence. In another embodiment, the nucleic acid sequence encoding RPE65 carried by the rAAV vector is the normal, species-matched version of the mutated gene, e.g., wild-type canine RPE65 for the treatment of canine LCA.

In one embodiment, a nucleic acid molecule comprising the AL65 gene operably linked to regulatory control sequences for the gene is described. In one embodiment, the molecule is a ptasmid. Such a plasmid may be used as a production vector. An example of such a plasmid, used as a cis plasmid in a method of preparing an AAV viral vector, is described herein. In another embodiment, the nucleic acid molecule may be another genetic element useful for delivery of the AL65 gene to a host cell. Such a genetic element may include any genetic element (vector) which may be delivered to a host cell, e.g., naked DNA, a plasmid, phage, transposon, cosmid, episome, a protein in a non-viral delivery vehicle (e.g., a lipid-based carrier), virus, etc., which transfers the sequences carried thereon. The selected vector may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. The methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et aϊ, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. AA Vl Viruses And Uses Thereof

Packaged within the AA V7 capsid is a minigene carrying an RPE65 gene. The minigene is composed of, at a minimum, inverted terminal repeat sequences (ITRs) and the RPE-coάmg sequences as described herein which are operably linked to regulatory sequences which direct expression thereof.

In one embodiment, the minigene contains both a 5' ITR and a 3' ITR. An ITR sequence may be from AA V7 or from a different AAV than AAV7, e.g., AAV2. Optionally, the 5' and 3' ITRs are from different AAV sources. Such sources include natural sources from which the ITR is isolated or a synthetic ITR, which is prepared artificially by means of nucleic acid synthesizers, or obtained by mixed techniques (isolation from the genome, then extension by conventional synthesis techniques). For example, illustrated herein is a synthetic 5' ITR has the sequence of nt 1243-1372 of SEQ ID NO: 1. In another example, a synthetic 3' ITR has the sequence of the complement of nt 3876-3747 of SEQ ID NO: 1. Finally, these ITRs can also be modified by any technique known to persons skilled in the art (molecular biology, chemistry, enzymology and the like), with the aim of enhancing their functionality, of reducing their size, of increasing their stability after integration or their integration specificity and the like. In particular, they can be modified by mutation, deletion and/or addition of base pairs, according to conventional molecular biology techniques. In one embodiment, a single AAV ITR is used to induce the integration of the heterologous sequence. In this embodiment, the ITR may be located downstream or upstream of the ΛP£-coding sequence. In another embodiment, the minigene contains the AP£-coding sequence bordered (directly or indirectly) by AAV ITRs. Thus, the minigene may contain 2 ITRs: one 5' ITR (located at the left end), and one 3' ITR (located at the right end).

The minigene is packaged into an AAV7 capsid and delivered to a selected host cell according to known methods.

In addition to the RPE coding sequences and the at least minimal ITR sequence, the minigene and/or the vector also include other regulatory control elements necessary which are operably linked to the transgene in a manner which permits its transcription, translation and/or expression in a cell transfected with the plasmid vector or transduced with the virus produced by the invention. As used herein, "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency {i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. An example of a sequence that can enhance translation efficiency is a Kozak consensus sequence. A modified Kozak sequence has been described in, e.g., US Patent No. 6,365,403 and in J. Bennicelli etal, MoI. Ther., 16(3):458-465 (March 2008, e-pub Jan 2008), which is incorporated by reference herein. A great number of expression control sequences, including promoters which are native, constitutive, inducible and/or tissue-specific, are known in the art and may be utilized.

Examples of constitutive promoters which may be included in the rAAV7.RPE65 of this invention include, without limitation, a chicken β-actin (CB) promoter, a RSV LTR promoter/enhancer, an SV40 promoter, a CMV promoter, a dihydrofolate reductase promoter, a phosphoglycerol kinase (PGK) promoter, a composite CMV-immediate early (IE) enhancer/CB promoter, a human RPE65 promoter, and a human vitelliform macular dystrophy 2 (VMD2) promoter.

