WO2009134681A2 - Vecteurs viraux aav7 pour une administration ciblée de cellules rpe - Google Patents
Vecteurs viraux aav7 pour une administration ciblée de cellules rpe Download PDFInfo
- Publication number
- WO2009134681A2 WO2009134681A2 PCT/US2009/041606 US2009041606W WO2009134681A2 WO 2009134681 A2 WO2009134681 A2 WO 2009134681A2 US 2009041606 W US2009041606 W US 2009041606W WO 2009134681 A2 WO2009134681 A2 WO 2009134681A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- aav
- promoter
- rpe
- gene
- rpe65
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
- C12N2799/025—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a parvovirus
Definitions
- the invention relates generally to the use of recombinant viruses to deliver a desired transgene to the eye of subjects suffering from ocular disorders.
- LCA Leber congenital amaurosis
- RPE65 Mutations in the gene encoding an RPE protein, RPE65, are among the molecular causes of LCA.
- RPE65 is an evolutionarily-conserved 65kDa membrane-associated protein [Redmond, T. & Hamel, C. 2000 Meth. En ⁇ ymol 317: 705-724 and Bavik, C. et al, 1992 J. Biol Chem. 267: 23035-23042], which is important in retinoid metabolism (Saari, J. 2000 Invest Ophthalmol Vis 5c/ 41 : 337-348; Ma : J.-X. et al, 1998 J Biol Chem 1443: 255-261 ; and Simon, A. et al, 1995 J Biol Chem 270: 1107-1112).
- a mouse model for RPE65 deficiency has been described. [Redmond, T., et al.1998 Nat.
- Viral vectors for delivery of the RPE gene have been described for treating ocular disorders. See, e.g., Reichel et al, Opthalmotge, 96: 570-577 (1999), which describes subretinal injection of an adenovirus or adeno-associated viral vector carrying RPE65 gene.
- the use of adeno-associated virus-2 for delivery of the gene has been described. See, e.g., International Patent Application Publication No. WO 02/082904 and US Published Patent Application No. 2007/077228.
- the present invention provides a method for specifically targeting a gene product to retinal pigment epithelial cells by delivering to a subject's eye a low dose of an adeno-associated virus (AAV) having an AAV 7 capsid.
- AAV adeno-associated virus
- the present invention is particularly well adapted for delivery of a retinal pigment epithelial (RPE) 65 gene under the control of regulatory control sequences which direct expression of the RPE65 protein in RPE cells.
- the invention provides a synthetic RPE65 gene encoding human RPE65, which is termed herein AL65.
- the synthetic gene has the nucleic acid sequence of SEQ ID NO: 2. Also provided are nucleic acid molecules, vectors, pharmaceutical compositions and host cells containing this synthetic gene.
- the invention provides an AAV7 viral vector containing a minigene comprising a 5' ITR, a promoter, the AL65 gene, a rabbit globin polyadenylation signal, and a 3' ITR.
- a method for treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells involves administering to said subject an AAV7 AL65 adeno-associated virus (AAV).
- AAV7 AL65 adeno-associated virus AAV
- Fig. 2 provides a schematic map of a cis plasmid, p73ieAAVssAL65.
- the nucleotide sequence of this plasmid is provided in SEQ ID NO: 1.
- p73ieAAVssAL65 carries a minigene comprising a synthetic AAV 5' inverted terminal repeat (ITR) sequences (nt 1243-1372 of SEQ ID NO: 1), an immediate-early CMV promoter (nt 1376-1865 of SEQ ID NO: 1), a synthetic RPE65 coding sequence (nt 1994-3595 of SEQ ID NO: 1) operably linked to the ieCMV promoter and a rabbit globin polyadenylation termination signal (nt 3610-3736 of SEQ ID NO: 1), and a synthetic AAV 3' ITR (nt 3747-3876 of the complement of SEQ ID NO: 1).
- ITR inverted terminal repeat
- the plasmid backbone is based on pUC19, and further contains a kanamycin resistance gene (nt 1114 - 299 of the complement of SEQ ID NO: 1 ) to better comply with current accepted good manufacturing practice (GMP).
- GMP current accepted good manufacturing practice
- An untranslated exon from the CMV ie promoter is located between the promoter and synthetic RPE65 (nt 1866-1985 of SEQ ID NO: 1) to provide an efficient leader sequence.
- a method for specifically targeting a molecule to RPE65 cells by delivering the molecule via an AAV vector having an AAW capsid is provided.
- AAV7 specifically transduces RPE cells, avoiding transduction of other cells of the eye (i.e., photoreceptor cells, ganglion cells and/or optic nerve cells).
- AAV7's high level of expression in RPE cells was similar to several other AAVs.
- AAV7's specificity and efficiency at a lower dose provide advantages which are designed to include safety, biodistribution and expression from AAV7 for specific delivery to the RPE cells in the eye.
- an "AAV7 viral vector” refers to a viral particle having an AAV7 capsid in which a minigene or expression cassette is packaged.
