US20150082478A1 - Plant genome modification using guide rna/cas endonuclease systems and methods of use - Google Patents

Plant genome modification using guide rna/cas endonuclease systems and methods of use Download PDF

Info

Publication number
US20150082478A1
US20150082478A1 US14/463,687 US201414463687A US2015082478A1 US 20150082478 A1 US20150082478 A1 US 20150082478A1 US 201414463687 A US201414463687 A US 201414463687A US 2015082478 A1 US2015082478 A1 US 2015082478A1
Authority
US
United States
Prior art keywords
plant
cas endonuclease
sequence
cell
target site
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/463,687
Other languages
English (en)
Inventor
Andrew Mark Cigan
Saverio Carl Falco
Huirong Gao
Zhongsen Li
Zhan-Bin Liu
L. Aleksander Lyznik
Jinrui Shi
Sergei Svitashev
Joshua K. Young
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pioneer Hi Bred International Inc
EIDP Inc
Original Assignee
Pioneer Hi Bred International Inc
EI Du Pont de Nemours and Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=51493053&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20150082478(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Pioneer Hi Bred International Inc, EI Du Pont de Nemours and Co filed Critical Pioneer Hi Bred International Inc
Priority to US14/463,687 priority Critical patent/US20150082478A1/en
Assigned to PIONEER HI-BRED INTERNATIONAL, INC., E. I. DU PONT DE NEMOURS AND COMPANY reassignment PIONEER HI-BRED INTERNATIONAL, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: FALCO, SAVERIO CARL, GAO, HUIRONG, SHI, JINRUI, CIGAN, Andrew Mark, LI, ZHONGSEN, LIU, ZHAN-BIN, Lyznik, Aleksander L., SVITASHEV, SERGEI, YOUNG, JOSHUA K.
Publication of US20150082478A1 publication Critical patent/US20150082478A1/en
Priority to US16/130,295 priority patent/US20190040405A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/01—Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8206—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated
    • C12N15/8207—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated by mechanical means, e.g. microinjection, particle bombardment, silicon whiskers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8251—Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8275—Glyphosate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8278—Sulfonylurea
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
    • C12N15/8289—Male sterility
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits

Definitions

  • the disclosure relates to the field of plant molecular biology, in particular, to methods for altering the genome of a plant cell.
  • sequence listing is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file named 20140814_BB2284USNP_ST25_SeqLst created on Aug. 14, 2014 and having a size 560 kilobytes and is filed concurrently with the specification.
  • sequence listing contained in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.
  • Recombinant DNA technology has made it possible to insert foreign DNA sequences into the genome of an organism, thus, altering the organism's phenotype.
  • the most commonly used plant transformation methods are Agrobacterium infection and biolistic particle bombardment in which transgenes integrate into a plant genome in a random fashion and in an unpredictable copy number. Thus, efforts are undertaken to control transgene integration in plants.
  • One method for inserting or modifying a DNA sequence involves homologous DNA recombination by introducing a transgenic DNA sequence flanked by sequences homologous to the genomic target.
  • U.S. Pat. No. 5,527,695 describes transforming eukaryotic cells with DNA sequences that are targeted to a predetermined sequence of the eukaryote's DNA. Specifically, the use of site-specific recombination is discussed. Transformed cells are identified through use of a selectable marker included as a part of the introduced DNA sequences.
  • compositions and methods employing a guide RNA/Cas endonuclease system in plants for genome modification of a target sequence in the genome of a plant or plant cell, for selecting plants, for gene editing, and for inserting a polynucleotide of interest into the genome of a plant.
  • the methods and compositions employ a guide RNA/Cas endonuclease system to provide for an effective system for modifying or altering target sites and nucleotides of interest within the genome of a plant, plant cell or seed. Once a genomic target site is identified, a variety of methods can be employed to further modify the target sites such that they contain a variety of polynucleotides of interest.
  • RNA guide and Cas endonuclease system Breeding methods and methods for selecting plants utilizing a two component RNA guide and Cas endonuclease system are also disclosed. Also provided are nucleic acid constructs, plants, plant cells, explants, seeds and grain having the guide RNA/Cas endonuclease system. Compositions and methods are also provided employing a guide polynucleotide/Cas endonuclease system for genome modification of a target sequence in the genome of a cell or organism, for gene editing, and for inserting or deleting a polynucleotide of interest into or from the genome of a cell or organism.
  • the methods and compositions employ a guide polynucleotide/Cas endonuclease system to provide for an effective system for modifying or altering target sites and editing nucleotide sequences of interest within the genome of a cell, wherein the guide polynucleotide is comprised of a RNA sequence, a DNA sequence, or a DNA-RNA combination sequence.
  • the method comprises a method for selecting a plant comprising an altered target site in its plant genome, the method comprising: a) obtaining a first plant comprising at least one Cas endonuclease capable of introducing a double strand break at a target site in the plant genome; b) obtaining a second plant comprising a guide RNA that is capable of forming a complex with the Cas endonuclease of (a), c) crossing the first plant of (a) with the second plant of (b); d) evaluating the progeny of (c) for an alteration in the target site and e) selecting a progeny plant that possesses the desired alteration of said target site.
  • the method comprises, a method for selecting a plant comprising an altered target site in its plant genome, the method comprising selecting at least one progeny plant that comprises an alteration at a target site in its plant genome, wherein said progeny plant was obtained by crossing a first plant comprising at least one Cas endonuclease with a second plant comprising a guide RNA, wherein said Cas endonuclease is capable of introducing a double strand break at said target site.
  • the method comprises, a method for selecting a plant comprising an altered target site in its plant genome, the method comprising:
  • the method comprises, a method for selecting a plant comprising an altered target site in its plant genome, the method comprising selecting at least one progeny plant that comprises an alteration at a target site in its plant genome, wherein said progeny plant was obtained by crossing a first plant expressing at least one Cas endonuclease to a second plant comprising a guide RNA and a donor DNA, wherein said Cas endonuclease is capable of introducing a double strand break at said target site, wherein said donor DNA comprises a polynucleotide of interest.
  • the method comprises, method for modifying a target site in the genome of a plant cell, the method comprising introducing a guide RNA into a plant cell having a Cas endonuclease, wherein said guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at said target site.
  • the method comprises, a method for modifying a target site in the genome of a plant cell, the method comprising introducing a guide RNA and a Cas endonuclease into said plant cell, wherein said guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at said target site.
  • the method comprises, a method for modifying a target site in the genome of a plant cell, the method comprising introducing a guide RNA and a donor DNA into a plant cell having a Cas endonuclease, wherein said guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at said target site, wherein said donor DNA comprises a polynucleotide of interest.
  • the method comprises a method for modifying a target site in the genome of a plant cell, the method comprising: a) introducing into a plant cell a guide RNA and a Cas endonuclease, wherein said guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at said target site; and, b) identifying at least one plant cell that has a modification at said target, wherein the modification includes at least one deletion or substitution of one or more nucleotides in said target site.
  • the method comprises, method for modifying a target DNA sequence in the genome of a plant cell, the method comprising: A) introducing into a plant cell a first recombinant DNA construct capable of expressing a guide RNA and a second recombinant DNA construct capable of expressing a Cas endonuclease, wherein said guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at said target site; and, B) identifying at least one plant cell that has a modification at said target, wherein the modification includes at least one deletion or substitution of one or more nucleotides in said target site.
  • the method comprises, a method for introducing a polynucleotide of Interest into a target site in the genome of a plant cell, the method comprising: a) introducing into a plant cell a first recombinant DNA construct capable of expressing a guide RNA and a second recombinant DNA construct capable of expressing a Cas endonuclease, wherein said guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at said target site; (b) contacting the plant cell of (a) with a donor DNA comprising a polynucleotide of Interest; and, (c) identifying at least one plant cell from (b) comprising in its genome the polynucleotide of Interest integrated at said target site.
  • the guide RNA can be introduced directly by particle bombardment or can be introduced via particle bombardment or Agrobacterium transformation of a recombinant DNA construct comprising the corresponding guide DNA operably linked to a plant U6 polymerase III promoter.
  • the Cas endonuclease gene is a plant optimized Cas9 endonuclease.
  • the Cas endonuclease gene is operably linked to a SV40 nuclear targeting signal upstream of the Cas codon region and a VirD2 nuclear localization signal downstream of the Cas codon region.
  • the plant in these embodiments is a monocot or a dicot. More specifically, the monocot is selected from the group consisting of maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane, turfgrass, or switchgrass.
  • the dicot is selected from the group consisting of soybean, canola, alfalfa, sunflower, cotton, tobacco, peanut, potato, tobacco, Arabidopsis , or safflower.
  • the target site is located in the gene sequence of an acetolactate synthase (ALS) gene, an Enolpyruvylshikimate Phosphate Synthase Gene (ESPSP) gene, a male fertility (MS45, MS26 or MSCA1) gene.
  • ALS acetolactate synthase
  • ESPSP Enolpyruvylshikimate Phosphate Synthase Gene
  • the disclosure comprises a plant, plant part, or seed, comprising a recombinant DNA construct, said recombinant DNA construct comprising a promoter operably linked to a nucleotide sequence encoding a plant optimized Cas9 endonuclease, wherein said plant optimized Cas9 endonuclease is capable of binding to and creating a double strand break in a genomic target sequence said plant genome.
  • the plant comprises a recombinant DNA construct and a guide RNA, wherein said recombinant DNA construct comprises a promoter operably linked to a nucleotide sequence encoding a plant optimized Cas9 endonuclease, wherein said plant optimized Cas9 endonuclease and guide RNA are capable of forming a complex and creating a double strand break in a genomic target sequence said plant genome.
  • the recombinant DNA construct comprises a promoter operably linked to a nucleotide sequence encoding a plant optimized Cas9 endonuclease, wherein said plant optimized Cas9 endonuclease is capable of binding to and creating a double strand break in a genomic target sequence said plant genome.
  • the recombinant DNA construct comprises a promoter operably linked to a nucleotide sequence expressing a guide RNA, wherein said guide RNA is capable of forming a complex with a plant optimized Cas9 endonuclease, and wherein said complex is capable of binding to and creating a double strand break in a genomic target sequence said plant genome.
  • the method comprises a method for selecting a male sterile or male fertile plant, the method comprising selecting at least one progeny plant that comprises an alteration at a genomic target site located in a male fertility gene locus, wherein said progeny plant is obtained by crossing a first plant expressing a Cas9 endonuclease to a second plant comprising a guide RNA, wherein said Cas endonuclease is capable of introducing a double strand break at said genomic target site.
  • the method comprises a method for producing a male sterile or male fertile plant, the method comprising: a) obtaining a first plant comprising at least one Cas endonuclease capable of introducing a double strand break at a genomic target site located in a male fertility gene locus in the plant genome; b) obtaining a second plant comprising a guide RNA that is capable of forming a complex with the Cas endonuclease of (a), c) crossing the first plant of (a) with the second plant of (b); d) evaluating the progeny of (c) for an alteration in the target site; and e) selecting a progeny plant that is male sterile or male fertile.
  • Male fertility genes can be selected from, but are not limited to MS26, MS45, MSCA1 genes
  • compositions and methods are also provided for editing a nucleotide sequence in the genome of a cell.
  • the disclosure describes a method for editing a nucleotide sequence in the genome of a plant cell, the method comprising providing a guide RNA, a polynucleotide modification template, and at least one maize optimized Cas9 endonuclease to a plant cell, wherein the maize optimized Cas9 endonuclease is capable of introducing a double-strand break at a target site in the plant genome, wherein said polynucleotide modification template includes at least one nucleotide modification of said nucleotide sequence.
  • the nucleotide to be edited (the nucleotide sequence of interest) can be located within or outside a target site that is recognized and cleaved by a Cas endonuclease.
  • Cells include, but are not limited to, human, animal, bacterial, fungal, insect, and plant cells as well as plants and seeds produced by the methods described herein.
  • FIG. 1A shows a maize optimized Cas9 gene (encoding a Cas9 endonuclease) containing a potato ST-LS1 intron, a SV40 amino terminal nuclear localization sequence (NLS), and a VirD2 carboxyl terminal NLS, operably linked to a plant ubiquitin promoter (SEQ ID NO: 5).
  • the maize optimized Cas9 gene (just Cas9 coding sequence, no NLSs) corresponds to nucleotide positions 2037-2411 and 2601-6329 of SEQ ID NO: 5 with the potato intron residing at positions 2412-2600 of SEQ ID NO: 5.
  • SV40 NLS is at positions 2010-2036 of SEQ ID NO: 5.
  • FIG. 1B shows a long guide RNA operably linked to a maize U6 polymerase III promoter terminating with a maize U6 terminator (SEQ ID NO: 12).
  • the long guide RNA containing the variable targeting domain corresponding to the maize LIGCas-3 target site (SEQ ID NO: 8) is transcribed from/corresponds to positions 1001-1094 of SEQ ID NO: 12.
  • FIG. 1C shows the maize optimized Cas9 and long guide RNA expression cassettes combined on a single vector DNA (SEQ ID NO: 102).
  • FIG. 2A illustrates the duplexed crRNA (SEQ ID NO:6)-tracrRNA (SEQ ID NO:7)/Cas9 endonuclease system and target DNA complex relative to the appropriately oriented PAM sequence at the maize LIGCas-3 (SEQ ID NO: 18, Table 1) target site with triangles pointing towards the expected site of cleavage on both sense and anti-sense DNA strands.
  • FIG. 2 B illustrates the guide RNA/Cas9 endonuclease complex interacting with the genomic target site relative to the appropriately oriented PAM sequence (GGA) at the maize genomic LIGCas-3 target site (SEQ ID NO:18, Table 1).
  • the guide RNA (shown as boxed-in in light gray, SEQ ID NO:8) is a fusion between a crRNA and tracrRNA and comprises a variable targeting domain that is complementary to one DNA strand of the double strand DNA genomic target site.
  • the Cas9 endonuclease is shown in dark gray. Triangles point towards the expected site of DNA cleavage on both sense and anti-sense DNA strands.
  • FIG. 3A-3B shows an alignment and count of the top 10 most frequent NHEJ mutations induced by the maize optimized guide RNA/Cas endonuclease system described herein compared to a LIG3-4 homing endonuclease control at the maize genomic Liguleless 1 locus.
  • the mutations were identified by deep sequencing.
  • the reference sequence represents the unmodified locus with each target site underlined.
  • the PAM sequence and expected site of cleavage are also indicated. Deletions or insertions as a result of imperfect NHEJ are shown by a “-” or an italicized underlined nucleotide, respectively.
  • the reference and mutations 1-10 of the LIGCas-1 target site correspond to SEQ ID NOs: 55-65, respectively.
  • the reference and mutations 1-10 of the LIGCas-2 correspond to SEQ ID NOs: 55, 65-75, respectively.
  • the reference and mutations 1-10 of the LIGCas-3 correspond to SEQ ID NOs: 76-86, respectively.
  • the reference and mutations 1-10 of the LIG3-4 homing endonuclease target site correspond to SEQ ID NOs: 76, 87-96, respectively.
  • FIG. 4 illustrates how the homologous recombination (HR) repair DNA vector (SEQ ID NO: 97) was constructed.
  • HR homologous recombination
  • FIG. 5 illustrates how genomic DNA extracted from stable transformants was screened for site-specific transgene insertion by PCR.
  • Genomic primers corresponding to SEQ ID NOs: 98 and 101
  • the Liguleless 1 locus were designed outside of the regions used in constructing the HR repair DNA vector (SEQ ID NO: 97) and were paired with primers inside the transgene (corresponding to SEQ ID NOs: 99 and 100) to facilitate PCR detection of unique genomic DNA junctions created by appropriately oriented site-specific transgene integration.
  • FIG. 6 shows an alignment of the NHEJ mutations induced by the maize optimized guide RNA/Cas endonuclease system, described herein, when the short guide RNA was delivered directly as RNA.
  • the mutations were identified by deep sequencing.
  • the reference illustrates the unmodified locus with the genomic target site underlined.
  • the PAM sequence and expected site of cleavage are also indicated.
  • Deletions or insertions as a result of imperfect NHEJ are shown by a “-” or an italicized underlined nucleotide, respectively.
  • the reference and mutations 1-6 for 55CasRNA-1 correspond to SEQ ID NOs: 104-110, respectively.
  • FIG. 7 shows the QC782 vector comprising the Cas9 expression cassette.
  • FIG. 8A shows the QC783 vector comprising the guide RNA expression cassette.
  • FIG. 8B show the DNA sequence (coding sequence) of the DD43CR1 (20 bp) variable targeting domain of the guide RNA, as well as the terminator sequence linked to the guide RNA.
  • the 20 bp variable targeting domain DD43CR1 is in bold
  • FIG. 9 shows the map of a linked soybean optimized Cas9 and guide RNA construct QC815.
  • FIG. 10A shows the DD20 soybean locus on chromosome 4 and the DD20CR1 and DD20CR2 genomic target sites (indicated by bold arrows).
  • FIG. 10B shows the DD43 soybean locus on chromosome 4 and the DD43CR1 and DD43CR2 genomic target sites (indicated by bold arrows).
  • FIG. 11A-11D Alignments of expected target site sequences with mutant target sequences detected in four guide RNA induced NHEJ experiments.
  • FIG. 11A shows the DD20CR1 PCR amplicon (reference sequence, SEQ ID NO:142, genomic target site is underlined) and the 10 mutations (SEQ ID NOs: 147-156) induced by the guideRNA/Cas endonuclease system at the DD20CR1 genomic target site.
  • FIG. 11B shows the DD20CR2 PCR amplicon (reference sequence, SEQ ID NO:143) and the 10 mutations (SEQ ID NOs 157-166) induced by the guide RNA/Cas endonuclease system at the DD20CR2 genomic target site.
  • FIG. 11A shows the DD20CR1 PCR amplicon (reference sequence, SEQ ID NO:142, genomic target site is underlined) and the 10 mutations (SEQ ID NOs: 147-156) induced by the guideRNA/Ca
  • FIG. 11C shows the DD43CR1 PCR amplicon (reference sequence, SEQ ID NO:144) and the mutations (SEQ ID NOs:167-176) induced by the guide RNA/Cas endonuclease system at the DD43CR1 genomic target site.
  • FIG. 11D shows the DD43CR2 PCR amplicon (reference sequence, SEQ ID NO: 145) and the 10 mutations (SEQ ID NOs: 177-191) induced by the guide RNA/Cas endonuclease system at the DD43CR2 genomic target site.
  • the target sequences corresponding different guide RNAs are underlined. Each nucleotide deletions is indicated by “-”. Inserted and replaced sequences are in bold. The total number of each mutant sequence is listed in the last column.
  • FIG. 12A-12B shows a schematic representation of the guide RNA/Cas endonuclease system used for editing a nucleotide sequence of interest.
  • a polynucleotide modification template that includes at least one nucleotide modification (when compared to the nucleotide sequence to be edited) is introduced into a cell together with the guide RNA and Cas endonuclease expression cassettes.
  • the nucleotide sequence to be edited is an endogenous wild type enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in maize cells.
  • EPSPS enolpyruvylshikimate-3-phosphate synthase
  • the Cas endonuclease (shaded circle) is a maize optimized Cas9 endonuclease that cleaves a moCas9 target sequence within the epsps genomic locus using a guide RNA of SEQ ID NO:194.
  • FIG. 12-A shows a polynucleotide modification template that includes three nucleotide modifications (when compared to the wild type epsps locus depicted in FIG. 12-B ) flanked by two homology regions HR-1 and HR-2.
  • FIG. 12-B shows the guide RNA/maize optimized Cas9 endonuclease complex interacting with the epsps locus.
  • the original nucleotide codons of the EPSPS gene that needed to be edited are show as aCT and Cca ( FIG. 12-B ).
  • the nucleotide codons with modified nucleotides (shown in capitals) are shown as aTC and Tca ( FIG. 12-B ).
  • FIG. 13 shows a diagram of a maize optimized Cas9 endonuclease expression cassette.
  • the bacterial cas9 coding sequence was codon optimized for expression in maize cells and supplemented with the ST-LS1 potato intron (moCas9 coding sequence, SEQ ID NO: 193).
  • a DNA fragment encoding the SV40 nuclear localization signal (NLS) was fused to the 5′-end of the moCas9 coding sequence.
  • a maize ubiquitin promoter (Ubi promoter) and its cognate intron (ubi intron) provided controlling elements for the expression of moCas9 in maize cells.
  • the pinII transcription termination sequence pinII completed the maize moCAS9 gene design.
  • FIG. 14 shows some examples of the moCas9 target sequence (underlined), located on EPSPS DNA fragments, mutagenized by the introduction of double-strand breaks at the cleavage site of the moCas9 endonuclease (thick arrow) in maize cells.
  • SEQ ID NO: 206 three nucleotides were deleted (dashes) next to the moCas9 cleavage site.
  • SEQ ID NOs: 207-208 indicate that the nucleotide deletion can expand beyond the moCAs9 cleavage site
  • FIG. 15 depicts an EPSPS template vector used for delivery of the EPSPS polynucleotide modification template containing the three TIPS nucleotide modifications.
  • the EPSP polynucleotide modification template includes a partial fragment of the EPSPS gene.
  • the vector was 6,475 bp in length and consisted of two homology regions to the epsps locus (epsps-HR1 and epsps-HR2).
  • Two Gateway cloning sites (ATTL4 and ATTL3), an antibiotic resistance gene (KAN), and the pUC origin of replication (PUC ORI) completed synthesis of the EPSPS template vector1.
  • FIG. 16 illustrates the PCR-based screening strategy for the identification of maize events with TIPS nucleotide modifications in maize cells.
  • Two pairs of PCR primers were used to amplify the genomic fragments of the epsps locus (upper section). Both of them contained the TIPS specific primers (an arrow with a dot indicating the site of the three TIPS modifications).
  • the shorter fragment (780 bp F-E2) was produced by amplification of the EPSPS polynucleotide modification template fragment (template detection).
  • the amplified EPSPS polynucleotide modification template fragment was found in all but 4 analyzed events (panel F-E2).
  • the longer fragment (839 bp H-T) was produced by amplification of the genomic EPSPS sequence providing that the epsps locus contained the three nucleotide modifications responsible for the TIPS modifications.
  • Six events were identified as containing the three nucleotide modifications (panel H-T).
  • the white arrows point to events that contain both the amplified EPSPS polynucleotide modification template and the nucleotide modifications responsible for the TIPS modification.
  • FIG. 17A shows a schematic diagram of the PCR protocol used to identify edited EPSPS DNA fragments in selected events.
  • a partial genomic fragment comprising parts of Exon1, Intron 1 and Exon2 of the epsps locus, was amplified regardless of the editing product (panel A, 1050 bp F-E3).
  • the amplification products representing only partial EPSPS gene sequences having one or more mutations, were cloned and sequenced.
  • FIG. 17B shows 2 examples of sequenced amplification products.
  • the epsps nucleotides and the moCas9 target sequence underlined
  • three specific nucleotide substitutions (representing the TIPS modifications) were identified with no mutations at the moCas9 target sequence (underlined) (SEQ ID NO: 209).
  • FIG. 18 shows the location of MHP14, TS8, TS9 and TS10 loci comprising target sites for the guide RNA/Cas endonuclease system near trait A (located at 53.14 cM) on chromosome 1 of maize.
  • FIG. 19A shows the location of the MHP14Cas1 maize genomic target sequence (SEQ ID NO: 229) and the MSP14Cas-3 maize genomic target sequence (SEQ ID NO: 230) on the MHP14 maize genomic DNA locus on chromosome1.
  • FIG. 19B shows the location of the TS8Cas-1 (SEQ ID NO: 231) and TS8Cas-2 (SEQ ID NO: 232) maize genomic target sequences located on the TS8 locus.
  • FIG. 19C shows the location of the TS9Cas-2 (SEQ ID NO: 233) and TS9Cas-3 (SEQ ID NO: 234) maize genomic target sequences located on the TS8 locus.
  • FIG. 19B shows the location of the TS8Cas-1 (SEQ ID NO: 231) and TS8Cas-2 (SEQ ID NO: 232) maize genomic target sequences located on the TS8 locus.
  • FIG. 19D shows the location of the TS10Cas-1 (SEQ ID NO: 235), and TS10Cas-3 (SEQ ID NO: 236) maize genomic target sequences located on the TS10 locus. All these maize genomic target sites are recognized are recognized and cleaved by a guide RNA/Cas endonuclease system described herein. Each maize genomic target sequence (indicated by an arrow) is highlighted in bold and followed by the NGG PAM sequence shown boxed in.
  • FIG. 20 shows a schematic of a donor DNA (also referred to as HR repair DNA) comprising a transgene cassette with a selectable marker (phosphomannose isomerase, depicted in grey), flanked by homologous recombination sequences (HR1 and HR2) of about 0.5 to 1 kb in length, used to introduce the transgene cassette into a genomic target site for the guide RNA/Cas endonuclease system.
  • the arrows indicate the sections of the genomic DNA sequence on either side of the endonuclease cleavage site that corresponds to the homologous regions of the donor DNA.
  • This schematic is representative for homologous recombination occurring at any one of the 8 target sites (4 loci) located on chromosome 1 from 51.54 cM to 54.56 cM in maize genome.
  • FIG. 21 shows the junction PCR screen for identification of insertion events.
  • Primer 1 and 2 located on the transgene donor are common for all target sites.
  • Primer TSHR1f is located on the genomic region outside of the homologous sequence HR1.
  • Primer combination THR1f/primer1 amplify junction 1.
  • Primer TSHR2r is located on the genomic region outside of the HR2 region.
  • Primer combination primer2/TSHR2r amplify junction 2.
  • FIG. 22 shows a junction PCR screen for identification of insertion events at the TS10Cas10 locus.
  • a gel picture indicates the presence of insertion events at the TS10Cas10-1 target site (lane 02 A1).
  • PCR reaction of HR1 and HR2 junction loaded next to each other (lane 02-white label and lane 02-gray label), with white label representing HR1 junction PCR, gray label representing HR2 junction PCR.
  • FIG. 23 A-B DNA expression cassettes used in gRNA/Cas9 mediated genome modification experiments.
  • the Cas9 endonuclease cassette (EF1A2:CAS9) comprising a soybean EF1A2 promoter (GM-EF1A2 PRO) driving the soybean codon optimized Cas9 endonucleases (CAS9(SO), a soybean optimized SV40 nuclear localization signal (SV40 NLS(SO)) and a PINII terminator (PINII TERM) was linked to a guide RNA expression cassette (U6-9.1:DD20CR1, comprising a soybean U6 promoter driving the DD20CR1 guide RNA) used in experiment U6-9.1DD20CR1 (Table 27).
  • a guide RNA expression cassette (U6-9.1:DD20CR1, comprising a soybean U6 promoter driving the DD20CR1 guide RNA) used in experiment U6-9.1DD20CR1 (Table 27).
  • DD20HR1-SAMS:HPT-DD20HR2 The donor DNA cassette (DD20HR1-SAMS:HPT-DD20HR2) used in experiment U6-9.1DD20CR1 (Table 27). DD20HR1 and DD20HR2 homologous DNA regions between the donor DNA cassette and the genomic DNA sequences flanking the DD20 target site).
  • Other Donor DNA cassettes listed in Table 27 are identical except for the DD43HR1 and DD43HR2 regions in two of them.
  • FIG. 24 A-C DD20 and DD43 soybean genomic target sites locations and qPCR amplicons.
  • FIG. 25 A-C Schematic of guide RNA/Cas9 system mediated site-specific non-homologous end joining (NHEJ) and transgene insertion via homologous recombination (HR) at DD20CR1 site.
  • NHEJ non-homologous end joining
  • HR homologous recombination
  • the breaks can be repaired spontaneously as NHEJs or repaired as a HR event by the donor DNA facilitated by the flanking homologous regions DD20-HR1 and DD20HR2.
  • B) NHEJs are detected by DD20-specific qPCR and the mutated sequences are assessed by sequencing cloned HR1-HR2 PCR fragments.
  • C) HR events are revealed by two border-specific PCR analyses HR1-SAMS and NOS-HR2, noting that the primers are only able to amplify DNA recombined between the DD20CR1 region of chromosome 04 and the donor DNA.
  • Guide RNA/Cas9 mediated NHEJ and HR at DD20-CR2 site follow the same process except for using DD20-CR2 guide RNA.
  • Guide RNA/Cas9 mediated site-specific NHEJ and HR at DD43CR1 and DD43CR2 sites follow the same process except for using guide RNA and homologous regions specific to the DD43 sites.
  • FIG. 26 A-C Sequences of gRNA/Cas9 system mediated NHEJs. Only 60 bp sequences surrounding the genomic target site shown in bold case are aligned to show the mutations. The PAM sequence is shown boxed in. Insertion sequences are indicated by symbol ⁇ marking the insertion position followed by the size of the insert. Actual insertion sequences are listed in the sequences listing.
  • FIG. 27 A-C shows the ten most prevalent types of NHEJ mutations recovered based on the crRNA/tracrRNA/Cas endonuclease system.
  • FIG. 27A shows NHEJ mutations for LIGCas-1 target site, corresponding to SEQ ID NOs: 415-424
  • FIG. 27B shows NHEJ mutations for LIGCas-2 target site corresponding to SEQ ID NOs: 425-43
  • FIG. 27V shows NHEJ mutations (for LIGCas-3 target site corresponding to SEQ ID NOs: 435-444).
  • FIG. 28 Schematic representation of Zm-GOS2 PRO:GOS2 INTRON insertion in the 5′-UTR of maize ARGOS8 gene by targeting the guide RNA/Cas9 target sequence 1 (CTS1, SEQ ID NO: 1) with the gRNA1/Cas9 endonuclease system, described herein.
  • CTS1 and HR2 indicate homologous recombination regions.
  • FIG. 29 A-C Identification and analysis of Zm-GOS2 PRO:GOS2 INTRON insertion events in maize plants.
  • A Schematic representation of Zm-GOS2 PRO:GOS2 INTRON insertion in the 5′-UTR of Zm-ARGOS8. CTS1 was targeted with the gRNA1/Cas9 endonuclease system, described herein. HR1 and HR2 indicate homologous recombination regions. P1 to P4 indicate PCR primers.
  • B PCR screening of PMI-resistance calli to identify insertion events. PCR results are shown for 13 representative calli. The left and right junction PCRs were carried out with the primer pair P1+P2 and P3+P4, respectively.
  • C PCR analysis of a T0 plant. A PCR product with the expected size (2.4 kb, Lane T0) was amplified with the primer P3 and P4.
  • FIG. 30 Schematic representation of Zm-ARGOS8 promoter substitution with Zm-GOS2 PRO:GOS2 INTRON by targeting CTS3 (SEQ ID NO: 3) and CTS2 (SEQ ID NO:2).
  • HR1 and HR2 indicate homologous recombination regions.
  • FIG. 31 A-D Substitution of the native promoter of the ARGOS8 gene with Zm-GOS2 PRO:GOS2 INTRON in maize plants.
  • A Schematic representation of the Zm-GOS2 PRO:GOS2 INTRON:ARGOS8 allele generated by promoter swap. Two guide RNA/Cas9 target sites, CTS3 (SEQ ID NO:3) and CTS2 (SEQ ID NO:2), were targeted with a gRNA3/gRNA2/Cas9 system. HR1 and HR2 indicate homologous recombination regions. P1 to P5 indicate PCR primers.
  • B PCR screening of PMI-resistance calli to identify swap events. PCR results are shown for 10 representative calli.
  • One callus sample, 12A09 is positive for both left junction (L, primer P1+P2) and right junction (R, primer P5+P4) PCR, indicating that 12A09 is a swap event.
  • C PCR analysis of the callus events identified in primary screening. PCR products with the expected size (2.4 kb) were amplified using the primer P3 and P4 from event #3, 4, 6, 8 and 9, indicating presence of the Zm-GOS2 PRO:GOS2 INTRON:ARGOS8 allele.
  • D PCR analysis of a T0 plant. A PCR product with the expected size (2.4 kb, Lane T0) was amplified with the primer P3 and P4.
  • FIG. 32 A-B Deletion of the native promoter of the ARGOS8 gene in maize plants.
  • A Schematic representation of promoter deletion. Two guide RNA's and a Cas9 endonuclease system, referred to as a gRNA3/gRNA2/Cas9 system, were used to target the CTS3 and CTS2 sites in Zm-ARGOS8. P1 and P4 indicate PCR primers for deletion event screening.
  • B PCR screening of PMI-resistance calli to identify deletion events. PCR results are shown for 15 representative calli. A 1.1-kp PCR product indicates deletion of the CTS3/CTS2 fragment.
  • FIG. 33 Schematic representation of enhancer element deletions using the guide RNA/Cas9 target sequence.
  • the enhancer element to be deleted can be, but is not limited to, a 35S enhancer element.
  • FIG. 34 A-C Modification of a maize EPSPS polyubiquitination site.
  • A The selected maize EPSPS polyubiquitination site is compared to the analogous sites of other plant species.
  • B The nucleotides to be edited in the maize EPSPS coding sequence (underlined, encoded amino acid shown in bold).
  • C The edited EPSPS coding sequence identified in the selected T0 plant.
  • FIG. 35 A-C The intron mediated enhanced element (A).
  • the 5′ section of the first intron of the EPSPS gene (editing: substitutions underlined and deletions represented by dots) (B) and its edited version conferring three IMEs elements (underlined).
  • the edited nucleotides are shown in bold (C).
  • FIG. 36 A-B Alternatively spliced EPSPS mRNA in maize cells.
  • a left panel represents analysis of EPSPS cDNA.
  • the lane I4 in FIG. 36A shows amplification of the EPSPS pre-mRNA containing the 3 rd intron unspliced (the 804 bp diagnostic fragment as shown in FIG. 36 B indicates an alternate splicing event).
  • Lanes E3 and F8 show the EPSPS PCR amplified fragments with spliced introns. These diagnostic fragments are not amplified unless cDNA is synthesized (as is evident by the absence of bands in lanes E3, I4, and F8 comprising total RNA (shown in the total RNA panel on right of FIG. 36A ).
  • the grey boxes in FIG. 36 B represent the eight EPSPS exons (their sizes are indicated above each of them).
  • FIG. 37 Splicing site at the junction between the second EPSPS intron and the third exon (bolded). The nucleotide to be edited is underlined.
  • FIG. 38 Schematic representation of Southern hybridization analysis of T0 and T1 maize plants.
  • SEQ ID NO: 1 is the nucleotide sequence of the Cas9 gene from Streptococcus pyogenes M1 GAS (SF370).
  • SEQ ID NO: 2 is the nucleotide sequence of the potato ST-LS1 intron.
  • SEQ ID NO: 3 is the amino acid sequence of SV40 amino N-terminal.
  • SEQ ID NO: 4 is the amino acid sequence of Agrobacterium tumefaciens bipartite VirD2 T-DNA border endonuclease carboxyl terminal.
  • SEQ ID NO: 5 is the nucleotide sequence of an expression cassette expressing the maize optimized Cas9.
  • SEQ ID NO: 6 is the nucleotide sequence of crRNA containing the LIGCas-3 target sequence in the variable targeting domain.
  • SEQ ID NO: 7 is the nucleotide sequence of the tracrRNA.
  • SEQ ID NO: 8 is the nucleotide sequence of a long guide RNA containing the LIGCas-3 target sequence in the variable targeting domain.
  • SEQ ID NO: 9 is the nucleotide sequence of the Chromosome 8 maize U6 polymerase III promoter.
  • SEQ ID NO: 10 list two copies of the nucleotide sequence of the maize U6 polymerase III terminator.
  • SEQ ID NO: 11 is the nucleotide sequence of the maize optimized short guide RNA containing the LIGCas-3 variable targeting domain.
  • SEQ ID NO: 12 is the nucleotide sequence of the maize optimized long guide RNA expression cassette containing the LIGCas-3 variable targeting domain.
  • SEQ ID NO: 13 is the nucleotide sequence of the Maize genomic target site MS26Cas-1 plus PAM sequence.
  • SEQ ID NO: 14 is the nucleotide sequence of the Maize genomic target site MS26Cas-2 plus PAM sequence.
  • SEQ ID NO: 15 is the nucleotide sequence of the Maize genomic target site MS26Cas-3 plus PAM sequence.
  • SEQ ID NO: 16 is the nucleotide sequence of the Maize genomic target site LIGCas-2 plus PAM sequence.
  • SEQ ID NO: 17 is the nucleotide sequence of the Maize genomic target site LIGCas-3 plus PAM sequence.
  • SEQ ID NO: 18 is the nucleotide sequence of the Maize genomic target site LIGCas-4 plus PAM sequence.
  • SEQ ID NO: 19 is the nucleotide sequence of the Maize genomic target site MS45Cas-1 plus PAM sequence.
  • SEQ ID NO: 20 is the nucleotide sequence of the Maize genomic target site MS45Cas-2 plus PAM sequence.
  • SEQ ID NO: 21 is the nucleotide sequence of the Maize genomic target site MS45Cas-3 plus PAM sequence.
  • SEQ ID NO: 22 is the nucleotide sequence of the Maize genomic target site ALSCas-1 plus PAM sequence.
  • SEQ ID NO: 23 is the nucleotide sequence of the Maize genomic target site ALSCas-2 plus PAM sequence.
  • SEQ ID NO: 24 is the nucleotide sequence of the Maize genomic target site ALSCas-3 plus PAM sequence.
  • SEQ ID NO: 25 is the nucleotide sequence of the Maize genomic target site EPSPSCas-1 plus PAM sequence.
  • SEQ ID NO: 26 is the nucleotide sequence of the Maize genomic target site EPSPSCas-2 plus PAM sequence.
  • SEQ ID NO: 27 is the nucleotide sequence of the Maize genomic target site EPSPSCas-3 plus PAM sequence.
  • SEQ ID NOs: 28-52 are the nucleotide sequence of target site specific forward primers for primary PCR as shown in Table 2.
  • SEQ ID NO: 53 is the nucleotide sequence of the forward primer for secondary PCR.
  • SEQ ID NO: 54 is the nucleotide sequence of Reverse primer for secondary PCR
  • SEQ ID NO: 55 is the nucleotide sequence of the unmodified reference sequence for LIGCas-1 and LIGCas-2 locus.
  • SEQ ID Nos: 56-65 are the nucleotide sequences of mutations 1-10 for LIGCas-1.
  • SEQ ID NOs: 66-75 are the nucleotide sequences of mutations 1-10 for LIGCas-2.
  • SEQ ID NO: 76 is the nucleotide sequence of the unmodified reference sequence for the LIGCas-3 and LIG3-4 homing endonuclease locus.
  • SEQ ID NOs: 77-86 are the nucleotide sequences of mutations 1-10 for LIGCas-3.
  • SEQ ID NOs: 88-96 are the nucleotide sequences of mutations 1-10 for LIG3-4 homing endonuclease locus.
  • SEQ ID NO: 97 is the nucleotide sequence of a donor vector referred to as an HR Repair DNA.
  • SEQ ID NO: 98 is the nucleotide sequence of forward PCR primer for site-specific transgene insertion at junction 1.
  • SEQ ID NO: 99 is the nucleotide sequence of reverse PCR primer for site-specific transgene insertion at junction 1.
  • SEQ ID NO: 100 is the nucleotide sequence of forward PCR primer for site-specific transgene insertion at junction 2.
  • SEQ ID NO: 101 is the nucleotide sequence of reverse PCR primer for site-specific transgene insertion at junction 2.
  • SEQ ID NO: 102 is the nucleotide sequence of the linked Cas9 endonuclease and LIGCas-3 long guide RNA expression cassettes
  • SEQ ID NO: 103 is the nucleotide sequence of Maize genomic target site 55CasRNA-1 plus PAM sequence.
  • SEQ ID NO: 104 is the nucleotide sequence of the unmodified reference sequence for 55CasRNA-1 locus.
  • SEQ ID NOs: 105-110 are the nucleotide sequences of mutations 1-6 for 55CasRNA-1.
  • SEQ ID NO: 111 is the nucleotide sequence of LIG3-4 homing endonuclease target site
  • SEQ ID NO: 112 is the nucleotide sequence of LIG3-4 homing endonuclease coding sequence.
  • SEQ ID NO: 113 is the nucleotide sequence of the MS26++ homing endonuclease target site.
  • SEQ ID NO: 114 is the nucleotide sequence of MS26++ homing endonuclease coding sequence
  • SEQ ID NO: 115 is the nucleotide sequence of the soybean codon optimized Cas9 gene.
  • SEQ ID NO: 116 is the nucleotide sequence of the soybean constitutive promoter GM-EF1A2.
  • SEQ ID NO: 117 is the nucleotide sequence of linker SV40 NLS.
  • SEQ ID NO: 118 is the amino acid sequence of soybean optimized Cas9 with a SV40 NLS.
  • SEQ ID NO: 119 is the nucleotide sequence of vector QC782.
  • SEQ ID NO: 120 is the nucleotide sequence of soybean U6 polymerase III promoter described herein, GM-U6-13.1 PRO.
  • SEQ ID NO: 121 is the nucleotide sequence of the guide RNA in FIG. 8B .
  • SEQ ID NO: 122 is the nucleotide sequence of vector QC783.
  • SEQ ID NO: 123 is the nucleotide sequence of vector QC815.
  • SEQ ID NO: 124 is the nucleotide sequence of a Cas9 endonuclease (cas9-2) from S. pyogenes.
  • SEQ ID NO: 125 is the nucleotide sequence of the DD20CR1 soybean target site
  • SEQ ID NO: 126 is the nucleotide sequence of the DD20CR2 soybean target site
  • SEQ ID NO: 127 is the nucleotide sequence of the DD43CR1 soybean target site
  • SEQ ID NO: 128 is the nucleotide sequence of the DD43CR2 soybean target site
  • SEQ ID NO: 129 is the nucleotide sequence of the DD20 sequence in FIG. 10A .
  • SEQ ID NO: 130 is the nucleotide sequence of the DD20 sequence complementary in FIG. 10A .
  • SEQ ID NO: 131 is the nucleotide sequence of DD43 sequence.
  • SEQ ID NO: 132 is the nucleotide sequence of the DD43 complementary sequence.
  • SEQ ID NO: 133-141 are primer sequences.
  • SEQ ID NO: 142 is the nucleotide sequence of the DD20CR1 PCR amplicon.
  • SEQ ID NO: 143 is the nucleotide sequence of the DD20CR2 PCR amplicon.
  • SEQ ID NO: 144 is the nucleotide sequence of the DD43CR1 PCR amplicon.
  • SEQ ID NO: 145 is the nucleotide sequence of the DD43CR2 PCR amplicon.
  • SEQ ID NO: 146 is the nucleotide sequence of the DD43CR2 PCR amplicon.
  • SEQ ID NO: 147-156 are the nucleotide sequence of mutations 1 to 10 for the DD20CR1 target site
  • SEQ ID NO: 157-166 are the nucleotide sequence of mutations 1 to 10 for the DD20CR2 target site
  • SEQ ID NO: 167-176 are the nucleotide sequence of mutations 1 to 10 for the DD43CR1 target site
  • SEQ ID NO: 177-191 are the nucleotide sequence of mutations 1 to 10 for the DD43CR2 target site.
  • SEQ ID NO: 192 is the amino acid sequence of a maize optimized version of the Cas9 protein.
  • SEQ ID NO: 193 is the nucleotide sequence of the maize optimized version of the Cas9 gene of SEQ ID NO: 192.
  • SEQ ID NO: 194 is the DNA version of guide RNA (EPSPS sgRNA).
  • SEQ ID NO: 195 is the EPSPS polynucleotide modification template.
  • SEQ ID NO: 196 is a nucleotide fragment comprising the TIPS nucleotide modifications.
  • SEQ ID NO: 197-204 are primer sequences shown in Table 15.
  • SEQ ID NO: 205-208 are nucleotide fragments shown in FIG. 14 .
  • SEQ ID NO: 209 is an example of a TIPS edited EPSPS nucleotide sequence fragment shown in FIG. 17 .
  • SEQ ID NO: 210 is an example of a Wild-type EPSPS nucleotide sequence fragment shown in FIG. 17 .
  • SEQ ID NO: 211 is the nucleotide sequence of a maize enolpyruvylshikimate-3-phosphate synthase (epsps) locus
  • SEQ ID NO: 212 is the nucleotide sequence of a Cas9 endonuclease (genbank CS571758.1) from S. thermophiles.
  • SEQ ID NO: 213 is the nucleotide sequence of a Cas9 endonuclease (genbank CS571770.1) from S. thermophiles.
  • SEQ ID NO: 214 is the nucleotide sequence of a Cas9 endonuclease (genbank CS571785.1) from S. agalactiae.
  • SEQ ID NO: 215 is the nucleotide sequence of a Cas9 endonuclease, (genbank CS571790.1) from S. agalactiae.
  • SEQ ID NO: 216 is the nucleotide sequence of a Cas9 endonuclease (genbank CS571790.1) from S. mutant.
  • SEQ ID Nos: 217-228 are primer and probe nucleotide sequences described in Example 17.
  • SEQ ID NOs: 229 is the nucleotide sequence of the MHP14Cas1 target site.
  • SEQ ID NOs: 230 is the nucleotide sequence of the MHP14Cas3 target site.
  • SEQ ID NOs: 231 is the nucleotide sequence of the TS8Cas1 target site.
  • SEQ ID NOs: 232 is the nucleotide sequence of the TS8Cas2 target site.
  • SEQ ID NOs: 233 is the nucleotide sequence of the TS9Cas2 target site.
  • SEQ ID NOs: 234 is the nucleotide sequence of the TS9Cas3 target site.
  • SEQ ID NOs: 235 is the nucleotide sequence of the TS10Cas1 target site.
  • SEQ ID NOs: 236 is the nucleotide sequence of the TS10Cas3 target site.
  • SEQ ID NOs: 237-244 are the nucleotide sequences shown in FIG. 19A-D .
  • SEQ ID NOs: 245-252 are the nucleotide sequences of the guide RNA expression cassettes described in Example 18.
  • SEQ ID Nos: 253-260 are the nucleotide sequences of donor DNA expression cassettes described in Example 18.
  • SEQ ID Nos: 261-270 are the nucleotide sequences of the primers described in Example 18.
  • SEQ ID Nos: 271-294 are the nucleotide sequences of the primers and probes described in Example 18.
  • SEQ ID NO: 295 is the nucleotide sequence of GM-U6-13.1 PRO, a soybean U6 polymerase III promoter described herein,
  • SEQ ID NOs: 298, 300, 301 and 303 are the nucleotide sequences of the linked guideRNA/Cas9 expression cassettes.
  • SEQ ID Nos: 299 and 302 are the nucleotide sequences of the donor DNA expression cassettes.
  • SEQ ID Nos: 271-294 are the nucleotide sequences of the primers and probes described in Example 18.
  • SEQ ID NO: 304 is the nucleotide sequence of the DD20 qPCR amplicon.
  • SEQ ID NO: 305 is the nucleotide sequence of the DD43 qPCR amplicon.
  • SEQ ID Nos: 306-328 are the nucleotide sequences of the primers and probes described herein.
  • SEQ ID NOs: 329-334 are the nucleotide sequences of PCR amplicons described herein.
  • SEQ ID NO: 335 is the nucleotide sequence of a soybean genomic region comprising the DD20CR1 target site.
  • SEQ ID NO: 364 is the nucleotide sequence of a soybean genomic region comprising the DD20CR2 target site.
  • SEQ ID NO: 386 is the nucleotide sequence of a soybean genomic region comprising the DD43CR1 target site.
  • SEQ ID NOs: 336-363, 365-385 and 387-414 are the nucleotide sequences of shown in FIG. 26 A-C.
  • SEQ ID NOs: 415-444 are the nucleotide sequences of NHEJ mutations recovered based on the crRNA/tracrRNA/Cas endonuclease system shown in FIG. 27A-C .
  • SEQ ID NO: 445-447 are the nucleotide sequence of the LIGCas-1, LIGCas2 and LIGCas3 crRNA expression cassettes, respectively.
  • SEQ ID NO: 448 is the nucleotide sequence of the tracrRNA expression cassette.
  • SEQ ID NO: 449 is the nucleotide sequence of LIGCas-2 forward primer for primary PCR
  • SEQ ID NO: 450 is the nucleotide sequence of LIGCas-3 forward primer for primary PCR.
  • SEQ ID NO: 451 is the nucleotide sequence of the maize genomic Cas9 endonuclease target site Zm-ARGOS8-CTS1.
  • SEQ ID NO: 452 is the nucleotide sequence of the maize genomic Cas9 endonuclease target site Zm-ARGOS8-CTS2.
  • SEQ ID NO: 453 is the nucleotide sequence of the maize genomic Cas9 endonuclease target site Zm-ARGOS8-CTS3
  • SEQ ID Nos: 454-458 are the nucleotide sequence of primers P1, P2, P3, P4, P5, respectively.
  • SEQ ID NO: 459 is the nucleotide sequence of a Primer Binding Site (PBS), a sequence to facilitate event screening.
  • PBS Primer Binding Site
  • SEQ ID NO: 460 is the nucleotide sequence of the Zm-GOS2 PRO-GOS2 INTRON, the maize GOS2 promoter and GOS2 intron1 including the promoter, 5′-UTR1, INTRON1 and 5′-UTR2.
  • SEQ ID NO: 461 is the nucleotide sequence of the maize Zm-ARGOS8 promoter.
  • SEQ ID NO: 462 is the nucleotide sequence of the maize Zm-ARGOS8 5′-UTR.
  • SEQ ID NO: 463 is the nucleotide sequence of the maize Zm-ARGOS8 codon sequence
  • SEQ ID NO: 464 is the nucleotide sequence of the maize Zm-GOS2 gene, including promoter, 5′-UTR, CDS, 3′-UTR and introns.
  • SEQ ID NO: 465 is the nucleotide sequence of the maize Zm-GOS2 PRO promoter.
  • SEQ ID NO: 466 is the nucleotide sequence of the maize GOS2 INTRON, maize GOS2 5′-UTR1 and intron1 and 5′-UTR2.
  • SEQ ID NOs: 467-468, 490-491, 503-504 are the nucleotide sequence of the soybean genomic Cas endonuclease target sequences soy EPSPS-CR1, soy EPSPS-CR2, soy EPSPS-CR4, soy EPSPS-CR5, soy EPSPS-CR6, soy EPSPSCR7, respectively
  • SEQ ID NO: 469 is the nucleotide sequence of the soybean U6 small nuclear RNA promoter GM-U6-13.1.
  • SEQ ID NOs: 470, 471 are the nucleotide sequences of the QC868, QC879 plasmids, respectively.
  • SEQ ID NOs: 472, 473, 492, 493, 494, 505, 506, 507 are the nucleotide sequences of the RTW1013A, RTW1012A, RTW1199, RTW1200, RTW1190A, RTW1201, RTW1202, RTW1192A respectively.
  • SEQ ID Nos: 474-488, 495-402, 508-512 are the nucleotide sequences of primers and probes.
  • SEQ ID NO: 489 is the nucleotide sequence of the soybean codon optimized Cas9.
  • SEQ ID NO: 513 is the nucleotide sequence of the 35S enhancer.
  • SEQ ID NO: 514 is the nucleotide sequence of the 35S-CRTS for gRNA1 at 163-181 (including pam at 3′ end).
  • SEQ ID NO: 515 is the nucleotide sequence of the 35S-CRTS for gRNA2 at 295-319 (including pam at 3′ end).
  • SEQ ID NO: 516 is the nucleotide sequence of the 35S-CRT for gRNA3 at 331-350 (including pam at 3′ end).
  • SEQ ID NO: 517 is the nucleotide sequence of the EPSPS-K90R template.
  • SEQ ID NO: 518 is the nucleotide sequence of the EPSPS-IME template.
  • SEQ ID NO: 519 is the nucleotide sequence of the EPSPS-Tspliced template.
  • SEQ ID NO: 520 is the amino acid sequence of ZM-RAP2.7 peptide
  • SEQ ID NO: 521 is the nucleotide sequence ZM -RAP2.7 coding DNA sequence
  • SEQ ID NOs: 522 is the amino acid sequence of ZM-NPK1B peptide
  • SEQ ID NO: 523 is the nucleotide sequence of the ZM-NPK1B coding DNA sequence
  • SEQ ID NOs: 524 is the nucleotide sequence of the RAB17 promoter
  • SEQ ID NOs: 525 is the amino acid sequence of the Maize FTM1.
  • SEQ ID NO: 526 is the nucleotide sequence of the Maize FTM1 coding DNA sequence.
  • SEQ ID NOs: 527-532 are the nucleotide sequences shown in FIGS. 34 , 35 and 37 .
  • SEQ ID NOs: 533-534 are the nucleotide sequences of the Southern genomic probe and Southern MoPAT probe of FIG. 38 , respectively.
  • SEQ ID NOs: 535-541 are the nucleotide sequences of the RF-FPCas-1, RF-FPCas-2, ALSCas-4, ALS modification repair template 804, ALS modification repair template 127, ALS Forward_primer and ALS Reverse_primer, respectively.
  • SEQ ID NOs: 542-549 are the nucleotide sequences of the soy ALS1-CR1, Cas9 target sequence, soy ALS2-CR2, Cas9 target sequence, QC880, QC881, RTW1026A, WOL900, Forward_primer, WOL578, Reverse_primer and WOL573, Forward_primer, respectively.
  • SEQ ID NO: 550 is the nucleotide sequence of a maize ALS protein.
  • the present disclosure includes compositions and methods for genome modification of a target sequence in the genome of a plant or plant cell, for selecting plants, for gene editing, and for inserting a polynucleotide of interest into the genome of a plant.
  • the methods employ a guide RNA/Cas endonuclease system, wherein the Cas endonuclease is guided by the guide RNA to recognize and optionally introduce a double strand break at a specific target site into the genome of a cell.
  • the guide RNA/Cas endonuclease system provides for an effective system for modifying target sites within the genome of a plant, plant cell or seed.
  • compositions employing a guide polynucleotide/Cas endonuclease system to provide an effective system for modifying target sites within the genome of a cell and for editing a nucleotide sequence in the genome of a cell.
  • a variety of methods can be employed to further modify the target sites such that they contain a variety of polynucleotides of interest. Breeding methods utilizing a two component guide RNA/Cas endonuclease system are also disclosed.
  • Compositions and methods are also provided for editing a nucleotide sequence in the genome of a cell.
  • the nucleotide sequence to be edited (the nucleotide sequence of interest) can be located within or outside a target site that is recognized by a Cas endonuclease.
  • CRISPR loci Clustered Regularly Interspaced Short Palindromic Repeats (also known as SPIDRs—SPacer Interspersed Direct Repeats) constitute a family of recently described DNA loci.
  • CRISPR loci consist of short and highly conserved DNA repeats (typically 24 to 40 bp, repeated from 1 to 140 times—also referred to as CRISPR-repeats) which are partially palindromic.
  • the repeated sequences (usually specific to a species) are interspaced by variable sequences of constant length (typically 20 to 58 bp depending on the CRISPR locus (WO2007/025097 published Mar. 1, 2007).
  • CRISPR loci were first recognized in E. coli (Ishino et al. (1987) J. Bacterial. 169:5429-5433; Nakata et al. (1989) J. Bacterial. 171:3553-3556). Similar interspersed short sequence repeats have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena , and Mycobacterium tuberculosis (Groenen et al. (1993) Mol. Microbiol. 10:1057-1065; Hoe et al. (1999) Emerg. Infect. Dis. 5:254-263; Masepohl et al. (1996) Biochim.
  • the CRISPR loci differ from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al. (2002) OMICS J. Integ. Biol. 6:23-33; Mojica et al. (2000) Mol. Microbiol. 36:244-246).
  • SRSRs short regularly spaced repeats
  • the repeats are short elements that occur in clusters, that are always regularly spaced by variable sequences of constant length (Mojica et al. (2000) Mol. Microbiol. 36:244-246).
  • Cas gene includes a gene that is generally coupled, associated or close to or in the vicinity of flanking CRISPR loci.
  • the terms “Cas gene”, “CRISPR-associated (Cas) gene” are used interchangeably herein.
  • a comprehensive review of the Cas protein family is presented in Haft et al. (2005) Computational Biology, PLoS Comput Biol 1(6): e60. doi:10.1371/journal.pcbi.0010060.
  • CRISPR-associated (Cas) gene families are described, in addition to the four previously known gene families. It shows that CRISPR systems belong to different classes, with different repeat patterns, sets of genes, and species ranges. The number of Cas genes at a given CRISPR locus can vary between species.
  • Cas endonuclease relates to a Cas protein encoded by a Cas gene, wherein said Cas protein is capable of introducing a double strand break into a DNA target sequence.
  • the Cas endonuclease is guided by the guide polynucleotide to recognize and optionally introduce a double strand break at a specific target site into the genome of a cell.
  • the term “guide polynucleotide/Cas endonuclease system” includes a complex of a Cas endonuclease and a guide polynucleotide that is capable of introducing a double strand break into a DNA target sequence.
  • the Cas endonuclease unwinds the DNA duplex in close proximity of the genomic target site and cleaves both DNA strands upon recognition of a target sequence by a guide RNA, but only if the correct protospacer-adjacent motif (PAM) is approximately oriented at the 3′ end of the target sequence ( FIG. 2A , FIG. 2B ).
  • PAM protospacer-adjacent motif
  • the Cas endonuclease gene is a Cas9 endonuclease, such as but not limited to, Cas9 genes listed in SEQ ID NOs: 462, 474, 489, 494, 499, 505, and 518 of WO2007/025097 published Mar. 1, 2007, and incorporated herein by reference.
  • the Cas endonuclease gene is plant, maize or soybean optimized Cas9 endonuclease ( FIG. 1A ).
  • the Cas endonuclease gene is operably linked to a SV40 nuclear targeting signal upstream of the Cas codon region and a bipartite VirD2 nuclear localization signal (Tinland et al. (1992) Proc. Natl. Acad. Sci. USA 89:7442-6) downstream of the Cas codon region.
  • the Cas endonuclease gene is a Cas9 endonuclease gene of SEQ ID NO:1, 124, 212, 213, 214, 215, 216, 193 or nucleotides 2037-6329 of SEQ ID NO:5, or any functional fragment or variant thereof.
  • the Cas endonuclease gene is a plant codon optimized streptococcus pyogenes Cas9 gene that can recognize any genomic sequence of the form N(12-30)NGG can in principle be targeted.
  • the Cas endonuclease is introduced directly into a cell by any method known in the art, for example, but not limited to transient introduction methods, transfection and/or topical application.
  • Endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain, and include restriction endonucleases that cleave DNA at specific sites without damaging the bases. Restriction endonucleases include Type I, Type II, Type III, and Type IV endonucleases, which further include subtypes. In the Type I and Type III systems, both the methylase and restriction activities are contained in a single complex.
  • Endonucleases also include meganucleases, also known as homing endonucleases (HEases), which like restriction endonucleases, bind and cut at a specific recognition site, however the recognition sites for meganucleases are typically longer, about 18 bp or more.
  • HEases homing endonucleases
  • Meganucleases have been classified into four families based on conserved sequence motifs, the families are the LAGLIDADG, GIY-YIG, H-N-H, and His-Cys box families. These motifs participate in the coordination of metal ions and hydrolysis of phosphodiester bonds.
  • HEases are notable for their long recognition sites, and for tolerating some sequence polymorphisms in their DNA substrates.
  • the naming convention for meganuclease is similar to the convention for other restriction endonuclease.
  • Meganucleases are also characterized by prefix F-, I-, or PI- for enzymes encoded by free-standing ORFS, introns, and inteins, respectively.
  • One step in the recombination process involves polynucleotide cleavage at or near the recognition site. This cleaving activity can be used to produce a double-strand break.
  • recombinase is from the Integrase or Resolvase families.
  • TAL effector nucleases are a new class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in the genome of a plant or other organism.
  • Zinc finger nucleases are engineered double-strand break inducing agents comprised of a zinc finger DNA binding domain and a double-strand-break-inducing agent domain. Recognition site specificity is conferred by the zinc finger domain, which typically comprising two, three, or four zinc fingers, for example having a C2H2 structure, however other zinc finger structures are known and have been engineered.
  • Zinc finger domains are amenable for designing polypeptides which specifically bind a selected polynucleotide recognition sequence.
  • ZFNs include an engineered DNA-binding zinc finger domain linked to a non-specific endonuclease domain, for example nuclease domain from a Type IIs endonuclease such as FokI. Additional functionalities can be fused to the zinc-finger binding domain, including transcriptional activator domains, transcription repressor domains, and methylases. In some examples, dimerization of nuclease domain is required for cleavage activity.
  • Each zinc finger recognizes three consecutive base pairs in the target DNA. For example, a 3 finger domain recognized a sequence of 9 contiguous nucleotides, with a dimerization requirement of the nuclease, two sets of zinc finger triplets are used to bind an 18 nucleotide recognition sequence.
  • CRISPR clustered regularly interspaced short palindromic repeats
  • Cas CRISPR-associated systems
  • the type II CRISPR/Cas system from bacteria employs a crRNA and tracrRNA to guide the Cas endonuclease to its DNA target.
  • the crRNA contains the region complementary to one strand of the double strand DNA target and base pairs with the tracrRNA (trans-activating CRISPR RNA) forming a RNA duplex that directs the Cas endonuclease to cleave the DNA target ( FIG. 2 B).
  • guide RNA relates to a synthetic fusion of two RNA molecules, a crRNA (CRISPR RNA) comprising a variable targeting domain, and a tracrRNA ( FIG. 2 B).
  • the guide RNA comprises a variable targeting domain of 12 to 30 nucleotide sequences and a RNA fragment that can interact with a Cas endonuclease.
  • the term “guide polynucleotide”, relates to a polynucleotide sequence that can form a complex with a Cas endonuclease and enables the Cas endonuclease to recognize and optionally cleave a DNA target site.
  • the guide polynucleotide can be a single molecule or a double molecule.
  • the guide polynucleotide sequence can be a RNA sequence, a DNA sequence, or a combination thereof (a RNA-DNA combination sequence).
  • the guide polynucleotide can comprise at least one nucleotide, phosphodiester bond or linkage modification such as, but not limited, to Locked Nucleic Acid (LNA), 5-methyl dC, 2,6-Diaminopurine, 2′-Fluoro A, 2′-Fluoro U, 2′-O-Methyl RNA, phosphorothioate bond, linkage to a cholesterol molecule, linkage to a polyethylene glycol molecule, linkage to a spacer 18 (hexaethylene glycol chain) molecule, or 5′ to 3′ covalent linkage resulting in circularization.
  • LNA Locked Nucleic Acid
  • 5methyl dC 2,6-Diaminopurine
  • 2′-Fluoro A 2,6-Diaminopurine
  • 2′-Fluoro A 2′-Fluoro U
  • 2′-O-Methyl RNA phosphorothioate bond
  • the guide polynucleotide can be a double molecule (also referred to as duplex guide polynucleotide) comprising a first nucleotide sequence domain (referred to as Variable Targeting domain or VT domain) that is complementary to a nucleotide sequence in a target DNA and a second nucleotide sequence domain (referred to as Cas endonuclease recognition domain or CER domain) that interacts with a Cas endonuclease polypeptide.
  • the CER domain of the double molecule guide polynucleotide comprises two separate molecules that are hybridized along a region of complementarity.
  • the two separate molecules can be RNA, DNA, and/or RNA-DNA-combination sequences.
  • the first molecule of the duplex guide polynucleotide comprising a VT domain linked to a CER domain is referred to as “crDNA” (when composed of a contiguous stretch of DNA nucleotides) or “crRNA” (when composed of a contiguous stretch of RNA nucleotides), or “crDNA-RNA” (when composed of a combination of DNA and RNA nucleotides).
  • the crNucleotide can comprise a fragment of the cRNA naturally occurring in Bacteria and Archaea.
  • the size of the fragment of the cRNA naturally occurring in Bacteria and Archaea that is present in a crNucleotide disclosed herein can range from, but is not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides.
  • the second molecule of the duplex guide polynucleotide comprising a CER domain is referred to as “tracrRNA” (when composed of a contiguous stretch of RNA nucleotides) or “tracrDNA” (when composed of a contiguous stretch of DNA nucleotides) or “tracrDNA-RNA” (when composed of a combination of DNA and RNA nucleotides
  • the RNA that guides the RNA/Cas9 endonuclease complex is a duplexed RNA comprising a duplex crRNA-tracrRNA.
  • the guide polynucleotide can also be a single molecule comprising a first nucleotide sequence domain (referred to as Variable Targeting domain or VT domain) that is complementary to a nucleotide sequence in a target DNA and a second nucleotide domain (referred to as Cas endonuclease recognition domain or CER domain) that interacts with a Cas endonuclease polypeptide.
  • domain it is meant a contiguous stretch of nucleotides that can be RNA, DNA, and/or RNA-DNA-combination sequence.
  • the VT domain and/or the CER domain of a single guide polynucleotide can comprise a RNA sequence, a DNA sequence, or a RNA-DNA-combination sequence.
  • the single guide polynucleotide comprises a crNucleotide (comprising a VT domain linked to a CER domain) linked to a tracrNucleotide (comprising a CER domain), wherein the linkage is a nucleotide sequence comprising a RNA sequence, a DNA sequence, or a RNA-DNA combination sequence.
  • the single guide polynucleotide being comprised of sequences from the crNucleotide and tracrNucleotide may be referred to as “single guide RNA” (when composed of a contiguous stretch of RNA nucleotides) or “single guide DNA” (when composed of a contiguous stretch of DNA nucleotides) or “single guide RNA-DNA” (when composed of a combination of RNA and DNA nucleotides).
  • the single guide RNA comprises a cRNA or cRNA fragment and a tracrRNA or tracrRNA fragment of the type II CRISPR/Cas system that can form a complex with a type II Cas endonuclease, wherein said guide RNA/Cas endonuclease complex can direct the Cas endonuclease to a plant genomic target site, enabling the Cas endonuclease to introduce a double strand break into the genomic target site.
  • a single guide polynucleotide versus a duplex guide polynucleotide is that only one expression cassette needs to be made to express the single guide polynucleotide.
  • variable targeting domain or “VT domain” is used interchangeably herein and includes a nucleotide sequence that is complementary to one strand (nucleotide sequence) of a double strand DNA target site ( FIGS. 2 A and 2 B).
  • the % complementation between the first nucleotide sequence domain (VT domain) and the target sequence can be at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 63%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
  • variable target domain can be at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some embodiments, the variable targeting domain comprises a contiguous stretch of 12 to 30 nucleotides.
  • the variable targeting domain can be composed of a DNA sequence, a RNA sequence, a modified DNA sequence, a modified RNA sequence, or any combination thereof.
  • Cas endonuclease recognition domain or “CER domain” of a guide polynucleotide is used interchangeably herein and includes a nucleotide sequence (such as a second nucleotide sequence domain of a guide polynucleotide), that interacts with a Cas endonuclease polypeptide.
  • the CER domain can be composed of a DNA sequence, a RNA sequence, a modified DNA sequence, a modified RNA sequence (see for example modifications described herein), or any combination thereof.
  • the nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can comprise a RNA sequence, a DNA sequence, or a RNA-DNA combination sequence.
  • the nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can be at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 78, 79, 80, 81,
  • the nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can comprise a tetraloop sequence, such as, but not limiting to a GAAA tetraloop sequence.
  • Nucleotide sequence modification of the guide polynucleotide, VT domain and/or CER domain can be selected from, but not limited to, the group consisting of a 5′ cap, a 3′ polyadenylated tail, a riboswitch sequence, a stability control sequence, a sequence that forms a dsRNA duplex, a modification or sequence that targets the guide poly nucleotide to a subcellular location, a modification or sequence that provides for tracking, a modification or sequence that provides a binding site for proteins, a Locked Nucleic Acid (LNA), a 5-methyl dC nucleotide, a 2,6-Diaminopurine nucleotide, a 2′-Fluoro A nucleotide, a 2′-Fluoro U nucleotide; a 2′-O-Methyl RNA nucleotide, a phosphorothioate bond, linkage to a cholesterol molecule, linkage to
  • the additional beneficial feature is selected from the group of a modified or regulated stability, a subcellular targeting, tracking, a fluorescent label, a binding site for a protein or protein complex, modified binding affinity to complementary target sequence, modified resistance to cellular degradation, and increased cellular permeability.
  • the guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at a DNA target site
  • variable target domain is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.
  • the guide RNA comprises a cRNA (or cRNA fragment) and a tracrRNA (or tracrRNA fragment) of the type II CRISPR/Cas system that can form a complex with a type II Cas endonuclease, wherein said guide RNA/Cas endonuclease complex can direct the Cas endonuclease to a plant genomic target site, enabling the Cas endonuclease to introduce a double strand break into the genomic target site.
  • the guide RNA can be introduced into a plant or plant cell directly using any method known in the art such as, but not limited to, particle bombardment or topical applications.
  • the guide RNA can be introduced indirectly by introducing a recombinant DNA molecule comprising the corresponding guide DNA sequence operably linked to a plant specific promoter (as shown in FIG. 1B ) that is capable of transcribing the guide RNA in said plant cell.
  • a plant specific promoter as shown in FIG. 1B
  • corresponding guide DNA includes a DNA molecule that is identical to the RNA molecule but has a “T” substituted for each “U” of the RNA molecule.
  • the guide RNA is introduced via particle bombardment or Agrobacterium transformation of a recombinant DNA construct comprising the corresponding guide DNA operably linked to a plant U6 polymerase III promoter.
  • the RNA that guides the RNA/Cas9 endonuclease complex is a duplexed RNA comprising a duplex crRNA-tracrRNA (as shown in FIG. 2B ).
  • a duplexed RNA comprising a duplex crRNA-tracrRNA (as shown in FIG. 2B ).
  • target site refers to a polynucleotide sequence in the genome (including choloroplastic and mitochondrial DNA) of a plant cell at which a double-strand break is induced in the plant cell genome by a Cas endonuclease.
  • the target site can be an endogenous site in the plant genome, or alternatively, the target site can be heterologous to the plant and thereby not be naturally occurring in the genome, or the target site can be found in a heterologous genomic location compared to where it occurs in nature.
  • endogenous target sequence and “native target sequence” are used interchangeable herein to refer to a target sequence that is endogenous or native to the genome of a plant and is at the endogenous or native position of that target sequence in the genome of the plant.
  • the target site can be similar to a DNA recognition site or target site that that is specifically recognized and/or bound by a double-strand break inducing agent such as a LIG3-4 endonuclease (US patent publication 2009-0133152 A1 (published May 21, 2009) or a MS26++ meganuclease (U.S. patent application Ser. No. 13/526,912 filed Jun. 19, 2012).
  • a double-strand break inducing agent such as a LIG3-4 endonuclease (US patent publication 2009-0133152 A1 (published May 21, 2009) or a MS26++ meganuclease (U.S. patent application Ser. No. 13/526,912 filed Jun. 19, 2012).
  • an “artificial target site” or “artificial target sequence” are used interchangeably herein and refer to a target sequence that has been introduced into the genome of a plant.
  • Such an artificial target sequence can be identical in sequence to an endogenous or native target sequence in the genome of a plant but be located in a different position (i.e., a non-endogenous or non-native position) in the genome of a plant.
  • altered target site refers to a target sequence as disclosed herein that comprises at least one alteration when compared to non-altered target sequence.
  • alterations include, for example:
  • a method for modifying a target site in the genome of a plant cell comprises introducing a guide RNA into a plant cell having a Cas endonuclease, wherein said guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at said target site.
  • Also provided is a method for modifying a target site in the genome of a plant cell comprising introducing a guide RNA and a Cas endonuclease into said plant, wherein said guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at said target site.
  • a method for modifying a target site in the genome of a plant cell comprising introducing a guide RNA and a donor DNA into a plant cell having a Cas endonuclease, wherein said guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at said target site, wherein said donor DNA comprises a polynucleotide of interest.
  • a method for modifying a target site in the genome of a plant cell comprising: a) introducing into a plant cell a guide RNA comprising a variable targeting domain and a Cas endonuclease, wherein said guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at said target site; and, b) identifying at least one plant cell that has a modification at said target, wherein the modification includes at least one deletion or substitution of one or more nucleotides in said target site.