In another embodiment, a VMD2 promoter - intron construct was prepared (I-VMD2), which shows improved expression as compared to the VMD2 promoter without the intron. A VMD2 + intron promoter has been previously described in the literature, Esumi et al, JCB, 279(18): 19064 -19073 (April 30, 2004). However, the I-VMD2 promoter described herein differs from the published promoter in that it includes the octamer promotor element which starts at -600 (this contrasts with the publication which starts with -585), with respect to the sequence of Fig IB in Esumi et ai, cited above, and incorporated by reference herein. On the 3¹ end, the region which goes all the way past the first intron was amplified. The primers used: VMD fwd:catatgcagaattctgtcattttactaggg [SEQ ID NO: 5] and VMD+intron rev: ggccaggcagtgggctgc [SEQ ID NO: 6].

In one embodiment, the CMV promoter is a human CMV promoter. In another embodiment, the CMV promoter is an immediate-early CMV promoter (CMV-ie). Λ/Ε-specific promoters include, for example, the RPE65 promoter, the tissue inhibitor of metalloproteinase 3 (Timp3) promoter, and the tyrosinase promoter. Still other ΛP£-specific promoters are known to those of skill in the art. See, e.g., the promoters described in International Patent Application Publication No. WO 00/15822.

Alternatively, an inducible promoter is employed to express the transgene product, so as to control the amount and timing of the ocular cell's production thereof. Such promoters can be useful if the gene product proves to be toxic to the cell upon excessive accumulation. Inducible promoters include those known in the art and those discussed above including, without limitation, the zinc-inducible sheep metallothionine (MT) promoter; the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter; the T7 promoter; the ecdysone insect promoter; the tetracyc line-repress ible system; the tetracycline-inducible system; the RU486-inducible system; and the rapamycin-inducible system. In other embodiments, any type of inducible promoter which is tightly regulated may be utilized. In one embodiment, a regulated promoter is specific for the particular target ocular cell type used. Still other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, in replication cells only, or by a drug or other molecule which can be delivered to the cell. Selection of these and other common vector and regulatory elements are conventional and many such sequences are available. See, e.g., Sambrook et ah, and references cited therein at, for example, pages 3.18-3.26 and 16.17-16.27 and Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989). Of course, not all vectors and expression control sequences will function equally well to express an RPE gene of this invention. However, one of skill in the art may make a selection among these expression control sequences without departing from the scope of this invention. Suitable promoter/enhancer sequences may be selected by one of skill in the art using the guidance provided by this application. Such selection is a routine matter and is not a limitation of the molecule or construct. For instance, one may select one or more expression control sequences, operably link the sequence to a RPE gene, and insert the minigene comprising the expression control sequence and the RPE gene into an AAV7 vector. The vector may be packaged into an infectious particle or virion following one of the methods for packaging the rAAV taught in the art. Such infectious particles may include so-called double-stranded (ds) AAV₃ self-complementary (sc) AAV, and single-stranded (ss) AAV. Methods for designing cis-plasmids to preferentially produce a scAAV or ssAAV, including, e.g., modification of the 5' ITR sequence, are known in the art. Other methods of improving safety, e.g., via the use of a long stuffer sequences in the cis-plasmid to minimize reverse packaging from the AAV ITRs, have also been described. See, e.g., J. Bennicelli et al, cited above.

In one embodiment, AAV7 vector encoding a RPE65 gene product contains a minigene comprising a 5' ITR, a synthetic RPE65 gene encoding human RPE65 under the control of regulatory sequences which direct expression thereof, and a 3' ITR. In one embodiment, the synthetic 5' and/or 3' ITRs described above are included in the vector. Additionally, a rabbit globin polyadenylation signal is included in the vector.