- An AAV7-based viral vector carrying a minigene may be readily constructed using techniques which are known to those of skill in the art. See, e.g., International Patent Application Publication No. WO 03/042397, filed 22 May 2003, which describes the AAV7 sequences and construction of vectors using the AAV7 capsid.
- the capsid sequence is also provided in the NIH/GenBank database under accession number NC_006260.1 [GP Gao et al, Proc. Natl Acad. Sci. U.S.A. 99(18), 11854-1 1859 (2002)].
- the genomic sequences, with the open reading frames also identified in this publication, with reference to GenBank accession number NC 006260. These sequences are incorporated by reference herein.
- a composition which comprises an AAV7 capsid carrying an RPE65 gene under the control of regulatory control sequences which direct its expression in the host cells.
- the RPE65 gene can refer to natural or synthetic genes.
- the RPE65 gene encodes the human RPE65 protein [SEQ ID NO: 3].
- a synthetic RPE65 gene is provided [SEQ ID NO: 2] and is termed herein "AL65 ".
- the AL65 sequence is provided in Figs IA - ID, in comparison to the wild-type human sequence, spanning nucleotides nt 1 - 1602 of SEQ ID NO: 4.
- the AL65 sequences has 76% identity at the nucleotide level to the wild-type human RPE65 sequence.
- the AL65 nucleic acid sequences further encompass the strand which is complementary to the strand provided in Figs. IA-I D and the Sequence Listing, as well as the RNA corresponding to these sequences.
- Also included in the nucleic acid sequences of the invention are natural variants and engineered modifications of the sequences of Fig. 1 and the Sequence Listing, and their complementary strands. Such modifications include, for example, labels which are known in the art, methylation, and substitution of one or more of the naturally occurring nucleotides with a degenerate nucleotide.
- This AL65 gene was designed to provide efficient expression of the encoded human RPE65 protein [SEQ ID NO: 3] in the target host cells.
- the synthetic gene lacks at least one restriction enzyme site present in the wild-type human sequence and further lacks undesirable alternative splice sites found in the native human gene.
- the AL65 sequence has no out-of-frame initiation codons on the sense strand that may give rise to unexpected and potentially immunogenic proteins.
- ⁇ L65 is designed to provide improved expression in human cells as compared to the wild-type human RPE65 gene.
- the synthetic AL65 is also capable of being produced and of expressing its product [human RPE65, SEQ ID NO: 3] in non-human cells.
- the wild-type RPE65 gene is included in the AAV7 viral vectors.
- the sequence of wild-type human RPE65 is reproduced in SEQ ID NO: 4.
- a commercially available computer program e.g., Leto (vl .0.18; Entelechon GmbH Germany), using conventional parameters] or other techniques to alter the wild-type human sequence.
- the nucleic acid sequence encoding RPE65 carried by the rAAV vector is the normal, species-matched version of the mutated gene, e.g., wild-type canine RPE65 for the treatment of canine LCA.
- a nucleic acid molecule comprising the AL65 gene operably linked to regulatory control sequences for the gene is described.
- the molecule is a ptasmid.
- Such a plasmid may be used as a production vector.
- An example of such a plasmid, used as a cis plasmid in a method of preparing an AAV viral vector, is described herein.
- the nucleic acid molecule may be another genetic element useful for delivery of the AL65 gene to a host cell.
- Such a genetic element may include any genetic element (vector) which may be delivered to a host cell, e.g., naked DNA, a plasmid, phage, transposon, cosmid, episome, a protein in a non-viral delivery vehicle (e.g., a lipid-based carrier), virus, etc., which transfers the sequences carried thereon.
- the selected vector may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
- the methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et a ⁇ , Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. AA Vl Viruses And Uses Thereof
- the minigene is composed of, at a minimum, inverted terminal repeat sequences (ITRs) and the RPE-co ⁇ mg sequences as described herein which are operably linked to regulatory sequences which direct expression thereof.
- ITRs inverted terminal repeat sequences
- RPE-co ⁇ mg sequences as described herein which are operably linked to regulatory sequences which direct expression thereof.
- the minigene contains both a 5' ITR and a 3' ITR.
- An ITR sequence may be from AA V7 or from a different AAV than AAV7, e.g., AAV2.
- the 5' and 3' ITRs are from different AAV sources.
- sources include natural sources from which the ITR is isolated or a synthetic ITR, which is prepared artificially by means of nucleic acid synthesizers, or obtained by mixed techniques (isolation from the genome, then extension by conventional synthesis techniques).
- a synthetic 5' ITR has the sequence of nt 1243-1372 of SEQ ID NO: 1.
- a synthetic 3' ITR has the sequence of the complement of nt 3876-3747 of SEQ ID NO: 1.
- these ITRs can also be modified by any technique known to persons skilled in the art (molecular biology, chemistry, enzymology and the like), with the aim of enhancing their functionality, of reducing their size, of increasing their stability after integration or their integration specificity and the like. In particular, they can be modified by mutation, deletion and/or addition of base pairs, according to conventional molecular biology techniques.