  • a method for modifying a target DNA sequence in the genome of a plant cell comprising: a) introducing into a plant cell a first recombinant DNA construct capable of expressing a guide RNA and a second recombinant DNA construct capable of expressing a Cas endonuclease, wherein said guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at said target site; and, b) identifying at least one plant cell that has a modification at said target, wherein the modification includes at least one deletion or substitution of one or more nucleotides in said target site.
  • the length of the target site can vary, and includes, for example, target sites that are at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides in length. It is further possible that the target site can be palindromic, that is, the sequence on one strand reads the same in the opposite direction on the complementary strand.
  • the nick/cleavage site can be within the target sequence or the nick/cleavage site could be outside of the target sequence.
  • the cleavage could occur at nucleotide positions immediately opposite each other to produce a blunt end cut or, in other Cases, the incisions could be staggered to produce single-stranded overhangs, also called “sticky ends”, which can be either 5′ overhangs, or 3′ overhangs.
  • the genomic target site capable of being cleaved by a Cas endonuclease comprises a 12 to 30 nucleotide fragment of a male fertility gene such as MS26 (see for example U.S. Pat. Nos. 7,098,388, 7,517,975, 7,612,251), MS45 (see for example U.S. Pat. Nos. 5,478,369, 6,265,640) or MSCA1 (see for example U.S. Pat. No. 7,919,676), ALS or ESPS genes.
  • a male fertility gene such as MS26 (see for example U.S. Pat. Nos. 7,098,388, 7,517,975, 7,612,251), MS45 (see for example U.S. Pat. Nos. 5,478,369, 6,265,640) or MSCA1 (see for example U.S. Pat. No. 7,919,676), ALS or ESPS genes.
  • Active variants of genomic target sites can also be used.
  • Such active variants can comprise at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the given target site, wherein the active variants retain biological activity and hence are capable of being recognized and cleaved by an Cas endonuclease.
  • Assays to measure the double-strand break of a target site by an endonuclease are known in the art and generally measure the overall activity and specificity of the agent on DNA substrates containing recognition sites.
  • a polynucleotide of interest is provided to the plant cell in a donor DNA construct.
  • donor DNA is a DNA construct that comprises a polynucleotide of Interest to be inserted into the target site of a Cas endonuclease.
  • the donor DNA construct further comprises a first and a second region of homology that flank the polynucleotide of Interest.
  • the first and second regions of homology of the donor DNA share homology to a first and a second genomic region, respectively, present in or flanking the target site of the plant genome.
  • homology is meant DNA sequences that are similar.
  • a “region of homology to a genomic region” that is found on the donor DNA is a region of DNA that has a similar sequence to a given “genomic region” in the plant genome.
  • a region of homology can be of any length that is sufficient to promote homologous recombination at the cleaved target site.
  • the region of homology can comprise at least 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5-50, 5-55, 5-60, 5-65, 5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 5-100, 5-200, 5-300, 5-400, 5-500, 5-600, 5-700, 5-800, 5-900, 5-1000, 5-1100, 5-1200, 5-1300, 5-1400, 5-1500, 5-1600, 5-1700, 5-1800, 5-1900, 5-2000, 5-2100, 5-2200, 5-2300, 5-2400, 5-2500, 5-2600, 5-2700, 5-2800, 5-2900, 5-3000, 5-3100 or more bases in length such that the region of homology has sufficient homology to undergo homologous recombination with the corresponding genomic region.
  • “Sufficient homology” indicates that two polynucleotide sequences have sufficient structural similarity to act as substrates for a homologous recombination reaction.
  • the structural similarity includes overall length of each polynucleotide fragment, as well as the sequence similarity of the polynucleotides. Sequence similarity can be described by the percent sequence identity over the whole length of the sequences, and/or by conserved regions comprising localized similarities such as contiguous nucleotides having 100% sequence identity, and percent sequence identity over a portion of the length of the sequences.
  • the amount of homology or sequence identity shared by a target and a donor polynucleotide can vary and includes total lengths and/or regions having unit integral values in the ranges of about 1-20 bp, 20-50 bp, 50-100 bp, 75-150 bp, 100-250 bp, 150-300 bp, 200-400 bp, 250-500 bp, 300-600 bp, 350-750 bp, 400-800 bp, 450-900 bp, 500-1000 bp, 600-1250 bp, 700-1500 bp, 800-1750 bp, 900-2000 bp, 1-2.5 kb, 1.5-3 kb, 2-4 kb, 2.5-5 kb, 3-6 kb, 3.5-7 kb, 4-8 kb, 5-10 kb, or up to and including the total length of the target site.
  • ranges include every integer within the range, for example, the range of 1-20 bp includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 bp.
  • the amount of homology can also described by percent sequence identity over the full aligned length of the two polynucleotides which includes percent sequence identity of about at least 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.
  • Sufficient homology includes any combination of polynucleotide length, global percent sequence identity, and optionally conserved regions of contiguous nucleotides or local percent sequence identity, for example sufficient homology can be described as a region of 75-150 bp having at least 80% sequence identity to a region of the target locus. Sufficient homology can also be described by the predicted ability of two polynucleotides to specifically hybridize under high stringency conditions, see, for example, Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual , (Cold Spring Harbor Laboratory Press, NY); Current Protocols in Molecular Biology , Ausubel et al., Eds (1994) Current Protocols, (Greene Publishing Associates, Inc. and John Wiley & Sons, Inc.); and, Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes , (Elsevier, New York).
  • genomic region is a segment of a chromosome in the genome of a plant cell that is present on either side of the target site or, alternatively, also comprises a portion of the target site.
  • the genomic region can comprise at least 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40, 5-45, 5-50, 5-55, 5-60, 5-65, 5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 5-100, 5-200, 5-300, 5-400, 5-500, 5-600, 5-700, 5-800, 5-900, 5-1000, 5-1100, 5-1200, 5-1300, 5-1400, 5-1500, 5-1600, 5-1700, 5-1800, 5-1900, 5-2000, 5-2100, 5-2200, 5-2300, 5-2400, 5-2500, 5-2600, 5-2700, 5-2800. 5-2900, 5-3000, 5-3100 or more bases such that the genomic region has sufficient homology to undergo homologous recombination with the corresponding
  • Polynucleotides of interest and/or traits can be stacked together in a complex trait locus as described in US-2013-0263324-A1, published 3 Oct. 2013 and in PCT/US13/22891, published Jan. 24, 2013, both applications are hereby incorporated by reference.
  • the guide polynucleotide/Cas9 endonuclease system described herein provides for an efficient system to generate double strand breaks and allows for traits to be stacked in a complex trait locus.
  • the guide polynucleotide/Cas endonuclease system is used for introducing one or more polynucleotides of interest or one or more traits of interest into one or more target sites by providing one or more guide polynucleotides, one Cas endonuclease, and optionally one or more donor DNAs to a plant cell.
  • a fertile plant can be produced from that plant cell that comprises an alteration at said one or more target sites, wherein the alteration is selected from the group consisting of (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, and (iv) any combination of (i)-(iii).
  • Plants comprising these altered target sites can be crossed with plants comprising at least one gene or trait of interest in the same complex trait locus, thereby further stacking traits in said complex trait locus.
  • the method comprises a method for producing in a plant a complex trait locus comprising at least two altered target sequences in a genomic region of interest, said method comprising: (a) selecting a genomic region in a plant, wherein the genomic region comprises a first target sequence and a second target sequence; (b) contacting at least one plant cell with at least a first guide polynucleotide, a second polynucleotide, and optionally at least one donor DNA, and a Cas endonuclease, wherein the first and second guide polynucleotide and the Cas endonuclease can form a complex that enables the Cas endonuclease to introduce a double strand break in at least a first and a second target sequence; (c) identifying a cell from (b) comprising a first alteration at the first target sequence and a second alteration at the second target sequence; and (d) recovering a first fertile plant from the cell of (c) said fertile plant
  • the method comprises a method for producing in a plant a complex trait locus comprising at least two altered target sequences in a genomic region of interest, said method comprising: (a) selecting a genomic region in a plant, wherein the genomic region comprises a first target sequence and a second target sequence; (b) contacting at least one plant cell with a first guide polynucleotide, a Cas endonuclease, and optionally a first donor DNA, wherein the first guide polynucleotide and the Cas endonuclease can form a complex that enables the Cas endonuclease to introduce a double strand break a first target sequence; (c) identifying a cell from (b) comprising a first alteration at the first target sequence; (d) recovering a first fertile plant from the cell of (c), said first fertile plant comprising the first alteration; (e) contacting at least one plant cell with a second guide polynucleotide, a Cas
  • the structural similarity between a given genomic region and the corresponding region of homology found on the donor DNA can be any degree of sequence identity that allows for homologous recombination to occur.
  • the amount of homology or sequence identity shared by the “region of homology” of the donor DNA and the “genomic region” of the plant genome can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, such that the sequences undergo homologous recombination
  • the region of homology on the donor DNA can have homology to any sequence flanking the target site. While in some embodiments the regions of homology share significant sequence homology to the genomic sequence immediately flanking the target site, it is recognized that the regions of homology can be designed to have sufficient homology to regions that may be further 5′ or 3′ to the target site. In still other embodiments, the regions of homology can also have homology with a fragment of the target site along with downstream genomic regions. In one embodiment, the first region of homology further comprises a first fragment of the target site and the second region of homology comprises a second fragment of the target site, wherein the first and second fragments are dissimilar.
  • homologous recombination includes the exchange of DNA fragments between two DNA molecules at the sites of homology.
  • the frequency of homologous recombination is influenced by a number of factors. Different organisms vary with respect to the amount of homologous recombination and the relative proportion of homologous to non-homologous recombination.
  • the length of the region of homology affects the frequency of homologous recombination events: the longer the region of homology, the greater the frequency.
  • the length of the homology region needed to observe homologous recombination is also species-variable.
  • Homology-directed repair is a mechanism in cells to repair double-stranded and single stranded DNA breaks.
  • Homology-directed repair includes homologous recombination (HR) and single-strand annealing (SSA) (Lieber. 2010 Annu. Rev. Biochem. 79:181-211).
  • HR homologous recombination
  • SSA single-strand annealing
  • Other forms of HDR include single-stranded annealing (SSA) and breakage-induced replication, and these require shorter sequence homology relative to HR.
  • Homologous recombination has also been accomplished in other organisms. For example, at least 150-200 bp of homology was required for homologous recombination in the parasitic protozoan Leishmania (Papadopoulou and Dumas, (1997) Nucleic Acids Res 25:4278-86). In the filamentous fungus Aspergillus nidulans , gene replacement has been accomplished with as little as 50 bp flanking homology (Chaveroche et al., (2000) Nucleic Acids Res 28:e97). Targeted gene replacement has also been demonstrated in the ciliate Tetrahymena thermophila (Gaertig et al., (1994) Nucleic Acids Res 22:5391-8).
  • Homologous recombination in mammals other than mouse has been limited by the lack of stem cells capable of being transplanted to oocytes or developing embryos.
  • McCreath et al. Nature 405:1066-9 (2000) reported successful homologous recombination in sheep by transformation and selection in primary embryo fibroblast cells.
  • NHEJ Non-Homologous-End-Joining
  • Episomal DNA molecules can also be ligated into the double-strand break, for example, integration of T-DNAs into chromosomal double-strand breaks (Chilton and Que, (2003) Plant Physiol 133:956-65; Salomon and Puchta, (1998) EMBO J 17:6086-95).
  • gene conversion pathways can restore the original structure if a homologous sequence is available, such as a homologous chromosome in non-dividing somatic cells, or a sister chromatid after DNA replication (Molinier et al., (2004) Plant Cell 16:342-52).
  • Ectopic and/or epigenic DNA sequences may also serve as a DNA repair template for homologous recombination (Puchta, (1999) Genetics 152:1173-81).
  • NHEJ nonhomologous end-joining pathway
  • the double-strand break can be repaired by homologous recombination between homologous DNA sequences.
  • gene conversion pathways can restore the original structure if a homologous sequence is available, such as a homologous chromosome in non-dividing somatic cells, or a sister chromatid after DNA replication (Molinier et al., (2004) Plant Cell 16:342-52).
  • Ectopic and/or epigenic DNA sequences may also serve as a DNA repair template for homologous recombination (Puchta, (1999) Genetics 152:1173-81).
  • DNA double-strand breaks appear to be an effective factor to stimulate homologous recombination pathways (Puchta et al., (1995) Plant Mol Biol 28:281-92; Tzfira and White, (2005) Trends Biotechnol 23:567-9; Puchta, (2005) J Exp Bot 56:1-14).
  • DNA-breaking agents a two- to nine-fold increase of homologous recombination was observed between artificially constructed homologous DNA repeats in plants (Puchta et al., (1995) Plant Mol Biol 28:281-92).
  • experiments with linear DNA molecules demonstrated enhanced homologous recombination between plasmids (Lyznik et al., (1991) Mol Gen Genet 230:209-18).
  • the method comprises contacting a plant cell with the donor DNA and the endonuclease.
  • the first and second regions of homology of the donor DNA can undergo homologous recombination with their corresponding genomic regions of homology resulting in exchange of DNA between the donor and the genome.
  • the provided methods result in the integration of the polynucleotide of interest of the donor DNA into the double-strand break in the target site in the plant genome, thereby altering the original target site and producing an altered genomic target site.
  • the donor DNA may be introduced by any means known in the art.
  • a plant having a target site is provided.
  • the donor DNA may be provided by any transformation method known in the art including, for example, Agrobacterium -mediated transformation or biolistic particle bombardment.
  • the donor DNA may be present transiently in the cell or it could be introduced via a viral replicon. In the presence of the Cas endonuclease and the target site, the donor DNA is inserted into the transformed plant's genome.
  • Homing endonucleases such as I-SceI or I-CreI, bind to and cleave relatively long DNA recognition sequences (18 bp and 22 bp, respectively). These sequences are predicted to naturally occur infrequently in a genome, typically only 1 or 2 sites/genome.
  • cleavage specificity of a homing endonuclease can be changed by rational design of amino acid substitutions at the DNA binding domain and/or combinatorial assembly and selection of mutated monomers (see, for example, Arnould et al., (2006) J Mol Biol 355:443-58; Ashworth et al., (2006) Nature 441:656-9; Doyon et al., (2006) J Am Chem Soc 128:2477-84; Rosen et al., (2006) Nucleic Acids Res 34:4791-800; and Smith et al., (2006) Nucleic Acids Res 34:e149; Lyznik et al., (2009) U.S. Patent Application Publication No.
  • the maize liguleless locus was targeted using an engineered single-chain endonuclease designed based on the I-CreI meganuclease sequence. Mutations of the selected liguleless locus recognition sequence were detected in 3% of the T0 transgenic plants when the designed homing nuclease was introduced by Agrobacterium -mediated transformation of immature embryos (Gao et al., (2010) Plant J 61:176-87).
  • Polynucleotides of interest are further described herein and are reflective of the commercial markets and interests of those involved in the development of the crop. Crops and markets of interest change, and as developing nations open up world markets, new crops and technologies will emerge also. In addition, as our understanding of agronomic traits and characteristics such as yield and heterosis increase, the choice of genes for genetic engineering will change accordingly.
  • the guide RNA/Cas endonuclease system can be used in combination with a co-delivered polynucleotide modification template to allow for editing of a genomic nucleotide sequence of interest.
  • a similar guide polynucleotide/Cas endonuclease system can be deployed where the guide polynucleotide does not solely comprise ribonucleic acids but wherein the guide polynucleotide comprises a combination of RNA-DNA molecules or solely comprise DNA molecules.
  • DSBs induced double-strand breaks
  • the challenge has been to efficiently make DSBs at genomic sites of interest since there is a bias in the directionality of information transfer between two interacting DNA molecules (the broken one acts as an acceptor of genetic information).
  • Described herein is the use of a guide RNA/Cas system which provides flexible genome cleavage specificity and results in a high frequency of double-strand breaks at a DNA target site, thereby enabling efficient gene editing in a nucleotide sequence of interest, wherein the nucleotide sequence of interest to be edited can be located within or outside the target site recognized and cleaved by a Cas endonuclease.
  • a “modified nucleotide” or “edited nucleotide” refers to a nucleotide sequence of interest that comprises at least one alteration when compared to its non-modified nucleotide sequence. Such “alterations” include, for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i)-(iii).
  • polynucleotide modification template includes a polynucleotide that comprises at least one nucleotide modification when compared to the nucleotide sequence to be edited.
  • a nucleotide modification can be at least one nucleotide substitution, addition or deletion.
  • the polynucleotide modification template can further comprise homologous nucleotide sequences flanking the at least one nucleotide modification, wherein the flanking homologous nucleotide sequences provide sufficient homology to the desired nucleotide sequence to be edited.
  • the disclosure describes a method for editing a nucleotide sequence in the genome of a cell, the method comprising providing a guide RNA, a polynucleotide modification template, and at least one Cas endonuclease to a cell, wherein the Cas endonuclease is capable of introducing a double-strand break at a target sequence in the genome of said cell, wherein said polynucleotide modification template includes at least one nucleotide modification of said nucleotide sequence.
  • Cells include, but are not limited to, human, animal, bacterial, fungal, insect, and plant cells as well as plants and seeds produced by the methods described herein.
  • the nucleotide to be edited can be located within or outside a target site recognized and cleaved by a Cas endonuclease.
  • the at least one nucleotide modification is not a modification at a target site recognized and cleaved by a Cas endonuclease.
  • the disclosure describes a method for editing a nucleotide sequence in the genome of a plant cell, the method comprising providing a guide RNA, a polynucleotide modification template, and at least one maize optimized Cas9 endonuclease to a plant cell, wherein the maize optimized Cas9 endonuclease is capable of providing a double-strand break at a moCas9 target sequence in the plant genome, wherein said polynucleotide modification template includes at least one nucleotide modification of said nucleotide sequence.
  • the disclosure describes a method for editing a nucleotide sequence in the genome of a cell, the method comprising providing a guide RNA, a polynucleotide modification template and at least one Cas endonuclease to a cell, wherein said guide RNA and Cas endonuclease are capable of forming a complex that enables the Cas endonuclease to introduce a double strand break at a target site, wherein said polynucleotide modification template comprises at least one nucleotide modification of said nucleotide sequence.
  • EPSPS polynucleotide modification template includes a partial fragment of the EPSPS gene (and therefore does not encode a fully functional EPSPS polypeptide by itself).
  • the EPSPS polynucleotide modification template contained three point mutations that were responsible for the creation of the T102I/P106S (TIPS) double mutant (Funke, T et al., J. Biol. Chem. 2009, 284:9854-9860), which provide glyphosate tolerance to transgenic plants expressing as EPSPS double mutant transgene.
  • TIPS T102I/P106S
  • Glyphosate includes any herbicidally effective form of N-phosphonomethylglycine (including any salt thereof), other forms which result in the production of the glyphosate anion in plants and any other herbicides of the phosphonomethlyglycine family.
  • an epsps mutant plant is produced by the method described herein, said method comprising: a) providing a guide RNA, a polynucleotide modification template and at least one Cas endonuclease to a plant cell, wherein the Cas endonuclease introduces a double strand break at a target site within an epsps (enolpyruvylshikimate-3-phosphate synthase) genomic sequence in the plant genome, wherein said polynucleotide modification template comprises at least one nucleotide modification of said epsps genomic sequence; b) obtaining a plant from the plant cell of (a); c) evaluating the plant of (b) for the presence of said at least one nucleotide modification and d) selecting a progeny plant that shows resistance to glyphosate.
  • Increased resistance to an herbicide is demonstrated when plants which display the increased resistance to an herbicide are subjected to the herbicide and a dose/response curve is shifted to the right when compared with that provided by an appropriate control plant.
  • Such dose/response curves have “dose” plotted on the x-axis and “percentage injury”, “herbicidal effect” etc. plotted on the y-axis. Plants which are substantially resistant to the herbicide exhibit few, if any, bleached, necrotic, lytic, chlorotic or other lesions and are not stunted, wilted or deformed when subjected to the herbicide at concentrations and rates which are typically employed by the agricultural community to kill weeds in the field.
  • the terms resistance and tolerance may be used interchangeably.
  • FIG. 12 shows a schematic representation of components used in the genome editing procedure.
  • a maize optimized Cas endonuclease, a guide RNA and a polynucleotide modification template were provided to a plant cell.
  • the polynucleotide modification template included three nucleotide modifications (indicated by arrows) when compared to the EPSPS genomic sequence to be edited. These three nucleotide modifications are referred to as TIPS mutations as these nucleotide modifications result in the amino acid changes T-102 to I-102 and P-106 to S-106.
  • the first point mutation results from the substitution of the C nucleotide in the codon sequence ACT with a T nucleotide
  • a second mutation results from the substitution of the T nucleotide on the same codon sequence ACT with a C nucleotide to form the isoleucine codon ATC
  • the third point mutation results from the substitution of the first C nucleotide in the codon sequence CCA with a T nucleotide in order to form a serine codon TCA ( FIG. 12 ).
  • the disclosure describes a method for producing an epsps (enolpyruvylshikimate-3-phosphate synthase) mutant plant, the method comprising: a) providing a guide RNA, a polynucleotide modification template and at least one Cas endonuclease to a plant cell, wherein the Cas endonuclease introduces a double strand break at a target site within an epsps genomic sequence in the plant genome, wherein said polynucleotide modification template comprises at least one nucleotide modification of said epsps genomic sequence; b) obtaining a plant from the plant cell of (a); c) evaluating the plant of (b) for the presence of said at least one nucleotide modification; and, d) screening a progeny plant of (c) that is void of said guide RNA and Cas endonuclease.
  • the nucleotide sequence to be edited can be a sequence that is endogenous, artificial, pre-existing, or transgenic to the cell that is being edited.
  • the nucleotide sequence in the genome of a cell can be a native gene, a mutated gene, a non-native gene, a foreign gene, or a transgene that is stably incorporated into the genome of a cell. Editing of such nucleotide may result in a further desired phenotype or genotype.
  • the nucleotide sequence to be modified can be a regulatory sequence such as a promoter wherein the editing of the promoter comprises replacing the promoter (also referred to as a “promoter swap” or “promoter replacement”) or promoter fragment with a different promoter (also referred to as replacement promoter) or promoter fragment (also referred to as replacement promoter fragment), wherein the promoter replacement results in any one of the following or any one combination of the following: an increased promoter activity, an increased promoter tissue specificity, a decreased promoter activity, a decreased promoter tissue specificity, a new promoter activity, an inducible promoter activity, an extended window of gene expression, a modification of the timing or developmental progress of gene expression in the same cell layer or other cell layer (such as but not limiting to extending the timing of gene expression in the tapetum of maize anthers (U.S.
  • the promoter (or promoter fragment) to be modified can be a promoter (or promoter fragment) that is endogenous, artificial, pre-existing, or transgenic to the cell that is being edited.
  • the replacement promoter (or replacement promoter fragment) can be a promoter (or promoter fragment) that is endogenous, artificial, pre-existing, or transgenic to the cell that is being edited.
  • the nucleotide sequence can be a promoter wherein the editing of the promoter comprises replacing an ARGOS 8 promoter with a Zea mays GOS2 PRO:GOS2-intron promoter.
  • the nucleotide sequence can be a promoter wherein the editing of the promoter comprises replacing a native EPSPS1 promoter from with a plant ubiquitin promoter.
  • the nucleotide sequence can be a promoter wherein the editing of the promoter comprises replacing an endogenous maize NPK1 promoter with a stress inducible maize RAB17 promoter.
  • the nucleotide sequence can be a promoter wherein the promoter to be edited is selected from the group comprising Zea mays -PEPC1 promoter (Kausch et al, Plant Molecular Biology, 45: 1-15, 2001), Zea mays Ubiquitin promoter (UBI1ZM PRO, Christensen et al, plant Molecular Biology 18: 675-689, 1992), Zea mays -Rootmet2 promoter (U.S. Pat. No. 7,214,855), Rice actin promoter (OS-ACTIN PRO, U.S. Pat. No.
  • the guide polynucleotide/Cas endonuclease system can be used in combination with a co-delivered polynucleotide modification template or donor DNA sequence to allow for the insertion of a promoter or promoter element into a genomic nucleotide sequence of interest, wherein the promoter insertion (or promoter element insertion) results in any one of the following or any one combination of the following: an increased promoter activity (increased promoter strength), an increased promoter tissue specificity, a decreased promoter activity, a decreased promoter tissue specificity, a new promoter activity, an inducible promoter activity, an extended window of gene expression, a modification of the timing or developmental progress of gene expression a mutation of DNA binding elements and/or an addition of DNA binding elements.
  • a co-delivered polynucleotide modification template or donor DNA sequence to allow for the insertion of a promoter or promoter element into a genomic nucleotide sequence of interest, wherein the promoter insertion (or promoter
  • Promoter elements to be inserted can be, but are not limited to, promoter core elements (such as, but not limited to, a CAAT box, a CCAAT box, a Pribnow box, a and/or TATA box, translational regulation sequences and/or a repressor system for inducible expression (such as TET operator repressor/operator/inducer elements, or Sulphonylurea (Su) repressor/operator/inducer elements.
  • promoter core elements such as, but not limited to, a CAAT box, a CCAAT box, a Pribnow box, a and/or TATA box
  • translational regulation sequences and/or a repressor system for inducible expression such as TET operator repressor/operator/inducer elements, or Sulphonylurea (Su) repressor/operator/inducer elements.
  • the dehydration-responsive element was first identified as a cis-acting promoter element in the promoter of the drought-responsive gene rd29A, which contains a 9 bp conserved core sequence, TACCGACAT (Yamaguchi-Shinozaki, K, and Shinozaki, K. (1994) Plant Cell 6, 251-264). Insertion of DRE into an endogenous promoter may confer a drought inducible expression of the downstream gene.
  • Another example are ABA-responsive elements (ABREs) which contain a (C/T)ACGTGGC consensus sequence found to be present in numerous ABA and/or stress-regulated genes (Busk P. K., Pages M. (1998) Plant Mol. Biol. 37:425-435).
  • the promoter (or promoter element) to be inserted can be a promoter (or promoter element) that is endogenous, artificial, pre-existing, or transgenic to the cell that is being edited.
  • the guide polynucleotide/Cas endonuclease system can be used to insert an enhancer element, such as but not limited to a Cauliflower Mosaic Virus 35 S enhancer, in front of an endogenous FMT1 promoter to enhance expression of the FTM1.
  • an enhancer element such as but not limited to a Cauliflower Mosaic Virus 35 S enhancer
  • the guide polynucleotide/Cas endonuclease system can be used to insert a component of the TET operator repressor/operator/inducer system, or a component of the sulphonylurea (Su) repressor/operator/inducer system into plant genomes to generate or control inducible expression systems.
  • a component of the TET operator repressor/operator/inducer system or a component of the sulphonylurea (Su) repressor/operator/inducer system into plant genomes to generate or control inducible expression systems.
  • the guide polynucleotide/Cas endonuclease system can be used to allow for the deletion of a promoter or promoter element, wherein the promoter deletion (or promoter element deletion) results in any one of the following or any one combination of the following: a permanently inactivated gene locus, an increased promoter activity (increased promoter strength), an increased promoter tissue specificity, a decreased promoter activity, a decreased promoter tissue specificity, a new promoter activity, an inducible promoter activity, an extended window of gene expression, a modification of the timing or developmental progress of gene expression, a mutation of DNA binding elements and/or an addition of DNA binding elements.
  • a permanently inactivated gene locus an increased promoter activity (increased promoter strength), an increased promoter tissue specificity, a decreased promoter activity, a decreased promoter tissue specificity, a new promoter activity, an inducible promoter activity, an extended window of gene expression, a modification of the timing or developmental progress of gene expression, a mutation of DNA
  • Promoter elements to be deleted can be, but are not limited to, promoter core elements, promoter enhancer elements or 35 S enhancer elements (as described in Example 32)
  • the promoter or promoter fragment to be deleted can be endogenous, artificial, pre-existing, or transgenic to the cell that is being edited.
  • the guide polynucleotide/Cas endonuclease system can be used to delete the ARGOS 8 promoter present in a maize genome as described herein.
  • the guide polynucleotide/Cas endonuclease system can be used to delete a 35S enhancer element present in a plant genome as described herein.
  • the nucleotide sequence to be modified can be a terminator wherein the editing of the terminator comprises replacing the terminator (also referred to as a “terminator swap” or “terminator replacement”) or terminator fragment with a different terminator (also referred to as replacement terminator) or terminator fragment (also referred to as replacement terminator fragment), wherein the terminator replacement results in any one of the following or any one combination of the following: an increased terminator activity, an increased terminator tissue specificity, a decreased terminator activity, a decreased terminator tissue specificity, a mutation of DNA binding elements and/or a deletion or addition of DNA binding elements.”
  • the terminator (or terminator fragment) to be modified can be a terminator (or terminator fragment) that is endogenous, artificial, pre-existing, or transgenic to the cell that is being edited.
  • the replacement terminator (or replacement terminator fragment) can be a terminator (or terminator fragment) that is endogenous, artificial, pre-existing, or transgenic to the cell that is being edited.
  • the nucleotide sequence to be modified can be a terminator wherein the terminator to be edited is selected from the group comprising terminators from maize Argos 8 or SRTF18 genes, or other terminators, such as potato PinII terminator, sorghum actin terminator (SB-ACTIN TERM, WO 2013/184537 A1 published December 2013), sorghum SB-GKAF TERM (WO2013019461), rice T28 terminator (OS-T28 TERM, WO 2013/012729 A2), ATT9 TERM (WO 2013/012729 A2) or GZ-W64A TERM (U.S. Pat. No. 7,053,282).
  • terminators from maize Argos 8 or SRTF18 genes or other terminators, such as potato PinII terminator, sorghum actin terminator (SB-ACTIN TERM, WO 2013/184537 A1 published December 2013), sorghum SB-GKAF TERM (WO2013019461), rice
  • the guide polynucleotide/Cas endonuclease system can be used in combination with a co-delivered polynucleotide modification template or donor DNA sequence to allow for the insertion of a terminator or terminator element into a genomic nucleotide sequence of interest, wherein the terminator insertion (or terminator element insertion) results in any one of the following or any one combination of the following: an increased terminator activity (increased terminator strength), an increased terminator tissue specificity, a decreased terminator activity, a decreased terminator tissue specificity, a mutation of DNA binding elements and/or an addition of DNA binding elements.
  • the terminator (or terminator element) to be inserted can be a terminator (or terminator element) that is endogenous, artificial, pre-existing, or transgenic to the cell that is being edited.
  • the guide polynucleotide/Cas endonuclease system can be used to allow for the deletion of a terminator or terminator element, wherein the terminator deletion (or terminator element deletion) results in any one of the following or any one combination of the following: an increased terminator activity (increased terminator strength), an increased terminator tissue specificity, a decreased terminator activity, a decreased terminator tissue specificity, a mutation of DNA binding elements and/or an addition of DNA binding elements.
  • the terminator or terminator fragment to be deleted can be endogenous, artificial, pre-existing, or transgenic to the cell that is being edited.
  • the guide polynucleotide/Cas endonuclease system can be used to modify or replace a regulatory sequence in the genome of a cell.
  • a regulatory sequence is a segment of a nucleic acid molecule which is capable of increasing or decreasing the expression of specific genes within an organism and/or is capable of altering tissue specific expression of genes within an organism.
  • regulatory sequences include, but are not limited to, 3′ UTR (untranslated region) region, 5′ UTR region, transcription activators, transcriptional enhancers transcriptions repressors, translational repressors, splicing factors, miRNAs, siRNA, artificial miRNAs, promoter elements, CAMV 35 S enhancer, MMV enhancer elements (PCT/US14/23451 filed Mar. 11, 2013), SECIS elements, polyadenylation signals, and polyubiquitination sites.
  • the editing (modification) or replacement of a regulatory element results in altered protein translation, RNA cleavage, RNA splicing, transcriptional termination or post translational modification.
  • regulatory elements can be identified within a promoter and these regulatory elements can be edited or modified do to optimize these regulatory elements for up or down regulation of the promoter.
  • the genomic sequence of interest to be modified is a polyubiquitination site, wherein the modification of the polyubiquitination sites results in a modified rate of protein degradation.
  • the ubiquitin tag condemns proteins to be degraded by proteasomes or autophagy. Proteasome inhibitors are known to cause a protein overproduction. Modifications made to a DNA sequence encoding a protein of interest can result in at least one amino acid modification of the protein of interest, wherein said modification allows for the polyubiquitination of the protein (a post translational modification) resulting in a modification of the protein degradation
  • the genomic sequence of interest to be modified is a polyubiquitination site on a maize EPSPS gene, wherein the polyubiquitination site modified resulting in an increased protein content due to a slower rate of EPSPS protein degradation.
  • the genomic sequence of interest to be modified is a an intron site, wherein the modification consist of inserting an intron enhancing motif into the intron which results in modulation of the transcriptional activity of the gene comprising said intron.
  • the genomic sequence of interest to be modified is a an intron site, wherein the modification consist of replacing a soybean EPSP1 intron with a soybean ubiquitin intron 1 as described herein (Example 25)
  • the genomic sequence of interest to be modified is a an intron or UTR site, wherein the modification consist of inserting at least one microRNA into said intron or UTR site, wherein expression of the gene comprising the intron or UTR site also results in expression of said microRNA, which in turn can silence any gene targeted by the microRNA without disrupting the gene expression of the native/transgene comprising said intron.
  • the guide polynucleotide/Cas endonuclease system can be used to allow for the deletion or mutation of a Zinc Finger transcription factor, wherein the deletion or mutation of the Zinc Finger transcription factor results in or allows for the creation of a dominant negative Zinc Finger transcription factor mutant (Li et al 2013 Rice zinc finger protein DST enhances grain production through controlling Gn1a/OsCKX2 expression PNAS 110:3167-3172). Insertion of a single base pair downstream zinc finger domain will result in a frame shift and produces a new protein which still can bind to DNA without transcription activity. The mutant protein will compete to bind to cytokinin oxidase gene promoters and block the expression of cytokinin oxidase gene. Reduction of cytokinin oxidase gene expression will increase cytokinin level and promote panicle growth in rice and ear growth in maize, and increase yield under normal and stress conditions.
  • Protein synthesis utilizes mRNA molecules that emerge from pre-mRNA molecules subjected to the maturation process.
  • the pre-mRNA molecules are capped, spliced and stabilized by addition of polyA tails.
  • Eukaryotic cells developed a complex process of splicing that result in alternative variants of the original pre-mRNA molecules. Some of them may not produce functional templates for protein synthesis.
  • the splicing process is affected by splicing sites at the exon-intron junction sites.
  • An example of a canonical splice site is AGGT.
  • Gene coding sequences can contains a number of alternate splicing sites that may affect the overall efficiency of the pre-mRNA maturation process and as such may limit the protein accumulation in cells.
  • the guide polynucleotide/Cas endonuclease system can be used in combination with a co-delivered polynucleotide modification template to edit a gene of interest to introduce a canonical splice site at a described junction or any variant of a splicing site that changes the splicing pattern of pre-mRNA molecules.
  • the nucleotide sequence of interest to be modified is a maize EPSPS gene, wherein the modification of the gene consists of modifying alternative splicing sites resulting in enhanced production of the functional gene transcripts and gene products (proteins).
  • the nucleotide sequence of interest to be modified is a gene, wherein the modification of the gene consists of editing the intron borders of alternatively spliced genes to alter the accumulation of splice variants.
  • the guide polynucleotide/Cas endonuclease system can be used to modify or replace a coding sequence in the genome of a cell, wherein the modification or replacement results in any one of the following, or any one combination of the following: an increased protein (enzyme) activity, an increased protein functionality, a decreased protein activity, a decreased protein functionality, a site specific mutation, a protein domain swap, a protein knock-out, a new protein functionality, a modified protein functionality,
  • the protein knockout is due to the introduction of a stop codon into the coding sequence of interest.
  • the protein knockout is due to the deletion of a start codon into the coding sequence of interest.
  • the guide polynucleotide/Cas endonuclease system can be used with or without a co-delivered polynucleotide sequence to fuse a first coding sequence encoding a first protein to a second coding sequence encoding a second protein in the genome of a cell, wherein the protein fusion results in any one of the following or any one combination of the following: an increased protein (enzyme) activity, an increased protein functionality, a decreased protein activity, a decreased protein functionality, a new protein functionality, a modified protein functionality, a new protein localization, a new timing of protein expression, a modified protein expression pattern, a chimeric protein, or a modified protein with dominant phenotype functionality.
  • the guide polynucleotide/Cas endonuclease system can be used with or without a co-delivered polynucleotide sequence to fuse a first coding sequence encoding a chloroplast localization signal to a second coding sequence encoding a protein of interest, wherein the protein fusion results in targeting the protein of interest to the chloroplast.
  • the guide polynucleotide/Cas endonuclease system can be used with or without a co-delivered polynucleotide sequence to fuse a first coding sequence encoding a chloroplast localization signal to a second coding sequence encoding a protein of interest, wherein the protein fusion results in targeting the protein of interest to the chloroplast.
  • the guide polynucleotide/Cas endonuclease system can be used with or without a co-delivered polynucleotide sequence to fuse a first coding sequence encoding a chloroplast localization signal (e.g., a chloroplast transit peptide) to a second coding sequence, wherein the protein fusion results in a modified protein with dominant phenotype functionality
  • a chloroplast localization signal e.g., a chloroplast transit peptide
  • the guide polynucleotide/Cas endonuclease system can be used in combination with a co-delivered polynucleotide sequence to insert an inverted gene fragment into a gene of interest in the genome of an organism, wherein the insertion of the inverted gene fragment can allow for an in-vivo creation of an inverted repeat (hairpin) and results in the silencing of said endogenous gene.
  • a co-delivered polynucleotide sequence to insert an inverted gene fragment into a gene of interest in the genome of an organism, wherein the insertion of the inverted gene fragment can allow for an in-vivo creation of an inverted repeat (hairpin) and results in the silencing of said endogenous gene.
  • the insertion of the inverted gene fragment can result in the formation of an in-vivo created inverted repeat (hairpin) in a native (or modified) promoter of a gene and/or in a native 5′ end of the native gene.
  • the inverted gene fragment can further comprise an intron which can result in an enhanced silencing of the targeted gene.
  • Trait mapping in plant breeding often results in the detection of chromosomal regions housing one or more genes controlling expression of a trait of interest.
  • the guide polynucleotide/Cas endonuclease system can be used to eliminate candidate genes in the identified chromosomal regions to determine if deletion of the gene affects expression of the trait.
  • expression of a trait of interest is governed by multiple quantitative trait loci (QTL) of varying effect-size, complexity, and statistical significance across one or more chromosomes.
  • QTL quantitative trait loci
  • the guide polynucleotide/Cas endonuclease system can be used to eliminate whole regions delimited by marker-assisted fine mapping, and to target specific regions for their selective elimination or rearrangement.
  • presence/absence variation (PAV) or copy number variation (CNV) can be manipulated with selective genome deletion using the guide polynucleotide/Cas endonuclease system.
  • the region of interest can be flanked by two independent guide polynucleotide/CAS endonuclease target sequences. Cutting would be done concurrently. The deletion event would be the repair of the two chromosomal ends without the region of interest. Alternative results would include inversions of the region of interest, mutations at the cut sites and duplication of the region of interest.
  • identifying at least one plant cell comprising in its genome, a polynucleotide of interest integrated at the target site.
  • a variety of methods are available for identifying those plant cells with insertion into the genome at or near to the target site without using a screenable marker phenotype. Such methods can be viewed as directly analyzing a target sequence to detect any change in the target sequence, including but not limited to PCR methods, sequencing methods, nuclease digestion, Southern blots, and any combination thereof. See, for example, U.S. patent application Ser. No. 12/147,834, herein incorporated by reference to the extent necessary for the methods described herein.
  • the method also comprises recovering a plant from the plant cell comprising a polynucleotide of Interest integrated into its genome.
  • the plant may be sterile or fertile. It is recognized that any polynucleotide of interest can be provided, integrated into the plant genome at the target site, and expressed in a plant.
  • Polynucleotides/polypeptides of interest include, but are not limited to, herbicide-resistance coding sequences, insecticidal coding sequences, nematicidal coding sequences, antimicrobial coding sequences, antifungal coding sequences, antiviral coding sequences, abiotic and biotic stress tolerance coding sequences, or sequences modifying plant traits such as yield, grain quality, nutrient content, starch quality and quantity, nitrogen fixation and/or utilization, fatty acids, and oil content and/or composition.
  • More specific polynucleotides of interest include, but are not limited to, genes that improve crop yield, polypeptides that improve desirability of crops, genes encoding proteins conferring resistance to abiotic stress, such as drought, nitrogen, temperature, salinity, toxic metals or trace elements, or those conferring resistance to toxins such as pesticides and herbicides, or to biotic stress, such as attacks by fungi, viruses, bacteria, insects, and nematodes, and development of diseases associated with these organisms.
  • General categories of genes of interest include, for example, those genes involved in information, such as zinc fingers, those involved in communication, such as kinases, and those involved in housekeeping, such as heat shock proteins.
  • transgenes include genes encoding important traits for agronomics, insect resistance, disease resistance, herbicide resistance, fertility or sterility, grain characteristics, and commercial products.
  • Genes of interest include, generally, those involved in oil, starch, carbohydrate, or nutrient metabolism as well as those affecting kernel size, sucrose loading, and the like that can be stacked or used in combination with other traits, such as but not limited to herbicide resistance, described herein.
  • Agronomically important traits such as oil, starch, and protein content can be genetically altered in addition to using traditional breeding methods. Modifications include increasing content of oleic acid, saturated and unsaturated oils, increasing levels of lysine and sulfur, providing essential amino acids, and also modification of starch. Hordothionin protein modifications are described in U.S. Pat. Nos. 5,703,049, 5,885,801, 5,885,802, and 5,990,389, herein incorporated by reference. Another example is lysine and/or sulfur rich seed protein encoded by the soybean 2S albumin described in U.S. Pat. No. 5,850,016, and the chymotrypsin inhibitor from barley, described in Williamson et al. (1987) Eur. J. Biochem. 165:99-106, the disclosures of which are herein incorporated by reference.
  • Derivatives of the coding sequences can be made by site-directed mutagenesis to increase the level of preselected amino acids in the encoded polypeptide.
  • the gene encoding the barley high lysine polypeptide (BHL) is derived from barley chymotrypsin inhibitor, U.S. application Ser. No. 08/740,682, filed Nov. 1, 1996, and WO 98/20133, the disclosures of which are herein incorporated by reference.
  • Other proteins include methionine-rich plant proteins such as from sunflower seed (Lilley et al. (1989) Proceedings of the World Congress on Vegetable Protein Utilization in Human Foods and Animal Feedstuffs , ed.
  • Applewhite American Oil Chemists Society, Champaign, Ill.), pp. 497-502; herein incorporated by reference
  • corn Pedersen et al. (1986) J. Biol. Chem. 261:6279; Kirihara et al. (1988) Gene 71:359; both of which are herein incorporated by reference
  • rice agronomically important genes encode latex, Floury 2, growth factors, seed storage factors, and transcription factors.
  • Polynucleotides that improve crop yield include dwarfing genes, such as Rht1 and Rht2 (Peng et al. (1999) Nature 400:256-261), and those that increase plant growth, such as ammonium-inducible glutamate dehydrogenase.
  • Polynucleotides that improve desirability of crops include, for example, those that allow plants to have reduced saturated fat content, those that boost the nutritional value of plants, and those that increase grain protein.
  • Polynucleotides that improve salt tolerance are those that increase or allow plant growth in an environment of higher salinity than the native environment of the plant into which the salt-tolerant gene(s) has been introduced.
  • Polynucleotides/polypeptides that influence amino acid biosynthesis include, for example, anthranilate synthase (AS; EC 4.1.3.27) which catalyzes the first reaction branching from the aromatic amino acid pathway to the biosynthesis of tryptophan in plants, fungi, and bacteria. In plants, the chemical processes for the biosynthesis of tryptophan are compartmentalized in the chloroplast. See, for example, US Pub. 20080050506, herein incorporated by reference. Additional sequences of interest include Chorismate Pyruvate Lyase (CPL) which refers to a gene encoding an enzyme which catalyzes the conversion of chorismate to pyruvate and pHBA. The most well characterized CPL gene has been isolated from E. coli and bears the GenBank accession number M96268. See, U.S. Pat. No. 7,361,811, herein incorporated by reference.
  • CPL Chorismate Pyruvate Lyase
  • Polynucleotide sequences of interest may encode proteins involved in providing disease or pest resistance.
  • Disease resistance or “pest resistance” is intended that the plants avoid the harmful symptoms that are the outcome of the plant-pathogen interactions.
  • Pest resistance genes may encode resistance to pests that have great yield drag such as rootworm, cutworm, European Corn Borer, and the like.
  • Disease resistance and insect resistance genes such as lysozymes or cecropins for antibacterial protection, or proteins such as defensins, glucanases or chitinases for antifungal protection, or Bacillus thuringiensis endotoxins, protease inhibitors, collagenases, lectins, or glycosidases for controlling nematodes or insects are all examples of useful gene products.
  • Genes encoding disease resistance traits include detoxification genes, such as against fumonisin (U.S. Pat. No. 5,792,931); avirulence (avr) and disease resistance (R) genes (Jones et al. (1994) Science 266:789; Martin et al.
  • Insect resistance genes may encode resistance to pests that have great yield drag such as rootworm, cutworm, European Corn Borer, and the like.
  • Such genes include, for example, Bacillus thuringiensis toxic protein genes (U.S. Pat. Nos. 5,366,892; 5,747,450; 5,736,514; 5,723,756; 5,593,881; and Geiser et al. (1986) Gene 48:109); and the like.
  • an “herbicide resistance protein” or a protein resulting from expression of an “herbicide resistance-encoding nucleic acid molecule” includes proteins that confer upon a cell the ability to tolerate a higher concentration of an herbicide than cells that do not express the protein, or to tolerate a certain concentration of an herbicide for a longer period of time than cells that do not express the protein.
  • Herbicide resistance traits may be introduced into plants by genes coding for resistance to herbicides that act to inhibit the action of acetolactate synthase (ALS), in particular the sulfonylurea-type herbicides, genes coding for resistance to herbicides that act to inhibit the action of glutamine synthase, such as phosphinothricin or basta (e.g., the bar gene), glyphosate (e.g., the EPSP synthase gene and the GAT gene), HPPD inhibitors (e.g, the HPPD gene) or other such genes known in the art. See, for example, U.S. Pat. Nos.
  • Sterility genes can also be encoded in an expression cassette and provide an alternative to physical detasseling. Examples of genes used in such ways include male fertility genes such as MS26 (see for example U.S. Pat. Nos. 7,098,388, 7,517,975, 7,612,251), MS45 (see for example U.S. Pat. Nos. 5,478,369, 6,265,640) or MSCA1 (see for example U.S. Pat. No. 7,919,676).
  • Maize plants Zea mays L.
  • Maize can be bred by both self-pollination and cross-pollination techniques. Maize has male flowers, located on the tassel, and female flowers, located on the ear, on the same plant.
  • breeding can self-pollinate (“selfing”) or cross pollinate. Natural pollination occurs in maize when wind blows pollen from the tassels to the silks that protrude from the tops of the incipient ears. Pollination may be readily controlled by techniques known to those of skill in the art.
  • the development of maize hybrids requires the development of homozygous inbred lines, the crossing of these lines, and the evaluation of the crosses.
  • Pedigree breeding and recurrent selections are two of the breeding methods used to develop inbred lines from populations. Breeding programs combine desirable traits from two or more inbred lines or various broad-based sources into breeding pools from which new inbred lines are developed by selfing and selection of desired phenotypes.
  • a hybrid maize variety is the cross of two such inbred lines, each of which may have one or more desirable characteristics lacked by the other or which complement the other. The new inbreds are crossed with other inbred lines and the hybrids from these crosses are evaluated to determine which have commercial potential.
  • the hybrid progeny of the first generation is designated F1.
  • the F1 hybrid is more vigorous than its inbred parents. This hybrid vigor, or heterosis, can be manifested in many ways, including increased vegetative growth and increased yield.
  • Hybrid maize seed can be produced by a male sterility system incorporating manual detasseling.
  • the male tassel is removed from the growing female inbred parent, which can be planted in various alternating row patterns with the male inbred parent. Consequently, providing that there is sufficient isolation from sources of foreign maize pollen, the ears of the female inbred will be fertilized only with pollen from the male inbred. The resulting seed is therefore hybrid (F1) and will form hybrid plants.
  • Field variation impacting plant development can result in plants tasseling after manual detasseling of the female parent is completed. Or, a female inbred plant tassel may not be completely removed during the detasseling process. In any event, the result is that the female plant will successfully shed pollen and some female plants will be self-pollinated. This will result in seed of the female inbred being harvested along with the hybrid seed which is normally produced. Female inbred seed does not exhibit heterosis and therefore is not as productive as F1 seed. In addition, the presence of female inbred seed can represent a germplasm security risk for the company producing the hybrid.
  • the female inbred can be mechanically detasseled by machine.
  • Mutations that cause male sterility in plants have the potential to be useful in methods for hybrid seed production for crop plants such as maize and can lower production costs by eliminating the need for the labor-intensive removal of male flowers (also known as de-tasseling) from the maternal parent plants used as a hybrid parent.
  • Mutations that cause male sterility in maize have been produced by a variety of methods such as X-rays or UV-irradiations, chemical treatments, or transposable element insertions (ms23, ms25, ms26, ms32) (Chaubal et al. (2000) Am J Bot 87:1193-1201).
  • Conditional regulation of fertility genes through fertility/sterility “molecular switches” could enhance the options for designing new male-sterility systems for crop improvement (Unger et al. (2002) Transgenic Res 11:455-465).
  • genes that have been discovered subsequently that are important to male fertility are numerous and include the Arabidopsis ABORTED MICROSPORES (AMS) gene, Sorensen et al., The Plant Journal (2003) 33(2):413-423); the Arabidopsis MS1 gene (Wilson et al., The Plant Journal (2001) 39(2):170-181); the NEF1 gene (Ariizumi et al., The Plant Journal (2004) 39(2):170-181); Arabidopsis AtGPAT1 gene (Zheng et al., The Plant Cell (2003) 15:1872-1887); the Arabidopsis dde2-2 mutation was shown to be defective in the allene oxide syntase gene (Malek et al., Planta (2002)216:187-192); the Arabidopsis faceless pollen-1 gene (flp1) (Ariizumi et al, Plant Mol.
  • AMS Arabidopsis ABORTED MICROSPORES
  • genes include kinases and those encoding compounds toxic to either male or female gametophytic development.
  • the polynucleotide of interest may also comprise antisense sequences complementary to at least a portion of the messenger RNA (mRNA) for a targeted gene sequence of interest.
  • Antisense nucleotides are constructed to hybridize with the corresponding mRNA. Modifications of the antisense sequences may be made as long as the sequences hybridize to and interfere with expression of the corresponding mRNA. In this manner, antisense constructions having 70%, 80%, or 85% sequence identity to the corresponding antisense sequences may be used. Furthermore, portions of the antisense nucleotides may be used to disrupt the expression of the target gene. Generally, sequences of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, or greater may be used.
  • the polynucleotide of interest may also be used in the sense orientation to suppress the expression of endogenous genes in plants.
  • Methods for suppressing gene expression in plants using polynucleotides in the sense orientation are known in the art.
  • the methods generally involve transforming plants with a DNA construct comprising a promoter that drives expression in a plant operably linked to at least a portion of a nucleotide sequence that corresponds to the transcript of the endogenous gene.
  • a nucleotide sequence has substantial sequence identity to the sequence of the transcript of the endogenous gene, generally greater than about 65% sequence identity, about 85% sequence identity, or greater than about 95% sequence identity. See, U.S. Pat. Nos. 5,283,184 and 5,034,323; herein incorporated by reference.
  • the polynucleotide of interest can also be a phenotypic marker.
  • a phenotypic marker is screenable or a selectable marker that includes visual markers and selectable markers whether it is a positive or negative selectable marker. Any phenotypic marker can be used.
  • a selectable or screenable marker comprises a DNA segment that allows one to identify, or select for or against a molecule or a cell that contains it, often under particular conditions. These markers can encode an activity, such as, but not limited to, production of RNA, peptide, or protein, or can provide a binding site for RNA, peptides, proteins, inorganic and organic compounds or compositions and the like.
  • selectable markers include, but are not limited to, DNA segments that comprise restriction enzyme sites; DNA segments that encode products which provide resistance against otherwise toxic compounds including antibiotics, such as, spectinomycin, ampicillin, kanamycin, tetracycline, Basta, neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT)); DNA segments that encode products which are otherwise lacking in the recipient cell (e.g., tRNA genes, auxotrophic markers); DNA segments that encode products which can be readily identified (e.g., phenotypic markers such as ⁇ -galactosidase, GUS; fluorescent proteins such as green fluorescent protein (GFP), cyan (CFP), yellow (YFP), red (RFP), and cell surface proteins); the generation of new primer sites for PCR (e.g., the juxtaposition of two DNA sequence not previously juxtaposed), the inclusion of DNA sequences not acted upon or acted upon by a restriction endonuclease or other DNA
  • Additional selectable markers include genes that confer resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). See for example, Yarranton, (1992) Curr Opin Biotech 3:506-11; Christopherson et al., (1992) Proc. Natl. Acad. Sci.
  • Exogenous products include plant enzymes and products as well as those from other sources including procaryotes and other eukaryotes. Such products include enzymes, cofactors, hormones, and the like.
  • the level of proteins, particularly modified proteins having improved amino acid distribution to improve the nutrient value of the plant, can be increased. This is achieved by the expression of such proteins having enhanced amino acid content.
  • the transgenes, recombinant DNA molecules, DNA sequences of interest, and polynucleotides of interest can be comprise one or more DNA sequences for gene silencing.
  • Methods for gene silencing involving the expression of DNA sequences in plant include, but are not limited to, cosuppression, antisense suppression, double-stranded RNA (dsRNA) interference, hairpin RNA (hpRNA) interference, intron-containing hairpin RNA (ihpRNA) interference, transcriptional gene silencing, and micro RNA (miRNA) interference
  • nucleic acid means a polynucleotide and includes a single or a double-stranded polymer of deoxyribonucleotide or ribonucleotide bases. Nucleic acids may also include fragments and modified nucleotides. Thus, the terms “polynucleotide”, “nucleic acid sequence”, “nucleotide sequence” and “nucleic acid fragment” are used interchangeably to denote a polymer of RNA and/or DNA that is single- or double-stranded, optionally containing synthetic, non-natural, or altered nucleotide bases.
  • Nucleotides are referred to by their single letter designation as follows: “A” for adenosine or deoxyadenosine (for RNA or DNA, respectively), “C” for cytosine or deoxycytosine, “G” for guanosine or deoxyguanosine, “U” for uridine, “T” for deoxythymidine, “R” for purines (A or G), “Y” for pyrimidines (C or T), “K” for G or T, “H” for A or C or T, “I” for inosine, and “N” for any nucleotide.
  • ORF Open reading frame
  • fragment that is functionally equivalent and “functionally equivalent subfragment” are used interchangeably herein. These terms refer to a portion or subsequence of an isolated nucleic acid fragment in which the ability to alter gene expression or produce a certain phenotype is retained whether or not the fragment or subfragment encodes an active enzyme.
  • the fragment or subfragment can be used in the design of genes to produce the desired phenotype in a transformed plant. genes can be designed for use in suppression by linking a nucleic acid fragment or subfragment thereof, whether or not it encodes an active enzyme, in the sense or antisense orientation relative to a plant promoter sequence.
  • conserved domain or “motif” means a set of amino acids conserved at specific positions along an aligned sequence of evolutionarily related proteins. While amino acids at other positions can vary between homologous proteins, amino acids that are highly conserved at specific positions indicate amino acids that are essential to the structure, the stability, or the activity of a protein. Because they are identified by their high degree of conservation in aligned sequences of a family of protein homologues, they can be used as identifiers, or “signatures”, to determine if a protein with a newly determined sequence belongs to a previously identified protein family.
  • Polynucleotide and polypeptide sequences, variants thereof, and the structural relationships of these sequences can be described by the terms “homology”, “homologous”, “substantially identical”, “substantially similar” and “corresponding substantially” which are used interchangeably herein. These refer to polypeptide or nucleic acid fragments wherein changes in one or more amino acids or nucleotide bases do not affect the function of the molecule, such as the ability to mediate gene expression or to produce a certain phenotype. These terms also refer to modification(s) of nucleic acid fragments that do not substantially alter the functional properties of the resulting nucleic acid fragment relative to the initial, unmodified fragment. These modifications include deletion, substitution, and/or insertion of one or more nucleotides in the nucleic acid fragment.
  • Substantially similar nucleic acid sequences encompassed may be defined by their ability to hybridize (under moderately stringent conditions, e.g., 0.5 ⁇ SSC, 0.1% SDS, 60° C.) with the sequences exemplified herein, or to any portion of the nucleotide sequences disclosed herein and which are functionally equivalent to any of the nucleic acid sequences disclosed herein.
  • Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms. Post-hybridization washes determine stringency conditions.
  • sequences include reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids.
  • Selectively hybridizing sequences typically have about at least 80% sequence identity, or 90% sequence identity, up to and including 100% sequence identity (i.e., fully complementary) with each other.
  • stringent conditions or “stringent hybridization conditions” includes reference to conditions under which a probe will selectively hybridize to its target sequence in an in vitro hybridization assay. Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length.
  • stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salt(s)) at pH 7.0 to 8.3, and at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.5 ⁇ to 1 ⁇ SSC at 55 to 60° C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1 ⁇ SSC at 60 to 65° C.
  • Sequence identity or “identity” in the context of nucleic acid or polypeptide sequences refers to the nucleic acid bases or amino acid residues in two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
  • percentage of sequence identity refers to the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the results by 100 to yield the percentage of sequence identity.
  • percent sequence identities include, but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or any integer percentage from 50% to 100%. These identities can be determined using any of the programs described herein.
  • Sequence alignments and percent identity or similarity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the MegAlignTM program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.).
  • sequence analysis software is used for analysis, that the results of the analysis will be based on the “default values” of the program referenced, unless otherwise specified.
  • default values will mean any set of values or parameters that originally load with the software when first initialized.
  • Clustal V method of alignment corresponds to the alignment method labeled Clustal V (described by Higgins and Sharp, (1989) CABIOS 5:151-153; Higgins et al., (1992) Comput Appl Biosci 8:189-191) and found in the MegAlignTM program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.).
  • sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 (GCG, Accelrys, San Diego, Calif.) using the following parameters: % identity and % similarity for a nucleotide sequence using a gap creation penalty weight of 50 and a gap length extension penalty weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using a GAP creation penalty weight of 8 and a gap length extension penalty of 2, and the BLOSUM62 scoring matrix (Henikoff and Henikoff, (1989) Proc. Natl. Acad. Sci. USA 89:10915).