In still another embodiment, an AAV7 vector contains a minigene comprising AAV ITRs as described herein and a heterologous molecule other than RPE65, for which specific targeting to the RPE cells is desired. Particularly suitable heterologous molecules include those which encode products useful for treating ocular disorders including, e.g., macular degeneration. Examples of suitable products include anti-angiogenesis agents. Examples of such products include, e.g., inhibitors of vascular endothelial growth factor (VEGF), inhibitors of platelet derived growth factor, pigment epithelium-derived factor (PEDF), angiostatin, endostatin, dominant-negative FIk-I mutant receptor, human VEGF-Al 65/bFGF, VEGF Trap,

Ranibizumab, soluble platelet factor 4, soluble FIt-I receptor, thrombospondin-1, and the like. Inhibitors of VEGF or PEGF, as described herein may include antisense sequences, anti-VEGF antibodies, domain antibodies (dAB) [see, e.g., WO 2007/087673], or antibody fragments, anti- PEGF antibodies, or antibody fragments. Such an AA V7 vector can include the other vector elements described above and can be prepared using techniques described herein and known in the art.

Delivery to RPE Cells and Treatment of RP E65- Associated Conditions A method for treating an ocular disorder by specifically targeting the RPE65 cells via AAV7-mediated delivery using a low dose of the AA V7 vector is provided. In one embodiment, the ocular disorder is characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject. In another embodiment, the ocular disorder is treated, or its symptoms are ameliorated, by expression of a desired gene product in the RPE cells.

In one embodiment, a method comprises the step of administering to said subject an AAV7 carrying a heterologous gene for treatment of an ocular disorder. In another embodiment, a method comprises the step of administering to said subject an AAV7 carrying an RPE65 gene. In another embodiment, a method comprises delivering a vector comprising an AL65 gene as described herein to a subject. The above-described rAAV7 vectors and AL65-caττy\ng vectors may be delivered to the eye as previously described. In further embodiments, the methods described herein comprise administration of therapeutically effective amounts of the vector.

In one embodiment, use of an adeno-associated virus (AAV) described herein in preparing a medicament. In a further embodiment, the medicament is useful in treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject is provided. In another embodiment, use of an adeno-associated virus (AAV) described herein in treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject is provided.

In yet another embodiment, use of a dose of about 10⁹ genome copies of an adeno- associated virus (AAV), comprising an AA V7 capsid and a minigene comprising the sequences encoding a gene product for delivery to a retinal pigment epithelial (RPE) cell operably linked to regulatory sequences which direct expression thereof, in preparing a medicament useful in delivering a gene product specifically targeted to a RPE cell to the eye of a subject is provided. In another embodiment, use of a dose of about 10⁹ genome copies of an adeno-assodated virus (AAV), comprising an AAV7 capsid and a minigene comprising the sequences encoding a gene product for delivery to a retinal pigment epithelial (RPE) cell operably linked to regulatory sequences which direct expression thereof, in delivering a gene product specifically targeted to a RPE cell to the eye of a subject is provided.

In still another embodiment, use of a pharmaceutical composition described herein in preparing a medicament useful in treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject is provided. In another embodiment, use of a pharmaceutical composition described herein in treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject is provided.

In one embodiment, the subject is injected subretinally in the affected eye(s). However, in other embodiments, other routes of administration are selected, including those described below.

The vectors, suspended in a physiologically compatible carrier, may be administered to a human or non-human mammalian patient via injection. Suitable carriers may be readily selected by one of skill in the art, e.g., for delivery to the eye. For example, one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The selection of the carrier is not a limitation of the present invention.