- a single AAV ITR is used to induce the integration of the heterologous sequence.
- the ITR may be located downstream or upstream of the ⁇ P£-coding sequence.
- the minigene contains the AP£-coding sequence bordered (directly or indirectly) by AAV ITRs.
- the minigene may contain 2 ITRs: one 5' ITR (located at the left end), and one 3' ITR (located at the right end).
- the minigene is packaged into an AAV7 capsid and delivered to a selected host cell according to known methods.
- the minigene and/or the vector also include other regulatory control elements necessary which are operably linked to the transgene in a manner which permits its transcription, translation and/or expression in a cell transfected with the plasmid vector or transduced with the virus produced by the invention.
- operably linked sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
- Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency ⁇ i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
- RNA processing signals such as splicing and polyadenylation (polyA) signals
- sequences that stabilize cytoplasmic mRNA sequences that enhance translation efficiency ⁇ i.e., Kozak consensus sequence
- sequences that enhance protein stability e.g., a sequence that enhance protein stability
- sequences that enhance secretion of the encoded product e.g., a sequence that can enhance translation efficiency is a Kozak consensus sequence.
- a modified Kozak sequence has been described in, e.g., US Patent No. 6,365,403 and in J. Bennicelli etal, MoI.
- constitutive promoters which may be included in the rAAV7.RPE65 of this invention include, without limitation, a chicken ⁇ -actin (CB) promoter, a RSV LTR promoter/enhancer, an SV40 promoter, a CMV promoter, a dihydrofolate reductase promoter, a phosphoglycerol kinase (PGK) promoter, a composite CMV-immediate early (IE) enhancer/CB promoter, a human RPE65 promoter, and a human vitelliform macular dystrophy 2 (VMD2) promoter.
- CB chicken ⁇ -actin
- RSV LTR promoter/enhancer an SV40 promoter
- CMV promoter a CMV promoter
- PGK phosphoglycerol kinase
- IE phosphoglycerol kinase
- VMD2 human vitelliform macular dystrophy 2
- VMD2 promoter - intron construct was prepared (I-VMD2), which shows improved expression as compared to the VMD2 promoter without the intron.
- I-VMD2 + intron promoter has been previously described in the literature, Esumi et al, JCB, 279(18): 19064 -19073 (April 30, 2004).
- the I-VMD2 promoter described herein differs from the published promoter in that it includes the octamer promotor element which starts at -600 (this contrasts with the publication which starts with -585), with respect to the sequence of Fig IB in Esumi et ai, cited above, and incorporated by reference herein.
- VMD fwd catatgcagaattctgtcattttactaggg [SEQ ID NO: 5]
- VMD+intron rev ggccaggcagtgggctgc [SEQ ID NO: 6].
- the CMV promoter is a human CMV promoter.
- the CMV promoter is an immediate-early CMV promoter (CMV-ie).
- ⁇ / ⁇ -specific promoters include, for example, the RPE65 promoter, the tissue inhibitor of metalloproteinase 3 (Timp3) promoter, and the tyrosinase promoter. Still other ⁇ P£-specific promoters are known to those of skill in the art. See, e.g., the promoters described in International Patent Application Publication No. WO 00/15822.
- an inducible promoter is employed to express the transgene product, so as to control the amount and timing of the ocular cell's production thereof.
- Such promoters can be useful if the gene product proves to be toxic to the cell upon excessive accumulation.
- Inducible promoters include those known in the art and those discussed above including, without limitation, the zinc-inducible sheep metallothionine (MT) promoter; the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter; the T7 promoter; the ecdysone insect promoter; the tetracyc line-repress ible system; the tetracycline-inducible system; the RU486-inducible system; and the rapamycin-inducible system.
- MT zinc-inducible sheep metallothionine
- MMTV dexamethasone
- T7 promoter the ecdysone insect promoter
- any type of inducible promoter which is tightly regulated may be utilized.
- a regulated promoter is specific for the particular target ocular cell type used.
- Still other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, in replication cells only, or by a drug or other molecule which can be delivered to the cell. Selection of these and other common vector and regulatory elements are conventional and many such sequences are available.
- the vector may be packaged into an infectious particle or virion following one of the methods for packaging the rAAV taught in the art.
- infectious particles may include so-called double-stranded (ds) AAV 3 self-complementary (sc) AAV, and single-stranded (ss) AAV.
- ds double-stranded
- sc self-complementary
- ss single-stranded
- AAV7 vector encoding a RPE65 gene product contains a minigene comprising a 5' ITR, a synthetic RPE65 gene encoding human RPE65 under the control of regulatory sequences which direct expression thereof, and a 3' ITR.
- the synthetic 5' and/or 3' ITRs described above are included in the vector.
- a rabbit globin polyadenylation signal is included in the vector.
- an AAV7 vector contains a minigene comprising AAV ITRs as described herein and a heterologous molecule other than RPE65, for which specific targeting to the RPE cells is desired.