  • GAP uses the algorithm of Needleman and Wunsch, (1970) J Mol Biol 48:443-53, to find an alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps, using a gap creation penalty and a gap extension penalty in units of matched bases.
  • BLAST is a searching algorithm provided by the National Center for Biotechnology Information (NCBI) used to find regions of similarity between biological sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches to identify sequences having sufficient similarity to a query sequence such that the similarity would not be predicted to have occurred randomly. BLAST reports the identified sequences and their local alignment to the query sequence.
  • sequence identity is useful in identifying polypeptides from other species or modified naturally or synthetically wherein such polypeptides have the same or similar function or activity.
  • Useful examples of percent identities include, but are not limited to, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or any integer percentage from 50% to 100%.
  • any integer amino acid identity from 50% to 100% may be useful in describing the present disclosure, such as 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.
  • Gene includes a nucleic acid fragment that expresses a functional molecule such as, but not limited to, a specific protein, including regulatory sequences preceding (5′ non-coding sequences) and following (3′ non-coding sequences) the coding sequence.
  • “Native gene” refers to a gene as found in nature with its own regulatory sequences.
  • a “mutated gene” is a gene that has been altered through human intervention. Such a “mutated gene” has a sequence that differs from the sequence of the corresponding non-mutated gene by at least one nucleotide addition, deletion, or substitution. In certain embodiments of the disclosure, the mutated gene comprises an alteration that results from a guide polynucleotide/Cas endonuclease system as disclosed herein.
  • a mutated plant is a plant comprising a mutated gene.
  • a “targeted mutation” is a mutation in a native gene that was made by altering a target sequence within the native gene using a method involving a double-strand-break-inducing agent that is capable of inducing a double-strand break in the DNA of the target sequence as disclosed herein or known in the art.
  • the targeted mutation is the result of a guideRNA/Cas endonuclease induced gene editing as described herein.
  • the guide RNA/Cas endonuclease induced targeted mutation can occur in a nucleotide sequence that is located within or outside a genomic target site that is recognized and cleaved by a Cas endonuclease.
  • gene as it applies to a plant cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components (e.g., mitochondria, or plastid) of the cell.
  • a “codon-modified gene” or “codon-preferred gene” or “codon-optimized gene” is a gene having its frequency of codon usage designed to mimic the frequency of preferred codon usage of the host cell.
  • an “allele” is one of several alternative forms of a gene occupying a given locus on a chromosome. When all the alleles present at a given locus on a chromosome are the same, that plant is homozygous at that locus. If the alleles present at a given locus on a chromosome differ, that plant is heterozygous at that locus.
  • Coding sequence refers to a polynucleotide sequence which codes for a specific amino acid sequence.
  • Regulatory sequences refer to nucleotide sequences located upstream (5′ non-coding sequences), within, or downstream (3′ non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to: promoters, translation leader sequences, 5′ untranslated sequences, 3′ untranslated sequences, introns, polyadenylation target sequences, RNA processing sites, effector binding sites, and stem-loop structures.
  • a plant-optimized nucleotide sequence is nucleotide sequence that has been optimized for increased expression in plants, particularly for increased expression in plants or in one or more plants of interest.
  • a plant-optimized nucleotide sequence can be synthesized by modifying a nucleotide sequence encoding a protein such as, for example, double-strand-break-inducing agent (e.g., an endonuclease) as disclosed herein, using one or more plant-preferred codons for improved expression. See, for example, Campbell and Gowri (1990) Plant Physiol. 92:1-11 for a discussion of host-preferred codon usage.
  • the G-C content of the sequence may be adjusted to levels average for a given plant host, as calculated by reference to known genes expressed in the host plant cell.
  • the sequence is modified to avoid one or more predicted hairpin secondary mRNA structures.
  • a plant-optimized nucleotide sequence of the present disclosure comprises one or more of such sequence modifications.
  • Promoter refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
  • the promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
  • An “enhancer” is a DNA sequence that can stimulate promoter activity, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, and/or comprise synthetic DNA segments.
  • promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of some variation may have identical promoter activity. Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”.
  • tissue specific promoters or tissue-preferred promoters if the promoters direct RNA synthesis preferably in certain tissues but also in other tissues at reduced levels. Since patterns of expression of a chimeric gene (or genes) introduced into a plant are controlled using promoters, there is an ongoing interest in the isolation of novel promoters which are capable of controlling the expression of a chimeric gene or (genes) at certain levels in specific tissue types or at specific plant developmental stages.
  • Some embodiments of the disclosures relate to newly discovered U6 RNA polymerase III promoters, GM-U6-13.1 (SEQ ID NO: 120) as described in Example 12 and GM-U6-9.1 (SEQ ID NO: 295) described in Example 19.
  • Non-limiting examples of methods and compositions relating to the soybean promoters described herein are as follows:
  • a recombinant DNA construct comprising a nucleotide sequence comprising any of the sequences set forth in SEQ ID NO:120 or SEQ ID NO:295, or a functional fragment thereof, operably linked to at least one heterologous sequence, wherein said nucleotide sequence is a promoter.
  • a vector comprising the recombinant DNA construct of embodiment A1.
  • a cell comprising the recombinant DNA construct of embodiment A1.
  • A5. The cell of embodiment A4, wherein the cell is a plant cell.
  • a transgenic plant having stably incorporated into its genome the recombinant DNA construct of embodiment A1.
  • transgenic plant of embodiment A6 wherein said plant is a dicot plant.
  • A8 The transgenic plant of embodiment A7 wherein the plant is soybean.
  • the recombinant DNA construct of embodiment A1 wherein the at least one heterologous sequence codes for a gene selected from the group consisting of: a reporter gene, a selection marker, a disease resistance conferring gene, a herbicide resistance conferring gene, an insect resistance conferring gene; a gene involved in carbohydrate metabolism, a gene involved in fatty acid metabolism, a gene involved in amino acid metabolism, a gene involved in plant development, a gene involved in plant growth regulation, a gene involved in yield improvement, a gene involved in drought resistance, a gene involved in cold resistance, a gene involved in heat resistance and a gene involved in salt resistance in plants.
  • a reporter protein a selection marker, a protein conferring disease resistance, protein conferring herbicide resistance, protein conferring insect resistance
  • protein involved in carbohydrate metabolism protein involved in fatty acid metabolism, protein involved in amino acid metabolism, protein involved in plant development, protein involved in plant growth regulation, protein involved in yield improvement, protein involved in drought resistance, protein involved in cold resistance, protein involved in heat resistance and protein involved in salt resistance in plants.
  • A12 A method of expressing a coding sequence or a functional RNA in a plant comprising:
  • step b) growing the plant of step a);
  • A13 A method of transgenically altering a marketable plant trait, comprising:
  • step b) growing a fertile, mature plant resulting from step a);
  • A14 The method of embodiment A13 wherein the marketable trait is selected from the group consisting of: disease resistance, herbicide resistance, insect resistance carbohydrate metabolism, fatty acid metabolism, amino acid metabolism, plant development, plant growth regulation, yield improvement, drought resistance, cold resistance, heat resistance, and salt resistance.
  • a method for altering expression of at least one heterologous sequence in a plant comprising:
  • step (b) growing fertile mature plants from transformed plant cell of step (a);
  • Embodiment A16 The method of Embodiment A15 wherein the plant is a soybean plant.
  • A17 A plant stably transformed with a recombinant DNA construct comprising a soybean promoter and a heterologous nucleic acid fragment operably linked to said promoter, wherein said promoter is a capable of controlling expression of said heterologous nucleic acid fragment in a plant cell, and further wherein said promoter comprises any of the sequences set forth in SEQ ID NO: 120 or SEQ ID NO:295.
  • Translation leader sequence refers to a polynucleotide sequence located between the promoter sequence of a gene and the coding sequence.
  • the translation leader sequence is present in the mRNA upstream of the translation start sequence.
  • the translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. Examples of translation leader sequences have been described (e.g., Turner and Foster, (1995) Mol Biotechnol 3:225-236).
  • 3′ non-coding sequences refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
  • the polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3′ end of the mRNA precursor.
  • the use of different 3′ non-coding sequences is exemplified by Ingelbrecht et al., (1989) Plant Cell 1:671-680.
  • RNA transcript refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complimentary copy of the DNA sequence, it is referred to as the primary transcript or pre-mRNA. A RNA transcript is referred to as the mature RNA or mRNA when it is a RNA sequence derived from post-transcriptional processing of the primary transcript pre mRNAt. “Messenger RNA” or “mRNA” refers to the RNA that is without introns and that can be translated into protein by the cell. “cDNA” refers to a DNA that is complementary to, and synthesized from, a mRNA template using the enzyme reverse transcriptase.
  • RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro.
  • Antisense RNA refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA, and that blocks the expression of a target gene (see, e.g., U.S. Pat. No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5′ non-coding sequence, 3′ non-coding sequence, introns, or the coding sequence.
  • RNA refers to antisense RNA, ribozyme RNA, or other RNA that may not be translated but yet has an effect on cellular processes.
  • complement and “reverse complement” are used interchangeably herein with respect to mRNA transcripts, and are meant to define the antisense RNA of the message.
  • operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is regulated by the other.
  • a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter).
  • Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation.
  • the complementary RNA regions can be operably linked, either directly or indirectly, 5′ to the target mRNA, or 3′ to the target mRNA, or within the target mRNA, or a first complementary region is 5′ and its complement is 3′ to the target mRNA.
  • PCR or “polymerase chain reaction” is a technique for the synthesis of specific DNA segments and consists of a series of repetitive denaturation, annealing, and extension cycles. Typically, a double-stranded DNA is heat denatured, and two primers complementary to the 3′ boundaries of the target segment are annealed to the DNA at low temperature, and then extended at an intermediate temperature. One set of these three consecutive steps is referred to as a “cycle”.
  • recombinant refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis, or manipulation of isolated segments of nucleic acids by genetic engineering techniques.
  • Plasmid refers to an extra chromosomal element often carrying genes that are not part of the central metabolism of the cell, and usually in the form of double-stranded DNA.
  • Such elements may be autonomously replicating sequences, genome integrating sequences, phage, or nucleotide sequences, in linear or circular form, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a polynucleotide of interest into a cell.
  • Transformation cassette refers to a specific vector containing a gene and having elements in addition to the gene that facilitates transformation of a particular host cell.
  • Expression cassette refers to a specific vector containing a gene and having elements in addition to the gene that allow for expression of that gene in a host.
  • a recombinant construct comprises an artificial combination of nucleic acid fragments, e.g., regulatory and coding sequences that are not all found together in nature.
  • a construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
  • Such a construct may be used by itself or may be used in conjunction with a vector.
  • a vector is used, then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art.
  • a plasmid vector can be used.
  • the skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells.
  • the skilled artisan will also recognize that different independent transformation events may result in different levels and patterns of expression (Jones et al., (1985) EMBO J. 4:2411-2418; De Almeida et al., (1989) Mol Gen Genetics 218:78-86), and thus that multiple events are typically screened in order to obtain lines displaying the desired expression level and pattern.
  • Such screening may be accomplished standard molecular biological, biochemical, and other assays including Southern analysis of DNA, Northern analysis of mRNA expression, PCR, real time quantitative PCR (qPCR), reverse transcription PCR (RT-PCR), immunoblotting analysis of protein expression, enzyme or activity assays, and/or phenotypic analysis.
  • Southern analysis of DNA Northern analysis of mRNA expression, PCR, real time quantitative PCR (qPCR), reverse transcription PCR (RT-PCR), immunoblotting analysis of protein expression, enzyme or activity assays, and/or phenotypic analysis.
  • expression refers to the production of a functional end-product (e.g., an mRNA, guide RNA, or a protein) in either precursor or mature form.
  • a functional end-product e.g., an mRNA, guide RNA, or a protein
  • introduced means providing a nucleic acid (e.g., expression construct) or protein into a cell. Introduced includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell, and includes reference to the transient provision of a nucleic acid or protein to the cell. Introduced includes reference to stable or transient transformation methods, as well as sexually crossing.
  • “introduced” in the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct/expression construct) into a cell means “transfection” or “transformation” or “transduction” and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
  • a nucleic acid fragment e.g., a recombinant DNA construct/expression construct
  • “Mature” protein refers to a post-translationally processed polypeptide (i.e., one from which any pre- or propeptides present in the primary translation product have been removed). “Precursor” protein refers to the primary product of translation of mRNA (i.e., with pre- and propeptides still present). Pre- and propeptides may be but are not limited to intracellular localization signals.
  • “Stable transformation” refers to the transfer of a nucleic acid fragment into a genome of a host organism, including both nuclear and organellar genomes, resulting in genetically stable inheritance.
  • “transient transformation” refers to the transfer of a nucleic acid fragment into the nucleus, or other DNA-containing organelle, of a host organism resulting in gene expression without integration or stable inheritance.
  • Host organisms containing the transformed nucleic acid fragments are referred to as “transgenic” organisms.
  • Gene stacking can be accomplished by many means including but not limited to co-transformation, retransformation, and crossing lines with different genes of interest.
  • Plant refers to whole plants, plant organs, plant tissues, seeds, plant cells, seeds and progeny of the same.
  • Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores.
  • Plant parts include differentiated and undifferentiated tissues including, but not limited to roots, stems, shoots, leaves, pollens, seeds, tumor tissue and various forms of cells and culture (e.g., single cells, protoplasts, embryos, and callus tissue).
  • the plant tissue may be in plant or in a plant organ, tissue or cell culture.
  • plant organ refers to plant tissue or a group of tissues that constitute a morphologically and functionally distinct part of a plant.
  • gene refers to the entire complement of genetic material (genes and non-coding sequences) that is present in each cell of an organism, or virus or organelle; and/or a complete set of chromosomes inherited as a (haploid) unit from one parent. “Progeny” comprises any subsequent generation of a plant.
  • a transgenic plant includes, for example, a plant which comprises within its genome a heterologous polynucleotide introduced by a transformation step.
  • the heterologous polynucleotide can be stably integrated within the genome such that the polynucleotide is passed on to successive generations.
  • the heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct.
  • a transgenic plant can also comprise more than one heterologous polynucleotide within its genome. Each heterologous polynucleotide may confer a different trait to the transgenic plant.
  • a heterologous polynucleotide can include a sequence that originates from a foreign species, or, if from the same species, can be substantially modified from its native form.
  • Transgenic can include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic.
  • the alterations of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods, by the genome editing procedure described herein that does not result in an insertion of a foreign polynucleotide, or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation are not intended to be regarded as transgenic.
  • a fertile plant is a plant that produces viable male and female gametes and is self-fertile. Such a self-fertile plant can produce a progeny plant without the contribution from any other plant of a gamete and the genetic material contained therein.
  • Other embodiments of the disclosure can involve the use of a plant that is not self-fertile because the plant does not produce male gametes, or female gametes, or both, that are viable or otherwise capable of fertilization.
  • a “male sterile plant” is a plant that does not produce male gametes that are viable or otherwise capable of fertilization.
  • a “female sterile plant” is a plant that does not produce female gametes that are viable or otherwise capable of fertilization.
  • male-sterile and female-sterile plants can be female-fertile and male-fertile, respectively. It is further recognized that a male fertile (but female sterile) plant can produce viable progeny when crossed with a female fertile plant and that a female fertile (but male sterile) plant can produce viable progeny when crossed with a male fertile plant.
  • centimorgan or “map unit” is the distance between two linked genes, markers, target sites, loci, or any pair thereof, wherein 1% of the products of meiosis are recombinant.
  • a centimorgan is equivalent to a distance equal to a 1% average recombination frequency between the two linked genes, markers, target sites, loci, or any pair thereof.
  • transgenic traits are randomly inserted throughout the plant genome as a consequence of transformation systems based on Agrobacterium , biolistics, or other commonly used procedures. More recently, gene targeting protocols have been developed that enable directed transgene insertion.
  • site-specific integration SSI
  • Custom-designed meganucleases and custom-designed zinc finger meganucleases allow researchers to design nucleases to target specific chromosomal locations, and these reagents allow the targeting of transgenes at the chromosomal site cleaved by these nucleases.
  • RNA-directed DNA nuclease, guide RNA/Cas9 endonuclease system described herein is more easily customizable and therefore more useful when modification of many different target sequences is the goal.
  • This disclosure takes further advantage of the two component nature of the guide RNA/Cas system, with its constant protein component, the Cas endonuclease, and its variable and easily reprogrammable targeting component, the guide RNA or the crRNA.
  • the constant component in the form of an expression-optimized Cas9 gene, is stably integrated into the target genome, e.g. plant genome.
  • Expression of the Cas9 gene is under control of a promoter, e.g. plant promoter, which can be a constitutive promoter, tissue-specific promoter or inducible promoter, e.g. temperature-inducible, stress-inducible, developmental stage inducible, or chemically inducible promoter.
  • a promoter e.g. plant promoter, which can be a constitutive promoter, tissue-specific promoter or inducible promoter, e.g. temperature-inducible, stress-inducible, developmental stage inducible, or chemically inducible promoter.
  • guide RNAs or crRNAs can be introduced by a variety of methods into cells containing the stably-integrated and expressed cas9 gene.
  • guide RNAs or crRNAs can be chemically or enzymatically synthesized, and introduced into the Cas9 expressing cells via direct delivery methods such a particle bombardment or electroporation.
  • genes capable of efficiently expressing guide RNAs or crRNAs in the target cells can be synthesized chemically, enzymatically or in a biological system, and these genes can be introduced into the Cas9 expressing cells via direct delivery methods such a particle bombardment, electroporation or biological delivery methods such as Agrobacterium mediated DNA delivery.
  • One embodiment of the disclosure is a method for selecting a plant comprising an altered target site in its plant genome, the method comprising: a) obtaining a first plant comprising at least one Cas endonuclease capable of introducing a double strand break at a target site in the plant genome; b) obtaining a second plant comprising a guide RNA that is capable of forming a complex with the Cas endonuclease of (a), c) crossing the first plant of (a) with the second plant of (b); d) evaluating the progeny of (c) for an alteration in the target site and e) selecting a progeny plant that possesses the desired alteration of said target site.
  • Another embodiment of the disclosure is a method for selecting a plant comprising an altered target site in its plant genome, the method comprising: a) obtaining a first plant comprising at least one Cas endonuclease capable of introducing a double strand break at a target site in the plant genome; b) obtaining a second plant comprising a guide RNA and a donor DNA, wherein said guide RNA is capable of forming a complex with the Cas endonuclease of (a), wherein said donor DNA comprises a polynucleotide of interest; c) crossing the first plant of (a) with the second plant of (b); d) evaluating the progeny of (c) for an alteration in the target site and e) selecting a progeny plant that comprises the polynucleotide of interest inserted at said target site.
  • Another embodiment of the disclosure is a method for selecting a plant comprising an altered target site in its plant genome, the method comprising selecting at least one progeny plant that comprises an alteration at a target site in its plant genome, wherein said progeny plant was obtained by crossing a first plant expressing at least one Cas endonuclease to a second plant comprising a guide RNA and a donor DNA, wherein said Cas endonuclease is capable of introducing a double strand break at said target site, wherein said donor DNA comprises a polynucleotide of interest.
  • a guide RNA/Cas system mediating gene targeting can be used in methods for directing transgene insertion and/or for producing complex transgenic trait loci comprising multiple transgenes in a fashion similar as disclosed in WO2013/0198888 (published Aug. 1, 2013) where instead of using a double strand break inducing agent to introduce a gene of interest, a guide RNA/Cas system or a guide polynucleotide/Cas system as disclosed herein is used.
  • a complex transgenic trait locus is a genomic locus that has multiple transgenes genetically linked to each other.
  • the transgenes can be bred as a single genetic locus (see, for example, U.S. patent application Ser. No. 13/427,138) or PCT application PCT/US2012/030061.
  • plants containing (at least) one transgenes can be crossed to form an F1 that contains both transgenes.
  • progeny from these F1 F2 or BC1
  • progeny would have the two different transgenes recombined onto the same chromosome.
  • the complex locus can then be bred as single genetic locus with both transgene traits. This process can be repeated to stack as many traits as desired.
  • Chromosomal intervals that correlate with a phenotype or trait of interest can be identified.
  • a variety of methods well known in the art are available for identifying chromosomal intervals.
  • the boundaries of such chromosomal intervals are drawn to encompass markers that will be linked to the gene controlling the trait of interest.
  • the chromosomal interval is drawn such that any marker that lies within that interval (including the terminal markers that define the boundaries of the interval) can be used as a marker for northern leaf blight resistance.
  • the chromosomal interval comprises at least one QTL, and furthermore, may indeed comprise more than one QTL.
  • QTL quantitative trait locus
  • An “allele of a QTL” can comprise multiple genes or other genetic factors within a contiguous genomic region or linkage group, such as a haplotype.
  • An allele of a QTL can denote a haplotype within a specified window wherein said window is a contiguous genomic region that can be defined, and tracked, with a set of one or more polymorphic markers.
  • a haplotype can be defined by the unique fingerprint of alleles at each marker within the specified window.
  • a variety of methods are available to identify those cells having an altered genome at or near a target site without using a screenable marker phenotype. Such methods can be viewed as directly analyzing a target sequence to detect any change in the target sequence, including but not limited to PCR methods, sequencing methods, nuclease digestion, Southern blots, and any combination thereof.
  • Proteins may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known. For example, amino acid sequence variants of the protein(s) can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations include, for example, Kunkel, (1985) Proc. Natl. Acad. Sci. USA 82:488-92; Kunkel et al., (1987) Meth Enzymol 154:367-82; U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein.
  • amino acid substitutions not likely to affect biological activity of the protein are found, for example, in the model of Dayhoff et al., (1978) Atlas of Protein Sequence and Structure (Natl Biomed Res Found, Washington, D.C.). Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be preferable. Conservative deletions, insertions, and amino acid substitutions are not expected to produce radical changes in the characteristics of the protein, and the effect of any substitution, deletion, insertion, or combination thereof can be evaluated by routine screening assays. Assays for double-strand-break-inducing activity are known and generally measure the overall activity and specificity of the agent on DNA substrates containing target sites.
  • a variety of methods are known for the introduction of nucleotide sequences and polypeptides into an organism, including, for example, transformation, sexual crossing, and the introduction of the polypeptide, DNA, or mRNA into the cell.
  • Methods for contacting, providing, and/or introducing a composition into various organisms include but are not limited to, stable transformation methods, transient transformation methods, virus-mediated methods, and sexual breeding.
  • Stable transformation indicates that the introduced polynucleotide integrates into the genome of the organism and is capable of being inherited by progeny thereof.
  • Transient transformation indicates that the introduced composition is only temporarily expressed or present in the organism.
  • Protocols for introducing polynucleotides and polypeptides into plants may vary depending on the type of plant or plant cell targeted for transformation, such as monocot or dicot. Suitable methods of introducing polynucleotides and polypeptides into plant cells and subsequent insertion into the plant genome include microinjection (Crossway et al., (1986) Biotechniques 4:320-34 and U.S. Pat. No. 6,300,543), meristem transformation (U.S. Pat. No. 5,736,369), electroporation (Riggs et al., (1986) Proc. Natl. Acad. Sci. USA 83:5602-6, Agrobacterium -mediated transformation (U.S. Pat. Nos.
  • polynucleotides may be introduced into plants by contacting plants with a virus or viral nucleic acids.
  • such methods involve incorporating a polynucleotide within a viral DNA or RNA molecule.
  • a polypeptide of interest may be initially synthesized as part of a viral polyprotein, which is later processed by proteolysis in vivo or in vitro to produce the desired recombinant protein.
  • Methods for introducing polynucleotides into plants and expressing a protein encoded therein, involving viral DNA or RNA molecules are known, see, for example, U.S. Pat. Nos. 5,889,191, 5,889,190, 5,866,785, 5,589,367 and 5,316,931.
  • Transient transformation methods include, but are not limited to, the introduction of polypeptides, such as a double-strand break inducing agent, directly into the organism, the introduction of polynucleotides such as DNA and/or RNA polynucleotides, and the introduction of the RNA transcript, such as an mRNA encoding a double-strand break inducing agent, into the organism.
  • Such methods include, for example, microinjection or particle bombardment. See, for example Crossway et al., (1986) Mol Gen Genet 202:179-85; Nomura et al., (1986) Plant Sci 44:53-8; Hepler et al., (1994) Proc. Natl. Acad. Sci. USA 91:2176-80; and, Hush et al., (1994) J Cell Sci 107:775-84.
  • phytoen refers to the subclass of angiosperm plants also knows as “dicotyledoneae” and includes reference to whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds, plant cells, and progeny of the same.
  • Plant cell as used herein includes, without limitation, seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.
  • crossing means the fusion of gametes via pollination to produce progeny (i.e., cells, seeds, or plants).
  • progeny i.e., cells, seeds, or plants.
  • the term encompasses both sexual crosses (the pollination of one plant by another) and selfing (self-pollination, i.e., when the pollen and ovule (or microspores and megaspores) are from the same plant or genetically identical plants).
  • introgression refers to the transmission of a desired allele of a genetic locus from one genetic background to another.
  • introgression of a desired allele at a specified locus can be transmitted to at least one progeny plant via a sexual cross between two parent plants, where at least one of the parent plants has the desired allele within its genome.
  • transmission of an allele can occur by recombination between two donor genomes, e.g., in a fused protoplast, where at least one of the donor protoplasts has the desired allele in its genome.
  • the desired allele can be, e.g., a transgene, a modified (mutated or edited) native allele, or a selected allele of a marker or QTL.
  • Vectors and constructs include circular plasmids, and linear polynucleotides, comprising a polynucleotide of interest and optionally other components including linkers, adapters, regulatory regions, introns, restriction sites, enhancers, insulators, selectable markers, nucleotide sequences of interest, promoters, and/or other sites that aid in vector construction or analysis.
  • a recognition site and/or target site can be contained within an intron, coding sequence, 5′ UTRs, 3′ UTRs, and/or regulatory regions.
  • the present disclosure further provides expression constructs for expressing in a plant, plant cell, or plant part a guide RNA/Cas system that is capable of binding to and creating a double strand break in a target site.
  • the expression constructs of the disclosure comprise a promoter operably linked to a nucleotide sequence encoding a Cas gene and a promoter operably linked to a guide RNA of the present disclosure.
  • the promoter is capable of driving expression of an operably linked nucleotide sequence in a plant cell.
  • a promoter is a region of DNA involved in recognition and binding of RNA polymerase and other proteins to initiate transcription.
  • a plant promoter is a promoter capable of initiating transcription in a plant cell, for a review of plant promoters, see, Potenza et al., (2004) In Vitro Cell Dev Biol 40:1-22.
  • Constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO99/43838 and U.S. Pat. No.
  • Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator.
  • the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression.
  • Chemical-inducible promoters include, but are not limited to, the maize In2-2 promoter, activated by benzene sulfonamide herbicide safeners (De Veylder et al., (1997) Plant Cell Physiol 38:568-77), the maize GST promoter (GST-II-27, WO93/01294), activated by hydrophobic electrophilic compounds used as pre-emergent herbicides, and the tobacco PR-1a promoter (Ono et al., (2004) Biosci Biotechnol Biochem 68:803-7) activated by salicylic acid.
  • steroid-responsive promoters see, for example, the glucocorticoid-inducible promoter (Schena et al., (1991) Proc. Natl. Acad. Sci. USA 88:10421-5; McNellis et al., (1998) Plant J 14:247-257); tetracycline-inducible and tetracycline-repressible promoters (Gatz et al., (1991) Mol Gen Genet 227:229-37; U.S. Pat. Nos. 5,814,618 and 5,789,156).
  • Tissue-preferred promoters can be utilized to target enhanced expression within a particular plant tissue.
  • Tissue-preferred promoters include, for example, Kawamata et al., (1997) Plant Cell Physiol 38:792-803; Hansen et al., (1997) Mol Gen Genet 254:337-43; Russell et al., (1997) Transgenic Res 6:157-68; Rinehart et al., (1996) Plant Physiol 112:1331-41; Van Camp et al., (1996) Plant Physiol 112:525-35; Canevascini et al., (1996) Plant Physiol 112:513-524; Lam, (1994) Results Probl Cell Differ 20:181-96; and Guevara-Garcia et al., (1993) Plant J 4:495-505.
  • Leaf-preferred promoters include, for example, Yamamoto et al., (1997) Plant J 12:255-65; Kwon et al., (1994) Plant Physiol 105:357-67; Yamamoto et al., (1994) Plant Cell Physiol 35:773-8; Gotor et al., (1993) Plant J 3:509-18; Orozco et al., (1993) Plant Mol Biol 23:1129-38; Matsuoka et al., (1993) Proc. Natl. Acad. Sci. USA 90:9586-90; Simpson et al., (1958) EMBO J. 4:2723-9; Timko et al., (1988) Nature 318:57-8.
  • Root-preferred promoters include, for example, Hire et al., (1992) Plant Mol Biol 20:207-18 (soybean root-specific glutamine synthase gene); Miao et al., (1991) Plant Cell 3:11-22 (cytosolic glutamine synthase (GS)); Keller and Baumgartner, (1991) Plant Cell 3:1051-61 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al., (1990) Plant Mol Biol 14:433-43 (root-specific promoter of A.
  • MAS tumefaciens mannopine synthase
  • Bogusz et al. (1990) Plant Cell 2:633-41 (root-specific promoters isolated from Parasponia andersonii and Trema tomentosa ); Leach and Aoyagi, (1991) Plant Sci 79:69-76 ( A.
  • Seed-preferred promoters include both seed-specific promoters active during seed development, as well as seed-germinating promoters active during seed germination. See, Thompson et al., (1989) BioEssays 10:108. Seed-preferred promoters include, but are not limited to, Cim1 (cytokinin-induced message); cZ19B1 (maize 19 kDa zein); and milps (myo-inositol-1-phosphate synthase); (WO00/11177; and U.S. Pat. No. 6,225,529).
  • seed-preferred promoters include, but are not limited to, bean ⁇ -phaseolin, napin, ⁇ -conglycinin, soybean lectin, cruciferin, and the like.
  • seed-preferred promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa gamma zein, waxy, shrunken 1, shrunken 2, globulin 1, oleosin, and nuc1. See also, WO00/12733, where seed-preferred promoters from END1 and END2 genes are disclosed.
  • a phenotypic marker is a screenable or selectable marker that includes visual markers and selectable markers whether it is a positive or negative selectable marker. Any phenotypic marker can be used.
  • a selectable or screenable marker comprises a DNA segment that allows one to identify, or select for or against a molecule or a cell that contains it, often under particular conditions. These markers can encode an activity, such as, but not limited to, production of RNA, peptide, or protein, or can provide a binding site for RNA, peptides, proteins, inorganic and organic compounds or compositions and the like.
  • selectable markers include, but are not limited to, DNA segments that comprise restriction enzyme sites; DNA segments that encode products which provide resistance against otherwise toxic compounds including antibiotics, such as, spectinomycin, ampicillin, kanamycin, tetracycline, Basta, neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT)); DNA segments that encode products which are otherwise lacking in the recipient cell (e.g., tRNA genes, auxotrophic markers); DNA segments that encode products which can be readily identified (e.g., phenotypic markers such as ⁇ -galactosidase, GUS; fluorescent proteins such as green fluorescent protein (GFP), cyan (CFP), yellow (YFP), red (RFP), and cell surface proteins); the generation of new primer sites for PCR (e.g., the juxtaposition of two DNA sequence not previously juxtaposed), the inclusion of DNA sequences not acted upon or acted upon by a restriction endonuclease or other DNA
  • Additional selectable markers include genes that confer resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). See for example, Yarranton, (1992) Curr Opin Biotech 3:506-11; Christopherson et al., (1992) Proc. Natl. Acad. Sci.
  • the cells having the introduced sequence may be grown or regenerated into plants using conventional conditions, see for example, McCormick et al., (1986) Plant Cell Rep 5:81-4. These plants may then be grown, and either pollinated with the same transformed strain or with a different transformed or untransformed strain, and the resulting progeny having the desired characteristic and/or comprising the introduced polynucleotide or polypeptide identified. Two or more generations may be grown to ensure that the polynucleotide is stably maintained and inherited, and seeds harvested.
  • Any plant can be used, including monocot and dicot plants.
  • monocot plants that can be used include, but are not limited to, corn ( Zea mays ), rice ( Oryza sativa ), rye ( Secale cereale ), sorghum ( Sorghum bicolor, Sorghum vulgare ), millet (e.g., pearl millet ( Pennisetum glaucum ), proso millet ( Panicum miliaceum ), foxtail millet ( Setaria italica ), finger millet ( Eleusine coracana )), wheat ( Triticum aestivum ), sugarcane ( Saccharum spp.), oats ( Avena ), barley ( Hordeum ), switchgrass ( Panicum virgatum ), pineapple ( Ananas comosus ), banana ( Musa spp.), palm, ornamentals, turfgrasses, and other grasses.
  • corn Zea mays
  • rice Oryza sativa
  • dicot plants examples include, but are not limited to, soybean ( Glycine max ), canola ( Brassica napus and B. campestris ), alfalfa ( Medicago sativa ), tobacco ( Nicotiana tabacum ), Arabidopsis ( Arabidopsis thaliana ), sunflower ( Helianthus annuus ), cotton ( Gossypium arboreum ), and peanut ( Arachis hypogaea ), tomato ( Solanum lycopersicum ), potato ( Solanum tuberosum ) etc.
  • soybean Glycine max
  • canola Brassica napus and B. campestris
  • alfalfa Medicago sativa
  • tobacco Nicotiana tabacum
  • Arabidopsis Arabidopsis thaliana
  • sunflower Helianthus annuus
  • cotton Gossypium arboreum
  • peanut Arachis hypogaea
  • tomato Solanum lycopersicum
  • potato Sola
  • the transgenes, recombinant DNA molecules, DNA sequences of interest, and polynucleotides of interest can comprise one or more genes of interest.
  • genes of interest can encode, for example, a protein that provides agronomic advantage to the plant.
  • MAS marker assisted selection
  • QTL alleles quantitative trait loci
  • QTL alleles are used to identify plants that contain a desired genotype at one or more loci, and that are expected to transfer the desired genotype, along with a desired phenotype to their progeny.
  • Genetic marker alleles can be used to identify plants that contain a desired genotype at one locus, or at several unlinked or linked loci (e.g., a haplotype), and that would be expected to transfer the desired genotype, along with a desired phenotype to their progeny. It will be appreciated that for the purposes of MAS, the term marker can encompass both marker and QTL loci.
  • a desired phenotype and a polymorphic chromosomal locus e.g., a marker locus or QTL
  • a polymorphic chromosomal locus e.g., a marker locus or QTL
  • MAS marker-assisted selection
  • This detection can take the form of hybridization of a probe nucleic acid to a marker, e.g., using allele-specific hybridization, southern blot analysis, northern blot analysis, in situ hybridization, hybridization of primers followed by PCR amplification of a region of the marker or the like.
  • a marker e.g., using allele-specific hybridization, southern blot analysis, northern blot analysis, in situ hybridization, hybridization of primers followed by PCR amplification of a region of the marker or the like.
  • a variety of procedures for detecting markers are well known in the art. After the presence (or absence) of a particular marker in the biological sample is verified, the plant is selected, i.e., used to make progeny plants by selective breeding.
  • Plant breeders need to combine traits of interest with genes for high yield and other desirable traits to develop improved plant varieties. Screening for large numbers of samples can be expensive, time consuming, and unreliable.
  • Use of markers, and/or genetically-linked nucleic acids is an effective method for selecting plant having the desired traits in breeding programs. For example, one advantage of marker-assisted selection over field evaluations is that MAS can be done at any time of year regardless of the growing season. Moreover, environmental effects are irrelevant to marker-assisted selection.
  • DNA homologous recombination is a specialized way of DNA repair that the cells repair DNA damages using a homologous sequence.
  • DNA homologous recombination happens at frequencies too low to be routinely used in gene targeting or gene editing until it has been found that the process can be stimulated by DNA double-strand breaks (Bibikova et al., (2001) Mol. Cell. Biol. 21:289-297; Puchta and Baltimore, (2003) Science 300:763; Wright et al., (2005) Plant J. 44:693-705).
  • a similar guide polynucleotide can be designed wherein the guide polynucleotide does not solely comprise ribonucleic acids but wherein the guide polynucleotide comprises a combination of RNA-DNA molecules or solely comprises DNA molecules.
  • compositions and methods disclosed herein are as follows:
  • the type II CRISPR/Cas system minimally requires the Cas9 protein and a duplexed crRNA/tracrRNA molecule or a synthetically fused crRNA and tracrRNA (guide RNA) molecule for DNA target site recognition and cleavage (Gasiunas et al. (2012) Proc. Natl. Acad. Sci. USA 109:E2579-86, Jinek et al. (2012) Science 337:816-21, Mali et al. (2013) Science 339:823-26, and Gong et al. (2013) Science 339:819-23).
  • Described herein is a guideRNA/Cas endonuclease system that is based on the type II CRISPR/Cas system and consists of a Cas endonuclease and a guide RNA (or duplexed crRNA and tracrRNA) that together can form a complex that recognizes a genomic target site in a plant and introduces a double-strand-break into said target site.
  • a guide RNA or duplexed crRNA and tracrRNA
  • the Cas9 gene from Streptococcus pyogenes M1 GAS (SF370) (SEQ ID NO: 1) was maize codon optimized per standard techniques known in the art and the potato ST-LS1 intron (SEQ ID NO: 2) was introduced in order to eliminate its expression in E. coli and Agrobacterium ( FIG. 1A ).
  • Simian virus 40 SV40 monopartite amino terminal nuclear localization signal (MAPKKKRKV, SEQ ID NO: 3) and Agrobacterium tumefaciens bipartite VirD2 T-DNA border endonuclease carboxyl terminal nuclear localization signal (KRPRDRHDGELGGRKRAR, SEQ ID NO: 4) were incorporated at the amino and carboxyl-termini of the Cas9 open reading frame ( FIG. 1A ), respectively.
  • the maize optimized Cas9 gene was operably linked to a maize constitutive or regulated promoter by standard molecular biological techniques.
  • FIG. 1A shows a maize optimized Cas9 gene containing the ST-LS1 intron, SV40 amino terminal nuclear localization signal (NLS) and VirD2 carboxyl terminal NLS driven by a plant Ubiquitin promoter.
  • the second component necessary to form a functional guide RNA/Cas endonuclease system for genome engineering applications is a duplex of the crRNA and tracrRNA molecules or a synthetic fusing of the crRNA and tracrRNA molecules, a guide RNA.
  • a guide RNA a guide RNA.
  • the maize U6 polymerase III promoter (SEQ ID NO: 9) and maize U6 polymerase III terminator (first 8 bases of SEQ ID NO: 10) residing on chromosome 8 were isolated and operably fused to the termini of a guide RNA ( FIG. 1B ) using standard molecular biology techniques.
  • FIG. 1B illustrates a maize U6 polymerase III promoter driving expression of a long guide RNA terminated with a U6 polymerase III terminator.
  • the guide RNA or crRNA molecule contains a region complementary to one strand of the double strand DNA target (referred to as the variable targeting domain) that is approximately 12-30 nucleotides in length and upstream of a PAM sequence (5′NGG3′ on antisense strand of FIG. 2A-2B , corresponding to 5′CCN3′ on sense strand of FIG. 2A-2B ) for target site recognition and cleavage (Gasiunas et al. (2012) Proc. Natl. Acad. Sci. USA 109:E2579-86, Jinek et al. (2012) Science 337:816-21, Mali et al.
  • the variable targeting domain a region complementary to one strand of the double strand DNA target (referred to as the variable targeting domain) that is approximately 12-30 nucleotides in length and upstream of a PAM sequence (5′NGG3′ on antisense strand of FIG. 2A-2B , corresponding to 5′CCN3′ on sense strand of FIG.
  • Type IIS BbsI restriction endonuclease target sites were introduced in an inverted tandem orientation with cleavage orientated in an outward direction as described in Cong et al. (2013) Science 339:819-23.
  • the Type IIS restriction endonuclease excises its target sites from the crRNA or guide RNA expression plasmid, generating overhangs allowing for the in-frame directional cloning of duplexed oligos containing the desired maize genomic DNA target site into the variable targeting domain.
  • only target sequences starting with a G nucleotide were used to promote favorable polymerase III expression of the guide RNA or crRNA.
  • the Guide RNA/Cas Endonuclease System Cleaves Chromosomal DNA in Maize and Introduces Mutations by Imperfect Non-Homologous End-Joining
  • the maize optimized Cas9 endonuclease and long guide RNA expression cassettes containing the specific maize variable targeting domains were co-delivered to 60-90 Hi-II immature maize embryos by particle-mediated delivery (see Example 10) in the presence of BBM and WUS2 genes (see Example 11).
  • the region surrounding the intended target site was PCR amplified with Phusion® High Fidelity PCR Master Mix (New England Biolabs, M0531 L) adding on the sequences necessary for amplicon-specific barcodes and Illumnia sequencing using “tailed” primers through two rounds of PCR.
  • the primers used in the primary PCR reaction are shown in Table 2 and the primers used in the secondary PCR reaction were AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACG (forward, SEQ ID NO: 53) and CAAGCAGAAGACGGCATA (reverse, SEQ ID NO: 54).
  • the resulting PCR amplifications were purified with a Qiagen PCR purification spin column, concentration measured with a Hoechst dye-based fluorometric assay, combined in an equimolar ratio, and single read 100 nucleotide-length deep sequencing was performed on Illumina's MiSeq Personal Sequencer with a 30-40% (v/v) spike of PhiX control v3 (Illumina, FC-110-3001) to off-set sequence bias. Only those reads with a ⁇ 1 nucleotide indel arising within the 10 nucleotide window centered over the expected site of cleavage and not found in a similar level in the negative control were classified as NHEJ mutations.
  • NHEJ mutant reads with the same mutation were counted and collapsed into a single read and the top 10 most prevalent mutations were visually confirmed as arising within the expected site of cleavage. The total numbers of visually confirmed NHEJ mutations were then used to calculate the % mutant reads based on the total number of reads of an appropriate length containing a perfect match to the barcode and forward primer.
  • the frequency of NHEJ mutations recovered by deep sequencing for the guide RNA/Cas endonuclease system targeting the three LIGCas targets (SEQ ID NOS: 16, 17, 18) compared to the LIG3-4 homing endonuclease targeting the same locus is shown in Table 3.
  • the ten most prevalent types of NHEJ mutations recovered based on the guide RNA/Cas endonuclease system compared to the LIG3-4 homing endonuclease are shown in FIG. 3 A (corresponding to SEQ ID NOs: 55-75) and FIG. 3 B (corresponding to SEQ ID NOs: 76-96).
  • variable targeting domains of the guide RNA targeting the maize genomic target sites at the LIG locus were introduced into both the maize optimized long and short guide RNA expression cassettes as described in Example 1 and co-transformed along with the maize optimized Cas9 endonuclease expression cassette into immature maize embryos and deep sequenced for NHEJ mutations as described in Example 2. Embryos transformed with only the Cas9 endonuclease expression cassette served as a negative control.
  • the Guide RNA/Cas Endonuclease System May be Multiplexed to Simultaneously Target Multiple Chromosomal Loci in Maize for Mutagenesis by Imperfect Non-Homologous End-Joining
  • the long guide RNA expression cassettes targeting the MS26Cas-2 target site (SEQ ID NO: 14), the LIGCas-3 target site (SEQ ID NO: 18) and the MS45Cas-2 target site (SEQ ID NO: 20), were co-transformed into maize embryos either in duplex or in triplex along with the Cas9 endonuclease expression cassette and examined by deep sequencing for the presence of imprecise NHEJ mutations as described in Example 2.
  • RNA/Cas Endonuclease Mediated DNA Cleavage in Maize Chromosomal Loci can Stimulate Homologous Recombination Repair-Mediated Transgene Insertion
  • a HR repair DNA vector also referred to as a donor DNA
  • SEQ ID NO: 97 was constructed as illustrated in FIG. 4 using standard molecular biology techniques and co-transformed with a long guide RNA expression cassette, comprising a variable targeting domain corresponding to the LIGCas-3 genomic target site, and a Cas9 endonuclease expression cassette into immature maize embryos as described in Example 2.
  • the long guide RNA expression cassette for LIGCas-3 and the Cas9 expression cassette were consolidated onto a single vector DNA ( FIG. 1C , SEQ ID NO: 102) by standard molecular biology techniques and transformed into immature Hi-II maize embryos as described in Examples 10 and 11 by particle-mediated delivery.
  • Hi-II embryos co-transformed with the Cas9 and LIGCas-3 long guide RNA expression cassettes served as a positive control while embryos transformed with only the Cas9 expression cassette served as a negative control.
  • Deep sequencing for NHEJ mutations was performed as described in Example 2.
  • This example describes methods to deliver or maintain and express the Cas9 endonuclease and guide RNA (or individual crRNA and tracrRNAs) into, or within plants, respectively, to enable directed DNA modification or gene insertion via homologous recombination. More specifically this example describes a variety of methods which include, but are not limited to, delivery of the Cas9 endonuclease as a DNA, RNA (5′-capped and polyadenylated) or protein molecule.
  • the guide RNA may be delivered as a DNA or RNA molecule.
  • Example 2 a high mutation frequency was observed when Cas9 endonuclease and guide RNA were delivered as DNA vectors by biolistic transformation of immature corn embryos.
  • Other embodiments of this disclosure can be to deliver the Cas9 endonuclease as a DNA, RNA or protein and the guide RNA as a DNA or RNA molecule or as a duplex crRNA/tracrRNA molecule as RNA or DNA or a combination.
  • Various combinations of Cas9 endonuclease, guide RNA and crRNA/tracrRNA delivery methods can be, but are not limited to, the methods shown in Table 9.
  • Cas9 as DNA vector
  • guide RNA as DNA vector
  • example Table 9, combination1
  • Delivery of the Cas9 (as DNA vector) and guide RNA (as DNA vector) example can also be accomplished by co-delivering these DNA cassettes on a single or multiple Agrobacterium vectors and transforming plant tissues by Agrobacterium mediated transformation.
  • a vector containing a constitutive, tissue-specific or conditionally regulated Cas9 gene can be first delivered to plant cells to allow for stable integration into the plant genome to establish a plant line that contains only the Cas9 gene in the plant genome.
  • single or multiple guide RNAs, or single or multiple crRNA and a tracrRNA can be delivered as either DNA or RNA, or combination, to the plant line containing the genome-integrated version of the Cas9 gene for the purpose of generating mutations or promoting homologous recombination when HR repair DNA vectors for targeted integration are co-delivered with the guide RNAs.
  • plant line containing the genome-integrated version of the Cas9 gene and a tracrRNA as a DNA molecule can also be established.
  • single or multiple crRNA molecules can be delivered as RNA or DNA to promote the generation of mutations or to promote homologous recombination when HR repair DNA vectors for targeted integration are co-delivered with crRNA molecule(s) enabling the targeted mutagenesis or homologous recombination at single or multiple sites in the plant genome.
  • Example 7 [Cas9 (DNA vector), guide RNA (RNA)] for modification or mutagenesis of chromosomal loci in plants.
  • the maize optimized Cas9 endonuclease expression cassette described in Example 1 was co-delivered by particle gun as described in Example 2 along with single stranded RNA molecules (synthesized by Integrated DNA Technologies, Inc.) constituting a short guide RNA targeting the maize locus and sequence shown in Table 10.
  • Embryos transformed with only the Cas9 expression cassette or short guide RNA molecules served as negative controls. Seven days post-bombardment, the immature embryos were harvested and analyzed by deep sequencing for NHEJ mutations as described in Example 2.
  • LIG3-4 intended recognition sequence SEQ ID NO: 111
  • SEQ ID NO: 112 a rare-cutting double-strand break inducing agent
  • TS-MS26 An endogenous maize genomic target site designated “TS-MS26” (SEQ ID NO: 113) was selected for design of a custom double-strand break inducing agent MS26++ as described in U.S. patent application Ser. No. 13/526,912 filed Jun. 19, 2012).
  • the TS-MS26 target site is a 22 bp polynucleotide positioned 62 bps from the 5′ end of the fifth exon of the maize MS26 gene and having the following sequence: gatggtgac gtac ⁇ gtgccctac (SEQ ID NO: 113).
  • the double strand break site and overhang region is underlined, the enzyme cuts after C13, as indicated by the ⁇ .
  • Plant optimized nucleotide sequences for an engineered endonuclease (SEQ ID NO: 114) encoding an engineered MS26++ endonuclease were designed to bind and make double-strand breaks at the selected TS-MS26 target site.
  • Transformation can be accomplished by various methods known to be effective in plants, including particle-mediated delivery, Agrobacterium -mediated transformation, PEG-mediated delivery, and electroporation.
  • Transformation of maize immature embryos using particle delivery is performed as follows. Media recipes follow below.
  • the ears are husked and surface sterilized in 30% Clorox bleach plus 0.5% Micro detergent for 20 minutes, and rinsed two times with sterile water.
  • the immature embryos are isolated and placed embryo axis side down (scutellum side up), 25 embryos per plate, on 560Y medium for 4 hours and then aligned within the 2.5-cm target zone in preparation for bombardment.
  • isolated embryos are placed on 560L (Initiation medium) and placed in the dark at temperatures ranging from 26° C. to 37° C. for 8 to 24 hours prior to placing on 560Y for 4 hours at 26° C. prior to bombardment as described above.
  • Plasmids containing the double strand brake inducing agent and donor DNA are constructed using standard molecular biology techniques and co-bombarded with plasmids containing the developmental genes ODP2 (AP2 domain transcription factor ODP2 (Ovule development protein 2); US20090328252 A1) and Wushel (US2011/0167516).
  • ODP2 AP2 domain transcription factor ODP2 (Ovule development protein 2); US20090328252 A1) and Wushel (US2011/0167516).
  • the plasmids and DNA of interest are precipitated onto 0.6 ⁇ m (average diameter) gold pellets using a water-soluble cationic lipid transfection reagent as follows.
  • DNA solution is prepared on ice using 1 ⁇ g of plasmid DNA and optionally other constructs for co-bombardment such as 50 ng (0.5 ⁇ l) of each plasmid containing the developmental genes ODP2 (AP2 domain transcription factor ODP2 (Ovule development protein 2); US20090328252 A1) and Wushel.
  • ODP2 AP2 domain transcription factor ODP2 (Ovule development protein 2); US20090328252 A1
  • Wushel To the pre-mixed DNA, 20 ⁇ l of prepared gold particles (15 mg/ml) and 5 ⁇ l of a water-soluble cationic lipid transfection reagent is added in water and mixed carefully.
  • Gold particles are pelleted in a microfuge at 10,000 rpm for 1 min and supernatant is removed. The resulting pellet is carefully rinsed with 100 ml of 100% EtOH without resuspending the pellet and the EtOH rinse is carefully removed. 105 ⁇ l of 100% EtOH is added and the particles are resuspended by brief sonication. Then, 10 ⁇ l is spotted onto the center of each macrocarrier and allowed to dry about 2 minutes before bombardment.
  • the plasmids and DNA of interest are precipitated onto 1.1 ⁇ m (average diameter) tungsten pellets using a calcium chloride (CaCl 2 ) precipitation procedure by mixing 100 ⁇ l prepared tungsten particles in water, 10 ⁇ l (1 ⁇ g) DNA in Tris EDTA buffer (1 ⁇ g total DNA), 100 ⁇ l 2.5 M CaCl 2 , and 10 ⁇ l 0.1 M spermidine. Each reagent is added sequentially to the tungsten particle suspension, with mixing. The final mixture is sonicated briefly and allowed to incubate under constant vortexing for 10 minutes.
  • CaCl 2 calcium chloride
  • the tubes are centrifuged briefly, liquid is removed, and the particles are washed with 500 ml 100% ethanol, followed by a 30 second centrifugation. Again, the liquid is removed, and 105 ⁇ l of 100% ethanol is added to the final tungsten particle pellet.
  • the tungsten/DNA particles are briefly sonicated. 10 ⁇ l of the tungsten/DNA particles is spotted onto the center of each macrocarrier, after which the spotted particles are allowed to dry about 2 minutes before bombardment.
  • sample plates are bombarded at level #4 with a Biorad Helium Gun. All samples receive a single shot at 450 PSI, with a total of ten aliquots taken from each tube of prepared particles/DNA.
  • the embryos are incubated on 560P (maintenance medium) for 12 to 48 hours at temperatures ranging from 26C to 37C, and then placed at 26C. After 5 to 7 days the embryos are transferred to 560R selection medium containing 3 mg/liter Bialaphos, and subcultured every 2 weeks at 26C. After approximately 10 weeks of selection, selection-resistant callus clones are transferred to 288J medium to initiate plant regeneration. Following somatic embryo maturation (2-4 weeks), well-developed somatic embryos are transferred to medium for germination and transferred to a lighted culture room. Approximately 7-10 days later, developing plantlets are transferred to 272V hormone-free medium in tubes for 7-10 days until plantlets are well established.
  • 560P maintenance medium
  • Plants are then transferred to inserts in flats (equivalent to a 2.5′′ pot) containing potting soil and grown for 1 week in a growth chamber, subsequently grown an additional 1-2 weeks in the greenhouse, then transferred to Classic 600 pots (1.6 gallon) and grown to maturity. Plants are monitored and scored for transformation efficiency, and/or modification of regenerative capabilities.
  • Initiation medium comprises 4.0 g/l N6 basal salts (SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix (1000 ⁇ SIGMA-1511), 0.5 mg/l thiamine HCl, 20.0 g/l sucrose, 1.0 mg/l 2,4-D, and 2.88 g/l L-proline (brought to volume with D-I H2O following adjustment to pH 5.8 with KOH); 2.0 g/l Gelrite (added after bringing to volume with D-I H2O); and 8.5 mg/l silver nitrate (added after sterilizing the medium and cooling to room temperature).
  • Maintenance medium comprises 4.0 g/l N6 basal salts (SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix (1000 ⁇ SIGMA-1511), 0.5 mg/l thiamine HCl, 30.0 g/l sucrose, 2.0 mg/l 2,4-D, and 0.69 g/l L-proline (brought to volume with D-I H2O following adjustment to pH 5.8 with KOH); 3.0 g/l Gelrite (added after bringing to volume with D-I H2O); and 0.85 mg/l silver nitrate (added after sterilizing the medium and cooling to room temperature).
  • Bombardment medium comprises 4.0 g/l N6 basal salts (SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix (1000 ⁇ SIGMA-1511), 0.5 mg/l thiamine HCl, 120.0 g/l sucrose, 1.0 mg/l 2,4-D, and 2.88 g/l L-proline (brought to volume with D-I H2O following adjustment to pH 5.8 with KOH); 2.0 g/l Gelrite (added after bringing to volume with D-I H2O); and 8.5 mg/l silver nitrate (added after sterilizing the medium and cooling to room temperature).
  • Selection medium comprises 4.0 g/l N6 basal salts (SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix (1000 ⁇ SIGMA-1511), 0.5 mg/l thiamine HCl, 30.0 g/l sucrose, and 2.0 mg/l 2,4-D (brought to volume with D-I H2O following adjustment to pH 5.8 with KOH); 3.0 g/l Gelrite (added after bringing to volume with D-I H2O); and 0.85 mg/l silver nitrate and 3.0 mg/l bialaphos (both added after sterilizing the medium and cooling to room temperature).
  • Plant regeneration medium (288J) comprises 4.3 g/l MS salts (GIBCO 11117-074), 5.0 ml/l MS vitamins stock solution (0.100 g nicotinic acid, 0.02 g/l thiamine HCL, 0.10 g/l pyridoxine HCL, and 0.40 g/l glycine brought to volume with polished D-I H2O) (Murashige and Skoog (1962) Physiol. Plant.
  • Hormone-free medium comprises 4.3 g/l MS salts (GIBCO 11117-074), 5.0 ml/l MS vitamins stock solution (0.100 g/l nicotinic acid, 0.02 g/l thiamine HCL, 0.10 g/l pyridoxine HCL, and 0.40 g/l glycine brought to volume with polished D-I H2O), 0.1 g/1 myo-inositol, and 40.0 g/l sucrose (brought to volume with polished D-I H2O after adjusting pH to 5.6); and 6 g/l bacto-agar (added after bringing to volume with polished D-I H2O), sterilized and cooled to 60° C.
  • Agrobacterium -mediated transformation was performed essentially as described in Djukanovic et al. (2006) Plant Biotech J 4:345-57. Briefly, 10-12 day old immature embryos (0.8-2.5 mm in size) were dissected from sterilized kernels and placed into liquid medium (4.0 g/L N6 Basal Salts (Sigma C-1416), 1.0 ml/L Eriksson's Vitamin Mix (Sigma E-1511), 1.0 mg/L thiamine HCl, 1.5 mg/L 2, 4-D, 0.690 g/L L-proline, 68.5 g/L sucrose, 36.0 g/L glucose, pH 5.2).
  • liquid medium 4.0 g/L N6 Basal Salts (Sigma C-1416), 1.0 ml/L Eriksson's Vitamin Mix (Sigma E-1511), 1.0 mg/L thiamine HCl, 1.5 mg/L 2, 4-D, 0.690 g/L L-proline, 68.5 g/L sucrose, 36.0 g
  • Embryos were incubated axis down, in the dark for 3 days at 20° C., then incubated 4 days in the dark at 28° C., then transferred onto new media plates containing 4.0 g/L N6 Basal Salts (Sigma C-1416), 1.0 ml/L Eriksson's Vitamin Mix (Sigma E-1511), 1.0 mg/L thiamine HCl, 1.5 mg/L 2, 4-D, 0.69 g/L L-proline, 30.0 g/L sucrose, 0.5 g/L MES buffer, 0.85 mg/L silver nitrate, 3.0 mg/L Bialaphos, 100 mg/L carbenicillin, and 6.0 g/L agar, pH 5.8.
  • Embryos were subcultured every three weeks until transgenic events were identified. Somatic embryogenesis was induced by transferring a small amount of tissue onto regeneration medium (4.3 g/L MS salts (Gibco 11117), 5.0 ml/L MS Vitamins Stock Solution, 100 mg/L myo-inositol, 0.1 ⁇ M ABA, 1 mg/L IAA, 0.5 mg/L zeatin, 60.0 g/L sucrose, 1.5 mg/L Bialaphos, 100 mg/L carbenicillin, 3.0 g/L Gelrite, pH 5.6) and incubation in the dark for two weeks at 28° C.
  • regeneration medium 4.3 g/L MS salts (Gibco 11117), 5.0 ml/L MS Vitamins Stock Solution, 100 mg/L myo-inositol, 0.1 ⁇ M ABA, 1 mg/L IAA, 0.5 mg/L zeatin, 60.0 g/L sucrose, 1.5 mg/L Bialaphos, 100 mg
  • Parameters of the transformation protocol can be modified to ensure that the BBM activity is transient.
  • One such method involves precipitating the BBM-containing plasmid in a manner that allows for transcription and expression, but precludes subsequent release of the DNA, for example, by using the chemical PEI.
  • the BBM plasmid is precipitated onto gold particles with PEI, while the transgenic expression cassette (UBI::moPAT ⁇ GFPm::PinII; moPAT is the maize optimized PAT gene) to be integrated is precipitated onto gold particles using the standard calcium chloride method.
  • gold particles were coated with PEI as follows. First, the gold particles were washed. Thirty-five mg of gold particles, 1.0 in average diameter (A.S.I. #162-0010), were weighed out in a microcentrifuge tube, and 1.2 ml absolute EtOH was added and vortexed for one minute. The tube was incubated for 15 minutes at room temperature and then centrifuged at high speed using a microfuge for 15 minutes at 4° C. The supernatant was discarded and a fresh 1.2 ml aliquot of ethanol (EtOH) was added, vortexed for one minute, centrifuged for one minute, and the supernatant again discarded (this is repeated twice).
  • EtOH 1.2 ml aliquot of ethanol
  • the particles were rinsed 3 times with 250 ⁇ l aliquots of 2.5 mM HEPES buffer, pH 7.1, with 1 ⁇ pulse-sonication, and then a quick vortex before each centrifugation. The particles were then suspended in a final volume of 250 ⁇ l HEPES buffer. A 25 ⁇ l aliquot of the particles was added to fresh tubes before attaching DNA. To attach uncoated DNA, the particles were pulse-sonicated, then 1 ⁇ g of DNA (in 5 ⁇ l water) was added, followed by mixing by pipetting up and down a few times with a Pipetteman and incubated for 10 minutes. The particles were spun briefly (i.e.
  • DNA-1 plasmid contained a UBI::RFP::pinII expression cassette
  • DNA-2 contained a UBI::CFP::pinII expression cassette.
  • PEI-precipitation could be used to effectively introduce DNA for transient expression while dramatically reducing integration of the PEI-introduced DNA and thus reducing the recovery of RFP-expressing transgenic events. In this manner, PEI-precipitation can be used to deliver transient expression of BBM and/or WUS2.
  • the particles are first coated with UBI::BBM::pinII using PEI, then coated with UBI::moPAT ⁇ YFP using a water-soluble cationic lipid transfection reagent, and then bombarded into scutellar cells on the surface of immature embryos.
  • PEI-mediated precipitation results in a high frequency of transiently expressing cells on the surface of the immature embryo and extremely low frequencies of recovery of stable transformants
  • the PEI-precipitated BBM cassette expresses transiently and stimulates a burst of embryogenic growth on the bombarded surface of the tissue (i.e. the scutellar surface), but this plasmid will not integrate.
  • the PAT ⁇ GFP plasmid released from the Ca++/gold particles is expected to integrate and express the selectable marker at a frequency that results in substantially improved recovery of transgenic events.
  • PEI-precipitated particles containing a UBI::GUS::pinII instead of BBM
  • the PAT ⁇ GFP/Ca++ particles are mixed with the PAT ⁇ GFP/Ca++ particles. Immature embryos from both treatments are moved onto culture medium containing 3 mg/l bialaphos. After 6-8 weeks, it is expected that GFP+, bialaphos-resistant calli will be observed in the PEI/BBM treatment at a much higher frequency relative to the control treatment (PEI/GUS).
  • the BBM plasmid is precipitated onto gold particles with PEI, and then introduced into scutellar cells on the surface of immature embryos, and subsequent transient expression of the BBM gene elicits a rapid proliferation of embryogenic growth.
  • the explants are treated with Agrobacterium using standard methods for maize (see Example 1), with T-DNA delivery into the cell introducing a transgenic expression cassette such as UBI::moPAT ⁇ GFPm::pinII. After co-cultivation, explants are allowed to recover on normal culture medium, and then are moved onto culture medium containing 3 mg/l bialaphos. After 6-8 weeks, it is expected that GFP+, bialaphos-resistant calli will be observed in the PEI/BBM treatment at a much higher frequency relative to the control treatment (PEI/GUS).
  • BBM and/or WUS2 polynucleotide products It may be desirable to “kick start” callus growth by transiently expressing the BBM and/or WUS2 polynucleotide products.
  • This can be done by delivering BBM and WUS2 5′-capped polyadenylated RNA, expression cassettes containing BBM and WUS2 DNA, or BBM and/or WUS2 proteins. All of these molecules can be delivered using a biolistics particle gun.
  • 5′-capped polyadenylated BBM and/or WUS2 RNA can easily be made in vitro using Ambion's mMessage mMachine kit.