In further embodiments, the compositions of the invention may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate. the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. The viral vectors are administered in sufficient amounts to transfect the cells and to provide sufficient levels of gene transfer and expression to provide a therapeutic benefit without undue adverse effects, or with medically acceptable physiological effects, which can be determined by those skilled in the medical arts. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the eyes (e.g., intraretinal injection), via eye drop, or other suitable delivery routes. Routes of administration may be combined, if desired. Optionally, a vector as described herein is formulated with a surfactant, e.g., to prevent sticking to the delivery device. Such a surfactant may be in addition to the selected carrier. Dosages of the AAV7 viral vector will depend primarily on factors such as the condition being treated, the age, weight and health of the patient, and may thus vary among patients. For example, a therapeutically effective human dosage of the viral vector is generally in the range of from about 0.5 μL to about 1 mL of solution containing concentrations of from about 1 x 10⁷ to 1 x 10¹¹ genome copies of the virus vector, and desirably, about 10⁹ genomes or lower. The dosage may be adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed. The levels of expression of the transgene can be monitored to determine the frequency of dosage. Optionally, dosage regimens similar to those described for therapeutic purposes may be utilized for immunization or vaccine purposes using the compositions of the invention. In other embodiments, kits are provided for administration of a combination of a vector or composition described herein to the eye, for example, for the purpose of treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject. In one embodiment, the kit comprises two or more pharmaceutical compositions, at least one of which contains a vector or pharmaceutical composition containing the vector as described herein, and may conveniently be combined in the form of a kit suitable for co-administration. In a further embodiment, the second composition comprises a physiologically acceptable carrier or diluent, such as those described above. Thus the kit of the invention comprises two or more separate pharmaceutical compositions, at least one of which contains a vector described herein, and means for separately retaining said compositions, such as containers or a divided bottle. In one embodiment, the kit comprises a syringe and needle, eye dropper, or other suitable delivery means. To assist the treating physician, in one embodiment the kit comprises directions for administration.

The following examples are illustrative only and do not limit the invention. EXAMPLE 1 - LEAD AAV SEROTYPE DETERMINATION FOR GENE TRANSFER TO THE RPE AND INNER NEURAL RETINA

In addition to AAV2, twenty-six (26) AAV capsids were compared with AA V2 in C57B1/6 mice following delivery in the subretinal space for their ability to target the inner neural retina and/or the retinal pigment epithelium (RPE). The CMV.eGFP transduced retinas were followed up by ophthalmoscopy and fundus photography and subsequently examined histologically. A scoring method for cell type specificity and morphometric analysis for efficiency of transduction by fluorescent intensity were used. A hierarchy of vectors for the various retinal cell types was prepared.

Among these AAV7, AA V9, rh.8R and rh64.1 transduced the mouse RPE most efficiently. Several vectors including AAV7, AAV8, hu.l l , hu.44R3 and rh.8R demonstrated significant eGFP expression in photoreceptors. Surprisingly, a vector based on a novel Clade C isolate, hu. 1 1, efficiently transduced cells throughout the neural retinal from other plexiform layer through the ganglion cell layer. From these murine experiments, those vectors that performed best in the RPE were evaluated in the cynomolgus macaque eye at doses of 10⁹ and 10¹⁰ genome copies (GC) and compared to non-human primate (NHP) data with AA V2 and AAV8 previously presented by this laboratory. Although all vectors transduced the RPE equally efficiently, remarkable differences in vector tropisms were noted. Overall, at the higher dose of 10ⁱ⁰ GC, dramatically more substantial photoreceptor transduction was observed as in the non-human primate model. For all vectors, the relative area of photoreceptor versus RPE expression at this dose was equivalent. At 10⁹ GC, AAV8 still demonstrated efficient photoreceptor targeting while other vectors did less so with AA V9 demonstrating a pattern of almost exclusive RPE transduction. AAV7 demonstrated increased specificity for the RPE in comparison to AAV8 by approximately 10-fold; at a dose of 10⁹ GC, photoreceptors were transduced at a level of less than 1% of level of RPE transduction. All in-life diagnostics indicated that the treatment was well tolerated and no evidence for immune reaction toward capsid or transgene product was noted throughout the study as monitored by IFN-γ ELlSPOT and histological examination.