- heterologous molecules include those which encode products useful for treating ocular disorders including, e.g., macular degeneration.
- suitable products include anti-angiogenesis agents.
- examples of such products include, e.g., inhibitors of vascular endothelial growth factor (VEGF), inhibitors of platelet derived growth factor, pigment epithelium-derived factor (PEDF), angiostatin, endostatin, dominant-negative FIk-I mutant receptor, human VEGF-Al 65/bFGF, VEGF Trap,
- Inhibitors of VEGF or PEGF, as described herein may include antisense sequences, anti-VEGF antibodies, domain antibodies (dAB) [see, e.g., WO 2007/087673], or antibody fragments, anti- PEGF antibodies, or antibody fragments.
- dAB domain antibodies
- Such an AA V7 vector can include the other vector elements described above and can be prepared using techniques described herein and known in the art.
- a method for treating an ocular disorder by specifically targeting the RPE65 cells via AAV7-mediated delivery using a low dose of the AA V7 vector is provided.
- the ocular disorder is characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject.
- the ocular disorder is treated, or its symptoms are ameliorated, by expression of a desired gene product in the RPE cells.
- a method comprises the step of administering to said subject an AAV7 carrying a heterologous gene for treatment of an ocular disorder.
- a method comprises the step of administering to said subject an AAV7 carrying an RPE65 gene.
- a method comprises delivering a vector comprising an AL65 gene as described herein to a subject.
- the above-described rAAV7 vectors and AL65-ca ⁇ y ⁇ ng vectors may be delivered to the eye as previously described.
- the methods described herein comprise administration of therapeutically effective amounts of the vector.
- an adeno-associated virus (AAV) described herein in preparing a medicament.
- the medicament is useful in treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject.
- use of an adeno-associated virus (AAV) described herein in treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject is provided.
- a dose of about 10 9 genome copies of an adeno- associated virus (AAV), comprising an AA V7 capsid and a minigene comprising the sequences encoding a gene product for delivery to a retinal pigment epithelial (RPE) cell operably linked to regulatory sequences which direct expression thereof, in preparing a medicament useful in delivering a gene product specifically targeted to a RPE cell to the eye of a subject is provided.
- AAV adeno- associated virus
- RPE retinal pigment epithelial
- a dose of about 10 9 genome copies of an adeno-assodated virus (AAV), comprising an AAV7 capsid and a minigene comprising the sequences encoding a gene product for delivery to a retinal pigment epithelial (RPE) cell operably linked to regulatory sequences which direct expression thereof, in delivering a gene product specifically targeted to a RPE cell to the eye of a subject is provided.
- AAV adeno-assodated virus
- RPE retinal pigment epithelial
- a pharmaceutical composition described herein in preparing a medicament useful in treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject is provided.
- use of a pharmaceutical composition described herein in treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject is provided.
- the subject is injected subretinally in the affected eye(s).
- other routes of administration are selected, including those described below.
- the vectors, suspended in a physiologically compatible carrier may be administered to a human or non-human mammalian patient via injection.
- Suitable carriers may be readily selected by one of skill in the art, e.g., for delivery to the eye.
- one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline).
- Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The selection of the carrier is not a limitation of the present invention.
- compositions of the invention may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers.
- suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate. the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol.
- the viral vectors are administered in sufficient amounts to transfect the cells and to provide sufficient levels of gene transfer and expression to provide a therapeutic benefit without undue adverse effects, or with medically acceptable physiological effects, which can be determined by those skilled in the medical arts.
- routes of administration include, but are not limited to, direct delivery to the eyes (e.g., intraretinal injection), via eye drop, or other suitable delivery routes. Routes of administration may be combined, if desired.
- a vector as described herein is formulated with a surfactant, e.g., to prevent sticking to the delivery device. Such a surfactant may be in addition to the selected carrier. Dosages of the AAV7 viral vector will depend primarily on factors such as the condition being treated, the age, weight and health of the patient, and may thus vary among patients.
- a therapeutically effective human dosage of the viral vector is generally in the range of from about 0.5 ⁇ L to about 1 mL of solution containing concentrations of from about 1 x 10 7 to 1 x 10 11 genome copies of the virus vector, and desirably, about 10 9 genomes or lower.
- the dosage may be adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed.
- the levels of expression of the transgene can be monitored to determine the frequency of dosage.
- dosage regimens similar to those described for therapeutic purposes may be utilized for immunization or vaccine purposes using the compositions of the invention.
- kits are provided for administration of a combination of a vector or composition described herein to the eye, for example, for the purpose of treating an ocular disorder characterized by the defect or absence of a normal gene in the retinal pigment epithelial (RPE) cells of a subject.
- the kit comprises two or more pharmaceutical compositions, at least one of which contains a vector or pharmaceutical composition containing the vector as described herein, and may conveniently be combined in the form of a kit suitable for co-administration.
- the second composition comprises a physiologically acceptable carrier or diluent, such as those described above.