  • RNA is co-delivered along with DNA containing a polynucleotide of interest and a marker used for selection/screening such as Ubi::moPAT ⁇ GFPm::PinII. It is expected that the cells receiving the RNA will immediately begin dividing more rapidly and a large portion of these will have integrated the agronomic gene. These events can further be validated as being transgenic clonal colonies because they will also express the PAT ⁇ GFP fusion protein (and thus will display green fluorescence under appropriate illumination). Plants regenerated from these embryos can then be screened for the presence of the polynucleotide of interest.
  • a marker used for selection/screening such as Ubi::moPAT ⁇ GFPm::PinII.
  • a Cas9 (SO) gene SEQ ID NO:115 soybean codon optimized from Streptococcus pyogenes M1 GAS (SF370) was expressed with a strong soybean constitutive promoter GM-EF1A2 (US patent application 20090133159 (SEQ ID NO: 116).
  • the codon optimized Cas9 gene was synthesized as two pieces by GenScript USA Inc. (Piscataway, N.J.) and cloned in frame downstream of the GM-EF1A2 promoter to make DNA construct QC782 shown in FIG. 7 (SEQ ID NO:119).
  • Plant U6 RNA polymerase III promoters have been cloned and characterized from such as Arabidopsis and Medicago truncatula (Waibel and Filipowicz, NAR 18:3451-3458 (1990); Li et al., J. Integrat. Plant Biol. 49:222-229 (2007); Kim and Nam, Plant Mol. Biol. Rep. 31:581-593 (2013); Wang et al., RNA 14:903-913 (2008)). Soybean U6 small nuclear RNA (snRNA) genes were identified herein by searching public soybean variety Williams82 genomic sequence using Arabidopsis U6 gene coding sequence.
  • snRNA Soybean U6 small nuclear RNA
  • RNA polymerase III promoter for example, GM-U6-13.1 promoter (SEQ ID NO:120), to express guide RNA to direct Cas9 nuclease to designated genomic site.
  • the guide RNA coding sequence was 76 bp long ( FIG. 8B ) and comprised a 20 bp variable targeting domain from a chosen soybean genomic target site on the 5′ end and a tract of 4 or more T residues as a transcription terminator on the 3′ end. (SEQ ID NO:121, FIG. 8 B).
  • the first nucleotide of the 20 bp variable targeting domain was a G residue to be used by RNA polymerase III for transcription.
  • the U6 gene promoter and the complete guide RNA was synthesized and then cloned into an appropriate vector to make, for example, DNA construct QC783 shown in FIG. 8 A (SEQ ID NO:122).
  • Other soybean U6 homologous genes promoters were similarly cloned and used for small RNA expression.
  • the Cas9 endonuclease and the guide RNA need to form a protein/RNA complex to mediate site-specific DNA double strand cleavage, the Cas9 endonuclease and guide RNA must be expressed in same cells.
  • the Cas9 endonuclease and guide RNA expression cassettes were linked into a single DNA construct, for example, QC815 in FIG. 9 A (SEQ ID NO:123), which was then used to transform soybean cells to test the soybean optimized guide RNA/Cas system for genome modification. Similar DNA constructs were made to target different genomic sites using guide RNAs containing different target sequences.
  • a region of the soybean chromosome 4 (Gm04) was selected to test if the soybean optimized guide RNA/Cas endonuclease system could recognize, cleave, and mutate soybean chromosomal DNA through imprecise non-homologous end-joining (NHEJ) repair.
  • Two genomic target sites were selected one close to a predicted gene Glyma04g39780.1 at 114.13 cM herein named DD20 locus ( FIG. 10A ) and another close to Glyma04g39550.1 at 111.95 cM herein named DD43 locus ( FIG. 10B ).
  • Each of the 20 bp variable targeting domain of the guide RNA started with a G residue required by RNA polymerase III and was followed in the soybean genome by a 3 bp PAM motif (Table 11).
  • the chromosome positions of the soybean genomic targets sites in close proximity to the PAM sequences were determined by blast searching the public soybean variety Williams82 genomic sequence.
  • soybean genomic target sites DD20CR1 SEQ ID NO: 125
  • DD20CR2 SEQ ID NO: 126
  • DD43CR1 SEQ ID NO: 127
  • DD43CR2 SEQ ID NO: 128
  • Gm06:12072339-12072361 a second identical 23 bp genomic target site targeted by DD43CR2 guide RNA.
  • Both DD43CR1 and DD43CR2 are complementary strand sequences indicated by “c” after the positions.
  • Genomic Chromo- Desig- Target some Positions nation Sites PAM Gm04, 45936311- DD20CR1 GGAACTGACA TGG 114.13 45936333 CACGACATGA cM 45936324- DD20CR2 GACATGATGG AGG 45936346 AACGTGACTA Gm04, 45731921- DD43CR1 GTCCCTTGTA CGG 111.95 45731943c CTTGTACGTA cM 45731895- DD43CR2 GTATTCTAGA TGG 45731917c AAAGAGGAAT
  • Guide RNA expression cassette comprising a variable targeting domain targeting one of DD20CR1, DD20CR2, DD43CR2 genomic target sites were similarly constructed and linked to the soybean Cas9 expression cassette to make DNA constructs QC817, QC818, and QC816 that are similar to QC815 in FIG. 9 A (SEQ ID NO:123) except for the 20 bp variable targeting domain of the guide RNA
  • any 23 bp genomic DNA sequence following the pattern N(20)NGG can be selected as a target site for the guide RNA/Cas endonuclease system.
  • the last NGG is the PAM sequence that should not be included in the 20 bp variable targeting domain of the guide RNA. If the first N is not endogenously a G residue it must be replaced with a G residue in guide RNA target sequence to accommodate RNA polymerase III, which should not sacrifice recognition specificity of the target site by the guide RNA.
  • soybean optimized Cas9 endonuclease and guide RNA expression cassettes were delivered to young soybean somatic embryos in the form of embryogenic suspension cultures by particle gun bombardment. Soybean embryogenic suspension cultures were induced as follows. Cotyledons ( ⁇ 3 mm in length) were dissected from surface sterilized, immature seeds and were cultured for 6-10 weeks in the light at 26° C. on a Murashige and Skoog (MS) media containing 0.7% agar and supplemented with 10 mg/ml 2,4-D (2,4-Dichlorophenoxyacetic acid).
  • MS Murashige and Skoog
  • Globular stage somatic embryos which produced secondary embryos, were then excised and placed into flasks containing liquid MS medium supplemented with 2,4-D (10 mg/ml) and cultured in the light on a rotary shaker. After repeated selection for clusters of somatic embryos that multiplied as early, globular staged embryos, the soybean embryogenic suspension cultures were maintained in 35 ml liquid media on a rotary shaker, 150 rpm, at 26° C. with fluorescent lights on a 16:8 hour day/night schedule. Cultures were subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 ml of the same fresh liquid MS medium.
  • Soybean embryogenic suspension cultures were then transformed by the method of particle gun bombardment using a DuPont BiolisticTM PDS1000/HE instrument (Bio-Rad Laboratories, Hercules, Calif.).
  • a DuPont BiolisticTM PDS1000/HE instrument Bio-Rad Laboratories, Hercules, Calif.
  • To 50 ⁇ l of a 60 mg/ml 1.0 mm gold particle suspension were added (in order): 30 ⁇ l of 30 ng/ ⁇ l QC815 DNA fragment U6-13.1:DD43CR1+EF1A2:CAS9 as an example, 20 ⁇ l of 0.1 M spermidine, and 25 ⁇ l of 5 M CaCl 2 .
  • the particle preparation was then agitated for 3 minutes, spun in a centrifuge for 10 seconds and the supernatant removed.
  • the DNA-coated particles were then washed once in 400 ⁇ l 100% ethanol and resuspended in 45 ⁇ l of 100% ethanol.
  • the DNA/particle suspension was sonicated three times for one second each. Then 5 ⁇ l of the DNA-coated gold particles was loaded on each macro carrier disk.
  • Approximately 100 mg of a two-week-old suspension cultures were placed in an empty 60 ⁇ 15 mm Petri dish and the residual liquid removed from the tissue with a pipette.
  • Membrane rupture pressure was set at 1100 psi and the chamber was evacuated to a vacuum of 28 inches mercury.
  • the tissue was placed approximately 3.5 inches away from the retaining screen and bombarded once. The tissue clumps were rearranged and bombarded another time.
  • Minimum amount of liquid MS media without 2,4-D supplement was added to the tissue to prevent the cultures from drying or overgrowing.
  • the 60 ⁇ 15 mm Petri dish was sealed in a 100 ⁇ 25 mm Petri dish containing agar solid MS media to as another measure to keep the tissues from drying up.
  • the tissues were harvested seven days after and genomic DNA was extracted for PCR analysis.
  • a region of approximately 100 bp genomic DNA surrounding the target site was amplified by PCR and the PCR product was then sequenced to check mutations at the target site as results of NHEJs.
  • the region was first amplified by 20 cycles of PCR with Phusion High Fidelity mastermix (New England Biolabs) from 100 ng genomic DNA using gene-specific primers that also contain adaptors and amplicon-specific barcode sequences needed for a second round PCR and subsequence sequence analysis.
  • the first PCR for the four experiments listed in Table 2 were done using primers DD20-S3 (SEQ ID NO:133)/DD20-A (SEQ ID NO:134), DD20-S4 (SEQ ID NO:135)/DD20-A, DD43-S3 (SEQ ID NO:136)/DD43-A (SEQ ID NO:137) and DD43-S4 (SEQ ID NO:138)/DD43-A.
  • One micro liter of the first round PCR products was further amplified by another 20 cycles of PCR using universal primers (SEQ ID NOs:140, 141) with Phusion High Fidelity mastermix.
  • PCR products were separated on 1.5% agarose gel and the specific DNA bands were purified with Qiagen gel purification spin columns.
  • DNA concentrations were measured with a DNA Bioanalyzer (Agilent) and equal molar amounts of DNA for up to 12 different samples each with specific barcode were mixed as one sample for Illumina deep sequencing analysis.
  • Single read 100 nucleotide-length deep sequencing was performed at a DuPont core facility on a Illumnia's MiSeq Personal Sequencer with a 40% (v/v) spike of PhiX control v3 (Illumina, FC-110-3001) to off-set sequence bias.
  • the 100 nucleotide-length deep sequencing is sufficient to cover the targets site region.
  • NHEJ mutant reads of different lengths but with the same mutation were counted into a single read and up to 10 most prevalent mutations were visually confirmed to be specific mutations before they were then used to calculate the % mutant reads based on the total analyzed reads containing specific barcode and forward primer.
  • the frequencies of NHEJ mutations revealed by deep sequencing for four target sites DD20CR1, DD20CR2, DD43CR1, DD43CR2 with one RNA polymerase III promoter GM-U6-13.1 are shown in Table 2.
  • the visually confirmed most prevalent NHEJ mutations are shown in FIG. 11A-11D .
  • the mutant sequences in FIG. 11A-11E are listed as SEQ ID NOs:147-201.
  • the top row is the original reference sequence with the target site sequence underlined. Deletions in the mutated sequences are indicated by “ - - - ” while additions and replacements are indicated by bold letters. Total count of each mutation of different reads is given in the last column.
  • Cas9 nuclease construct only, guide RNA construct only, and no DNA bombardment negative controls were similarly performed and analyzed but data not shown since no-specific mutations were detected. Other targets sites and guide RNAs were also tested with similar positive results and data not shown.
  • the Guide RNA/Cas Endonuclease System Delivers Double-Strand Breaks (DBSs) to the Maize Epsps Locus Resulting in Desired Point Mutations
  • Two maize optimized Cas9 endonucleases were developed and evaluated for their ability to introduce a double-strand break at a genomic target sequence.
  • a first Cas9 endonuclease was as described in FIG. 1A (Example 2 and expression cassette SEQ ID NO:5).
  • a second maize optimized Cas9 endonuclease (moCas9 endonuclease; SEQ ID NO:192) was supplemented with the SV40 nuclear localization signal by adding the signal coding sequence to the 5′ end of the moCas9 coding sequence ( FIG. 13 ).
  • the plant moCas9 expression cassette was subsequently modified by the insertion of the ST-LS1 intron into the moCas9 coding sequence in order to enhance its expression in maize cells and to eliminate its expression in E. coli and Agrobacterium .
  • the maize ubiquitin promoter and the potato proteinase inhibitor II gene terminator sequences complemented the moCas9 endonuclease gene designs.
  • the structural elements of the moCas9 expression cassette are shown in FIG. 13 and its amino acid and nucleotide sequences are listed as SEQ ID Nos: 192 and 193.
  • a single guide RNA (sgRNA) expression cassette was essentially as described in Example 1 and shown in FIG. 1B . It consists of the U6 polymerase III maize promoter (SEQ ID NO: 9) and its cognate U6 polymerase III termination sequences (TTTTTTTT).
  • the guide RNA (SEQ ID NO: 194) comprised a 20 nucleotide variable targeting domain (nucleotide1-20 of SEQ ID NO: 194) followed by a RNA sequence capable of interacting with the double strand break inducing endonuclease.
  • a maize optimized Cas9 endonuclease target sequence (moCas9 target sequence) within the EPSPS codon sequence was complementary to the 20 nucleotide variable sequence of the guide sgRNA determined the site of the Cas9 endonuclease cleavage within the EPSPS coding sequence.
  • the moCAS9 target sequence (nucleotides 25-44 of SEQ ID NO:209) was synthesized and cloned into the guide RNA-Cas9 expression vector designed for delivery of the components of the guide RNA-Cas9 system to the BMS (Black Mexican Sweet) cells through Agrobacterium -mediated transformation.
  • Agrobacterium T-DNA delivered also the yeast FLP site-specific recombinase and the WDV (wheat dwarf virus) replication-associated protein (replicase). Since the moCas9 target sequences were flanked by the FLP recombination targets (FRT), they were excised by FLP in maize cells forming episomal (chromosome-like) structures.
  • Table 13 shows the percent of the moCas9 target sequences mutagenized in the maize BMS cells using the moCas9 endonuclease of SEQ ID NO: 192 or the maize optimized cas9 endonuclease described in FIG. 1A and expressed by the expression cassette of SEQ ID NO:5.
  • Both guideRNA/Cas endonuclease systems generated double-strand breaks (as judged by the number of targeted mutagenesis events) ranging from 67 to 84% of the moCas9 target sequences available on episomal DNA molecules in maize BMS cells.
  • a sample of mutagenized EPSPS target sequences is shown in FIG. 14 . This observation indicates that the maize optimized Cas9 endonuclease described herein is functional in maize cells and efficiently generates double-strand breaks at the moCas9 target sequence.
  • a polynucleotide modification template which provided genetic information for editing the EPSPS coding sequence was created (SEQ ID NO:195) and co-delivered with the guide RNA/Cas9 system components.
  • the polynucleotide modification template comprised three nucleotide modifications (indicated by arrows) when compared to the EPSPS genomic sequence to be edited. These three nucleotide modifications are referred to as TIPS mutations as these nucleotide modifications result in the amino acid changes T-102 to I-102 and P-106 to S-106.
  • the first point mutation results from the substitution of the C nucleotide in the codon sequence ACT with a T nucleotide
  • a second mutation results from the substitution of the T nucleotide on the same codon sequence ACT with a C nucleotide to form the isoleucine codon (ATC)
  • the third point mutation results from the substitution of the first C nucleotide in the codon sequence CCA with a T nucleotide in order to form a serine codon, TCA.
  • Both codon sequences were located within 9 nucleotides of each other as shown in SEQ ID NO: 196: atcgcaatgcggtca. The three nucleotide modifications are shown in bold.
  • the nucleotides between the two codon sequences were homologous to the non-edited EPSPS gene on the epsps locus.
  • the polynucleotide modification template further comprised DNA fragments of maize EPSPS genomic sequence that were used as homologous sequence for the EPSPS gene editing.
  • the short arm of homologous sequence (HR1— FIG. 12 ) was 810 base pairs long and the long arm of homologous sequence (HR2— FIG. 12 ) was 2,883 base pairs long (SEQ ID NO: 195).
  • the EPSPS polynucleotide modification template was co-delivered using particle gun bombardment as a plasmid (see template vector 1, FIG. 15 ) together with the guide sgRNA expression cassette and a maize optimizedCas9 endonuclease expression vector which contained the maize optimized Cas9 endonuclease expression cassette described in FIG. 1A (Example 1, SEQ ID NO:5) and also contained a moPAT selectable marker gene.
  • Ten to eleven day-old immature embryos were placed, embryo-axis down, onto plates containing the N6 medium (Table 14) and incubated at 28° C. for 4-6 hours before bombardment.
  • the plates were placed on the third shelf from the bottom in the PDS-1000 apparatus and bombarded at 200 psi. Post-bombardment, embryos were incubated in the dark overnight at 28° C. and then transferred to plates containing the N6-2 media for 6-8 days at 28° C. The embryos were then transferred to plates containing the N6-3 media for three weeks, followed by transferring the responding callus to plates containing the N6-4 media for an additional three-week selection. After six total weeks of selection at 28° C., a small amount of selected tissue was transferred onto the MS regeneration medium and incubated for three weeks in the dark at 28° C.
  • Culture medium Composition N6 4.0 g/L N 6 Basal Salts (Sigma C-1416; Sigma-Aldrich Co., St. Louis, MO, USA), 1.0 ml/L Ericksson's Vitamin Mix (Sigma E-1511), 0.5 mg/L thiamine HCl, 190 g/L sucrose, 1.0 mg/L 2,4- dichlorophenoxyacetic acid (2,4-D), 2.88 g/L L-proline, 8.5 mg/L silver nitrate, 25 mg/L cefotaxime, and 6.36 g/L Sigma agar at pH 5.8 N6-2 4.0 g/L N 6 Basal Salts (Sigma C-1416), 1.0 ml/L Ericksson's Vitamin Mix (Sigma E-1511), 0.5 mg/L thiamine HCl, 20 g/L sucrose, 1.0 mg/L 2,4-D, 2.88 g/L L-proline, 8.5 mg/L silver n
  • DNA was extracted by placing callus cell samples, two stainless-steel beads, and 450 ul of extraction buffer (250 mM NaCl, 200 mM Tris-HCl pH 7.4, 25 mM EDTA, 4.2 M Guanidine HCl) into each tube of a Mega titer rack.
  • the rack was shaken in the Genogrinder at 1650 r.p.m. for 60 seconds and centrifuged at 3000 ⁇ g for 20 min at 4° C. Three hundred ⁇ l of supernatant was transferred to the wells of the Unifilter 96-well DNA Binding GF/F Microplate (770-2810, Whatman, GE Healthcare).
  • the plate was placed on the top of a Multi-well plate vacuum manifold (5017, Pall Life Sciences). A vacuum pressure was applied until the wells were completely dried. The vacuum filtration procedure was repeated one time with 100 ul extraction buffer and two times with 250 ul washing buffer (50 mM Tris-HCl pH 7.4, 200 mM NaCl, 70% ethanol). The residual ethanol was removed by placing the GF/F filter plate on an empty waste collection plate and centrifuged for 10 min at 3000 ⁇ g. The DNA was eluted in 100 ul Elution Buffer (10 mM Tris-HCl, pH 8.3) and centrifuged at 3000 ⁇ g for 1 min. For each sample, four PCR reactions were run.
  • 100 ul Elution Buffer (10 mM Tris-HCl, pH 8.3
  • PCR reactions were done on five samples of genomic DNA obtained from untransformed maize inbred plantlets. After an initial denaturation at 95° C. for 5 minutes, each PCR amplification was carried out over 35 cycles using DNA Engine Tetrad2 Thermal Cycler (BioRad Laboratories, Hercules, Calif.) at 94° C. for 30 sec denaturation, 68° C. for 30 sec annealing, and 72° C. for 1 min extension. PCR products F-E2, F-T and H-T were separated in 1% agarose gel at 100 Volts for 45 minutes, with 100 bp DNA Ladder (N0467S, NewEngland Biolabs).
  • the F-F3 PCR amplified fragments from selected calli were cloned into pCR 2.1-TOPO vectors using the TOPO TA Cloning Kit (Invitrogen Corp, Carlsbad, Calif.). DNA sequencing was done with BigDye Terminator chemistry on ABI 3700 capillary sequencing machines (Applied Biosystems, Foster City, Calif.). Each sample contained about 0.5 ug Topo plasmid DNA and 6.4 pmole primer E3-EPex3 Rev (ACCAAGCTGCTTCAATCCGACAAC, SEQ ID NO: 204). Sequences were analyzed using the Sequencer program.
  • a sample of thirty one callus events selected on media containing bialophos (the moPAT selectable marker gene was part of the guide RNA-moCas9 expression vector) were screened for the presence of the TIPS point mutations. Twenty four events contained the TIPS point mutations integrated into genomic DNA ( FIG. 16 , the F-E2 treatment). Among them, six events showed the PCR amplification product of the chromosomal EPSPS gene with TIPS mutations ( FIG. 16 , the H-T treatment).
  • the pair of PCR primers distinguished the EPSPS-TIPS editing products from the wild-type epsps alleles or random insertions of the TIPS mutations. If one EPSPS allele was edited to contain the TIPS substitutions, it should be detected as a DNA fragment originating from the genomic epsps locus, regardless whether the TIPS substitutions were selected for during the PCR amplification process.
  • the TIPS primer was replaced with the wild-type EPSPS primer (Table 15, the F-E3 pair of primers) and the PCR amplification products were cloned into the TOPO cloning vectors and sequenced.
  • the sequencing data represented a random sample of the genomic epsps locus sequences in one of the selected events ( FIG. 17 , callus A12 3360.92).
  • FIG. 17 shows that the method disclosed herein resulted in the successful nucleotide editing of three nucleotides ( FIG. 17 bold) responsible for the TIPS mutations without altering any of the other epsps nucleotides, while the moCas9 target sequence (the site of guide RNA binding underlined in FIG. 17 ) was not mutagenized.
  • the Quide RNA/Cas Endonuclease System Delivers Double-Strand Breaks to the Maize Epsps Locus Resulting in Maize Plants Containing an EPSPS-TIPS Edited Gene.
  • the EPSPS gene edited events were produced and selected as described in the Example 16.
  • the EPSPS polynucleotide modification template was co-n delivered using particle gun bombardment as a plasmid (see template vector 1, FIG. 15 ) together with the guide RNA expression cassette and a maize optimized Cas9 endonuclease expression vector which contained the maize optimized Cas9 endonuclease expression cassette described in FIG. 1A (Example 1, SEQ ID NO:5) and also contained a moPAT selectable marker gene.
  • the Ms-1 medium contained: 4.3 g/L MS salts (Gibco 11117), 5.0 ml/L MS Vitamins Stock Solution (Sigma M3900), 100 mg/L myo-inositol, 40.0 g/L sucrose, and 6.0 g/L Bacto-Agar at pH 5.6.
  • DNA was extracted from each T0 plantlet 7-10 days after transfer to the greenhouse and PCR procedures were conducted as described in the Example 16 to screen the T0 plants for mutations at the epsps locus.
  • T0 plants Seventy two percent of analyzed T0 plants ( 270/375, Table 17) contained mutagenized EPSPS alleles as determined by the end-point PCR procedure described in the Example 16. Most of the mutations ( 230/375 or 89%) were produced as a result of error-prone non-homologous end joining (NHEJ) while forty T0 plants ( 40/375 or 11%) contained the TIPS edited EPSPS alleles indicating the involvement of a templated double-strand break repair mechanism (Table 17).
  • NHEJ error-prone non-homologous end joining
  • a pair of primers (Table 15, the F-E3 pair of primers) was used to amplify a native, endogenous fragment of the epsps locus containing the moCas6 target sequence and the EPSPS editing site from the genomic DNA of selected T0 plants.
  • the PCR amplification products were cloned into the TOPO cloning vectors and sequenced as described in Example 16.
  • the sequencing data represent a random sample of the genomic epsps locus sequences from a particular T0 plant (Table 18) and indicate the genotype of the selected T0 plants.
  • the list of the EPSPS-TIPS allele-containing T0 plants transferred to the pots is presented in Table 18 (a selected set of T0 plants from the original 40 TIPS-containing events).
  • TIPS refers to a clone comprising the TIPS edited EPSPS sequence.
  • NHEJ refers to the presence of a NHEJ mutation and WT refers to the presence of a wild-type EPSPS sequence amplified from the native epsps locus.
  • the selected plants of E1 and E3 to E9 contained the EPSPS-TIPS edited version of the EPSPS gene either accompanied by a wild-type EPSPS allele (WT) or a NHEJ mutagenized EPSPS allele (NHEJ).
  • WT wild-type EPSPS allele
  • NHEJ NHEJ mutagenized EPSPS allele
  • the numbers before TIPS, WT, NHEJ in Table18 indicate the frequency at which a particular version of the EPSPS allele was identified. If all clones contained the TIPS-edited EPSPS sequence, the analyzed plant was likely to be homozygous for the EPSPS-TIPS allele (see for example E2).
  • the analyzed plant was likely to be hemizygous for the EPSPS-TIPS allele (see for example E1).
  • Other plants, such as E3 or E4 were likely to be chimeric for TIPS.
  • E2 the T0 plant contained only TIPS-edited sequence at the epsps locus indicating that the guide RNA/Cas endonuclease system disclosed herein resulted in the successful nucleotide editing of three nucleotides ( FIG. 17 bold) responsible for the two EPSPS-TIPS alleles at the epsps locus in maize plants.
  • a comparative Ct method with Delta Ct values normalized to the average Delta Ct from the bi-allelic TIPS genotypes provided a copy number estimation for the TIPS sequence detected in the analyzed plant samples.
  • T0 plants grew well in the greenhouse and were fertile.
  • a sample of T0 plants was sprayed with a 1 ⁇ dose of glyphosate (Roundup Powermax) at V3 growth stage using the spray booth setting of 20 gallons per acre.
  • the 1 ⁇ dose of glyphosate was prepared as follow: 2.55 ml Powermax in 300 ml water (active ingredient: glyphosate, N-(phosphonomethyl)glycine, in the form of its potassium salt at 48.7%).
  • Seven days after glyphosate application no leaf tissue damage was observed in some of the T0 plants. These plantlets were hemizygous for the EPSPS-TIPS alleles, while other plantlets were severely damaged.
  • One plant showing no damage to the leaf tissue 14 days after herbicide application contained 21 EPSPS-TIPS alleles among 44 genomic clones of the epsps locus (cloned and sequenced as described in the Example 16).
  • RNA/Cas system can be used to create a TIPS-edited EPSPS allele in maize.
  • Maize plants homozygous at the epsps-tips locus (two EPSPS alleles edited) with no additional insertion of the TIPS template (plant E2) were obtained.
  • some EPSPS-TIPS edited maize plants did show some level of tolerance against a 1 ⁇ dose of glyphosate.
  • MHP14Cas-1 Two target sites for a Cas endonuclease were identified at each of the four loci and are referred to as MHP14Cas-1, MHP14Cas-3, TS8Cas-1, TS8Cas2, TS9Cas-2, TS9Cas-3, TS10Cas-1 and TS10Cas-3 ( FIG. 19 , Table 22, SEQ ID NOs:229-236).
  • Maize genomic target sites targeted by a guide RNA/Cas endonuclease Maize SEQ Target Genomic Target ID Locus Location Site Site Sequence
  • the maize optimized Cas endonuclease cassette (SEQ ID NO: 5 was as prepared as describe in Example 1.
  • Long guide RNA expression cassettes comprising a variable targeting domain targeting one of the 8 genomic target sites, driven by a maize U6 polymerase III promoter, and terminated by a maize U6 polymerase III terminator were designed as described in Example 1 and 3 and listed in Table 23.
  • a donor DNA HR repair DNA
  • a selectable marker a phosphomannose-isomerase (PMI) expression cassette
  • a vector containing the maize optimized Cas9 endonuclease of SEQ ID NO: 5, a vector containing one of eight long guide RNA expression cassettes of SEQ ID NOs: 245-252, and a vector containing one of eight donor DNAs of SEQ ID NOs: 253-260 were co-delivered to maize elite line immature embryos by particle-mediated delivery as described in Example 10. About 1000 embryos were bombarded for each target site. Since the donor DNA contained a selectable marker, PMI, successful delivery of the donor DNA allowed for callus growth on mannose media. Putative HR-mediated transgenic insertions were selected by placing the callus on mannose containing media.
  • SEQ Target ID Locus Site Junction Primer NO: UBIR donor 1 CCATGTCTAACTGTTCA 261 TTTATATGATTCTCT PSBF donor 2 GCTCGTGTCCAAGCGTC 262 ACTTACGATTAGCT MHP14 MHP14Cas-1 14-1HR1f CTCACATGAGGCTCTTC 263 MHP14Cas-3 TTTGCTTGCT 14-1HR2r AGGATCCTATTCCCCAA 264 TTTGTAGAT CHR1-8 TS8Cas-1 8HR1f CAGTCCGTGGATTGAAG 265 CCAT TS8Cas-2 8HR2r CTCTGTCTCCGAGACGT 266 GCTTA CHR1-9 TS9Cas-2 9HR1f GGAGCAAATGTTTTAGG 267 TATGAAATG TS9Cas-3 9HR2r CGGATTCTAAAGATCAT 268 ACGTAAATGAA CHR1-10 TS10Cas-1 10
  • the “Event Recovery frequency” was calculated using the number of events recovered divided by the total number of embryos bombarded, and may indicate if an endonuclease has some toxic effect or not (Table 26). Hence, if 1000 embryos were bombarded and 240 were recovered, the Event Recovery frequency is 24%. Table 26 indicates that for all target sites analyzed the Event Recovery frequency ranged between 17 and 28%, indicating that the guide RNA/Cas system used herein results in low or no toxicity. Cas endonuclease activity was measured in-planta by determining the “Target Site Mutation frequency” (Table 26) which is defined as: (number of events with target site modification/total number recovered events)*100%.
  • Target Site Mutation frequency is 75%.
  • the target site mutation frequency was measured using target site allele copy number as described in Example 9 of U.S. application Ser. No. 13/886,317, filed on May 3, 2013.
  • the primers and probes for obtaining the target site copy number using qPCR at each site were as listed in Table 25 (SEQ ID NO: 271-294).
  • Primer and probe sequences used to assess DNA cleavage at 8 maize genomic target sites Target Site SEQ Desig- Probe Primer ID nation primers sequence NO: MHP14 probe CAGATTCACGTCAGATTT 271 Cas-1 forward CATAGTGGTGTATGAAAG 272 GAAGCACTT reverse CATTTTGGATTGTAATAT 273 GTGTACCTCATA MHP14 probe CACCACTATGTCGCTTC 274 Cas-3 forward CGGATGCACGAAAATTGT 275 AGGA reverse CTGACGTGAATCTGTTTG 276 GAATTG TS8 probe TACGTAACGTGCAGTACT 277 Cas-1 forward ACGGACGGACCATACG 278 TTATG reverse TCAGCTGGTGGAGTATAT 279 TAGTTCGT TS8 probe CCAGCTGATCACTGATGA 280 Cas-2 forward ACGGACGGACCATACGT 281 TATG reverse CGCACATGTTATAAATTA 282 CAATGCAT TS9 probe CTGTTTGCGGCCTC 283 Cas-2 forward ACGG
  • FIG. 21 The primers used for insertion PCR analysis at each site are listed in Table 24.
  • FIG. 22 shows one example of an insertion event screening PCR result.
  • the frequency of transgene insertion was determined by calculating the “Insertion frequency” which is defined as: (number of events with target site insertion/total number recovered events)*100%. Hence, if 240 events were recovered and 21 events showed a transgene insertion, the Insertion frequency was 9%.
  • a soybean U6 small nuclear RNA promoter (GM-U6-9.1; SEQ ID NO: 295) was identified in a similar manner as the soybean promoter GM-U6-13.1 (SEQ ID NO:120) described in Example 12.
  • the GM-U6-9.1 promoter was used to express guide RNA to direct Cas9 nuclease to designated genomic target site.
  • a soybean codon optimized Cas9 endonuclease expression cassette (such as for example EF1A2:CAS9, SEQ ID NO: 296) and a guide RNA expression cassette (such as for example U6-9.1:DD20CR1; SEQ ID NO: 297) were linked (such as U6-9.1: DD20CR1+EF1A2:CAS9; SEQ ID NO: 298, FIG.
  • FIGS. 23A and 23B Other guide RNA/Cas9 DNA constructs targeting various soybean genomic sites and donor DNA constructs for site-specific transgene integration through homologous recombination were similarly configured and are listed in Table 27.
  • the four gRNA/Cas9 constructs differed only in the 20 bp guide RNA targeting domain (variable targeting domain) targeting the soybean genomic target sites DD20CR1 (SEQ ID NO: 125), DD20CR2 (SEQ ID NO: 126), DD43CR1 (SEQ ID NO: 127), or DD43CR2 (SEQ ID NO: 128).
  • the two donor DNA constructs differed only in the homologous regions such as DD20HR1 and DD20HR ( FIG. 23B ), or DD43HR1 and DD43HR2.
  • These guide RNA/Cas9 DNA constructs and donor DNAs were co-delivered to an elite (93B86) or a non-elite (Jack) soybean genome by the stable transformation procedure described below.
  • RNA/Cas9 Mediated Soybean Stable Transformation.
  • Soybean somatic embryogenic suspension cultures were induced from a DuPont Pioneer proprietary elite cultivar 93B86 as follows. Cotyledons ( ⁇ 3 mm in length) were dissected from surface sterilized, immature seeds and were cultured for 6-10 weeks in the light at 26° C. on a Murashige and Skoog (MS) media containing 0.7% agar and supplemented with 10 mg/ml 2,4-D (2,4-Dichlorophenoxyacetic acid). Globular stage somatic embryos, which produced secondary embryos, were then excised and placed into flasks containing liquid MS medium supplemented with 2,4-D (10 mg/ml) and cultured in light on a rotary shaker.
  • MS Murashige and Skoog
  • soybean embryogenic suspension cultures were maintained in 35 ml liquid media on a rotary shaker, 150 rpm, at 26° C. with fluorescent lights on a 16:8 hour day/night schedule. Cultures were subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 ml of the same fresh liquid MS medium.
  • Soybean embryogenic suspension cultures were then transformed by the method of particle gun bombardment using a DuPont BiolisticTM PDS1000/HE instrument (Bio-Rad Laboratories, Hercules, Calif.).
  • plasmid DNA comprising, for example, U6-9.1:DD20CR1+EF1A2:CAS9 (SEQ ID NO:298) and plasmid DNA comprising, for example, (DD20HR1-SAMS:HPT-DD20HR2, SEQ ID NO: 299)
  • 20 ⁇ l of 0.1 M spermidine 20 ⁇ l of 0.1 M spermidine, and 25 ⁇ l of 5 M CaCl 2 .
  • the particle preparation was then agitated for 3 minutes, spun in a centrifuge for 10 seconds and the supernatant removed.
  • the DNA-coated particles were then washed once in 400 ⁇ l 100% ethanol and resuspended in 45 ⁇ l of 100% ethanol.
  • the DNA/particle suspension was sonicated three times for one second each. Then 5 ⁇ l of the DNA-coated gold particles was loaded on each macro carrier disk.
  • Approximately 300-400 mg of a two-week-old suspension culture was placed in an empty 60 ⁇ 15 mm Petri dish and the residual liquid removed from the tissue with a pipette. For each transformation experiment, approximately 5 to 10 plates of tissue were bombarded. Membrane rupture pressure was set at 1100 psi and the chamber was evacuated to a vacuum of 28 inches mercury. The tissue was placed approximately 3.5 inches away from the retaining screen and bombarded once. Following bombardment, the tissue was divided in half and placed back into liquid media and cultured as described above.
  • Cotyledon stage somatic embryos were dried-down (by transferring them into an empty small Petri dish that was seated on top of a 10 cm Petri dish containing some agar gel to allow slow dry down) to mimic the last stages of soybean seed development. Dried-down embryos were placed on germination solid media and transgenic soybean plantlets were regenerated. The transgenic plants were then transferred to soil and maintained in growth chambers for seed production. Transgenic events were sampled at somatic embryo stage or T0 leaf stage for molecular analysis.
  • Genomic DNA was extracted from somatic embryo samples and analyzed by quantitative PCR using a 7500 real time PCR system (Applied Biosystems, Foster City, Calif.) with target site-specific primers and FAM-labeled fluorescence probe to check copy number changes of the target site DD20 or DD43 ( FIG. 24 A-C).
  • the qPCR analysis was done in duplex reactions with a heat shock protein (HSP) gene as the endogenous controls and a wild type 93B86 genomic DNA sample that contains one copy of the target site with 2 alleles, as the single copy calibrator.
  • HSP endogenous control qPCR employed primer probe set HSP-F/HSP-T/HSP-R.
  • the guide RNA/Cas9 DNA (SEQ ID NOs: 298, 300, 301, and 303) specific qPCR employed primer probe set Cas9-F (SEQ ID NO:317/Cas9-T (SEQ ID NO:318)/Cas-9-R(SEQ ID NO:319).
  • the donor DNA (SEQ ID NOS: 299, and 302) specific qPCR employed primer probe set Sams-76F (SEQ ID NO:320)/FRT1I63-T (SEQ ID NO:321)/FRT1I-41F (SEQ ID NO:322).
  • the endogenous control probe HSP-T was labeled with VIC and the gene-specific probes DD20-T, DD43-T, Cas9-T, and FRT1I63-T were labeled with FAM for the simultaneous detection of both fluorescent probes (Applied Biosystems).
  • PCR reaction data were captured and analyzed using the sequence detection software provided with the 7500 real time PCR system and the gene copy numbers were calculated using the relative quantification methodology (Applied Biosystems).
  • the target region of NHEJ-Null events were amplified by regular PCR from the same genomic DNA samples using DD20-LB (SEQ ID NO: 323) and DD20-RB (SEQ ID NO: 326) primers specific respectively to DD20-HR1 and DD20-HR2 for DD20 target site specific HR1-HR2 PCR amplicon ( FIG. 25 A-C; SEQ ID NO: 329), or DD43-LB (SEQ ID NO: 327) and DD43-RB (SEQ ID NO: 328) primers specific respectively to DD43-HR1 and DD43-HR2 for DD43 target site specific HR1-HR2 PCR amplicon (SEQ ID NO: 332).
  • PCR bands were cloned into pCR2.1 vector using a TOPO-TA cloning kit (Invitrogen) and multiple clones were sequenced to check for target site sequence changes as the results of NHEJ.
  • Different mutated sequences were identified from some of the same events indicating the chimeric nature of these events. Some of the same mutated sequences were also identified from different events suggesting that the same mutations could have happened independently or some of the events could be clonal events.
  • Any events with both the 5′ border and 3′ border-specific bands amplified are considered as site-specific integration events through homologous recombination containing the transgene from the donor DNA fragment DD20HR1-SAMS:HPT-DD20HR2 or its circular form ( FIG. 23 ).
  • DD43CR1 and DD43CR2 events were amplified as a 1202 bp DD43 HR1-SAMS PCR amplicon (SEQ ID NO: 333) by PCR with primers DD43-LB and Sams-A1 while the 3′ borders of the same events were amplified as a 1454 bp DD43 NOS-HR2 PCR amplicon (SEQ ID NO: 334) with primers QC498A-S1 (SEQ ID NO: 325) and DD43-RB (SEQ ID NO: 328).
  • any events with both the 5′ border and 3′ border-specific bands amplified are considered as site-specific integration events through homologous recombination containing the transgene from repair DNA fragment DD43HR1-SAMS:HPT-DD43HR2 or its circular form.
  • Some of the border-specific PCR fragments were sequenced and were all confirmed to be recombined sequences as expected from homologous recombination.
  • gene integration through the guide RNA/Cas9 mediated homologous recombination occurred at approximately 4% of the total transgenic events (Insertion frequency, Table 28 and Table 29).
  • One homologous recombination event was identified from experiment U6-9.1 DD43CR1-Jack repeated in “Jack” genotype (Table 29).
  • the crRNA/tracrRNA/Cas Endonuclease System Cleaves Chromosomal DNA in Maize and Introduces Mutations by Imperfect Non-Homologous End-Joining
  • Example 1 To test whether the maize optimized crRNA/tracrRNA/Cas endonuclease system described in Example 1 could recognize, cleave, and mutate maize chromosomal DNA through imprecise non-homologous end-joining (NHEJ) repair pathways, three different genomic target sequences were targeted for cleavage (see Table 30) and examined by deep sequencing for the presence of NHEJ mutations.
  • NHEJ non-homologous end-joining
  • the maize optimized Cas9 endonuclease expression cassette, crRNA expression cassettes containing the specific maize variable targeting domains (SEQ ID NOs: 445-447) complementary to the antisense strand of the maize genomic target sequences listed in Table 30 and tracrRNA expression cassette (SEQ ID NO: 448) were co-delivered to 60-90 Hi-II immature maize embryos by particle-mediated delivery (see Example 5) in the presence of BBM and WUS2 genes (see Example 6).
  • Hi-II maize embryos transformed with the Cas9 and long guide RNA expression cassettes targeting the LIGCas-3 genomic target site (SEQ ID NO: 18) for cleavage served as a positive control and embryos transformed with only the Cas9 expression cassette served as a negative control.
  • the 20-30 most uniformly transformed embryos from each treatment were pooled and total genomic DNA was extracted.
  • the region surrounding the intended target site was PCR amplified with Phusion® High Fidelity PCR Master Mix (New England Biolabs, M0531L) adding on the sequences necessary for amplicon-specific barcodes and Illumnia sequencing using “tailed” primers through two rounds of PCR.
  • the primers used in the primary PCR reaction are shown in Table 31 and the primers used in the secondary PCR reaction were AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACG (forward, SEQ ID NO: 53) and CAAGCAGAAGACGGCATA (reverse, SEQ ID NO: 54).
  • the resulting PCR amplifications were purified with a Qiagen PCR purification spin column, concentration measured with a Hoechst dye-based fluorometric assay, combined in an equimolar ratio, and single read 100 nucleotide-length deep sequencing was performed on Illumina's MiSeq Personal Sequencer with a 30-40% (v/v) spike of PhiX control v3 (Illumina, FC-110-3001) to off-set sequence bias. Only those reads with a ⁇ 1 nucleotide indel arising within the 10 nucleotide window centered over the expected site of cleavage and not found in a similar level in the negative control were classified as NHEJ mutations.
  • NHEJ mutant reads with the same mutation were counted and collapsed into a single read and the top 10 most prevalent mutations were visually confirmed as arising within the expected site of cleavage. The total numbers of visually confirmed NHEJ mutations were then used to calculate the % mutant reads based on the total number of reads of an appropriate length containing a perfect match to the barcode and forward primer.
  • FIG. 27A for LIGCas-1 target site, corresponding to SEQ ID NOs:415-424
  • FIG. 27B for LIGCas-2 target site corresponding to SEQ ID NOs: 425-43
  • FIG. 27C for LIGCas-3 target site corresponding to SEQ ID NOs:435-444.
  • ARGOS is a negative regulator for ethylene responses in plants (WO 2013/066805 A1, published 10 May 2013).
  • ARGOS proteins target the ethylene signal transduction pathway.
  • DTT drought tolerance
  • NUE nitrogen use efficiency
  • promoters have been tested for driving Zm-ARGOS8 over-expression in transgenic maize plants. Field trials showed that a maize promoter, Zm-GOS2 PRO:GOS2 INTRON (SEQ ID NO:460, U.S. Pat. No. 6,504,083 patent issued on Jan.
  • Zm-GOS2 is a maize homologous gene of rice GOS2.
  • Rice GOS2 stands for Gene from Oryza Sativa 2), provided a favorable expression level and tissue coverage for Zm-ARGOS8 and the transgenic plants have a higher grain yield than non-transgenic controls under drought stress and low nitrogen conditions (WO 2013/066805 A1, published 10 May 2013).
  • these transgenic plants contain two ARGOS8 genes, the endogenous gene and the transgene.
  • ARGOS8 protein levels therefore, are determined by these two genes. Because the endogenous ARGOS8 gene varies in sequence and the expression level among different inbred lines, the ARGOS8 protein level will be different when the transgene is integrated into different inbreds.
  • a mutagenization gene editing
  • the promoter Zm-GOS2 PRO:GOS2 INTRON (SEQ ID NO:460; U.S. Pat. No. 6,504,083 patent issued on Jan. 7, 2003) was inserted into the 5′-UTR of Zm-ARGOS8 (SEQ ID NO:462) by using a guideRNA/Cas9 system.
  • the Zm-GOS2 PRO:GOS2 INTRON fragment also included a primer binding site (SEQ ID NO:459) at its 5′ end to facilitate event screening with PCR.
  • Resulted maize lines carry a new ARGOS8 allele whose expression levels and tissue specificity will differ from the native form. We expect that these lines will recapitulate the phenotype of increased drought tolerance and improved NUE as observed in the Zm-GOS2 PRO:Zm-ARGOS8 transgenic plants (WO 2013/066805 A1, published 10 May 2013). These maize lines are different from those conventional transgenic events: (1) there is only one ARGOS8 gene in the genome; (2) this modified version of Zm-ARGOS8 resides at its native locus; (3) the ARGOS8 protein level and the tissue specificity of gene expression are entirely controlled by the edited allele.
  • the DNA reagents used during the mutagenization such as guideRNA, Cas9endonuclease, transformation selection marker and other DNA fragments are not required for function of the newly generated ARGOS8 allele and can be eliminated from the genome by segregation through standard breeding methods. Because the promoter Zm-GOS2 PRO:GOS2 INTRON was copied from maize GOS2 gene (SEQ ID NO:464) and inserted into the ARGOS8 locus through homologous recombination, this ARGOS8 allele is indistinguishable from natural mutant alleles.
  • a guideRNA construct gRNA1
  • the 5′-end of the guide RNA contained a 19-bp variable targeting domain targeting the genomic target sequence 1 (CTS1; SEQ ID NO; 451) in the 5′-UTR of Zm-ARGOS8 ( FIG. 28 ).
  • CTS1 genomic target sequence 1
  • SEQ ID NO; 451 genomic target sequence 1
  • FIG. 28 A polynucleotide modification template containing the Zm-GOS2 PRO:GOS2 INTRON that was flanked by two genomic DNA fragments (HR1 and HR2, 370 and 430-bp in length, respectively) derived from the upstream and downstream region of the CTS1 ( FIG.
  • the gRNA1 construct, the polynucleotide modification template, a Cas9 cassette and transformation selection marker phosphomannose isomerase (PMI) were introduced into maize immature embryo cells by using a particle bombardment method. PMI-resistant calli were screened with PCR for Zm-GOS2 PRO:GOS2 INTRON insertion ( FIGS. 29A and 29B ). Multiple callus events were identified and plants were regenerated. The insertion events were confirmed by amplifying the Zm-ARGOS8 region in T0 plants with PCR ( FIG. 29C ) and sequencing the PCR products.
  • a guide RNA construct was made for targeting the genomic target site CTS3 (SEQ ID NO:453), located 710-bp upstream of the Zm-ARGOS8 start codon ( FIG. 30 ).
  • Another guide RNA, gRNA2 was designed to target the genomic target site CTS2 (SEQ ID NO:452) located in the 5′-UTR of Zm-ARGOSO8 ( FIG. 30 ).
  • the polynucleotide modification template contained a 400-bp genomic DNA fragment derived from the upstream region of CTS3, Zm-GOS2 PRO:GOS2 INTRON and a 360-bp genomic DNA fragment derived from the downstream region of CTS2 ( FIG. 30 ).
  • the gRNA3 and gRNA2, the Cas9 cassette, the polynucleotide modification template and the PMI selection marker were used to transform immature embryo cells.
  • Multiple promoter swap (promoter replacement) events were identified by PCR screening of the PMI-resistance calli ( FIGS. 31A , 31 B & 31 C) and plants were regenerated. The swap events were confirmed by PCR analysis of the Zm-ARGOS8 region in T0 plants ( FIG. 31D ).
  • RNA/Cas9 endonuclease target sites on soybean EPSPS1 gene Cas endonuclease Name of gRNA-Cas9 target endonuclease sequence target site (SEQ ID NO:) Physical location soy EPSPS-CR1 467 Gm01: 45865337 . . . 45865315 soy EPSPS-CR2 468 Gm01: 45865311 . . . 45865333
  • the soybean U6 small nuclear RNA promoter, GM-U6-13.1 (SEQ ID. NO: 469), was used to express guide RNAs to direct Cas9 nuclease to designated genomic target sites (Table 34).
  • a soybean codon optimized Cas9 endonuclease (SEQ ID NO: 489) expression cassette and a guide RNA expression cassette were linked in a first plasmid that was co-delivered with a polynucleotide modification template.
  • the polynucleotide modification template contained specific nucleotide changes that encoded for amino acid changes in the EPSPS1 polypeptide (Glyma01g33660), such as the T183I and P187S (TIPS) in the Exon2.
  • EPSPS1 polypeptide can also be obtained using the guide RNA/Cas endonuclease system described herein. Specific amino acid modifications can be achieved by homologous recombination between the genomic DNA and the polynucleotide modification template facilitated by the guideRNA/Cas endonuclease system.
  • RNA/Cas9 expression cassettes and polynucleotide modification templates used in soybean stable transformation for the specific amino acid modifications of the EPSPS1 gene.
  • SEQ polynucleotide SEQ Guide RNA/Cas9 ID modification ID Experiment (plasmid name) NO: template NO: soy EPSPS- U6-13.1:EPSPS CR1 + 470 RTW1013A 472 CR1 EF1A2:CAS9 (QC878) soy EPSPS- U6-13.1:EPSPS CR2 + 471 RTW1012A 473 CR2 EF1A2:CAS9 (QC879)
  • NHEJ Site-Specific Non-Homologous-End-Joining
  • Genomic DNA was extracted from somatic embryo samples and analyzed by quantitative PCR using a 7500 real time PCR system (Applied Biosystems, Foster City, Calif.) with target site-specific primers and FAM-labeled fluorescence probe to check copy number changes of the double strand break target sites.
  • the qPCR analysis was done in duplex reactions with a syringolide induced protein (SIP) as the endogenous controls and a wild type 93B86 genomic DNA sample that contains one copy of the target site with 2 alleles, as the single copy calibrator.
  • SIP syringolide induced protein
  • the presence or absence of the guide RNA-Cas9 expression cassette in the transgenic events was also analyzed with the qPCR primer/probes for guideRNA/Cas9 (SEQ IDs: 477-479) and for PinII (SEQ ID: 480-482).
  • the qPCR primers/probes are listed in Table 35.
  • Primer/ Target Probe SEQ ID Site Name Sequences NOs: EPSPS-CR1 & Soy1-F1 CCACTAGTAAGGAATCT 474 EPSPS-CR2 AAAGATGAAATCA Soy1-R2 CCTGCAGCAACCACAGC 475 TGCTGTC Soy1-T1 CTGCAATGCGTCCTT 476 (FAM-MGB) gRNA/ Cas9-F CCTTCTTCCACCGCC 477 CAS9 TTGA Cas9-R TGGGTGTCTCTCGTGCT 478 TTTT Cas9-T AATCATTCCTGGTGG 479 (FAM-MGB) AGGA plNll plNll-99F TGATGCCCACATTATAG 480 TGATTAGC plNll-13R CATCTTCTGGATTGGCC 481 AACTT plNll-69T ACTATGTGTGCATCCTT 482 (FAM-MGB) SIP SEQ ID Site Name Sequences NOs: EPSPS-CR1 & Soy
  • the endogenous control probe SIP-T was labeled with VIC and the gene-specific probes for all the target sites were labeled with FAM for the simultaneous detection of both fluorescent probes (Applied Biosystems).
  • PCR reaction data were captured and analyzed using the sequence detection software provided with the 7500 real time PCR system and the gene copy numbers were calculated using the relative quantification methodology (Applied Biosystems).
  • both guideRNA/Cas endonuclease systems targeting the soy EPSPS-CR1 and EPSPS-CR2 sites can introduce efficient Double Strand Break (DSB) efficiency at their designed target sites.
  • DSB Double Strand Break
  • Both NHEJ-Hemi and NHEJ-Null were detected in the 93B86 genotype.
  • NHEJ (Non-Homologous-End-Joining) mutations mediated by the guide RNA/Cas9 system at the specific Cas9 target sites were confirmed by PCR/topo cloning/sequencing.
  • a polynucleotide modification template such as RTW1013A or RTW1012A (Table 34) was co-delivered with the guideRNA/Cas9 expression cassettes into soybean cells.
  • the modification of the native EPSPS1 gene via guide RNA/Cas9 system mediated DNA homologous recombination was determined by specific PCR analysis.
  • a specific PCR assay with primer pair WOL569 (SEQ ID NO: 486) and WOL876 (SEQ ID NO: 487) was used to detect perfect TIPS modification at the native EPSPS1 gene.
  • a second primer pair WOL569 (SEQ ID NO: 486) and WOL570 (SEQ ID NO: 488) was used to amplify both TIPS modified EPSPS1 allele and WT (wild type)/NHEJ mutated allele. Topo cloning/sequencing was used to verify the sequences.
  • RNA/Cas9 endonuclease target sites on soybean EPSPS1 gene Cas endonuclease Name of gRNA-Cas9 target endonuclease sequence target site (SEQ ID NO:) Physical location soy EPSPS-CR1 467 Gm01: 45865337 . . . 45865315 soy EPSPS-CR2 468 Gm01: 45865311 . . . 45865333 soy EPSPS-CR4 490 Gm01: 45866302 . . . 45866280 soy EPSPS-CR5 491 Gm01: 45866295 . . . 45866274 B.
  • the soybean U6 small nuclear RNA promoter GM-U6-13.1 (SEQ ID. NO: 469) was used to express two guide RNAs (soy-EPSPS-CR1 and soy-EPSPS-CR4, or soy-EPSPS-CR1 and soy-EPSPS-CR5) to direct Cas9 endonuclease to designated genomic target sites (Table 38).
  • One of the target sites (soy-EPSPS-CR1) was located in the exon2, as described in Example 24, and a second target site (soy-EPSPS-CR4 or soy-EPSPS-CR5) was located near the 5′ end of intron1 of the native EPSPS1 gene.
  • a soybean codon optimized Cas9 endonuclease expression cassette and a guide RNA expression cassette were linked in the expression plasmids QC878/RTW1199 (SEQ ID NO:470/492) or QC878/RTW1200 (SEQ ID NO:470/493) that was co-delivered with a polynucleotide modification template.
  • the polynucleotide modification template, RTW1190A contained 532 bp intron1 of the soybean UBQ gene and the TIPS modified Exon2.
  • Soybean EPSPS1 intron 1 replacement with the soybean UBQ intron1 can be achieved with the guide RNA/Cas system by homologous recombination between the genomic DNA and the polynucleotide modification template, resulting in enhancement of the native or modified soy EPSPS1 gene expression.
  • the QC878 vector (SEQ ID NO: 470) was targeting the exon2 and the RTW1199 (SEQ ID NO:492) or RTW1200 (SEQ ID NO:493) was targeting the 5′ end of the intron1.
  • the double cleavage of soybean EPSPS gene with the two guide RNA/Cas systems resulted in the removal of the native EPSPS1 intron1/partial Exon2 fragment.
  • a polynucleotide modification template RTW1190A (SEQ ID NO:494) was co-delivered into soybean cells and homologous recombination between the polynucleotide modification template and the genomic DNA resulted in the replacement of EPSPS1 intron1 with the soybean UBQ intron1 and the desired amino acid modifications in exon2 as evidenced by PCR analysis.
  • PCR assays with primer WOL1001/WOL1002 pair (SEQ ID NO: 499 and 500) and WOL1003/WOL1004 pair (SEQ ID NO: 501 and 502) were used to detect the intron replacement events.
  • RNA/Cas9 endonuclease target sites on soybean EPSPS1 gene Cas Name of gRNA-Cas9 endonuclease endonuclease target sequence target site (SEQ ID NO:) Physical location soy EPSPS-CR1 467 Gm01: 45865337 . . . 45865315 soy EPSPS-CR2 468 Gm01: 45865311 . . . 45865333 soy EPSPS-CR6 503 Gm01: 45867471 . . . 45867493 soy EPSPS-CR7 504 Gm01: 45867459 . . . 45867481 B.
  • SEQ ID NO: Physical location soy EPSPS-CR1 467 Gm01: 45865337 . . . 45865315 soy EPSPS-CR2 468 Gm01: 45865311 . . . 45865333 soy EPSPS-CR6 503 Gm01
  • the soybean U6 small nuclear RNA promoter GM-U6-13.1 (SEQ ID. NO: 469) was used to express two guide RNAs (soyEPSPS-CR1 and soyEPSPS-CR6, or soyEPSPS-CR1 and soyEPSPS-CR7) to direct Cas9 nuclease to designated genomic target sites (Table 41).
  • One of the target sites (soy-EPSPS-CR1) was located in the exon2 as described in Example 24 and a second target site (soy-EPSPS-CR6 or soy-EPSPS-CR7) was located near 5′ end of the ⁇ 798 bp of the native EPSPS1 promoter.
  • a soybean codon optimized Cas9 endonuclease expression cassette and a guide RNA expression cassette were linked in the expression plasmids QC878/RTW1201 (SEQ ID NO:470/505) or QC878/RTW1202 (SEQ ID NO:470/506) that was co-delivered with a polynucleotide modification template, RTW1192A (SEQ ID NO:507).
  • the polynucleotide modification template contained 1369 bp of the soybean UBQ gene promoter, 47 bp 5UTR and 532 bp UBQ intron1.
  • soybean EPSPS1 promoter replacement with the soybean UBQ promoter can be achieved with the guide RNA/Cas system by homologous recombination between the genomic DNA and the polynucleotide modification template, resulting enhancement of the native or modified soy EPSPS1 gene expression
  • a polynucleotide modification template RTW1192A (SEQ ID NO: 507) was co-delivered into soybean cells.
  • This RTW1192A DNA contained 1369 bp soybean UBQ promoter, its 47 bp 5-UTR and 532 bp UBQ intron1 in front of the EPSPS1 exon1-Intron1-modified Exon2.
  • Homologous recombination between the polynucleotide modification template and the genomic DNA resulted in the replacement of EPSPS1 promoter/5′UTR with the soybean UBQ promoter/5′UTR/Intron1 and the desired amino acid modifications evidenced by PCR analysis.
  • PCR assays with primer WOL1005/WOL1006 pair (SEQ ID NO: 511 and 512) and WOL1003/WOL1004 pair (SEQ ID NO: 501 and 502) were used to detect the promoter replacement events.
  • Enhancer Element Deletions Using the guideRNA/Cas Endonuclease System
  • the guide RNA/Cas endonuclease system described herein can be used to allow for the deletion of a promoter element from either a transgenic (pre-existing, artificial) or endogenous gene.
  • Enhancer elements can be, but are not limited to, a 35S enhancer element (Benfey et al, EMBO J, August 1989; 8(8): 2195-2202, SEQ ID NO:513).
  • the enhancer elements can cause an unwanted phenotype, a yield drag, or a change in expression pattern of the trait of interest that is not desired.
  • a plant comprising multiple enhancer elements (3 copies, 3 ⁇ ) in its genomic DNA located between two trait cassettes (Trait A en Trait B) was characterized to show an unwanted phenotype. It is desired to remove the extra copies of the enhancer element while keeping the trait gene cassettes intact at their integrated genomic location.
  • the guide RNA/Cas endonuclease system described herein can be used to removing the unwanted enhancing element from the plant genome.
  • a guide RNA can be designed to contain a variable targeting region targeting a target site sequence of 12-30 bps adjacent to a NGG (PAM) in the enhancer. If a Cas endonuclease target site sequence is present in all copies of the enhancer elements (such as the three Cas endonuclease target sites 35S-CRTS1 (SEQ ID NO:514), 35S-CRTS2 (SEQ ID NO:515), 35S-CRTS3 (SEQ ID NO:516)), only one guide RNA is needed to guide the Cas endonuclease to the target sites and induce a double strand break in all the enhancer elements at once. The Cas endonuclease can make cleavage to remove one or multiple enhancers.
  • PAM NGG
  • the guideRNA/Cas endonuclease system can introduced by either agrobacterium or particle gun bombardment.
  • two different guide RNAs targeting two different genomic target sites
  • ubiquitination sites on proteins to be degraded There are defined ubiquitination sites on proteins to be degraded and they were found within the maize EPSPS protein by using dedicated computer programs (for example, the CKSAAP_UbSite (Ziding Zhang's Laboratory of Protein Bioinformatics College of Biological Sciences, China Agricultural University, 100193 Beijing, China).
  • One of the selected polyubiquitination site within the maize EPSPS coding sequence is shown in FIG. 34A and its amino acid signature sequence is compared to the equivalent EPSPS sites from the other plants ( FIG. 34A ).
  • the lysine amino acid (K) at position 90 was selected as a potential site of the EPSPS protein polyubiquitination.
  • the polynucleotide modification template (referred to as EPSPS polynucleotide maize K90R template) used to edit the epsps locus is listed as SEQ ID NO: 517.
  • This template allowed for editing the epsps locus to contain the lysine (K) to arginine (R) substitution at position 90 (K90R) and two additional TIPS substitutions at positions 102 and 106 ( FIGS. 34B and 34C ).
  • Maize genomic DNA was edited using the guideRNA/Cas endonuclease system described herein and T0 plants were produced as described herein.
  • F1 EPSPS-K90R plants can be selected for elevated protein content due to a slower rate of the EPSPS protein degradation.
  • Transcriptional activity of the native EPSPS gene can be modulated by transcriptional enhancers positioned in the vicinity of other transcription controlling elements.
  • Introns are known to contain enhancer elements affecting the overall rate of transcription from native promoters including the EPSPS promoter.
  • the first intron of the maize ubiquitin 5′UTR confers a high level of expression in monocot plants as specified in the WO 2011/156535 A1 patent application.
  • An intron enhancing motif CATATCTG ( FIG. 35 A), also referred to as a intron-mediated enhancer element, IME) was identified by proprietary analysis (WO2011/156535 A1, published on Dec.
  • EPSPS polynucleotide maize IME template The polynucleotide modification template allows for editing of the epsps locus to contain three IMEs (two on one strand of the DNA, one on the reverse strand) in the first EPSPS intron and the TIPS substitutions at positions 102 and 106.
  • the genomic DNA of maize plants was edited using the guideRNA/Cas endonuclease system described herein. Maize plants containing the IME edited EPSPS coding sequence can be selected by genotyping the T0 plants and can be further evaluated for elevated EPSPS-TIPS protein content due to the enhanced transcription rate of the native EPSPS gene.
  • FIG. 36A shows analysis of EPSPS amplified pre-mRNA (cDNA panel on left).
  • Lane I4 in FIG. 36A shows amplification of the EPSPS pre-mRNA containing the 3 rd intron unspliced, resulting in a 804 bp diagnostic fragment indicative for an alternate splicing event.
  • Lanes E3 and F8 show the EPSPS PCR amplified fragments resulting from regular spliced introns.
  • Diagnostic fragments such as the 804 bp fragment of lane I4 are not amplified unless cDNA is synthesized (as is evident by the absence of bands in lanes E3, I4, and F8 comprising total RNA (shown in the total RNA panel on right of FIG. 36A ).
  • the canonical splice site in the maize EPSPS gene and genes from other species is AGGT, while other (alternative) variants of the splice sites may lead to the aberrant processing of pre-mRNA molecules.
  • the EPSPS coding sequence contains a number of alternate splicing sites that may affect the overall efficiency of the pre-mRNA maturation process and as such may limit the EPSPS protein accumulation in maize cells.
  • a guideRNA/Cas endonuclease system as described herein can be used to edit splicing sites.
  • the splicing site at the junction of the second native EPSPS intron and the third exon is AGTT and can be edited in order to introduce the canonical AGGT splice site at this junction ( FIG. 37 ).
  • the T>G substitution does not affect the native EPSPS open reading frame and it does not change the EPSPS amino acid sequence.
  • the polynucleotide modification template (referred to as EPSPS polynucleotide maize Tspliced template) is listed as SEQ ID NO: 519.
  • This polynucleotide modification template allows for editing of the epsps locus to contain the canonical AGGT splice site at the 2 nd intron-3 rd exon junction site and the TIPS substitutions at positions 102 and 106.
  • Maize plants are edited using the procedures described herein.
  • F1 EPSPS-Tspliced maize plants can be evaluated for increased protein content due to the enhanced production of functional EPSPS mRNA messages.
  • RAP2.7 is an acronym for Related to APETALA 2.7.
  • RAPL means RAP2.7 LIKE and RAP2.7 functions as an AP2-family transcription factor that suppresses floral transition (SEQ ID NOs:520 and 521).
  • Transgenic phenotype upon silencing or knock-down of Rap2.7 resulted in early flowering, reduced plant height, but surprisingly developed normal ear and tassel as compared the wild-type plants (PCT/US14/26279 application, filed Mar. 13, 2014).
  • the guide RNA/Cas endonuclease system described herein can be used to target and induce a double strand break at a Cas endonuclease target site located within the RAP2.7 gene. Plants comprising NHEJ within the RAP2.7 gene can be selected and evaluated for the presence of a shortened maturity phenotype.
  • Nicotiana Protein Kinase1 is a mitogen activated protein kinase kinase kinase that is involved in cytokinesis regulation and oxidative stress signal transduction.
  • the ZM-NPK1B (SEQ ID NO: 522 and SEQ ID NO: 523) which has about 70% amino acid similarity to rice NPKL3 has been tested for frost tolerance in maize seedlings and reproductive stages (PCT/US14/26279 application, filed Mar. 13, 2014).
  • Transgenic seedlings and plants comprising a ZM-NPK1B driven by an inducible promoter Rab17 had significantly higher frost tolerance than control seedlings and control plants. The gene seemed inducted after cold acclimation and during ⁇ 3° C. treatment period in most of the events but at low levels. (PCT/US14/26279 application, filed Mar. 13, 2014).
  • a guide RNA/Cas endonuclease system described herein can be used to replace the endogenous promoter of NPK1 gene, with a stress-inducible promoter such as the maize RAB17 promoter stages (SEQ ID NO: 524; PCT/US14/26279 application, filed Mar. 13, 2014), thus modulate NPK1B expression in a stress-responsive manner and provide frost tolerance to the modulated maize plants.
  • a stress-inducible promoter such as the maize RAB17 promoter stages (SEQ ID NO: 524; PCT/US14/26279 application, filed Mar. 13, 2014
  • FTM1 stands for Floral Transition MADS 1 transcription factor (SEQ ID NOs: 525 and 526). It is a MADS Box transcriptional factor and induces floral transition. Upon expression of FTM1 under a constitutive promoter, transgenic plants exhibited early flowering and shortened maturity, but surprisingly ear and tassel developed normally as compared to the wild-type plants (PCT/US14/26279 application, filed Mar. 13, 2014).
  • FTM1-expressing maize plants demonstrated that by manipulating a floral transition gene, time to flowering can be reduced significantly, leading to a shortened maturity for the plant. As maturity can be generally described as time from seeding to harvest, a shorter maturity is desired for ensuring that a crop can finish in the northern continental dry climatic environment (PCT/US14/26279 application, filed Mar. 13, 2014).
  • a guide RNA/Cas endonuclease system described herein can be used to introduce enhancer elements such as the CaMV35S enhancers (Benfey et al, EMBO J, August 1989; 8(8): 2195-2202, SEQ ID NO:512), specifically targeted in front of the endogenous promoter of FTM1, in order to enhance the expression of FTM1 while preserving most of the tissue and temporal specificities of native expression, providing shortened maturity to the modulated plants.
  • enhancer elements such as the CaMV35S enhancers (Benfey et al, EMBO J, August 1989; 8(8): 2195-2202, SEQ ID NO:512)
  • Inducible expression systems controlled by an external stimulus are desirable for functional analysis of cellular proteins as well as trait development as changes in the expression level of the gene of interest can lead to an accompanying phenotype modification. Ideally such a system would not only mediate an “on/off” status for gene expression but would also permit limited expression of a gene at a defined level.
  • the guide RNA/Cas endonuclease system described herein can be used to introduce components of repressor/operator/inducer systems to regulate gene expression of an organism.
  • Repressor/operator/inducer systems and their components are well known I the art (US 2003/0186281 published Oct. 2, 2003; U.S. Pat. No. 6,271,348).
  • nut not limited to, components of the tetracycline (Tc) resistance system of E. coli have been found to function in eukaryotic cells and have been used to regulate gene expression (U.S. Pat. No. 6,271,348).
  • Nucleotide sequences of tet operators of different classes are known in the art see for example: classA, classB, classC, classD, classE TET operator sequences lists as SEQ ID NOs:11-15 of U.S. Pat. No. 6,271,348.
  • Components of a sulfonylurea-responsive repressor system can also be introduced into plant genomes to generate a epressor/operator/inducer systems into said plant where polypeptides can specifically bind to an operator, wherein the specific binding is regulated by a sulfonylurea compound.
  • QTL quantitative trait loci
  • a QTL or haplotype that is associated with suppression of kernel-row number in the maize ear can be found to be endemic in elite breeding germplasm.
  • the negative effect of this QTL for kernel row number can be fine-mapped to an acceptable resolution to desire selective elimination of this negative QTL segment within specific recipient germplasm.
  • Two flanking cut sites for the guide polynucleotide/Cas endonuclease system are designed via haplotype, marker, and/or DNA sequence context at the targeted QTL region, and the two guide polynucleotide/Cas endonuclease systems are deployed simultaneously or sequentially to produce the desired end product of two independent double strand breaks (cuts) that liberate the intervening region from the chromosome.
  • Individuals harboring the desired deletion event would result by the NHEJ repair of the two chromosomal ends and eliminating the intervening DNA region.
  • Assays to identify these individuals is based on the presence of flanking DNA marker regions, but absence of intervening DNA markers.
  • a proprietary haplotype for kernel-row-number is created that is not extant in the previously defined elite breeding germplasm pool.
  • ACC (1-aminocyclopropane-1-carboxylic acid) synthase (ACS) genes encode enzymes that catalyze the rate limiting step in ethylene biosynthesis.
  • a construct containing one of the maize ACS genes, ZM-ACS6, in an inverted repeat configuration, has been extensively tested for improved abiotic stress tolerance in maize (PCT/US2010/051358, filed Oct. 4, 2010; PCT/US2010/031008, filed Apr. 14, 2010).
  • the guide RNA/Cas endonuclease system can be used in combination with a co-delivered polynucleotide sequence to insert an inverted ZM-ACS6 gene fragment into the genome of maize, wherein the insertion of the inverted gene fragment allows for the in-vivo creation of an inverted repeat (hairpin) and results in the silencing of the endogenous ethylene biosynthesis gene.
  • the insertion of the inverted gene fragment can result in the formation of an in-vivo created inverted repeat (hairpin) in a native (or modified) promoter of an ACS6 gene and/or in a native 5′ end of the native ACS6 gene.
  • the inverted gene fragment can further comprise an intron which can result in an enhanced silencing of the targeted ethylene biosynthetic gene.
  • This example demonstrates the high efficiency of the guide RNA/Cas endonuclease system in generating maize plants with multiple mutagenized loci and their inheritance in the consecutive generation(s).
  • MS26Cas-2 target site SEQ ID NO: 14
  • LIGCas-3 target site SEQ ID NO: 18
  • MS45Cas-2 target site SEQ ID NO: 20.
  • T0 plants were crossed with wild type maize plants to produce T1 seeds.
  • T1 progeny plants 32 plants of the second T0 plant from the triplex experiment (see Table 43, Lig34/MS26/MS45) were analyzed by sequencing to evaluate segregation frequencies of the mutated alleles.
  • Our results demonstrated proper inheritance and expected (1:1) segregation of the mutated alleles as well as between mutated and wild type alleles at all three target sites.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Environmental Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Physiology (AREA)
  • Immunology (AREA)
  • Insects & Arthropods (AREA)
  • Pest Control & Pesticides (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
US14/463,687 2013-08-22 2014-08-20 Plant genome modification using guide rna/cas endonuclease systems and methods of use Abandoned US20150082478A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US14/463,687 US20150082478A1 (en) 2013-08-22 2014-08-20 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US16/130,295 US20190040405A1 (en) 2013-08-22 2018-09-13 Plant genome modification using guide rna/cas endonuclease systems and methods of use

