WO2022031720A1 - Constructions d'adn contenant des promoteurs d'arn polymérase iii provenant du cannabis, et leurs méthodes d'utilisation - Google Patents

Constructions d'adn contenant des promoteurs d'arn polymérase iii provenant du cannabis, et leurs méthodes d'utilisation Download PDF

Info

Publication number
WO2022031720A1
WO2022031720A1 PCT/US2021/044369 US2021044369W WO2022031720A1 WO 2022031720 A1 WO2022031720 A1 WO 2022031720A1 US 2021044369 W US2021044369 W US 2021044369W WO 2022031720 A1 WO2022031720 A1 WO 2022031720A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleotide sequence
sequence
seq
plant
plant cell
Prior art date
Application number
PCT/US2021/044369
Other languages
English (en)
Inventor
Bridget PREISS
Cayla TSUCHIDA
Randall SHULTZ
Original Assignee
Arcadia Biosciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Arcadia Biosciences, Inc. filed Critical Arcadia Biosciences, Inc.
Publication of WO2022031720A1 publication Critical patent/WO2022031720A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/28—Cannabaceae, e.g. cannabis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • Cannabis is a versatile plant producing products ranging from fiber extracted from stems for paper and textiles, seeds used for food and oil, and floral buds producing secondary metabolites called cannabinoids.
  • Cannabinoids include a range of compounds, including delta-9 tetrahydrocannabinol (“THC”) used for its psychoactive properties and cannabidiol (“CBD”) used for therapeutic purposes such as the treatment of certain types of epilepsy, nausea, pain, and inflammation.
  • THC delta-9 tetrahydrocannabinol
  • CBD cannabidiol
  • Any Cannabis plant or derivative thereof that contains not more than 0.3% THC on a dry-weight basis is defined by the Agricultural Improvement Act of 2018 as hemp. Hemp plants have low levels of the psychoactive THC and may have higher levels of other cannabinoids such as CBD.
  • a promoter is a non-coding genomic DNA sequence, usually upstream (5′) to the relevant sequence, to which RNA polymerase binds before initiating transcription.
  • the nucleotide sequence of the promoter determines the nature of the RNA polymerase and other related factors that attach to the RNA polymerase and/or promoter, and the rate of RNA synthesis.
  • promoters especially promoters capable of controlling the expression of functional RNA sequences in Cannabis and other plants.
  • Many such promoter elements are largely uncharacterized in Cannabis, and heterologous expression of DNA is often most efficient when promoter sequences from the host organism are used to control expression.
  • the use of different promoter, terminator, and other sequences in a vector to control expression of various elements is important in stabilizing a DNA construct. Repeated use of the same sequence element in a DNA construct can lead to homologous recombination or secondary structure formation as well as potential competition for regulatory factors between similar or identical sequences in a DNA construct.
  • the present application is directed to overcoming these and other deficiencies in the art.
  • One aspect of the present application relates to a DNA construct comprising a first nucleotide sequence comprising a Cannabis U6 RNA polymerase III promoter with at least 70% sequence identity to any one of SEQ ID NOs:1-24 or a functional fragment thereof.
  • the DNA construct also has a second nucleotide sequence heterologous to the first nucleotide sequence, where the second nucleotide sequence is operably linked to the first nucleotide sequence, such that the first nucleotide sequence is capable of controlling expression of the second nucleotide sequence.
  • aspects of the present application relate to a vector; cell; and transgenic plant, seed, pollen, floral bud, or clone comprising the DNA construct described herein.
  • Another aspect of the present application relates to a method of expressing a functional RNA sequence in a plant cell.
  • This method involves introducing into a plant cell a DNA construct comprising a first nucleotide sequence comprising a Cannabis U6 RNA polymerase III promoter with at least 70% sequence identity to any one of SEQ ID NOs:1-24, and a second nucleotide sequence heterologous to the first nucleotide sequence, the second nucleotide sequence comprising a functional RNA sequence, where the second nucleotide sequence is operably linked to the first nucleotide sequence such that the first nucleotide sequence is capable of controlling expression of the functional RNA sequence.
  • the method also involves growing the plant cell and selecting a plant cell expressing the functional RNA sequence.
  • a further aspect of the present application relates to a method of modifying a target site in a genome of a plant cell.
  • This method involves introducing a guide RNA and a 118066633.1 genome editing endonuclease into a plant cell, where the guide RNA and genome editing endonuclease are capable of forming a complex that enables the genome editing endonuclease to introduce a double strand break at a target site in a genome of the cell.
  • the guide RNA is expressed by a DNA construct comprising a first nucleotide sequence comprising a Cannabis U6 RNA polymerase III promoter, where the first nucleotide sequence comprises at least 70% sequence identity to any one of SEQ ID NOs:1-24, and a second nucleotide sequence heterologous to the first nucleotide sequence, where the second nucleotide sequence is operably linked to the first nucleotide sequence such that the first nucleotide sequence is capable of controlling expression of the second nucleotide sequence.
  • Introducing the guide RNA and the genome editing endonuclease into the plant cell modifies the target site.
  • Another aspect of the present application relates to a method of altering a plant trait.
  • This method involves introducing into a plant cell a DNA construct comprising a first nucleotide sequence comprising a Cannabis U6 RNA polymerase III promoter, where the first nucleotide sequence comprises at least 70% sequence identity to any one of SEQ ID NOs:1-24, and a second nucleotide sequence comprising a functional RNA sequence operably linked to the first nucleotide sequence, where the first nucleotide sequence is capable of controlling expression of the second nucleotide sequence in the plant cell.
  • the method further involves growing the plant cell and selecting an altered plant cell expressing the functional RNA sequence, wherein the altered plant cell has an altered trait in at least one plant tissue compared to a plant cell not expressing the functional RNA sequence.
  • FIGs.1A-C show an alignment of eight U6 genes from Cannabis.
  • the Cannabis genes are named by their locus designation in the published Cannabis genome sequence (GenBank GCA_900626175.1) and given names based on their chromosomal locations.
  • CsU6-1.1 LOC115708496
  • CsU6-2.1 LOC115721575
  • CsU6-2.2 LOC115721564
  • CsU6-2.3 LOC115721586
  • CsU6-6.1 LOC115696114
  • CsU6-6.2 LOC115696125
  • the aligned sequences in FIGs.1A-C correspond to the promoter regions and their small nuclear RNA (“snRNA”) coding regions as follows: CsU6-1.1 (SEQ ID NO:3 (promoter) and SEQ ID NO:25 (snRNA), CsU6-2.1 (SEQ ID NO:12 (promoter) and SEQ ID NO:28 (snRNA)), CsU6-2.2 (SEQ ID NO:15 (promoter) and SEQ ID NO:29 (snRNA)), CsU6-2.3 (SEQ ID NO:18 (promoter) and SEQ ID NO:30 (snRNA)), CsU6-1.2 (SEQ ID NO:6 (promoter) and SEQ ID NO:26 (snRNA)), CsU6-1.3 (SEQ ID NO:9 (promoter) and SEQ ID NO:27 (snRNA)), CsU6-6.1 (SEQ ID NO:21 (promoter) and SEQ ID NO:31 (snRNA
  • the CsU6 sequences are aligned with Arabidopsis U6-26 (AtU6-26) (nucleotides 1-448 (promoter) and nucleotides 449- 908 (snRNA) of SEQ ID NO:34) and a consensus sequence (in lower case nucleotide designations, but with structural elements in upper case nucleotide designations) (SEQ ID NO:77).
  • the conserved upstream sequence elements (“USE”) and TATA boxes (“TATA”) are boxed.
  • the transcriptional start site is indicated with an arrow (FIG.1C).
  • the Cannabis U6 promoter SEQ ID NOs. listed above include the first G nucleotide of the snRNA coding sequence.
  • FIGs.2A-E show embodiments of vectors described herein with DNA constructs comprising the Cannabis U6 promoter of SEQ ID NO:1.
  • FIG.2A is a schematic illustration of vector pARC1147, which has Cannabis U6 promoter CsU6-1.1 (300 bp), BsaI restriction sites, and bH-term sequence with flanking AvrII sites in the pUC57 vector.
  • FIG.2B is a schematic illustration of vector pARC1188, which has the insertion of a guide RNA target sequence after cutting pARC1147 (FIG.2A) with BsaI.
  • FIG.2C shows exemplary nucleotide sequences (SEQ ID NOs:1, 49, and 35) cloned between the AvrII sites of the pARC1188 vector of FIG.2B.
  • FIG. 2D is a schematic illustration of vector pARC1294, which is a vector for use in particle bombardment and contains an AvrII site to clone in the gRNA cassette from pARC1188 (FIG. 2B).
  • d35S promoter driving Cas9 with a CaMV 3′UTR and a Parsley Ubiquitin promoter driving a plant selectable marker, NPTII, with a CaMV 3′ UTR.