- the kit of the invention comprises two or more separate pharmaceutical compositions, at least one of which contains a vector described herein, and means for separately retaining said compositions, such as containers or a divided bottle.
- the kit comprises a syringe and needle, eye dropper, or other suitable delivery means.
- the kit comprises directions for administration.
- AAV capsids were compared with AA V2 in C57B1/6 mice following delivery in the subretinal space for their ability to target the inner neural retina and/or the retinal pigment epithelium (RPE).
- RPE retinal pigment epithelium
- the CMV.eGFP transduced retinas were followed up by ophthalmoscopy and fundus photography and subsequently examined histologically.
- a scoring method for cell type specificity and morphometric analysis for efficiency of transduction by fluorescent intensity were used.
- a hierarchy of vectors for the various retinal cell types was prepared.
- AAV7 AA V9, rh.8R and rh64.1 transduced the mouse RPE most efficiently.
- a vector based on a novel Clade C isolate, hu. 1 efficiently transduced cells throughout the neural retinal from other plexiform layer through the ganglion cell layer.
- AAV8 still demonstrated efficient photoreceptor targeting while other vectors did less so with AA V9 demonstrating a pattern of almost exclusive RPE transduction.
- AAV7 demonstrated increased specificity for the RPE in comparison to AAV8 by approximately 10-fold; at a dose of 10 9 GC, photoreceptors were transduced at a level of less than 1% of level of RPE transduction. All in-life diagnostics indicated that the treatment was well tolerated and no evidence for immune reaction toward capsid or transgene product was noted throughout the study as monitored by IFN- ⁇ ELlSPOT and histological examination.
- Fig. 2 provides a schematic map of a cis plasmid, p73ieAAVssAL65.
- the nucleotide sequence of this plasmid is provided in SEQ ID NO: 1.
- p73 ieAAVssAL65 carries a minigene comprising a synthetic AAV 5' inverted terminal repeat (ITR) sequences (nt 1243- 1372 of SEQ ID NO: 1), an immediate-early CMV promoter, (nt 1376-1865 of SEQ ID NO: 1), a synthetic RPR 65 coding sequence (nt 1994-3595 of SEQ ID NO: 1) operably linked to the ieCMV promoter and a rabbit globin polyadenylation termination signal (nt 3610-3736 of SEQ ID NO: 1), and a synthetic AAV 3' ITR (nt 3876-3747 of the complement of SEQ ID NO: 1).
- ITR inverted terminal repeat
- the plasmid backbone is based on pUC19, and further contains a kanamycin resistance gene (nt 1 1 14 - 299 of the complement of SEQ ID NO: 1) to comply with current accepted good manufacturing practice (GMP).
- GMP current accepted good manufacturing practice
- An exon is located between the promoter and synthetic RPE65 (nt 1866-1985 of SEQ ID NO: 1).
- p5El 8 plasmid (Xiao et ah, 1999, J. Virol 73:3994-4003) is partially digested with Xho I to linearize the plasmid at the Xho I site at the position of 3169 bp only. The Xho I cut ends are then filled in and ligated back.
- This modified p5E18 plasmid is restricted with Xba I and Xho I in a complete digestion to remove the AA V2 cap gene sequence and replaced with a 2267 bp Spe 1/Xho I fragment containing the AA V7 cap gene which is isolated from pCRAAW 6-5+15-4 plasmid.
- the resulting plasmid contains the AA V2 rep sequences for Rep78/68 under the control of the AA V2 P5 promoter, and the AA V2 rep sequences for Rep52/40 under the control of the AAV2 P19 promoter.
- the AAV7 capsid sequences are under the control of the AA V2 P40 promoter, which is located within the Rep sequences.
- This plasmid further contains a spacer 5' of the rep ORF.