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201361868706P 2013-08-22 2013-08-22
US201361882532P 2013-09-25 2013-09-25
US201461937045P 2014-02-07 2014-02-07
US201461953090P 2014-03-14 2014-03-14
US201462023239P 2014-07-11 2014-07-11
US14/463,687 US20150082478A1 (en) 2013-08-22 2014-08-20 Plant genome modification using guide rna/cas endonuclease systems and methods of use

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/130,295 Continuation US20190040405A1 (en) 2013-08-22 2018-09-13 Plant genome modification using guide rna/cas endonuclease systems and methods of use

Publications (1)

Publication Number Publication Date
US20150082478A1 true US20150082478A1 (en) 2015-03-19

Family

ID=51493053

Family Applications (16)

Application Number Title Priority Date Filing Date
US14/913,614 Abandoned US20160208272A1 (en) 2013-08-22 2014-08-20 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US14/913,630 Active US10519457B2 (en) 2013-08-22 2014-08-20 Soybean U6 polymerase III promoter and methods of use
US14/913,607 Active US11773400B2 (en) 2013-08-22 2014-08-20 Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof
US14/463,687 Abandoned US20150082478A1 (en) 2013-08-22 2014-08-20 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US14/463,691 Abandoned US20150059010A1 (en) 2013-08-22 2014-08-20 Genome modification using guide polynucleotide/cas endonuclease systems and methods of use
US14/913,177 Abandoned US20160201072A1 (en) 2013-08-22 2014-08-20 Genome modification using guide polynucleotide/cas endonuclease systems and methods of use
US16/054,156 Pending US20180371479A1 (en) 2013-08-22 2018-08-03 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US16/130,295 Pending US20190040405A1 (en) 2013-08-22 2018-09-13 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US16/552,632 Active 2034-09-19 US11427830B2 (en) 2013-08-22 2019-08-27 U6 polymerase III promoter and methods of use
US16/674,698 Active US10870859B2 (en) 2013-08-22 2019-11-05 U6 polymerase III promoter and methods of use
US16/777,401 Abandoned US20200157554A1 (en) 2013-08-22 2020-01-30 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US17/677,494 Pending US20220177900A1 (en) 2013-08-22 2022-02-22 Genome modification using guide polynucleotide/cas endonuclease systems and methods of use
US18/055,614 Pending US20230323374A1 (en) 2013-08-22 2022-11-15 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US18/056,002 Pending US20230279413A1 (en) 2013-08-22 2022-11-16 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US18/056,372 Abandoned US20230235345A1 (en) 2013-08-22 2022-11-17 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US18/355,529 Pending US20240084318A1 (en) 2013-08-22 2023-07-20 Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof

Family Applications Before (3)

Application Number Title Priority Date Filing Date
US14/913,614 Abandoned US20160208272A1 (en) 2013-08-22 2014-08-20 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US14/913,630 Active US10519457B2 (en) 2013-08-22 2014-08-20 Soybean U6 polymerase III promoter and methods of use
US14/913,607 Active US11773400B2 (en) 2013-08-22 2014-08-20 Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof

Family Applications After (12)

Application Number Title Priority Date Filing Date
US14/463,691 Abandoned US20150059010A1 (en) 2013-08-22 2014-08-20 Genome modification using guide polynucleotide/cas endonuclease systems and methods of use
US14/913,177 Abandoned US20160201072A1 (en) 2013-08-22 2014-08-20 Genome modification using guide polynucleotide/cas endonuclease systems and methods of use
US16/054,156 Pending US20180371479A1 (en) 2013-08-22 2018-08-03 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US16/130,295 Pending US20190040405A1 (en) 2013-08-22 2018-09-13 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US16/552,632 Active 2034-09-19 US11427830B2 (en) 2013-08-22 2019-08-27 U6 polymerase III promoter and methods of use
US16/674,698 Active US10870859B2 (en) 2013-08-22 2019-11-05 U6 polymerase III promoter and methods of use
US16/777,401 Abandoned US20200157554A1 (en) 2013-08-22 2020-01-30 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US17/677,494 Pending US20220177900A1 (en) 2013-08-22 2022-02-22 Genome modification using guide polynucleotide/cas endonuclease systems and methods of use
US18/055,614 Pending US20230323374A1 (en) 2013-08-22 2022-11-15 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US18/056,002 Pending US20230279413A1 (en) 2013-08-22 2022-11-16 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US18/056,372 Abandoned US20230235345A1 (en) 2013-08-22 2022-11-17 Plant genome modification using guide rna/cas endonuclease systems and methods of use
US18/355,529 Pending US20240084318A1 (en) 2013-08-22 2023-07-20 Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof

Country Status (12)

Country Link
US (16) US20160208272A1 (fr)
EP (6) EP3036333B1 (fr)
CN (4) CN106133138A (fr)
AU (6) AU2014308900A1 (fr)
BR (3) BR112016003591A8 (fr)
CA (7) CA2922090C (fr)
DK (1) DK3036327T3 (fr)
ES (1) ES2729635T3 (fr)
HU (1) HUE044916T2 (fr)
LT (1) LT3036327T (fr)
MX (5) MX363842B (fr)
WO (4) WO2015026887A1 (fr)

Cited By (119)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016100309A1 (fr) 2014-12-16 2016-06-23 Pioneer Hi-Bred International, Inc. Rétablissement de la fertilité mâle dans le blé
WO2016126417A1 (fr) 2015-02-04 2016-08-11 Pioneer Hi Bred International Inc Nouveaux récepteurs de toxine btet procédés d'utilisation
WO2016186946A1 (fr) 2015-05-15 2016-11-24 Pioneer Hi-Bred International, Inc. Caractérisation rapide de systèmes d'endonucléases cas, séquences pam et éléments d'arn guide
WO2016210393A1 (fr) * 2015-06-26 2016-12-29 Pioneer Hi-Bred International, Inc. Éléments régulateurs de gos2 et leur utilisation
US9580727B1 (en) 2015-08-07 2017-02-28 Caribou Biosciences, Inc. Compositions and methods of engineered CRISPR-Cas9 systems using split-nexus Cas9-associated polynucleotides
WO2017066175A1 (fr) 2015-10-12 2017-04-20 E. I. Du Pont De Nemours And Company Matrices adn protégées pour modification génique et recombinaison homologue accrue dans les cellules et leurs procédés d'utilisation
US20170114351A1 (en) * 2014-06-12 2017-04-27 King Abdullah University Of Science And Technology TARGETED VIRAL-MEDIATED PLANT GENOME EDITING USING CRISPR /Cas9
WO2017070032A1 (fr) 2015-10-20 2017-04-27 Pioneer Hi-Bred International, Inc. Restauration de la fonction d'un produit génique non fonctionnel par l'intermédiaire de systèmes cas guidés et méthodes d'utilisation associées
WO2017079026A1 (fr) 2015-11-06 2017-05-11 E. I. Du Pont De Nemours And Company Génération de locus à traits complexes dans le soja et procédés d'utilisation
WO2017095698A1 (fr) 2015-11-30 2017-06-08 Pioneer Hi-Bred International, Inc. Éléments régulateurs de plantes et procédés d'utilisation associés
WO2017096237A1 (fr) * 2015-12-02 2017-06-08 Ceres, Inc. Procédés de modification génétique de plantes
US9677090B2 (en) 2015-10-23 2017-06-13 Caribou Biosciences, Inc. Engineered nucleic-acid targeting nucleic acids
WO2017100158A1 (fr) 2015-12-11 2017-06-15 Danisco Us Inc. Procédés et compositions pour modification de génome médiée par nucléase augmentée et effets hors-site cible réduits
WO2017123772A1 (fr) * 2016-01-12 2017-07-20 Regents Of The University Of Minnesota Plantes tolérant le glyphosate ayant une régulation du gène 5-énolpyruvylshikimate-3-phosphate synthase modifié
WO2017132239A1 (fr) 2016-01-26 2017-08-03 Pioneer Hi-Bred International, Inc. Maïs cireux
CN107066944A (zh) * 2017-03-06 2017-08-18 北京聚爱聊网络科技有限公司 一种手指指根的定位方法及装置
WO2017155714A1 (fr) 2016-03-11 2017-09-14 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas9 et procédés d'utilisation
WO2017155715A1 (fr) 2016-03-11 2017-09-14 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas9 et procédés d'utilisation
WO2017155717A1 (fr) 2016-03-11 2017-09-14 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas9 et procédés d'utilisation
US9816093B1 (en) 2016-12-06 2017-11-14 Caribou Biosciences, Inc. Engineered nucleic acid-targeting nucleic acids
WO2017207589A1 (fr) 2016-06-01 2017-12-07 Kws Saat Se Séquences d'acides nucléiques hybrides destinées à l'ingénierie génomique
WO2017218185A1 (fr) 2016-06-14 2017-12-21 Pioneer Hi-Bred International, Inc. Utilisation de l'endonucléase cpf1 pour modifier le génome des plantes
WO2017222773A1 (fr) 2016-06-20 2017-12-28 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas et méthodes d'utilisation
US9888673B2 (en) 2014-12-10 2018-02-13 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
WO2018047183A1 (fr) * 2016-09-11 2018-03-15 Yeda Research And Development Co. Ltd. Compositions et méthodes de régulation de l'expression génétique par mutagenèse ciblée
WO2018052919A1 (fr) * 2016-09-14 2018-03-22 Monsanto Technology Llc Méthodes et compositions d'édition génomique par induction d'haploïde
WO2018071362A1 (fr) 2016-10-13 2018-04-19 Pioneer Hi-Bred International, Inc. Génération de maïs résistant à l'helminthosporiose du nord
WO2018102131A1 (fr) 2016-11-29 2018-06-07 Pioneer Hi-Bred International, Inc. Terminateurs transcriptionnels pour l'expression génique dans des plantes
WO2018183878A1 (fr) 2017-03-31 2018-10-04 Pioneer Hi-Bred International, Inc. Éléments de modulation d'expression et leur utilisation
WO2018183607A1 (fr) 2017-03-30 2018-10-04 Pioneer Hi-Bred International, Inc. Procédés d'identification et de caractérisation de variations d'édition de gènes dans des acides nucléiques
WO2018197520A1 (fr) 2017-04-24 2018-11-01 Dupont Nutrition Biosciences Aps Procédés et compositions de protéines anti-crispr destinés à être utilisés dans des plantes
WO2018213547A1 (fr) * 2017-05-17 2018-11-22 Cold Spring Harbor Laboratory Compositions et méthodes de génération d'allèles faibles dans des plantes
WO2018220582A1 (fr) 2017-05-31 2018-12-06 Tropic Biosciences UK Limited Méthodes de sélection de cellules comprenant des événements d'édition de génome
WO2018220579A1 (fr) 2017-05-31 2018-12-06 Tropic Biosciences UK Limited Compositions et procédés permettant d'augmenter l'extractibilité de solides en provenance de grains de café
WO2018220581A1 (fr) 2017-05-31 2018-12-06 Tropic Biosciences UK Limited Compositions et procédés pour l'augmentation de la durée de conservation de la banane
WO2018224861A1 (fr) 2017-06-07 2018-12-13 International Rice Research Institute Augmentation de la production de semences hybrides par un taux de croisement plus élevé chez des plantes graminacées stériles cytoplasmiques et matériaux et procédés associés
US10166255B2 (en) 2015-07-31 2019-01-01 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
WO2018237197A3 (fr) * 2017-06-21 2019-01-31 Noble Research Institute, Llc Disruption génique sélective médiée par crispr dans des plantes
WO2018183050A3 (fr) * 2017-03-30 2019-05-02 Pioneer Hi-Bred International, Inc. Epsp synthases améliorées de végétaux et procédés d'utilisation
WO2019099191A1 (fr) * 2017-11-16 2019-05-23 Dow Agrosciences Llc Promoteur végétal pour l'expression transgénique
WO2019118463A1 (fr) 2017-12-15 2019-06-20 Danisco Us Inc Variants de cas9 et procédés d'utilisation
WO2019165199A1 (fr) * 2018-02-22 2019-08-29 Elsoms Developments Ltd Procédés et compositions liés à des lignées de maintenance
WO2019173125A1 (fr) 2018-03-09 2019-09-12 Pioneer Hi-Bred International, Inc. Compositions et procédés de modification d'acides gras du soja
EP3553178A1 (fr) 2015-03-27 2019-10-16 E. I. du Pont de Nemours and Company Promoteurs de petit gène d'arn nucléaire u6 de graines de soja et leur utilisation dans l'expression de constitutive de petits gènes dans des plantes
WO2019226984A2 (fr) 2018-05-25 2019-11-28 Pioneer Hi-Bred International, Inc. Systèmes et procédés de sélection améliorée par modulation de taux de recombinaison
US10513711B2 (en) 2014-08-13 2019-12-24 Dupont Us Holding, Llc Genetic targeting in non-conventional yeast using an RNA-guided endonuclease
US10519457B2 (en) 2013-08-22 2019-12-31 E I Du Pont De Nemours And Company Soybean U6 polymerase III promoter and methods of use
WO2020005667A1 (fr) 2018-06-29 2020-01-02 Pioneer Hi-Bred International, Inc. Gène nac édité chez les plantes
WO2020036747A1 (fr) 2018-08-13 2020-02-20 Pioneer Hi-Bred International, Inc. Nouveaux récepteurs de toxines insecticides et leur procédé d'utilisation
WO2020081173A1 (fr) 2018-10-16 2020-04-23 Pioneer Hi-Bred International, Inc. Cartographie fine résultant d'une édition du génome et identification de gène causal
WO2020092494A1 (fr) 2018-10-31 2020-05-07 Pioneer Hi-Bred International, Inc. Compositions et méthodes pour l'édition génétique médiée par ochrobactrum
US10767201B2 (en) 2015-09-10 2020-09-08 Yeda Research And Development Co. Ltd. CYP76AD1-beta clade polynucleotides, polypeptides, and uses thereof
EP3708665A1 (fr) 2015-12-18 2020-09-16 Danisco US Inc. Procédés et compositions pour l'expression de l'arn guide à base d'arn-t
WO2020183414A2 (fr) 2019-03-14 2020-09-17 Tropic Biosciences UK Limited Modification de la spécificité de molécules d'arn non codantes pour le silençage de l'expression génique dans des cellules eucaryotes
WO2020183419A1 (fr) 2019-03-14 2020-09-17 Tropic Biosciences UK Limited Introduction d'une activité de silençage sur des molécules d'arn dysfonctionnelles et modification de leur spécificité vis-à-vis d'un gène d'intérêt
WO2020185907A1 (fr) * 2019-03-11 2020-09-17 Colorado State University Research Foundation Plantes tolérantes aux herbicides et production et détection de celles-ci
WO2020183416A1 (fr) 2019-03-14 2020-09-17 Tropic Biosciences UK Limited Production d'arndb dans des cellules végétales pour la protection antiparasitaire via le silencage génique
WO2020206202A1 (fr) 2019-04-05 2020-10-08 Danisco Us Inc Procédés d'intégration d'une séquence d'adn donneur dans le génome de bacillus à l'aide de constructions d'adn recombinant linéaire et compositions associées
WO2020206197A1 (fr) 2019-04-05 2020-10-08 Danisco Us Inc Procédés d'intégration de polynucléotides dans le génome de bacillus à l'aide de constructions d'adn recombiné double circulaire et compositions correspondantes
WO2020264016A1 (fr) 2019-06-25 2020-12-30 Inari Agriculture, Inc. Édition améliorée du génome de réparation dépendant de l'homologie
US10912797B2 (en) 2016-10-18 2021-02-09 Intima Bioscience, Inc. Tumor infiltrating lymphocytes and methods of therapy
US10934536B2 (en) 2018-12-14 2021-03-02 Pioneer Hi-Bred International, Inc. CRISPR-CAS systems for genome editing
US20210095299A1 (en) * 2018-04-23 2021-04-01 Cas Center For Excellence In Molecular Plant Sciences Repeat-mediated plant site-specific recombination method
WO2021100034A1 (fr) 2019-11-19 2021-05-27 Protalix Ltd. Élimination de constructions à partir de cellules transformées
US11098325B2 (en) 2017-06-30 2021-08-24 Intima Bioscience, Inc. Adeno-associated viral vectors for gene therapy
WO2021183874A1 (fr) * 2020-03-13 2021-09-16 Pairwise Plants Services, Inc. Procédés d'introduction de variation dans des plantes et produits obtenus à partir desdits procédés
WO2021202061A2 (fr) 2020-04-02 2021-10-07 Pioneer Hi-Bred International, Inc. Nouveaux récepteurs de toxines insecticides et leur procédé d'utilisation
GB202112865D0 (en) 2021-09-09 2021-10-27 Tropic Biosciences Uk Ltd Resistance to black sigatoka disease in banana
GB202112866D0 (en) 2021-09-09 2021-10-27 Tropic Biosciences Uk Ltd Resistance to fusarium wilt in a banana
US11186843B2 (en) * 2014-02-27 2021-11-30 Monsanto Technology Llc Compositions and methods for site directed genomic modification
US20210371868A1 (en) * 2017-12-28 2021-12-02 Pioneer Overseas Corporation Flowering time-regulating gene cmp1 and related constructs and applications thereof
US11198885B1 (en) 2020-09-28 2021-12-14 Inari Agriculture Technology, Inc. Genetic regulatory element
WO2021252238A1 (fr) 2020-06-12 2021-12-16 Pioneer Hi-Bred International, Inc. Altération de la composition de graines dans des plantes
US11214811B1 (en) 2020-07-31 2022-01-04 Inari Agriculture Technology, Inc. INIR6 transgenic maize
US11220694B1 (en) 2018-01-29 2022-01-11 Inari Agriculture, Inc. Rice cells and rice plants
US11242534B1 (en) 2020-07-31 2022-02-08 Inari Agriculture Technology, Inc. INHT31 transgenic soybean
WO2022040134A1 (fr) 2020-08-18 2022-02-24 Pioneer Hi-Bred International, Inc. Gènes de résistance à de multiples maladies et empilements génomiques correspondants
WO2022038536A1 (fr) 2020-08-18 2022-02-24 International Rice Research Institute Procédés d'augmentation des taux de croisement de gramineae
WO2022074646A1 (fr) 2020-10-05 2022-04-14 Protalix Ltd. Cellules végétales inactivées de type dicer
US11326177B2 (en) 2020-07-31 2022-05-10 Inari Agriculture Technology, Inc. INIR12 transgenic maize
US11359210B2 (en) 2020-07-31 2022-06-14 Inari Agriculture Technology, Inc. INIR12 transgenic maize
US11369073B2 (en) 2020-07-31 2022-06-28 Inari Agriculture Technology, Inc. INIR12 transgenic maize
US11407995B1 (en) 2018-10-26 2022-08-09 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
US11434477B1 (en) 2018-11-02 2022-09-06 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
US11453885B1 (en) 2019-02-19 2022-09-27 Inari Agriculture Technology, Inc. Plant transformation
US11459551B1 (en) 2018-08-31 2022-10-04 Inari Agriculture Technology, Inc. Compositions, systems, and methods for genome editing
US11466271B2 (en) 2017-02-06 2022-10-11 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
US11518999B1 (en) 2018-11-09 2022-12-06 Inari Agriculture Technology, Inc. Plant transformation
WO2023275245A1 (fr) 2021-07-02 2023-01-05 Tropic Biosciences UK Limited Procédé d'édition de gènes de plant de banane
WO2023275255A1 (fr) 2021-07-02 2023-01-05 Tropic Biosciences UK Limited Retardement ou prévention du brunissement de bananes
US11555199B2 (en) 2017-09-19 2023-01-17 Tropic Biosciences UK Limited Modifying the specificity of plant non-coding RNA molecules for silencing gene expression
US11603536B2 (en) 2017-09-29 2023-03-14 Inari Agriculture Technology, Inc. Methods for efficient maize genome editing
US11624071B2 (en) 2017-01-28 2023-04-11 Inari Agriculture Technology, Inc. Method of creating a plurality of targeted insertions in a plant cell
US11634722B2 (en) 2018-01-22 2023-04-25 Inari Agriculture Technology, Inc. Plant gene editing systems, methods, and compositions
WO2023077118A1 (fr) 2021-11-01 2023-05-04 Flagship Pioneering Innovations Vii, Llc Polynucléotides pour modifier des organismes
WO2023102393A1 (fr) 2021-11-30 2023-06-08 Pioneer Hi-Bred International, Inc. Manipulation de génome chromosomique à grande échelle et à haute efficacité
US11692197B2 (en) 2019-05-06 2023-07-04 Inari Agriculture Technology, Inc. Delivery of biological molecules to plant cells
WO2023141540A2 (fr) 2022-01-20 2023-07-27 Flagship Pioneering Innovations Vii, Llc Polynucléotides pour modifier des organismes
US11746354B2 (en) 2019-07-19 2023-09-05 Inari Agriculture Technology, Inc. Homology dependent repair genome editing
US11753648B2 (en) 2020-07-31 2023-09-12 Inari Agriculture Technology, Inc. INIR6 transgenic maize
EP4256951A2 (fr) 2016-11-04 2023-10-11 Flagship Pioneering Innovations V. Inc. Nouvelles cellules végétales, plantes et graines
US11802288B1 (en) 2018-01-29 2023-10-31 Inari Agriculture Technology, Inc. Methods for efficient soybean genome editing
US11859219B1 (en) 2016-12-30 2024-01-02 Flagship Pioneering Innovations V, Inc. Methods of altering a target nucleotide sequence with an RNA-guided nuclease and a single guide RNA
EP4299733A1 (fr) 2022-06-30 2024-01-03 Inari Agriculture Technology, Inc. Compositions, systèmes et procédés pour l'édition de génomes
EP4299739A1 (fr) 2022-06-30 2024-01-03 Inari Agriculture Technology, Inc. Compositions, systèmes et procédés d'édition de génomes
WO2024005863A1 (fr) 2022-06-30 2024-01-04 Inari Agriculture Technology, Inc. Compositions, systèmes et procédés d'édition génomique
WO2024006802A1 (fr) 2022-06-30 2024-01-04 Pioneer Hi-Bred International, Inc. Procédés et systèmes à médiation par intelligence artificielle pour édition génomique
WO2024005864A1 (fr) 2022-06-30 2024-01-04 Inari Agriculture Technology, Inc. Compositions, systèmes et procédés d'édition génomique
US11866719B1 (en) 2018-06-04 2024-01-09 Inari Agriculture Technology, Inc. Heterologous integration of regulatory elements to alter gene expression in wheat cells and wheat plants
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
WO2024023578A1 (fr) 2022-07-28 2024-02-01 Institut Pasteur Hsc70-4 utilisé dans le silençage génique induit par l'hôte et induit par pulvérisation
WO2024036190A2 (fr) 2022-08-09 2024-02-15 Pioneer Hi-Bred International, Inc. Multiplexage de polynucléotides de guidage
US11926835B1 (en) 2018-01-29 2024-03-12 Inari Agriculture Technology, Inc. Methods for efficient tomato genome editing
US11976291B2 (en) 2020-09-28 2024-05-07 Inari Agriculture Technology, Inc. Genetically enhanced maize plants
WO2024118882A1 (fr) 2022-12-01 2024-06-06 Genencor International Bv Ingénierie génomique multiplex itérative dans les cellules microbiennes à l'aide d'un système de permutation de marqueurs de sélection
WO2024118881A1 (fr) 2022-12-01 2024-06-06 Genencor International Bv Ingénierie itérative du génome multiplex dans les cellules microbiennes à l'aide d'un système de marqueurs de sélection bidirectionnels
WO2024118876A1 (fr) 2022-12-01 2024-06-06 Genencor International Bv Ingénierie génomique multiplex itérative dans les cellules microbiennes à l'aide d'un système de marqueurs de sélection auto-exécutable recombiné
WO2024123786A1 (fr) 2022-12-06 2024-06-13 Pioneer Hi-Bred International, Inc. Procédés et compositions pour la co-administration d'adn-t exprimant de multiples polynucléotides guides dans des plantes
WO2024137918A1 (fr) 2022-12-21 2024-06-27 Donald Danforth Plant Science Center Peptides antimicrobiens et leurs modifications