  • FIG.2E is a schematic illustration of vector pARC1269 showing the guide RNA cassette from vector pARC1188 (FIGs. 2B-2C) cloned into the AvrII site of pARC1294 (FIG.2D).
  • FIG.3 is a schematic illustration showing guide RNA target sites in the GUSPlus gene coding sequence corresponding to SEQ ID NOs:39-50. 118066633.1
  • FIGs.4A-D are sequence alignments of different Cannabis U6 promoter sequences.
  • FIGs.4A-B show an alignment of Cannabis U6 promoter sequences (CsU6-1.1 (600bp)) from Cannabis variety CBDRx (“CsU6-1.1_Cs10”, SEQ ID NO:3) and hemp varieties BaOX (“CsU6-1.1_BaOx”, SEQ ID NO:53), a Z2 female (“CsU6-1.1_Z2-F”, SEQ ID NO:54), and a Z2 male (“CsU6-1.1_Z2-M”, SEQ ID NO:55).
  • FIGs.4C-D are sequence alignments of Cannabis U6 promoter sequences CsU6-2.1(600bp)) from Cannabis variety CBDRx, (“CsU6- 2.1_Cs10”, SEQ ID NO:12) and hemp varieties BaOX (“CsU6-2.1_BaOx”, SEQ ID NO:62), a Z2 female (“CsU6-2.1_Z2-F”, SEQ ID NO:63), and a Z2 male (“CsU6-2.1_Z2-M”, SEQ ID NO:64).
  • FIGs.5A-B are bar graphs showing relative expression of gRNAs from each promoter construct as calculated using the endogenous Cannabis gene, TIP41-like, as a standard.
  • FIG.5A shows the initial screen of Cannabis U6 promoter expression.
  • Vectors are ordered by size (300 bp, 450 bp, and 600 bp) and grouped by gene.
  • the horizontal box shows the range of expression of gRNA by AtU6-26.
  • Arabidopsis U6 Arabidopsis U6
  • the vertical boxed constructs in FIG.5A identify the promoters chosen for further study. Additional qPCR assays repeated with technical duplicates is shown in FIG.5B.
  • the vertical rectangle in FIG.5B shows those Cannabis U6 promoters chosen to be carried forward for further experiments as described in Example 6.
  • FIGs.6A-B are photographs of calli transformed with the GUSPlus construct described in Example 5 and stained with X-Gal solution to show Gus activity.
  • FIG.6A shows the initial expression of stably transformed calli created in Example 5.
  • FIG.6B shows an example of calli from Example 5 (FIG.6A) transformed with Cannabis U6 promoter pARC1286. After transformation with pARC1286, this image shows inactive GUS gene expression, indicating editing (white calli), or were unedited and actively expressing GUS (blue calli). Blue calli with white spots or white calli with blue spots indicate later editing of some cells after subculturing the callus, which then proliferated. Light blue indicates either partial GUS expression from editing or incomplete staining.
  • the present application relates to DNA constructs comprising a Cannabis U6 RNA polymerase III promoter; vectors, cells, and transgenic plants and plant parts containing the DNA constructs; and methods of using the DNA constructs. 118066633.1
  • One aspect of the present application relates to a DNA construct comprising a first nucleotide sequence comprising a Cannabis U6 RNA polymerase III promoter with at least 70% sequence identity to any one of SEQ ID NOs:1-24 or a functional fragment thereof.
  • the DNA construct also has a second nucleotide sequence heterologous to the first nucleotide sequence, where the second nucleotide sequence is operably linked to the first nucleotide sequence, such that the first nucleotide sequence is capable of controlling expression of the second nucleotide sequence.
  • Other aspects of the present application relate to a vector; cell; and transgenic plant, seed, pollen, floral bud, or clone comprising the DNA construct described herein.
  • U6 is a small nuclear RNA (snRNA) which, along with other snRNAs such as U1, U2, and U4, is a component of a splicesosome involved in RNA intron processing. snRNAs can combine with protein factors to form an RNA-protein complex called small nuclear ribonucleoprotein (snRNP). U6 snRNA is transcribed by RNA polymerase III, typically requiring a guanosine residue as the start and 4 or more thymidine residues as the transcriptional terminator.
  • snRNA small nuclear RNA
  • snRNP small nuclear ribonucleoprotein
  • nucleotide refers to a nucleotide or protein of the present application.
  • isolated refers to a synthesized, cloned, and/or partial sequence from the naturally-occurring sequence.
  • promoter refers to a nucleic acid fragment capable of controlling transcription of another nucleic acid fragment.
  • a promoter is a non-coding genomic DNA sequence, usually upstream (5′) to the relevant coding sequence, and its primary function is to act as a binding site for RNA polymerase to initiate transcription by the RNA polymerase.
  • RNA including functional RNA, or the expression of polypeptide for operably linked encoding nucleotide sequences, as the transcribed RNA ultimately may be translated into the corresponding polypeptide. Promoters vary in their “strength” (i.e., their ability to promote transcription).
  • the nucleotide sequence of the promoter determines the nature of the RNA polymerase binding and other related protein factors that attach to the RNA polymerase and/or promoter, and the rate of RNA synthesis.
  • Promoter sequences in general include proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an “enhancer” is a 118066633.1
  • DNA sequence that can stimulate promoter activity may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter.
  • Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene or functional RNA in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Since, in many cases, the exact boundaries of regulatory sequences have not been completely defined, a functional fragment of some variation of the promoter may also have promoter activity.
  • annabis U6 RNA polymerase III promoter As used herein, the terms “Cannabis U6 RNA polymerase III promoter”, “CsU6 promoter”, and “U6 promoter” are used interchangeably, and refer to the promoter of a Cannabis U6 gene, or a functional fragment thereof.
  • the term “Cannabis U6 promoter” includes both (i) a native Cannabis U6 RNA polymerase III promoter (or a functional fragment thereof) and (ii) an engineered sequence (a) comprising at least a fragment of the native Cannabis U6 RNA polymerase III promoter with, for example, a DNA linker attached to facilitate cloning or (b) that functions like a native Cannabis U6 RNA polymerase III promoter.
  • a DNA linker may, without limitation, comprise a restriction enzyme site or homologous ends to a destination vector.
  • the Cannabis U6 RNA polymerase III promoter includes, without limitation, a sequence disclosed in SEQ ID NOs:1-24.
  • the promoter may include the nucleotide sequence of SEQ ID NO:1.
  • the promoter may include the nucleotide sequence of SEQ ID NO:2.
  • the promoter may include the nucleotide sequence of SEQ ID NO:3.
  • the promoter may include the nucleotide sequence of SEQ ID NO:4.
  • the promoter may include the nucleotide sequence of SEQ ID NO:5.
  • the promoter may include the nucleotide sequence of SEQ ID NO:6. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:7. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:8. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:9. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:10. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:11. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:12.
  • the promoter may include the nucleotide sequence of SEQ ID NO:13. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:14. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:15. In some 118066633.1
  • the promoter may include the nucleotide sequence of SEQ ID NO:16. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:17. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:18. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:19. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:20. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:21. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:22.
  • the promoter may include the nucleotide sequence of SEQ ID NO:23. In some embodiments, the promoter may include the nucleotide sequence of SEQ ID NO:24. Also encompassed are promoters with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity to any one of SEQ ID NOs:1-24 or a functional fragment thereof.
  • the Cannabis U6 RNA polymerase III promoter comprises at least 80% sequence identity to any one of SEQ ID NOs:1- 24, or a functional fragment thereof. In some embodiments, the Cannabis U6 RNA polymerase III promoter comprises at least 90% sequence identity to any one of SEQ ID NOs:1-24, or a functional fragment thereof. In some embodiments, the Cannabis U6 RNA polymerase III promoter comprises at least 95% sequence identity to any one of SEQ ID NOs:1-24, or a functional fragment thereof. And in some embodiments, the Cannabis U6 RNA polymerase III promoter comprises any one of SEQ ID NOs:1-24, or a functional fragment thereof.
  • the Cannabis U6 RNA polymerase III promoter sequence comprises any one of SEQ ID NOs:53-76, or a functional fragment thereof.
  • the nucleotide sequences of SEQ ID NOs: 53-76 are set forth in Table 5 (infra).
  • the term “functional fragment” refers to a portion or subsequence of the Cannabis U6 RNA polymerase III promoter with the ability to initiate or control transcription of a heterologous nucleotide sequence.