- the rAAV particles (AA V2 vector in AAV7 capsid) are generated using an adenovirus-free method. Briefly, the cis plasmid constructed as described above and the trans plasmid pCRAAV7 6-5+15-4 (containing the AAV2 rep and AAV7 cap) and a helper plasmid, respectively, are simultaneously co-transfected into 293 cells in a ratio of 1 : 1 :2 by calcium phosphate precipitation as described in WO 03/042397.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
L'invention porte sur un procédé pour diriger spécifiquement un produit de gène vers une cellule épithéliale de pigment rétinien, conjointement avec des virus adéno-associés (AAV) utiles dans celui-ci. Le procédé entraîne l'administration à l'œil d'un sujet d'une dose d'environ 109 copies de génome d'un vecteur viral AAV7 et d'un mini-gène comportant des séquences codant pour le produit de gène dirigé vers les cellules RPE. L'invention porte également sur un gène RPE synthétique 65. De façon appropriée, ce gène RPE synthétique, qui est sous le contrôle de séquences de contrôle régulatrices qui dirigent l'expression de la protéine RPE65 dans des cellules RPE, est administré par l'intermédiaire du vecteur viral AAV7.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US12611008P | 2008-04-30 | 2008-04-30 | |
US61/126,110 | 2008-04-30 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2009134681A2 true WO2009134681A2 (fr) | 2009-11-05 |
WO2009134681A3 WO2009134681A3 (fr) | 2011-04-28 |
Family
ID=40974429
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2009/041606 WO2009134681A2 (fr) | 2008-04-30 | 2009-04-24 | Vecteurs viraux aav7 pour une administration ciblée de cellules rpe |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2009134681A2 (fr) |
Cited By (31)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8147823B2 (en) | 2001-04-13 | 2012-04-03 | The Trustees Of The University Of Pennsylvania | Method of treating or retarding the development of blindness |
WO2013063383A2 (fr) | 2011-10-27 | 2013-05-02 | Wellstat Ophthalmics Corporation | Vecteurs codant pour un facteur de viabilité des cônes dérivé des bâtonnets |
EP3265568A4 (fr) * | 2015-03-06 | 2018-08-08 | Massachusetts Eye & Ear Infirmary | Thérapies d'augmentation génétique de la dégénérescence rétinienne héréditaire causée par des mutations au niveau du gène prpf31 |
RU2679843C2 (ru) * | 2012-07-06 | 2019-02-13 | Юниверсити Оф Айова Рисерч Фаундейшн | Векторные композиции с модифицированным аденоассоциированным вирусом |
US10335466B2 (en) | 2014-11-05 | 2019-07-02 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of parkinson's disease |
US10480031B2 (en) | 2013-02-01 | 2019-11-19 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Method for generating Retinal Pigment Epithelium (RPE) cells from Induced Pluripotent Stem Cells (IPSCs) |
US10570395B2 (en) | 2014-11-14 | 2020-02-25 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
US10577627B2 (en) | 2014-06-09 | 2020-03-03 | Voyager Therapeutics, Inc. | Chimeric capsids |
US10584337B2 (en) | 2016-05-18 | 2020-03-10 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
US10597660B2 (en) | 2014-11-14 | 2020-03-24 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
US10610606B2 (en) | 2018-02-01 | 2020-04-07 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
CN111726985A (zh) * | 2017-11-15 | 2020-09-29 | 弗里德里克·米谢尔生物医学研究所 | 灵长类动物视网膜色素上皮细胞特异性启动子 |
US10983110B2 (en) | 2015-12-02 | 2021-04-20 | Voyager Therapeutics, Inc. | Assays for the detection of AAV neutralizing antibodies |
US20210171982A1 (en) * | 2018-08-03 | 2021-06-10 | Sangamo Therapeutics, Inc. | Improved clinical parameters by expression of factor viii |
WO2021159069A3 (fr) * | 2020-02-07 | 2021-10-28 | The Trustees Of Columbia University In The City Of New York | Reprogrammation du métabolome pour retarder l'apparition d'une neurodégénérescence ou pour la traiter |
US11298041B2 (en) | 2016-08-30 | 2022-04-12 | The Regents Of The University Of California | Methods for biomedical targeting and delivery and devices and systems for practicing the same |
US11299751B2 (en) | 2016-04-29 | 2022-04-12 | Voyager Therapeutics, Inc. | Compositions for the treatment of disease |
US11306329B2 (en) | 2018-02-19 | 2022-04-19 | City Of Hope | Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof |
CN114650847A (zh) * | 2019-09-25 | 2022-06-21 | 犹他大学研究基金会 | 用于表达来自vmd2启动子的组成型活性rap1a的方法和组合物 |
WO2022165313A1 (fr) | 2021-02-01 | 2022-08-04 | Regenxbio Inc. | Thérapie génique de céroïdes-lipofuscinoses neuronales |
US11434502B2 (en) | 2017-10-16 | 2022-09-06 | Voyager Therapeutics, Inc. | Treatment of amyotrophic lateral sclerosis (ALS) |
US11497576B2 (en) | 2017-07-17 | 2022-11-15 | Voyager Therapeutics, Inc. | Trajectory array guide system |
US11512327B2 (en) | 2017-08-03 | 2022-11-29 | Voyager Therapeutics, Inc. | Compositions and methods for delivery of AAV |
US11603542B2 (en) | 2017-05-05 | 2023-03-14 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
US11697825B2 (en) | 2014-12-12 | 2023-07-11 | Voyager Therapeutics, Inc. | Compositions and methods for the production of scAAV |
US11752181B2 (en) | 2017-05-05 | 2023-09-12 | Voyager Therapeutics, Inc. | Compositions and methods of treating Huntington's disease |
US11759506B2 (en) | 2017-06-15 | 2023-09-19 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
US11931375B2 (en) | 2017-10-16 | 2024-03-19 | Voyager Therapeutics, Inc. | Treatment of amyotrophic lateral sclerosis (ALS) |
US11952585B2 (en) | 2020-01-13 | 2024-04-09 | Homology Medicines, Inc. | Methods of treating phenylketonuria |
US11951121B2 (en) | 2016-05-18 | 2024-04-09 | Voyager Therapeutics, Inc. | Compositions and methods for treating Huntington's disease |
US12076420B2 (en) | 2020-05-27 | 2024-09-03 | Homology Medicines, Inc. | Adeno-associated virus compositions for restoring PAH gene function and methods of use thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002082904A2 (fr) * | 2001-04-13 | 2002-10-24 | The Trustees Of The University Of Pennsylvania | Traitement soignant ou retardant l'installation de la cecite |
-
2009
- 2009-04-24 WO PCT/US2009/041606 patent/WO2009134681A2/fr active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002082904A2 (fr) * | 2001-04-13 | 2002-10-24 | The Trustees Of The University Of Pennsylvania | Traitement soignant ou retardant l'installation de la cecite |
Non-Patent Citations (4)
Title |
---|
BENNICELLI JEANNETTE ET AL: "Reversal of blindness in animal models of leber congenital amaurosis using optimized AAV2-mediated gene transfer." MOLECULAR THERAPY : THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY MAR 2008, vol. 16, no. 3, March 2008 (2008-03), pages 458-465, XP002543023 ISSN: 1525-0024 * |
LE MEUR G ET AL: "Restoration of vision in RPE65-deficient Briard dogs using an AAV serotype 4 vector that specifically targets the retinal pigmented epithelium" GENE THERAPY, MACMILLAN PRESS LTD., BASINGSTOKE, GB, vol. 14, no. 4, 1 February 2007 (2007-02-01), pages 292-303, XP002493281 ISSN: 0969-7128 [retrieved on 2006-10-05] * |
LEBHERZ CORINNA ET AL: "Novel AAV serotypes for improved ocular gene transfer" JOURNAL OF GENE MEDICINE, [Online] vol. 10, no. 4, 18 February 2008 (2008-02-18), pages 375-382, XP002543022 ISSN: 1521-2254 Retrieved from the Internet: URL:www.interscience.wiley.com> * |
PANG ET AL: "Comparative analysis of in vivo and in vitro AAV vector transduction in the neonatal mouse retina: Effects of serotype and site of administration" VISION RESEARCH, PERGAMON PRESS, OXFORD, GB, vol. 48, no. 3, 22 October 2007 (2007-10-22), pages 377-385, XP022452232 ISSN: 0042-6989 * |
Cited By (45)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9433688B2 (en) | 2001-04-13 | 2016-09-06 | The Trustees Of The University Of Pennsylvania | Method of treating or retarding the development of blindness |
US8147823B2 (en) | 2001-04-13 | 2012-04-03 | The Trustees Of The University Of Pennsylvania | Method of treating or retarding the development of blindness |
WO2013063383A2 (fr) | 2011-10-27 | 2013-05-02 | Wellstat Ophthalmics Corporation | Vecteurs codant pour un facteur de viabilité des cônes dérivé des bâtonnets |
RU2679843C2 (ru) * | 2012-07-06 | 2019-02-13 | Юниверсити Оф Айова Рисерч Фаундейшн | Векторные композиции с модифицированным аденоассоциированным вирусом |
US11441184B2 (en) | 2013-02-01 | 2022-09-13 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Method for generating retinal pigment epithelium (RPE) cells from induced pluripotent stem cells (IPSCs) |
US10480031B2 (en) | 2013-02-01 | 2019-11-19 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Method for generating Retinal Pigment Epithelium (RPE) cells from Induced Pluripotent Stem Cells (IPSCs) |
US10577627B2 (en) | 2014-06-09 | 2020-03-03 | Voyager Therapeutics, Inc. | Chimeric capsids |
US10335466B2 (en) | 2014-11-05 | 2019-07-02 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of parkinson's disease |
US11975056B2 (en) | 2014-11-05 | 2024-05-07 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
US11027000B2 (en) | 2014-11-05 | 2021-06-08 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
US12071625B2 (en) | 2014-11-14 | 2024-08-27 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
US10570395B2 (en) | 2014-11-14 | 2020-02-25 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
US10597660B2 (en) | 2014-11-14 | 2020-03-24 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
US11542506B2 (en) | 2014-11-14 | 2023-01-03 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
US10920227B2 (en) | 2014-11-14 | 2021-02-16 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
US11198873B2 (en) | 2014-11-14 | 2021-12-14 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
US11697825B2 (en) | 2014-12-12 | 2023-07-11 | Voyager Therapeutics, Inc. | Compositions and methods for the production of scAAV |