EXAMPLE 2 - CONSTRUCTION OF VECTOR CARRYING SYNTHETIC RPE65 GENE, AL65

A. Cloning of cis plasmid

Fig. 2 provides a schematic map of a cis plasmid, p73ieAAVssAL65. The nucleotide sequence of this plasmid is provided in SEQ ID NO: 1. p73 ieAAVssAL65 carries a minigene comprising a synthetic AAV 5' inverted terminal repeat (ITR) sequences (nt 1243- 1372 of SEQ ID NO: 1), an immediate-early CMV promoter, (nt 1376-1865 of SEQ ID NO: 1), a synthetic RPR 65 coding sequence (nt 1994-3595 of SEQ ID NO: 1) operably linked to the ieCMV promoter and a rabbit globin polyadenylation termination signal (nt 3610-3736 of SEQ ID NO: 1), and a synthetic AAV 3' ITR (nt 3876-3747 of the complement of SEQ ID NO: 1). The plasmid backbone is based on pUC19, and further contains a kanamycin resistance gene (nt 1 1 14 - 299 of the complement of SEQ ID NO: 1) to comply with current accepted good manufacturing practice (GMP). An exon is located between the promoter and synthetic RPE65 (nt 1866-1985 of SEQ ID NO: 1). B. Cloning of trans plasmid

To construct the chimeric trans-plasmid for production of recombinant pseudotyped AAV7 vectors, p5El 8 plasmid (Xiao et ah, 1999, J. Virol 73:3994-4003) is partially digested with Xho I to linearize the plasmid at the Xho I site at the position of 3169 bp only. The Xho I cut ends are then filled in and ligated back. This modified p5E18 plasmid is restricted with Xba I and Xho I in a complete digestion to remove the AA V2 cap gene sequence and replaced with a 2267 bp Spe 1/Xho I fragment containing the AA V7 cap gene which is isolated from pCRAAW 6-5+15-4 plasmid.

The resulting plasmid contains the AA V2 rep sequences for Rep78/68 under the control of the AA V2 P5 promoter, and the AA V2 rep sequences for Rep52/40 under the control of the AAV2 P19 promoter. The AAV7 capsid sequences are under the control of the AA V2 P40 promoter, which is located within the Rep sequences. This plasmid further contains a spacer 5' of the rep ORF.

C. Production ofrAAV7.AL65

The rAAV particles (AA V2 vector in AAV7 capsid) are generated using an adenovirus-free method. Briefly, the cis plasmid constructed as described above and the trans plasmid pCRAAV7 6-5+15-4 (containing the AAV2 rep and AAV7 cap) and a helper plasmid, respectively, are simultaneously co-transfected into 293 cells in a ratio of 1 : 1 :2 by calcium phosphate precipitation as described in WO 03/042397.

All publications listed in this specification are incorporated herein by reference. While the invention has been described with reference to a particularly preferred embodiments, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such modifications are intended to be encompassed by this specification and the following claims.

Claims

CLAIMS:

1. An adeno-associated virus (AAV) having an AAV7 capsid and a minigene comprising a heterologous nucleic acid sequence encoding a retinal pigment epithelial (RPE) 65 protein under the control of a regulatory control sequences which direct expression of the RPE65 protein in RPE cells.

2. The AAV according to claim 1, wherein the regulatory control sequences comprise a promoter selected from the group consisting of a human CMV promoter, a chicken β-actin promoter, a RSV LTR promoter/enhancer, an SV40 promoter, a dihydrofolate reductase promoter, a phosphoglycerol kinase promoter, a composite CMV-immediate early (IE) enhancer/CB promoter, a human RPE65 promoter, and a human vitelliform macular dystrophy 2 (VMD2) promoter.

3. The AAV according to claim 2, wherein the promoter comprises the VMD2 promoter comprises the VMD2 octamer promotor element and intron 1.

4. The AAV according to claim 1 , wherein the nucleic acid sequence encoding the RPE65 is a synthetic RPE65 sequence having the sequence of SEQ ID NO: 2.

5. The AAV according to claim 1, wherein the minigene comprises at least one inverted terminal repeat sequence (ITR) from AA V2.

6. The AAV according to claim 1, wherein the minigene comprises a synthetic 5' ITR having a sequence of nt 1243 tol372 of SEQ ID NO: 1.

7. The AAV according to claim 1 , wherein the minigene comprises a synthetic 3' ITR having a sequence of the complement of nt 3876 to 3747 of SEQ ID NO: 1.