  • the functional fragment includes the USE and/or TATA elements.
  • the functional fragment includes only one or neither of the USE or TATA elements.
  • the promoters disclosed herein can be modified.
  • promoters that have variations in the nucleotide sequence.
  • the nucleotide sequence of the promoters of the present application as shown in SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 may be modified or altered to enhance their control characteristics.
  • modification or alteration of the promoter sequence can be made without substantially affecting 118066633.1
  • FIG.4A shows sequence variation between Cannabis CsU6-2.1(600 bp) sequences from three different varieties (including a male and female plant of one variety).
  • sequence identity means that sequences are identical (i.e., on a nucleotide-by-nucleotide basis for nucleic acids or amino acid-by-amino acid basis for polypeptides) over a window of comparison. Methods to calculate sequence identity are known to those of skill in the art.
  • sequence alignments and percent identity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the Multalin program (Corpet, “Multiple Sequence Alignment with Hierarchical Clustering,” Nucleic Acids Res.16:10881-90 (1988), which is hereby incorporated by reference in its entirety), or the Megalign ® program of the LASERGENE ® bioinformatics computing suite (DNASTAR ® Inc., Madison, Wis.). Sequences may also be aligned using algorithms known in the art including, but not limited to, CLUSTAL V algorithm or the BLASTN or BLAST 2 sequence programs.
  • the DNA construct of the present application comprises a second heterologous nucleotide sequence operably linked to the first nucleotide sequence comprising a Cannabis U6 RNA polymerase III promoter.
  • a promoter is capable of controlling the expression of an operably linked sequence.
  • operably linked refers to an association of nucleotide sequences such that the function of one is affected by the other.
  • a nucleotide promoter sequence may be operably linked to a nucleotide sequence encoding a functional RNA if it affects the transcription of the nucleotide sequence encoding the functional RNA.
  • Other elements of the DNA construct may also be operably linked.
  • the second nucleotide sequence is heterologous to the first nucleotide sequence.
  • a “heterologous” nucleotide sequence refers to a sequence that is not naturally occurring with the Cannabis U6 RNA polymerase III promoter sequences described herein. While the second nucleotide sequence is heterologous to the first nucleotide sequence, it may be homologous, native, heterologous, or 118066633.1
  • a promoter operably linked to a heterologous nucleotide sequence refers to a nucleotide sequence from an organism or species different from that from which the promoter was derived, or, if from the same organism or species, a nucleotide sequence which is not naturally associated with the promoter (e.g., a functional RNA or a guide RNA sequence).
  • the second nucleotide sequence of the DNA construct encodes a molecule selected from the group consisting of a guide RNA, a functional RNA, a reporter coding sequence, a selection marker, a disease resistance conferring coding sequence, a herbicide resistance conferring coding sequence, a terpene metabolism conferring coding sequence, a cannabinoid metabolism conferring coding sequence, a fiber quality conferring coding sequence, a yield conferring coding sequence, a plant architecture conferring coding sequence, a transcriptional regulator conferring coding sequence, an insect resistance conferring coding sequence, a carbohydrate metabolism coding sequence, a fatty acid metabolism coding sequence, an amino acid metabolism coding sequence, a drought resistance coding sequence, a cold resistance coding sequence, a heat resistance coding sequence, a salt resistance coding sequence, and combinations thereof.
  • the second nucleotide sequence of the DNA construct encodes a functional RNA molecule.
  • the term “functional RNA” refers to an RNA molecule that may not be translated but has a biological role. Suitable functional RNA molecules include, but are not limited to, guide RNA (“gRNA”), short hairpin RNA (“shRNA”), microRNA (“miRNA”), artificial micro RNA (“amiRNA”), RNA interference (“RNAi”), small interfering RNA (“siRNA”), CRISPR RNA (“crRNA”), trans-activating CRISPR RNA (“tracrRNA”), antisense RNA, transfer RNA (“tRNA”), and ribosomal RNA (“rRNA”).
  • gRNA guide RNA
  • shRNA short hairpin RNA
  • miRNA microRNA
  • amiRNA artificial micro RNA
  • RNAi RNA interference
  • siRNA small interfering RNA
  • crRNA CRISPR RNA
  • tracrRNA trans-activating CRISPR RNA
  • the functional RNA molecule is selected from the group consisting of crRNA, tracrRNA, miRNA, and guide RNA.
  • the second nucleotide sequence of the DNA construct encodes a guide RNA.
  • the guide RNA comprises a first nucleotide sequence domain that is complementary to a nucleotide sequence in a target DNA (a guide RNA targeting sequence) and a second nucleotide sequence domain that interacts with a genome editing endonuclease.
  • the second nucleotide sequence encodes a single guide RNA that is capable of forming a guide RNA/genome editing endonuclease complex, where the guide RNA hybridizes to a DNA target site.
  • guide RNA refers to an RNA molecule that can target a genome editing protein to a specific location within a target sequence.
  • the guide RNA is a 118066633.1
  • the guide RNA can form a complex with genome editing endonuclease such as a type II Cas endonuclease, where the guide RNA/Cas endonuclease complex can direct the genome editing endonuclease to a genomic target site, enabling the genome editing endonuclease to introduce a single or double strand break into the genomic target site.
  • genome editing endonuclease such as a type II Cas endonuclease
  • the guide RNA does not comprise a tracrRNA sequence such as when used with the Cpf1 genome editing endonuclease.
  • Methods of designing guide RNA sequences are well known in the art and are described in more detail in, e.g., U.S. Patent No.8,697,359 and U.S. Patent No.9,023,649, both of which are hereby incorporated by reference in their entirety.
  • target site As used herein, the terms “target site”, “targeting sequence”, “target DNA”, “genomic target site”, and “genomic target sequence” are interchangeable and refer to a nucleotide sequence in the genome (including chloroplast, mitochondrial DNA, plasmid DNA) of a cell at which a single or double-strand break is induced in the cell genome by a genome editing endonuclease.
  • the target site can be an endogenous site in the genome of a cell or, alternatively, the target site can be heterologous to the cell and thereby not be naturally occurring in the genome of the cell, or the target site can be found in a heterologous genomic location compared to where it occurs in nature.
  • the DNA construct is used in concert with a genome editing endonuclease.
  • the genomic target sequence can be modified or permanently disrupted.
  • the guide RNA/genome editing endonuclease complex is recruited to the target sequence by the base- pairing between the guide RNA sequence and the complementary sequence of the target sequence in the genomic DNA.
  • the term “genome editing endonuclease”, “genome editing protein”, or “Cas endonuclease” refers to a protein such as a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) associated nuclease.
  • CRISPR associated nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cpf1, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, CasX, CasY, Mad7, homologs thereof, or modified versions, and endonuclease inactive versions thereof.
  • CRISPR guide RNA in conjunction with CRISPR-Cas9 technology to target RNA is described in Wiedenheft et al., “RNA-Guided Genetic Silencing Systems in Bacteria and Archaea,” Nature 482:331-338 (2012); Zhang et al., “Multiplex Genome Engineering Using CRISPR/Cas Systems,” Science 339:819-23 (2013); and Gaj et al., “ZFN, TALEN, and CRISPR/Cas-based Methods for Genome Engineering,” Cell 31:397-405 (2013), which are hereby incorporated by reference in their entirety.
  • the genome editing endonuclease is Cas9, but can also be an endonuclease from one of many related CRISPR systems that have been described.
  • Cas9 refers to a Cas endonuclease of a type II CRISPR system that forms a complex with a crRNA and a tracrRNA, or with a guide RNA, for specifically recognizing and cleaving all or part of a DNA target sequence.
  • a Cas9 can be in complex with a CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA).
  • a Cas9 can be in complex with a guide RNA.
  • the Cas endonuclease gene is a plant optimized Cas9 endonuclease gene.
  • plant codon-optimized means that the coding sequence has been optimized to improve expression, such as by reducing the use of rarely used codons in plants. Codons can be further optimized for use in monocot or dicot plants, or for a specific plant species.
  • the Cas endonuclease gene is a Cpf1 or a Mad7 endonuclease.