EP3265568A4 (fr) * | 2015-03-06 | 2018-08-08 | Massachusetts Eye & Ear Infirmary | Thérapies d'augmentation génétique de la dégénérescence rétinienne héréditaire causée par des mutations au niveau du gène prpf31 |
EP3748007A1 (fr) * | 2015-03-06 | 2020-12-09 | Massachusetts Eye & Ear Infirmary | Thérapies d'augmentation génétique de la dégénérescence rétinienne héréditaire causée par des mutations au niveau du gène prpf31 |
US10983110B2 (en) | 2015-12-02 | 2021-04-20 | Voyager Therapeutics, Inc. | Assays for the detection of AAV neutralizing antibodies |
US11299751B2 (en) | 2016-04-29 | 2022-04-12 | Voyager Therapeutics, Inc. | Compositions for the treatment of disease |
US10584337B2 (en) | 2016-05-18 | 2020-03-10 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
US12084659B2 (en) | 2016-05-18 | 2024-09-10 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
US11951121B2 (en) | 2016-05-18 | 2024-04-09 | Voyager Therapeutics, Inc. | Compositions and methods for treating Huntington's disease |
US11193129B2 (en) | 2016-05-18 | 2021-12-07 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
US11298041B2 (en) | 2016-08-30 | 2022-04-12 | The Regents Of The University Of California | Methods for biomedical targeting and delivery and devices and systems for practicing the same |
US11752181B2 (en) | 2017-05-05 | 2023-09-12 | Voyager Therapeutics, Inc. | Compositions and methods of treating Huntington's disease |
US11603542B2 (en) | 2017-05-05 | 2023-03-14 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
US11759506B2 (en) | 2017-06-15 | 2023-09-19 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
US11497576B2 (en) | 2017-07-17 | 2022-11-15 | Voyager Therapeutics, Inc. | Trajectory array guide system |
US11512327B2 (en) | 2017-08-03 | 2022-11-29 | Voyager Therapeutics, Inc. | Compositions and methods for delivery of AAV |
US11434502B2 (en) | 2017-10-16 | 2022-09-06 | Voyager Therapeutics, Inc. | Treatment of amyotrophic lateral sclerosis (ALS) |
US11931375B2 (en) | 2017-10-16 | 2024-03-19 | Voyager Therapeutics, Inc. | Treatment of amyotrophic lateral sclerosis (ALS) |
CN111726985A (zh) * | 2017-11-15 | 2020-09-29 | 弗里德里克·米谢尔生物医学研究所 | 灵长类动物视网膜色素上皮细胞特异性启动子 |
US11951183B2 (en) | 2018-02-01 | 2024-04-09 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
US12064486B2 (en) | 2018-02-01 | 2024-08-20 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
US10610606B2 (en) | 2018-02-01 | 2020-04-07 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
US11891619B2 (en) | 2018-02-19 | 2024-02-06 | City Of Hope | Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof |
US11306329B2 (en) | 2018-02-19 | 2022-04-19 | City Of Hope | Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof |
US20210171982A1 (en) * | 2018-08-03 | 2021-06-10 | Sangamo Therapeutics, Inc. | Improved clinical parameters by expression of factor viii |
CN114650847A (zh) * | 2019-09-25 | 2022-06-21 | 犹他大学研究基金会 | 用于表达来自vmd2启动子的组成型活性rap1a的方法和组合物 |
US11952585B2 (en) | 2020-01-13 | 2024-04-09 | Homology Medicines, Inc. | Methods of treating phenylketonuria |
WO2021159069A3 (fr) * | 2020-02-07 | 2021-10-28 | The Trustees Of Columbia University In The City Of New York | Reprogrammation du métabolome pour retarder l'apparition d'une neurodégénérescence ou pour la traiter |
US12076420B2 (en) | 2020-05-27 | 2024-09-03 | Homology Medicines, Inc. | Adeno-associated virus compositions for restoring PAH gene function and methods of use thereof |
WO2022165313A1 (fr) | 2021-02-01 | 2022-08-04 | Regenxbio Inc. | Thérapie génique de céroïdes-lipofuscinoses neuronales |
Also Published As
Publication number | Publication date |
---|---|
WO2009134681A3 (fr) | 2011-04-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2009134681A2 (fr) | Vecteurs viraux aav7 pour une administration ciblée de cellules rpe | |
US11491213B2 (en) | Modified factor IX, and compositions, methods and uses for gene transfer to cells, organs, and tissues | |
EP1381276A2 (fr) | Traitement soignant ou retardant l'installation de la cecite | |
US20220118111A1 (en) | Methods and Compositions for Treatment of Disorders and Diseases Involving RDH12 | |
US10857240B2 (en) | Methods and compositions for treatment of ocular disorders and blinding diseases | |
US20230265455A1 (en) | Improved aav-mediated x-linked retinoschisis therapies | |
WO2022015715A1 (fr) | Compositions utiles pour le traitement de la maladie de charcot-marie-tooth | |
US12097267B2 (en) | Methods and compositions for treatment of ocular disorders and blinding diseases | |
EP4405469A1 (fr) | Compositions utiles pour le traitement de la maladie de charcot-marie-tooth | |
JP2024515612A (ja) | 球脊髄性筋萎縮症(sbma)の治療に有用な組成物 | |
AU2002256162A1 (en) | Method of treating or retarding the development of blindness |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09739483 Country of ref document: EP Kind code of ref document: A2 |
|
NENP | Non-entry into the national phase in: |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 09739483 Country of ref document: EP Kind code of ref document: A2 |