8. The AAV according to any one of claims 1 to 7, wherein the minigene comprises: a 5' ITR; a synthetic RPE65 gene encoding human RPE65; a rabbit globin polyadenylation signal; and a 3' ITR.

9. The AAV according to any one of claims 1 or 4 to 8, wherein the regulatory control element comprises an RPE-specific promoter.

10. The AAV according to claim 9, wherein the RPE-specific promoter is selected from the group consisting of the tissue inhibitor of metal loproteinase 3 (Timp3) promoter, the RPE65 promoter, and the tyrosinase promoter.

1 1. A pharmaceutical composition comprising an AAV according to any of claims 1 to 10 and a physiologically compatible carrier.

12. The composition according to claim 11 , wherein the composition is formulated for injection into the eye.

13. A synthetic RPE65 gene encoding human RPE65, said synthetic gene having the nucleic acid sequence of SEQ ID NO: 2.

14. A synthetic nucleic acid sequence selected from the group consisting of the DNA strand complementary to nt 1 to 1602 of SEQ ID NO: 2, and an RNA sequence complementary to SEQ ID NO: 2 or its complementary strand.

15. A nucleic acid molecule comprising the synthetic RPE65 gene according to claim 14 operably linked to regulatory control sequences for the gene.

16. The nucleic acid molecule according to claim 15, wherein the molecule is a plasmid.

17. A host cell comprising the nucleic acid molecule according to claim 15.

18. A method for treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) celts of a subject, said method comprising the step of administering to said subject an adeno-associated virus (AAV) according to any of claims 1 to 10.

19. The method according to claim 18, wherein said subject is injected with the AAV according to any of claims 1 to 10 in an amount of 10⁷ to 10¹⁰ genome copies.

20. The method according to claim 19, wherein said subject is injected with the AAV according to any of claims 1 to 10 in an amount of about 10⁹ genome copies.

21. The method according to claim 19 or 20, wherein said subject is injected in both eyes.

22. Use of an adeno-associated virus (AAV) according to any of claims 1 to 10 in preparing a medicament.

23. Use of an adeno-associated virus (AAV) according to any of claims 1 to 10 in treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject.

24. A method for specifically targeting a gene product to a retinal pigment epithelial (RPE) cell comprising the step of delivering to a subject's eye a dose of about 10⁹ genome copies of an adeno-associated virus (AAV) having an AAV7 capsid and carrying a minigene comprising the sequences encoding a gene product for delivery to a RPE cell operably linked to regulatory sequences which direct expression thereof.

25. Use of a dose of about 10⁹ genome copies of an adeno-associated virus (AAV) comprising an AAV7 capsid and a minigene comprising the sequences encoding a gene product for delivery to a retinal pigment epithelial (RPE) cell operabfy linked to regulatory sequences which direct expression thereof, in preparing a medicament useful in delivering a gene product specifically targeted to a RPE cell to the eye of a subject.

26. Use of a dose of about 10⁹ genome copies of an adeno-associated virus (AAV) comprising an AAV7 capsid and a minigene comprising the sequences encoding a gene product for delivery to a retinal pigment epithelial (RPE) cell operably linked to regulatory sequences which direct expression thereof, in delivering a gene product specifically targeted to a RPE cell to the eye of a subject.

27. A vector comprising a synthetic RPE65 gene encoding human RPE65, said synthetic gene having the nucleic acid sequence of SEQ ID NO: 2 operably linked to regulatory sequences which direct expression of the human RPE65.

28. The vector according to claim 27, wherein the vector is a viral vector.

29. The vector according to claim 28, wherein the vector is an adeno-associated virus (AAV) vector.

30. Use of a vector according to any one of claims 27 to 29 in preparing a medicament.

31. A pharmaceutical composition comprising a vector according to any of claims 27 to 29, and a physiologically compatible carrier.

32. A method for treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject, said method comprising the step of administering to said subject a pharmaceutical composition according to claim 30.