  • the recognition and cutting of a target sequence by a genome editing endonuclease occurs if the correct protospacer-adjacent motif (“PAM”) is located at or adjacent to the 3′ end of the DNA target sequence.
  • PAM protospacer-adjacent motif
  • Cas9 will cut 3-4 nucleotides upstream of the PAM sequence.
  • a double strand break (“DSB”) in DNA can be repaired through one of two general repair pathways: (1) non-homologous end joining (“NHEJ”) DNA repair pathway or (2) the homologous directed repair (“HDR”) pathway.
  • NHEJ non-homologous end joining
  • HDR homologous directed repair
  • the NHEJ repair pathway often results in insertions/deletions (“InDels”) at the DSB site that can lead to frameshifts and/or premature stop codons, effectively disrupting the open reading frame (“ORF”) of the targeted gene.
  • the HDR pathway requires the presence of a repair template, which is used to fix the DSB. HDR faithfully copies the sequence of the repair template to the cut target sequence. Specific nucleotide changes can be introduced into a targeted gene by the use of HDR with a repair template.
  • a prerequisite for cleavage for Cas is the presence of a conserved PAM downstream of the target DNA.
  • the sequence and length of a PAM can differ depending on the Cas protein or Cas protein complex used, but are typically 2, 3, 4, 5, 6, 7, or 8 nucleotides long. 118066633.1
  • a PAM has the sequence 5'-NGG-3' but less frequently NAG. Specificity is provided by the sequence approximately 12 bases upstream of the PAM, which matches between the RNA and target DNA.
  • Cpf1 acts in a similar manner to Cas9, but Cpf1 does not require a tracrRNA and it recognizes a T-rich PAM sequence adjacent to the 5′ end of the DNA target sequence. Specificity of the CRISPR/Cas system is based on the guide RNA that use complementary base pairing to recognize target DNA sequences.
  • the DNA construct comprises a single guide RNA. In other embodiments, the DNA construct comprises two or more guide RNAs.
  • the DNA construct comprises single or multiple crRNA and a tracrRNA.
  • Single or multiple guide RNAs can promote the generation of mutations or promote homologous recombination when HDR repair DNA vectors for targeted integration are co-delivered with crRNA molecule(s) enabling the targeted mutagenesis or homologous recombination at single or multiple sites in the plant genome.
  • additional regulatory sequences may be present in the DNA construct including 3' non-translated sequences, 3' transcription termination regions, and polyadenylation regions.
  • nucleotide sequence of interest can include nucleotides that provide polyadenylation signal and/or other regulatory signals capable of affecting transcription or RNA processing.
  • An exemplary 3′ terminator sequence is listed in SEQ ID NO:38. Additional exemplary 3′ regulatory regions include, without limitation, the nopaline synthase (“NOS”) 3′ regulatory region (Fraley et al., “Expression of Bacterial Genes in Plant Cells,” Proc. Nat’l Acad. Sci.
  • NOS nopaline synthase
  • An additional aspect of the present application relates to a vector comprising the DNA constructs described herein.
  • a “vector” means any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, virion, T-DNA vector, etc., which is capable of replication when associated with the proper control elements, and/or which is capable of transferring gene sequences into cells.
  • the term includes cloning and expression vectors, as well as viral vectors.
  • the vector includes left and right Agrobacterium T-DNA border sequences (Peralta and Ream, “T-DNA Border Sequences Required for Crown Gall Tumorigenesis,” Proc. Natl. Acad. Sci.82:5112-5116 (1985), which is hereby incorporated by 118066633.1
  • border sequences allow the introduction of heterologous DNA located between the left and right T-DNA border sequences into a host cell when using Agrobacterium-mediated DNA transformation.
  • Standard cloning procedures known in the art can be used to prepare the DNA construct and/or the vector, such as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor: Cold Spring Harbor Laboratory Press, New York (2001), which is hereby incorporated by reference in its entirety.
  • the vector comprising the DNA construct is introduced into a host cell.
  • “Introduced” includes reference to the incorporation of a nucleotide into a eukaryotic or prokaryotic cell, where the nucleotide may be incorporated into the genome of the cell, and includes reference to the transient provision of a nucleotide or protein to the cell. “Introduced” includes reference to stable or transient transformation methods, as well as sexually crossing.
  • nucleotide fragment in the context of inserting a nucleotide fragment (e.g., a DNA construct/expression construct) into a cell, means “transfection”, “transformation”, or “transduction” and includes reference to the incorporation of a nucleotide fragment into a eukaryotic or prokaryotic cell where the nucleotide fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed.
  • DNA constructs and vectors can be introduced into cells via transformation.
  • transformation refers to both stable transformation and transient transformation.
  • transient transformation refers to the introduction of the DNA construct into the plant cell of a host organism resulting in gene expression without genetically stable inheritance.
  • stable transformation refers to the introduction of the DNA construct into a genome of a host organism resulting in genetically stable inheritance. Once stably transformed, the nucleotide fragment is stably integrated in the genome of the host organism and any subsequent generation.
  • selectable markers may also be used to select for plants or plant cells that comprise a DNA construct. Selection of transformed cells comprising the DNA construct utilizes an antibiotic or other compound useful for selective growth as a supplement to the media.
  • the compound to be used will be dictated by the selectable marker element present in the vector with which the host cell was transformed.
  • the marker may encode biocide resistance, antibiotic resistance (e.g., kanamycin, Geneticin (G418), bleomycin, hygromycin, etc.), or herbicide resistance (e.g., glyphosate, glufosinate, etc.).
  • antibiotic resistance e.g., kanamycin, Geneticin (G418), bleomycin, hygromycin, etc.
  • herbicide resistance e.g., glyphosate, glufosinate, etc.
  • selectable markers include, 118066633.1
  • a neo gene which codes for kanamycin resistance and can be selected for using kanamycin, G418, etc.; a bar gene which codes for bialaphos resistance; a mutant EPSP synthase gene which encodes glyphosate resistance; a nitrilase gene which confers resistance to bromoxynil; a mutant acetolactate synthase gene (ALS) which confers imidazolinone or sulfonylurea resistance; and a methotrexate resistant DHFR gene.
  • selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, spectinomycin, rifampicin, streptomycin and tetracycline, etc. Examples of selectable markers are illustrated in, e.g., U.S. Patent Nos.5,550,318; 5,633,435; 5,780,708; and 6,118,047, which are hereby incorporated by reference in their entirety.
  • reporter genes that encode enzymes providing for production of an identifiable compound, or other markers which indicate relevant information regarding the outcome of transformation are used for selection.
  • a widely used reporter gene has been uidA, a gene from Escherichia coli that encodes the ⁇ -glucuronidase protein, also known as GUS (Jefferson et al., “GUS Fusions: ⁇ -Glucuronidase as a Sensitive and Versatile Gene Fusion Marker in Higher Plants,” EMBO J.6:3901-3907 (1987); and GUSPlus, (Vickers et al., “pGFPGUSPlus, a New Binary Vector for Gene Expression Studies and Optimizing Transformation Systems in Plants,” Biotechnol Lett.11:1793-1796 (2007), which are hereby incorporated by reference in their entirety).
  • reporter genes include a GFP gene from A. victoria which encodes for green fluorescent light emission under UV light (Chalfie et al., “Green Fluorescent Protein as a Marker For Gene Expression,” Science 263:802-805 (1994), which is hereby incorporated by reference in its entirety); other fluorescent protein markers (Shaner et al., “Improved Monomeric Red, Orange and Yellow Fluorescent Proteins Derived from Discosoma sp. Red Fluorescent Protein,” Nat.
  • transient or stable transformation is performed using particle bombardment (also known as biolistic transformation).
  • particle bombardment involves propelling inert or biologically active particles at cells. This technique is disclosed, for example in Klein et al., “High-Velocity Microprojectiles for Delivering Nucleic Acids Into Living Cells,” Nature 327:70-73 (1987), which is hereby incorporated by reference in its entirety, and is also known as biolistic transformation of the host cell, as disclosed in U.S.
  • this procedure involves propelling inert or biologically active particles at the cells under conditions effective to penetrate the outer surface of the cell and to be incorporated within the interior thereof.
  • the vector can be introduced into the cell by coating the particles with the vector containing the heterologous DNA.
  • the target cell can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle.
  • Biologically active particles e.g., dried bacterial cells containing the vector and heterologous DNA
  • biolistic methods use gold or tungsten particles typically of 0.5 to 2 micrometers in size and coated with DNA, RNA, or ribonucleotide particles that has been precipitated onto the particles; the particles are discharged using a “gene gun” powered by a gas at high pressure (typically hundreds to thousands pounds per square inch) onto a plant held in an evacuated chamber. More recent biolistic methods using equipment such as the Helios ® gene gun (Bio-Rad Laboratories, Inc.) use lower pressures (in the hundreds pounds per square 118066633.1
  • Biologically active particles e.g., dried bacterial cells containing the vector and heterologous DNA
  • Other variations of particle bombardment now known or hereafter developed, can also be used.
  • delivery of the DNA construct for modification of a plant genome can be accomplished by plant transformation including, for example, infection with a microbe, such as Rhizobia or Agrobacterium infection.
  • the Ti (or Ri) plasmid of Agrobacterium enables the highly successful transfer of a foreign nucleotide molecule into plant cells.
  • transformation involves fusion of protoplasts with other entities, either minicells, cells, lysosomes, or other fusible lipid-surfaced bodies (Fraley et al., “Liposome-Mediated Delivery of Tobacco Mosaic Virus RNA into Tobacco Protoplasts: A Sensitive Assay for Monitoring Liposome-Protoplast Interactions,” Proc. Natl. Acad. Sci.
  • transformation can be accomplished by electroporation (Fromm et al., “Expression of Genes Transferred into Monocot And Dicot Plant Cells by Electroporation,” Proc. Natl. Acad. Sci. USA 82:5824 (1985), which is hereby incorporated by reference in its entirety).
  • plant protoplasts are electroporated in the presence of plasmids containing the expression cassette. Electrical impulses of high field strength reversibly permeabilize biomembranes allowing the introduction of the plasmids. Electroporated plant protoplasts reform the cell wall, divide, and regenerate.
  • transformation can be accomplished through PEG- mediated DNA transfer, microinjection, or vacuum infiltration to provide for stable or transient expression of the DNA construct.
  • Other methods of transformation include polyethylene- mediated plant transformation, micro-injection, physical abrasives, and laser beams (Senior, “Uses of Plant Gene Silencing,” Biotechnology and Genetic Engineering Reviews 15:79-119 (1998), which is hereby incorporated by reference in its entirety).
  • transformation can be enhanced by the use of a suitable microbe, such as a Rhizobia microbe, or an Agrobacterium, to facilitate DNA uptake by plant cells.
  • wounding of a target plant tissue prior to or during DNA delivery for example using Agrobacterium or a Rhizobia species, such as Ensifer adhaerens, may be employed.
  • Various methods of wounding are employed in plant transformation methods, 118066633.1
  • a cell comprises the DNA construct.
  • the cell comprising the DNA construct is a plant cell.
  • plant cell includes, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, cotyledons, hypocotyls, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, microspores cotyledon, zygotic and somatic embryos, protoplasts, pollen, embryos, anthers, and the like.
  • the means of transformation chosen is that most suited to the tissue to be transformed.
  • the DNA construct is introduced into a plant.
  • plant includes reference to whole plants, plant organs, plant tissues, seeds, cuttings, clones, and progeny of same.
  • the DNA construct is not incorporated into the plant’s genome.
  • the plant cell comprising the DNA construct is from a monocot. Monocots are well known to those of skill in the art. Examples of monocots include rice, maize, sorghum, wheat, barley, and oats. In some embodiments, the monocot cell is a rice cell. [0064] In other embodiments, the plant cell comprising the DNA construct is from a dicot. Dicots are well known to those of skill in the art, an include the family Cannabaceae, among a vast number of other families.
  • dicots examples include Cannabis, hops, soybean, alfalfa, sunflower, cotton, canola, and sugar beet, to name a few.
  • “Cannabis” refers to a genus of flowering plants in the family Cannabaceae, and includes at least three recognized species: Cannabis sativa, Cannabis indica, and Cannabis ruderalis.
  • Various types of Cannabis plants can exist within the same species including narrow leaf and broad leaf types, as well as medicinal and non-medicinal types. Cannabis is also classified based on cannabinoid content into 5 classes referred to as chemotypes or chemovars.
  • Chemotype 1 (marijuana) has high tetrahydrocannabinolic acid (THC) and low cannabidiol (CBD) content.
  • Chemotype 2 has approximately equal amounts of THC and CBD.
  • Chemotype 3 (hemp) has high CBD and low THC.
  • Chemotype 4 has high CBG, a precursor of THC and CBD.
  • Chemotype 5 does not produce cannabinoids.
  • the plant cell comprising the DNA construct described in the present application is from a Cannabis plant. 118066633.1
  • the transformed plant cells can be regenerated.
  • Means for regeneration vary from species to species of plants, but generally a petri plate containing explants or a suspension of transformed protoplasts is first provided. Callus tissue is formed and transformation of callus tissue can be performed. Shoots may be induced from callus and subsequently rooted. Alternatively, embryo formation can be induced in the callus tissue. These embryos germinate as natural embryos to form plants.
  • the culture media will generally contain various amino acids and hormones, such as auxin and cytokinins. Efficient regeneration will depend on the medium, on the genotype, and on the history of the culture.
  • Transformed cells may first be identified using a selection marker simultaneously introduced into the host cells along with the DNA construct or vector of the present application. Suitable selection markers are described above. Cells or tissues are grown on a selection medium containing the appropriate antibiotic, whereby generally only those transformants expressing the antibiotic resistance marker continue to grow. Other types of markers are also suitable for inclusion in the vector of the present application, such as reporter genes as described above. The selection employed will depend on the target species; for certain target species, different antibiotics, herbicide, or biosynthesis selection markers may be preferred. [0067] Plant cells and tissues selected by means of an inhibitory agent or other selection marker are then tested for the acquisition of the DNA construct. In some embodiments, a transgenic plant comprises the DNA construct.
  • a “transgenic” plant or plant cell comprises within its genome a heterologous nucleotide introduced by transformation.
  • the heterologous nucleotide is stably integrated within the genome such that the nucleotide is passed on to successive generations.
  • “genome” as it applies to plant cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components (e.g., mitochondrial, plastid) of the cell.
  • the heterologous nucleotide may be integrated into the genome alone or as part of a DNA construct.
  • a transgenic plant can also comprise more than one heterologous nucleotide within its genome.
  • Each heterologous nucleotide may confer a different trait to the transgenic plant.
  • a heterologous nucleotide can include a sequence that originates from a foreign species or, if from the same species, can be substantially modified from its native form.
  • “Transgenic” can include any cell, cell line, callus, tissue, plant part, or plant, or clone, the genotype of which has been altered by the presence of a heterologous nucleotide including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic plant.
  • a transgenic plant comprises the DNA construct stably incorporated into the plant’s genome.
  • transgenic seed, pollen, floral buds, or clones of the transgenic plant comprise the DNA construct.
  • the alterations of the genome (chromosomal or extra-chromosomal) by genome editing procedures that do not result in an insertion of a foreign polynucleotide, or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non- recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation are not intended to be regarded as transgenic.
  • Another aspect of present application relates to a method of expressing a functional RNA sequence in a plant cell.
  • This method involves introducing into a plant cell a DNA construct comprising a first nucleotide sequence comprising a Cannabis U6 RNA polymerase III promoter with at least 70% sequence identity to any one of SEQ ID NOs:1-24, and a second nucleotide sequence heterologous to the first nucleotide sequence, the second nucleotide sequence comprising a functional RNA sequence, where the second nucleotide sequence is operably linked to the first nucleotide sequence such that the first nucleotide sequence is capable of controlling expression of the functional RNA sequence.