Families Citing this family (167)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10030245B2 (en) 2011-03-23 2018-07-24 E I Du Pont De Nemours And Company Methods for producing a complex transgenic trait locus
EP3613852A3 (fr) 2011-07-22 2020-04-22 President and Fellows of Harvard College Évaluation et amélioration de la spécificité de clivage des nucléases
CA2877290A1 (fr) 2012-06-19 2013-12-27 Daniel F. Voytas Ciblage de gene dans des plantes a l'aide de virus a adn
CN110643600A (zh) 2012-10-23 2020-01-03 基因工具股份有限公司 用于切割靶dna的系统及其用途
CN111500630A (zh) 2013-04-16 2020-08-07 瑞泽恩制药公司 大鼠基因组的靶向修饰
JP2016521561A (ja) 2013-06-14 2016-07-25 セレクティス 植物における非トランスジェニックのゲノム編集のための方法
US20150044192A1 (en) 2013-08-09 2015-02-12 President And Fellows Of Harvard College Methods for identifying a target site of a cas9 nuclease
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
US9228207B2 (en) 2013-09-06 2016-01-05 President And Fellows Of Harvard College Switchable gRNAs comprising aptamers
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
WO2015066119A1 (fr) 2013-10-30 2015-05-07 North Carolina State University Compositions et méthodes liées à un système crispr-cas de type ii chez lactobacillus buchneri
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US9546384B2 (en) 2013-12-11 2017-01-17 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse genome
US9068179B1 (en) 2013-12-12 2015-06-30 President And Fellows Of Harvard College Methods for correcting presenilin point mutations
US10787654B2 (en) 2014-01-24 2020-09-29 North Carolina State University Methods and compositions for sequence guiding Cas9 targeting
CN106460003A (zh) 2014-04-08 2017-02-22 北卡罗来纳州立大学 用于使用crispr相关基因rna引导阻遏转录的方法和组合物
US10676754B2 (en) 2014-07-11 2020-06-09 E I Du Pont De Nemours And Company Compositions and methods for producing plants resistant to glyphosate herbicide
AU2015298571B2 (en) 2014-07-30 2020-09-03 President And Fellows Of Harvard College Cas9 proteins including ligand-dependent inteins
US10450584B2 (en) 2014-08-28 2019-10-22 North Carolina State University Cas9 proteins and guiding features for DNA targeting and genome editing
CN108064129A (zh) 2014-09-12 2018-05-22 纳幕尔杜邦公司 玉米和大豆中复合性状基因座的位点特异性整合位点的产生和使用方法
CN107406838A (zh) 2014-11-06 2017-11-28 纳幕尔杜邦公司 Rna引导的内切核酸酶向细胞中的肽介导的递送
PT3221457T (pt) 2014-11-21 2019-06-27 Regeneron Pharma Métodos e composições para modificação genética visada através da utilização de arn guia emparelhados
JP7068821B2 (ja) 2014-12-03 2022-05-17 アジレント・テクノロジーズ・インク 化学修飾を有するガイドｒｎａ
EP3234133B1 (fr) 2014-12-18 2020-11-11 Integrated DNA Technologies, Inc. Compositions à base de crispr et leurs procédés d'utilisation
US20180179523A1 (en) * 2014-12-18 2018-06-28 Integrated Dna Technologies, Inc. Crispr-based compositions and methods of use
DK3252162T3 (da) 2015-01-27 2023-06-06 Inst Genetics & Developmental Biology Cas Fremgangsmåde til foretagelse af stedsspecifik modifikation på hel plante via transient genekspression
HRP20231022T1 (hr) 2015-01-28 2023-12-08 Caribou Biosciences, Inc. Hibridni polinukleotidi crispr dna/rna i načini uporabe
SG11201706767RA (en) 2015-02-23 2017-09-28 Crispr Therapeutics Ag Materials and methods for treatment of hemoglobinopathies
CN107406858A (zh) * 2015-02-25 2017-11-28 先锋国际良种公司 用于指导rna/cas内切核酸酶复合物的调节型表达的组合物和方法
EP3270685B1 (fr) * 2015-03-19 2023-07-19 Pioneer Hi-Bred International, Inc. Procédés et compositions permettant d'accélérer l'introgression de caractères
AU2016246450B2 (en) 2015-04-06 2022-03-17 Agilent Technologies, Inc. Chemically modified guide RNAs for CRISPR/Cas-mediated gene regulation
EP3095870A1 (fr) 2015-05-19 2016-11-23 Kws Saat Se Procédés pour la transformation in planta de plantes et procédés de fabrication basés sur ceux-ci et produits pouvant être obtenus à partir de ceux-ci
DE102015006335A1 (de) 2015-05-19 2016-11-24 Kws Saat Se Verfahren und Konstrukte zur gezielten Nukleinsäure Editierung in Pflanzen
DE102015014252A1 (de) 2015-11-05 2017-05-11 Kws Saat Se Verfahren und Konstrukte zur gezielten Nukleinsäure Editierung in Pflanzen
JP2018516563A (ja) 2015-05-29 2018-06-28 ノース カロライナ ステート ユニバーシティＮｏｒｔｈ Ｃａｒｏｌｉｎａ Ｓｔａｔｅ Ｕｎｉｖｅｒｓｉｔｙ Ｃｒｉｓｐｒ核酸を用いて、細菌、古細菌、藻類、および、酵母をスクリーニングする方法
EP3303585A4 (fr) 2015-06-03 2018-10-31 Board of Regents of the University of Nebraska Traitement des données d'une séquence d'adn utilisant un adn monocaténaire
WO2016205276A1 (fr) 2015-06-15 2016-12-22 North Carolina State University Procédés et compositions permettant une délivrance efficace d'acides nucléiques et d'antimicrobiens à base d'arn
WO2017004279A2 (fr) * 2015-06-29 2017-01-05 Massachusetts Institute Of Technology Compositions comprenant des acides nucléiques et leurs méthodes d'utilisation
WO2017004261A1 (fr) * 2015-06-29 2017-01-05 Ionis Pharmaceuticals, Inc. Arn crispr modifié et arn crispr simple modifié et utilisations correspondantes
CA2994883A1 (fr) 2015-08-14 2017-02-23 Institute Of Genetics And Developmental Biology, Chinese Academy Of Scnces Procede pour obtenir du riz resistant au glyphosate par substitution de nucleotide dirigee
CA2992488A1 (fr) 2015-08-28 2017-03-09 Pioneer Hi-Bred International, Inc. Transformation de plantes mediee par ochrobactrum
WO2017053729A1 (fr) * 2015-09-25 2017-03-30 The Board Of Trustees Of The Leland Stanford Junior University Édition du génome à médiation par une nucléase de cellules primaires et leur enrichissement
WO2017058751A1 (fr) 2015-09-28 2017-04-06 North Carolina State University Méthodes et compositions pour agents antimicrobiens spécifiques d'une séquence
EP3356535A1 (fr) * 2015-09-30 2018-08-08 Pioneer Hi-Bred International, Inc. Epsp synthases végétales et procédés d'utilisation
CN108513583A (zh) * 2015-10-02 2018-09-07 孟山都技术公司 重组玉米b染色体序列及其用途
US11692182B2 (en) 2015-10-09 2023-07-04 Monsanto Technology Llc RNA-guided DNA nucleases and uses thereof
EA037614B1 (ru) 2015-10-16 2021-04-21 Пайонир Хай-Бред Интернэшнл, Инк. Получение растений маиса с повышенной устойчивостью к северной пятнистости листьев
EP3159407A1 (fr) * 2015-10-23 2017-04-26 Silence Therapeutics (London) Ltd Arn de guidage, procédés et utilisations
CN108513575A (zh) 2015-10-23 2018-09-07 哈佛大学的校长及成员们 核碱基编辑器及其用途
CN115806940A (zh) * 2015-11-04 2023-03-17 菲特治疗公司 多能细胞的基因组工程改造
CN106811479B (zh) * 2015-11-30 2019-10-25 中国农业科学院作物科学研究所 利用CRISPR/Cas9系统定点修饰ALS基因获得抗除草剂水稻的系统及其应用
EP3386550B1 (fr) * 2015-12-07 2021-01-20 Arc Bio, LLC Procédés pour la fabrication et l'utilisation d'acides nucléiques de guidage
JP6888906B2 (ja) * 2015-12-11 2021-06-18 株式会社豊田中央研究所 生物体のゲノムの改変方法及びその利用
US11761007B2 (en) * 2015-12-18 2023-09-19 The Scripps Research Institute Production of unnatural nucleotides using a CRISPR/Cas9 system
US11104911B2 (en) 2015-12-22 2021-08-31 Pioneer Hi-Bred International, Inc. Embryo-preferred Zea mays promoters and methods of use
WO2017112620A1 (fr) 2015-12-22 2017-06-29 North Carolina State University Méthodes et compositions pour l'administration d'agents antimicrobiens à base de crispr
US9856497B2 (en) 2016-01-11 2018-01-02 The Board Of Trustee Of The Leland Stanford Junior University Chimeric proteins and methods of regulating gene expression
KR20180095719A (ko) 2016-01-11 2018-08-27 더 보드 어브 트러스티스 어브 더 리랜드 스탠포드 주니어 유니버시티 키메라 단백질 및 면역요법 방법
WO2017138986A1 (fr) * 2016-02-09 2017-08-17 Cibus Us Llc Procédés et compositions permettant d'améliorer l'efficacité de modifications génétiques ciblées en utilisant la réparation de gène médiée par des oligonucléotides
CN107312821A (zh) * 2016-04-25 2017-11-03 中国检验检疫科学研究院 用于转基因大米m12品系特异性基因成分精准定量检测的引物探针、试剂盒及方法
JP2019521659A (ja) 2016-05-27 2019-08-08 アーディジェン， エルエルシー ゲノム編集分子の細胞内送達のためのペプチドおよびナノ粒子
US10767175B2 (en) * 2016-06-08 2020-09-08 Agilent Technologies, Inc. High specificity genome editing using chemically modified guide RNAs
CA3029271A1 (fr) * 2016-06-28 2018-01-04 Cellectis Modification de l'expression de produits geniques dans des plantes par insertion ciblee de sequences d'acides nucleiques
WO2018027078A1 (fr) 2016-08-03 2018-02-08 President And Fellows Of Harard College Éditeurs de nucléobases d'adénosine et utilisations associées
CA3033327A1 (fr) 2016-08-09 2018-02-15 President And Fellows Of Harvard College Proteines de fusion cas9-recombinase programmables et utilisations associees
WO2018039438A1 (fr) 2016-08-24 2018-03-01 President And Fellows Of Harvard College Incorporation d'acides aminés non naturels dans des protéines au moyen de l'édition de bases
CN106350536B (zh) * 2016-08-28 2021-02-12 浙江大学 一种植物杂交体系及其应用
US20190225974A1 (en) 2016-09-23 2019-07-25 BASF Agricultural Solutions Seed US LLC Targeted genome optimization in plants
US11242542B2 (en) 2016-10-07 2022-02-08 Integrated Dna Technologies, Inc. S. pyogenes Cas9 mutant genes and polypeptides encoded by same
WO2018068053A2 (fr) 2016-10-07 2018-04-12 Integrated Dna Technologies, Inc. Gènes mutants cas9 de s. pyogenes et polypeptides codés par de tels gènes
KR20240007715A (ko) 2016-10-14 2024-01-16 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 핵염기 에디터의 aav 전달
WO2018081728A1 (fr) * 2016-10-31 2018-05-03 Emendobio Inc. Compositions pour l'édition du génome
BR112019002455A2 (pt) * 2016-11-14 2019-06-25 Inst Genetics & Developmental Biology Cas método para edição de base em plantas
EP3545085A4 (fr) 2016-11-22 2020-10-28 Integrated Dna Technologies, Inc. Systèmes crispr/cpf1 et méthodes
WO2018103686A1 (fr) * 2016-12-07 2018-06-14 中国科学院上海生命科学研究院 Procédé d'édition de génome de chloroplaste
CN110291198A (zh) * 2016-12-08 2019-09-27 因特利亚治疗公司 经修饰的指导rna
EP3550958A4 (fr) * 2016-12-08 2020-10-07 Syngenta Participations AG Procédés d'amélioration de la fréquence de transformation
US11293022B2 (en) 2016-12-12 2022-04-05 Integrated Dna Technologies, Inc. Genome editing enhancement
KR102551664B1 (ko) * 2016-12-22 2023-07-05 인텔리아 테라퓨틱스, 인크. 알파-1 항트립신 결핍을 치료하기 위한 조성물 및 방법
WO2018119225A1 (fr) * 2016-12-22 2018-06-28 Monsanto Technology Llc Génie génétique de cultures basé sur l'édition génique et production de plantes brachytiques
KR102117110B1 (ko) * 2016-12-22 2020-05-29 주식회사 툴젠 Fad2 유전자 조작된 올레인산 강화 식물체 및 이의 제조 방법
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
CN106834341B (zh) * 2016-12-30 2020-06-16 中国农业大学 一种基因定点突变载体及其构建方法和应用
EP3568484A1 (fr) * 2017-01-11 2019-11-20 Yeda Research and Development Co. Ltd Recombinaison ciblée entre des chromosomes homologues et ses utilisations
WO2018160485A1 (fr) 2017-03-03 2018-09-07 Pioneer Hi-Bred International, Inc. Dosage non destructif de graines de soja à l'aide d'une analyse dans le proche infrarouge
EP3592853A1 (fr) 2017-03-09 2020-01-15 President and Fellows of Harvard College Suppression de la douleur par édition de gène
JP2020510439A (ja) 2017-03-10 2020-04-09 プレジデント アンド フェローズ オブ ハーバード カレッジ シトシンからグアニンへの塩基編集因子
SG11201908658TA (en) 2017-03-23 2019-10-30 Harvard College Nucleobase editors comprising nucleic acid programmable dna binding proteins
US20200407737A1 (en) 2017-05-03 2020-12-31 KWS SAAT SE & Co. KGaA Use of crispr-cas endonucleases for plant genome engineering
KR20200004382A (ko) * 2017-05-05 2020-01-13 인스티튜트 오브 제네틱스 앤드 디벨롭멘털 바이오롤지, 차이니즈 아카데미 오브 사이언시스 전이유전자성 마커 서열을 이용하지 않는 세포 단리 방법
EP3622061A4 (fr) * 2017-05-11 2021-01-27 Institute Of Genetics And Developmental Biology Chinese Academy of Sciences Création d'un gène résistant aux herbicides et utilisation de celui-ci
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
WO2018237372A1 (fr) 2017-06-23 2018-12-27 Cornell University Molécules d'arn, procédés de production d'arn circulaire, et procédés de traitement
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
CN111263810A (zh) 2017-08-22 2020-06-09 纳匹基因公司 使用多核苷酸指导的核酸内切酶的细胞器基因组修饰
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
WO2019055141A1 (fr) * 2017-09-14 2019-03-21 Pioneer Hi-Bred International, Inc. Compositions et procédés destinés à modifier la taille des plantes
US20200270632A1 (en) * 2017-09-15 2020-08-27 The Board Of Trustees Of The Leland Stanford Junior University Multiplex production and barcoding of genetically engineered cells
CA3072614A1 (fr) * 2017-09-18 2019-03-21 Futuragene Israel Ltd. Controle d'expression specifique au tissu de polypeptides della
CN111373046A (zh) 2017-09-25 2020-07-03 先锋国际良种公司 组织偏好性启动子和使用方法
CN111465321B (zh) 2017-10-13 2022-12-06 先锋国际良种公司 用于植物细胞的细胞重编程的系统和方法
CN111757937A (zh) 2017-10-16 2020-10-09 布罗德研究所股份有限公司 腺苷碱基编辑器的用途
WO2019084306A1 (fr) * 2017-10-26 2019-05-02 University Of Florida Research Foundation, Inc. Procédé pour réduire la complexité génomique et détecter les polymorphismes
CN111684069A (zh) * 2017-12-22 2020-09-18 G+Flas生命科学有限公司 嵌合基因组工程分子和方法
CN111683971A (zh) 2017-12-23 2020-09-18 宇越生医科技股份有限公司 医药重组受体组成物及方法
WO2019133371A1 (fr) 2017-12-27 2019-07-04 Pioneer Hi-Bred International, Inc. Transformation de plantes dicotylédones
CN111527638A (zh) * 2017-12-28 2020-08-11 日立造船株式会社 全固态电池及其制造方法和加工装置
US11268077B2 (en) 2018-02-05 2022-03-08 Vertex Pharmaceuticals Incorporated Materials and methods for treatment of hemoglobinopathies
MA51787A (fr) 2018-02-05 2020-12-16 Vertex Pharma Substances et méthodes de traitement d'hémoglobinopathies
EP3752647B1 (fr) * 2018-02-15 2022-05-25 The Broad Institute, Inc. Enregistreurs de données cellulaires et leurs utilisations
US20210062203A1 (en) * 2018-03-12 2021-03-04 Pioneer Hi-Bred International, Inc. Methods for plant transformation
CN111902547B (zh) 2018-03-23 2024-06-14 先锋国际良种公司 鉴定、选择和产生疾病抗性作物的方法
WO2019205919A1 (fr) * 2018-04-28 2019-10-31 青岛清原化合物有限公司 Procédé de construction pour bibliothèque de mutants biologiques
US20210238614A1 (en) * 2018-05-07 2021-08-05 Pioneer Hi-Bred International, Inc. Methods and compositions for homology directed repair of double strand breaks in plant cell genomes
WO2019213910A1 (fr) * 2018-05-10 2019-11-14 Syngenta Participations Ag Procédés et compositions pour l'édition ciblée de polynucléotides
EP3794130A4 (fr) 2018-05-16 2022-07-27 Synthego Corporation Méthodes et systèmes de conception et d'utilisation d'arn guide
CN108642077A (zh) * 2018-05-18 2018-10-12 江苏省农业科学院 基于CRISPR/Cas9基因编辑技术选育绿豆不育突变体的方法及专用gRNA
WO2019226553A1 (fr) * 2018-05-21 2019-11-28 Pioneer Hi-Bred International, Inc. Modification de la glutamine synthétase pour améliorer le rendement des plantes
EP3575402A1 (fr) * 2018-06-01 2019-12-04 Algentech SAS Ciblage de gènes
WO2020006112A1 (fr) 2018-06-26 2020-01-02 Regents Of The University Of Minnesota Administration de régulateurs de développement à des plantes pour l'induction de tissu méristématique avec des altérations génétiques
US20210277409A1 (en) 2018-06-28 2021-09-09 Pioneer Hi-Bred International, Inc. Methods for selecting transformed plants
EP4070802A1 (fr) * 2018-06-30 2022-10-12 Inscripta, Inc. Instruments, modules et procédés de détection améliorée de séquences éditées dans des cellules vivantes
WO2020081149A2 (fr) * 2018-08-30 2020-04-23 Inscripta, Inc. Détection améliorée de séquences à édition par nucléase dans des modules automatisés et des instruments
CN109136258A (zh) * 2018-09-06 2019-01-04 先正达参股股份有限公司 小麦中基因编辑效率的优化
BR112021005115A2 (pt) * 2018-09-20 2021-06-15 Sanofi métodos e composições de clonagem universal baseada em íntron
EP3861120A4 (fr) 2018-10-01 2023-08-16 North Carolina State University Système crispr-cas de type i recombinant
EP3860332A4 (fr) * 2018-10-02 2022-07-13 Monsanto Technology LLC Compositions et procédés de transfert de biomolécules à des cellules blessées
CA3111090A1 (fr) 2018-10-31 2020-05-07 Pioneer Hi-Bred International, Inc. Compositions et procedes de transformation de plante mediee par ochrobactrum
WO2020089448A1 (fr) * 2018-11-01 2020-05-07 Keygene N.V. Arn guide double pour édition de génome crispr/cas dans des cellules végétales
JP2022511508A (ja) * 2018-12-04 2022-01-31 シンジェンタ クロップ プロテクション アクチェンゲゼルシャフト ゲノム編集による遺伝子サイレンシング
WO2020122195A1 (fr) * 2018-12-12 2020-06-18 国立大学法人九州大学 Procédé de production de cellules à modification génomique
DE112020001342T5 (de) 2019-03-19 2022-01-13 President and Fellows of Harvard College Verfahren und Zusammensetzungen zum Editing von Nukleotidsequenzen
CA3128376A1 (fr) 2019-03-27 2020-10-01 Pioneer Hi-Bred International, Inc. Transformation d'explant de plante
PE20212082A1 (es) * 2019-04-24 2021-10-28 Univ Oregon Health & Science Secuencia promotora y productos y usos relacionados de la misma
CN110241121B (zh) * 2019-05-21 2022-03-29 南京农业大学 大豆E3泛素连接酶GmNLA1编码基因的应用
JP2022537722A (ja) * 2019-06-19 2022-08-29 ベターシーズ リミテッド 遺伝子編集を介してカンナビス（Ｃａｎｎａｂｉｓ：大麻）の収量を増加させるための方法
US20210047651A1 (en) * 2019-07-12 2021-02-18 The Regents Of The University Of California Compositions and methods for targeted insertion of selectable marker-free dna sequence in plants
CN110358767B (zh) * 2019-07-30 2021-06-08 湖北大学 一种基于CRISPR-Cas12a系统的运动发酵单胞菌基因组编辑方法及其应用
CN115244176A (zh) * 2019-08-19 2022-10-25 钟明宏 向导rna-cas蛋白复合物的缀合物
EP3798301A1 (fr) * 2019-09-25 2021-03-31 KWS SAAT SE & Co. KGaA Répression de promoteur
JP2023505600A (ja) 2019-11-05 2023-02-09 ペアーワイズ プランツ サービシズ， インコーポレイテッド 対立遺伝子のｒｎａにコードされたｄｎａの置換のための組成物および方法
CN112779266A (zh) * 2019-11-06 2021-05-11 青岛清原化合物有限公司 在生物体内创制新基因的方法及应用
CN114746555A (zh) * 2019-11-25 2022-07-12 先正达农作物保护股份公司 大豆属调节元件及其用途
CA3159799A1 (fr) * 2019-12-02 2021-06-10 Prashant MALI Ingenierie d'arn guides circulaires
CN111057713A (zh) * 2019-12-18 2020-04-24 广东省微生物研究所（广东省微生物分析检测中心） 一种适用于埃德菌FS110的CRISPR/Cas9载体及其构建方法和应用
US20230059309A1 (en) * 2020-01-09 2023-02-23 Pioneer Hi-Bred International, Inc. Two-step gene swap
US20210222183A1 (en) * 2020-01-22 2021-07-22 Pioneer Hi-Bred International, Inc. Dominant crispr inverted-repeat alleles to down-regulate gene expression in heterozygous plants
WO2021162970A1 (fr) * 2020-02-12 2021-08-19 Pioneer Hi-Bred International, Inc. Réparation dirigée par homologie médiée par cas dans un tissu végétal somatique
WO2021173528A1 (fr) 2020-02-28 2021-09-02 Pioneer Hi-Bred International, Inc. Système de production d'haploïde doublé de sorgho
BR112022019960A2 (pt) * 2020-03-30 2022-12-13 Inari Agriculture Tech Inc Método de modificação de um gene endógeno, método de modificação da expressão de um gene endógeno, célula vegetal, planta de soja, parte da planta, tecido ou tecido do calo, método para obter a célula vegetal, polinucleotídeo isolado, ácido nucleico recombinante
BR112022020714A2 (pt) 2020-04-15 2022-12-20 Pioneer Hi Bred Int Identificação de gene efetor de patógeno vegetal e de resistência à doença, composições e métodos de uso
EP4146804A1 (fr) 2020-05-08 2023-03-15 The Broad Institute Inc. Méthodes et compositions d'édition simultanée des deux brins d'une séquence nucléotidique double brin cible
KR20230010678A (ko) * 2020-05-13 2023-01-19 넌헴스 비.브이. 표적화된 돌연변이유발에 의해 돌연변이체 식물을 수득하는 방법
MX2022015156A (es) * 2020-06-03 2023-01-11 Pioneer Hi Bred Int Evento de maiz dp-915635-4 y metodos para la deteccion del mismo.
CN111778274A (zh) * 2020-06-09 2020-10-16 新疆生产建设兵团第六师农业科学研究所 一种通过基因编辑提高番茄耐贮藏性的方法
WO2022031720A1 (fr) * 2020-08-03 2022-02-10 Arcadia Biosciences, Inc. Constructions d'adn contenant des promoteurs d'arn polymérase iii provenant du cannabis, et leurs méthodes d'utilisation
JP2023541418A (ja) * 2020-09-10 2023-10-02 モンサント テクノロジー エルエルシー 減数分裂及び生殖系列プロモーターを使用する遺伝子編集及び部位特異的組込み事象の増加
KR102579767B1 (ko) * 2020-09-21 2023-09-18 서울대학교산학협력단 eIF4E1 유전자 교정에 의해 포티바이러스 저항성이 증가된 유전체 교정 토마토 식물체의 제조방법 및 상기 방법에 의해 제조된 포티바이러스 저항성이 증가된 유전체 교정 토마토 식물체
CN112481259B (zh) * 2020-11-24 2022-09-16 南昌大学 两种甘薯U6基因启动子IbU6的克隆与应用
EP4258858A1 (fr) * 2020-12-11 2023-10-18 Celanese International Corporation Mousse formée à partir d'une composition d'ester de cellulose
WO2023039586A1 (fr) 2021-09-10 2023-03-16 Agilent Technologies, Inc. Arn guides avec modification chimique pour l'édition primaire
WO2023172875A1 (fr) * 2022-03-07 2023-09-14 Inedita Bio, Inc. Procédés et compositions pour l'expression médiée par intron d'éléments régulateurs pour le développement de caractères
CN114836446B (zh) * 2022-04-26 2023-12-19 上海交通大学 一种抗草甘膦的植物及其制法
WO2024020360A1 (fr) 2022-07-18 2024-01-25 Pairwise Plants Services, Inc. Plantes vertes de moutarde nommées 'pwrg-1', 'pwrg-2,' et 'pwsgc'
WO2024026232A1 (fr) * 2022-07-27 2024-02-01 Pioneer Hi-Bred International, Inc Édition de génome piégée par arn guide
CN115762641B (zh) * 2023-01-10 2023-04-07 天津极智基因科技有限公司 一种指纹图谱构建方法及系统

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5959177A (en) * 1989-10-27 1999-09-28 The Scripps Research Institute Transgenic plants expressing assembled secretory antibodies
US20040231016A1 (en) * 2003-02-19 2004-11-18 Commonwealth Scientific And Industrial Research Organization Efficient gene silencing in plants using short dsRNA sequences
US20070199095A1 (en) * 2005-10-13 2007-08-23 Edwards Allen Methods for producing hybrid seed
US7262055B2 (en) * 1998-08-25 2007-08-28 Gendaq Limited Regulated gene expression in plants
US8697359B1 (en) * 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products

Family Cites Families (201)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US1230061A (en) 1916-02-25 1917-06-12 Joseph A Blanchette Oil-can.
US5380831A (en) 1986-04-04 1995-01-10 Mycogen Plant Science, Inc. Synthetic insecticidal crystal protein gene
US5036006A (en) 1984-11-13 1991-07-30 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US5569597A (en) 1985-05-13 1996-10-29 Ciba Geigy Corp. Methods of inserting viral DNA into plant material
US5107065A (en) 1986-03-28 1992-04-21 Calgene, Inc. Anti-sense regulation of gene expression in plant cells
US5268463A (en) 1986-11-11 1993-12-07 Jefferson Richard A Plant promoter α-glucuronidase gene construct
US5608142A (en) 1986-12-03 1997-03-04 Agracetus, Inc. Insecticidal cotton plants
US5196525A (en) 1987-01-13 1993-03-23 University Of British Columbia DNA construct for enhancing the efficiency of transcription
US4873192A (en) 1987-02-17 1989-10-10 The United States Of America As Represented By The Department Of Health And Human Services Process for site specific mutagenesis without phenotypic selection
US5316931A (en) 1988-02-26 1994-05-31 Biosource Genetics Corp. Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes
US5990387A (en) 1988-06-10 1999-11-23 Pioneer Hi-Bred International, Inc. Stable transformation of plant cells
US5023179A (en) 1988-11-14 1991-06-11 Eric Lam Promoter enhancer element for gene expression in plant roots
US5110732A (en) 1989-03-14 1992-05-05 The Rockefeller University Selective gene expression in plants
US5034323A (en) 1989-03-30 1991-07-23 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
US5231020A (en) 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
US5879918A (en) 1989-05-12 1999-03-09 Pioneer Hi-Bred International, Inc. Pretreatment of microprojectiles prior to using in a particle gun
US5240855A (en) 1989-05-12 1993-08-31 Pioneer Hi-Bred International, Inc. Particle gun
US5310667A (en) 1989-07-17 1994-05-10 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases
US5322783A (en) 1989-10-17 1994-06-21 Pioneer Hi-Bred International, Inc. Soybean transformation by microparticle bombardment
US5641876A (en) 1990-01-05 1997-06-24 Cornell Research Foundation, Inc. Rice actin gene and promoter
EP0452269B1 (fr) 1990-04-12 2002-10-09 Syngenta Participations AG Promoteurs à préférence tissulaire
CA2079877C (fr) 1990-04-26 2001-07-31 Marnix Peferoen Souches de bacillus thuringiensis possedant des genes codant pour la production de toxines insecticides
US5478369A (en) 1990-06-12 1995-12-26 Pioneer Hi-Bred International, Inc. Nucleotide sequences mediating male fertility and method of using same
US5498830A (en) 1990-06-18 1996-03-12 Monsanto Company Decreased oil content in plant seeds
US5633435A (en) 1990-08-31 1997-05-27 Monsanto Company Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
US5866775A (en) 1990-09-28 1999-02-02 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases
US5932782A (en) 1990-11-14 1999-08-03 Pioneer Hi-Bred International, Inc. Plant transformation method using agrobacterium species adhered to microprojectiles
US5277905A (en) 1991-01-16 1994-01-11 Mycogen Corporation Coleopteran-active bacillus thuringiensis isolate
US5459252A (en) 1991-01-31 1995-10-17 North Carolina State University Root specific gene promoter
US5399680A (en) 1991-05-22 1995-03-21 The Salk Institute For Biological Studies Rice chitinase promoter
GB9114259D0 (en) 1991-07-02 1991-08-21 Ici Plc Plant derived enzyme and dna sequences
ES2124738T3 (es) 1991-08-02 1999-02-16 Mycogen Corp Nuevo microorganismo e insecticida.
HU219057B (hu) 1991-08-27 2001-02-28 Novartis Ag. Inszekticid hatású proteinek Homoptera rovarok ellen és alkalmazásuk a növényvédelemben
JPH06511152A (ja) 1991-10-04 1994-12-15 ノースカロライナ　ステイト　ユニバーシティー 病原体耐性トランスジェニック植物
TW261517B (fr) 1991-11-29 1995-11-01 Mitsubishi Shozi Kk
AU675923B2 (en) 1991-12-04 1997-02-27 E.I. Du Pont De Nemours And Company Fatty acid desaturase genes from plants
US5324646A (en) 1992-01-06 1994-06-28 Pioneer Hi-Bred International, Inc. Methods of regeneration of Medicago sativa and expressing foreign DNA in same
US5792632A (en) 1992-05-05 1998-08-11 Institut Pasteur Nucleotide sequence encoding the enzyme I-SceI and the uses thereof
US5474896A (en) 1992-05-05 1995-12-12 Institut Pasteur Nucleotide sequence encoding the enzyme I-SceI and the uses thereof
US5401836A (en) 1992-07-16 1995-03-28 Pioneer Hi-Bre International, Inc. Brassica regulatory sequence for root-specific or root-abundant gene expression
EP0652965A1 (fr) 1992-07-27 1995-05-17 Pioneer Hi-Bred International, Inc. Procede ameliore de transformation induite par agrobacterium de cellules de soja cultivees
WO1994011516A1 (fr) 1992-11-17 1994-05-26 E.I. Du Pont De Nemours And Company Genes pour des desaturases d'acides gras en position delta-12 microsomales et enzymes apparentees provenant de plantes
CA2127807A1 (fr) 1992-11-20 1994-06-09 John Maliyakal Plants de coton transgeniques produisant un bioplastique heterologue
IL108241A (en) 1992-12-30 2000-08-13 Biosource Genetics Corp Plant expression system comprising a defective tobamovirus replicon integrated into the plant chromosome and a helper virus
DE69428290T2 (de) 1993-01-13 2002-04-18 Pioneer Hi Bred Int Derivate von alpha-hordothionin mit höherem behalt an lysin
US5527695A (en) 1993-01-29 1996-06-18 Purdue Research Foundation Controlled modification of eukaryotic genomes
US5814618A (en) 1993-06-14 1998-09-29 Basf Aktiengesellschaft Methods for regulating gene expression
US5789156A (en) 1993-06-14 1998-08-04 Basf Ag Tetracycline-regulated transcriptional inhibitors
US5837850A (en) 1994-04-21 1998-11-17 Pioneer Hi-Bred International, Inc. Regulatory element conferring tapetum specificity
US5593881A (en) 1994-05-06 1997-01-14 Mycogen Corporation Bacillus thuringiensis delta-endotoxin
US5633363A (en) 1994-06-03 1997-05-27 Iowa State University, Research Foundation In Root preferential promoter
US5736369A (en) 1994-07-29 1998-04-07 Pioneer Hi-Bred International, Inc. Method for producing transgenic cereal plants
US5608144A (en) 1994-08-12 1997-03-04 Dna Plant Technology Corp. Plant group 2 promoters and uses thereof
US5792931A (en) 1994-08-12 1998-08-11 Pioneer Hi-Bred International, Inc. Fumonisin detoxification compositions and methods
EP0711834A3 (fr) 1994-10-14 1996-12-18 Nissan Chemical Ind Ltd Nouvelle souche de Bacillus et agents de contrÔle d'organismes nuisibles
US5659026A (en) 1995-03-24 1997-08-19 Pioneer Hi-Bred International ALS3 promoter
EP0832235A1 (fr) 1995-06-02 1998-04-01 Pioneer Hi-Bred International, Inc. DERIVES DE alfa-HORDOTHIONINE A TENEUR ELEVEE EN METHIONINE
AU705933B2 (en) 1995-06-02 1999-06-03 Pioneer Hi-Bred International, Inc. High threonine derivatives of alpha-hordothionin
US5837876A (en) 1995-07-28 1998-11-17 North Carolina State University Root cortex specific gene promoter
US5703049A (en) 1996-02-29 1997-12-30 Pioneer Hi-Bred Int'l, Inc. High methionine derivatives of α-hordothionin for pathogen-control
US5850016A (en) 1996-03-20 1998-12-15 Pioneer Hi-Bred International, Inc. Alteration of amino acid compositions in seeds
US6072050A (en) 1996-06-11 2000-06-06 Pioneer Hi-Bred International, Inc. Synthetic promoters
AU3495297A (en) 1996-07-08 1998-02-02 Pioneer Hi-Bred International, Inc. Transformation of zygote, egg or sperm cells and recovery of transformed plants from isolated embryo sacs
WO1998020133A2 (fr) 1996-11-01 1998-05-14 Pioneer Hi-Bred International, Inc. Proteines a concentration amelioree en acides amines essentiels
US5981840A (en) 1997-01-24 1999-11-09 Pioneer Hi-Bred International, Inc. Methods for agrobacterium-mediated transformation
US7053282B1 (en) 1998-02-09 2006-05-30 Pioneer Hi-Bred International, Inc. Alteration of amino acid compositions in seeds
AU762993C (en) 1998-02-26 2004-06-10 Pioneer Hi-Bred International, Inc. Constitutive maize promoters
US6518485B1 (en) * 1998-06-04 2003-02-11 Westvaco Corporation Particle-mediated conifer transformation
DE69928264T2 (de) 1998-08-20 2006-07-13 Pioneer Hi-Bred International, Inc. Samen-bevorzugende promotoren
WO2000012733A1 (fr) 1998-08-28 2000-03-09 Pioneer Hi-Bred International, Inc. PROMOTEURS PREFERES DE SEMENCES PROVENANT DE GENES $i(END)
US6504083B1 (en) 1998-10-06 2003-01-07 Pioneer Hi-Bred International, Inc. Maize Gos-2 promoters
CN1360634A (zh) 1999-04-29 2002-07-24 辛甄塔有限公司 抗除草剂植物
US20100293669A2 (en) * 1999-05-06 2010-11-18 Jingdong Liu Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement
US7868149B2 (en) * 1999-07-20 2011-01-11 Monsanto Technology Llc Plant genome sequence and uses thereof
US6603061B1 (en) * 1999-07-29 2003-08-05 Monsanto Company Agrobacterium-mediated plant transformation method
US20070083945A1 (en) * 2000-03-10 2007-04-12 Byrum Joseph R Nucleic acid molecules and other molecules associated with plants
US6627797B1 (en) * 2000-03-21 2003-09-30 The Texas A&M University System Maize lipoxygenase polynucleotide and methods of use
US6683231B2 (en) 2000-06-02 2004-01-27 E. I. Du Pont De Nemours And Company High level production of p-hydroxybenzoic acid in green plants
US7517975B2 (en) 2000-09-26 2009-04-14 Pioneer Hi-Bred International, Inc. Nucleotide sequences mediating male fertility and method of using same
BR0114199A (pt) 2000-09-26 2006-01-31 Pioneer Hi Bred Int Sequências de nucleotìdeos que medeiam a fertilidade masculina e métodos de uso das mesmas
US7612251B2 (en) 2000-09-26 2009-11-03 Pioneer Hi-Bred International, Inc. Nucleotide sequences mediating male fertility and method of using same
JP2004528808A (ja) 2000-09-29 2004-09-24 シンジェンタ リミテッド 除草剤抵抗性植物
DE10131786A1 (de) 2001-07-04 2003-01-16 Sungene Gmbh & Co Kgaa Rekombinationssysteme und Verfahren zum Entfernen von Nukleinsäuresequenzen aus dem Genom eukaryotischer Organismen
US20090100536A1 (en) * 2001-12-04 2009-04-16 Monsanto Company Transgenic plants with enhanced agronomic traits
US20030186281A1 (en) 2001-12-21 2003-10-02 Wolfgang Hillen Modified tetracycline repressor protein compositions and methods of use
US7045684B1 (en) 2002-08-19 2006-05-16 Mertec, Llc Glyphosate-resistant plants
AU2004208031B2 (en) 2003-01-28 2009-10-08 Cellectis Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof.
IES20030696A2 (en) 2003-09-23 2005-03-23 Carsphairn Ltd A pipeline apparatus
PL1689870T3 (pl) 2003-11-18 2009-06-30 Bayer Cropscience Nv Ulepszona docelowa insercja DNA w roślinach
BRPI0418025A (pt) 2003-12-22 2007-09-11 Pioneer Hi Bred Internacional molécula de ácido nucléico isolada, cassette de expressão, vetor e métodos de expressão de sequências de nucleotìdeos em plantas e células de planta
AU2005210493B2 (en) 2004-02-02 2009-06-04 Pioneer Hi-Bred International, Inc. AP2 domain transcription factor ODP2 (ovule development protein 2) and methods of use
US7292055B2 (en) 2005-04-21 2007-11-06 Endicott Interconnect Technologies, Inc. Interposer for use with test apparatus
US20070016985A1 (en) 2005-07-18 2007-01-18 Pioneer Hi-Bred International, Inc. Particle Preparation for Direct-Delivery Transformation
WO2007011733A2 (fr) 2005-07-18 2007-01-25 Pioneer Hi-Bred International, Inc. Sites de recombinaison frt modifies et leurs procedes d'utilisation
EP2325332B1 (fr) 2005-08-26 2012-10-31 DuPont Nutrition Biosciences ApS Utilisation de genes associes à CRISPR (CAS)
JP5937292B2 (ja) 2005-10-18 2016-06-22 デューク大学 配列特異性およびｄｎａ−結合親和度が変更された、合理設計メガヌクレアーゼ
RU2441366C2 (ru) 2006-01-12 2012-02-10 Сайбас Юроп Б.В. Мутанты epsps
US8138393B2 (en) 2006-08-11 2012-03-20 Monsanto Technology Llc Production of high tryptophan maize by chloroplast targeted expression of anthranilate synthase
BR122017006111B8 (pt) 2006-10-31 2022-12-06 Du Pont Métodos para controlar ervas daninhas
ES2406087T3 (es) 2006-12-29 2013-06-05 Dow Agrosciences Llc Métodos in vitro para la inducción y el mantenimiento de líneas celulares vegetales como células en suspensión únicas con paredes celulares intactas, y su transformación
RU2485180C2 (ru) 2007-06-07 2013-06-20 Эгрикалча Энд Эгри-Фуд Кэнэда Способ трансфекции и трансдукции растительных клеток
EP2568048A1 (fr) 2007-06-29 2013-03-13 Pioneer Hi-Bred International, Inc. Procédés de modification du génome d'une cellule de plante monocotylédone
US7919676B2 (en) 2007-08-03 2011-04-05 Pioneer Hi-Bred International, Inc. Msca1 nucleotide sequences impacting plant male fertility and method of using same
DK2205749T3 (en) * 2007-09-27 2016-08-22 Dow Agrosciences Llc MODIFIED PROTEINS zinc finger, which target the 5-enolpyruvylshikimate-3-phosphate synthase genes
AU2008308486B2 (en) 2007-10-05 2014-08-07 Corteva Agriscience Llc Methods for transferring molecular substances into plant cells
US8697857B2 (en) 2007-11-20 2014-04-15 E. I. Du Pont De Nemours And Company Soybean EF1A2 promoter and its use in constitutive expression of transgenic genes in plants
WO2010011961A2 (fr) 2008-07-25 2010-01-28 University Of Georgia Research Foundation, Inc. Système procaryote arni-like et ses procédés d'utilisation
US20100076057A1 (en) 2008-09-23 2010-03-25 Northwestern University TARGET DNA INTERFERENCE WITH crRNA
UA106458C2 (uk) 2008-10-28 2014-08-26 Піонер Хай-Бред Інтернешенл, Інк. Чутливий до сульфонілсечовини репресорний білок
AU2009333863B2 (en) 2008-12-17 2015-02-05 Corteva Agriscience Llc Targeted integration into the Zp15 locus
EP2417262B1 (fr) 2009-04-07 2015-05-20 Dow AgroSciences LLC Distribution à médiation par nanoparticules de nucléases à spécificité de séquence
US8466341B2 (en) 2009-05-04 2013-06-18 Pioneer Hi-Bred International, Inc. Maize 17KD oleosin seed-preferred regulatory element
EP2529018B1 (fr) 2009-12-30 2016-06-22 Pioneer Hi-Bred International, Inc. Procédés et compositions pour l'introduction et l'expression régulée de gènes dans des plantes
US8704041B2 (en) 2009-12-30 2014-04-22 Pioneer Hi Bred International Inc Methods and compositions for targeted polynucleotide modification
AU2011238826B2 (en) 2010-03-31 2014-11-13 Corteva Agriscience Llc Plant peptide gamma-zein for delivery of biomolecules into plant cells
EP2569425B1 (fr) 2010-05-10 2016-07-06 The Regents of The University of California Compositions d'endoribonucléases et leurs procédés d'utilisation
CN102933712A (zh) 2010-06-09 2013-02-13 纳幕尔杜邦公司 用于在植物中调节转基因表达的调控序列
CN103052713A (zh) 2010-07-07 2013-04-17 陶氏益农公司 官能化线性dna盒的生成及植物中量子点/纳米颗粒介导的投递
CA3065095C (fr) 2010-07-07 2023-02-14 Dow Agrosciences Llc Procede d'introgression de caracteres dans une plante
WO2012016052A1 (fr) 2010-07-28 2012-02-02 True Fit Corporation Recommandation de taille par inférence collaborative
EP2675900B1 (fr) 2011-02-15 2017-09-06 Pioneer Hi-Bred International, Inc. Promoteur destiné de préférence aux racines et méthodes d'utilisation
WO2012129443A2 (fr) 2011-03-23 2012-09-27 Dow Agrosciences Llc Conjugués peptidiques supports de points quantiques adaptés pour des applications d'imagerie et d'administration dans des plantes
US10030245B2 (en) 2011-03-23 2018-07-24 E I Du Pont De Nemours And Company Methods for producing a complex transgenic trait locus
US9726249B2 (en) 2011-05-13 2017-08-08 Mississippi State University Shock mitigating materials and methods utilizing spiral shaped elements
US20140113376A1 (en) 2011-06-01 2014-04-24 Rotem Sorek Compositions and methods for downregulating prokaryotic genes
AU2012333207A1 (en) 2011-06-21 2014-01-23 E.I. Du Pont De Nemours And Company Methods and compositions for producing male sterile plants
CN106906214B (zh) 2011-07-15 2021-04-02 纳幕尔杜邦公司 新型植物终止子序列
CN103842995A (zh) 2011-08-01 2014-06-04 标记公司 在分布式数据库中的一般化的协调
CN107190018A (zh) 2011-08-02 2017-09-22 先锋国际良种公司 用于植物基因表达的终止子序列
WO2013019411A1 (fr) 2011-08-03 2013-02-07 E. I. Du Pont De Nemours And Company Procédés et compositions permettant une intégration ciblée dans une plante
BR112014003919A2 (pt) 2011-08-22 2017-03-14 Bayer Cropscience Ag métodos e meios para modificar um genoma de planta
MX2014005212A (es) 2011-10-31 2014-11-25 Pioneer Hi Bred Int Mejoramiento de la tolerancia a la sequia, eficiencia de uso de nitrogeno y rendimiento de una planta.
EP2776560A2 (fr) 2011-11-07 2014-09-17 The University of Western Ontario Endonucléase pour l'édition de génome
AU2012352095A1 (en) 2011-12-15 2014-06-12 Dow Agrosciences Llc Method for improved transformation using Agrobacterium
GB201122458D0 (en) 2011-12-30 2012-02-08 Univ Wageningen Modified cascade ribonucleoproteins and uses thereof
AR089793A1 (es) 2012-01-27 2014-09-17 Du Pont Metodos y composiciones para generar locus de rasgos transgenicos complejos
US9637739B2 (en) 2012-03-20 2017-05-02 Vilnius University RNA-directed DNA cleavage by the Cas9-crRNA complex
WO2013141680A1 (fr) 2012-03-20 2013-09-26 Vilnius University Clivage d'adn dirigé par arn par le complexe cas9-arncr
BR112014028615A2 (pt) 2012-05-18 2017-06-27 Pioneer Hi Bred Int polinucleotídeos, constructo de dna, vetor, célula, plantas, semente, método de expressão, métodos para alterar a expressão e para alterar uma característica de planta.
DK3401400T3 (da) 2012-05-25 2019-06-03 Univ California Fremgangsmåder og sammensætninger til rna-styret mål-dna-modifikation og til rna-styret transskriptionsmodulering
US9725729B2 (en) 2012-06-04 2017-08-08 Pioneer Hi-Bred International, Inc. SB-actin terminator sequence for gene expression in plants
CA2877290A1 (fr) * 2012-06-19 2013-12-27 Daniel F. Voytas Ciblage de gene dans des plantes a l'aide de virus a adn
JP2015527889A (ja) 2012-07-25 2015-09-24 ザ ブロード インスティテュート， インコーポレイテッド 誘導可能なｄｎａ結合タンパク質およびゲノム撹乱ツール、ならびにそれらの適用
UA119135C2 (uk) 2012-09-07 2019-05-10 ДАУ АГРОСАЙЄНСІЗ ЕлЕлСі Спосіб отримання трансгенної рослини
US20140096284A1 (en) 2012-10-01 2014-04-03 Iowa State University Research Foundation, Inc. Method for the delivery of molecules lyophilized onto microparticles to plant tissues
CN110643600A (zh) 2012-10-23 2020-01-03 基因工具股份有限公司 用于切割靶dna的系统及其用途
CA2890160A1 (fr) 2012-10-31 2014-05-08 Cellectis Couplage de la resistance aux herbicides a l'insertion ciblee de transgenes chez la plante
JP6620018B2 (ja) 2012-12-06 2019-12-11 シグマ−アルドリッチ・カンパニー・リミテッド・ライアビリティ・カンパニーＳｉｇｍａ−Ａｌｄｒｉｃｈ Ｃｏ．， ＬＬＣ Ｃｒｉｓｐｒに基づくゲノム修飾および制御
WO2014093479A1 (fr) 2012-12-11 2014-06-19 Montana State University Contrôle de la régulation génétique guidé par arn crispr (répétitions palindromiques groupées, courtes régulièrement espacées )
MX2015007550A (es) 2012-12-12 2017-02-02 Broad Inst Inc Suministro, modificación y optimización de sistemas, métodos y composiciones para la manipulación de secuencias y aplicaciones terapéuticas.
CN105658796B (zh) 2012-12-12 2021-10-26 布罗德研究所有限公司 用于序列操纵的crispr-cas组分系统、方法以及组合物
PT2898075E (pt) * 2012-12-12 2016-06-16 Harvard College Manipulação e otimização de sistemas, métodos e composições de enzima melhorados para manipulação de sequências
PT2896697E (pt) 2012-12-12 2015-12-31 Massachusetts Inst Technology Engenharia de sistemas, métodos e composições guia otimizadas para a manipulação de sequências
WO2014093694A1 (fr) 2012-12-12 2014-06-19 The Broad Institute, Inc. Systèmes, procédés et compositions de crispr-nickase cas pour la manipulation de séquences dans les eucaryotes
US8993233B2 (en) 2012-12-12 2015-03-31 The Broad Institute Inc. Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains
US20140186843A1 (en) 2012-12-12 2014-07-03 Massachusetts Institute Of Technology Methods, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof
WO2014093701A1 (fr) 2012-12-12 2014-06-19 The Broad Institute, Inc. Génomique fonctionnelle employant des systèmes crispr-cas, des compositions, des procédés, des banques d'inactivation et leurs applications
BR102013032200A2 (pt) 2012-12-13 2015-11-24 Dow Agrosciences Llc direcionamento preciso de um gene para um locus específico em milho
EP3553174A1 (fr) 2012-12-17 2019-10-16 President and Fellows of Harvard College Ingénierie de génome humain guidée par arn
CA2901676C (fr) 2013-02-25 2023-08-22 Sangamo Biosciences, Inc. Methodes et compositions pour ameliorer une disruption genique a mediation nuclease
RU2694686C2 (ru) 2013-03-12 2019-07-16 Е.И.Дюпон Де Немур Энд Компани Способы идентификации вариантных сайтов распознавания для редкощепящих сконструированных средств для индукции двунитевого разрыва, и композиции с ними, и их применения
EP2971167B1 (fr) 2013-03-14 2019-07-31 Caribou Biosciences, Inc. Compositions et procédés pour des acides nucléiques à ciblage d'acide nucléique
CA2906747A1 (fr) 2013-03-15 2014-09-18 Regents Of The University Of Minnesota Ingenierie de genomes de plantes a l'aide de systemes crispr/cas
US10113162B2 (en) 2013-03-15 2018-10-30 Cellectis Modifying soybean oil composition through targeted knockout of the FAD2-1A/1B genes
KR102339732B1 (ko) * 2013-03-15 2021-12-15 시버스 유에스 엘엘씨 올리고뉴클레오타이드 매개 유전자 보수를 사용한 표적화된 유전자 변형의 효율을 증가시키기 위한 방법 및 조성물
CA2907198C (fr) 2013-03-15 2019-12-10 The General Hospital Corporation Utilisation de nucleases foki a guidage arn (rfn) pour augmenter la specificite pour la modification d'un genome a guidage arn
CN105518146B (zh) 2013-04-04 2022-07-15 哈佛学院校长同事会 利用CRISPR/Cas系统的基因组编辑的治疗性用途
WO2014186686A2 (fr) 2013-05-17 2014-11-20 Two Blades Foundation Mutagénèse ciblée et ingénierie génomique dans des plantes à l'aide de nucléases cas guidées par arn
US20150067922A1 (en) * 2013-05-30 2015-03-05 The Penn State Research Foundation Gene targeting and genetic modification of plants via rna-guided genome editing
EP3019204B1 (fr) 2013-07-10 2020-01-01 President and Fellows of Harvard College Protéines cas9 orthogonales pour la régulation et l'édition de gènes avec arn guide
EP3971287A1 (fr) * 2013-07-11 2022-03-23 ModernaTX, Inc. Compositions comprenant des polynucléotides synthétiques codant pour des protéines liées à crispr et des arnsg synthétiques et méthodes d'utilisation
US20150044772A1 (en) 2013-08-09 2015-02-12 Sage Labs, Inc. Crispr/cas system-based novel fusion protein and its applications in genome editing
US20150044192A1 (en) 2013-08-09 2015-02-12 President And Fellows Of Harvard College Methods for identifying a target site of a cas9 nuclease
WO2015026887A1 (fr) 2013-08-22 2015-02-26 E. I. Du Pont De Nemours And Company Promoteur de polymérase iii u6 de soja et procédés d'utilisation
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
EP3071695A2 (fr) 2013-11-18 2016-09-28 Crispr Therapeutics AG Système crips-cas, matériels et procédés
US9068179B1 (en) 2013-12-12 2015-06-30 President And Fellows Of Harvard College Methods for correcting presenilin point mutations
WO2015112896A2 (fr) 2014-01-24 2015-07-30 North Carolina State University Méthodes et compositions pour des séquences guidant le ciblage de cas9
CN106232803A (zh) 2014-02-27 2016-12-14 孟山都技术公司 用于定点基因组修饰的组合物和方法
US11584936B2 (en) 2014-06-12 2023-02-21 King Abdullah University Of Science And Technology Targeted viral-mediated plant genome editing using CRISPR /Cas9
CN106795524A (zh) 2014-07-11 2017-05-31 先锋国际良种公司 使用向导rna/cas内切核酸酶系统改变农学性状及其使用方法
US10676754B2 (en) 2014-07-11 2020-06-09 E I Du Pont De Nemours And Company Compositions and methods for producing plants resistant to glyphosate herbicide
US10450584B2 (en) 2014-08-28 2019-10-22 North Carolina State University Cas9 proteins and guiding features for DNA targeting and genome editing
CN108064129A (zh) 2014-09-12 2018-05-22 纳幕尔杜邦公司 玉米和大豆中复合性状基因座的位点特异性整合位点的产生和使用方法
HRP20231022T1 (hr) 2015-01-28 2023-12-08 Caribou Biosciences, Inc. Hibridni polinukleotidi crispr dna/rna i načini uporabe
CN107406858A (zh) 2015-02-25 2017-11-28 先锋国际良种公司 用于指导rna/cas内切核酸酶复合物的调节型表达的组合物和方法
EP3270685B1 (fr) 2015-03-19 2023-07-19 Pioneer Hi-Bred International, Inc. Procédés et compositions permettant d'accélérer l'introgression de caractères
CN107567499A (zh) 2015-03-27 2018-01-09 纳幕尔杜邦公司 大豆u6核小rna基因启动子及其在植物小rna基因的组成型表达中的用途
WO2016186946A1 (fr) 2015-05-15 2016-11-24 Pioneer Hi-Bred International, Inc. Caractérisation rapide de systèmes d'endonucléases cas, séquences pam et éléments d'arn guide
DE102015006335A1 (de) 2015-05-19 2016-11-24 Kws Saat Se Verfahren und Konstrukte zur gezielten Nukleinsäure Editierung in Pflanzen
CN107750125A (zh) 2015-06-02 2018-03-02 孟山都技术有限公司 用于将多核苷酸递送至植物中的组合物和方法
CN108138164B (zh) 2015-08-21 2022-05-10 孟山都技术公司 基因组基因座的增强的重组
US11692182B2 (en) 2015-10-09 2023-07-04 Monsanto Technology Llc RNA-guided DNA nucleases and uses thereof
EP4089175A1 (fr) 2015-10-13 2022-11-16 Duke University Ingénierie génomique avec systèmes crispr de type i dans des cellules eucaryotes
MX2018004808A (es) 2015-10-20 2018-08-01 Pioneer Hi Bred Int Funcion restauradora para un producto genico no funcional mediante sistemas cas guiados y metodos de uso.
WO2017155715A1 (fr) 2016-03-11 2017-09-14 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas9 et procédés d'utilisation
WO2017155714A1 (fr) 2016-03-11 2017-09-14 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas9 et procédés d'utilisation
WO2017155717A1 (fr) 2016-03-11 2017-09-14 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas9 et procédés d'utilisation
EP3469077A1 (fr) 2016-06-14 2019-04-17 Pioneer Hi-Bred International, Inc. Utilisation de l'endonucléase cpf1 pour modifier le génome des plantes
WO2017222773A1 (fr) 2016-06-20 2017-12-28 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas et méthodes d'utilisation