  • the method also involves growing the plant cell and selecting a plant cell expressing the functional RNA sequence.
  • the first nucleotide sequence may comprise a Cannabis U6 RNA polymerase III promoter with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity to any one of SEQ ID NOs:1-24 or a functional fragment thereof.
  • a further aspect of the present application relates to a method of modifying a target site the genome of a plant cell.
  • This method involves introducing a guide RNA and a genome editing endonuclease into a plant cell, where the guide RNA and genome editing endonuclease are capable of forming a complex that enables the genome editing endonuclease to introduce a double strand break at a target site in the cell.
  • the guide RNA is expressed by a DNA construct comprising a first nucleotide sequence comprising a Cannabis U6 RNA polymerase III promoter, where the first nucleotide sequence comprises at least 70% sequence identity to any one of SEQ ID NOs:1-24, and a second nucleotide sequence heterologous to the first nucleotide sequence, where the second nucleotide sequence is operably linked to the first 118066633.1
  • nucleotide sequence such that the first nucleotide sequence is capable of controlling expression of the second nucleotide sequence.
  • Introducing the guide RNA and the genome editing endonuclease into the plant cell modifies the target site.
  • the first nucleotide sequence may comprise a Cannabis U6 RNA polymerase III promoter with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity to any one of SEQ ID NOs:1-24 or a functional fragment thereof.
  • Another aspect of embodiments of the present application relates to a method of altering a plant trait.
  • This method involves introducing into a plant cell a DNA construct comprising a first nucleotide sequence comprising a Cannabis U6 RNA polymerase III promoter, where the first nucleotide sequence comprises at least 70% sequence identity to any one of SEQ ID NOs:1-24, and a second nucleotide sequence comprising a functional RNA sequence operably linked to the first nucleotide sequence, where the first nucleotide sequence is capable of controlling expression of the second nucleotide sequence in the plant cell.
  • the method further involves growing the plant cell and selecting an altered plant cell expressing the functional RNA sequence, where the altered plant cell has an altered trait in at least one plant tissue compared to a plant cell not expressing the functional RNA sequence.
  • the first nucleotide sequence may comprise a Cannabis U6 RNA polymerase III promoter with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity to any one of SEQ ID NOs:1-24 or a functional fragment thereof.
  • the trait is selected from the group consisting of disease resistance, herbicide resistance, insect resistance, terpene content, cannabinoid content, fiber quality, protein content, oil content, increased yield, amino acid metabolism, plant development, drought resistance, cold resistance, heat resistance, salt resistance, altered selectable marker expression, and combinations thereof.
  • Altered trait means a trait different from a starting plant, meaning the plant containing the DNA construct has a trait that is not found in a plant that does not contain the DNA construct. 118066633.1
  • U6 RNA has a coding sequence of approximately 102 nucleotides in length and is highly conserved across species.
  • X52528.1 (SEQ ID NO:33) (Nekrasov et al., “Targeted Mutagenesis in the Model Plant Nicotiana benthamiana using Cas9 RNA-Guided Endonuclease,” Nature Biotechnology 31:691- 693 (2013), which is hereby incorporated by reference in its entirety) was used to BLAST search the genome sequence (Cs10) of Cannabis sativa genotype CBDRx:18:580 variety CBDRx (GenBank GCA_900626175.1, hereby incorporated by reference in its entirety). [0080] Eight different U6 snRNA Cannabis genes were identified on three different chromosomes.
  • Cannabis U6 genes were identified on chromosome 1, three on chromosome 2, and two on chromosome 6. These Cannabis U6 genes were named according to their chromosomal locations. For example, the three U6 genes on chromosome 1 were named CsU6-1.1 (LOC115708496), CsU6-1.2 (LOC115708508), and CsU6-1.3 (LOC115708520). The three genes on chromosome 2 were named CsU6-2.1 (LOC115721575), CsU6-2.2 (LOC115721564), and CsU6-2.3 (LOC115721586).
  • CsU6-6.1 LOC115696114
  • CsU6-6.2 LOC115696125
  • Various lengths of the promoter sequences were isolated from each gene (including the first G nucleotide of the snRNA coding sequence) and are listed in Table 1 as CsU6-1.1(300 bp), SEQ ID NO:1; CsU6-1.1(450 bp), SEQ ID NO:2; CsU6-1.1(600 bp), SEQ ID 118066633.1
  • U6 snRNA coding sequences vary at 3 single base positions from each other and the AtU6-26 U6 snRNA coding sequence, SEQ ID NO:33 (GenBank Accession No. X52528.1) (FIG.1C).
  • a consensus sequence for a portion of the alignment is as follows (SEQ ID NO:77): GTCCCACATtGCtaAbaTaananttntttnvaatgTTTATATAtncctAcctcagthacn tagcttGtCCCtTCGGGGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGG CCCCTGCGCAAGGATGACAC GCAcAAATCGAGAAATGGTCCAAATTTT Table 2.
  • U6 snRNA Nucleotide Coding Sequences Name SEQ ID Se uence (5' to 3') 118066633.1 118066633.1
  • FIGs.1A-C A conserved upstream sequence element (USE) and a TATA box (TATA) is shown in the alignment of the U6 snRNA genes (FIG.1C). Since U6 promoters also may contain less conserved regulatory elements that are more upstream to the TATA box or USE element, sequence up to 600 bp upstream of the transcription start site may contribute to full U6 promoter functions.
  • USE conserved upstream sequence element
  • TATA TATA box
  • Example 2 Cloning of Cannabis U6 RNA Polymerase III Promoters
  • Three sizes (approximately 300 bp, 450 bp, and 600 bp, corresponding to SEQ ID NOs:1-24) of each of the proximate promoter regions upstream of the eight Cannabis U6 gene transcription initiation sites (FIG.1C, arrow) were synthesized for promoter cloning and evaluation with the addition of a binding handle sequence and a 3′ terminator sequence (“bH- term”) (SEQ ID NO:35) at the 3′ end of each promoter sequence.
  • bH- term 3′ terminator sequence
  • the bH-term sequence comprises two BsaI restriction endonuclease sites (SEQ ID NO:36) used for introducing different gene editing targeting sequences into the DNA construct, a guide RNA binding handle (SEQ ID NO:37), and a transcription terminator sequence (SEQ ID NO:38) (Table 3).
  • Cannabis U6 promoter fragments with bH-term sequences at their 3′ ends were synthesized using a standard gene synthesis service (PriorityGene) into DNA vector pUC57-Kan by Genewiz (South Plainfield, NJ), with the addition of AvrII restriction site sequences (5′-CCTAGG-3′) placed at the 5′ and 3′ ends (at the beginning of the promoter sequence and after the bH-term sequence).
  • An example of the cloning of CsU6 promoter CsU6- 1.1(300bp) (SEQ ID NO:1) with the bH-term is shown in FIG.2A (pARC1147).
  • Each Cannabis U6 RNA Polymerase III promoter (SEQ ID NOs:1-24) was operably linked to the heterologous bH-term sequence.
  • Table 3. bH-term Sequence Guide RNA Name SEQ ID Se uence (5' to 3') 118066633.1
  • RNA sequences specifically guide RNA sequences representing gene targeting sequences to the coding sequence of the GUSPlus ( ⁇ -glucuronidase) reporter gene (pCAMBIA1305.1, GenBank Accession No. AF354045.1, which is hereby incorporated by reference in its entirety), were designed using the CHOPCHOP program (Labun et al., “CHOPCHOP v3: Expanding the CRISPR Web Toolbox Beyond Genome Editing,” Nuc Acids Res 47:W171-W174 (2019), which is hereby incorporated by reference in its entirety).
  • Guide RNA sequences representing gene targeting sequences to the coding sequence of other desired target genes can be designed in a similar fashion. Oligonucleotides corresponding to these guide RNA gene targeting sequences and comprising nucleotides on each end that will anneal to the BsaI digested DNA constructs were heated to 100 o C and allowed to slowly cool to room temperature to anneal. Examples of guide RNA sequences representing gene targeting sequences to GUSPlus are shown in Table 4.
  • Overhanging nucleotides depend upon the flanking nucleotides of the BsaI sites, and nucleotides such as (5′-TTGG-3′), (5′-TCGG-3′) (5′-CTGG-3′) for the first BsaI site, and (5′-AACC-3′) for the second BsaI site can be added to the guide RNA targeting sequence oligonucleotides to facilitate cloning into the BsaI sites.
  • Table 4 Guide RNA Targeting Sequences to GUSPlus and GUSPlus Sequence Name SEQ ID NO: Se uence (5' to 3') 118066633.1 118066633.1
  • the guide RNA targeting sequences to the GUSPlus gene coding sequence can be selected from SEQ ID NOs:39-50, among other potential sequences, without limitation.
  • the target sequence locations for genome editing in the GUSPlus gene are shown in FIG.3.
  • the oligonucleotides SEQ ID NOs:49 and 50
  • the oligonucleotides were first annealed as described above and were cloned into the BsaI sites of each DNA construct comprising SEQ ID NOs:1-24, thus ligating the oligonucleotides 5′ to the binding handle sequences.
  • guide RNA sequence in this DNA construct comprises guide RNA targeting sequence contiguous with the binding handle (tracrRNA) sequence.
  • a guide RNA targeting sequence was cloned into a vector with the CsU6 promoter.
  • a guide RNA targeting sequence was cloned into the BsaI sites of pARC1147 a vector with a CsU6-1.1(300bp) (SEQ ID NO:1) promoter.
  • the resulting DNA construct is shown in FIG.2B (pARC1188) and FIG.2C.
  • RNA When RNA is expressed by the Cannabis U6 RNA Polymerase III promoters, this orientation results in a chimeric crRNA and tracrRNA produced as one nucleotide strand.
  • This guide RNA can form a functional complex with a Cas endonuclease, wherein the guide RNA guides the Cas endonuclease to a gene target site. Similar constructs were made with the other CsU6 promoters (Table 5).
  • the Arabidopsis U6 promoter (nucleotides 62-449 of SEQ ID NO:34) was used as a control (pARC1268). Table 5.
  • B5 vitamins (4.43 g/L), sucrose (20 g/L), phytagar (3 g/L), pH 5.8) and incubated at 24°C under light (16 hours light and 8 hours dark) for 2-3 days. Once the seedlings became dark green- purple (around 3-4 days), the shoot tissues (hypocotyl, cotyledons, and emerging true leaves) were cut into 0.5 cm pieces and placed on Resting media (MS with B5 vitamins (4.43 g/L), sucrose (30 g/L), casein (0.5 g/L), glutamine (0.5 g/L), MES (0.5 g/L), TDZ (2m g/L), NAA (0.5 mg/L), Gelzan (3 g/L), pH 5.8) under light (16 hr light and 8 hr dark) for 2 weeks.
  • the DNA-coated gold was loaded on a biolistic particle delivery system (Biorad PDS-1000/HeTM, 100/120V System) and delivered to the prepared plate of calli, set 6 cm from the particles, at 28 Hg vacuum and 1100 psi, according to manufacturer’s instructions. Each plate was shot once, rotated 180°, then shot again. Two plates, or approximately 100 calli, were shot per vector. Following bombardment, calli were transferred to Resting media (described above) supplemented with G418 (75 mg/L), immediately to 24 hours later. Bombarded calli were incubated at 24°C under 16 hours light and 8 hours dark for 1 to 2 weeks.
  • a biolistic particle delivery system Biorad PDS-1000/HeTM, 100/120V System
  • RNA concentrations were normalized to 200-250 ng/uL then 0.8-1 ug of normalized RNA was reverse transcribed using SuperScript TM VILO cDNA Synthesis Kit (Invitrogen) in a 20 uL reaction according to manufacturer’s instructions.
  • Expression of the guide RNA was assessed by an RT-qPCR assay targeting the gRNA and binding handle sequence and performed on a QuantStudio TM 5 (Applied Biosystems).
  • tonoplast intrinsic protein (TIP41) like was also assessed by the same method as the guide RNA and used to calculate the relative expression of the gRNA using the standard ⁇ CT method (Livak & Schmittgen, “Analysis of Relative Gene Expression Data using Real-Time Quantitative PCR and the 2 ⁇ CT Method,” Methods 25:402–408 (2001), which is hereby incorporated by reference in its entirety) as shown in FIG. 5.
  • the CsU6 promoters that had the highest gRNA expression are shown in FIG. 5A.
  • pARC1198 with the CsU6-2.1(450) promoter had the highest expression, followed by pARC1192 (CsU6-1.2(450) SEQ ID NO:5), pARC1260 (CsU6-2.3(450) SEQ ID NO:17), pARC1261 (CsU6-2.3(600) SEQ ID NO:18).
  • Other promoter constructs chosen for further analysis as shown in Table 6. In some cases, the promoters that expressed the highest as well and a promoter from the same gene that was the next largest size were chosen for reevaluation.
  • promoters that did not express well such as pARC1188 (CsU6- 1.1(3000) (SEQ ID NO:1)), 1189 (CsU6-1.1(450) (SEQ ID NO:2)).
  • FIG.6 The reevaluation of the CsU6 promoters with technical repeats to verify results is shown in FIG.6. In this case, elevated expression was seen using the CsU6 promoters of three genes on Chromosome 2 for at least one length of each of the CsU6-2.1, CsU6-2.2, and CsU6- 2.3 promoters. Table 6.
  • a fresh culture of Agrobacterium was prepared in LB containing 100 mg/L kanamycin, 25 mg/L rifampicin, and 200 ⁇ M acetosyringone then incubated at 28°C and shaken at 220 rpm for greater than 4 hours. After incubation, 1 mL cells were pelleted at 14,000 rpm for 1 min, resuspended in 2 mL Inoculation buffer (MS with 10% vitamins (0.474 g/L), glucose (10 g/L), MES (0.5 g/L), pH 5.8), then adjusted with the buffer to a cell density at OD 600 between 0.5 and 1.0.
  • Seedlings and explants of the Cannabis variety Original Cherry were prepared as described in Example 4 above. Seedling explants were transformed with the Agrobacterium cell suspension by gently rotating a test tube containing the explants and the bacteria several times for 10 min at room temperature. The bacterial suspension was then removed, replaced with 30 ml of an antibiotic solution (Timentin (400 mg/L), Carbenicillin (500 mg/L), and Cefotaxim (500 mg/L) dissolved in sterile nuclease- free water), then incubated at 28°C and shaken at 100 rpm for more than 4 hours.
  • an antibiotic solution Timentin (400 mg/L), Carbenicillin (500 mg/L), and Cefotaxim (500 mg/L) dissolved in sterile nuclease- free water
  • Disinfected seedling explants were removed and dried, then transferred to Co-Cultivation media (MS with 10% vitamins (0.443 g/L), glucose (10 g/L), MES (0.5 g/L), CuSO 4 •5H 2 O (5 ⁇ M), acetosyringone (200 ⁇ M), AgNO 3 (5 ⁇ M), Micropropagation Agar-Type 1 (12 g/L)) and incubated at 24°C in the dark for 2 days. After co-cultivation, plant tissue was moved to Selection media (Resting media with Timentin (300 mg/L) and Hygromycin (75 mg/L)) and incubated at 24°C under light (16 hours light and 8 hours dark) for 2 weeks.
  • Selection media Repsting media with Timentin (300 mg/L) and Hygromycin (75 mg/L)
  • Cannabis callus tissue (No.5) previously stably transformed with GUSPlus using Agrobacterium-mediated transformation method as described in Example 5 above was used for genome editing analysis of Cannabis U6 RNA Polymerase III promoters controlling expression of gRNAs.
  • the GUSPlus gRNA and Cas9 can form a gRNA-Cas9 riboprotein complex to recognize and cleave the GUSPlus target site.
  • the coding sequence of the GUSPlus gene is shown in SEQ ID NO:51.
  • CsU6 promoters were cloned into vector pARC1294 (FIG.2D), which is a vector for use in particle bombardment.
  • CsU6 promoters were cloned from the vector carrying the corresponding CsU6 promoter and gRNA cassette from vectors such as pARC1188 (as one example for CsU6-1.1 (FIG.2B)) to pARC1264 using an AvrII site.
  • FIG.2E is a schematic illustration of vector pARC1269 showing the CsU6 promoter/guide RNA cassette from vector pARC1188 (FIG.2B) cloned into the AvrII site of pARC1294 (FIG.2D).
  • Table 7 shows the vectors used for CsU6 promoter editing efficiency testing. Table 7.
  • Targeted genomic site editing was initiated by transformation of the GUSPlus expressing Cannabis callus tissue described in Example 5 above with the Cannabis U6 RNA 118066633.1 Polymerase III gRNA vectors shown in Table 7 (which contain d35S:Cas9 and PcUbi:NPTII selectable marker). Particle bombardment was used to transform the GUSPlus expressing callus tissue using the method described in Example 4 above.
  • Example 7 Sequence Heterogeneity of U6 Promoters in Cannabis Varieties
  • An alignment of Cannabis U6 RNA Polymerase III promoter sequences illustrates the sequence heterogeneity between different varieties of Cannabis (Table 9).
  • Table 9 An alignment of Cannabis U6 RNA Polymerase III promoter CsU6-1.1 sequences from variety CBDRx Cs10, SEQ ID NO:3; BaOx, SEQ ID NO:53; Z2 female (“Z2F”), SEQ ID NO:54; and Z2 male (“Z2M”), SEQ ID NO:55; using Multalin, is shown in FIG.4A.
  • Sequence identities were calculated using the NCBI BLASTN suite (Zheng et al., “A Greedy Algorithm for Aligning DNA Sequences,” J. Comput. Biol.7(1-2):203-214 (2000), which is hereby incorporated by reference in its entirety). Sequence identity between CsU6-1.1(600 bp, Cs10) and CsU6-1.1(600 bp, Z2M) was 98.00%. Sequence identity between CsU6-1.1(600 bp, Cs10) and CsU6-1.1(600 bp, Z2F) was 99.17%.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Physiology (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne des séquences de promoteur d'expression génique provenant du Cannabis, en particulier des promoteurs d'ARN polymérase III U6 de Cannabis , et des fragments fonctionnels de ceux-ci, et leur utilisation pour favoriser l'expression d'un ou de plusieurs fragments nucléotidiques hétérologues dans des plantes. La présente invention concerne en outre des compositions, des constructions nucléotidiques et des cellules transformées contenant la construction d'ADN avec le promoteur, et des méthodes de préparation et d'utilisation de celles-ci.
PCT/US2021/044369 2020-08-03 2021-08-03 Constructions d'adn contenant des promoteurs d'arn polymérase iii provenant du cannabis, et leurs méthodes d'utilisation WO2022031720A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063060575P 2020-08-03 2020-08-03
US63/060,575 2020-08-03

Publications (1)

Publication Number Publication Date
WO2022031720A1 true WO2022031720A1 (fr) 2022-02-10

Family

ID=80118501

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/044369 WO2022031720A1 (fr) 2020-08-03 2021-08-03 Constructions d'adn contenant des promoteurs d'arn polymérase iii provenant du cannabis, et leurs méthodes d'utilisation

Country Status (1)

Country Link
WO (1) WO2022031720A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112481259A (zh) * 2020-11-24 2021-03-12 南昌大学 两种甘薯U6基因启动子IbU6的克隆与应用
CN114703187A (zh) * 2022-03-31 2022-07-05 东北林业大学 一种水曲柳U6基因启动子proFmU6.7及其克隆与应用
CN114703188A (zh) * 2022-03-31 2022-07-05 东北林业大学 一种水曲柳U6基因启动子proFmU6.6及其克隆与应用
CN114774414A (zh) * 2022-03-31 2022-07-22 东北林业大学 一种水曲柳U6基因启动子proFmU6.5及其克隆与应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160177404A1 (en) * 2011-08-18 2016-06-23 Courtagen Life Sciences Inc. Cannabis genomes and uses thereof
US20190376074A1 (en) * 2013-08-22 2019-12-12 E. I. Du Pont De Nemours And Company U6 polymerase iii promoter and methods of use

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160177404A1 (en) * 2011-08-18 2016-06-23 Courtagen Life Sciences Inc. Cannabis genomes and uses thereof
US20190376074A1 (en) * 2013-08-22 2019-12-12 E. I. Du Pont De Nemours And Company U6 polymerase iii promoter and methods of use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NEKRASOV, V ET AL.: "Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease", NATURE BIOTECHNOLOGY, vol. 31, no. 8, August 2013 (2013-08-01), pages 691 - 693, XP055129106, DOI: 10.1038/nbt.2655 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112481259A (zh) * 2020-11-24 2021-03-12 南昌大学 两种甘薯U6基因启动子IbU6的克隆与应用
CN112481259B (zh) * 2020-11-24 2022-09-16 南昌大学 两种甘薯U6基因启动子IbU6的克隆与应用
CN114703187A (zh) * 2022-03-31 2022-07-05 东北林业大学 一种水曲柳U6基因启动子proFmU6.7及其克隆与应用
CN114703188A (zh) * 2022-03-31 2022-07-05 东北林业大学 一种水曲柳U6基因启动子proFmU6.6及其克隆与应用
CN114774414A (zh) * 2022-03-31 2022-07-22 东北林业大学 一种水曲柳U6基因启动子proFmU6.5及其克隆与应用
CN114774414B (zh) * 2022-03-31 2023-05-23 东北林业大学 一种水曲柳U6基因启动子proFmU6.5及其克隆与应用

Similar Documents

Publication Publication Date Title
WO2022031720A1 (fr) Constructions d'adn contenant des promoteurs d'arn polymérase iii provenant du cannabis, et leurs méthodes d'utilisation
Chan et al. Agrobacterium-mediated production of transgenic rice plants expressing a chimeric α-amylase promoter/β-glucuronidase gene
McCormac et al. The use of visual marker genes as cell-specific reporters of Agrobacterium-mediated T-DNA delivery to wheat (Triticum aestivum L.) and barley (Hordeum vulgare L.).
Bordas et al. Transfer of the yeast salt tolerance gene HAL1 to Cucumis melo L. cultivars and in vitro evaluation of salt tolerance
EP1756282B1 (fr) Transformation amelioree de soja
US20020048814A1 (en) Methods of gene silencing using poly-dT sequences
KR20020086724A (ko) 세스트룸 황색 잎 컬링 바이러스 프로모터
AU2001242516A1 (en) Cestrum yellow leaf curling virus promoters
Zang et al. Efficient production of transgenic plants using the bar gene for herbicide resistance in sweetpotato
JP6353197B2 (ja) 植物成長阻害ホルモンを用いた植物形質転換方法
CN116249780A (zh) 单子叶植物叶外植体的快速转化
Cui et al. Efficient shoot regeneration from hairy roots of Antirrhinum majus L. transformed by the rol type MAT vector system
US20230130592A1 (en) Novel agrobacterium tumefaciens strains
US20220298523A1 (en) Genetically modified plants and methods of making the same
Alimohammadi et al. Agrobacterium-mediated transformation of plants: Basic principles and influencing factors
ZA200700157B (en) Improved transformation of soybean
KR101554678B1 (ko) 식물 바이러스를 이용한 식물체 형질전환을 위한 유전자 전달 시스템 및 이의 용도
CN104829699A (zh) 一种与植物抗逆性相关蛋白Gshdz4及其编码基因与应用
Liu et al. Optimization of soybean (Glycine max (L.) Merrill) in planta ovary transformation using a linear minimal gus gene cassette
Sugiharto et al. A Comparison Study for Agrobacterium-mediated transformation Method in Sugarcane (Saccharum spp L.)
JPH09131187A (ja) 植物プロモーターおよびその利用
WO2008119136A1 (fr) Procédés et constructions perfectionnés pour transformation à médiation par agrobacterium sans marqueur
US9873884B2 (en) Male reproductive tissue and stage specific promoters from Eucalyptus camaldulensis sweet gene family member
EP3144381A1 (fr) Procédé de préparation d'agrobacterium et de plante transgénique à l'aide de cet agrobacterium
WO2022046957A2 (fr) Constructions d'adn de cannabis et procédés de régulation de l'expression génique dans des plantes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21854426

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21854426

Country of ref document: EP

Kind code of ref document: A1