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5959177A (en) * 1989-10-27 1999-09-28 The Scripps Research Institute Transgenic plants expressing assembled secretory antibodies
US7262055B2 (en) * 1998-08-25 2007-08-28 Gendaq Limited Regulated gene expression in plants
US20040231016A1 (en) * 2003-02-19 2004-11-18 Commonwealth Scientific And Industrial Research Organization Efficient gene silencing in plants using short dsRNA sequences
US20070199095A1 (en) * 2005-10-13 2007-08-23 Edwards Allen Methods for producing hybrid seed
US8697359B1 (en) * 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Relic et al (PNAS, 1998, 95: 9105-9110) *
Ziemienowicz et al (Plant Cell, 2001, 13(2): 369-383) *

Cited By (182)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10519457B2 (en) 2013-08-22 2019-12-31 E I Du Pont De Nemours And Company Soybean U6 polymerase III promoter and methods of use
US11773400B2 (en) 2013-08-22 2023-10-03 E.I. Du Pont De Nemours And Company Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof
US11566254B2 (en) 2014-02-27 2023-01-31 Monsanto Technology Llc Compositions and methods for site directed genomic modification
US11186843B2 (en) * 2014-02-27 2021-11-30 Monsanto Technology Llc Compositions and methods for site directed genomic modification
US11952578B2 (en) 2014-02-27 2024-04-09 Monsanto Technology Llc Compositions and methods for site directed genomic modification
US20170114351A1 (en) * 2014-06-12 2017-04-27 King Abdullah University Of Science And Technology TARGETED VIRAL-MEDIATED PLANT GENOME EDITING USING CRISPR /Cas9
US11584936B2 (en) * 2014-06-12 2023-02-21 King Abdullah University Of Science And Technology Targeted viral-mediated plant genome editing using CRISPR /Cas9
EP3686278A1 (fr) 2014-08-13 2020-07-29 DuPont US Holding, LLC Manipulation génétique dans des levures non-conventionnelles avec une endonucléase guidée par arn
US10513711B2 (en) 2014-08-13 2019-12-24 Dupont Us Holding, Llc Genetic targeting in non-conventional yeast using an RNA-guided endonuclease
US9888673B2 (en) 2014-12-10 2018-02-13 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
US10993419B2 (en) 2014-12-10 2021-05-04 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
US11234418B2 (en) 2014-12-10 2022-02-01 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
US10278372B2 (en) 2014-12-10 2019-05-07 Regents Of The University Of Minnesota Genetically modified cells, tissues, and organs for treating disease
WO2016100309A1 (fr) 2014-12-16 2016-06-23 Pioneer Hi-Bred International, Inc. Rétablissement de la fertilité mâle dans le blé
WO2016126417A1 (fr) 2015-02-04 2016-08-11 Pioneer Hi Bred International Inc Nouveaux récepteurs de toxine btet procédés d'utilisation
EP3553178A1 (fr) 2015-03-27 2019-10-16 E. I. du Pont de Nemours and Company Promoteurs de petit gène d'arn nucléaire u6 de graines de soja et leur utilisation dans l'expression de constitutive de petits gènes dans des plantes
US10450576B2 (en) 2015-03-27 2019-10-22 E I Du Pont De Nemours And Company Soybean U6 small nuclear RNA gene promoters and their use in constitutive expression of small RNA genes in plants
WO2016186953A1 (fr) 2015-05-15 2016-11-24 Pioneer Hi Bred International Inc Systèmes arn guide/endonucléase cas
WO2016186946A1 (fr) 2015-05-15 2016-11-24 Pioneer Hi-Bred International, Inc. Caractérisation rapide de systèmes d'endonucléases cas, séquences pam et éléments d'arn guide
WO2016210393A1 (fr) * 2015-06-26 2016-12-29 Pioneer Hi-Bred International, Inc. Éléments régulateurs de gos2 et leur utilisation
US10166255B2 (en) 2015-07-31 2019-01-01 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US11903966B2 (en) 2015-07-31 2024-02-20 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US11266692B2 (en) 2015-07-31 2022-03-08 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US11642375B2 (en) 2015-07-31 2023-05-09 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US11642374B2 (en) 2015-07-31 2023-05-09 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US11147837B2 (en) 2015-07-31 2021-10-19 Regents Of The University Of Minnesota Modified cells and methods of therapy
US10406177B2 (en) 2015-07-31 2019-09-10 Regents Of The University Of Minnesota Modified cells and methods of therapy
US11925664B2 (en) 2015-07-31 2024-03-12 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US11583556B2 (en) 2015-07-31 2023-02-21 Regents Of The University Of Minnesota Modified cells and methods of therapy
EP3461894A1 (fr) 2015-08-07 2019-04-03 Caribou Biosciences, Inc. Compositions de crispr-cas9 manipulées et procédés d'utilisation
US11111506B2 (en) 2015-08-07 2021-09-07 Caribou Biosciences, Inc. Compositions and methods of engineered CRISPR-Cas9 systems using split-nexus Cas9-associated polynucleotides
US9580727B1 (en) 2015-08-07 2017-02-28 Caribou Biosciences, Inc. Compositions and methods of engineered CRISPR-Cas9 systems using split-nexus Cas9-associated polynucleotides
US9970026B2 (en) 2015-08-07 2018-05-15 Caribou Biosciences, Inc. Compositions and methods of engineered CRISPR-Cas9 systems using split-nexus Cas9-associated polynucleotides
US9970027B2 (en) 2015-08-07 2018-05-15 Caribou Biosciences, Inc. Compositions and methods of engineered CRISPR-CAS9 systems using split-nexus CAS9-associated polynucleotides
US9745600B2 (en) 2015-08-07 2017-08-29 Caribou Biosciences, Inc. Compositions and methods of engineered CRISPR-Cas9 systems using split-nexus Cas9-associated polynucleotides
US11932887B2 (en) 2015-09-10 2024-03-19 Yeda Research And Development Co. Ltd. CYP76AD1-beta clade polynucleotides, polypeptides, and uses thereof
US10767201B2 (en) 2015-09-10 2020-09-08 Yeda Research And Development Co. Ltd. CYP76AD1-beta clade polynucleotides, polypeptides, and uses thereof
JP2018530352A (ja) * 2015-10-12 2018-10-18 イー・アイ・デュポン・ドウ・ヌムール・アンド・カンパニーＥ．Ｉ．Ｄｕ Ｐｏｎｔ Ｄｅ Ｎｅｍｏｕｒｓ Ａｎｄ Ｃｏｍｐａｎｙ 細胞内での遺伝子組換えおよび相同組換えの増加のための保護ｄｎａ鋳型および使用方法
EP4144844A1 (fr) 2015-10-12 2023-03-08 DuPont US Holding, LLC Modèles d'adn protégés pour modification génétique et recombinaison homologue accrue dans les cellules et procédés d'utilisation
WO2017066175A1 (fr) 2015-10-12 2017-04-20 E. I. Du Pont De Nemours And Company Matrices adn protégées pour modification génique et recombinaison homologue accrue dans les cellules et leurs procédés d'utilisation
KR102628801B1 (ko) 2015-10-12 2024-01-25 이아이디피, 인크. 세포내 유전자 변형 및 증가된 상동 재조합을 위한 보호 dna 주형 및 이용 방법
KR20180056772A (ko) * 2015-10-12 2018-05-29 이 아이 듀폰 디 네모아 앤드 캄파니 세포내 유전자 변형 및 증가된 상동 재조합을 위한 보호 dna 주형 및 이용 방법
JP7011590B2 (ja) 2015-10-12 2022-02-10 イー・アイ・デュポン・ドウ・ヌムール・アンド・カンパニー 細胞内での遺伝子組換えおよび相同組換えの増加のための保護ｄｎａ鋳型および使用方法
WO2017070032A1 (fr) 2015-10-20 2017-04-27 Pioneer Hi-Bred International, Inc. Restauration de la fonction d'un produit génique non fonctionnel par l'intermédiaire de systèmes cas guidés et méthodes d'utilisation associées
US10023853B1 (en) 2015-10-23 2018-07-17 Caribou Biosciences, Inc. Engineered nucleic-acid targeting nucleic acids
US9677090B2 (en) 2015-10-23 2017-06-13 Caribou Biosciences, Inc. Engineered nucleic-acid targeting nucleic acids
US10711258B2 (en) 2015-10-23 2020-07-14 Caribou Biosciences, Inc. Engineered nucleic-acid targeting nucleic acids
US9957490B1 (en) 2015-10-23 2018-05-01 Caribou Biosciences, Inc. Cells comprising engineered nucleic-acid targeting nucleic acids
US9745562B2 (en) 2015-10-23 2017-08-29 Caribou Biosciences, Inc. Methods of using engineered nucleic-acid targeting nucleic acids
US9816081B1 (en) 2015-10-23 2017-11-14 Caribou Biosciences, Inc. Engineered nucleic-acid targeting nucleic acids
US10196619B1 (en) 2015-10-23 2019-02-05 Caribou Biosciences, Inc. Engineered nucleic-acid targeting nucleic acids
US10501728B2 (en) 2015-10-23 2019-12-10 Caribou Biosciences, Inc. Engineered nucleic-acid targeting nucleic acids
US10138472B2 (en) 2015-10-23 2018-11-27 Caribou Biosciences, Inc. Engineered nucleic-acid targeting nucleic acids
US10125354B1 (en) 2015-10-23 2018-11-13 Caribou Biosciences, Inc. Engineered nucleic-acid targeting nucleic acids
WO2017079026A1 (fr) 2015-11-06 2017-05-11 E. I. Du Pont De Nemours And Company Génération de locus à traits complexes dans le soja et procédés d'utilisation
WO2017095698A1 (fr) 2015-11-30 2017-06-08 Pioneer Hi-Bred International, Inc. Éléments régulateurs de plantes et procédés d'utilisation associés
WO2017096237A1 (fr) * 2015-12-02 2017-06-08 Ceres, Inc. Procédés de modification génétique de plantes
US11802287B2 (en) 2015-12-02 2023-10-31 Ceres, Inc. Methods for genetic modification of plants
US11118189B2 (en) * 2015-12-02 2021-09-14 Ceres, Inc. Methods for genetic modification of plants
WO2017100158A1 (fr) 2015-12-11 2017-06-15 Danisco Us Inc. Procédés et compositions pour modification de génome médiée par nucléase augmentée et effets hors-site cible réduits
EP3708665A1 (fr) 2015-12-18 2020-09-16 Danisco US Inc. Procédés et compositions pour l'expression de l'arn guide à base d'arn-t
WO2017123772A1 (fr) * 2016-01-12 2017-07-20 Regents Of The University Of Minnesota Plantes tolérant le glyphosate ayant une régulation du gène 5-énolpyruvylshikimate-3-phosphate synthase modifié
WO2017132239A1 (fr) 2016-01-26 2017-08-03 Pioneer Hi-Bred International, Inc. Maïs cireux
WO2017155715A1 (fr) 2016-03-11 2017-09-14 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas9 et procédés d'utilisation
WO2017155714A1 (fr) 2016-03-11 2017-09-14 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas9 et procédés d'utilisation
EP3699281A1 (fr) 2016-03-11 2020-08-26 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas9 et procédés d'utilisation
WO2017155717A1 (fr) 2016-03-11 2017-09-14 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas9 et procédés d'utilisation
EP3699280A2 (fr) 2016-03-11 2020-08-26 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas9 et procédés d'utilisation
CN109642232A (zh) * 2016-06-01 2019-04-16 Kws种子欧洲股份公司 用于基因组改造的杂合核酸序列
US20190161760A1 (en) * 2016-06-01 2019-05-30 Kws Saat Se Hybrid nucleic acid sequences for genome engineering
WO2017207589A1 (fr) 2016-06-01 2017-12-07 Kws Saat Se Séquences d'acides nucléiques hybrides destinées à l'ingénierie génomique
WO2017218185A1 (fr) 2016-06-14 2017-12-21 Pioneer Hi-Bred International, Inc. Utilisation de l'endonucléase cpf1 pour modifier le génome des plantes
WO2017222773A1 (fr) 2016-06-20 2017-12-28 Pioneer Hi-Bred International, Inc. Nouveaux systèmes cas et méthodes d'utilisation
US11104910B2 (en) 2016-09-11 2021-08-31 Yeda Research And Development Co. Ltd. Compositions and methods for regulating gene expression for targeted mutagenesis
WO2018047183A1 (fr) * 2016-09-11 2018-03-15 Yeda Research And Development Co. Ltd. Compositions et méthodes de régulation de l'expression génétique par mutagenèse ciblée
WO2018052919A1 (fr) * 2016-09-14 2018-03-22 Monsanto Technology Llc Méthodes et compositions d'édition génomique par induction d'haploïde
US11401524B2 (en) 2016-09-14 2022-08-02 Monsanto Technology, Llc Methods and compositions for genome editing via haploid induction
EP4242330A2 (fr) 2016-10-13 2023-09-13 Pioneer Hi-Bred International, Inc. Génération de maïs résistant à l'helminthosporiose du nord
WO2018071362A1 (fr) 2016-10-13 2018-04-19 Pioneer Hi-Bred International, Inc. Génération de maïs résistant à l'helminthosporiose du nord
US10912797B2 (en) 2016-10-18 2021-02-09 Intima Bioscience, Inc. Tumor infiltrating lymphocytes and methods of therapy
US11154574B2 (en) 2016-10-18 2021-10-26 Regents Of The University Of Minnesota Tumor infiltrating lymphocytes and methods of therapy
EP4256951A2 (fr) 2016-11-04 2023-10-11 Flagship Pioneering Innovations V. Inc. Nouvelles cellules végétales, plantes et graines
WO2018102131A1 (fr) 2016-11-29 2018-06-07 Pioneer Hi-Bred International, Inc. Terminateurs transcriptionnels pour l'expression génique dans des plantes
US9816093B1 (en) 2016-12-06 2017-11-14 Caribou Biosciences, Inc. Engineered nucleic acid-targeting nucleic acids
US10590415B2 (en) 2016-12-06 2020-03-17 Ceribou Biosciences, Inc. Engineered nucleic acid-targeting nucleic acids
US11001843B2 (en) 2016-12-06 2021-05-11 Caribou Biosciences, Inc. Engineered nucleic acid-targeting nucleic acids
US11859219B1 (en) 2016-12-30 2024-01-02 Flagship Pioneering Innovations V, Inc. Methods of altering a target nucleotide sequence with an RNA-guided nuclease and a single guide RNA
US11624071B2 (en) 2017-01-28 2023-04-11 Inari Agriculture Technology, Inc. Method of creating a plurality of targeted insertions in a plant cell
US11466271B2 (en) 2017-02-06 2022-10-11 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
CN107066944A (zh) * 2017-03-06 2017-08-18 北京聚爱聊网络科技有限公司 一种手指指根的定位方法及装置
WO2018183607A1 (fr) 2017-03-30 2018-10-04 Pioneer Hi-Bred International, Inc. Procédés d'identification et de caractérisation de variations d'édition de gènes dans des acides nucléiques
WO2018183050A3 (fr) * 2017-03-30 2019-05-02 Pioneer Hi-Bred International, Inc. Epsp synthases améliorées de végétaux et procédés d'utilisation
WO2018183878A1 (fr) 2017-03-31 2018-10-04 Pioneer Hi-Bred International, Inc. Éléments de modulation d'expression et leur utilisation
WO2018197520A1 (fr) 2017-04-24 2018-11-01 Dupont Nutrition Biosciences Aps Procédés et compositions de protéines anti-crispr destinés à être utilisés dans des plantes
US11732251B2 (en) 2017-04-24 2023-08-22 Dupont Nutrition Biosciences Aps Anti-CRISPR polynucleotides and polypeptides and methods of use
WO2018213547A1 (fr) * 2017-05-17 2018-11-22 Cold Spring Harbor Laboratory Compositions et méthodes de génération d'allèles faibles dans des plantes
WO2018220582A1 (fr) 2017-05-31 2018-12-06 Tropic Biosciences UK Limited Méthodes de sélection de cellules comprenant des événements d'édition de génome
WO2018220579A1 (fr) 2017-05-31 2018-12-06 Tropic Biosciences UK Limited Compositions et procédés permettant d'augmenter l'extractibilité de solides en provenance de grains de café
WO2018220581A1 (fr) 2017-05-31 2018-12-06 Tropic Biosciences UK Limited Compositions et procédés pour l'augmentation de la durée de conservation de la banane
WO2018224861A1 (fr) 2017-06-07 2018-12-13 International Rice Research Institute Augmentation de la production de semences hybrides par un taux de croisement plus élevé chez des plantes graminacées stériles cytoplasmiques et matériaux et procédés associés
WO2018237197A3 (fr) * 2017-06-21 2019-01-31 Noble Research Institute, Llc Disruption génique sélective médiée par crispr dans des plantes
US11098325B2 (en) 2017-06-30 2021-08-24 Intima Bioscience, Inc. Adeno-associated viral vectors for gene therapy
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
EP4170029A2 (fr) 2017-09-19 2023-04-26 Tropic Biosciences UK Limited Modification de la spécificité de molécules d'arn non codantes végétales pour le silençage de l'expression génique
US11555199B2 (en) 2017-09-19 2023-01-17 Tropic Biosciences UK Limited Modifying the specificity of plant non-coding RNA molecules for silencing gene expression
US11603536B2 (en) 2017-09-29 2023-03-14 Inari Agriculture Technology, Inc. Methods for efficient maize genome editing
US11274311B2 (en) 2017-11-16 2022-03-15 Corteva Agriscience Llc Plant promoter for transgene expression
WO2019099191A1 (fr) * 2017-11-16 2019-05-23 Dow Agrosciences Llc Promoteur végétal pour l'expression transgénique
WO2019118463A1 (fr) 2017-12-15 2019-06-20 Danisco Us Inc Variants de cas9 et procédés d'utilisation
US20210371868A1 (en) * 2017-12-28 2021-12-02 Pioneer Overseas Corporation Flowering time-regulating gene cmp1 and related constructs and applications thereof
US11634722B2 (en) 2018-01-22 2023-04-25 Inari Agriculture Technology, Inc. Plant gene editing systems, methods, and compositions
US11220694B1 (en) 2018-01-29 2022-01-11 Inari Agriculture, Inc. Rice cells and rice plants
US11802288B1 (en) 2018-01-29 2023-10-31 Inari Agriculture Technology, Inc. Methods for efficient soybean genome editing
US11926835B1 (en) 2018-01-29 2024-03-12 Inari Agriculture Technology, Inc. Methods for efficient tomato genome editing
WO2019165199A1 (fr) * 2018-02-22 2019-08-29 Elsoms Developments Ltd Procédés et compositions liés à des lignées de maintenance
WO2019173125A1 (fr) 2018-03-09 2019-09-12 Pioneer Hi-Bred International, Inc. Compositions et procédés de modification d'acides gras du soja
US20210095299A1 (en) * 2018-04-23 2021-04-01 Cas Center For Excellence In Molecular Plant Sciences Repeat-mediated plant site-specific recombination method
WO2019226984A2 (fr) 2018-05-25 2019-11-28 Pioneer Hi-Bred International, Inc. Systèmes et procédés de sélection améliorée par modulation de taux de recombinaison
US11866719B1 (en) 2018-06-04 2024-01-09 Inari Agriculture Technology, Inc. Heterologous integration of regulatory elements to alter gene expression in wheat cells and wheat plants
WO2020005667A1 (fr) 2018-06-29 2020-01-02 Pioneer Hi-Bred International, Inc. Gène nac édité chez les plantes
WO2020036747A1 (fr) 2018-08-13 2020-02-20 Pioneer Hi-Bred International, Inc. Nouveaux récepteurs de toxines insecticides et leur procédé d'utilisation
US11479762B1 (en) 2018-08-31 2022-10-25 Inari Agriculture Technology, Inc. Compositions, systems, and methods for genome editing
US11459551B1 (en) 2018-08-31 2022-10-04 Inari Agriculture Technology, Inc. Compositions, systems, and methods for genome editing
WO2020081173A1 (fr) 2018-10-16 2020-04-23 Pioneer Hi-Bred International, Inc. Cartographie fine résultant d'une édition du génome et identification de gène causal
US11407995B1 (en) 2018-10-26 2022-08-09 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
WO2020092494A1 (fr) 2018-10-31 2020-05-07 Pioneer Hi-Bred International, Inc. Compositions et méthodes pour l'édition génétique médiée par ochrobactrum
US11434477B1 (en) 2018-11-02 2022-09-06 Inari Agriculture Technology, Inc. RNA-guided nucleases and DNA binding proteins
US11518999B1 (en) 2018-11-09 2022-12-06 Inari Agriculture Technology, Inc. Plant transformation
US11807878B2 (en) 2018-12-14 2023-11-07 Pioneer Hi-Bred International, Inc. CRISPR-Cas systems for genome editing
US10934536B2 (en) 2018-12-14 2021-03-02 Pioneer Hi-Bred International, Inc. CRISPR-CAS systems for genome editing
US11453885B1 (en) 2019-02-19 2022-09-27 Inari Agriculture Technology, Inc. Plant transformation
WO2020185907A1 (fr) * 2019-03-11 2020-09-17 Colorado State University Research Foundation Plantes tolérantes aux herbicides et production et détection de celles-ci
WO2020183414A2 (fr) 2019-03-14 2020-09-17 Tropic Biosciences UK Limited Modification de la spécificité de molécules d'arn non codantes pour le silençage de l'expression génique dans des cellules eucaryotes
WO2020183419A1 (fr) 2019-03-14 2020-09-17 Tropic Biosciences UK Limited Introduction d'une activité de silençage sur des molécules d'arn dysfonctionnelles et modification de leur spécificité vis-à-vis d'un gène d'intérêt
WO2020183416A1 (fr) 2019-03-14 2020-09-17 Tropic Biosciences UK Limited Production d'arndb dans des cellules végétales pour la protection antiparasitaire via le silencage génique
WO2020206202A1 (fr) 2019-04-05 2020-10-08 Danisco Us Inc Procédés d'intégration d'une séquence d'adn donneur dans le génome de bacillus à l'aide de constructions d'adn recombinant linéaire et compositions associées
WO2020206197A1 (fr) 2019-04-05 2020-10-08 Danisco Us Inc Procédés d'intégration de polynucléotides dans le génome de bacillus à l'aide de constructions d'adn recombiné double circulaire et compositions correspondantes
US11692197B2 (en) 2019-05-06 2023-07-04 Inari Agriculture Technology, Inc. Delivery of biological molecules to plant cells
WO2020264016A1 (fr) 2019-06-25 2020-12-30 Inari Agriculture, Inc. Édition améliorée du génome de réparation dépendant de l'homologie
US11041172B2 (en) 2019-06-25 2021-06-22 Inari Agriculture, Inc. Homology dependent repair genome editing
US11746354B2 (en) 2019-07-19 2023-09-05 Inari Agriculture Technology, Inc. Homology dependent repair genome editing
WO2021100034A1 (fr) 2019-11-19 2021-05-27 Protalix Ltd. Élimination de constructions à partir de cellules transformées
US20230112792A1 (en) * 2020-03-13 2023-04-13 Pairwise Plants Services, Inc. Methods of introducing variation into plants and products produced therefrom
WO2021183874A1 (fr) * 2020-03-13 2021-09-16 Pairwise Plants Services, Inc. Procédés d'introduction de variation dans des plantes et produits obtenus à partir desdits procédés
WO2021202061A2 (fr) 2020-04-02 2021-10-07 Pioneer Hi-Bred International, Inc. Nouveaux récepteurs de toxines insecticides et leur procédé d'utilisation
WO2021252238A1 (fr) 2020-06-12 2021-12-16 Pioneer Hi-Bred International, Inc. Altération de la composition de graines dans des plantes
US11369073B2 (en) 2020-07-31 2022-06-28 Inari Agriculture Technology, Inc. INIR12 transgenic maize
US11753648B2 (en) 2020-07-31 2023-09-12 Inari Agriculture Technology, Inc. INIR6 transgenic maize
US11326177B2 (en) 2020-07-31 2022-05-10 Inari Agriculture Technology, Inc. INIR12 transgenic maize
US11773397B2 (en) 2020-07-31 2023-10-03 Inari Agriculture Technology, Inc. Modified excisable DAS59122-7 maize transgenic locus
US11214811B1 (en) 2020-07-31 2022-01-04 Inari Agriculture Technology, Inc. INIR6 transgenic maize
US11773398B2 (en) 2020-07-31 2023-10-03 Inari Agriculture Technology, Inc. Modified excisable 5307 maize transgenic locus lacking a selectable marker
US11814630B2 (en) 2020-07-31 2023-11-14 Inari Agriculture Technology, Inc. Modified excisable DAS81419-2 soybean transgenic insect resistance locus
US11788096B2 (en) 2020-07-31 2023-10-17 Inari Agriculture Technology, Inc. Excisable INHT31 transgenic soybean glyphosate tolerance locus
US11814631B2 (en) 2020-07-31 2023-11-14 Inari Agriculture Technology, Inc. Modified excisable MON89034 transgenic maize insect resistance locus
US11359210B2 (en) 2020-07-31 2022-06-14 Inari Agriculture Technology, Inc. INIR12 transgenic maize
US11242534B1 (en) 2020-07-31 2022-02-08 Inari Agriculture Technology, Inc. INHT31 transgenic soybean
US11814632B2 (en) 2020-07-31 2023-11-14 Inari Agriculture Technology, Inc. Modified excisable MON87701 soybean transgenic insect resistance locus
WO2022040134A1 (fr) 2020-08-18 2022-02-24 Pioneer Hi-Bred International, Inc. Gènes de résistance à de multiples maladies et empilements génomiques correspondants
WO2022038536A1 (fr) 2020-08-18 2022-02-24 International Rice Research Institute Procédés d'augmentation des taux de croisement de gramineae
US11198885B1 (en) 2020-09-28 2021-12-14 Inari Agriculture Technology, Inc. Genetic regulatory element
US11976291B2 (en) 2020-09-28 2024-05-07 Inari Agriculture Technology, Inc. Genetically enhanced maize plants
WO2022074646A1 (fr) 2020-10-05 2022-04-14 Protalix Ltd. Cellules végétales inactivées de type dicer
WO2023275245A1 (fr) 2021-07-02 2023-01-05 Tropic Biosciences UK Limited Procédé d'édition de gènes de plant de banane
WO2023275255A1 (fr) 2021-07-02 2023-01-05 Tropic Biosciences UK Limited Retardement ou prévention du brunissement de bananes
GB202112865D0 (en) 2021-09-09 2021-10-27 Tropic Biosciences Uk Ltd Resistance to black sigatoka disease in banana
GB202112866D0 (en) 2021-09-09 2021-10-27 Tropic Biosciences Uk Ltd Resistance to fusarium wilt in a banana
WO2023077118A1 (fr) 2021-11-01 2023-05-04 Flagship Pioneering Innovations Vii, Llc Polynucléotides pour modifier des organismes
WO2023102393A1 (fr) 2021-11-30 2023-06-08 Pioneer Hi-Bred International, Inc. Manipulation de génome chromosomique à grande échelle et à haute efficacité
WO2023141540A2 (fr) 2022-01-20 2023-07-27 Flagship Pioneering Innovations Vii, Llc Polynucléotides pour modifier des organismes
WO2024006802A1 (fr) 2022-06-30 2024-01-04 Pioneer Hi-Bred International, Inc. Procédés et systèmes à médiation par intelligence artificielle pour édition génomique
WO2024005863A1 (fr) 2022-06-30 2024-01-04 Inari Agriculture Technology, Inc. Compositions, systèmes et procédés d'édition génomique
WO2024005864A1 (fr) 2022-06-30 2024-01-04 Inari Agriculture Technology, Inc. Compositions, systèmes et procédés d'édition génomique
EP4299739A1 (fr) 2022-06-30 2024-01-03 Inari Agriculture Technology, Inc. Compositions, systèmes et procédés d'édition de génomes
EP4299733A1 (fr) 2022-06-30 2024-01-03 Inari Agriculture Technology, Inc. Compositions, systèmes et procédés pour l'édition de génomes
WO2024023578A1 (fr) 2022-07-28 2024-02-01 Institut Pasteur Hsc70-4 utilisé dans le silençage génique induit par l'hôte et induit par pulvérisation
WO2024036190A2 (fr) 2022-08-09 2024-02-15 Pioneer Hi-Bred International, Inc. Multiplexage de polynucléotides de guidage
WO2024118882A1 (fr) 2022-12-01 2024-06-06 Genencor International Bv Ingénierie génomique multiplex itérative dans les cellules microbiennes à l'aide d'un système de permutation de marqueurs de sélection
WO2024118881A1 (fr) 2022-12-01 2024-06-06 Genencor International Bv Ingénierie itérative du génome multiplex dans les cellules microbiennes à l'aide d'un système de marqueurs de sélection bidirectionnels
WO2024118876A1 (fr) 2022-12-01 2024-06-06 Genencor International Bv Ingénierie génomique multiplex itérative dans les cellules microbiennes à l'aide d'un système de marqueurs de sélection auto-exécutable recombiné
WO2024123786A1 (fr) 2022-12-06 2024-06-13 Pioneer Hi-Bred International, Inc. Procédés et compositions pour la co-administration d'adn-t exprimant de multiples polynucléotides guides dans des plantes
WO2024137918A1 (fr) 2022-12-21 2024-06-27 Donald Danforth Plant Science Center Peptides antimicrobiens et leurs modifications

Also Published As

Publication number Publication date
MX363842B (es) 2019-04-05
MX2016002306A (es) 2016-07-08
CA3157565A1 (fr) 2015-02-26
BR112016003561B1 (pt) 2022-10-04
WO2015026886A1 (fr) 2015-02-26
CN105916987A (zh) 2016-08-31
ES2729635T3 (es) 2019-11-05
DK3036327T3 (da) 2019-06-11
BR112016003591A2 (pt) 2017-12-05
US20160251667A1 (en) 2016-09-01
US20190376074A1 (en) 2019-12-12
US20190040405A1 (en) 2019-02-07
CA2922040C (fr) 2024-02-27
US20180371479A1 (en) 2018-12-27
US10870859B2 (en) 2020-12-22
EP3036332A1 (fr) 2016-06-29
WO2015026883A1 (fr) 2015-02-26
CA2922040A1 (fr) 2015-02-26
EP3036327A1 (fr) 2016-06-29
US20220177900A1 (en) 2022-06-09
CA2922090A1 (fr) 2015-02-26
EP3036327B1 (fr) 2019-05-08
AU2014308896A1 (en) 2016-03-10
AU2023201788A1 (en) 2023-04-20
CA3221516A1 (fr) 2015-02-26
AU2014308898B2 (en) 2020-05-14
BR112016003561A2 (pt) 2017-12-05
CA2922089A1 (fr) 2015-02-26
CA3109801A1 (fr) 2015-02-26
MX2016002119A (es) 2016-06-23
US11427830B2 (en) 2022-08-30
US20200157554A1 (en) 2020-05-21
EP3036332B1 (fr) 2020-06-24
BR112016003776B1 (pt) 2023-12-12
US20150059010A1 (en) 2015-02-26
AU2020264325A1 (en) 2020-11-26
HUE044916T2 (hu) 2019-11-28
MX2016002266A (es) 2016-07-26
US20230323374A1 (en) 2023-10-12
LT3036327T (lt) 2019-06-25
US20230235345A1 (en) 2023-07-27
BR112016003776A2 (pt) 2017-12-05
CN105829536A (zh) 2016-08-03
EP3473720A1 (fr) 2019-04-24
US11773400B2 (en) 2023-10-03
MX2016002118A (es) 2016-06-28
US20160201072A1 (en) 2016-07-14
EP3036334A1 (fr) 2016-06-29
US20230279413A1 (en) 2023-09-07
US20200063151A1 (en) 2020-02-27
AU2014308900A1 (en) 2016-03-10
EP3036333A1 (fr) 2016-06-29
AU2014308899B2 (en) 2020-11-19
CA3109801C (fr) 2024-01-09
CN105916989A (zh) 2016-08-31
CA2922089C (fr) 2022-07-05
US20240084318A1 (en) 2024-03-14
AU2014308899A1 (en) 2016-03-10
EP3036333B1 (fr) 2022-01-19
CN106133138A (zh) 2016-11-16
AU2014308898A1 (en) 2016-03-03
MX361154B (es) 2018-11-28
BR112016003561B8 (pt) 2022-11-01
BR112016003578A2 (pt) 2017-12-05
WO2015026887A1 (fr) 2015-02-26
WO2015026885A1 (fr) 2015-02-26
CA2922046A1 (fr) 2015-02-26
BR112016003591A8 (pt) 2018-01-30
CA2922090C (fr) 2021-05-18
US20160208271A1 (en) 2016-07-21
MX2018014501A (es) 2020-09-14
EP3611268A1 (fr) 2020-02-19
US10519457B2 (en) 2019-12-31
US20160208272A1 (en) 2016-07-21

Similar Documents

Publication Publication Date Title
US10870859B2 (en) U6 polymerase III promoter and methods of use
US20220364107A1 (en) Agronomic trait modification using guide rna/cas endonuclease systems and methods of use
US10676754B2 (en) Compositions and methods for producing plants resistant to glyphosate herbicide
US20230407417A1 (en) Marker assisted selection of traits for producing meal from brassica napus
US20230193304A1 (en) U6 polymerase iii promoter and methods of use

Legal Events

Date Code Title Description
AS Assignment

Owner name: PIONEER HI-BRED INTERNATIONAL, INC., IOWA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CIGAN, ANDREW MARK;GAO, HUIRONG;LYZNIK, ALEKSANDER L.;AND OTHERS;SIGNING DATES FROM 20140820 TO 20140825;REEL/FRAME:035050/0267

Owner name: E. I. DU PONT DE NEMOURS AND COMPANY, DELAWARE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CIGAN, ANDREW MARK;GAO, HUIRONG;LYZNIK, ALEKSANDER L.;AND OTHERS;SIGNING DATES FROM 20140820 TO 20140825;REEL/FRAME:035050/0267

STCV Information on status: appeal procedure

Free format text: ON APPEAL -- AWAITING DECISION BY THE BOARD OF APPEALS

STCV Information on status: appeal procedure

Free format text: BOARD OF APPEALS DECISION RENDERED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION