WO2017201258A1 - Compositions and methods of treating huntington's disease - Google Patents

Compositions and methods of treating huntington's disease Download PDF

Info

Publication number
WO2017201258A1
WO2017201258A1 PCT/US2017/033281 US2017033281W WO2017201258A1 WO 2017201258 A1 WO2017201258 A1 WO 2017201258A1 US 2017033281 W US2017033281 W US 2017033281W WO 2017201258 A1 WO2017201258 A1 WO 2017201258A1
Authority
WO
WIPO (PCT)
Prior art keywords
aav
expression
seq
htt
antisense
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/033281
Other languages
English (en)
French (fr)
Inventor
Dinah Wen-Yee Sah
Jinzhao Hou
Pengcheng ZHOU
Xin Wang
Jochen DECKERT
Markus Hossbach
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Voyager Therapeutics Inc
Original Assignee
Voyager Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US16/302,140 priority Critical patent/US11951121B2/en
Priority to KR1020227025973A priority patent/KR20220108216A/ko
Priority to SG11201809643UA priority patent/SG11201809643UA/en
Priority to CA3024449A priority patent/CA3024449A1/en
Priority to KR1020187033504A priority patent/KR102427379B1/ko
Priority to IL297576A priority patent/IL297576B2/en
Priority to AU2017268382A priority patent/AU2017268382B2/en
Priority to MX2018014152A priority patent/MX2018014152A/es
Priority to JP2018560628A priority patent/JP7220080B2/ja
Application filed by Voyager Therapeutics Inc filed Critical Voyager Therapeutics Inc
Priority to BR112018073472A priority patent/BR112018073472A2/pt
Priority to RU2018140499A priority patent/RU2764587C2/ru
Priority to CN201780043501.XA priority patent/CN109831916B/zh
Priority to EP17800155.8A priority patent/EP3458589A4/en
Publication of WO2017201258A1 publication Critical patent/WO2017201258A1/en
Priority to IL262763A priority patent/IL262763A/en
Anticipated expiration legal-status Critical
Priority to US18/591,756 priority patent/US20240415868A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/02Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/50Biochemical production, i.e. in a transformed host cell
    • C12N2330/51Specially adapted vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • compositions and Methods of Treating Huntington’s Disease the contents each of which are herein incorporated by reference in their entireties.
  • the present invention relates to compositions, methods and processes for the design, preparation, manufacture, use and/or formulation of modulatory polynucleotides, e.g., polynucleotides encoding small interfering RNA (siRNA) molecules which target the Huntingtin (HTT) gene (e.g., the wild-type or the mutated CAG-expanded HTT gene). Targeting of the mutated HTT gene may interfere with the HTT gene expression and the resultant HTT protein production.
  • the modulatory polynucleotides encoding the siRNA molecules may be inserted into recombinant adeno-associated virus (AAV) vectors.
  • AAV adeno-associated virus
  • Huntington’s Disease is a monogenic fatal neurodegenerative disease
  • Huntington’s Disease is known to be caused by an autosomal dominant triplet (CAG) repeat expansion in exon 1 of the huntingtin (htt) gene, which encodes a huntington protein (HTT) bearing a poly- glutamine expanded tract at its N-terminus.
  • CAG autosomal dominant triplet
  • HTT huntington protein
  • This repeat expansion results in a toxic gain of function of HTT and ultimately leads to striatal neurodegeneration which progresses to widespread brain atrophy.
  • Symptoms typically appear between the ages of 35-44 and the average life expectancy subsequent to disease onset is 10-25 years.
  • the length of the CAG expansion correlates with both age of onset and rate of disease progression, with longer expansions linked to greater severity of disease and shorter survival.
  • the present invention develops an RNA interference based approach, novel double stranded RNA (dsRNA) constructs and siRNA constructs and methods of their design, to inhibit or prevent the expression of polyglutamine expanded HTT in HD patients for treatment of the disease.
  • dsRNA double stranded RNA
  • siRNA constructs may be synthetic molecules or be encoded in an expression vector (one or both strands) for delivery into cells.
  • vectors include, but are not limited to adeno-associated viral vectors such as vector genomes of any of the AAV serotypes or other viral delivery vehicles such as lentivirus, etc.
  • the present invention relates to RNA molecule-mediated gene specific interference with gene expression and protein production. Methods for treating neurodegenerative diseases such as Huntington’s Disease are also included in the present invention.
  • the siRNAs included in the compositions featured herein encompass a dsRNA having an antisense strand (that is 30 nucleotides or less, generally 19-24 nucleotides in length), that is substantially complementary to at least part of an mRNA transcript of the mutated HTT gene.
  • the present invention provides short double stranded RNA molecules such as small interfering RNA (siRNA) duplexes that target HTT mRNA to interfere with HTT gene expression and/or HTT protein production.
  • siRNA duplexes of the present invention may interfere with the HTT gene, and may particularly interact with the HTT gene which has mutations to cause Huntington’s Disease.
  • siRNA molecules are inserted into (AAV) adeno-associated viral vectors to be introduced into cells, specifically striatal or cortical neurons and/or other surrounding cells in the central nervous system.
  • AAV vector may comprise sequences encoding 1, 2, 3, 4, or more than 4 siRNA duplexes.
  • the siRNA duplex of the present invention comprises an antisense strand and a sense strand hybridized together forming a duplex structure, wherein the antisense strand is complementary to the nucleic acid sequence of the HTT gene, and wherein the sense strand is homologous to the nucleic acid sequence of the HTT gene.
  • the 5’end of the antisense strand has a 5’ phosphate group and the 3’end of the sense strand contains a 3’hydroxyl group.
  • each strand of the siRNA duplex targeting the HTT gene is about 19-25 nucleotides in length, preferably about 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, or 25 nucleotides in length.
  • the siRNAs may be unmodified RNA molecules.
  • the siRNAs may contain at least one modified nucleotide, such as base, sugar or backbone modification.
  • a siRNA or dsRNA includes at least two sequences that are complementary to each other.
  • the dsRNA includes a sense strand having a first sequence and an antisense strand having a second sequence.
  • the antisense strand includes a nucleotide sequence that is substantially complementary to at least part of an mRNA encoding the HTT protein, and the region of complementarity is 30 nucleotides or less, and at least 15 nucleotides in length.
  • the dsRNA is 19 to 24, e.g., 19 to 21 nucleotides in length.
  • the dsRNA is from about 15 to about 25 nucleotides in length, and in other embodiments the dsRNA is from about 25 to about 30 nucleotides in length.
  • the dsRNA either upon contacting with a cell expressing HTT protein or upon transcription within a cell expressing HTT protein, inhibits or suppresses the expression of a HTT gene by at least 10%, at least 20%, at least 25%, at least 30%, at least 35% or at least 40% or more, such as when assayed by a method as described herein.
  • AAV vectors comprising the nucleic acids encoding the siRNA duplexes, one strand of the siRNA duplex or the dsRNA targeting the HTT gene are produced, the AAV vector serotype may be AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, AAV-PHP.A (PHP.A), and/or AAV-PHP.B (PHP.B), and variants thereof.
  • the AAV vector serotype is AAV1.
  • the AAV serotype is AAV-DJ8.
  • the AAV serotype is AAV-PHP.A (PHP.A).
  • the AAV serotype is AAV- PHP.B (PHP.B).
  • the AAV vectors comprising the nucleic acids encoding the siRNA duplexes, one strand of the siRNA duplex or the dsRNA targeting the HTT gene are produced may be selected based on the tropism for medium spiny striatal neurons, cortical neurons and/or astrocytes.
  • the AAV vector is selected based on the expression level in a desired cell type such as, but not limited to, medium spiny striatal neurons, cortical neurons and/or astrocytes.
  • siRNA duplexes or dsRNA targeting the HTT gene in HD are selected from the siRNA duplexes listed in Tables 3, 4, or 5.
  • the siRNA duplexes or dsRNA targeting HTT gene in HD are selected from the group consisting of siRNA duplexes: D-3500 to D-3570.
  • the present invention also provides pharmaceutical compositions comprising at least one siRNA duplex targeting the HTT gene and a pharmaceutically acceptable carrier.
  • a nucleic acid sequence encoding the siRNA duplex is inserted into an AAV vector.
  • the present invention provides methods for inhibiting/silencing HTT gene expression in a cell.
  • the siRNA duplexes or dsRNA can be used to substantially inhibit HTT gene expression in a cell.
  • the cell may be a neuron (e.g., medium spiny neurons of the putamen, caudate or striatum, and cortical neurons in the cerebral cortex), an astrocyte (e.g., astrocyte in the striatum, cortical astrocytes in the cerebral cortex) and/or oligodendrocytes.
  • the inhibition (or lowering) of the HTT gene expression in the putamen, caudate and cortex reduces the effect of Huntington’s Disease in a subject.
  • the inhibition (or lowering) of the HTT gene expression in the medium spiny neurons in the striatum reduces the effect of Huntington’s Disease in a subject.
  • the inhibition (or lowering) of the HTT gene expression in the astrocytes in the striatum reduces the effect of Huntington’s Disease in a subject.
  • the inhibition of the HTT gene expression refers to an inhibition or lowering by at least about 20%, preferably by at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% and 100%. Accordingly, the protein product of the targeted gene may be inhibited by at least about 20%, preferably by at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% and 100%.
  • the present invention provides methods for inhibiting/silencing HTT gene expression by at least about 40% in a cell using siRNA duplexes or dsRNA.
  • the cell may be a neuron (e.g., medium spiny neurons of the putamen or striatum, and cortical neurons in the cerebral cortex), an astrocyte (e.g., astrocyte in the striatum, cortical astrocytes in the cerebral cortex) and/or oligodendrocytes.
  • the at least 40% inhibition (or lowering) of the HTT gene expression in the putamen and cortex reduces the effect of
  • the at least 40% inhibition (or lowering) of the HTT gene expression in the medium spiny neurons in the striatum reduces the effect of Huntington’s Disease in a subject.
  • the at least 40% inhibition (or lowering) of the HTT gene expression in the putamen and the at least 20% inhibition (or lowering) of the HTT gene expression in the cortex reduces the effect of
  • the at least 40% inhibition (or lowering) of the HTT gene expression in the astrocytes in the striatum reduces the effect of Huntington’s Disease in a subject.
  • the present invention provides methods for treating, or ameliorating Huntington’s Disease associated with the HTT gene (e.g., CAG-expanded HTT gene) and the resultant HTT protein (e.g., poly-Q protein) in a subject in need of treatment, the method comprising administering to the subject a pharmaceutically effective amount of at least one siRNA duplex targeting the HTT gene (e.g., CAG-expanded HTT gene), delivering said siRNA duplex into targeted cells, inhibiting the HTT gene (e.g., CAG-expanded HTT gene) expression and resultant protein production, and ameliorating symptoms of HD in the subject.
  • the HTT gene e.g., CAG-expanded HTT gene
  • the resultant HTT protein e.g., poly-Q protein
  • an AAV vector comprising the nucleic acid sequence encoding at least one siRNA duplex targeting the HTT gene is administered to the subject in need for treating and/or ameliorating HD.
  • the AAV vector serotype may be selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, AAV- PHP.A (PHP.A), and/or AAV-PHP.B (PHP.B) and variants thereof.
  • the siRNA duplexes or dsRNA targeting HTT gene or the AAV vectors comprising such siRNA-encoding molecules may be introduced directly into the central nervous system of the subject, for example, by intracranial injection.
  • the pharmaceutical composition of the present invention is used as a solo therapy. In other embodiments, the pharmaceutical composition of the present invention is used in combination therapy.
  • the combination therapy may be in combination with one or more neuroprotective agents such as small molecule compounds, growth factors and hormones which have been tested for their neuroprotective effect on neuron degeneration.
  • the present invention provides methods for treating, or ameliorating Huntington’s Disease by administering to a subject in need thereof a therapeutically effective amount of a plasmid or AAV vector described herein.
  • the present invention provides a method for inhibiting the expression of the HTT gene in a region of the central nervous system of a subject by
  • the nucleic acid sequence position between two inverted terminal repeats (ITRs) may include an antisense strand and a sense strand which may form a siRNA duplex that when expressed inhibits or suppresses the expression of HTT in the subject.
  • the expression may be reduced in a region of the subject such as, but not limited to, the forebrain of a subject or a region of the forebrain such as, but not limited to, the putamen.
  • HTT in the forebrain or region of the forebrain may be reduced by 40-70%, 40-60%, 50-70%, 50-60%, or it may be reduced by 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%.
  • the present invention provides a method for treating
  • the method may inhibit the expression of the HTT gene in a region of the central nervous system of a subject comprising administering to the subject a composition comprising at least one adeno-associated viral (AAV) vector comprising a nucleic acid sequence positioned between two inverted terminal repeats (ITRs).
  • AAV adeno-associated viral
  • the nucleic acid sequence may comprise an antisense strand and a sense strand which can form a siRNA duplex that when expressed inhibits or suppresses the expression of HTT in a said subject.
  • the expression may be reduced in a region of the subject such as, but not limited to, the forebrain of a subject or a region of the forebrain such as, but not limited to, the putamen.
  • HTT in the forebrain or region of the forebrain may be reduced by 40-70%, 40-60%, 50-70%, 50-60%, or it may be reduced by 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%.
  • the present invention relates to modulatory polynucleotides, e.g., RNA or DNA molecules as therapeutic agents.
  • RNA interference mediated gene silencing can specifically inhibit targeted gene expression.
  • a“modulatory polynucleotide” is any nucleic acid sequence(s) which functions to modulate (either increase or decrease) the level or amount of a target gene, e.g., mRNA or protein levels.
  • the present invention then provides small double stranded RNA (dsRNA) molecules (small interfering RNA, siRNA) targeting the HTT gene, pharmaceutical compositions comprising such siRNAs, as well as processes of their design.
  • dsRNA small double stranded RNA
  • siRNA small interfering RNA
  • the present invention also provides methods of their use for inhibiting HTT gene expression and protein production, for treating neurodegenerative disease, in particular, Huntington’s Disease (HD).
  • the present invention provides small interfering RNA (siRNA) duplexes (and modulatory polynucleotides encoding them) that target HTT mRNA to interfere with HTT gene expression and/or HTT protein production.
  • siRNA small interfering RNA
  • a nucleic acid sequence encoding such siRNA molecules, or a single strand of the siRNA molecules is inserted into adeno-associated viral vectors and introduced into cells, specifically neurons and/or other surrounding cells in the central nervous system.
  • the encoded siRNA duplex of the present invention contains an antisense strand and a sense strand hybridized together forming a duplex structure, wherein the antisense strand is complementary to the nucleic acid sequence of the targeted HTT gene, and wherein the sense strand is homologous to the nucleic acid sequence of the targeted HTT gene.
  • the 5’end of the antisense strand has a 5’ phosphate group and the 3’end of the sense strand contains a 3’hydroxyl group.
  • each strand of the siRNA duplex targeting the HTT gene is about 19 to 25, 19 to 24 or 19 to 21 nucleotides in length, preferably about 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, or 25 nucleotides in length.
  • the siRNAs may be unmodified RNA molecules.
  • the siRNAs may contain at least one modified nucleotide, such as base, sugar or backbone modification.
  • a siRNA or dsRNA includes at least two sequences that are complementary to each other.
  • the dsRNA includes a sense strand having a first sequence and an antisense strand having a second sequence.
  • the antisense strand includes a nucleotide sequence that is substantially complementary to at least part of an mRNA encoding HTT, and the region of complementarity is 30 nucleotides or less, and at least 15 nucleotides in length.
  • the dsRNA is 19 to 25, 19 to 24 or 19 to 21 nucleotides in length.
  • the dsRNA is from about 15 to about 25 nucleotides in length, and in other embodiments the dsRNA is from about 25 to about 30 nucleotides in length.
  • the dsRNA whether directly administered or encoded in an expression vector upon contacting with a cell expressing HTT protein, inhibits the expression of HTT protein by at least 10%, at least 20%, at least 25%, at least 30%, at least 35% or at least 40% or more, such as when assayed by a method as described herein.
  • the siRNA molecules included in the compositions featured herein comprise a dsRNA having an antisense strand (the antisense strand) having a region that is 30 nucleotides or less, generally 19 to 25, 19 to 24 or 19 to 21 nucleotides in length, that is substantially complementary to at least part of a mRNA transcript of the HTT gene.
  • AAV vectors comprising the nucleic acids of the siRNA duplexes, one strand of the siRNA duplex or the dsRNA targeting HTT gene are produced, where the AAV vector serotypes may be AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, AAV-PHP.A (PHP.A), and/or AAV-PHP.B (PHP.B) and variants thereof.
  • the AAV vector serotypes may be AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, A
  • siRNA duplexes or the encoded dsRNA targeting the HTT gene in HD is selected from the siRNA duplexes listed in Table 7 or Table 8.
  • the siRNA duplexes or dsRNA targeting the HTT in HD is D-3500 to D-3570.
  • the present invention also provides pharmaceutical compositions comprising at least one siRNA duplex targeting the HTT gene and a pharmaceutically acceptable carrier.
  • the siRNA duplex is encoded by an AAV vector.
  • the present invention provides methods for inhibiting/silencing HTT gene expression in a cell. Accordingly, the siRNA duplexes or encoded dsRNA can be used to substantially inhibit HTT gene expression in a cell, in particular in a neuron.
  • the inhibition of HTT gene expression refers to an inhibition by at least about 15%, such as by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15- 60%, 15-70%, 15-80%
  • the protein product of the targeted gene may be inhibited by at least about 15%, preferably by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%,
  • the present invention provides methods for inhibiting/silencing HTT gene expression in a cell, in particular in a medium spiny neuron.
  • the inhibition of HTT gene expression refers to an inhibition by at least about 15%, such as by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%,
  • the protein product of the targeted gene may be inhibited by at least about 15%, preferably by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%,
  • the present invention provides methods for inhibiting/silencing gene expression in a cell, in particular in a motor neuron.
  • the inhibition of gene expression refers to an inhibition by at least about 15%, such as by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%
  • the protein product of the targeted gene may be inhibited by at least about 15%, preferably by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%,
  • the present invention provides methods for inhibiting/silencing HTT gene expression in a cell, in particular in an astrocyte.
  • the inhibition of HTT gene expression refers to an inhibition by at least about 15%, such as by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%,
  • the protein product of the targeted gene may be inhibited by at least about 15%, preferably by at least about 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%,
  • the siRNA duplexes or encoded dsRNA may be used to reduce the expression of HTT protein by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15- 20%, 15-30%, 15-40%, 15-50%
  • the expression of HTT protein may be reduced by 50-90%. As a non-limiting example, the expression of HTT protein may be reduced by 30-70%. As a non-limiting example, the expression of protein may be reduced by 20-70%. As a non-limiting example, the expression of protein may be reduced by 15-30%.
  • the siRNA duplexes or encoded dsRNA may be used to reduce the expression of HTT mRNA by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 95% and 100%, or at least 15- 20%, 15-30%, 15-40%, 15
  • the expression of HTT mRNA may be reduced by 50-90%. As a non-limiting example, the expression of HTT mRNA may be reduced by 30-70%. As a non-limiting example, the expression of HTT mRNA may be reduced by 20-70%. As a non-limiting example, the expression of HTT mRNA may be reduced by 15-30%.
  • the siRNA duplexes or encoded dsRNA may be used to reduce the expression of HTT protein and/or mRNA in at least one region of the CNS such as, but not limited to the midbrain.
  • the expression of HTT protein and/or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 50-90%.
  • the expression of HTT protein and mRNA in the striatum is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the striatum is reduced by 20-50%.
  • the expression of HTT protein and mRNA in the striatum is reduced by 15-50%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 30-70%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 20- 70%.
  • the expression of protein and mRNA in the cortex is reduced by 15-70%.
  • the expression of protein and mRNA in the cortex is reduced by 20-70%.
  • the expression of protein and mRNA in the striatum and/or cortex is reduced by 15-70%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 40-70%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 50-70%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 50-60%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 50%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 51%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 52%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 53%.As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 54%. As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 55%. As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 56%. As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 57%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 58%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 59%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 60%.
  • the siRNA duplexes or encoded dsRNA may be used to reduce the expression of HTT protein and/or mRNA in at least one region of the CNS such as, but not limited to the forebrain.
  • the expression of HTT protein and/or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 75%, 75%,
  • the expression of HTT protein and mRNA in the putamen is reduced by 50- 90%.
  • the expression of HTT protein and mRNA in the striatum is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 30-70%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 20-70%.
  • the expression of protein and mRNA in the cortex is reduced by 15-70%.
  • the expression of protein and mRNA in the striatum and/or cortex is reduced by 15-70%.
  • the expression of protein and mRNA in the striatum and/or cortex is reduced by 20-70%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 40-70%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 50-70%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 50-60%. As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 50%. As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 51%. As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 52%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 53%.As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 54%. As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 55%. As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 56%. As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 57%.
  • the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 58%. As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 59%. As a non-limiting example, the expression of HTT protein and mRNA in the striatum and/or cortex is reduced by 60%. As a non-limiting example, the expression of protein and mRNA in the striatum and/or cortex is reduced by 61%. As a non-limiting example, the expression of protein and mRNA in the striatum and/or cortex is reduced by 62%.
  • the expression of protein and mRNA in the striatum and/or cortex is reduced by 63%.
  • the expression of protein and mRNA in the striatum and/or cortex is reduced by 64%.
  • the expression of protein and mRNA in the striatum and/or cortex is reduced by 65%.
  • the expression of protein and mRNA in the striatum and/or cortex is reduced by 66%.
  • the expression of protein and mRNA in the striatum and/or cortex is reduced by 67%.
  • the expression of protein and mRNA in the striatum and/or cortex is reduced by 68%.
  • the expression of protein and mRNA in the striatum and/or cortex is reduced by 69%.
  • the expression of protein and mRNA in the striatum and/or cortex is reduced by 70%.
  • the siRNA duplexes or encoded dsRNA may be used to reduce the expression of HTT protein and/or mRNA in the putamen.
  • the expression of HTT protein and/or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%
  • the expression of HTT protein and mRNA in the putamen is reduced by 40-70%.
  • the expression of HTT protein and mRNA in the putamen is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the putamen is reduced by 50-70%.
  • the expression of HTT protein and mRNA in the putamen is reduced by 50-60%.
  • the expression of HTT protein and mRNA in the putamen is reduced by 50%.
  • the expression of HTT protein and mRNA in the putamen is reduced by 51%.
  • the expression of HTT protein and mRNA in the putamen is reduced by 52%. As a non-limiting example, the expression of HTT protein and mRNA in the putamen is reduced by 53%. As a non-limiting example, the expression of HTT protein and mRNA in the putamen is reduced by 54%. As a non-limiting example, the expression of HTT protein and mRNA in the putamen is reduced by 55%. As a non-limiting example, the expression of HTT protein and mRNA in the putamen is reduced by 56%. As a non-limiting example, the expression of HTT protein and mRNA in the putamen is reduced by 57%.
  • the expression of HTT protein and mRNA in the putamen is reduced by 58%. As a non-limiting example, the expression of HTT protein and mRNA in the putamen is reduced by 59%. As a non-limiting example, the expression of HTT protein and mRNA in the putamen is reduced by 60%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 61%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 62%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 63%.
  • the expression of protein and mRNA in the putamen is reduced by 64%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 65%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 66%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 67%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 68%. As a non-limiting example, the expression of protein and mRNA in the putamen is reduced by 69%. As a non- limiting example, the expression of protein and mRNA in the putamen is reduced by 70%.
  • the siRNA duplexes or encoded dsRNA may be used to reduce the expression of HTT protein and/or mRNA in the cortex.
  • the expression of HTT protein and/or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%
  • the expression of HTT protein and mRNA in the cortex is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 30-70%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 20-70%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 15-70%.
  • the expression of HTT protein and mRNA in the cortex is reduced by at least 30%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 40-70%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 50-70%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 50-60%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 50%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 51%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 52%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 53%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 54%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 55%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 56%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 57%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 58%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 59%.
  • the expression of HTT protein and mRNA in the cortex is reduced by 60%.
  • the expression of protein and mRNA in the cortex is reduced by 61%.
  • the expression of protein and mRNA in the cortex is reduced by 62%.
  • the expression of protein and mRNA in the cortex is reduced by 63%.
  • the expression of protein and mRNA in the cortex is reduced by 64%.
  • the expression of protein and mRNA in the cortex is reduced by 65%.
  • the expression of protein and mRNA in the cortex is reduced by 66%.
  • the expression of protein and mRNA in the cortex is reduced by 67%.
  • the expression of protein and mRNA in the cortex is reduced by 68%.
  • the expression of protein and mRNA in the cortex is reduced by 69%.
  • the expression of protein and mRNA in the cortex is reduced by 70%.
  • the siRNA duplexes or encoded dsRNA may be used to reduce the expression of HTT protein and/or mRNA in the motor cortex.
  • the expression of HTT protein and/or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%,
  • the expression of HTT protein and mRNA in the motor cortex is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the motor cortex is reduced by 30-70%.
  • the expression of HTT protein and mRNA in the motor cortex is reduced by 20-70%.
  • the expression of HTT protein and mRNA in the motor cortex is reduced by 15-70%.
  • the expression of HTT protein and mRNA in the motor cortex is reduced by at least 30%.
  • the expression of HTT protein and mRNA in the motor cortex is reduced by 40-70%.
  • the expression of HTT protein and mRNA in the motor cortex is reduced by 50-70%. As a non-limiting example, the expression of HTT protein and mRNA in the motor cortex is reduced by 50-60%. As a non-limiting example, the expression of HTT protein and mRNA in the motor cortex is reduced by 50%. As a non-limiting example, the expression of HTT protein and mRNA in the motor cortex is reduced by 51%. As a non-limiting example, the expression of HTT protein and mRNA in the motor cortex is reduced by 52%. As a non-limiting example, the expression of HTT protein and mRNA in the motor cortex is reduced by 53%.
  • the expression of HTT protein and mRNA in the motor cortex is reduced by 54%. As a non-limiting example, the expression of HTT protein and mRNA in the motor cortex is reduced by 55%. As a non-limiting example, the expression of HTT protein and mRNA in the motor cortex is reduced by 56%. As a non-limiting example, the expression of HTT protein and mRNA in the motor cortex is reduced by 57%. As a non-limiting example, the expression of HTT protein and mRNA in the motor cortex is reduced by 58%. As a non-limiting example, the expression of HTT protein and mRNA in the motor cortex is reduced by 59%.
  • the expression of HTT protein and mRNA in the motor cortex is reduced by 60%.
  • the expression of protein and mRNA in the motor cortex is reduced by 61%.
  • the expression of protein and mRNA in the motor cortex is reduced by 62%.
  • the expression of protein and mRNA in the motor cortex is reduced by 63%.
  • the expression of protein and mRNA in the motor cortex is reduced by 64%.
  • the expression of protein and mRNA in the motor cortex is reduced by 65%.
  • the expression of protein and mRNA in the motor cortex is reduced by 66%.
  • the expression of protein and mRNA in the motor cortex is reduced by 67%.
  • the expression of protein and mRNA in the motor cortex is reduced by 68%.
  • the expression of protein and mRNA in the motor cortex is reduced by 69%.
  • the expression of protein and mRNA in the motor cortex is reduced by 70%.
  • the siRNA duplexes or encoded dsRNA may be used to reduce the expression of HTT protein and/or mRNA in the somatosensory cortex.
  • the expression of HTT protein and/or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 30-70%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 20-70%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 15-70%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by at least 30%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 40-70%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 50-70%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 50-60%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 50%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 51%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 52%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 53%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 54%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 55%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 56%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 57%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 58%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 59%.
  • the expression of HTT protein and mRNA in the somatosensory cortex is reduced by 60%.
  • the expression of protein and mRNA in the somatosensory cortex is reduced by 61%.
  • the expression of protein and mRNA in the somatosensory cortex is reduced by 62%.
  • the expression of protein and mRNA in the somatosensory cortex is reduced by 63%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 64%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 65%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 66%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 67%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 68%. As a non-limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 69%. As a non- limiting example, the expression of protein and mRNA in the somatosensory cortex is reduced by 70%.
  • the siRNA duplexes or encoded dsRNA may be used to reduce the expression of HTT protein and/or mRNA in the temporal cortex.
  • the expression of HTT protein and/or mRNA is reduced by at least about 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 40-50%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 30-70%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 20- 70%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 15-70%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by at least 30%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 40-70%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 50-70%. As a non-limiting example, the expression of HTT protein and mRNA in the temporal cortex is reduced by 50-60%. As a non-limiting example, the expression of HTT protein and mRNA in the temporal cortex is reduced by 50%. As a non-limiting example, the expression of HTT protein and mRNA in the temporal cortex is reduced by 51%. As a non-limiting example, the expression of HTT protein and mRNA in the temporal cortex is reduced by 52%. As a non- limiting example, the expression of HTT protein and mRNA in the temporal cortex is reduced by 53%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 54%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 55%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 56%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 57%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 58%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 59%.
  • the expression of HTT protein and mRNA in the temporal cortex is reduced by 60%.
  • the expression of protein and mRNA in the temporal cortex is reduced by 61%.
  • the expression of protein and mRNA in the temporal cortex is reduced by 62%.
  • the expression of protein and mRNA in the temporal cortex is reduced by 63%.
  • the expression of protein and mRNA in the temporal cortex is reduced by 64%.
  • the expression of protein and mRNA in the temporal cortex is reduced by 65%.
  • the expression of protein and mRNA in the temporal cortex is reduced by 66%.
  • the expression of protein and mRNA in the temporal cortex is reduced by 67%.
  • the expression of protein and mRNA in the temporal cortex is reduced by 68%.
  • the expression of protein and mRNA in the temporal cortex is reduced by 69%.
  • the expression of protein and mRNA in the temporal cortex is reduced by 70%.
  • the present invention provides methods for treating, or ameliorating Huntington’s Disease associated with HTT gene and/or HTT protein in a subject in need of treatment, the method comprising administering to the subject a pharmaceutically effective amount of at least one siRNA duplex or a nucleic acid encoding a siRNA duplex targeting the HTT gene, delivering said siRNA duplex (or encoded duplex) into targeted cells, inhibiting HTT gene expression and protein production, and ameliorating symptoms of HD in the subject.
  • an AAV vector comprising the nucleic acid sequence of at least one siRNA duplex targeting the HTT gene is administered to the subject in need for treating and/or ameliorating HD.
  • the AAV vector serotype may be selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8 (AAVDJ8), AAV-DJ (AAVDJ), AAV-PHP.A (PHP.A), and/or AAV-PHP.B (PHP.B) and variants thereof.
  • the AAV vector serotype is AAV1. In one embodiment, the AAV vector serotype is AAV2. In another embodiment, the AAV vector serotype is AAV5 (e.g., as described by Miniarikova et al. MolTher (2016) 5, e297 and International Publication No. WO2016102664; the contents of each of which are herein incorporated by reference in their entireties). In another embodiment, the AAV vector is AAV-DJ. In yet another embodiment, the AAV vector serotype is AAV-DJ8.
  • the serotype which may be useful in the present invention may be AAV-DJ8.
  • the amino acid sequence of AAV-DJ8 may comprise two or more mutations in order to remove the heparin binding domain (HBD).
  • HBD heparin binding domain
  • the AAV-DJ8 sequence described as SEQ ID NO: 1 in US Patent No.7,588,772, the contents of which are herein incorporated by reference in their entirety may comprise two mutations: (1) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (2) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).
  • K406R where lysine (K; Lys) at amino acid 406 is changed to arginine (R; Arg)
  • R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln)
  • R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).
  • the siRNA molecules or the AAV vectors comprising such siRNA molecules may be introduced directly into the central nervous system of the subject, for example, by infusion into the putamen.
  • the siRNA molecules or the AAV vectors comprising such siRNA molecules may be introduced directly into the central nervous system of the subject, for example, by infusion into the thalamus of a subject.
  • the thalamus is an area of the brain which is relatively spared in subjects with Huntington’s Disease which means it may allow for more widespread cortical transduction via axonal transport of the AAV vectors.
  • the siRNA molecules or the AAV vectors comprising such siRNA molecules may be introduced indirectly into the central nervous system of the subject, for example, by intravenous administration.
  • the siRNA molecules or the AAV vectors comprising such siRNA molecules may be introduced directly into the central nervous system of the subject, for example, by infusion to the white matter of a subject. While not wishing to be bound by theory, distribution via direct white matter infusion may be independent of axonal transport mechanisms which may be impaired in subjects with Huntington’s Disease which means white matter infusion may allow for more transport of the AAV vectors.
  • the pharmaceutical composition of the present invention is used as a solo therapy. In other embodiments, the pharmaceutical composition of the present invention is used in combination therapy.
  • the combination therapy may be in combination with one or more neuroprotective agents such as small molecule compounds, growth factors and hormones which have been tested for their neuroprotective effect on neuron degeneration.
  • the present invention provides methods for treating, or ameliorating Huntington’s Disease (HD) by administering to a subject in need thereof a therapeutically effective amount of a plasmid or AAV vector described herein.
  • HD Huntington’s Disease
  • Huntington’s Disease is a monogenic fatal neurodegenerative disease characterized by progressive chorea, neuropsychiatric and cognitive dysfunction. Huntington’s disease is known to be caused by an autosomal dominant triplet (CAG) repeat expansion in the huntingtin (HTT) gene, which encodes HTT protein with poly-glutamine stretch at its N- terminus. This repeat expansion results in a toxic gain of function of HTT and ultimately leads to striatal neurodegeneration which progresses to widespread brain atrophy. Medium spiny neurons of the striatum appear to be especially vulnerable in HD with up to 95% loss, whereas interneurons are largely spared.
  • CAG autosomal dominant triplet
  • Huntington’s Disease has a profound impact on quality of life. Symptoms typically appear between the ages of 35-44 and the average life expectancy subsequent to disease onset is 10-25 years. In a small percentage of the HD population ( ⁇ 6%), disease onset occurs prior to the age of 21 with appearance of an akinetic-rigid syndrome. These cases tend to progress faster than those of the later onset variety and have been classified as juvenile or Westphal variant HD. It is estimated that approximately 35,000-70,000 patients are currently suffering from HD in the US and Europe. Currently, only symptomatic relief and supportive therapies are available for treatment of HD, with a cure yet to be identified. Ultimately, individuals with HD succumb to pneumonia, heart failure or other complications such as physical injury from falls.
  • HTT is a very large protein (67 exons, 3144 amino acids, ⁇ 350kDa) that undergoes extensive post-translational modification and has numerous sites for interaction with other proteins, particularly at its N-terminus (coincidently the region that carries the repeats in HD). HTT localizes primarily to the cytoplasm but has been shown to shuttle into the nucleus where it may regulate gene
  • HTT has a role in vesicular transport and regulating RNA trafficking. It has also been suggested that HTT has a role in vesicular transport and regulating RNA trafficking.
  • the HTT protein sequence is SEQ ID NO: 1 (NCBI NP_002102.4) and the HTT nucleic acid sequence is SEQ ID NO: 2 (NCBI NM_002111.7).
  • HD belongs to a family of nine additional human genetic disorders all of which are characterized by CAG-expanded genes and resultant polyglutamine (poly-Q) protein products with subsequent formation of intraneuronal aggregates.
  • poly-Q polyglutamine
  • polyglutamine-expanded HTT protein and its resultant aggregates have been wide ranging, but include, caspase activation, dysregulation of transcriptional pathways, increased production of reactive oxygen species, mitochondrial dysfunction, disrupted axonal transport and/or inhibition of protein degradation systems within the cell.
  • Polyglutamine-expanded HTT may not only have a toxic gain of function, but also exert a dominant negative effect by interfering with the normal function of other cellular proteins and processes.
  • HTT has also been implicated in non-cell autonomous neurotoxicity, whereby a cell hosting HTT spreads the HTT to other neurons nearby.
  • the present invention provides modulatory polynucleotides, e.g., siRNA molecules targeting the HTT gene and methods for their design and manufacture. While not wishing to be bound by a single theory of operability, the invention provides modulatory polynucleotides, including siRNAs, that interfere with HTT expression, including HTT mutant and/or wild-type HTT gene expression. Particularly, the present invention employs viral vectors such as adeno- associated viral (AAV) vectors comprising the nucleic acid sequence encoding the siRNA molecules of the present invention.
  • AAV adeno- associated viral
  • the AAV vectors comprising the nucleic acid sequence encoding the siRNA molecules of the present invention may increase the delivery of active agents into neurons of interest such as medium spiny neurons of the striatum and cortical neurons.
  • the siRNA duplexes or encoding dsRNA targeting the HTT gene may be able to inhibit HTT gene expression (e.g., mRNA level) significantly inside cells; therefore, ameliorating HTT expression-induced stress inside the cells such as aggregation of protein and formation of inclusions, increased free radicals, mitochondrial dysfunction and RNA metabolism.
  • Symptoms of HD may include features attributed to CNS degeneration such as, but are not limited to, chorea, dystonia, bradykinesia, incoordination, irritability and depression, problem-solving difficulties, reduction in the ability of a person to function in their normal day to day life, diminished speech, and difficulty swallowing, , as well as features not attributed to CNS degeneration such as, but not limited to, weight loss, muscle wasting, metabolic dysfunction and endocrine disturbances.
  • siRNA-mediated HTT expression inhibition may be used for treating HD.
  • methods for treating and/or ameliorating HD in a patient comprises administering to the patient an effective amount of AAV vector comprising a nucleic acid sequence encoding the siRNA molecules of the present invention into cells.
  • the administration of the AAV vector comprising such a nucleic acid sequence will encode the siRNA molecules which cause the inhibition/silence of HTT gene expression.
  • the vector e.g., AAV vectors
  • a subject has fully penetrant HD where the HTT gene has 41 or more CAG repeats (e.g., 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 or more than 90 CAG repeats).
  • CAG repeats e.g., 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,
  • a subject has incomplete penetrance where the HTT gene has between 36 and 40 CAG repeats (e.g., 36, 37, 38, 39 and 40 CAG repeats).
  • Model systems for studying Huntington’s Disease which may be used with the siRNAs and vectors described herein include, but are not limited to, cell models (e.g., primary neurons and induced pluripotent stem cells), invertebrate models (e.g., drosophila or caenorhabditis elegans), mouse models (e.g., YAC128 mouse model; R6/2 mouse model; BAC, YAC and knock-in mouse model), rat models (e.g., BAC) and large mammal models (e.g., pigs, sheep or monkeys).
  • cell models e.g., primary neurons and induced pluripotent stem cells
  • invertebrate models e.g., drosophila or caenorhabditis elegans
  • mouse models e.g., YAC128 mouse model; R6/2 mouse model; BAC, YAC and knock-in mouse model
  • rat models e.g., BAC
  • modulatory polynucleotides may be used to treat neurodegenerative disease, in particular, Huntington’s Disease (HD).
  • a“modulatory polynucleotide” is any nucleic acid sequence(s) which functions to modulate (either increase or decrease) the level or amount of a target gene, e.g., mRNA or protein levels.
  • the modulatory polynucleotides may comprise at least one nucleic acid sequence encoding at least one siRNA molecule.
  • the nucleic acids may, independently if there is more than one, encode 1, 2, 3, 4, 5, 6, 7, 8, 9, or more than 9 siRNA molecules.
  • the present invention relates to RNA interference (RNAi) induced inhibition of gene expression for treating neurodegenerative disorders.
  • RNAi RNA interference
  • siRNA duplexes or encoded dsRNA that target the HTT gene referred to herein collectively as“siRNA
  • siRNA duplexes or encoded dsRNA can reduce or silence HTT gene expression in cells, for example, medium spiny neurons, cortical neurons and/or astrocytes, thereby, ameliorating symptoms of Huntington’s Disease (HD).
  • HD Huntington’s Disease
  • RNAi also known as post-transcriptional gene silencing (PTGS), quelling, or co- suppression
  • PTGS post-transcriptional gene silencing
  • the active components of RNAi are short/small double stranded RNAs (dsRNAs), called small interfering RNAs (siRNAs), that typically contain 15-30 nucleotides (e.g., 19 to 25, 19 to 24 or 19-21 nucleotides) and 2 nucleotide 3’ overhangs and that match the nucleic acid sequence of the target gene.
  • dsRNAs short/small double stranded RNAs
  • siRNAs small interfering RNAs
  • These short RNA species may be naturally produced in vivo by Dicer-mediated cleavage of larger dsRNAs and they are functional in mammalian cells.
  • miRNAs Naturally expressed small RNA molecules, named microRNAs (miRNAs), elicit gene silencing by regulating the expression of mRNAs.
  • the miRNAs-containing RNA Induced Silencing Complex (RISC) targets mRNAs presenting a perfect sequence complementarity with nucleotides 2-7 in the 5’region of the miRNA which is called the seed region, and other base pairs with its 3’region.
  • miRNA-mediated down-regulation of gene expression may be caused by cleavage of the target mRNAs, translational inhibition of the target mRNAs, or mRNA decay.
  • miRNA targeting sequences are usually located in the 3’-UTR of the target mRNAs.
  • a single miRNA may target more than 100 transcripts from various genes, and one mRNA may be targeted by different miRNAs.
  • siRNA duplexes or dsRNA targeting a specific mRNA may be designed and synthesized in vitro and introduced into cells for activating RNAi processes.
  • Elbashir et al. demonstrated that 21-nucleotide siRNA duplexes (termed small interfering RNAs) were capable of effecting potent and specific gene knockdown without inducing immune response in mammalian cells (Elbashir SM et al., Nature, 2001, 411, 494-498). Since this initial report, post- transcriptional gene silencing by siRNAs quickly emerged as a powerful tool for genetic analysis in mammalian cells and has the potential to produce novel therapeutics.
  • RNAi molecules which were designed to target against a nucleic acid sequence that encodes poly-glutamine repeat proteins which cause poly-glutamine expansion diseases such as Huntington’s Disease, are described in US Patent No.9,169,483 and 9,181,544 and International Patent Publication No. WO2015179525, the content of each of which is herein incorporated by reference in their entirety. US Patent Nos.9,169,483 and 9,181,544 and International Patent Publication No.
  • WO2015179525 each provide isolated RNA duplexes comprising a first strand of RNA (e.g., 15 contiguous nucleotides) and second strand of RNA (e.g., complementary to at least 12 contiguous nucleotides of the first strand) where the RNA duplex is about 15 to 30 base pairs in length.
  • the first strand of RNA and second strand of RNA may be operably linked by an RNA loop ( ⁇ 4 to 50 nucleotides) to form a hairpin structure which may be inserted into an expression cassette.
  • Non-limiting examples of loop portions include SEQ ID NO: 9-14 of US Patent No.9,169,483, the content of which is herein incorporated by reference in its entirety.
  • Non-limiting examples of strands of RNA which may be used, either full sequence or part of the sequence, to form RNA duplexes include SEQ ID NO: 1-8 of US Patent No.9,169,483 and SEQ ID NO: 1-11, 33-59, 208-210, 213-215 and 218-221 of US Patent No.9,181,544, the contents of each of which is herein incorporated by reference in its entirety.
  • Non-limiting examples of RNAi molecules include SEQ ID NOs: 1-8 of US Patent No.9,169,483, SEQ ID NOs: 1-11, 33-59, 208-210, 213-215 and 218-221 of US Patent No.9,181,544 and SEQ ID NOs: 1, 6, 7, and 35-38 of International Patent Publication No. WO2015179525, the contents of each of which is herein incorporated by reference in their entirety.
  • siRNA molecules may be introduced into cells in order to activate RNAi.
  • An exogenous siRNA duplex when it is introduced into cells, similar to the endogenous dsRNAs, can be assembled to form the RNA Induced Silencing Complex (RISC), a multiunit complex that interacts with RNA sequences that are complementary to one of the two strands of the siRNA duplex (i.e., the antisense strand).
  • RISC RNA Induced Silencing Complex
  • the sense strand (or passenger strand) of the siRNA is lost from the complex, while the antisense strand (or guide strand) of the siRNA is matched with its complementary RNA.
  • the targets of siRNA containing RISC complexes are mRNAs presenting a perfect sequence complementarity. Then, siRNA mediated gene silencing occurs by cleaving, releasing and degrading the target.
  • siRNA duplex comprised of a sense strand homologous to the target mRNA and an antisense strand that is complementary to the target mRNA offers much more advantage in terms of efficiency for target RNA destruction compared to the use of the single strand (ss)-siRNAs (e.g. antisense strand RNA or antisense oligonucleotides). In many cases, it requires higher concentration of the ss-siRNA to achieve the effective gene silencing potency of the ss-siRNA.
  • Any of the foregoing molecules may be encoded by an AAV vector or vector genome. Design and Sequences of siRNA duplexes targeting HTT gene
  • siRNA sequence preference include, but are not limited to, (i) A/U at the 5 ⁇ end of the antisense strand; (ii) G/C at the 5 ⁇ end of the sense strand; (iii) at least five A/U residues in the 5 ⁇ terminal one ⁇ third of the antisense strand; and (iv) the absence of any GC stretch of more than 9 nucleotides in length.
  • highly effective siRNA molecules essential for suppressing mammalian target gene expression may be readily designed.
  • siRNA molecules e.g., siRNA duplexes or encoded dsRNA
  • Such siRNA molecules can specifically, suppress HTT gene expression and protein production.
  • the siRNA molecules are designed and used to selectively“knock out” HTT gene variants in cells, i.e., mutated HTT transcripts that are identified in patients with HD disease.
  • the siRNA molecules are designed and used to selectively“knock down” HTT gene variants in cells.
  • the siRNA molecules are able to inhibit or suppress both the wild type and mutated HTT gene.
  • an siRNA molecule of the present invention comprises a sense strand and a complementary antisense strand in which both strands are hybridized together to form a duplex structure.
  • the antisense strand has sufficient complementarity to the HTT mRNA sequence to direct target-specific RNAi, i.e., the siRNA molecule has a sequence sufficient to trigger the destruction of the target mRNA by the RNAi machinery or process.
  • an siRNA molecule of the present invention comprises a sense strand and a complementary antisense strand in which both strands are hybridized together to form a duplex structure and where the start site of the hybridization to the HTT mRNA is between nucleotide 100 and 7000 on the HTT mRNA sequence.
  • the start site may be between nucleotide 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 700-70, 750-800, 800-850, 850-900, 900-950, 950-1000, 1000-1050, 1050-1100, 1100-1150, 1150-1200, 1200-1250, 1250-1300, 1300-1350, 1350-1400, 1400-1450, 1450-1500, 1500-1550, 1550-1600, 1600-1650, 1650-1700, 1700-1750, 1750-1800, 1800-1850, 1850-1900, 1900-1950, 1950-2000, 2000-2050, 2050-2100, 2100-2150, 2150-2200, 2200-2250, 2250-2300, 2300-2350, 2350-2400, 2400-2450, 2450-2500, 2500-2550, 2550-2600, 2600-2650,
  • the start site may be nucleotide 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 875, 876, 877, 878, 879, 880, 881, 882
  • the antisense strand and target mRNA sequences have 100% complementary.
  • the antisense strand may be complementary to any part of the target mRNA sequence.
  • the antisense strand and target mRNA sequences comprise at least one mismatch.
  • the antisense strand and the target mRNA sequence have at least 30%, 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-99%, 30-40%, 30-50%, 30- 60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-99%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-99%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-99%, 60-70%, 60-80%, 60- 90%, 60-9
  • the siRNA molecule has a length from about 10-50 or more nucleotides, i.e., each strand comprising 10-50 nucleotides (or nucleotide analogs).
  • the siRNA molecule has a length from about 15-30, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein one of the strands is sufficiently complementarity to a target region.
  • the siRNA molecule has a length from about 19 to 25, 19 to 24 or 19 to 21 nucleotides.
  • the siRNA molecules of the present invention can be synthetic RNA duplexes comprising about 19 nucleotides to about 25 nucleotides, and two overhanging nucleotides at the 3'-end.
  • the siRNA molecules may be unmodified RNA molecules.
  • the siRNA molecules may contain at least one modified nucleotide, such as base, sugar or backbone modifications.
  • the siRNA molecules of the present invention may comprise a nucleotide sequence such as, but not limited to, the antisense (guide) sequences in Table 1 or a fragment or variant thereof.
  • the antisense sequence used in the siRNA molecule of the present invention is at least 30%, 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-99%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-99%, 40-50%, 40- 60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-99%, 50-60%, 50-70%, 50
  • the antisense sequence used in the siRNA molecule of the present invention comprises at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or more than 21 consecutive nucleotides of a nucleotide sequence in Table 1.
  • the antisense sequence used in the siRNA molecule of the present invention comprises nucleotides 1 to 22, 1 to 21, 1 to 20, 1 to 19, 1 to 18, 1 to 17, 1 to 16, 1 to 15, 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 9, 1 to 8, 2 to 22, 2 to 21, 2 to 20, 2 to 19, 2 to 18, 2 to 17, 2 to 16, 2 to 15, 2 to 14, 2 to 13, 2 to 12, 2 to 11, 2 to 10, 2 to 9, 2 to 8, 3 to 22, 3 to 21, 3 to 20, 3 to 19, 3 to 18, 3 to 17, 3 to 16, 3 to 15, 3 to 14, 3 to 13, 3 to 12, 3 to 11, 3 to 10, 3 to 9, 3 to 8, 4 to 22, 4 to 21, 4 to 20, 4 to 19, 4 to 18, 4 to 17, 4 to 16, 4 to 15, 4 to 14, 4 to 13, 4 to 12, 4 to 11, 4 to 10, 4 to 9, 4 to 8, 5 to 22, 5 to 21, 5 to 20, 5 to 19, 5 to 18, 5 to 17, 5 to 16, 5 to 15, 5 to 14, 5 to 13, 5 to 12, 5 to 11, 5 to 10, 5 to 9, 5 to 9, 5 to 9, 5 to 9, 5
  • the siRNA molecules of the present invention may comprise a nucleotide sequence such as, but not limited to, the sense (passenger) sequences in Table 2 or a fragment or variant thereof.
  • the sense sequence used in the siRNA molecule of the present invention is at least 30%, 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-99%, 30- 40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-99%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-99%, 50-60%, 50-70%, 50-80%,
  • the sense sequence used in the siRNA molecule of the present invention comprises at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or more than 21 consecutive nucleotides of a nucleotide sequence in Table 2.
  • the sense sequence used in the siRNA molecule of the present invention comprises nucleotides 1 to 22, 1 to 21, 1 to 20, 1 to 19, 1 to 18, 1 to 17, 1 to 16, 1 to 15, 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 9, 1 to 8, 2 to 22, 2 to 21, 2 to 20, 2 to 19, 2 to 18, 2 to 17, 2 to 16, 2 to 15, 2 to 14, 2 to 13, 2 to 12, 2 to 11, 2 to 10, 2 to 9, 2 to 8, 3 to 22, 3 to 21, 3 to 20, 3 to 19, 3 to 18, 3 to 17, 3 to 16, 3 to 15, 3 to 14, 3 to 13, 3 to 12, 3 to 11, 3 to 10, 3 to 9, 3 to 8, 4 to 22, 4 to 21, 4 to 20, 4 to 19, 4 to 18, 4 to 17, 4 to 16, 4 to 15, 4 to 14, 4 to 13, 4 to 12, 4 to 11, 4 to 10, 4 to 9, 4 to 8, 5 to 22, 4 to 13, 4 to 12, 4 to 11, 4 to 10, 4 to 9, 4 to 8, 5 to 22, 5 to 21, 5 to 20, 5 to 19, 5 to 18, 5 to 17, 5 to 16, 5 to 15, 5 to 14, 5 to 13, 5 to 12,
  • the siRNA molecules of the present invention may comprise an antisense sequence from Table 1 and a sense sequence from Table 2, or a fragment or variant thereof.
  • the antisense sequence and the sense sequence have at least 30%, 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or at least 20-30%, 20-40%, 20-50%, 20- 60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-99%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-99%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-99%, 50- 60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-99%, 60-70%,
  • the siRNA molecules of the present invention may comprise the sense and antisense siRNA duplex as described in Tables 3-5.
  • these siRNA duplexes may be tested for in vitro inhibitory activity on endogenous HTT gene expression.
  • the siRNA molecules of the present invention can be encoded in plasmid vectors, viral vectors (e.g., AAV vectors), genome or other nucleic acid expression vectors for delivery to a cell.
  • viral vectors e.g., AAV vectors
  • genome or other nucleic acid expression vectors for delivery to a cell.
  • DNA expression plasmids can be used to stably express the siRNA duplexes or dsRNA of the present invention in cells and achieve long-term inhibition of the target gene expression.
  • the sense and antisense strands of a siRNA duplex are typically linked by a short spacer sequence leading to the expression of a stem-loop structure termed short hairpin RNA (shRNA).
  • shRNA short hairpin RNA
  • the hairpin is recognized and cleaved by Dicer, thus generating mature siRNA molecules.
  • the sense and antisense strands of a siRNA duplex may be linked by a short spacer sequence, which may optionally be linked to additioal flanking sequence, leading to the expression of a flanking arm-stem-loop structure termed primary microRNA (pri- miRNA).
  • pri- miRNA flanking arm-stem-loop structure
  • the pri-miRNA may be recognized and cleaved by Drosha and Dicer, and thus generate mature siRNA molecules.
  • AAV vectors comprising the nucleic acids encoding the siRNA molecules targeting HTT mRNA are produced
  • the AAV vector serotypes may be AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, AAV- PHP.A (PHP.A), and/or AAV-PHP.B (PHP.B) and variants thereof.
  • the siRNA duplexes or encoded dsRNA of the present invention suppress (or degrade) target mRNA (e.g., HTT). Accordingly, the siRNA duplexes or encoded dsRNA can be used to substantially inhibit HTT gene expression in a cell, for example a neuron.
  • target mRNA e.g., HTT
  • the inhibition of HTT gene expression refers to an inhibition by at least about 20%, preferably by at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30- 40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40- 70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50- 100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80- 90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%.
  • the protein product of the targeted gene may be inhibited by at least about 20%, preferably by at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% and 100%, or at least 20-30%, 20-40%, 20-50%, 20- 60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30- 80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40- 100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60- 95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90- 100% or 95-100%.
  • the siRNA molecules are designed and tested for their ability to reduce HTT mRNA levels in cultured cells.
  • Such siRNA molecules may form a duplex such as, but not limited to, include those listed in Table 3, Table 4 or Table 5.
  • the siRNA duplexes may be siRNA duplex IDs: D-3500 to D-3570.
  • the siRNA molecules comprise a miRNA seed match for the target (e.g., HTT) located in the guide strand.
  • the siRNA molecules comprise a miRNA seed match for the target (e.g., HTT) located in the passenger strand.
  • the siRNA duplexes or encoded dsRNA targeting HTT gene do not comprise a seed match for the target (e.g., HTT) located in the guide or passenger strand.
  • the siRNA duplexes or encoded dsRNA targeting HTT gene may have almost no significant full-length off targets for the guide strand. In another embodiment, the siRNA duplexes or encoded dsRNA targeting HTT gene may have almost no significant full- length off target effects for the passenger strand.
  • the siRNA duplexes or encoded dsRNA targeting HTT gene may have less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 1-5%, 2-6%, 3-7%, 4-8%, 5-9%, 5- 10%, 6-10%, 5-15%, 5-20%, 5-25% 5-30%, 10-20%, 10-30%, 10-40%, 10-50%, 15-30%, 15- 40%, 15-45%, 20-40%, 20-50%, 25-50%, 30-40%, 30-50%, 35-50%, 40-50%, 45-50% full- length off target effects for the passenger strand.
  • the siRNA duplexes or encoded dsRNA targeting HTT gene may have almost no significant full-length off targets for the guide strand or the passenger strand.
  • the siRNA duplexes or encoded dsRNA targeting HTT gene may have less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 1-5%, 2-6%, 3-7%, 4-8%, 5-9%, 5- 10%, 6-10%, 5-15%, 5-20%, 5-25% 5-30%, 10-20%, 10-30%, 10-40%, 10-50%, 15-30%, 15- 40%, 15-45%, 20-40%, 20-50%, 25-50%, 30-40%, 30-50%, 35-50%, 40-50%, 45-50% full- length off target effects for the guide or passenger strand.
  • the siRNA duplexes or encoded dsRNA targeting HTT gene may have high activity in vitro.
  • the siRNA molecules may have low activity in vitro.
  • the siRNA duplexes or dsRNA targeting the HTT gene may have high guide strand activity and low passenger strand activity in vitro.
  • the siRNA molecules have a high guide strand activity and low passenger strand activity in vitro.
  • the target knock-down (KD) by the guide strand may be at least 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5% or 100%.
  • the target knock-down by the guide strand may be 40-50%, 45-50%, 50-55%, 50-60%, 60-65%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 60-99%, 60-99.5%, 60-100%, 65-70%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 65-99%, 65-99.5%, 65-100%, 70-75%, 70-80%, 70-85%, 70-90%, 70-95%, 70-99%, 70-99.5%, 70-100%, 75-80%, 75-85%, 75-90%, 75-95%, 75-99%, 75-99.5%, 75-100%, 80-85%, 80-90%, 80-95%, 80-99%, 80-99.5%, 80-100%, 85-90%, 85-95%, 85-99%, 85-99.5%, 85-100%, 90-95%, 90-99%, 90-99.5%, 90-100%, 95-99%, 95-99.5%, 95- 100%, 99-
  • the siRNA duplex is designed so there is no miRNA seed match for the sense or antisense sequence to non-Htt sequences.
  • the IC50 of the guide strand for the nearest off target is greater than 100 multiplied by the IC 50 of the guide strand for the target.
  • the siRNA molecule is said to have high guide strand selectivity for inhibiting Htt in vitro.
  • the 5’ processing of the guide strand has a correct start (n) at the 5’ end at least 75%, 80%, 85%, 90%, 95%, 99% or 100% of the time in vitro or in vivo.
  • the 5’ processing of the guide strand is precise and has a correct start (n) at the 5’ end at least 99% of the time in vitro.
  • the 5’ processing of the guide strand is precise and has a correct start (n) at the 5’ end at least 99% of the time in vivo.
  • the 5’ processing of the guide strand is precise and has a correct start (n) at the 5’ end at least 90% of the time in vitro.
  • the 5’ processing of the guide strand is precise and has a correct start (n) at the 5’ end at least 90% of the time in vivo.
  • the 5’ processing of the guide strand is precise and has a correct start (n) at the 5’ end at least 85% of the time in vitro.
  • the 5’ processing of the guide strand is precise and has a correct start (n) at the 5’ end at least 85% of the time in vivo.
  • the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1;1, 2:10, 2:9, 2:8, 2:7, 2:6, 2:5, 2:4, 2:3, 2:2, 2:1, 3:10, 3:9, 3:8, 3:7, 3:6, 3:5, 3:4, 3:3, 3:2, 3:1, 4:10, 4:9, 4:8, 4:7, 4:6, 4:5, 4:4, 4:3, 4:2, 4:1, 5:10, 5:9, 5:8, 5:7, 5:6, 5:5, 5:4, 5:3, 5:2, 5:1, 6:10, 6:9, 6:8, 6:7, 6:6, 6:5, 6:4, 6:3, 6:2, 6:1, 7:10, 7:9, 7:8, 7:7, 7:6, 7:5, 7:4, 7:3, 7:
  • the guide to passenger ratio refers to the ratio of the guide strands to the passenger strands after the intracellular processing of the pri-microRNA. For example, a 80:20 guide-to-passenger ratio would have 8 guide strands to every 2 passenger strands processed from the precursor.
  • the guide-to-passenger strand ratio is 8:2 in vitro.
  • the guide-to-passenger strand ratio is 8:2 in vivo.
  • the guide-to- passenger strand ratio is 9:1 in vitro.
  • the guide-to-passenger strand ratio is 9:1 in vivo.
  • the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is greater than 1.
  • the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is greater than 2.
  • the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is greater than 5.
  • the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is greater than 10.
  • the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is greater than 20.
  • the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is greater than 50.
  • the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is at least 3:1.
  • the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is at least 5:1.
  • the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is at least 10:1.
  • the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is at least 20:1.
  • the guide to passenger (G:P) (also referred to as the antisense to sense) strand ratio expressed is at least 50:1.
  • the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1;1, 2:10, 2:9, 2:8, 2:7, 2:6, 2:5, 2:4, 2:3, 2:2, 2:1, 3:10, 3:9, 3:8, 3:7, 3:6, 3:5, 3:4, 3:3, 3:2, 3:1, 4:10, 4:9, 4:8, 4:7, 4:6, 4:5, 4:4, 4:3, 4:2, 4:1, 5:10, 5:9, 5:8, 5:7, 5:6, 5:5, 5:4, 5:3, 5:2, 5:1, 6:10, 6:9, 6:8, 6:7, 6:6, 6:5, 6:4, 6:3, 6:2, 6:1, 7:10, 7:9, 7:8, 7:7, 7:6, 7:5, 7:4, 7:3, 7:
  • the passenger to guide ratio refers to the ratio of the passenger strands to the guide strands after the excision of the guide strand.
  • a 80:20 passenger to guide ratio would have 8 passenger strands to every 2 guide strands processed from the precursor.
  • the passenger-to-guide strand ratio is 80:20 in vitro.
  • the passenger-to-guide strand ratio is 80:20 in vivo.
  • the passenger-to- guide strand ratio is 8:2 in vitro.
  • the passenger-to-guide strand ratio is 8:2 in vivo.
  • the passenger-to-guide strand ratio is 9:1 in vitro.
  • the passenger-to-guide strand ratio is 9:1 in vivo.
  • the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is greater than 1.
  • the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is greater than 2.
  • the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is greater than 5.
  • the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is greater than 10.
  • the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is greater than 20.
  • the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is greater than 50.
  • the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is at least 3:1.
  • the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is at least 5:1.
  • the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is at least 10:1.
  • the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is at least 20:1.
  • the passenger to guide (P:G) (also referred to as the sense to antisense) strand ratio expressed is at least 50:1.
  • a passenger-guide strand duplex is considered effective when the pri- or pre-microRNAs demonstrate, but methods known in the art and described herein, greater than 2-fold guide to passenger strand ratio when processing is measured.
  • the pri- or pre-microRNAs demonstrate great than 2-fold, 3-fold, 4-fold, 5-fold, 6- fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, or 2 to 5-fold, 2 to 10-fold, 2 to 15-fold, 3 to 5-fold, 3 to 10-fold, 3 to 15-fold, 4 to 5-fold, 4 to 10-fold, 4 to 15-fold, 5 to 10-fold, 5 to 15-fold, 6 to 10-fold, 6 to 15-fold, 7 to 10-fold, 7 to 15-fold, 8 to 10-fold, 8 to 15-fold, 9 to 10-fold, 9 to 15-fold, 10 to 15-fold, 11 to 15-fold, 12 to 15-fold, 13 to 15-
  • the vector genome encoding the dsRNA comprises a sequence which is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more than 99% of the full length of the construct.
  • the vector genome comprises a sequence which is at least 80% of the full length sequence of the construct.
  • the siRNA molecules may be used to silence wild type or mutant HTT by targeting at least one exon on the htt sequence.
  • the exon may be exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, exon 22, exon 23, exon 24, exon 25, exon 26, exon 27, exon 28, exon 29, exon 30, exon 31, exon 32, exon 33, exon 34, exon 35, exon 36, exon 37, exon 38, exon 39, exon 40, exon 41, exon 42, exon 43, exon 44, exon 45, exon 46, exon 47, exon 48, exon 49, exon 50, exon 51, exon 52, exon 53, exon 54, exon 55, exon 56, exon 57, exon 58, exon 59, exon 60,
  • the siRNA molecules may be used to silence wild type or mutant HTT by targeting exon 1.
  • the siRNA molecules may be used to silence wild type or mutant HTT by targeting an exon other than exon 1.
  • the siRNA molecules may be used to silence wild type or mutant HTT by targeting exon 50.
  • the siRNA molecules may be used to silence wild type or mutant HTT by targeting exon 67.
  • the siRNA molecules may be used to silence wild type and/or mutant HTT by targeting at least one exon on the htt sequence.
  • the exon may be exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, exon 22, exon 23, exon 24, exon 25, exon 26, exon 27, exon 28, exon 29, exon 30, exon 31, exon 32, exon 33, exon 34, exon 35, exon 36, exon 37, exon 38, exon 39, exon 40, exon 41, exon 42, exon 43, exon 44, exon 45, exon 46, exon 47, exon 48, exon 49, exon 50, exon 51, exon 52, exon 53, exon 54, exon 55, exon 56, exon 57, exon 58, exon 59, exon
  • the siRNA molecules may be used to silence wild type and/or mutant HTT by targeting exon 1.
  • the siRNA molecules may be used to silence wild type and/or mutant HTT by targeting an exon other than exon 1.
  • the siRNA molecules may be used to silence wild type and/or mutant HTT by targeting exon 50.
  • the siRNA molecules may be used to silence wild type and/or mutant HTT by targeting exon 67.
  • the siRNA molecules of the present invention when not delivered as a precursor or DNA, may be chemically modified to modulate some features of RNA molecules, such as, but not limited to, increasing the stability of siRNAs in vivo.
  • the chemically modified siRNA molecules can be used in human therapeutic applications, and are improved without compromising the RNAi activity of the siRNA molecules.
  • the siRNA molecules modified at both the 3 ⁇ and the 5 ⁇ end of both the sense strand and the antisense strand may be chemically modified to modulate some features of RNA molecules, such as, but not limited to, increasing the stability of siRNAs in vivo.
  • the chemically modified siRNA molecules can be used in human therapeutic applications, and are improved without compromising the RNAi activity of the siRNA molecules.
  • the siRNA molecules modified at both the 3 ⁇ and the 5 ⁇ end of both the sense strand and the antisense strand may be chemically modified to modulate some features of RNA molecules, such as, but not limited to, increasing the stability of siRNAs in vivo.
  • the siRNA duplexes of the present invention may contain one or more modified nucleotides such as, but not limited to, sugar modified nucleotides, nucleobase modifications and/or backbone modifications.
  • the siRNA molecule may contain combined modifications, for example, combined nucleobase and backbone modifications.
  • the modified nucleotide may be a sugar-modified nucleotide.
  • Sugar modified nucleotides include, but are not limited to 2 ⁇ -fluoro, 2 ⁇ -amino and 2 ⁇ -thio modified ribonucleotides, e.g.2 ⁇ -fluoro modified ribonucleotides.
  • Modified nucleotides may be modified on the sugar moiety, as well as nucleotides having sugars or analogs thereof that are not ribosyl.
  • the sugar moieties may be, or be based on, mannoses, arabinoses, glucopyranoses, galactopyranoses, 4 ⁇ -thioribose, and other sugars, heterocycles, or carbocycles.
  • the modified nucleotide may be a nucleobase-modified nucleotide.
  • the modified nucleotide may be a backbone-modified nucleotide.
  • the siRNA duplexes of the present invention may further comprise other modifications on the backbone.
  • a normal“backbone”, as used herein, refers to the repeating alternating sugar-phosphate sequences in a DNA or RNA molecule. The deoxyribose/ribose sugars are joined at both the 3'-hydroxyl and 5'-hydroxyl groups to phosphate groups in ester links, also known as "phosphodiester" bonds/linker (PO linkage).
  • PO backbones may be modified as“phosphorothioate backbone (PS linkage).
  • the natural phosphodiester bonds may be replaced by amide bonds but the four atoms between two sugar units are kept.
  • Such amide modifications can facilitate the solid phase synthesis of oligonucleotides and increase the thermodynamic stability of a duplex formed with siRNA complement. See e.g. Mesmaeker et al., Pure & Appl. Chem., 1997, 3, 437-440; the content of which is incorporated herein by reference in its entirety.
  • Modified bases refer to nucleotide bases such as, for example, adenine, guanine, cytosine, thymine, uracil, xanthine, inosine, and queuosine that have been modified by the replacement or addition of one or more atoms or groups.
  • nucleobase moieties include, but are not limited to, alkylated, halogenated, thiolated, aminated, amidated, or acetylated bases, individually or in combination.
  • More specific examples include, for example, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N,- dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, 3- methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides having a modification at the 5 position, 5-(2-amino)propyl uridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1- methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7- methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, deazanucleotides such as 7-deaza-adenosine, 6-azouridine, 6-azocytidine,
  • the modified nucleotides may be on just the sense strand.
  • the modified nucleotides may be on just the antisense strand.
  • the modified nucleotides may be in both the sense and antisense strands.
  • the chemically modified nucleotide does not affect the ability of the antisense strand to pair with the target mRNA sequence, such as the HTT mRNA sequence.
  • the siRNA molecules may be encoded in a modulatory
  • polynucleotide which also comprises a molecular scaffold.
  • a“molecular scaffold” is a framework or starting molecule that forms the sequence or structural basis against which to design or make a subsequent molecule.
  • the molecular scaffold comprises at least one 5’ flanking region.
  • the 5’ flanking region may comprise a 5’ flanking sequence which may be of any length and may be derived in whole or in part from wild type microRNA sequence or be a completely artificial sequence.
  • the molecular scaffold comprises at least one 3’ flanking region.
  • the 3’ flanking region may comprise a 3’ flanking sequence which may be of any length and may be derived in whole or in part from wild type microRNA sequence or be a completely artificial sequence.
  • the molecular scaffold comprises at least one loop motif region.
  • the loop motif region may comprise a sequence which may be of any length.
  • the molecular scaffold comprises a 5’ flanking region, a loop motif region and/or a 3’ flanking region.
  • At least one payload may be encoded by a modulatory polynucleotide which may also comprise at least one molecular scaffold.
  • the molecular scaffold may comprise a 5’ flanking sequence which may be of any length and may be derived in whole or in part from wild type microRNA sequence or be completely artificial.
  • the 3’ flanking sequence may mirror the 5’ flanking sequence and/or a 3’ flanking sequence in size and origin. Either flanking sequence may be absent.
  • the 3’ flanking sequence may optionally contain one or more CNNC motifs, where“N” represents any nucleotide.
  • Forming the stem of a stem loop structure is a minimum of the modulatory
  • the payload sequence comprises at least one nucleic acid sequence which is in part complementary or will hybridize to a target sequence.
  • the payload is a siRNA molecule or fragment of a siRNA molecule.
  • the 5’ arm of the stem loop structure of the modulatory polynucleotide comprises a nucleic acid sequence encoding a sense sequence.
  • sense sequences, or fragments or variants thereof, which may be encoded by the modulatory polynucleotide are described in Table 2.
  • the 3’ arm of the stem loop of the modulatory polynucleotide comprises a nucleic acid sequence encoding an antisense sequence.
  • the antisense sequence in some instances, comprises a“G” nucleotide at the 5’ most end.
  • Non-limiting examples of antisense sequences, or fragments or variants thereof, which may be encoded by the modulatory polynucleotide are described in Table 3.
  • the sense sequence may reside on the 3’ arm while the antisense sequence resides on the 5’ arm of the stem of the stem loop structure of the modulatory polynucleotide.
  • sense and antisense sequences which may be encoded by the modulatory polynucleotide are described in Tables 2 and 3.
  • the sense and antisense sequences may be completely identical
  • the sense sequence and antisense sequence may be at least 70, 80, 90, 95 or 99% complementarity across independently at least 50, 60, 70, 80, 85, 90, 95, or 99 % of the length of the strands.
  • separating the sense and antisense sequence of the stem loop structure of the modulatory polynucleotide is a loop sequence (also known as a loop motif, linker or linker motif).
  • the loop sequence may be of any length, between 4-30 nucleotides, between 4- 20 nucleotides, between 4-15 nucleotides, between 5-15 nucleotides, between 6-12 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, and/or 15 nucleotides.
  • the loop sequence comprises a nucleic acid sequence encoding at least one UGUG motif. In some embodiments, the nucleic acid sequence encoding the UGUG motif is located at the 5’ terminus of the loop sequence.
  • spacer regions may be present in the modulatory polynucleotide to separate one or more modules (e.g., 5’ flanking region, loop motif region, 3’ flanking region, sense sequence, antisense sequence) from one another. There may be one or more such spacer regions present.
  • modules e.g., 5’ flanking region, loop motif region, 3’ flanking region, sense sequence, antisense sequence
  • a spacer region of between 8-20, i.e., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides may be present between the sense sequence and a flanking region sequence.
  • the length of the spacer region is 13 nucleotides and is located between the 5’ terminus of the sense sequence and the 3’ terminus of the flanking sequence.
  • a spacer is of sufficient length to form approximately one helical turn of the sequence.
  • a spacer region of between 8-20, i.e., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides may be present between the antisense sequence and a flanking sequence.
  • the spacer sequence is between 10-13, i.e., 10, 11, 12 or 13 nucleotides and is located between the 3’ terminus of the antisense sequence and the 5’ terminus of a flanking sequence.
  • a spacer is of sufficient length to form
  • the modulatory polynucleotide comprises in the 5’ to 3’ direction, a 5’ flanking sequence, a 5’ arm, a loop motif, a 3’ arm and a 3’ flanking sequence.
  • the 5’ arm may comprise a sense sequence and the 3’ arm comprises the antisense sequence.
  • the 5’ arm comprises the antisense sequence and the 3’ arm comprises the sense sequence.
  • the 5’ arm, payload (e.g., sense and/or antisense sequence), loop motif and/or 3’ arm sequence may be altered (e.g., substituting 1 or more nucleotides, adding nucleotides and/or deleting nucleotides).
  • the alteration may cause a beneficial change in the function of the construct (e.g., increase knock-down of the target sequence, reduce degradation of the construct, reduce off target effect, increase efficiency of the payload, and reduce degradation of the payload).
  • the molecular scaffold of the modulatory polynucleotides is aligned in order to have the rate of excision of the guide strand be greater than the rate of excision of the passenger strand.
  • the rate of excision of the guide or passenger strand may be, independently, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more than 99%.
  • the rate of excision of the guide strand is at least 80%.
  • the rate of excision of the guide strand is at least 90%.
  • the rate of excision of the guide strand is greater than the rate of excision of the passenger strand.
  • the rate of excision of the guide strand may be at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more than 99% greater than the passenger strand.
  • the efficiency of excision of the guide strand is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more than 99%.
  • the efficiency of the excision of the guide strand is greater than 80%.
  • the efficiency of the excision of the guide strand is greater than the excision of the passenger strand from the molecular scaffold.
  • the excision of the guide strand may be 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 times more efficient than the excision of the passenger strand from the molecular scaffold.
  • the molecular scaffold comprises a dual-function targeting modulatory polynucleotide. As used herein, a“dual-function targeting” modulatory
  • polynucleotide is a polynucleotide where both the guide and passenger strands knock down the same target or the guide and passenger strands knock down different targets.
  • the molecular scaffold of the modulatory polynucleotides described herein may comprise a 5’ flanking region, a loop motif region and a 3’ flanking region.
  • Non-limiting examples of the sequences for the 5’ flanking region, loop motif region (may also be referred to as a linker region) and the 3’ flanking region which may be encoded by the modulatory polynucleotides described herein are shown in Tables 6 - 8.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5’ flanking region listed in Table 6.
  • the 5’ flanking region may be 5F1, 5F2, 5F3, 5F4, 5F5, 5F6, or 5F7.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F1 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F2 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F3 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F4 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F5 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F6 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F7 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one loop motif region listed in Table 7.
  • the loop motif region may be L1, L2, L3, L4, L5, L6, L7, or L8.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L1 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L2 loop motif region. [00190] In one embodiment, the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L3 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L4 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L5 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L6 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L7 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L8 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 3’ flanking region listed in Table 8.
  • the 3’ flanking region may be 3F1, 3F2, 3F3, 3F4, or 3F5.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 3F1 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 3F2 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 3F3 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 3F4 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 3F5 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5’ flanking region and at least one loop motif region as described in Tables 6 and 7.
  • the 5’ flanking region and the loop motif region may be 5F1 and L1, 5F1 and L2, 5F1 and L3, 5F1 and L4, 5F1 and L5, 5F1 and L6, 5F1 and L7, 5F1 and L8, 5F2 and L1, 5F2 and L2, 5F2 and L3, 5F2 and L4, 5F2 and L5, 5F2 and L6, 5F2 and L7, 5F2 and L8, 5F3 and L1, 5F3 and L2, 5F3 and L3, 5F3 and L4, 5F3 and L5, 5F3 and L6, 5F3 and L7, 5F3 and L8, 5F4 and L1, 5F4 and L2, 5F4 and L3, 5F4 and L4, 5F4 and L5, 5F4 and L6, 5F1, 5F4 and L2, 5F4 and L3,
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F2 flanking region and at least one nucleic acid sequence encoding at least one L1 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F1 flanking region and at least one nucleic acid sequence encoding at least one L4 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F7 flanking region and at least one nucleic acid sequence encoding at least one L8 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F3 flanking region and at least one nucleic acid sequence encoding at least one L4 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F3 flanking region and at least one nucleic acid sequence encoding at least one L5 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F4 flanking region and at least one nucleic acid sequence encoding at least one L4 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F3 flanking region and at least one nucleic acid sequence encoding at least one L7 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F5 flanking region and at least one nucleic acid sequence encoding at least one L4 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F6 flanking region and at least one nucleic acid sequence encoding at least one L4 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F3 flanking region and at least one nucleic acid sequence encoding at least one L6 loop motif region. [00213] In one embodiment, the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F7 flanking region and at least one nucleic acid sequence encoding at least one L4 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F2 flanking region and at least one nucleic acid sequence encoding at least one L2 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F1 flanking region and at least one nucleic acid sequence encoding at least one L1 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F1 flanking region and at least one nucleic acid sequence encoding at least one L2 loop motif region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 3’ flanking region and at least one nucleic acid sequence encoding at least one loop motif region as described in Tables 7 and 8.
  • the 3’ flanking region and the loop motif region may be 3F1 and L1, 3F1 and L2, 3F1 and L3, 3F1 and L4, 3F1 and L5, 3F1 and L6, 3F1 and L7, 3F1 and L8, 3F2 and L1, 3F2 and L2, 3F2 and L3, 3F2 and L4, 3F2 and L5, 3F2 and L6, 3F2 and L7, 3F2 and L8, 3F3 and L1, 3F3 and L2, 3F3 and L3, 3F3 and L4, 3F3 and L5, 3F3 and L6, 3F3 and L7, 3F3 and L8, 3F4 and L1, 3F4 and L2, 3F4 and L3, 3F4 and L4, 3F
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L1 loop motif region and at least one nucleic acid sequence encoding at least one 3F2 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L4 loop motif region and at least one nucleic acid sequence encoding at least one 3F1 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L8 loop motif region and at least one nucleic acid sequence encoding at least one 3F5 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L5 loop motif region and at least one nucleic acid sequence encoding at least one 3F1 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L4 loop motif region and at least one nucleic acid sequence encoding at least one 3F4 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L7 loop motif region and at least one nucleic acid sequence encoding at least one 3F1 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L6 loop motif region and at least one nucleic acid sequence encoding at least one 3F1 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L4 loop motif region and at least one nucleic acid sequence encoding at least one 3F5 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L2 loop motif region and at least one nucleic acid sequence encoding at least one 3F2 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L1 loop motif region and at least one nucleic acid sequence encoding at least one 3F3 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L5 loop motif region and at least one nucleic acid sequence encoding at least one 3F4 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L1 loop motif region and at least one nucleic acid sequence encoding at least one 3F1 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one L2 loop motif region and at least one nucleic acid sequence encoding at least one 3F1 flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5’ flanking region and at least least one nucleic acid sequence encoding at least 3’ flanking region as described in Tables 6 and 8.
  • the flanking regions may be 5F1 and 3F1, 5F1 and 3F2, 5F1 and 3F3, 5F1 and 3F4, 5F1 and 3F5, 5F2 and 3F1, 5F2 and 3F2, 5F2 and 3F3, 5F2 and 3F4, 5F2 and 3F5, 5F3 and 3F1, 5F3 and 3F2, 5F3 and 3F3, 5F3 and 3F4, 5F3 and 3F5, 5F4 and 3F1, 5F4 and 3F2, 5F4 and 3F3, 5F4 and 3F4, 5F4 and 3F5, 5F5 and 3F1, 5F5 and 3F2, 5F5 and 3F3, 5F5 and 3F4, 5F5 and 3F5, 5F6
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F25' flanking region and at least one nucleic acid sequence encoding at least one 3F23' flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F15' flanking region and at least one nucleic acid sequence encoding at least one 3F13' flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F75' flanking region and at least one nucleic acid sequence encoding at least one 3F53' flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F35' flanking region and at least one nucleic acid sequence encoding at least one 3F13' flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F45' flanking region and at least one nucleic acid sequence encoding at least one 3F43' flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F55' flanking region and at least one nucleic acid sequence encoding at least one 3F43' flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F65' flanking region and at least one nucleic acid sequence encoding at least one 3F13' flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F25' flanking region and at least one nucleic acid sequence encoding at least one 3F33' flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F35' flanking region and at least one nucleic acid sequence encoding at least one 3F43' flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F15' flanking region and at least one nucleic acid sequence encoding at least one 3F23' flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5’ flanking region, at least one nucleic acid sequence encoding at least one loop motif region and at least one nucleic acid sequence encoding at least one 3’ flanking region as described in Tables 6 - 8.
  • flanking and loop motif regions may be 5F1, L1 and 3F1; 5F1, L1 and 3F2; 5F1, L1 and 3F3; 5F1, L1 and 3F4; 5F1, L1 and 3F5; 5F2, L1 and 3F1; 5F2, L1 and 3F2; 5F2, L1 and 3F3; 5F2, L1 and 3F4; 5F2, L1 and 3F5; 5F3, L1 and 3F3; 5F3, L1 and 3F2; 5F3, L1 and 3F3; 5F3, L1 and 3F4; 5F3, L1 and 3F5; 5F4, L1 and 3F4; 5F4, L1 and 3F2; 5F4, L1 and 3F3; 5F4, L1 and 3F4; 5F4, L1 and 3F2; 5F4, L1 and 3F3; 5F4, L1 and 3F4; 5F4, L1 and 3F5; 5F5, L1 and 3F1; 5F5, L1 and
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F25’ flanking region, at least one nucleic acid sequence encoding at least one L1 loop motif region, and at least one nucleic acid sequence encoding at least one 3F23’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F15’ flanking region, at least one nucleic acid sequence encoding at least one L4 loop motif region, and at least one nucleic acid sequence encoding at least one 3F13’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F75’ flanking region, at least one nucleic acid sequence encoding at least one L8 loop motif region, and at least one nucleic acid sequence encoding at least one 3F53’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F35’ flanking region, at least one nucleic acid sequence encoding at least one L4 loop motif region, and at least one nucleic acid sequence encoding at least one 3F13’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F35’ flanking region, at least one nucleic acid sequence encoding at least one L5 loop motif region, and at least one nucleic acid sequence encoding at least one 3F13’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F45’ flanking region, at least one nucleic acid sequence encoding at least one L4 loop motif region, and at least one nucleic acid sequence encoding at least one 3F43’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F35’ flanking region, at least one nucleic acid sequence encoding at least one L7 loop motif region, and at least one nucleic acid sequence encoding at least one 3F13’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F55’ flanking region, at least one nucleic acid sequence encoding at least one L4 loop motif region, and at least one nucleic acid sequence encoding at least one 3F43’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F65’ flanking region, at least one nucleic acid sequence encoding at least one L4 loop motif region, and at least one nucleic acid sequence encoding at least one 3F13’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F35’ flanking region, at least one nucleic acid sequence encoding at least one L6 loop motif region, and at least one nucleic acid sequence encoding at least one 3F13’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F75’ flanking region, at least one nucleic acid sequence encoding at least one L4 loop motif region, and at least one nucleic acid sequence encoding at least one 3F53’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F25’ flanking region, at least one nucleic acid sequence encoding at least one L2 loop motif region, and at least one nucleic acid sequence encoding at least one 3F23’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F25’ flanking region, at least one nucleic acid sequence encoding at least one L1 loop motif region, and at least one nucleic acid sequence encoding at least one 3F33’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F35’ flanking region, at least one nucleic acid sequence encoding at least one L5 loop motif region, and at least one nucleic acid sequence encoding at least one 3F43’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F15’ flanking region, at least one nucleic acid sequence encoding at least one L1 loop motif region, and at least one nucleic acid sequence encoding at least one 3F13’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F15’ flanking region, at least one nucleic acid sequence encoding at least one L2 loop motif region, and at least one nucleic acid sequence encoding at least one 3F13’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F15’ flanking region, at least one nucleic acid sequence encoding at least one L1 loop motif region, and at least one nucleic acid sequence encoding at least one 3F23’ flanking region.
  • the molecular scaffold may comprise at least one nucleic acid sequence encoding at least one 5F25’ flanking region, at least one nucleic acid sequence encoding at least one L3 loop motif region, and at least one nucleic acid sequence encoding at least one 3F33’ flanking region.
  • the modulatory polynucleotide may comprise nucleic acid sequences encoding 5’ and 3’ flanking regions, loop motif region, sense sequence and antisense sequence as described in Tables 9 and 10.
  • the passenger and guide strands are described as well as the 5’ and 3’ Flanking Regions and the Loop region (also referred to as the linker region).
  • the“miR” component of the name of the sequence does not necessarily correspond to the sequence numbering of miRNA genes (e.g., VOYHTmiR-102 is the name of the sequence and does not necessarily mean that miR-102 is part of the sequence).
  • Table 9. Pri-miRNA Cassettes Containing Passenger and Guide Sequences (5’-3’)
  • the molecular scaffold may comprise one or more linkers known in the art.
  • the linkers may separate regions or one molecular scaffold from another.
  • the molecular scaffold may be polycistronic.
  • the modulatory polynucleotide is designed using at least one of the following properties: loop variant, seed mismatch/bulge/wobble variant, stem mismatch, loop variant and vassal stem mismatch variant, seed mismatch and basal stem mismatch variant, stem mismatch and basal stem mismatch variant, seed wobble and basal stem wobble variant, or a stem sequence variant.
  • the molecular scaffold may be a natural pri-miRNA scaffold.
  • the molecular scaffold may be a scaffold derived from the human miR155 scaffold.
  • the molecular scaffold may be located downstream of a CMV promoter, fragment or variant thereof.
  • the molecular scaffold may be located downstream of a CBA promoter, fragment or variant thereof.
  • the molecular scaffold may be a natural pri-miRNA scaffold located downstream of a CMV promoter.
  • the natural pri-miRNA scaffold is derived from the human miR155 scaffold.
  • the molecular scaffold may be a natural pri-miRNA scaffold located downstream of a CBA promoter.
  • polynucleotide is determined by a method of comparing modulatory polynucleotides in pri- miRNA (see e.g., the method described by Miniarikova et al. Design, Characterization, and Lead Selection of Therapeutic miRNAs Targeting Huntingtin for Development of Gene Therapy for Huntington’s Disease. Molecular Therapy-Nucleic Acids (2016) 5, e297 and International Publication No. WO2016102664; the contents of each of which are herein incorporated by reference in their entireties).
  • the modulatory polynucleotide may, but it not limited to, targeting exon 1, CAG repeats, SNP rs362331 in exon 50 and/or SNP rs362307 in exon 67.
  • the molecular scaffold used which may be used is a human pri-miRNA scaffold (e.g., miR155 scaffold) and the promoter may be CMV.
  • the activity may be determined in vitro using HEK293T cells and a reporter (e.g., Luciferase).
  • a reporter e.g., Luciferase
  • the modulatory polynucleotide is determined to be efficient at HTT knockdown if the knockdown is 80% or greater.
  • the modulatory polynucleotide is determined to be efficient at HTT knockdown if the knockdown is at least 60%.
  • the modulatory polynucleotide is determined to be efficient at HTT knockdown if the knockdown is at least 60%.
  • the modulatory polynucleotides may comprise at least 1 substitution in order to improve allele selectivity.
  • substitution may be a G or C replaced with a T or corresponding U and A or T/U replaced by a C.
  • the modulatory polynucleotide is used in pri-miRNA scaffolds with a CAG promoter.
  • the constructs are co-transfected with a reporter (e.g., luciferase reporter) at 50 ng. Constructs with greater than 80% knockdown at 50 ng co-transfection are considered efficient.
  • the constructs with strong guide-strand activity are preferred.
  • the constructs with strong passenger-strand activity are preferred.
  • the molecular scaffolds can be processed in HEK293T cells by NGS to determine guide-passenger ratios, and processing variability.
  • the molecular scaffolds comprising the modulatory polynucleotides are packaged in AAV (e.g., the serotype may be AAV5 (see e.g., the method and constructs described in WO2015060722, the contents of which are herein incorporated by reference in their entirety)) and administered to an in vivo model (e.g., Hu128/21 HD mouse) and the guide-passenger ratios, 5’ and 3’ end processing, reversal of guide and passenger strands, and knockdown can be determined in different areas of the model.
  • AAV e.g., the serotype may be AAV5 (see e.g., the method and constructs described in WO2015060722, the contents of which are herein incorporated by reference in their entirety)
  • an in vivo model e.g., Hu128/21 HD mouse
  • polynucleotide is determined by a method of comparing modulatory polynucleotides in natural pri-miRNA and synthetic pri-miRNA.
  • the modulatory polynucleotide may, but it not limited to, targeting an exon other than exon 1.
  • the molecular scaffold is used with a CBA promoter.
  • the activity may be determined in vitro using HEK293T cells, HeLa cell and a reporter (e.g., Luciferase) and knockdown efficient modulatory polynucleotides showed HTT knockdown of at least 80% in the cell tested. Additionally, the modulatory polynucleotides which are considered most efficient showed low to no significant passenger strand (p-strand) activity.
  • the endogenous HTT knockdown efficacy is evaluated by transfection in vitro using HEK293T cells, HeLa cell and a reporter. Efficient modulatory polynucleotides show greater than 50% endogenous HTT knockdown.
  • the endogenous HTT knockdown efficacy is evaluated in different cell types (e.g., HEK293, HeLa, primary astrocytes, U251 astrocytes, SH- SY5Y neuron cells and fibroblasts from HD patients) by infection (e.g., AAV2).
  • Efficient modulatory polynucleotides show greater than 60% endogenous HTT knockdown.
  • the molecular scaffolds comprising the modulatory polynucleotides are packaged in AAV and administered to an in vivo model (e.g., YAC128 HD mouse) and the guide-passenger ratios, 5’ and 3’ end processing, raio of guide to passenger strands, and knockdown can be determined in different areas of the model (e.g., tissue regions).
  • the molecular scaffolds can be processed from in vivo samples by NGS to determine guide-passenger ratios, and processing variability.
  • the siRNA molecules described herein can be encoded by vectors such as plasmids or viral vectors.
  • the siRNA molecules are encoded by viral vectors.
  • Viral vectors may be, but are not limited to, Herpesvirus (HSV) vectors, retroviral vectors, adenoviral vectors, adeno-associated viral vectors, lentiviral vectors, and the like.
  • the viral vectors are AAV vectors.
  • the siRNA duplex targeting HTT gene may be encoded by a retroviral vector (See, e.g., U.S. Pat. Nos.5,399,346; 5,124,263; 4,650,764 and 4,980,289; the content of each of which are incorporated herein by reference in their entirety).
  • Adenoviruses are eukaryotic DNA viruses that can be modified to efficiently deliver a nucleic acid to a variety of cell types in vivo, and have been used extensively in gene therapy protocols, including for targeting genes to neural cells.
  • Various replication defective adenovirus and minimum adenovirus vectors have been described for nucleic acid therapeutics (See, e.g., PCT Patent Publication Nos. WO199426914, WO 199502697, WO199428152, WO199412649, WO199502697 and WO199622378; the content of each of which is incorporated by reference in their entirety).
  • Such adenoviral vectors may also be used to deliver siRNA molecules of the present invention to cells.
  • AAV Adeno-associated viral
  • An adeno-associated virus is a dependent parvovirus (like other parvoviruses) which is a single stranded non-enveloped DNA virus having a genome of about 5000 nucleotides in length and which contains two open reading frames encoding the proteins responsible for replication (Rep) and the structural protein of the capsid (Cap). The open reading frames are flanked by two Inverted Terminal Repeat (ITR) sequences, which serve as the origin of replication of the viral genome. Furthermore, the AAV genome contains a packaging sequence, allowing packaging of the viral genome into an AAV capsid.
  • the AAV vector requires a co- helper (e.g., adenovirus) to undergo productive infection in infected cells. In the absence of such helper functions, the AAV virions essentially enter host cells but do not integrate into the cells’ genome.
  • AAV vectors have been investigated for siRNA delivery because of several unique features.
  • Non-limiting examples of the features include (i) the ability to infect both dividing and non-dividing cells; (ii) a broad host range for infectivity, including human cells; (iii) wild-type AAV has not been associated with any disease and has not been shown to replicate in infected cells; (iv) the lack of cell-mediated immune response against the vector and (v) the non- integrative nature in a host chromosome thereby reducing potential for long-term genetic alterations.
  • infection with AAV vectors has minimal influence on changing the pattern of cellular gene expression (Stilwell and Samulski et al., Biotechniques, 2003, 34, 148).
  • AAV vectors for siRNA delivery may be recombinant viral vectors which are replication defective as they lack sequences encoding functional Rep and Cap proteins within the viral genome.
  • the defective AAV vectors may lack most or all coding sequences and essentially only contains one or two AAV ITR sequences and a packaging sequence.
  • the AAV vectors comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be introduced into mammalian cells.
  • AAV vectors may be modified to enhance the efficiency of delivery.
  • modified AAV vectors comprising the nucleic acid sequence encoding the siRNA molecules of the present invention can be packaged efficiently and can be used to successfully infect the target cells at high frequency and with minimal toxicity.
  • the AAV vector comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be a human serotype AAV vector.
  • Such human AAV vector may be derived from any known serotype, e.g., from any one of serotypes AAV1-AAV11.
  • AAV vectors may be vectors comprising an AAV1- derived genome in an AAV1-derived capsid; vectors comprising an AAV2-derived genome in an AAV2-derived capsid; vectors comprising an AAV4-derived genome in an AAV4 derived capsid; vectors comprising an AAV6-derived genome in an AAV6 derived capsid or vectors comprising an AAV9-derived genome in an AAV9 derived capsid.
  • the AAV vector comprising a nucleic acid sequence for encoding siRNA molecules of the present invention may be a pseudotyped hybrid or chimeric AAV vector which contains sequences and/or components originating from at least two different AAV serotypes.
  • Pseudotyped AAV vectors may be vectors comprising an AAV genome derived from one AAV serotype and a capsid protein derived at least in part from a different AAV serotype.
  • such pseudotyped AAV vectors may be vectors comprising an AAV2-derived genome in an AAV1-derived capsid; or vectors comprising an AAV2-derived genome in an AAV6-derived capsid; or vectors comprising an AAV2-derived genome in an AAV4-derived capsid; or an AAV2-derived genome in an AAV9-derived capsid.
  • the present invention contemplates any hybrid or chimeric AAV vector.
  • AAV vectors comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be used to deliver siRNA molecules to the central nervous system (e.g., U.S. Pat. No.6,180,613; the contents of which is herein incorporated by reference in its entirety).
  • the AAV vectors comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may further comprise a modified capsid including peptides from non-viral origin.
  • the AAV vector may contain a CNS specific chimeric capsid to facilitate the delivery of encoded siRNA duplexes into the brain and the spinal cord.
  • an alignment of cap nucleotide sequences from AAV variants exhibiting CNS tropism may be constructed to identify variable region (VR) sequence and structure.
  • the AAV vector comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may encode siRNA molecules which are polycistronic molecules.
  • the siRNA molecules may additionally comprise one or more linkers between regions of the siRNA molecules.
  • the AAV vector used in the present invention is a single strand vector (ssAAV).
  • the AAV vectors may be self-complementary AAV vectors (scAAVs).
  • scAAV vectors contain both DNA strands which anneal together to form double stranded DNA. By skipping second strand synthesis, scAAVs allow for rapid expression in the cell.
  • the AAV vector used in the present invention is a scAAV.
  • AAV particles of the present invention may comprise or be derived from any natural or recombinant AAV serotype.
  • the AAV particles may utilize or be based on a serotype selected from any of the following AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12, AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a
  • AAVN721-8/rh.43 AAVCh.5, AAVCh.5R1, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVCy.5R1, AAVCy.5R2, AAVCy.5R3, AAVCy.5R4, AAVcy.6, AAVhu.1, AAVhu.2, AAVhu.3, AAVhu.4, AAVhu.5, AAVhu.6, AAVhu.7, AAVhu.9, AAVhu.10, AAVhu.11, AAVhu.13, AAVhu.15, AAVhu.16, AAVhu.17, AAVhu.18, AAVhu.20, AAVhu.21,
  • AAVhu.29R AAVhu.31, AAVhu.32, AAVhu.34, AAVhu.35, AAVhu.37, AAVhu.39,
  • AAVF11/HSC11 AAVF12/HSC12, AAVF13/HSC13, AAVF14/HSC14, AAVF15/HSC15, AAVF16/HSC16, AAVF17/HSC17, AAVF2/HSC2, AAVF3/HSC3, AAVF4/HSC4,
  • the capsid of the recombinant AAV virus is AAV1.
  • the capsid of the recombinant AAV virus is AAV2.
  • the capsid of the recombinant AAV virus is AAVrh10.
  • the capsid of the recombinant AAV virus is AAV9(hu14).
  • the capsid of the recombinant AAV virus is AAV-DJ.
  • the capsid of the recombinant AAV virus is AAV9.47.
  • the capsid of the recombinant AAV virus is AAV-DJ8.
  • the capsid of the recombinant AAV virus is AAV-PHP.B.
  • the capsid of the recombinant AAV virus is AAV- PHP.A.
  • the AAV serotype may be, or have, a sequence as described in United States Publication No. US20030138772, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV1 (SEQ ID NO: 6 and 64 of
  • US20030138772) AAV2 (SEQ ID NO: 7 and 70 of US20030138772), AAV3 (SEQ ID NO: 8 and 71 of US20030138772), AAV4 (SEQ ID NO: 63 of US20030138772), AAV5 (SEQ ID NO: 114 of US20030138772), AAV6 (SEQ ID NO: 65 of US20030138772), AAV7 (SEQ ID NO: 1- 3 of US20030138772), AAV8 (SEQ ID NO: 4 and 95 of US20030138772), AAV9 (SEQ ID NO: 5 and 100 of US20030138772), AAV10 (SEQ ID NO: 117 of US20030138772), AAV11 (SEQ ID NO: 118 of US20030138772), AAV12 (SEQ ID NO: 119 of US20030138772), AAVrh10 (amino acids 1 to 738 of SEQ ID NO: 81 of US20030138772), AAV16.3 (
  • the AAV serotype may be, or have, a sequence as described in United States Publication No. US20150159173, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV2 (SEQ ID NO: 7 and 23 of
  • the AAV serotype may be, or have, a sequence as described in United States Patent No. US 7198951, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV9 (SEQ ID NO: 1-3 of US 7198951), AAV2 (SEQ ID NO: 4 of US 7198951), AAV1 (SEQ ID NO: 5 of US 7198951), AAV3 (SEQ ID NO: 6 of US 7198951), and AAV8 (SEQ ID NO: 7 of US7198951).
  • AAV9 SEQ ID NO: 1-3 of US 7198951
  • AAV2 SEQ ID NO: 4 of US 7198951
  • AAV1 SEQ ID NO: 5 of US 7198951
  • AAV3 SEQ ID NO: 6 of US 7198951
  • AAV8 SEQ ID NO: 7 of US7198951.
  • the AAV serotype may be, or have, a mutation in the AAV9 sequence as described by N Pulichla et al. (Molecular Therapy 19(6):1070-1078 (2011), herein incorporated by reference in its entirety), such as but not limited to, AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.
  • the AAV serotype may be, or have, a sequence as described in United States Patent No. US 6156303, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV3B (SEQ ID NO: 1 and 10 of US 6156303), AAV6 (SEQ ID NO: 2, 7 and 11 of US 6156303), AAV2 (SEQ ID NO: 3 and 8 of US 6156303), AAV3A (SEQ ID NO: 4 and 9, of US 6156303), or derivatives thereof.
  • AAV3B SEQ ID NO: 1 and 10 of US 6156303
  • AAV6 SEQ ID NO: 2, 7 and 11 of US 6156303
  • AAV2 SEQ ID NO: 3 and 8 of US 6156303
  • AAV3A SEQ ID NO: 4 and 9, of US 6156303
  • the AAV serotype may be, or have, a sequence as described in United States Publication No. US20140359799, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV8 (SEQ ID NO: 1 of
  • the serotype may be AAVDJ (or AAV-DJ) or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al. (Journal of Virology 82(12): 5887-5911 (2008), herein incorporated by reference in its entirety).
  • the amino acid sequence of AAVDJ8 may comprise two or more mutations in order to remove the heparin binding domain (HBD).
  • the AAV-DJ sequence described as SEQ ID NO: 1 in US Patent No.7,588,772, the contents of which are herein incorporated by reference in their entirety, may comprise two mutations: (1) R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln) and (2) R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).
  • K406R where lysine (K; Lys) at amino acid 406 is changed to arginine (R; Arg)
  • R587Q where arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln)
  • R590T where arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).
  • the AAV serotype may be, or have, a sequence of AAV4 as described in International Publication No. WO1998011244, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAV4 (SEQ ID NO: 1-20 of WO1998011244).
  • the AAV serotype may be, or have, a mutation in the AAV2 sequence to generate AAV2G9 as described in International Publication No. WO2014144229 and herein incorporated by reference in its entirety.
  • the AAV serotype may be, or have, a sequence as described in International Publication No. WO2005033321, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAV3-3 (SEQ ID NO: 217 of
  • WO2005033321 AAV1 (SEQ ID NO: 219 and 202 of WO2005033321), AAV106.1/hu.37 (SEQ ID No: 10 of WO2005033321), AAV114.3/hu.40 (SEQ ID No: 11 of WO2005033321), AAV127.2/hu.41 (SEQ ID NO:6 and 8 of WO2005033321), AAV128.3/hu.44 (SEQ ID No: 81 of WO2005033321), AAV130.4/hu.48 (SEQ ID NO: 78 of WO2005033321), AAV145.1/hu.53 (SEQ ID No: 176 and 177 of WO2005033321), AAV145.6/hu.56 (SEQ ID NO: 168 and 192 of WO2005033321), AAV16.12/hu.11 (SEQ ID NO: 153 and 57 of WO2005033321),
  • AAV16.8/hu.10 (SEQ ID NO:: 156 and 56 of WO2005033321), AAV161.10/hu.60 (SEQ ID No: 170 of WO2005033321), AAV161.6/hu.61 (SEQ ID No: 174 of WO2005033321), AAV1- 7/rh.48 (SEQ ID NO: 32 of WO2005033321), AAV1-8/rh.49 (SEQ ID NOs: 103 and 25 of WO2005033321), AAV2 (SEQ ID NO: 211 and 221 of WO2005033321), AAV2-15/rh.62 (SEQ ID No: 33 and 114 of WO2005033321), AAV2-3/rh.61 (SEQ ID NO: 21 of WO2005033321), AAV2-4/rh.50 (SEQ ID No: 23 and 108 of WO2005033321), AAV2-5/rh.51 (SEQ ID NO: 104 and 22 of WO200
  • AAV3.1/hu.9 (SEQ ID NO: 155 and 58 of WO2005033321), AAV3-11/rh.53 (SEQ ID NO: 186 and 176 of WO2005033321), AAV3-3 (SEQ ID NO: 200 of WO2005033321), AAV33.12/hu.17 (SEQ ID NO:4 of WO2005033321), AAV33.4/hu.15 (SEQ ID No: 50 of WO2005033321), AAV33.8/hu.16 (SEQ ID No: 51 of WO2005033321), AAV3-9/rh.52 (SEQ ID NO: 96 and 18 of WO2005033321), AAV4-19/rh.55 (SEQ ID NO: 117 of WO2005033321), AAV4-4 (SEQ ID NO: 201 and 218 of WO2005033321), AAV4-9/rh.54 (SEQ ID NO: 116 of WO2005033321), AAV5 (SEQ ID
  • WO2005033321 WO2005033321
  • AAV6 SEQ ID NO: 203 and 220 of WO2005033321
  • AAV7 SEQ ID NO: 222 and 213 of WO2005033321
  • AAV7.3/hu.7 SEQ ID No: 55 of WO2005033321
  • AAV8 SEQ ID NO: 223 and 214 of WO2005033321
  • AAVH-1/hu.1 SEQ ID No: 46 of
  • WO2005033321 AAVH-5/hu.3 (SEQ ID No: 44 of WO2005033321), AAVhu.1 (SEQ ID NO: 144 of WO2005033321), AAVhu.10 (SEQ ID NO: 156 of WO2005033321), AAVhu.11 (SEQ ID NO: 153 of WO2005033321), AAVhu.12 (WO2005033321 SEQ ID NO: 59), AAVhu.13 (SEQ ID NO: 129 of WO2005033321), AAVhu.14/AAV9 (SEQ ID NO: 123 and 3 of
  • WO2005033321 AAVhu.15 (SEQ ID NO: 147 of WO2005033321), AAVhu.16 (SEQ ID NO: 148 of WO2005033321), AAVhu.17 (SEQ ID NO: 83 of WO2005033321), AAVhu.18 (SEQ ID NO: 149 of WO2005033321), AAVhu.19 (SEQ ID NO: 133 of WO2005033321), AAVhu.2 (SEQ ID NO: 143 of WO2005033321), AAVhu.20 (SEQ ID NO: 134 of WO2005033321), AAVhu.21 (SEQ ID NO: 135 of WO2005033321), AAVhu.22 (SEQ ID NO: 138 of
  • WO2005033321 WO2005033321
  • AAVhu.23.2 SEQ ID NO: 137 of WO2005033321
  • AAVhu.24 SEQ ID NO: 136 of WO2005033321
  • AAVhu.25 SEQ ID NO: 146 of WO2005033321
  • AAVhu.27 SEQ ID NO: 140 of WO2005033321
  • AAVhu.29 SEQ ID NO: 132 of WO2005033321
  • AAVhu.3 SEQ ID NO: 145 of WO2005033321
  • AAVhu.31 SEQ ID NO: 121 of
  • WO2005033321 WO2005033321
  • AAVhu.32 SEQ ID NO: 122 of WO2005033321
  • AAVhu.34 SEQ ID NO: 125 of WO2005033321
  • AAVhu.35 SEQ ID NO: 164 of WO2005033321
  • AAVhu.37 SEQ ID NO: 88 of WO2005033321
  • AAVhu.39 SEQ ID NO: 102 of WO2005033321
  • AAVhu.4 SEQ ID NO: 141 of WO2005033321
  • AAVhu.40 SEQ ID NO: 87 of WO2005033321
  • AAVhu.41 SEQ ID NO: 91 of WO2005033321
  • AAVhu.42 SEQ ID NO: 85 of
  • WO2005033321 AAVhu.43 (SEQ ID NO: 160 of WO2005033321), AAVhu.44 (SEQ ID NO: 144 of WO2005033321), AAVhu.45 (SEQ ID NO: 127 of WO2005033321), AAVhu.46 (SEQ ID NO: 159 of WO2005033321), AAVhu.47 (SEQ ID NO: 128 of WO2005033321), AAVhu.48 (SEQ ID NO: 157 of WO2005033321), AAVhu.49 (SEQ ID NO: 189 of WO2005033321), AAVhu.51 (SEQ ID NO: 190 of WO2005033321), AAVhu.52 (SEQ ID NO: 191 of WO2005033321), AAVhu.53 (SEQ ID NO: 186 of WO2005033321), AAVhu.54 (SEQ ID NO: 188 of WO2005033321), AAVhu.55 (
  • WO2005033321 AAVpi.1 (WO2005033321 SEQ ID NO: 28), AAVpi.2 (WO2005033321 SEQ ID NO: 30), AAVpi.3 (WO2005033321 SEQ ID NO: 29), AAVrh.38 (SEQ ID NO: 86 of WO2005033321), AAVrh.40 (SEQ ID NO: 92 of WO2005033321), AAVrh.43 (SEQ ID NO: 163 of WO2005033321), AAVrh.44 (WO2005033321 SEQ ID NO: 34), AAVrh.45
  • WO2005033321 WO2005033321
  • AAVrh.52 SEQ ID NO: 96 of WO2005033321
  • AAVrh.53 SEQ ID NO: 97 of WO2005033321
  • AAVrh.55 WO2005033321 SEQ ID NO: 37
  • AAVrh.56 SEQ ID NO: 152 of WO2005033321
  • AAVrh.57 SEQ ID NO: 105 of WO2005033321
  • AAVrh.58 SEQ ID NO: 106 of WO2005033321
  • AAVrh.59 WO2005033321 SEQ ID NO: 42
  • AAVrh.60 WO2005033321 SEQ ID NO: 31
  • AAVrh.61 SEQ ID NO: 107 of WO2005033321
  • AAVrh.62 (SEQ ID NO: 114 of WO2005033321), AAVrh.64 (SEQ ID NO: 99 of
  • WO2005033321 AAVrh.65 (WO2005033321 SEQ ID NO: 35), AAVrh.68 (WO2005033321 SEQ ID NO: 16), AAVrh.69 (WO2005033321 SEQ ID NO: 39), AAVrh.70 (WO2005033321 SEQ ID NO: 20), AAVrh.72 (WO2005033321 SEQ ID NO: 9), or variants thereof including, but not limited to, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVcy.6, AAVrh.12, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.25/42 15, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.
  • Non-limiting examples of variants include SEQ ID NO: 13, 15, 17, 19, 24, 36, 40, 45, 47, 48, 51-54, 60-62, 64-77, 79, 80, 82, 89, 90, 93-95, 98, 100, 101, , 109-113, 118-120, 124, 126, 131, 139, 142, 151,154, 158, 161, 162, 165-183, 202, 204-212, 215, 219, 224-236, of WO2005033321, the contents of which are herein incorporated by reference in their entirety.
  • the AAV serotype may be, or have, a sequence as described in International Publication No. WO2015168666, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAVrh8R (SEQ ID NO: 9 of
  • WO2015168666 AAVrh8R A586R mutant (SEQ ID NO: 10 of WO2015168666), AAVrh8R R533A mutant (SEQ ID NO: 11 of WO2015168666), or variants thereof.
  • the AAV serotype may be, or have, a sequence as described in United States Patent No. US9233131, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAVhE1.1 ( SEQ ID NO:44 of US9233131), AAVhEr1.5 (SEQ ID NO:45 of US9233131), AAVhER1.14 (SEQ ID NO:46 of US9233131), AAVhEr1.8 (SEQ ID NO:47 of US9233131), AAVhEr1.16 (SEQ ID NO:48 of US9233131), AAVhEr1.18 (SEQ ID NO:49 of US9233131), AAVhEr1.35 (SEQ ID NO:50 of US9233131), AAVhEr1.7 (SEQ ID NO:51 of US9233131), AAVhEr1.36 (SEQ ID NO:52 of US9233131), AAVhEr2.29 (SEQ ID NO:53 of US9233131), AAVhEr2.4 (SEQ ID NO:44 of US9233131
  • the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150376607, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV-PAEC (SEQ ID NO:1 of US20150376607), AAV-LK01 (SEQ ID NO:2 of US20150376607), AAV-LK02 (SEQ ID NO:3 of US20150376607), AAV-LK03 (SEQ ID NO:4 of US20150376607), AAV-LK04 (SEQ ID NO:5 of US20150376607), AAV-LK05 (SEQ ID NO:6 of US20150376607), AAV- LK06 (SEQ ID NO:7 of US20150376607), AAV-LK07 (SEQ ID NO:8 of US20150376607), AAV-LK08 (SEQ ID NO:9 of US20150376607), AAV-LK09 (SEQ ID NO:
  • AAV-LK10 SEQ ID NO:11 of US20150376607), AAV-LK11 (SEQ ID NO:12 of US20150376607), AAV-LK12 (SEQ ID NO:13 of US20150376607), AAV-LK13 (SEQ ID NO:14 of US20150376607), AAV-LK14 (SEQ ID NO:15 of US20150376607), AAV- LK15 (SEQ ID NO:16 of US20150376607), AAV-LK16 (SEQ ID NO:17 of US20150376607), AAV-LK17 (SEQ ID NO:18 of US20150376607), AAV-LK18 (SEQ ID NO:19 of
  • US20150376607 AAV-LK19 (SEQ ID NO:20 of US20150376607), AAV-PAEC2 (SEQ ID NO:21 of US20150376607), AAV-PAEC4 (SEQ ID NO:22 of US20150376607), AAV-PAEC6 (SEQ ID NO:23 of US20150376607), AAV-PAEC7 (SEQ ID NO:24 of US20150376607), AAV-PAEC8 (SEQ ID NO:25 of US20150376607), AAV-PAEC11 (SEQ ID NO:26 of US20150376607), AAV-PAEC12 (SEQ ID NO:27, of US20150376607), or variants thereof.
  • the AAV serotype may be, or have, a sequence as described in United States Patent No. US9163261, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV-2-pre-miRNA-101 (SEQ ID NO: 1
  • the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150376240, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV-8h (SEQ ID NO: 6 of US20150376240), AAV-8b (SEQ ID NO: 5 of US20150376240), AAV-h (SEQ ID NO: 2 of US20150376240), AAV-b (SEQ ID NO: 1 of US20150376240), or variants thereof.
  • AAV-8h SEQ ID NO: 6 of US20150376240
  • AAV-8b SEQ ID NO: 5 of US20150376240
  • AAV-h SEQ ID NO: 2 of US20150376240
  • AAV-b SEQ ID NO: 1 of US20150376240
  • the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20160017295, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV SM 10-2 (SEQ ID NO: 22 of US20160017295), AAV Shuffle 100-1 (SEQ ID NO: 23 of US20160017295), AAV Shuffle 100-3 (SEQ ID NO: 24 of US20160017295), AAV Shuffle 100-7 (SEQ ID NO: 25 of US20160017295), AAV Shuffle 10-2 (SEQ ID NO: 34 of US20160017295), AAV Shuffle 10-6 (SEQ ID NO: 35 of US20160017295), AAV Shuffle 10-8 (SEQ ID NO: 36 of US20160017295), AAV Shuffle 100-2 (SEQ ID NO: 37 of US20160017295), AAV SM 10-1 (SEQ ID NO: 38 of US20160017295), AAV SM 10-8 (SEQ ID NO NO:
  • the AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20150238550, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, BNP61 AAV (SEQ ID NO: 1 of US20150238550), BNP62 AAV (SEQ ID NO: 3 of US20150238550), BNP63 AAV (SEQ ID NO: 4 of US20150238550), or variants thereof.
  • the AAV serotype may be or may have a sequence as described in United States Patent Publication No. US20150315612, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAVrh.50 (SEQ ID NO: 108 of US20150315612), AAVrh.43 (SEQ ID NO: 163 of US20150315612), AAVrh.62 (SEQ ID NO: 114 of US20150315612), AAVrh.48 (SEQ ID NO: 115 of US20150315612), AAVhu.19 (SEQ ID NO: 133 of US20150315612), AAVhu.11 (SEQ ID NO: 153 of US20150315612), AAVhu.53 (SEQ ID NO: 186 of US20150315612), AAV4-8/rh.64 (SEQ ID No: 15 of US20150315612), AAVLG-9/hu.39 (SEQ ID No: 24 of US20150315612)
  • AAV54.5/hu.23 (SEQ ID No: 60 of US20150315612), AAV54.2/hu.22 (SEQ ID No: 67 of US20150315612), AAV54.7/hu.24 (SEQ ID No: 66 of US20150315612), AAV54.1/hu.21 (SEQ ID No: 65 of US20150315612), AAV54.4R/hu.27 (SEQ ID No: 64 of US20150315612), AAV46.2/hu.28 (SEQ ID No: 68 of US20150315612), AAV46.6/hu.29 (SEQ ID No: 69 of US20150315612), AAV128.1/hu.43 (SEQ ID No: 80 of US20150315612), or variants thereof.
  • the AAV serotype may be, or have, a sequence as described in International Publication No. WO2015121501, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, true type AAV (ttAAV) (SEQ ID NO: 2 of WO2015121501),“UPenn AAV10” (SEQ ID NO: 8 of WO2015121501),“Japanese AAV10” (SEQ ID NO: 9 of WO2015121501), or variants thereof.
  • true type AAV ttAAV
  • UPenn AAV10 SEQ ID NO: 8 of WO2015121501
  • Japanese AAV10 Japanese Patent Application Protocol
  • AAV capsid serotype selection or use may be from a variety of species.
  • the AAV may be an avian AAV (AAAV).
  • the AAAV serotype may be, or have, a sequence as described in United States Patent No. US 9238800, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAAV (SEQ ID NO: 1, 2, 4, 6, 8, 10, 12, and 14 of US 9,238,800), or variants thereof.
  • the AAV may be a bovine AAV (BAAV).
  • BAAV serotype may be, or have, a sequence as described in United States Patent No. US 9,193,769, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, BAAV (SEQ ID NO: 1 and 6 of US 9193769), or variants thereof.
  • BAAV serotype may be or have a sequence as described in United States Patent No. US7427396, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, BAAV (SEQ ID NO: 5 and 6 of US7427396), or variants thereof.
  • the AAV may be a caprine AAV.
  • the caprine AAV serotype may be, or have, a sequence as described in United States Patent No. US7427396, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, caprine AAV (SEQ ID NO: 3 of US7427396), or variants thereof.
  • the AAV may be engineered as a hybrid AAV from two or more parental serotypes.
  • the AAV may be AAV2G9 which comprises sequences from AAV2 and AAV9.
  • the AAV2G9 AAV serotype may be, or have, a sequence as described in United States Patent Publication No. US20160017005, the contents of which are herein incorporated by reference in its entirety.
  • the AAV may be a serotype generated by the AAV9 capsid library with mutations in amino acids 390-627 (VP1 numbering) as described by Pulichla et al. (Molecular Therapy 19(6):1070-1078 (2011), the contents of which are herein incorporated by reference in their entirety.
  • the serotype and corresponding nucleotide and amino acid substitutions may be, but is not limited to, AAV9.1 (G1594C; D532H), AAV6.2 (T1418A and T1436X; V473D and I479K), AAV9.3 (T1238A; F413Y), AAV9.4 (T1250C and A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A; F411I), AAV9.9 (G1203A, G1785T; W595C), AAV9.10 (A1500G, T1676C;
  • AAV9.11 A1425T, A1702C, A1769T; T568P, Q590L
  • AAV9.13 A1369C, A1720T; N457H, T574S
  • AAV9.14 T1340A, T1362C, T1560C, G1713A; L447H
  • AAV9.16 A1775T; Q592L
  • AAV9.24 T1507C, T1521G; W503R
  • AAV9.26 A1337G, A1769C; Y446C, Q590P
  • AAV9.33 A1667C; D556A
  • AAV9.34 A1534G, C1794T; N512D
  • AAV9.35 A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I
  • AAV9.40 A1694T, E565V
  • the AAV serotype may be, or have, a sequence as described in International Publication No. WO2016049230, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAVF1/HSC1 (SEQ ID NO: 2 and 20 of WO2016049230), AAVF2/HSC2 (SEQ ID NO: 3 and 21 of WO2016049230), AAVF3/HSC3 (SEQ ID NO: 5 and 22 of WO2016049230), AAVF4/HSC4 (SEQ ID NO: 6 and 23 of
  • WO2016049230 AAVF5/HSC5 (SEQ ID NO: 11 and 25 of WO2016049230), AAVF6/HSC6 (SEQ ID NO: 7 and 24 of WO2016049230), AAVF7/HSC7 (SEQ ID NO: 8 and 27 of
  • WO2016049230 AAVF8/HSC8 (SEQ ID NO: 9 and 28 of WO2016049230), AAVF9/HSC9 (SEQ ID NO: 10 and 29 of WO2016049230), AAVF11/HSC11 (SEQ ID NO: 4 and 26 of WO2016049230), AAVF12/HSC12 (SEQ ID NO: 12 and 30 of WO2016049230),
  • AAVF13/HSC13 SEQ ID NO: 14 and 31 of WO2016049230
  • AAVF14/HSC14 SEQ ID NO: 15 and 32 of WO2016049230
  • AAVF15/HSC15 SEQ ID NO: 16 and 33 of WO2016049230
  • AAVF16/HSC16 SEQ ID NO: 17 and 34 of WO2016049230
  • AAVF17/HSC17 SEQ ID NO: 13 and 35 of WO2016049230
  • the AAV serotype may be, or have, a sequence as described in United States Patent No. US 8734809, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV CBr-E1 (SEQ ID NO: 13 and 87 of
  • the AAV serotype may be, or have, a sequence as described in International Publication No. WO2016065001, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to AAV CHt-P2 (SEQ ID NO: 1 and 51 of WO2016065001), AAV CHt-P5 (SEQ ID NO: 2 and 52 of WO2016065001), AAV CHt-P9 (SEQ ID NO: 3 and 53 of WO2016065001), AAV CBr-7.1 (SEQ ID NO: 4 and 54 of
  • WO2016065001 AAV CBr-7.2 (SEQ ID NO: 5 and 55 of WO2016065001), AAV CBr-7.3 (SEQ ID NO: 6 and 56 of WO2016065001), AAV CBr-7.4 (SEQ ID NO: 7 and 57 of
  • WO2016065001 AAV CBr-7.5 (SEQ ID NO: 8 and 58 of WO2016065001), AAV CBr-7.7 (SEQ ID NO: 9 and 59 of WO2016065001), AAV CBr-7.8 (SEQ ID NO: 10 and 60 of WO2016065001), AAV CBr-7.10 (SEQ ID NO: 11 and 61 of WO2016065001), AAV CKd-N3 (SEQ ID NO: 12 and 62 of WO2016065001), AAV CKd-N4 (SEQ ID NO: 13 and 63 of WO2016065001), AAV CKd-N9 (SEQ ID NO: 14 and 64 of WO2016065001), AAV CLv-L4 (SEQ ID NO: 15 and 65 of WO2016065001), AAV CLv-L5 (SEQ ID NO: 16 and 66 of WO2016065001), AAV CLv-L6 (SEQ ID NO: 17 and 67 of WO
  • the AAV may be a serotype comprising at least one AAV capsid CD8+ T-cell epitope.
  • the serotype may be AAV1, AAV2 or AAV8.
  • the AAV may be a serotype selected from any of those found in Table 11.
  • the AAV may comprise a sequence, fragment or variant thereof, of the sequences in Table 11.
  • the AAV may be encoded by a sequence, fragment or variant as described in Table 11.
  • the AAV serotype may be, or may have a sequence as described in International Patent Publication WO2015038958, the contents of which are herein incorporated by reference in their entirety, such as, but not limited to, AAV9 (SEQ ID NO: 2 and 11 of WO2015038958 or SEQ ID NO: 494 and 495 respectively herein), AAV-PHP.B (PHP.B) (SEQ ID NO: 8 and 9 of WO2015038958, herein SEQ ID NO: 1236 and 1237), G2B-13 (SEQ ID NO: 12 of WO2015038958, herein SEQ ID NO: 1238), G2B-26 (SEQ ID NO: 13 of WO2015038958, herein SEQ ID NO: 1236 and 1237), TH1.1-32 (SEQ ID NO: 14 of
  • WO2015038958 herein SEQ ID NO: 1239), TH1.1-35 (SEQ ID NO: 15 of WO2015038958, herein SEQ ID NO: 1240) or variants thereof.
  • any of the targeting peptides or amino acid inserts described in WO2015038958 may be inserted into any parent AAV serotype, such as, but not limited to, AAV9 (SEQ ID NO: 494 for the DNA sequence and SEQ ID NO: 495 for the amino acid sequence).
  • the amino acid insert is inserted between amino acids 586-592 of the parent AAV (e.g., AAV9).
  • the amino acid insert is inserted between amino acids 588-589 of the parent AAV sequence.
  • the amino acid insert may be, but is not limited to, any of the following amino acid sequences, TLAVPFK (SEQ ID NO: 1 of WO2015038958; herein SEQ ID NO: 1241), KFPVALT (SEQ ID NO: 3 of WO2015038958; herein SEQ ID NO: 1242), LAVPFK (SEQ ID NO: 31 of WO2015038958; herein SEQ ID NO: 1243), AVPFK (SEQ ID NO: 32 of WO2015038958; herein SEQ ID NO: 1244), VPFK (SEQ ID NO: 33 of WO2015038958; herein SEQ ID NO: 1245), TLAVPF (SEQ ID NO: 34 of
  • WO2015038958 herein SEQ ID NO: 1246
  • TLAVP SEQ ID NO: 35 of WO2015038958; herein SEQ ID NO: 1247
  • TLAV SEQ ID NO: 36 of WO2015038958; herein SEQ ID NO: 1248
  • SVSKPFL SEQ ID NO: 28 of WO2015038958; herein SEQ ID NO: 1249
  • FTLTTPK SEQ ID NO: 29 of WO2015038958; herein SEQ ID NO: 1250
  • MNATKNV SEQ ID NO: 30 of WO2015038958; herein SEQ ID NO: 1251), QSSQTPR (SEQ ID NO: 54 of WO2015038958; herein SEQ ID NO: 1252), ILGTGTS (SEQ ID NO: 55 of WO2015038958; herein SEQ ID NO: 1253), TRTNPEA (SEQ ID NO: 56 of WO2015038958; herein SEQ ID NO: 1254), NGGTSSS (S
  • AAGTTTCCTGTGGCGTTGACT for SEQ ID NO: 3 of WO2015038958; herein SEQ ID NO: 1257), ACTTTGGCGGTGCCTTTTAAG (SEQ ID NO: 24 and 49 of WO2015038958; herein SEQ ID NO: 1258), AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 25 of WO2015038958; herein SEQ ID NO: 1259), TTTACGTTGACGACGCCTAAG (SEQ ID NO: 26 of
  • WO2015038958 herein SEQ ID NO: 1260
  • ATGAATGCTACGAAGAATGTG SEQ ID NO: 27 of WO2015038958; herein SEQ ID NO: 1261
  • CAGTCGTCGCAGACGCCTAGG SEQ ID NO: 48 of WO2015038958; herein SEQ ID NO: 1262
  • ATTCTGGGGACTGGTACTTCG SEQ ID NO: 50 and 52 of WO2015038958; herein SEQ ID NO: 1263
  • ACGCGGACTAATCCTGAGGCT SEQ ID NO: 51 of WO2015038958; herein SEQ ID NO: 1264
  • AATGGGGGGACTAGTAGTTCT SEQ ID NO: 53 of WO2015038958; herein SEQ ID NO: 1265
  • TATACTTTGTCGCAGGGTTGG SEQ ID NO: 59 of WO2015038958; herein SEQ ID NO: 1266
  • the AAV serotype may be engineered to comprise at least one AAV capsid CD8+ T-cell epitope.
  • Hui et al. Molecular Therapy– Methods & Clinical
  • AAV capsid-specific CD8+ T-cell epitopes for AAV1 and AAV2 (see e.g., Table 2 in the publication).
  • the capsid-specific CD8+ T-cell epitope may be for an AAV2 serotype.
  • the capsid-specific CD8+ T-cell epitope may be for an AAV1 serotype.
  • the AAV serotype may be engineered to comprise at least one AAV capsid CD8+ T-cell epitope for AAV2 such as, but not limited to, SADNNNSEY (SEQ ID NO: 1267), LIDQYLYYL (SEQ ID NO: 1268), VPQYGYLTL (SEQ ID NO: 1269), TTSTRTWAL (SEQ ID NO: 1270), YHLNGRDSL (SEQ ID NO: 1271), SQAVGRSSF (SEQ ID NO: 1272), VPANPSTTF (SEQ ID NO: 1273), FPQSGVLIF (SEQ ID NO: 1274),
  • SADNNNSEY SEQ ID NO: 1267
  • LIDQYLYYL SEQ ID NO: 1268
  • VPQYGYLTL SEQ ID NO: 1269
  • TTSTRTWAL SEQ ID NO: 1270
  • YHLNGRDSL SEQ ID NO: 1271
  • SQAVGRSSF SEQ ID NO: 1272
  • YFDFNRFHCHFSPRD (SEQ ID NO: 1275), VGNSSGNWHCDSTWM (SEQ ID NO: 1276), QFSQAGASDIRDQSR (SEQ ID NO: 1277), GASDIRQSRNWLP (SEQ ID NO: 1278) and GNRQAATADVNTQGV (SEQ ID NO: 1279).
  • the AAV serotype may be engineered to comprise at least one AAV capsid CD8+ T-cell epitope for AAV1 such as, but not limited to, LDRLMNPLI (SEQ ID NO: 1280), TTSTRTWAL (SEQ ID NO: 1270), and QPAKKRLNF (SEQ ID NO: 1281)).
  • AAV capsid CD8+ T-cell epitope for AAV1 such as, but not limited to, LDRLMNPLI (SEQ ID NO: 1280), TTSTRTWAL (SEQ ID NO: 1270), and QPAKKRLNF (SEQ ID NO: 1281)).
  • peptides for inclusion in an AAV serotype may be identified using the methods described by Hui et al. (Molecular Therapy– Methods & Clinical
  • the procedure includes isolating human splenocytes, restimulating the splenocytes in vitro using individual peptides spanning the amino acid sequence of the AAV capsid protein, IFN-gamma ELISpot with the individual peptides used for the in vitro restimulation, bioinformatics analysis to determine the HLA restriction of 15-mers identified by IFN-gamma ELISpot, identification of candidate reactive 9-mer epitopes for a given HLA allele, synthesis candidate 9-mers, second IFN-gamma ELISpot screening of splenocytes from subjects carrying the HLA alleles to which identified AAV epitopes are predicted to bind, determine the AAV capsid-reactive CD8+ T cell epitopes and determine the frequency of subjects reacting to a given AAV epitope.
  • the AAV may be a serotype generated by Cre-recombination-based AAV targeted evolution (CREATE) as described by Deverman et al., (Nature Biotechnology 34(2):204-209 (2016)), the contents of which are herein incorporated by reference in their entirety.
  • AAV serotypes generated in this manner have improved CNS transduction and/or neuronal and astrocytic tropism, as compared to other AAV serotypes.
  • the AAV serotype may be PHP.B, PHP.B2, PHP.B3, PHP.A, G2A12, G2A15.
  • these AAV serotypes may be AAV9 (SEQ ID NO: 494 and 495) derivatives with a 7-amino acid insert between amino acids 588-589.
  • Non-limiting examples of these 7-amino acid inserts include TLAVPFK (SEQ ID NO: 1241), SVSKPFL (SEQ ID NO: 1249), FTLTTPK (SEQ ID NO: 1250), YTLSQGW (SEQ ID NO: 1256), QAVRTSL (SEQ ID NO: 1282) and/or LAKERLS (SEQ ID NO: 1283).
  • the AAV serotype may be as described in Jackson et al (Frontiers in Molecular Neuroscience 9:154 (2016)), the contents of which are herein incorporated by reference in their entirety.
  • the AAV serotype is PHP.B or AAV9.
  • the AAV serotype is paired with a synapsin promoter to enhance neuronal transduction, as compared to when more ubiquitous promoters are used (i.e., CBA or CMV).
  • peptides for inclusion in an AAV serotype may be identified by isolating human splenocytes, restimulating the splenocytes in vitro using individual peptides spanning the amino acid sequence of the AAV capsid protein, IFN-gamma ELISpot with the individual peptides used for the in vitro restimulation, bioinformatics analysis to determine the given allele restriction of 15-mers identified by IFN-gamma ELISpot, identification of candidate reactive 9-mer epitopes for a given allele, synthesis candidate 9-mers, second IFN-gamma ELISpot screening of splenocytes from subjects carrying the specific alleles to which identified AAV epitopes are predicted to bind, determine the AAV capsid-reactive CD8+ T cell epitopes and determine the frequency of subjects reacting to a given AAV epitope.
  • AAV vectors comprising the nucleic acid sequence for the siRNA molecules may be prepared or derived from various serotypes of AAVs, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ8, AAV-DJ, AAV-PHP.A (PHP.A), and/or AAV-PHP.B (PHP.B).
  • different serotypes of AAVs may be mixed together or with other types of viruses to produce chimeric AAV vectors.
  • the AAV vector is derived from the AAV9 serotype.
  • ITRs Inverted Terminal Repeats
  • the AAV particles of the present invention comprise a viral genome with at least one ITR region and a payload region.
  • the viral genome has two ITRs. These two ITRs flank the payload region at the 5’ and 3’ ends.
  • the ITRs function as origins of replication comprising recognition sites for replication.
  • ITRs comprise sequence regions which can be complementary and symmetrically arranged.
  • ITRs incorporated into viral genomes of the invention may be comprised of naturally occurring polynucleotide sequences or recombinantly derived polynucleotide sequences.
  • the ITRs may be derived from the same serotype as the capsid, selected from any of the serotypes listed in Table 6, or a derivative thereof.
  • the ITR may be of a different serotype from the capsid.
  • the AAV particle has more than one ITR.
  • the AAV particle has a viral genome comprising two ITRs.
  • the ITRs are of the same serotype as one another.
  • the ITRs are of different serotypes. Non-limiting examples include zero, one or both of the ITRs having the same serotype as the capsid.
  • both ITRs of the viral genome of the AAV particle are AAV2 ITRs.
  • each ITR may be about 100 to about 150 nucleotides in length.
  • An ITR may be about 100-105 nucleotides in length, 106-110 nucleotides in length, 111-115 nucleotides in length, 116-120 nucleotides in length, 121-125 nucleotides in length, 126-130 nucleotides in length, 131-135 nucleotides in length, 136-140 nucleotides in length, 141-145 nucleotides in length or 146-150 nucleotides in length.
  • the ITRs are 140- 142 nucleotides in length.
  • Non-limiting examples of ITR length are 102, 140, 141, 142, 145 nucleotides in length, and those having at least 95% identity thereto.
  • the encoded siRNA molecule may be located near the 5’ end of the flip ITR in an expression vector. In another embodiment, the encoded siRNA molecule may be located near the 3’ end of the flip ITR in an expression vector. In yet another embodiment, the encoded siRNA molecule may be located near the 5’ end of the flop ITR in an expression vector. In yet another embodiment, the encoded siRNA molecule may be located near the 3’ end of the flop ITR in an expression vector. In one embodiment, the encoded siRNA molecule may be located between the 5’ end of the flip ITR and the 3’ end of the flop ITR in an expression vector.
  • the encoded siRNA molecule may be located between (e.g., half-way between the 5’ end of the flip ITR and 3’ end of the flop ITR or the 3’ end of the flop ITR and the 5’ end of the flip ITR), the 3’ end of the flip ITR and the 5’ end of the flip ITR in an expression vector.
  • the encoded siRNA molecule may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream from the 5’ or 3’ end of an ITR (e.g., Flip or Flop ITR) in an expression vector.
  • the encoded siRNA molecule may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides upstream from the 5’ or 3’ end of an ITR (e.g., Flip or Flop ITR) in an expression vector.
  • an ITR e.g., Flip or Flop ITR
  • the encoded siRNA molecule may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides downstream from the 5’ or 3’ end of an ITR (e.g., Flip or Flop ITR) in an expression vector.
  • an ITR e.g., Flip or Flop ITR
  • the encoded siRNA molecule may be located within 1-5, 1-10, 1-15, 1-20, 1- 25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 upstream from the 5’ or 3’ end of an ITR (e.g., Flip or Flop ITR) in an expression vector.
  • an ITR e.g., Flip or Flop ITR
  • the encoded siRNA molecule may be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides upstream from the 5’ or 3’ end of an ITR (e.g., Flip or Flop ITR) in an expression vector.
  • an ITR e.g., Flip or Flop ITR
  • the encoded siRNA molecule may be located with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10- 25%, 15-20%, 15-25%, or 20-25% downstream from the 5’ or 3’ end of an ITR (e.g., Flip or Flop ITR) in an expression vector.
  • an ITR e.g., Flip or Flop ITR
  • a target cell may require a specific promoter including but not limited to a promoter that is species specific, inducible, tissue- specific, or cell cycle-specific (Parr et al., Nat. Med.3:1145-9 (1997); the contents of which are herein incorporated by reference in its entirety).
  • the promoter is a promoter deemed to be efficient to drive the expression of the modulatory polynucleotide.
  • the promoter is a promoter having a tropism for the cell being targeted.
  • the promoter is a weak promoter which provides expression of a payload e.g., a modulatory polynucleotide, e.g., siRNA or dsRNA, for a period of time in targeted tissues such as, but not limited to, nervous system tissues.
  • a payload e.g., a modulatory polynucleotide, e.g., siRNA or dsRNA
  • Expression may be for a period of 1 hour, 2, hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years,
  • Expression may be for 1-5 hours, 1-12 hours, 1-2 days, 1-5 days, 1-2 weeks, 1-3 weeks, 1-4 weeks, 1-2 months, 1-4 months, 1-6 months, 2-6 months, 3-6 months, 3-9 months, 4-8 months, 6-12 months, 1-2 years, 1-5 years, 2-5 years, 3-6 years, 3-8 years, 4-8 years or 5-10 years.
  • the promoter is a weak promoter for sustained expression of a payload in nervous tissues.
  • the promoter may be a promoter which is less than 1 kb.
  • the promoter may have a length of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 or more than 800.
  • the promoter may have a length between 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300- 600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600- 700, 600-800 or 700-800.
  • the promoter may be a combination of two or more components such as, but not limited to, CMV and CBA.
  • Each component may have a length of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 or more than 800.
  • Each component may have a length between 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300- 500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500- 800, 600-700, 600-800 or 700-800.
  • the promoter is a combination of a 382 nucleotide CMV-enhancer sequence and a 260 nucleotide CBA-promoter sequence.
  • the vector genome comprises at least one element to enhance the target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are herein incorporated by reference in its entirety).
  • elements to enhance the transgene target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (PolyA) signal sequences and upstream enhancers (USEs), CMV enhancers and introns.
  • the vector genome comprises at least one element to enhance the target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are herein incorporated by reference in its entirety) such as promoters.
  • Promoters for which promote expression in most tissues include, but are not limited to, human elongation factor 1 ⁇ -subunit (EF1 ⁇ ), immediate-early cytomegalovirus (CMV), chicken ⁇ -actin (CBA) and its derivative CAG, the ⁇ glucuronidase (GUSB), or ubiquitin C (UBC).
  • Tissue-specific expression elements can be used to restrict expression to certain cell types such as, but not limited to, nervous system promoters which can be used to restrict expression to neurons, astrocytes, or oligodendrocytes.
  • tissue-specific expression elements for neurons include neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B-chain (PDGF- ⁇ ), the synapsin (Syn), the methyl-CpG binding protein 2 (MeCP2), CaMKII, mGluR2, NFL, NFH, n ⁇ 2, PPE, Enk and EAAT2 promoters.
  • NSE neuron-specific enolase
  • PDGF platelet-derived growth factor
  • PDGF- ⁇ platelet-derived growth factor B-chain
  • Syn the synapsin
  • MeCP2 methyl-CpG binding protein 2
  • CaMKII methyl-CpG binding protein 2
  • mGluR2 methyl-CpG binding protein 2
  • GFAP glial fibrillary acidic protein
  • EAAT2 EAAT2 promoters
  • a non-limiting example of a tissue-specific expression element for oligodendrocytes include the my
  • the vector genome comprises a ubiquitous promoter.
  • ubiquitous promoters include H1, U6, CMV, CBA (including derivatives CAG, CBh, etc.), EF-1 ⁇ , PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B1-CBX3). Yu et al.
  • the vector genome comprises an UBC promoter.
  • the UBC promoter may have a size of 300-350 nucleotides. As a non-limiting example, the UBC promoter is 332 nucleotides.
  • the vector genome comprises a GUSB promoter.
  • the GUSB promoter may have a size of 350-400 nucleotides.
  • the GUSB promoter is 378 nucleotides.
  • the construct may be AAV-promoter- CMV/globin intron-modulatory polynucleotide-RBG, where the AAV may be self- complementary and the AAV may be the DJ serotype.
  • the vector genome comprises a NFL promoter.
  • the NFL promoter may have a size of 600-700 nucleotides.
  • the NFL promoter is 650 nucleotides.
  • the construct may be AAV-promoter-CMV/globin intron-modulatory polynucleotide-RBG, where the AAV may be self-complementary and the AAV may be the DJ serotype.
  • the vector genome comprises a NFH promoter.
  • the NFH promoter may have a size of 900-950 nucleotides.
  • the NFH promoter is 920 nucleotides.
  • the construct may be AAV-promoter-CMV/globin intron-modulatory polynucleotide-RBG, where the AAV may be self-complementary and the AAV may be the DJ serotype.
  • the vector genome comprises a scn8a promoter.
  • the scn8a promoter may have a size of 450-500 nucleotides.
  • the scn8a promoter is 470 nucleotides.
  • the construct may be AAV-promoter- CMV/globin intron-modulatory polynucleotide-RBG, where the AAV may be self- complementary and the AAV may be the DJ serotype.
  • the vector genome comprises a Pol III promoter.
  • the vector genome comprises a P1 promoter.
  • the vector genome comprises a FXN promoter.
  • the vector genome comprises a PGK promoter.
  • the vector genome comprises a CBA promoter.
  • the vector genome comprises a CMV promoter.
  • the vector genome comprises a H1 promoter.
  • the vector genome comprises a U6 promoter.
  • the vector genome comprises a liver or a skeletal muscle promoter.
  • liver promoters include hAAT and TBG.
  • skeletal muscle promoters include Desmin, MCK and C5-12.
  • the AAV vector comprises an enhancer element, a promoter and/or a 5’UTR intron.
  • the enhancer may be, but is not limited to, a CMV enhancer
  • the promoter may be, but is not limited to, a CMV, CBA, UBC, GUSB, NSE, Synapsin, MeCP2, and GFAP promoter
  • the 5’UTR/intron may be, but is not limited to, SV40, and CBA-MVM.
  • the enhancer, promoter and/or intron used in combination may be: (1) CMV enhancer, CMV promoter, SV405’UTR intron; (2) CMV enhancer, CBA promoter, SV 40 5’UTR intron; (3) CMV enhancer, CBA promoter, CBA-MVM 5’UTR intron; (4) UBC promoter; (5) GUSB promoter; (6) NSE promoter; (7) Synapsin promoter; (8) MeCP2 promoter; (9) GFAP promoter, (10) H1 promoter; and (11) U6 promoter.
  • the AAV vector has an engineered promoter.
  • the vector genome comprises at least one element to enhance the transgene target specificity and expression (See e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are herein incorporated by reference in its entirety) such as an intron.
  • introns include, MVM (67-97 bps), F.IX truncated intron 1 (300 bps), ⁇ - globin SD/immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice
  • donor/immunoglobin splice acceptor 500 bps
  • SV40 late splice donor/splice acceptor (19S/16S) (180 bps)
  • hybrid adenovirus splice donor/IgG splice acceptor 230 bps
  • the intron may be 100-500 nucleotides in length.
  • the intron may have a length of 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 or 500.
  • the promoter may have a length between 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250, 80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500, 300-400, 300-500, or 400- 500.
  • the AAV vector genome may comprise a promoter such as, but not limited to, CMV or U6.
  • the promoter for the AAV comprising the nucleic acid sequence for the siRNA molecules of the present invention is a CMV promoter.
  • the promoter for the AAV comprising the nucleic acid sequence for the siRNA molecules of the present invention is a U6 promoter.
  • the AAV vector may comprise a CMV promoter.
  • the AAV vector may comprise a U6 promoter.
  • the AAV vector may comprise a CMV and a U6 promoter.
  • the AAV vector may comprise a H1 promoter.
  • the AAV vector may comprise a CBA promoter.
  • the encoded siRNA molecule may be located downstream of a promoter in an expression vector such as, but not limited to, CMV, U6, H1, CBA or a CBA promoter with an intron such as SV40, betaGlobin or others known in the art. Further, the encoded siRNA molecule may also be located upstream of the polyadenylation sequence in an expression vector. As a non-limiting example, the encoded siRNA molecule may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream from the promoter and/or upstream of the polyadenylation sequence in an expression vector.
  • the encoded siRNA molecule may be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 or 25-30 nucleotides downstream from the promoter and/or upstream of the polyadenylation sequence in an expression vector.
  • the encoded siRNA molecule may be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides downstream from the promoter and/or upstream of the polyadenylation sequence in an expression vector.
  • the encoded siRNA molecule may be located with the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5- 20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% downstream from the promoter and/or upstream of the polyadenylation sequence in an expression vector.
  • Viral Genome Component Polyadenylation Sequence
  • the viral genome of the AAV particles of the present invention comprise at least one polyadenylation sequence.
  • the viral genome of the AAV particle may comprise a polyadenylation sequence between the 3’ end of the payload coding sequence and the 5’ end of the 3’ITR.
  • the polyadenylation sequence or“polyA sequence” may range from absent to about 500 nucleotides in length.
  • the polyadenylation sequence may be, but is not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100,
  • the polyadenylation sequence is 50-100 nucleotides in length.
  • the polyadenylation sequence is 50-150 nucleotides in length.
  • the polyadenylation sequence is 50-160 nucleotides in length.
  • the polyadenylation sequence is 50-200 nucleotides in length.
  • the polyadenylation sequence is 60-100 nucleotides in length.
  • the polyadenylation sequence is 60-150 nucleotides in length.
  • the polyadenylation sequence is 60-160 nucleotides in length.
  • the polyadenylation sequence is 60-200 nucleotides in length.
  • the polyadenylation sequence is 70-100 nucleotides in length.
  • the polyadenylation sequence is 70-150 nucleotides in length.
  • the polyadenylation sequence is 70-160 nucleotides in length.
  • the polyadenylation sequence is 70-200 nucleotides in length.
  • the polyadenylation sequence is 80-100 nucleotides in length.
  • the polyadenylation sequence is 80-150 nucleotides in length.
  • the polyadenylation sequence is 80-160 nucleotides in length. [00388] In one embodiment, the polyadenylation sequence is 80-200 nucleotides in length.
  • the polyadenylation sequence is 90-100 nucleotides in length.
  • the polyadenylation sequence is 90-150 nucleotides in length.
  • the polyadenylation sequence is 90-160 nucleotides in length.
  • the polyadenylation sequence is 90-200 nucleotides in length.
  • the encoded siRNA molecule may be located upstream of the polyadenylation sequence in an expression vector. Further, the encoded siRNA molecule may be located downstream of a promoter such as, but not limited to, CMV, U6, H1, CBA or a CBA promoter with a SV40 or betaGlobin intron in an expression vector. As a non-limiting example, the encoded siRNA molecule may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more than 30 nucleotides downstream from the promoter and/or upstream of the polyadenylation sequence in an expression vector.
  • a promoter such as, but not limited to, CMV, U6, H1, CBA or a CBA promoter with a SV40 or betaGlobin intron in an expression vector.
  • the encoded siRNA molecule may be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
  • the encoded siRNA molecule may be located within 1-5, 1-10, 1- 15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15- 30, 20-25, 20-30 or 25-30 nucleotides downstream from the promoter and/or upstream of the polyadenylation sequence in an expression vector.
  • the encoded siRNA molecule may be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% or more than 25% of the nucleotides downstream from the promoter and/or upstream of the polyadenylation sequence in an expression vector.
  • the encoded siRNA molecule may be located with the first 1-5%, 1-10%, 1-15%, 1- 20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20- 25% downstream from the promoter and/or upstream of the polyadenylation sequence in an expression vector.
  • an expression vector (e.g., AAV vector) may comprise at least one of the modulatory polynucleotides encoding at least one of the siRNA sequences or duplexes described herein.
  • an expression vector may comprise, from ITR to ITR recited 5’ to 3’, an ITR, a promoter, an intron, a modulatory polynucleotide, a polyA sequence and an ITR.
  • the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides described herein may be single stranded or double stranded vector genome.
  • the size of the vector genome may be small, medium, large or the maximum size.
  • the vector genome may comprise a promoter and a polyA tail.
  • the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides described herein may be a small single stranded vector genome.
  • a small single stranded vector genome may be 2.7 to 3.5 kb in size such as about 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, and 3.5 kb in size.
  • the small single stranded vector genome may be 3.2 kb in size.
  • the vector genome may comprise a promoter and a polyA tail.
  • the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides described herein may be a small double stranded vector genome.
  • a small double stranded vector genome may be 1.3 to 1.7 kb in size such as about 1.3, 1.4, 1.5, 1.6, and 1.7 kb in size.
  • the small double stranded vector genome may be 1.6 kb in size.
  • the vector genome may comprise a promoter and a polyA tail.
  • the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides described herein e.g., siRNA or dsRNA may be a medium single stranded vector genome.
  • a medium single stranded vector genome may be 3.6 to 4.3 kb in size such as about 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2 and 4.3 kb in size.
  • the medium single stranded vector genome may be 4.0 kb in size.
  • the vector genome may comprise a promoter and a polyA tail.
  • the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides described herein may be a medium double stranded vector genome.
  • a medium double stranded vector genome may be 1.8 to 2.1 kb in size such as about 1.8, 1.9, 2.0, and 2.1 kb in size.
  • the medium double stranded vector genome may be 2.0 kb in size.
  • the vector genome may comprise a promoter and a polyA tail.
  • the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides described herein may be a large single stranded vector genome.
  • a large single stranded vector genome may be 4.4 to 6.0 kb in size such as about 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9 and 6.0 kb in size.
  • the large single stranded vector genome may be 4.7 kb in size.
  • the large single stranded vector genome may be 4.8 kb in size.
  • the large single stranded vector genome may be 6.0 kb in size.
  • the vector genome may comprise a promoter and a polyA tail.
  • the vector genome which comprises a nucleic acid sequence encoding the modulatory polynucleotides described herein may be a large double stranded vector genome.
  • a large double stranded vector genome may be 2.2 to 3.0 kb in size such as about 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 and 3.0 kb in size.
  • the large double stranded vector genome may be 2.4 kb in size.
  • the vector genome may comprise a promoter and a polyA tail.
  • the present disclosure provides a method for the generation of parvoviral particles, e.g. AAV particles, by viral genome replication in a viral replication cell comprising contacting the viral replication cell with an AAV polynucleotide or AAV genome.
  • parvoviral particles e.g. AAV particles
  • the present disclosure provides a method for producing an AAV particle having enhanced (increased, improved) transduction efficiency comprising the steps of: 1) co- transfecting competent bacterial cells with a bacmid vector and either a viral construct vector and/or AAV payload construct vector, 2) isolating the resultant viral construct expression vector and AAV payload construct expression vector and separately transfecting viral replication cells, 3) isolating and purifying resultant payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, 4) co-infecting a viral replication cell with both the AAV payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, 5) harvesting and purifying the viral particle comprising a parvoviral genome.
  • the present invention provides a method for producing an AAV particle comprising the steps of 1) simultaneously co-transfecting mammalian cells, such as, but not limited to HEK293 cells, with a payload region, a construct expressing rep and cap genes and a helper construct, 2) harvesting and purifying the AAV particle comprising a viral genome.
  • mammalian cells such as, but not limited to HEK293 cells
  • the present disclosure provides a cell comprising an AAV polynucleotide and/or AAV genome.
  • Viral production disclosed herein describes processes and methods for producing AAV particles that contact a target cell to deliver a payload construct, e.g. a recombinant viral construct, which comprises a polynucleotide sequence encoding a payload molecule.
  • a payload construct e.g. a recombinant viral construct, which comprises a polynucleotide sequence encoding a payload molecule.
  • the AAV particles may be produced in a viral replication cell that comprises an insect cell.
  • nucleic acids such as vectors, e.g., insect-cell compatible vectors
  • methods of introducing nucleic acids, such as vectors, e.g., insect-cell compatible vectors into such cells and methods of maintaining such cells in culture. See, for example, Methods in Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J. Vir.63:3822-8 (1989);
  • the viral replication cell may be selected from any biological organism, including prokaryotic (e.g., bacterial) cells, and eukaryotic cells, including, insect cells, yeast cells and mammalian cells.
  • Viral replication cells may comprise mammalian cells such as A549, WEH1, 3T3, 10T1/2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO. W138, HeLa, HEK293, Saos, C2C12, L cells, HT1080, HepG2 and primary fibroblast, hepatocyte and myoblast cells derived from mammals.
  • Viral replication cells comprise cells derived from mammalian species including, but not limited to, human, monkey, mouse, rat, rabbit, and hamster or cell type, including but not limited to fibroblast, hepatocyte, tumor cell, cell line transformed cell, etc.
  • Viral production disclosed herein describes processes and methods for producing AAV particles that contact a target cell to deliver a payload, e.g. a recombinant viral construct, which comprises a polynucleotide sequence encoding a payload.
  • a payload e.g. a recombinant viral construct, which comprises a polynucleotide sequence encoding a payload.
  • the AAV particles may be produced in a viral replication cell that comprises a mammalian cell.
  • Viral replication cells commonly used for production of recombinant AAV particles include, but are not limited to 293 cells, COS cells, HeLa cells, KB cells, and other mammalian cell lines as described in U.S. Pat. Nos.6,156,303, 5,387,484, 5,741,683, 5,691,176, and 5,688,676; U.S. patent application 2002/0081721, and International Patent Applications WO 00/47757, WO 00/24916, and WO 96/17947, the contents of each of which are herein incorporated by reference in their entireties.
  • AAV particles are produced in mammalian-cells wherein all three VP proteins are expressed at a stoichiometry approaching 1:1:10 (VP1:VP2:VP3).
  • the regulatory mechanisms that allow this controlled level of expression include the production of two mRNAs, one for VP1, and the other for VP2 and VP3, produced by differential splicing.
  • AAV particles are produced in mammalian cells using a triple transfection method wherein a payload construct, parvoviral Rep and parvoviral Cap and a helper construct are comprised within three different constructs.
  • the triple transfection method of the three components of AAV particle production may be utilized to produce small lots of virus for assays including transduction efficiency, target tissue (tropism) evaluation, and stability.
  • Particle production disclosed herein describes processes and methods for producing AAV particles that contact a target cell to deliver a payload construct which comprises a polynucleotide sequence encoding a payload.
  • the viral construct vector and the AAV payload construct vector are each incorporated by a transposon donor/acceptor system into a bacmid, also known as a baculovirus plasmid, by standard molecular biology techniques known and performed by a person skilled in the art.
  • Transfection of separate viral replication cell populations produces two baculoviruses, one that comprises the viral construct expression vector, and another that comprises the AAV payload construct expression vector.
  • the two baculoviruses may be used to infect a single viral replication cell population for production of AAV particles.
  • Baculovirus expression vectors for producing viral particles in insect cells including but not limited to Spodoptera frugiperda (Sf9) cells, provide high titers of viral particle product.
  • Recombinant baculovirus encoding the viral construct expression vector and AAV payload construct expression vector initiates a productive infection of viral replicating cells.
  • Infectious baculovirus particles released from the primary infection secondarily infect additional cells in the culture, exponentially infecting the entire cell culture population in a number of infection cycles that is a function of the initial multiplicity of infection, see Urabe, M. et al., J Virol.2006 Feb; 80 (4):1874-85, the contents of which are herein incorporated by reference in their entirety.
  • Production of AAV particles with baculovirus in an insect cell system may address known baculovirus genetic and physical instability.
  • the production system addresses baculovirus instability over multiple passages by utilizing a titerless infected-cells preservation and scale-up system.
  • Small scale seed cultures of viral producing cells are transfected with viral expression constructs encoding the structural, non-structural, components of the viral particle.
  • Baculovirus-infected viral producing cells are harvested into aliquots that may be cryopreserved in liquid nitrogen; the aliquots retain viability and infectivity for infection of large scale viral producing cell culture Wasilko DJ et al., Protein Expr Purif.2009 Jun;
  • a genetically stable baculovirus may be used to produce source of the one or more of the components for producing AAV particles in invertebrate cells.
  • defective baculovirus expression vectors may be maintained episomally in insect cells.
  • the bacmid vector is engineered with replication control elements, including but not limited to promoters, enhancers, and/or cell-cycle regulated replication elements.
  • baculoviruses may be engineered with a (non-) selectable marker for recombination into the chitinase/cathepsin locus.
  • the chia/v-cath locus is non-essential for propagating baculovirus in tissue culture, and the V-cath (EC 3.4.22.50) is a cysteine endoprotease that is most active on Arg-Arg dipeptide containing substrates.
  • the Arg-Arg dipeptide is present in densovirus and parvovirus capsid structural proteins but infrequently occurs in dependovirus VP1.
  • stable viral replication cells permissive for baculovirus infection are engineered with at least one stable integrated copy of any of the elements necessary for AAV replication and viral particle production including, but not limited to, the entire AAV genome, Rep and Cap genes, Rep genes, Cap genes, each Rep protein as a separate transcription cassette, each VP protein as a separate transcription cassette, the AAP (assembly activation protein), or at least one of the baculovirus helper genes with native or non-native promoters.
  • AAV particle production may be modified to increase the scale of production.
  • Large scale viral production methods according to the present disclosure may include any of those taught in US Patent Nos.5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498 and 7,491,508 or International Publication Nos.
  • Methods of increasing viral particle production scale typically comprise increasing the number of viral replication cells.
  • viral replication cells comprise adherent cells.
  • larger cell culture surfaces are required.
  • large-scale production methods comprise the use of roller bottles to increase cell culture surfaces. Other cell culture substrates with increased surface areas are known in the art.
  • adherent cell culture products with increased surface areas include, but are not limited to CELLSTACK ® , CELLCUBE ® (Corning Corp., Corning, NY) and NUNC TM CELL FACTORY TM (Thermo Scientific, Waltham, MA.)
  • large-scale adherent cell surfaces may comprise from about 1,000 cm 2 to about 100,000 cm 2 .
  • large-scale adherent cell cultures may comprise from about 10 7 to about 10 9 cells, from about 10 8 to about 10 10 cells, from about 10 9 to about 10 12 cells or at least 10 12 cells.
  • large-scale adherent cultures may produce from about 10 9 to about 10 12 , from about 10 10 to about 10 13 , from about 10 11 to about 10 14 , from about 10 12 to about 10 15 or at least 10 15 viral particles.
  • large-scale viral production methods of the present disclosure may comprise the use of suspension cell cultures.
  • Suspension cell culture allows for significantly increased numbers of cells. Typically, the number of adherent cells that can be grown on about 10-50 cm 2 of surface area can be grown in about 1 cm 3 volume in suspension.
  • Transfection of replication cells in large-scale culture formats may be carried out according to any methods known in the art.
  • transfection methods may include, but are not limited to the use of inorganic compounds (e.g. calcium phosphate), organic compounds [e.g. polyethyleneimine (PEI)] or the use of non-chemical methods (e.g. electroporation.)
  • inorganic compounds e.g. calcium phosphate
  • organic compounds e.g. polyethyleneimine (PEI)
  • non-chemical methods e.g. electroporation.
  • transfection methods may include, but are not limited to the use of calcium phosphate and the use of PEI.
  • transfection of large scale suspension cultures may be carried out according to the section entitled“Transfection Procedure” described in Feng, L. et al., 2008. Biotechnol Appl. Biochem. 50:121-32, the contents of which are herein incorporated by reference in their entirety.
  • PEI-DNA complexes may be formed for introduction of plasmids to be transfected.
  • cells being transfected with PEI-DNA complexes may be‘shocked’ prior to transfection. This comprises lowering cell culture temperatures to 4°C for a period of about 1 hour. In some cases, cell cultures may be shocked for a period of from about 10 minutes to about 5 hours. In some cases, cell cultures may be shocked at a temperature of from about 0°C to about 20°C.
  • transfections may include one or more vectors for expression of an RNA effector molecule to reduce expression of nucleic acids from one or more AAV payload construct.
  • Such methods may enhance the production of viral particles by reducing cellular resources wasted on expressing payload constructs.
  • such methods may be carried according to those taught in US Publication No. US2014/0099666, the contents of which are herein incorporated by reference in their entirety.
  • cell culture bioreactors may be used for large scale viral production.
  • bioreactors comprise stirred tank reactors.
  • Such reactors generally comprise a vessel, typically cylindrical in shape, with a stirrer (e.g. impeller.)
  • stirrer e.g. impeller.
  • such bioreactor vessels may be placed within a water jacket to control vessel temperature and/or to minimize effects from ambient temperature changes.
  • Bioreactor vessel volume may range in size from about 500 ml to about 2 L, from about 1 L to about 5 L, from about 2.5 L to about 20 L, from about 10 L to about 50 L, from about 25 L to about 100 L, from about 75 L to about 500 L, from about 250 L to about 2,000 L, from about 1,000 L to about 10,000 L, from about 5,000 L to about 50,000 L or at least 50,000 L.
  • Vessel bottoms may be rounded or flat. In some cases, animal cell cultures may be maintained in bioreactors with rounded vessel bottoms.
  • bioreactor vessels may be warmed through the use of a
  • thermocirculator pump heated water around water jackets.
  • heated water may be pumped through pipes (e.g. coiled pipes) that are present within bioreactor vessels.
  • warm air may be circulated around bioreactors, including, but not limited to air space directly above culture medium. Additionally, pH and CO 2 levels may be maintained to optimize cell viability.
  • bioreactors may comprise hollow-fiber reactors.
  • Hollow-fiber bioreactors may support the culture of both anchorage dependent and anchorage independent cells.
  • Further bioreactors may include, but are not limited to packed-bed or fixed-bed bioreactors.
  • Such bioreactors may comprise vessels with glass beads for adherent cell attachment.
  • Further packed-bed reactors may comprise ceramic beads.
  • viral particles are produced through the use of a disposable bioreactor.
  • bioreactors may include WAVE TM disposable bioreactors.
  • AAV particle production in animal cell bioreactor cultures may be carried out according to the methods taught in US Patent Nos.5,064764, 6,194,191, 6,566,118, 8,137,948 or US Patent Application No. US2011/0229971, the contents of each of which are herein incorporated by reference in their entirety.
  • Cells of the invention including, but not limited to viral production cells, may be subjected to cell lysis according to any methods known in the art. Cell lysis may be carried out to obtain one or more agents (e.g. viral particles) present within any cells of the invention.
  • agents e.g. viral particles
  • cell lysis may be carried out according to any of the methods listed in US Patent Nos.7,326,555, 7,579,181, 7,048,920, 6,410,300, 6,436,394, 7,732,129, 7,510,875, 7,445,930, 6,726,907, 6,194,191, 7,125,706, 6,995,006, 6,676,935, 7,968,333, 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498 and 7,491,508 or International Publication Nos.
  • Cell lysis methods may be chemical or mechanical. Chemical cell lysis typically comprises contacting one or more cells with one or more lysis agent. Mechanical lysis typically comprises subjecting one or more cells to one or more lysis condition and/or one or more lysis force.
  • chemical lysis may be used to lyse cells.
  • the term“lysis agent” refers to any agent that may aid in the disruption of a cell.
  • lysis agents are introduced in solutions, termed lysis solutions or lysis buffers.
  • the term“lysis solution” refers to a solution (typically aqueous) comprising one or more lysis agent.
  • lysis solutions may include one or more buffering agents, solubilizing agents, surfactants, preservatives, cryoprotectants, enzymes, enzyme inhibitors and/or chelators.
  • Lysis buffers are lysis solutions comprising one or more buffering agent.
  • lysis solutions may include one or more solubilizing agent.
  • solubilizing agent refers to a compound that enhances the solubility of one or more components of a solution and/or the solubility of one or more entities to which solutions are applied.
  • solubilizing agents enhance protein solubility.
  • solubilizing agents are selected based on their ability to enhance protein solubility while maintaining protein conformation and/or activity.
  • Exemplary lysis agents may include any of those described in US Patent Nos.
  • lysis agents may be selected from lysis salts, amphoteric agents, cationic agents, ionic detergents and non-ionic detergents.
  • Lysis salts may include, but are not limited to sodium chloride (NaCl) and potassium chloride (KCl.) Further lysis salts may include any of those described in US Patent Nos.8,614,101, 7,326,555,
  • Concentrations of salts may be increased or decreased to obtain an effective concentration for rupture of cell membranes.
  • Amphoteric agents as referred to herein, are compounds capable of reacting as an acid or a base.
  • Amphoteric agents may include, but are not limited to lysophosphatidylcholine, 3-((3-Cholamidopropyl) dimethylammonium)-1-propanesulfonate (CHAPS), ZWITTERGENT® and the like.
  • Cationic agents may include, but are not limited to cetyltrimethylammonium bromide (C (16) TAB) and Benzalkonium chloride.
  • Lysis agents comprising detergents may include ionic detergents or non- ionic detergents. Detergents may function to break apart or dissolve cell structures including, but not limited to cell membranes, cell walls, lipids, carbohydrates, lipoproteins and glycoproteins.
  • Exemplary ionic detergents include any of those taught in US Patent Nos.7,625,570 and 6,593,123 or US Publication No. US2014/0087361, the contents of each of which are herein incorporated by reference in their entirety.
  • Some ionic detergents may include, but are not limited to sodium dodecyl sulfate (SDS), cholate and deoxycholate.
  • SDS sodium dodecyl sulfate
  • ionic detergents may be included in lysis solutions as a solubilizing agent.
  • Non-ionic detergents may include, but are not limited to octylglucoside, digitonin, lubrol, C12E8, TWEEN®-20,
  • Non-ionic detergents are typically weaker lysis agents, but may be included as solubilizing agents for solubilizing cellular and/or viral proteins.
  • Further lysis agents may include enzymes and urea.
  • one or more lysis agents may be combined in a lysis solution in order to enhance one or more of cell lysis and protein solubility.
  • enzyme inhibitors may be included in lysis solutions in order to prevent proteolysis that may be triggered by cell membrane disruption.
  • mechanical cell lysis is carried out.
  • Mechanical cell lysis methods may include the use of one or more lysis condition and/or one or more lysis force.
  • lysis condition refers to a state or circumstance that promotes cellular disruption. Lysis conditions may comprise certain temperatures, pressures, osmotic purity, salinity and the like. In some cases, lysis conditions comprise increased or decreased
  • lysis conditions comprise changes in temperature to promote cellular disruption.
  • Cell lysis carried out according to such embodiments may include freeze-thaw lysis.
  • freeze-thaw lysis refers to cellular lysis in which a cell solution is subjected to one or more freeze-thaw cycle.
  • freeze- thaw lysis methods cells in solution are frozen to induce a mechanical disruption of cellular membranes caused by the formation and expansion of ice crystals.
  • Cell solutions used according freeze-thaw lysis methods may further comprise one or more lysis agents, solubilizing agents, buffering agents, cryoprotectants, surfactants, preservatives, enzymes, enzyme inhibitors and/or chelators.
  • cryoprotectant refers to an agent used to protect one or more substance from damage due to freezing. Cryoprotectants may include any of those taught in US Publication No.
  • cryoprotectants may include, but are not limited to dimethyl sulfoxide, 1,2-propanediol, 2,3- butanediol, formamide, glycerol, ethylene glycol, 1,3-propanediol and n-dimethyl formamide, polyvinylpyrrolidone, hydroxyethyl starch, agarose, dextrans, inositol, glucose,
  • freeze-thaw lysis may be carried out according to any of the methods described in US Patent No. 7,704,721, the contents of which are herein incorporated by reference in their entirety.
  • lysis force refers to a physical activity used to disrupt a cell. Lysis forces may include, but are not limited to mechanical forces, sonic forces, gravitational forces, optical forces, electrical forces and the like. Cell lysis carried out by mechanical force is referred to herein as“mechanical lysis.” Mechanical forces that may be used according to mechanical lysis may include high shear fluid forces. According to such methods of mechanical lysis, a microfluidizer may be used. Microfluidizers typically comprise an inlet reservoir where cell solutions may be applied. Cell solutions may then be pumped into an interaction chamber via a pump (e.g. high-pressure pump) at high speed and/or pressure to produce shear fluid forces. Resulting lysates may then be collected in one or more output reservoir. Pump speed and/or pressure may be adjusted to modulate cell lysis and enhance recovery of products (e.g. viral particles.) Other mechanical lysis methods may include physical disruption of cells by scraping.
  • a pump e.g. high-pressure pump
  • Cell lysis methods may be selected based on the cell culture format of cells to be lysed. For example, with adherent cell cultures, some chemical and mechanical lysis methods may be used. Such mechanical lysis methods may include freeze-thaw lysis or scraping. In another example, chemical lysis of adherent cell cultures may be carried out through incubation with lysis solutions comprising surfactant, such as Triton-X-100. In some cases, cell lysates generated from adherent cell cultures may be treated with one more nuclease to lower the viscosity of the lysates caused by liberated DNA.
  • surfactant such as Triton-X-100
  • a method for harvesting AAV particles without lysis may be used for efficient and scalable AAV particle production.
  • AAV particles may be produced by culturing an AAV particle lacking a heparin binding site, thereby allowing the AAV particle to pass into the supernatant, in a cell culture, collecting supernatant from the culture; and isolating the AAV particle from the supernatant, as described in US Patent Application 20090275107, the contents of which are incorporated herein by reference in their entirety.
  • Cell lysates comprising viral particles may be subjected to clarification.
  • Clarification refers to initial steps taken in purification of viral particles from cell lysates. Clarification serves to prepare lysates for further purification by removing larger, insoluble debris. Clarification steps may include, but are not limited to centrifugation and filtration. During clarification, centrifugation may be carried out at low speeds to remove larger debris only. Similarly, filtration may be carried out using filters with larger pore sizes so that only larger debris is removed. In some cases, tangential flow filtration may be used during clarification. Objectives of viral clarification include high throughput processing of cell lysates and to optimize ultimate viral recovery. Advantages of including a clarification step include scalability for processing of larger volumes of lysate.
  • clarification may be carried out according to any of the methods presented in US Patent Nos.8,524,446, 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498, 7,491,508, US Publication Nos. US2013/0045186, US2011/0263027, US2011/0151434, US2003/0138772, and International Publication Nos.
  • Cell lysate clarification by filtration are well understood in the art and may be carried out according to a variety of available methods including, but not limited to passive filtration and flow filtration.
  • Filters used may comprise a variety of materials and pore sizes.
  • cell lysate filters may comprise pore sizes of from about 1 ⁇ M to about 5 ⁇ M, from about 0.5 ⁇ M to about 2 ⁇ M, from about 0.1 ⁇ M to about 1 ⁇ M, from about 0.05 ⁇ M to about 0.05 ⁇ M and from about 0.001 ⁇ M to about 0.1 ⁇ M.
  • Exemplary pore sizes for cell lysate filters may include, but are not limited to, 2.0, 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.95, 0.9, 0.85, 0.8, 0.75, 0.7, 0.65, 0.6, 0.55, 0.5, 0.45, 0.4, 0.35, 0.3, 0.25, 0.2, 0.15, 0.1, 0.05, 0.22, 0.21, 0.20, 0.19, 0.18, 0.17, 0.16, 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06, 0.05, 0.04, 0.03, 0.02, 0.01, 0.02, 0.019, 0.018, 0.017, 0.016, 0.015, 0.014, 0.013, 0.012, 0.011, 0.0, 0.09, 0.08, 0.07, 0.06,
  • Filter materials may be composed of a variety of materials. Such materials may include, but are not limited to polymeric materials and metal materials (e.g. sintered metal and pored aluminum.) Exemplary materials may include, but are not limited to nylon, cellulose materials (e.g. cellulose acetate), polyvinylidene fluoride (PVDF), polyethersulfone, polyamide, polysulfone, polypropylene, and polyethylene terephthalate.
  • filters useful for clarification of cell lysates may include, but are not limited to ULTIPLEAT PROFILETM filters (Pall Corporation, Port Washington, NY), SUPORTM membrane filters (Pall Corporation, Port Washington, NY)
  • flow filtration may be carried out to increase filtration speed and/or effectiveness.
  • flow filtration may comprise vacuum filtration. According to such methods, a vacuum is created on the side of the filter opposite that of cell lysate to be filtered.
  • cell lysates may be passed through filters by centrifugal forces.
  • a pump is used to force cell lysate through clarification filters. Flow rate of cell lysate through one or more filters may be modulated by adjusting one of channel size and/or fluid pressure.
  • cell lysates may be clarified by centrifugation.
  • Centrifugation may be used to pellet insoluble particles in the lysate.
  • centrifugation strength [expressed in terms of gravitational units (g), which represents multiples of standard gravitational force] may be lower than in subsequent purification steps.
  • centrifugation may be carried out on cell lysates at from about 200 g to about 800 g, from about 500 g to about 1500 g, from about 1000 g to about 5000 g, from about 1200 g to about 10000 g or from about 8000 g to about 15000 g.
  • cell lysate centrifugation is carried out at 8000 g for 15 minutes.
  • density gradient centrifugation may be carried out in order to partition particulates in the cell lysate by sedimentation rate.
  • Gradients used according to methods of the present disclosure may include, but are not limited to cesium chloride gradients and iodixanol step gradients.
  • AAV particles may be purified from clarified cell lysates by one or more methods of chromatography.
  • Chromatography refers to any number of methods known in the art for separating out one or more elements from a mixture. Such methods may include, but are not limited to ion exchange chromatography (e.g. cation exchange chromatography and anion exchange chromatography), immunoaffinity chromatography and size-exclusion
  • methods of viral chromatography may include any of those taught in US Patent Nos.5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010,
  • ion exchange chromatography may be used to isolate viral particles. Ion exchange chromatography is used to bind viral particles based on charge-charge interactions between capsid proteins and charged sites present on a stationary phase, typically a column through which viral preparations (e.g. clarified lysates) are passed. After application of viral preparations, bound viral particles may then be eluted by applying an elution solution to disrupt the charge-charge interactions. Elution solutions may be optimized by adjusting salt concentration and/or pH to enhance recovery of bound viral particles. Depending on the charge of viral capsids being isolated, cation or anion exchange chromatography methods may be selected.
  • Methods of ion exchange chromatography may include, but are not limited to any of those taught in US Patent Nos.7,419,817, 6,143,548, 7,094,604, 6,593,123, 7,015,026 and 8,137,948, the contents of each of which are herein incorporated by reference in their entirety.
  • immunoaffinity chromatography may be used.
  • Immunoaffinity chromatography is a form of chromatography that utilizes one or more immune compounds (e.g. antibodies or antibody-related structures) to retain viral particles.
  • Immune compounds may bind specifically to one or more structures on viral particle surfaces, including, but not limited to one or more viral coat protein.
  • immune compounds may be specific for a particular viral variant.
  • immune compounds may bind to multiple viral variants.
  • immune compounds may include recombinant single-chain antibodies. Such recombinant single chain antibodies may include those described in Smith, R.H. et al., 2009. Mol.
  • Such immune compounds are capable of binding to several AAV capsid variants, including, but not limited to AAV1, AAV2, AAV6 and AAV8.
  • SEC size-exclusion chromatography
  • SEC may comprise the use of a gel to separate particles according to size.
  • SEC filtration is sometimes referred to as“polishing.”
  • SEC may be carried out to generate a final product that is near-homogenous. Such final products may in some cases be used in pre-clinical studies and/or clinical studies (Kotin, R.M.2011. Human Molecular Genetics. 20(1):R2-R6, the contents of which are herein incorporated by reference in their entirety.)
  • SEC may be carried out according to any of the methods taught in US Patent Nos.
  • compositions comprising at least one AAV particle may be isolated or purified using the methods described in US Patent No. US 6146874, the contents of which are herein incorporated by reference in its entirety.
  • compositions comprising at least one AAV particle may be isolated or purified using the methods described in US Patent No. US 6660514, the contents of which are herein incorporated by reference in its entirety.
  • compositions comprising at least one AAV particle may be isolated or purified using the methods described in US Patent No. US 8283151, the contents of which are herein incorporated by reference in its entirety.
  • compositions comprising at least one AAV particle may be isolated or purified using the methods described in US Patent No. US 8524446, the contents of which are herein incorporated by reference in its entirety.
  • compositions which are suitable for administration to humans
  • pharmaceutical compositions which are suitable for administration to humans
  • such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals.
  • Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation.
  • Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and/or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and/or rats; and/or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and/or turkeys.
  • compositions are administered to humans, human patients or subjects.
  • the phrase“active ingredient” generally refers either to the synthetic siRNA duplexes, the vector, e.g., AAV vector, encoding the siRNA duplexes, or to the siRNA molecule delivered by a vector as described herein.
  • Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology.
  • such preparatory methods include the step of bringing the active ingredient into association with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, dividing, shaping and/or packaging the product into a desired single- or multi-dose unit.
  • Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition in accordance with the invention will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered.
  • the vectors e.g., AAV vectors, comprising the nucleic acid sequence encoding the siRNA molecules of the present invention can be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection or transduction; (3) permit the sustained or delayed release; or (4) alter the biodistribution (e.g., target the viral vector to specific tissues or cell types such as brain and neurons).
  • Formulations of the present invention can include, without limitation, saline, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with viral vectors (e.g., for transplantation into a subject), nanoparticle mimics and combinations thereof. Further, the viral vectors of the present invention may be formulated using self-assembled nucleic acid nanoparticles.
  • Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of associating the active ingredient with an excipient and/or one or more other accessory ingredients.
  • a pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses.
  • a“unit dose” refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient.
  • the amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
  • Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure may vary, depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route by which the composition is to be administered.
  • the composition may comprise between 0.1% and 99% (w/w) of the active ingredient.
  • the composition may comprise between 0.1% and 100%, e.g., between .5 and 50%, between 1-30%, between 5-80%, at least 80% (w/w) active ingredient.
  • a pharmaceutically acceptable excipient may be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure.
  • an excipient is approved for use for humans and for veterinary use.
  • an excipient may be approved by United States Food and Drug Administration.
  • an excipient may be of pharmaceutical grade.
  • an excipient may meet the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and/or the International Pharmacopoeia.
  • Excipients which, as used herein, includes, but is not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired.
  • Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21 st Edition, A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference in its entirety).
  • any conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.
  • Exemplary diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch, powdered sugar, etc., and/or combinations thereof.
  • the formulations may comprise at least one inactive ingredient.
  • inactive ingredient refers to one or more inactive agents included in formulations.
  • all, none or some of the inactive ingredients which may be used in the formulations of the present invention may be approved by the US Food and Drug Administration (FDA).
  • FDA US Food and Drug Administration
  • Formulations of vectors comprising the nucleic acid sequence for the siRNA molecules of the present invention may include cations or anions.
  • the formulations include metal cations such as, but not limited to, Zn2+, Ca2+, Cu2+, Mg+ and combinations thereof.
  • “pharmaceutically acceptable salts” refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid).
  • suitable organic acid examples include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like.
  • Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy- ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, ole
  • alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like.
  • the pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids.
  • the pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods.
  • such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred.
  • nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred.
  • Lists of suitable salts are found in Remington’s Pharmaceutical Sciences, 17 th ed., Mack Publishing Company, Easton, Pa., 1985, p.1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1- 19 (1977); the content of each of which is incorporated herein by reference in their entirety.
  • solvates means a compound of the invention wherein molecules of a suitable solvent are incorporated in the crystal lattice.
  • a suitable solvent is physiologically tolerable at the dosage administered.
  • solvates may be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof.
  • solvents examples include ethanol, water (for example, mono-, di-, and tri-hydrates), N-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), N,N’-dimethylformamide (DMF), N,N’-dimethylacetamide (DMAC), 1,3- dimethyl-2-imidazolidinone (DMEU), 1,3-dimethyl-3,4,5,6-tetrahydro-2-(1H)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like.
  • NMP N-methylpyrrolidinone
  • DMSO dimethyl sulfoxide
  • DMF N,N’-dimethylformamide
  • DMAC N,N’-dimethylacetamide
  • DMEU 1,3- dimethyl-2-imidazolidinone
  • DMPU 1,3-
  • the vector e.g., AAV vector
  • the nucleic acid sequence for the siRNA molecules of the present invention may be formulated for CNS delivery.
  • Agents that cross the brain blood barrier (BBB) may be used.
  • BBB brain blood barrier
  • some cell-penetrating peptides that can target siRNA molecules to the BBB endothelium may be used to formulate the siRNA duplexes targeting the HTT gene.
  • formulations may comprise at least one excipient which is an inactive ingredient.
  • inactive ingredient refers to one or more inactive agents included in formulations.
  • all, none or some of the inactive ingredients which may be used in the formulations of the present disclosure may be approved by the US Food and Drug Administration (FDA).
  • FDA US Food and Drug Administration
  • Formulations of AAV particles and viral vectors carrying compositions described herein may include cations or anions.
  • the formulations include metal cations such as, but not limited to, Zn2+, Ca2+, Cu2+, Mg+ and combinations thereof.
  • formulations may include polymers and compositions described herein complexed with a metal cation (See e.g., U.S. Pat. Nos.6,265,389 and 6,555,525, each of which is herein incorporated by reference in its entirety).
  • the viral vector comprising compositions described herein may be administered or delivered using the methods for the delivery of AAV virions described in European Patent Application No. EP1857552, the contents of which are herein incorporated by reference in its entirety.
  • the viral vector comprising compositions described herein may be administered or delivered using the methods for delivering proteins using AAV vectors described in European Patent Application No. EP2678433, the contents of which are herein incorporated by reference in its entirety.
  • the viral vector comprising compositions described herein may be administered or delivered using the methods for delivering DNA molecules using AAV vectors described in US Patent No. US 5,858,351, the contents of which are herein incorporated by reference in its entirety.
  • the viral vector comprising compositions described herein may be administered or delivered using the methods for delivering DNA to the bloodstream described in US Patent No. US 6,211,163, the contents of which are herein incorporated by reference in its entirety.
  • the viral vector comprising compositions described herein may be administered or delivered using the methods for delivering AAV virions described in US Patent No. US 6,325,998, the contents of which are herein incorporated by reference in its entirety.
  • the viral vector comprising compositions described herein may be administered or delivered using the methods for delivering a payload to the central nervous system described in US Patent No. US 7,588,757, the contents of which are herein incorporated by reference in its entirety.
  • the viral vector comprising compositions described herein may be administered or delivered using the methods for delivering a payload described in US Patent No. US 8283151, the contents of which are herein incorporated by reference in its entirety.
  • the viral vector comprising compositions described herein may be administered or delivered using the methods for delivering a payload using a glutamic acid decarboxylase (GAD) delivery vector described in International Patent Publication No.
  • GAD glutamic acid decarboxylase
  • the viral vector comprising compositions described herein may be administered or delivered using the methods for delivering a payload to neural cells described in International Patent Publication No. WO2012057363, the contents of which are herein incorporated by reference in its entirety.
  • the present disclosure provides a method of delivering to a cell or tissue any of the above-described AAV polynucleotides or AAV genomes, comprising contacting the cell or tissue with said AAV polynucleotide or AAV genomes or contacting the cell or tissue with a particle comprising said AAV polynucleotide or AAV genome, or contacting the cell or tissue with any of the described compositions, including pharmaceutical compositions.
  • the method of delivering the AAV polynucleotide or AAV genome to a cell or tissue can be accomplished in vitro, ex vivo, or in vivo.
  • the cells may include, but are not limited to, cells of mammalian origin, cells of human origins, embryonic stem cells, induced pluripotent stem cells, neural stem cells, and neural progenitor cells.
  • Nucleic acids including siRNA, carry a net negative charge on the sugar-phosphate backbone under normal physiological conditions.
  • a siRNA molecule In order to enter the cell, a siRNA molecule must come into contact with a lipid bilayer of the cell membrane, whose head groups are also negatively charged.
  • the siRNA duplexes can be complexed with a carrier that allows them to traverse cell membranes such as package particles to facilitate cellular uptake of the siRNA.
  • the package particles may include, but are not limited to, liposomes, nanoparticles, cationic lipids, polyethylenimine derivatives, dendrimers, carbon nanotubes and the combination of carbon- made nanoparticles with dendrimers.
  • Lipids may be cationic lipids and/or neutral lipids.
  • siRNA molecules can be conjugated to a hydrophobic moiety, such as cholesterol (e.g., U.S.
  • siRNA molecules of the present invention may also be conjugated to certain cationic cell-penetrating peptides (CPPs), such as MPG, transportan or penetratin covalently or non-covalently (e.g., U.S. Patent
  • siRNA molecules e.g., siRNA duplexes
  • the siRNA molecules may be introduced into cells using any of a variety of approaches such as, but not limited to, viral vectors (e.g., AAV vectors). These viral vectors are engineered and optimized to facilitate the entry of siRNA molecule into cells that are not readily amendable to transfection. Also, some synthetic viral vectors possess an ability to integrate the shRNA into the cell genome, thereby leading to stable siRNA expression and long-term knockdown of a target gene. In this manner, viral vectors are engineered as vehicles for specific delivery while lacking the deleterious replication and/or integration features found in wild-type virus.
  • viral vectors e.g., AAV vectors
  • the siRNA molecules of the present invention are introduced into a cell by contacting the cell with a composition comprising a lipophilic carrier and a vector, e.g., an AAV vector, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention.
  • the siRNA molecule is introduced into a cell by transfecting or infecting the cell with a vector, e.g., an AAV vector, comprising nucleic acid sequences capable of producing the siRNA molecule when transcribed in the cell.
  • the siRNA molecule is introduced into a cell by injecting into the cell a vector, e.g., an AAV vector, comprising a nucleic acid sequence capable of producing the siRNA molecule when transcribed in the cell.
  • a vector e.g., an AAV vector, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be transfected into cells.
  • the vectors e.g., AAV vectors, comprising the nucleic acid sequence encoding the siRNA molecules of the present invention may be delivered into cells by electroporation (e.g. U.S. Patent Publication No.20050014264; the content of which is herein incorporated by reference in its entirety).
  • vectors comprising the nucleic acid sequence for the siRNA molecules described herein may include photochemical internalization as described in U. S. Patent publication No.20120264807; the content of which is herein incorporated by reference in its entirety.
  • the formulations described herein may contain at least one vector, e.g., AAV vectors, comprising the nucleic acid sequence encoding the siRNA molecules described herein.
  • the siRNA molecules may target the HTT gene at one target site.
  • the formulation comprises a plurality of vectors, e.g., AAV vectors, each vector comprising a nucleic acid sequence encoding a siRNA molecule targeting the HTT gene at a different target site.
  • the HTT may be targeted at 2, 3, 4, 5 or more than 5 sites.
  • the vectors e.g., AAV vectors, from any relevant species, such as, but not limited to, human, dog, mouse, rat or monkey may be introduced into cells.
  • the vectors may be introduced into cells which are relevant to the disease to be treated.
  • the disease is HD and the target cells are neurons and astrocytes.
  • the disease is HD and the target cells are medium spiny neurons, cortical neurons and astrocytes.
  • the vectors e.g., AAV vectors
  • the vectors may be introduced into cells which have a high level of endogenous expression of the target sequence.
  • the vectors e.g., AAV vectors
  • the vectors may be introduced into cells which have a low level of endogenous expression of the target sequence.
  • the cells may be those which have a high efficiency of AAV transduction.
  • the present disclosure additionally provides a method of delivering to a subject, including a mammalian subject, any of the above-described AAV polynucleotides or AAV genomes comprising administering to the subject said AAV polynucleotide or AAV genome, or administering to the subject a particle comprising said AAV polynucleotide or AAV genome, or administering to the subject any of the described compositions, including pharmaceutical compositions.
  • compositions of viral vectors described herein may be any pharmaceutical compositions of viral vectors described herein.
  • bioavailability characterized by one or more of bioavailability, therapeutic window and/or volume of distribution.
  • the vector e.g., AAV vector, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be administered by any route which results in a therapeutically effective outcome.
  • routes include, but are not limited to, within the parenchyma of an organ such as, but not limited to, a brain (e.g., intraparenchymal), corpus striatum
  • intrastriatal enteral (into the intestine), gastroenteral, epidural, oral (by way of the mouth), transdermal, peridural, intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous (into a vein), intravenous bolus, intravenous drip, intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), subpial (between the pia and the underlying tissue), intraganglionic (into the ganglion), intraperitoneal, (infusion or injection into the peritoneum), intravesical infusion, intravitreal, (through the eye), intracavernous injection (into a pathologic cavity) intraca
  • intrabronchial intrabursal, intracartilaginous (within a cartilage), intracaudal (within the cauda equine), intracisternal (within the cisterna magna cerebellomedularis), intracorneal (within the cornea), dental intracornal, intracoronary (within the coronary arteries), intracorporus cavernosum (within the dilatable spaces of the corporus cavernosa of the penis), intradiscal (within a disc), intraductal (within a duct of a gland), intraduodenal (within the duodenum), intradural (within or beneath the dura), intraepidermal (to the epidermis), intraesophageal (to the esophagus), intragastric (within the stomach), intragingival (within the gingivae), intraileal (within the distal portion of the small intestine), intralesional (within or introduced directly to a local
  • compositions of vector e.g., AAV vector, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be administered in a way which facilitates the vectors or siRNA molecule to enter the central nervous system and penetrate into medium spiny and/or cortical neurons and/or astrocytes.
  • the vector e.g., AAV vector, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be administered by intramuscular injection.
  • the vector e.g., AAV vector, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be administered via
  • the vector e.g., AAV vector, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be administered via
  • the vector e.g., AAV vector, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be administered via intrastriatal injection.
  • the vector e.g., AAV vector, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be administered via intrastriatal injection and another route of administration described herein.
  • AAV vectors that express siRNA duplexes of the present invention may be administered to a subject by peripheral injections (e.g., intravenous) and/or intranasal delivery. It was disclosed in the art that the peripheral administration of AAV vectors for siRNA duplexes can be transported to the central nervous system, for example, to the neurons (e.g., U. S. Patent Publication Nos.20100240739; and 20100130594; the content of each of which is incorporated herein by reference in their entirety).
  • compositions comprising at least one vector, e.g., AAV vector, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be administered to a subject by intracranial delivery (See, e.g., U. S. Pat. No.8,119,611; the content of which is incorporated herein by reference in its entirety).
  • the vector e.g., AAV vector, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be administered in any suitable form, either as a liquid solution or suspension, as a solid form suitable for liquid solution or suspension in a liquid solution.
  • the siRNA duplexes may be formulated with any appropriate and pharmaceutically acceptable excipient.
  • the vector e.g., AAV vector, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be administered in a“therapeutically effective” amount, i.e., an amount that is sufficient to alleviate and/or prevent at least one symptom associated with the disease, or provide improvement in the condition of the subject.
  • a“therapeutically effective” amount i.e., an amount that is sufficient to alleviate and/or prevent at least one symptom associated with the disease, or provide improvement in the condition of the subject.
  • the vector e.g., AAV vector
  • the vector may be administered to the CNS in a therapeutically effective amount to improve function and/or survival for a subject with
  • the vector may be administered by direct infusion into the striatum.
  • the vector e.g., AAV vector
  • the vector may be administered to a subject (e.g., to the CNS of a subject via intrathecal administration) in a therapeutically effective amount for the siRNA duplexes or dsRNA to target the medium spiny neurons, cortical neurons and/or astrocytes.
  • the siRNA duplexes or dsRNA may reduce the expression of HTT protein or mRNA.
  • the siRNA duplexes or dsRNA can suppress HTT and reduce HTT mediated toxicity. The reduction of HTT protein and/or mRNA as well as HTT mediated toxicity may be accomplished with almost no enhanced inflammation.
  • the vector e.g., AAV vector
  • a subject e.g., to the CNS of a subject
  • a therapeutically effective amount to slow the functional decline of a subject (e.g., determined using a known evaluation method such as the unified Huntington’s disease rating scale (UHDRS)).
  • UHDRS unified Huntington’s disease rating scale
  • the vector may be administered via intraparenchymal injection.
  • the vector e.g., AAV vector
  • the vector may be administered to the cisterna magna in a therapeutically effective amount to transduce medium spiny neurons, cortical neurons and/or astrocytes.
  • the vector may be administered intrathecally.
  • the vector e.g., AAV vector
  • the vector may be administered using intrathecal infusion in a therapeutically effective amount to transduce medium spiny neurons, cortical neurons and/or astrocytes.
  • the vector may be administered intrathecally.
  • the vector e.g., AAV vector
  • the vector may be administered to the cisterna magna in a therapeutically effective amount to transduce medium spiny neurons, cortical neurons and/or astrocytes.
  • the vector may be administered by
  • the vector e.g., AAV vector, comprising a modulatory polynucleotide may be formulated.
  • the baricity and/or osmolality of the formulation may be optimized to ensure optimal drug distribution in the central nervous system or a region or component of the central nervous system.
  • the vector e.g., AAV vector, comprising a modulatory polynucleotide may be delivered to a subject via a single route administration.
  • the vector e.g., AAV vector, comprising a modulatory polynucleotide may be delivered to a subject via a multi-site route of administration.
  • a subject may be administered the vector, e.g., AAV vector, comprising a modulatory polynucleotide at 2, 3, 4, 5 or more than 5 sites.
  • a subject may be administered the vector, e.g., AAV vector, comprising a modulatory polynucleotide described herein using a bolus injection.
  • the vector e.g., AAV vector
  • a subject may be administered the vector, e.g., AAV vector, comprising a modulatory polynucleotide described herein using sustained delivery over a period of minutes, hours or days.
  • the infusion rate may be changed depending on the subject, distribution, formulation or another delivery parameter.
  • the vector e.g., AAV vector, described herein is administered via putamen and caudate infusion.
  • the dual infusion provides a broad striatal distribution as well as a frontal and temporal cortical distribution.
  • the vector e.g., AAV vector
  • AAV-DJ8 which is administered via unilateral putamen infusion.
  • the distribution of the administered AAV-DJ8 is similar to the distribution of AAV1 delivered via unilateral putamen infusion.
  • the vector e.g., AAV vector, described herein is administered via intrathecal (IT) infusion at C1.
  • the infusion may be for 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more than 15 hours.
  • the selection of subjects for administration of the vector may be evaluated using imaging of the perivascular spaces (PVS) which are also known as Virchow-Robin spaces.
  • PVS surround the arterioles and venules as they perforate brain parenchyma and are filled with cerebrospinal fluid (CSF)/interstitial fluid.
  • CSF cerebrospinal fluid
  • PVS are common in the midbrain, basal ganglia, and centrum semiovale. While not wishing to be bound by theory, PVS may play a role in the normal clearance of metabolites and have been associated with worse cognition and several disease states including Parkinson’s disease.
  • PVS are usually are normal in size but they can increase in size in a number of disease states.
  • Potter et al. (Cerebrovasc Dis.2015 Jan; 39(4): 224–231; the contents of which are herein incorporated by reference in its entirety) developed a grading method where they studied a full range of PVS and rated basal ganglia, centrum semiovale and midbrain PVS. They used the frequency and range of PVS used by Mac and Lullich et al. (J Neurol Neurosurg Psychiatry.2004
  • compositions of the present invention may be administered to a subject using any amount effective for reducing, preventing and/or treating a HTT-associated disorder (e.g., Huntington’ Disease (HD)).
  • a HTT-associated disorder e.g., Huntington’ Disease (HD)
  • the exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like.
  • compositions of the present invention are typically formulated in unit dosage form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present invention may be decided by the attending physician within the scope of sound medical judgment.
  • the specific therapeutic effectiveness for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the siRNA duplexes employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts.
  • the age and sex of a subject may be used to determine the dose of the compositions of the present invention.
  • a subject who is older may receive a larger dose (e.g., 5-10%, 10-20%, 15-30% ,20-50%, 25-50% or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% more) of the composition as compared to a younger subject.
  • a subject who is younger may receive a larger dose (e.g., 5-10%, 10-20%, 15-30%, 20-50%, 25-50% or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% more) of the composition as compared to an older subject.
  • a larger dose e.g., 5-10%, 10-20%, 15-30%, 20-50%, 25-50% or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% more
  • a subject who is female may receive a larger dose (e.g., 5-10%, 10-20%, 15-30% ,20-50%, 25- 50% or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% more) of the composition as compared to a male subject.
  • a larger dose e.g., 5-10%, 10-20%, 15-30% ,20-50%, 25- 50% or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% more
  • a subject who is male may receive a larger dose (e.g., 5-10%, 10-20%, 15-30% ,20-50%, 25-50% or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% more) of the composition as compared to a female subject
  • a larger dose e.g., 5-10%, 10-20%, 15-30% ,20-50%, 25-50% or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% more
  • the doses of AAV vectors for delivering siRNA duplexes of the present invention may be adapted depending on the disease condition, the subject and the treatment strategy.
  • delivery of compositions in accordance with the present invention to cells may comprise a total concentration per subject between about 1x10 6 VG and about 1x10 16 VG.
  • delivery may comprise a composition concentration of about 1x10 6 , 2x10 6 , 3x10 6 , 4x10 6 , 5x10 6 , 6x10 6 , 7x10 6 , 8x10 6 , 9x10 6 , 1x10 7 , 2x10 7 , 3x10 7 , 4x10 7 , 5x10 7 , 6x10 7 , 7x10 7 , 8x10 7 , 9x10 7 , 1x10 8 , 2x10 8 , 3x10 8 , 4x10 8 , 5x10 8 , 6x10 8 , 7x10 8 , 8x10 8 , 9x10 8 , 1x10 9 , 2x10 9 , 3x10 9 , 4x10 9 , 5x10 9 , 6x10 8 , 7x10 8 , 8
  • delivery of compositions in accordance with the present invention to cells may comprise a total concentration per subject between about 1x10 6 VG/kg and about 1x10 16 VG/kg.
  • delivery may comprise a composition concentration of about 1x10 6 , 2x10 6 , 3x10 6 , 4x10 6 , 5x10 6 , 6x10 6 , 7x10 6 , 8x10 6 , 9x10 6 , 1x10 7 , 2x10 7 , 3x10 7 , 4x10 7 , 5x10 7 , 6x10 7 , 7x10 7 , 8x10 7 , 9x10 7 , 1x10 8 , 2x10 8 , 3x10 8 , 4x10 8 , 5x10 8 , 6x10 8 , 7x10 8 , 8x10 8 , 9x10 8 , 1x10 9 , 2x10 9 , 3x10 9 , 4x10 9 , 5x10 9 , 6x10 8 , 7x10
  • about 10 5 to 10 6 viral genome (unit) may be administered per dose.
  • delivery of the compositions in accordance with the present invention to cells may comprise a total concentration between about 1x10 6 VG/mL and about 1x10 16 VG/mL.
  • delivery may comprise a composition concentration of about 1x10 6 , 2x10 6 , 3x10 6 , 4x10 6 , 5x10 6 , 6x10 6 , 7x10 6 , 8x10 6 , 9x10 6 , 1x10 7 , 2x10 7 , 3x10 7 , 4x10 7 , 5x10 7 , 6x10 7 , 7x10 7 , 8x10 7 , 9x10 7 , 1x10 8 , 2x10 8 , 3x10 8 , 4x10 8 , 5x10 8 , 6x10 8 , 7x10 8 , 8x10 8 , 9x10 8 , 1x10 9 , 2x10 9 , 3x10 9 , 4x10 9 , 5x10 6 , 6x10 8 , 7x
  • the desired siRNA duplex dosage may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations).
  • multiple administrations e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations.
  • split dosing regimens such as those described herein may be used.
  • a“split dose” is the division of single unit dose or total daily dose into two or more doses, e.g., two or more administrations of the single unit dose.
  • a“single unit dose” is a dose of any modulatory polynucleotide therapeutic administered in one dose/at one time/single route/single point of contact, i.e., single administration event.
  • a“total daily dose” is an amount given or prescribed in a 24 hour period. It may be administered as a single unit dose.
  • the viral vectors comprising the modulatory polynucleotides of the present invention are administered to a subject in split doses. They may be formulated in buffer only or in a formulation described herein.
  • the dose, concentration and/or volume of the composition described herein may be adjusted depending on the contribution of the caudate or putamen to cortical and subcortical distribution after administration.
  • the administration may be
  • intracerebroventricular, intraputamenal, intrathalamic,intraparenchymal, subpial, and/or intrathecal administration are intracerebroventricular, intraputamenal, intrathalamic,intraparenchymal, subpial, and/or intrathecal administration.
  • the dose, concentration and/or volume of the composition described herein may be adjusted depending on the cortical and neuraxial distribution following administration by intracerebroventricular, intraputamenal, intrathalamic, intraparenchymal, subpial, and/or intrathecal delivery.
  • the present invention are methods for introducing the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention into cells, the method comprising introducing into said cells any of the vectors in an amount sufficient for degradation of target HTT mRNA to occur, thereby activating target- specific RNAi in the cells.
  • the cells may be stem cells, neurons such as medium spiny or cortical neurons, muscle cells and glial cells such as astrocytes.
  • the method optionally comprises administering to the subject a therapeutically effective amount of a composition comprising at least vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention.
  • a composition comprising at least vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention.
  • the siRNA molecules can silence HTT gene expression, inhibit HTT protein production, and reduce one or more symptoms of HD in the subject such that HD is therapeutically treated.
  • the composition comprising the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention is administered to the central nervous system of the subject.
  • the composition comprising the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention is administered to a tissue of a subject (e.g., brain of the subject).
  • composition comprising the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention is administered to the central nervous system of the subject via intraparenchymal injection.
  • vectors e.g., AAV vectors
  • a nucleic acid sequence encoding the siRNA molecules of the present invention is administered to the central nervous system of the subject via intraparenchymal injection.
  • composition comprising the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention is administered to the central nervous system of the subject via intraparenchymal injection and intrathecal injection.
  • vectors e.g., AAV vectors
  • a nucleic acid sequence encoding the siRNA molecules of the present invention is administered to the central nervous system of the subject via intraparenchymal injection and intrathecal injection.
  • the composition comprising the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention is administered to the central nervous system of the subject via intraparenchymal injection and intracerebroventricular injection.
  • the vectors e.g., AAV vectors
  • a nucleic acid sequence encoding the siRNA molecules of the present invention is administered to the central nervous system of the subject via intraparenchymal injection and intracerebroventricular injection.
  • the vectors e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be delivered into specific types of targeted cells, including, but not limited to, neurons including medium spiny or cortical neurons; glial cells including oligodendrocytes, astrocytes and microglia; and/or other cells surrounding neurons such as T cells.
  • AAV vectors comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be delivered into specific types of targeted cells, including, but not limited to, neurons including medium spiny or cortical neurons; glial cells including oligodendrocytes, astrocytes and microglia; and/or other cells surrounding neurons such as T cells.
  • the vectors e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be delivered to neurons in the striatum and/or neurons of the cortex.
  • the vectors e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be used as a therapy for HD.
  • the vectors, e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be used to suppress HTT protein in neurons and/or astrocytes of the striatum and/or the cortex.
  • the suppression of HTT protein is in medium spiny neurons of the striatum and/or neurons of the cortex.
  • the vectors e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be used to suppress HTT protein in neurons and/or astrocytes of the striatum and/or the cortex and reduce associated neuronal toxicity.
  • the suppression of HTT protein in the neurons and/or astrocytes of the striatum and/or the cortex may be, independently, suppressed by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5- 70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10- 45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15
  • the reduction of associated neuronal toxicity may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5- 50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10- 80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-3
  • the vectors e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be used to reduce the cognitive and/or motor decline of a subject with HD, where the amount of decline is determined by a standard evaluation system such as, but not limited to, Unified Huntington’s Disease Ratings Scale (UHDRS) and subscores, and cognitive testing.
  • UHDRS Unified Huntington’s Disease Ratings Scale
  • subscores e.g., cognitive testing.
  • the vectors e.g., AAV vectors, comprising a nucleic acid sequence encoding the siRNA molecules of the present invention may be used to reduce the decline of functional capacity and activities of daily living as measured by a standard evaluation system such as, but not limited to, the total functional capacity (TFC) scale.
  • TFC total functional capacity
  • the present composition is administered as a solo therapeutic or combination therapeutics for the treatment of HD.
  • the vectors e.g., AAV vectors, encoding siRNA duplexes targeting the HTT gene may be used in combination with one or more other therapeutic agents.
  • AAV vectors encoding siRNA duplexes targeting the HTT gene
  • Compositions can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and/or on a time schedule determined for that agent.
  • Therapeutic agents that may be used in combination with the vectors e.g., AAV vectors, encoding the nucleic acid sequence for the siRNA molecules of the present invention can be small molecule compounds which are antioxidants, anti-inflammatory agents, anti- apoptosis agents, calcium regulators, antiglutamatergic agents, structural protein inhibitors, compounds involved in muscle function, and compounds involved in metal ion regulation.
  • Compounds tested for treating HD which may be used in combination with the vectors described herein include, but are not limited to, dopamine-depleting agents (e.g., tetrabenazine for chorea), benzodiazepines (e.g., clonazepam for myoclonus, chorea, dystonia, rigidity, and/or spasticity), anticonvulsants (e.g., sodium valproate and levetiracetam for myoclonus), amino acid precursors of dopamine (e.g., levodopa for rigidity which is particularly associate with juvenile HD or young adult-onset parkinsonian phenotype), skeletal muscle relaxants (e.g., baclofen, tizanidine for rigidity and/or spasticity), inhibitors for acetycholine release at the neuromuscular junction to cause muscle paralysis (e.g., botulinum toxin for bruxism and/or dystonia),
  • carbamazepine for mania or hypomania carbamazepine for mania or hypomania
  • mood stabilizers e.g., lithium for mania or hypomania
  • Neurotrophic factors may be used in combination therapy with the vectors, e.g., AAV vectors, encoding the nucleic acid sequence for the siRNA molecules of the present invention for treating HD.
  • a neurotrophic factor is defined as a substance that promotes survival, growth, differentiation, proliferation and /or maturation of a neuron, or stimulates increased activity of a neuron.
  • the present methods further comprise delivery of one or more trophic factors into the subject in need of treatment.
  • Trophic factors may include, but are not limited to, IGF-I, GDNF, BDNF, CTNF, VEGF, Colivelin, Xaliproden, Thyrotrophin- releasing hormone and ADNF, and variants thereof.
  • the vector e.g., AAV vector
  • encoding the nucleic acid sequence for the at least one siRNA duplex targeting the HTT gene may be co-administered with AAV vectors expressing neurotrophic factors such as AAV-IGF-I (See e.g., Vincent et al., Neuromolecular medicine, 2004, 6, 79-85; the content of which is incorporated herein by reference in its entirety) and AAV-GDNF (See e.g., Wang et al., J Neurosci., 2002, 22, 6920-6928; the content of which is incorporated herein by reference in its entirety).
  • AAV-IGF-I See e.g., Vincent et al., Neuromolecular medicine, 2004, 6, 79-85; the content of which is incorporated herein by reference in its entirety
  • AAV-GDNF See e.g., Wang et al., J Neurosci., 2002, 22, 6920-6928; the content of which is incorporated
  • composition of the present invention for treating HD is administered to the subject in need intravenously, intramuscularly, subcutaneously,
  • the method includes administering (e.g., intraparenchymal administration, subpial administration, intraventricular administration and/or intrathecal administration) directly to the central nervous system (CNS) of a subject (using, e.g., an infusion pump and/or a delivery scaffold) a therapeutically effective amount of a composition comprising vectors, e.g., AAV vectors, encoding the nucleic acid sequence for the siRNA molecules of the present invention.
  • the vectors may be used to silence or suppress HTT gene expression, and/or reducing one or more symptoms of HD in the subject such that HD is therapeutically treated.
  • composition of the present invention for treating HD is administered to the subject in need by intraparenchymal administration.
  • the symptoms of HD include behavioral difficulties and symptoms such as, but not limited to, apathy or lack of initiative, dysphoria, irritability, agitation or anxiety, poor self-care, poor judgment, inflexibility, disinhibition, depression, suicidal ideation euphoria, aggression, delusions, compulsions, hypersexuality, hallucinations, speech deterioration, slurred speech, difficulty swallowing, weight loss, cognitive dysfunction which impairs executive functions (e.g., organizing, planning, checking or adapting alternatives, and delays in the acquisition of new motor skills), unsteady gait and involuntary movements (chorea).
  • the composition of the present invention is applied to one or both of the brain and the spinal cord.
  • the survival of the subject is prolonged by treating any of the symptoms of HD described herein.
  • administration of the vectors, e.g., AAV vectors encoding a siRNA of the invention, to a subject may lower HTT (e.g., mutant and/or wild-type HTT) in a subject.
  • administration of the vectors, e.g., AAV vectors, to a subject may lower wild- type HTT in a subject.
  • administration of the vectors, e.g., AAV vectors, to a subject may lower mutant HTT in a subject.
  • administration of the vectors, e.g., AAV vectors, to a subject may lower both mutant HTT and wild-type HTT in a subject.
  • the mutant and/or wild-type HTT may be lowered by about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20- 70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30- 90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50- 60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60- 100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100% in a subject such as, but not limited to, the CNS, a region of the CNS, or a specific cell of the CNS
  • the vectors, e.g., AAV vectors may lower the expression of HTT by at least 50% in the medium spiny neurons.
  • the vectors, e.g., AAV vectors may lower the expression of HTT by at least 40% in the medium spiny neurons.
  • the vectors, e.g., AAV vectors may lower the expression of HTT by at least 40% in the medium spiny neurons of the putamen.
  • the vectors, e.g., AAV vectors may lower the expression of HTT by at least 30% in the medium spiny neurons of the putamen.
  • the vectors may lower the expression of HTT by at least 30% in the putamen.
  • the vectors, e.g., AAV vectors may lower the expression of HTT in the putamen and cortex by at least 40%.
  • the vectors, e.g., AAV vectors may lower the expression of HTT in the putamen and cortex by at least 30%.
  • the vectors, e.g., AAV vectors may lower the expression of HTT in the putamen by at least 30% and in the cortex by at least 15%.
  • administering will reduce the expression of HTT in a subject and the reduction of expression of the HTT will reduce the effects of HD in a subject.
  • the vectors may be administered to a subject who has undergone biomarker assessment.
  • biomarkers in blood for premanifest and early progression of HD include, but are not limited to, 8-OHdG oxidative stress marker, metabolic markers (e.g., creatine kinase, branched-chain amino acids), cholesterol metabolites (e.g., 24-OH cholesterol), immune and inflammatory proteins (e.g., clusterin, complement components, interleukins 6 and 8), gene expression changes (e.g., transcriptomic markers), endocrine markers (e.g., cortisol, ghrelin and leptin), BDNF, adenosine 2A receptors.
  • metabolic markers e.g., creatine kinase, branched-chain amino acids
  • cholesterol metabolites e.g., 24-OH cholesterol
  • immune and inflammatory proteins e.g., clusterin, complement components, interleukins 6 and 8
  • gene expression changes e.g., transcriptomic
  • Potential biomarkers for brain imaging for premanifest and early progression of HD include, but are not limited to, striatal volume, subcortical white-matter volume, cortical thickness, whole brain and ventricular volumes, functional imaging (e.g., functional MRI), PET (e.g., with
  • biomarkers for quantitative clinical tools for premanifest and early progression of HD include, but are not limited to, quantitative motor assessments, motor physiological assessments (e.g., transcranial magnetic stimulation), and quantitative eye movement measurements.
  • quantitative clinical biomarker assessments include tongue force variability, metronome-guided tapping, grip force, oculomotor assessments and cognitive tests.
  • multicenter observational studies include PREDICT-HD and TRACK-HD.
  • a subject may have symptoms of HD, diagnosed with HD or may be asymptomatic for HD.
  • the vectors may be administered to a subject who has undergone biomarker assessment using neuroimaging.
  • a subject may have symptoms of HD, diagnosed with HD or may be asymptomatic for HD.
  • the vectors, e.g., AAV vectors may be administered to a subject who is asymptomatic for HD.
  • a subject may be asymptomatic but may have undergone predictive genetic testing or biomarker assessment to determine if they are at risk for HD and/or a subject may have a family member (e.g., mother, father, brother, sister, aunt, uncle, grandparent) who has been diagnosed with HD.
  • the vectors may be administered to a subject who is in the early stages of HD.
  • a subject In the early stage a subject has subtle changes in coordination, some involuntary movements (chorea), changes in mood such as irritability and depression, problem solving difficulties, reduction in the ability of a person to function in their normal day to day life.
  • chorea involuntary movements
  • changes in mood such as irritability and depression
  • problem solving difficulties reduction in the ability of a person to function in their normal day to day life.
  • the vectors may be administered to a subject who is in the middle stages of HD.
  • a subject In the middle stage a subject has an increase in the movement disorder, diminished speech, difficulty swallowing, and ordinary activities will become harder to do.
  • a subject may have occupational and physical therapists to help maintain control of voluntary movements and a subject may have a speech language pathologist.
  • the vectors may be administered to a subject who is in the late stages of HD.
  • a subject with HD is almost completely or completely dependent on others for care as the subject can no longer walk and is unable to speak.
  • a subject can generally still comprehend language and is aware of family and friends but choking is a major concern.
  • the vectors may be used to treat a subject who has the juvenile form of HD which is the onset of HD before the age of 20 years and as early as 2 years.
  • the vectors may be used to treat a subject with HD who has fully penetrant HD where the HTT gene has 41 or more CAG repeats (e.g., 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 or more than 90 CAG repeats).
  • CAG repeats e.g., 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,
  • the vectors may be used to treat a subject with HD who has incomplete penetrance where the HTT gene has between 36 and 40 CAG repeats (e.g., 36, 37, 38, 39 and 40 CAG repeats).
  • the HTT gene has between 36 and 40 CAG repeats (e.g., 36, 37, 38, 39 and 40 CAG repeats).
  • the vectors may be used to decrease HTT protein in a subject.
  • the decrease may independently be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5- 80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10- 55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%
  • a subject may have a 50% decrease of HTT protein.
  • a subject may have a decrease of 70% of HTT protein and a decrease of 10% of wild type HTT protein.
  • the decrease of HTT in the medium spiny neurons of the putamen may be about 40%.
  • the decrease of HTT in the putamen and cortex may be about 40%.
  • the decrease of HTT in the putamen maybe about 30% and in the cortex may be about 15%.
  • the decrease of HTT in the putamen and cortex may be about 40%.
  • the decrease of HTT in the medium spiny neurons of the putamen may be between 40%-70%.
  • the decrease of HTT in the putamen and cortex may be between 40%-70%.
  • the vectors may be used to decrease wild type HTT protein in a subject.
  • the decrease may independently be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5- 15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5- 75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10- 50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15
  • a subject may have a 50% decrease of wild type HTT protein.
  • the decrease of wild type HTT in the medium spiny neurons of the putamen may be about 40%.
  • the decrease of wild type HTT in the medium spiny neurons of the putamen may be about 30%.
  • the decrease of wild type HTT in the medium spiny neurons of the putamen may be about 20%.
  • the decrease of wild type HTT in the medium spiny neurons of the putamen may be about 15%.
  • the decrease of wild type HTT in the putamen and cortex may be about 40%.
  • the decrease of wild type HTT in the putamen and cortex may be about 30%. As a non-limiting example, the decrease of wild type HTT in the putamen and cortex may be about 20%. As a non-limiting example, the decrease of wild type HTT in the putamen and cortex may be about 15%. As a non-limiting example, the decrease of wild type HTT in the medium spiny neurons of the putamen may be between 40%-70%. As a non-limiting example, the decrease of wild type HTT in the medium spiny neurons of the putamen may be between 30%-70%. As a non-limiting example, the decrease of wild type HTT in the medium spiny neurons of the putamen may be between 20%-70%.
  • the decrease of wild type HTT in the medium spiny neurons of the putamen may be between 15%-70%.
  • the decrease of wild type HTT in the putamen and cortex may be between 40%-70%.
  • the decrease of wild type HTT in the medium spiny neurons of the putamen may be between 30%-70%.
  • the decrease of wild type HTT in the medium spiny neurons of the putamen may be between 20%-70%.
  • the decrease of wild type HTT in the medium spiny neurons of the putamen may be between 15%-70%.
  • the vectors may be used to decrease mutant HTT protein in a subject.
  • the decrease may independently be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%, 5- 15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5- 75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10- 50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15
  • a subject may have a 50% decrease of mutant HTT protein.
  • the decrease of mutant HTT in the medium spiny neurons of the putamen may be about 40%.
  • the decrease of mutant HTT in the medium spiny neurons of the putamen may be about 30%.
  • the decrease of mutant HTT in the medium spiny neurons of the putamen may be about 20%.
  • the decrease of mutant HTT in the medium spiny neurons of the putamen may be about 15%.
  • the decrease of mutant HTT in the putamen and cortex may be about 40%.
  • the decrease of mutant HTT in the putamen and cortex may be about 30%. As a non-limiting example, the decrease of mutant HTT in the putamen and cortex may be about 20%. As a non-limiting example, the decrease of mutant HTT in the putamen and cortex may be about 15%. As a non- limiting example, the decrease of mutant HTT in the medium spiny neurons of the putamen may be between 40%-70%. As a non-limiting example, the decrease of mutant HTT in the medium spiny neurons of the putamen may be between 30%-70%. As a non-limiting example, the decrease of mutant HTT in the medium spiny neurons of the putamen may be between 20%- 70%.
  • the decrease of mutant HTT in the medium spiny neurons of the putamen may be between 15%-70%.
  • the decrease of mutant HTT in the putamen and cortex may be between 40%-70%.
  • the decrease of mutant HTT in the medium spiny neurons of the putamen may be between 30%-70%.
  • the decrease of mutant HTT in the medium spiny neurons of the putamen may be between 20%-70%.
  • the decrease of mutant HTT in the medium spiny neurons of the putamen may be between 15%-70%.
  • the AAV vectors of the present invention may be used as a method of treating Huntington’s disease in a subject in need of treatment. Any method known in the art for defining a subject in need of treatment may be used to identify said subject(s). A subject may have a clinical diagnosis of Huntington’s disease, or may be pre-symptomatic. Any known method for diagnosing HD may be utilized, including, but not limited to, cognitive assessments and/or neurological or neuropsychiatric examinations, motor tests, sensory tests, psychiatric evaluations, brain imaging, family history and/or genetic testing.
  • HD subject selection is determined with the use of the Prognostic Index for Huntington’s Disease, or a derivative thereof (Long JD et al., Movement Disorders, 2017, 32(2), 256-263, the contents of which are herein incorporated by reference in their entirety).
  • This prognostic index uses four components to predict probability of motor diagnosis, (1) total motor score (TMS) from the Unified Huntington’s Disease Rating Scale (UHDRS), (2) Symbol Digit Modality Test (SDMT), (3) base-line age, and (4) cytosine-adenine-guanine (CAG) expansion.
  • TMS total motor score
  • UHDRS Unified Huntington’s Disease Rating Scale
  • SDMT Symbol Digit Modality Test
  • CAG cytosine-adenine-guanine
  • the prognostic index may be used to identify subjects whom will develop symptoms of HD within several years, but that do not yet have clinically diagnosable symptoms. Further, these asymptomatic patients may be selected for and receive treatment using the AAV vectors and compositions of the present invention during the asymptomatic period. V. DEFINITIONS
  • nucleic acid refers to any nucleic acid polymers composed of either polydeoxyribonucleotides (containing 2-deoxy-D- ribose), or polyribonucleotides (containing D-ribose), or any other type of polynucleotide which is an N glycoside of a purine or pyrimidine base, or modified purine or pyrimidine bases.
  • polynucleic acid refers only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single stranded RNA.
  • RNA or“RNA molecule” or“ribonucleic acid molecule” refers to a polymer of ribonucleotides; the term“DNA” or“DNA molecule” or
  • deoxyribonucleic acid molecule refers to a polymer of deoxyribonucleotides.
  • DNA and RNA can be synthesized naturally, e.g., by DNA replication and transcription of DNA, respectively; or be chemically synthesized.
  • DNA and RNA can be single-stranded (i.e., ssRNA or ssDNA, respectively) or multi-stranded (e.g., double stranded, i.e., dsRNA and dsDNA, respectively).
  • mRNA or“messenger RNA”, as used herein, refers to a single stranded RNA that encodes the amino acid sequence of one or more polypeptide chains.
  • RNA interfering refers to a sequence specific regulatory mechanism mediated by RNA molecules which results in the inhibition or interfering or“silencing” of the expression of a corresponding protein-coding gene.
  • RNAi has been observed in many types of organisms, including plants, animals and fungi. RNAi occurs in cells naturally to remove foreign RNAs (e.g., viral RNAs). Natural RNAi proceeds via fragments cleaved from free dsRNA which direct the degradative mechanism to other similar RNA sequences.
  • RNAi is controlled by the RNA-induced silencing complex (RISC) and is initiated by short/small dsRNA molecules in cell cytoplasm, where they interact with the catalytic RISC component argonaute.
  • RISC RNA-induced silencing complex
  • the dsRNA molecules can be introduced into cells exogenously.
  • Exogenous dsRNA initiates RNAi by activating the ribonuclease protein Dicer, which binds and cleaves dsRNAs to produce double-stranded fragments of 21-25 base pairs with a few unpaired overhang bases on each end. These short double stranded fragments are called small interfering RNAs (siRNAs).
  • siRNAs small interfering RNAs
  • RNA molecules or RNA analog
  • RNA molecules or RNA analogs
  • RNA molecules or RNA analogs
  • RNAi RNA molecules comprising between about 5-60 nucleotides (or nucleotide analogs) which is capable of directing or mediating RNAi.
  • a siRNA molecule comprises between about 15-30 nucleotides or nucleotide analogs, such as between about 16-25 nucleotides (or nucleotide analogs), between about 18-23 nucleotides (or nucleotide analogs), between about 19-22 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21 or 22 nucleotides or nucleotide analogs), between about 19-25 nucleotides (or nucleotide analogs), and between about 19-24 nucleotides (or nucleotide analogs).
  • nucleotides or nucleotide analogs such as between about 16-25 nucleotides (or nucleotide analogs), between about 18-23 nucleotides (or nucleotide analogs), between about 19-22 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21 or 22 nucleotides or nucleotide analogs), between about 19-25 nu
  • siRNA refers to a siRNA comprising 5-23 nucleotides, preferably 21 nucleotides (or nucleotide analogs), for example, 19, 20, 21 or 22 nucleotides.
  • the term“long” siRNA refers to a siRNA comprising 24- 60 nucleotides, preferably about 24-25 nucleotides, for example, 23, 24, 25 or 26 nucleotides. Short siRNAs may, in some instances, include fewer than 19 nucleotides, e.g., 16, 17 or 18 nucleotides, or as few as 5 nucleotides, provided that the shorter siRNA retains the ability to mediate RNAi.
  • siRNAs may, in some instances, include more than 26 nucleotides, e.g., 27, 28, 29, 30, 35, 40, 45, 50, 55, or even 60 nucleotides, provided that the longer siRNA retains the ability to mediate RNAi or translational repression absent further processing, e.g., enzymatic processing, to a short siRNA.
  • siRNAs can be single stranded RNA molecules (ss-siRNAs) or double stranded RNA molecules (ds-siRNAs) comprising a sense strand and an antisense strand which hybridized to form a duplex structure called siRNA duplex.
  • the term“the antisense strand” or“the first strand” or“the guide strand” of a siRNA molecule refers to a strand that is substantially complementary to a section of about 10-50 nucleotides, e.g., about 15-30, 16-25, 18-23 or 19-22 nucleotides of the mRNA of the gene targeted for silencing.
  • the antisense strand or first strand has sequence sufficiently complementary to the desired target mRNA sequence to direct target-specific silencing, e.g., complementarity sufficient to trigger the destruction of the desired target mRNA by the RNAi machinery or process.
  • the term“the sense strand” or“the second strand” or“the passenger strand” of a siRNA molecule refers to a strand that is complementary to the antisense strand or first strand.
  • the antisense and sense strands of a siRNA molecule are hybridized to form a duplex structure.
  • a“siRNA duplex” includes a siRNA strand having sufficient complementarity to a section of about 10-50 nucleotides of the mRNA of the gene targeted for silencing and a siRNA strand having sufficient complementarity to form a duplex with the other siRNA strand.
  • the term“complementary” refers to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can form base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes.
  • Watson-Crick manner e.g., A to T, A to U, C to G
  • uracil rather than thymine is the base that is considered to be complementary to adenosine.
  • a U is denoted in the context of the present invention, the ability to substitute a T is implied, unless otherwise stated. Perfect
  • complementarity or 100% complementarity refers to the situation in which each nucleotide unit of one polynucleotide strand can form hydrogen bond with a nucleotide unit of a second polynucleotide strand.
  • Less than perfect complementarity refers to the situation in which some, but not all, nucleotide units of two strands can form hydrogen bond with each other. For example, for two 20-mers, if only two base pairs on each strand can form hydrogen bond with each other, the polynucleotide strands exhibit 10% complementarity. In the same example, if 18 base pairs on each strand can form hydrogen bonds with each other, the polynucleotide strands exhibit 90% complementarity.
  • the term“substantially complementary” means that the siRNA has a sequence (e.g., in the antisense strand) which is sufficient to bind the desired target mRNA, and to trigger the RNA silencing of the target mRNA.
  • targeting means the process of design and selection of nucleic acid sequence that will hybridize to a target nucleic acid and induce a desired effect.
  • gene expression refers to the process by which a nucleic acid sequence undergoes successful transcription and in most instances translation to produce a protein or peptide.
  • measurement of“gene expression” this should be understood to mean that measurements may be of the nucleic acid product of transcription, e.g., RNA or mRNA or of the amino acid product of translation, e.g., polypeptides or peptides.
  • RNA, mRNA, polypeptides and peptides are well known in the art.
  • mutation refers to any changing of the structure of a gene, resulting in a variant (also called“mutant”) form that may be transmitted to subsequent generations. Mutations in a gene may be caused by the alternation of single base in DNA, or the deletion, insertion, or rearrangement of larger sections of genes or chromosomes.
  • the term“vector” means any molecule or moiety which transports, transduces or otherwise acts as a carrier of a heterologous molecule such as the siRNA molecule of the invention.
  • A“viral vector” is a vector which comprises one or more polynucleotide regions encoding or comprising a molecule of interest, e.g., a transgene, a polynucleotide encoding a polypeptide or multi-polypeptide or a modulatory nucleic acid such as small interfering RNA (siRNA).
  • Viral vectors are commonly used to deliver genetic materials into cells. Viral vectors are often modified for specific applications. Types of viral vectors include retroviral vectors, lentiviral vectors, adenoviral vectors and adeno-associated viral vectors.
  • AAV vector refers to any vector which comprises or derives from components of an adeno-associated vector and is suitable to infect mammalian cells, preferably human cells.
  • AAV vector typically designates an AAV type viral particle or virion comprising a nucleic acid molecule encoding a siRNA duplex.
  • the AAV vector may be derived from various serotypes, including combinations of serotypes (i.e.,“pseudotyped” AAV) or from various genomes (e.g., single stranded or self- complementary).
  • the AAV vector may be replication defective and/or targeted.
  • the phrase“inhibit expression of a gene” means to cause a reduction in the amount of an expression product of the gene.
  • the expression product can be a RNA molecule transcribed from the gene (e.g., an mRNA) or a polypeptide translated from an mRNA transcribed from the gene.
  • a reduction in the level of an mRNA results in a reduction in the level of a polypeptide translated therefrom.
  • the level of expression may be determined using standard techniques for measuring mRNA or protein.
  • in vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).
  • the term“in vivo” refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof).
  • the term“modified” refers to a changed state or structure of a molecule of the invention. Molecules may be modified in many ways including chemically, structurally, and functionally.
  • the term“synthetic” means produced, prepared, and/or manufactured by the hand of man. Synthesis of polynucleotides or polypeptides or other molecules of the present invention may be chemical or enzymatic.
  • transfection refers to methods to introduce exogenous nucleic acids into a cell. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures.
  • the list of agents that can be transfected into a cell is large and includes, but is not limited to, siRNA, sense and/or anti-sense sequences, DNA encoding one or more genes and organized into an expression plasmid, proteins, protein fragments, and more.
  • off target refers to any unintended effect on any one or more target, gene, or cellular transcript.
  • phrase“pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or
  • an effective amount of an agent is that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an“effective amount” depends upon the context in which it is being applied.
  • an effective amount of an agent is, for example, an amount sufficient to achieve treatment, as defined herein, of HD, as compared to the response obtained without administration of the agent.
  • the term“therapeutically effective amount” means an amount of an agent to be delivered (e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and/or condition, to treat, improve symptoms of, diagnose, prevent, and/or delay the onset of the infection, disease, disorder, and/or condition.
  • an agent to be delivered e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.
  • the term“subject” or“patient” refers to any organism to which a composition in accordance with the invention may be administered, e.g., for experimental, diagnostic, prophylactic, and/or therapeutic purposes.
  • Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates such as chimpanzees and other apes and monkey species, and humans) and/or plants.
  • preventing refers to delaying or forestalling the onset, development or progression of a condition or disease for a period of time, including weeks, months, or years.
  • treatment refers to the application of one or more specific procedures used for the cure or amelioration of a disease.
  • the specific procedure is the administration of one or more pharmaceutical agents.
  • the specific procedure is the administration of one or more siRNA molecules.
  • amelioration or“ameliorating” refers to a lessening of severity of at least one indicator of a condition or disease.
  • amelioration includes the reduction of neuron loss.
  • administering refers to providing a pharmaceutical agent or composition to a subject.
  • neurodegeneration refers to a pathologic state which results in neural cell death.
  • a large number of neurological disorders share neurodegeneration as a common pathological state.
  • Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis (ALS) all cause chronic neurodegeneration, which is characterized by a slow, progressive neural cell death over a period of several years
  • acute neurodegeneration is characterized by a sudden onset of neural cell death as a result of ischemia, such as stroke, or trauma, such as traumatic brain injury, or as a result of axonal transection by demyelination or trauma caused, for example, by spinal cord injury or multiple sclerosis.
  • ischemia such as stroke
  • trauma such as traumatic brain injury
  • one type of neuronal cell is degenerative, for example, medium spiny neuron degeneration in early HD.
  • articles such as“a,”“an,” and“the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include“or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context.
  • the invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process.
  • the invention includes embodiments in which more than one, or the entire group members are present in, employed in, or otherwise relevant to a given product or process.
  • any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Since such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the compositions of the invention (e.g., any antibiotic, therapeutic or active ingredient; any method of production; any method of use; etc.) can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art. [00612] It is to be understood that the words which have been used are words of description rather than limitation, and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the invention in its broader aspects.
  • the AAV-miRNA expression vectors were transfected into HEK293T and HeLa cells. mCherry-treated cells and untreated cells were also evaluated. After 48 hours, the relative HTT mRNA expression was determined. The relative HTT mRNA expression was obtained by normalizing the HTT mRNA level to the housekeeping gene mRNA level; this normalized HTT mRNA level was then expressed relative to the normalized HTT mRNA level in mCherry-treated and/or untreated cells, as determined by qRT-PCR. The results are shown in Tables 12-14.
  • AAV2- miRNA expression vectors were packaged in AAV2 (referred to as AAV2- miRNA expression vectors) or mCherry vectors were packaged in AAV2, for infection of HEK293T and HeLa cells. Untreated cells were also evaluated.
  • the AAV2 particles were used to infected HEK293T cells at a MOI of 1E4 or 1E5 vg/cell, and HeLa cells at a MOI of 1E5 vg/cell.
  • the relative expression of HTT was determined in HeLa cells at 24 hours after AAV- miRNA expression vector infection.
  • the relative HTT mRNA expression was obtained by normalizing the HTT mRNA level to the housekeeping gene mRNA level; this normalized HTT mRNA level was then expressed relative to the normalized HTT mRNA level in mCherry-treated and/or untreated cells, as determined by qRT-PCR.
  • the results are shown in Tables 15-18.
  • the infection of HeLa cells was at a MOI of 1E5 vg/cell (Tables 15-17) or at a MOI of 1E4 vg/cell (Table 18).
  • the relative expression of HTT was determined in HEK293T cells at 24 hours after AAV-miRNA expression vector infection.
  • the relative HTT mRNA expression was obtained by normalizing the HTT mRNA level to the housekeeping gene mRNA level; this normalized HTT mRNA level was then expressed relative to the normalized HTT mRNA level in mCherry-treated and/or untreated cells, as determined by qRT-PCR.
  • the results are shown in Tables 15, 17 and 18.
  • the infection of HEK293T cells was at a MOI of 1E5 vg/cell (Tables 15 and 17) or at a MOI of 1E4 vg/cell (Table 18).
  • VOYHTmiR-127.016 provided a relative HTT mRNA level of 0.3- 0.4; VOYHTmiR-127.218, VOYHTmiR-102.016, VOYHTmiR-109.016, VOYHTmiR-127.372, and VOYHTmiR-127.257 provided a relative HTT mRNA level of 0.41-0.5; VOYHTmiR- 104.016, VOYHTmiR-127.425, VOYHTmiR-104.425, VOYHTmiR-114.016, and VOYHTmiR- 127.907 provided a relative HTT mRNA level of 0.51-0.6; VOYHTmiR-116.016, VOYHTmiR- 102.425, VOYHTmiR-102.907, VOYHTmiR-102.257, VOYHTmiR-104.907, and VOYHTmiR-
  • VOYHTmiR-102.218, VOYHTmiR-114.372, VOYHTmiR-104.257, VOYHTmiR-109.907, VOYHTmiR-109.257, and VOYHTmiR-102.372 provided a relative HTT mRNA level of 0.81- 0.9; VOYHTmiR-109.372, and VOYHTmiR-116.218 provided a relative HTT mRNA level of 0.9124 hours after infection at a MOI of 1E4 vg/cell.
  • VOYHTmiR-127.579, VOYHTmiR-104.579.10, VOYHTmiR- 104.579.3, VOYHTmiR-104.579.7, VOYHTmiR-104.579.9, VOYHTmiR-104.579.1, and VOYHTmiR-104.579 provided a relative HTT mRNA level of 0.3-0.4;
  • VOYHTmiR-114.579, VOYHTmiR-102.579, VOYHTmiR-116.579, and VOYHTmiR-127.894 provided a relative HTT mRNA level of 0.41-0.5;
  • VOYHTmiR-109.579, VOYHTmiR-109.894, and VOYHTmiR- 114.894 provided a relative HTT mRNA level of 0.51-0.6; VOYHTmiR-102.894, and
  • VOYHTmiR-104.579.5 provided a relative HTT mRNA level of 0.61-0.7; VOYHTmiR- 114.219, VOYHTmiR-116.894, VOYHTmiR-109.219.n, VOYHTmiR-102.219.n, and
  • VOYHTmiR-104.894 provided a relative HTT mRNA level of 0.71-0.8; VOYHTmiR-104.219.n provided a relative HTT mRNA level of 0.81-0.9; VOYHTmiR-127.219.n, and VOYHTmiR- 116.219.n provided a relative HTT mRNA level of 0.91-0.9524 hours after infection at a MOI of 1E5 vg/cell.
  • VOYHTmiR-127.016 provided a relative HTT mRNA level of 0.3-0.4; VOYHTmiR-127.218, VOYHTmiR-127.257, and VOYHTmiR-127.372 provided a relative HTT mRNA level of 0.41-0.5; VOYHTmiR-102.016, VOYHTmiR-127.425, VOYHTmiR- 104.016, VOYHTmiR-127.907, VOYHTmiR-116.016, and VOYHTmiR-109.016 provided a relative HTT mRNA level of 0.51-0.6; VOYHTmiR-104.425, VOYHTmiR-114.016, and VOYHTmiR-104.907 provided a relative HTT mRNA level of 0.61-0.7; VOYHTmiR-102.907, VOYHTmiR-109.425, VOYHTmiR-104.257
  • VOYHTmiR-127.016, VOYHTmiR-104.579.3, VOYHTmiR- 104.579.10, VOYHTmiR-127.218, and VOYHTmiR-127.579 provided a relative HTT mRNA level of 0.3-0.4; VOYHTmiR-127.257, VOYHTmiR-104.579.7, VOYHTmiR-127.372, VOYHTmiR-104.579, VOYHTmiR-104.579.9, and VOYHTmiR-127.425 provided a relative HTT mRNA level of 0.41-0.5; VOYHTmiR-104.579.1, VOYHTmiR-102.016, VOYHTmiR- 127.907, VOYHTmiR-104.016, VOYHTmiR-116.016, VOYHTmiR-109.016, and VOYHTmiR- 127
  • AAV-miRNA expression vectors were packaged in AAV2, and infected into human normal primary astrocytes NHA (Lonza) (cultured in AGM TM Astrocyte Growth
  • human astrocyte cell line U251MG (Sigma Cat#09063001- 1VL) (cultured in DMEM/F-12 containing 2mM GLUAMAX TM supplement, 1x MEM Non- Essential Amino Acids Solution, 10mM HEPES and 10% FBS, 2ng/ml human FGF-2 and 5ug/ml human insulin, all reagents from Life Technologies), neuronally differentiated SH-SY5Y cells (Sigma Cat#94030304) (cultured in DMEM/F-12 containing 2mM GLUAMAX TM supplement, 1x MEM Non-Essential Amino Acids Solution, 10mM HEPES and 10% FBS, 2ng/ml human FGF-2 and 5ug/ml human insulin, all reagents from Life Technologies) and/or human HD primary fibroblasts (Coriell Institute Cat# GM21756) (cultured in DMEM/F-12 containing 2mM GLUAMAX TM supplement, 1x MEM Non- Essential Am
  • a control of mCherry was also evaluated.
  • NHA fibroblasts and U251MG the cells were plated into 96-well plates (1-2E4 cells/well in 200 ul cell culture medium) and infected in triplicate with AAV-miRNA expression vectors or the control mCherry vector packaged in AAV2.
  • the SH-SY5Y cells were plated into 96-well plates (1E4 cells/well in 200ul cell culture medium) that were double coated with 0.1 ug/ml Poly-D-lysine and 15ug/ml laminin, induced for neuronal differentiation in differentiation medium for 4 days, and then infected in triplicate with AAV2-miRNA expression vectors.
  • the AAV2-miRNA expression vectors were infected at a MOI of 1E5 or 1E6 vg/cell.24-48 hours after infection, the cells were harvested for immediate cell lysis and qRT-PCR.
  • HTT mRNA 24 hours after infection at a MOI of 1E5 vg/cell was determined by qRT-PCR for the normal human primary astrocytes, human astrocyte cell line U251MG, SH-SY5Y differentiated neurons, and human HD primary fibroblasts.
  • the relative HTT mRNA expression was obtained by normalizing the HTT mRNA level to the housekeeping gene mRNA level as determined by qRT-PCR; this normalized HTT mRNA level was then expressed relative to the normalized HTT mRNA level in mCherry-treated cells. The results are shown in Table 19.
  • VOYHTmiR-102.016 and VOYHTmiR-127.016 caused about 30-40% silencing of HTT mRNA 24 hours after infection at a MOI of 1E5 vg/cell.
  • VOYHTmiR-127.579, VOYHTmiR- 102.907, VOYHTmiR-102.257, VOYHTmiR-109.016, VOYHTmiR-109.218, VOYHTmiR- 114.016, VOYHTmiR-127.425 and VOYHTmiR-127.257 cause about 30-40 % silencing; VOYHTmiR-102.016, VOYHTmiR-127.372, VOYHTmiR-116.016 and VOYHTmiR-127.907 cause 41-50 % silencing; VOYHTmiR-127.218 causes 51-60 % silencing; and VOYHTmiR- 127.016 causes 61-70 % silencing of HTT mRNA 24 hours after infection at a MOI of 1E5 vg/cell.
  • VOYHTmiR-127.257 cause about 41-50 % silencing; and VOYHTmiR-127.016 and
  • VOYHTmiR-127.218 cause about 51-60 % silencing of Htt mRNA 24 hours after infection at a MOI of 1E5 vg/cell.
  • VOYHTmiR-116.894, VOYHT-miR-127.579, VOYHTmiR- 127.016, VOYHTmiR-127.214, VOYHTmiR-127.218, VOYHTmiR-127.907 and VOYHTmiR- 127.257 cause about 30-40 % silencing of Htt mRNA 24 hours after infection at a MOI of 1E5 vg/cell.
  • the relative HTT mRNA expression was obtained by normalizing the HTT mRNA level to the housekeeping gene mRNA level as determined by qRT-PCR; this normalized HTT mRNA level was then expressed relative to the normalized HTT mRNA level in mCherry-treated cells. The results are shown in Table 20.
  • VOYHTmiR-109.894 VOYHTmiR-109.579, VOYHTmiR-114.894, VOYHTmiR-104.425, VOYHTmiR-104.257, VOYHTmiR-109.016, VOYHTmiR-109.372, VOYHTmiR-109.425, VOYHTmiR-114.372, VOYHTmiR-127.425 cause about 41-50 % silencing; VOYHTmiR- 104.579, VOYHTmiR-114.579, VOYHTmiR-127.894, VOYHTmiR-127.579, VOYHTmiR- 102.016, VOYHTmiR-104.016, VOYHTmiR-114.016, VOYHTmiR-116.016, VOYHTmiR- 127.372, VOYHTmiR-127.907 cause about 51-60 % silencing; and VOY
  • HTT mRNA 36 hours after infection, the relative expression of HTT mRNA was determined by qRT-PCR for the human astrocyte cell line U251MG, and neuronally differentiated SH-SY5Y cells at a MOI of 1E5 vg/cell. Relative HTT mRNA expression was determined by normalization of HTT mRNA to a housekeeping mRNA, and further normalization to the mCherry-treated cells; the results are shown in Table 21.
  • VOYHTmiR-104.579.2 causes about 30-40 % silencing; VOYHTmiR-104.579.1 and VOYHTmiR-104.579.9 cause about 51-60 % silencing; VOYHTmiR-104.579, and VOYHTmiR-104.579.7 cause about 61-70% silencing; and VOYHTmiR-104.579.3, and VOYHTmiR-104.579.10 cause about 71-80 % silencing of Htt mRNA 36 hours after infection at a MOI of 1E5 vg/cell.
  • VOYHTmiR-104.579.5 and VOYHTmiR- 104.579.9 cause about 30-40 % silencing; VOYHTmiR-104.579.1 and VOYHTmiR-104.579 cause about 41-50 % silencing; and VOYHTmiR-104.579.7, VOYHTmiR-104.579.3 and VOYHTmiR-104.579.10 cause about 51-65% silencing of Htt mRNA 36 hours after infection at a MOI of 1E5 vg/cell.
  • VOYHTmiR-104.579.1 cause about 41-50 % silencing; and VOYHTmiR-104.579.7,
  • VOYHTmiR-104.579.3, and VOYHTmiR-104.579.10 cause about 51-65 % silencing of Htt mRNA 36 hours after infection at a MOI of 1E6/cell.
  • HTT mRNA expression 40 hours after infection, the relative expression of HTT mRNA was determined by qRT-PCR in the human astrocyte cell line U251MG, and neuronally differentiated SH-SY5Y cells at a MOI of 1E6 vg/cell. Relative HTT mRNA expression was determined by normalization of HTT mRNA to a housekeeping mRNA, and further normalization to the mCherry-treated cells; the results are shown in Table 23.
  • VOYHTmiR-102.214, VOYHTmiR- 104.016, VOYHTmiR-114.016, VOYHTmiR-127.372, VOYHTmiR-127.425 and VOYHTmiR- 127.257 caused about 30-40% silencing; and VOYHTmiR-127.016 and VOYHTmiR-127.218 caused about 41-50% silencing of HTT mRNA 40 hours after infection at a MOI of 1E6 vg/cell.
  • Example 3 In Vivo YAC128 Mouse Study of HTT Suppression, Guide to Passenger Ratio and Precision of 5’ End Processing After Treatment with AAV-miRNA Vectors Produced in Mammalian Cells
  • AAV-miRNA expression vectors were packaged in AAV1 and evaluated in vivo in YAC128 mice, to quantify HTT mRNA suppression, and to assess guide to passenger ratio and the precision of 5’ end processing by deep sequencing.
  • the AAV-miRNA transgene genomes were packaged in AAV1 with a CBA promoter (AAV1.CBA.iHtt), and then the vectors were produced by triple transfection in HEK293 or HEK293T cells, purified and formulated in phosphate buffered saline (PBS) with 0.001% F-68.
  • PBS phosphate buffered saline
  • Vectors were administered to YAC128 mice 7-12 weeks of age via bilateral intrastriatal infusion at a dose of approximately 1E10 to 3E10 vg in 5 uL over 10 minutes per hemisphere.
  • a control group was treated with vehicle (PBS with 0.001% F-68). Each group comprised 4 females and 4 males. Approximately 28 days following test article administration, striatum tissue punches were collected and snap-frozen for later analysis.
  • HTT mRNA was normalized to housekeeping gene expression, and then further normalized to the vehicle group. The results are shown in Tables 24 and 25.
  • VOYHTmiR-127.579, VOYHTmiR-104.579.3, VOYHTmiR-104.579.10, VOYHTmiR-104.016 and VOYHTmiR-109.016 caused about 20-40% silencing of HTT mRNA at about 28 days after intrastriatal infusion of 1E10 to 3E10 vg per striatum.
  • Striatum tissue samples were also evaluated for pri-miRNA processing by deep sequencing to assess guide: passenger ratio, abundance of guide and passenger strands relative to the total endogenous pool of miRNAs, and precision of processing at the 5’-end of the guide strand. The results are shown in Table 26.
  • HTT sequences [00643] HTT derived oligonucleotides are synthesized and formed into duplexes as described in Table 3. The siRNA duplexes are then tested for in vitro inhibitory activity on endogenous HTT gene expression.
  • Example 5 In Vitro Evaluation of AAV-miRNA Expression Vectors Containing Guide Strands Targeting HTT and Passenger Strands
  • the guide and passenger strands of duplexes of the HTT siRNA listed in Table 3 are engineered into AAV-miRNA expression vectors and transfected into cells of the central nervous system, neuronal cell lines or non-neuronal cell lines.
  • overhang utilized in the siRNA knockdown study is a canonical dTdT for siRNA, the overhang in the constructs may comprise any dinucleotide overhang.
  • the cells used may be primary cells, cell lines, or cells derived from induced pluripotent stem cells (iPS cells).
  • iPS cells induced pluripotent stem cells
  • HTT knockdown is then measured and deep sequencing performed to quantify the exact passenger and guide strands processed from each construct administered in the expression vector.
  • a guide to passenger strand ratio is calculated.
  • the 5’-terminus of the guide strand is sequenced to determine the precision of cleavage and to determine the percent expected guide strand resulting from precise cleavage.
  • AAV-miRNA expression vectors were packaged in AAV2, and then used to infect cells of the central nervous system, neuronal cell lines or non-neuronal cell lines to analyze in vitro knockdown of HTT.
  • a mCherry construct or vehicle group is used as a negative control.
  • constructs comprising the pri-miRNA cassette and HTT siRNAs were designed and are given in Table 27.
  • the passenger and guide strands are described in the tables as well as the 5’ and 3’ Flanking Regions and the Loop region (also referred to as the linker region).
  • the“miR” component of the name of the sequence does not necessarily correspond to the sequence numbering of miRNA genes (e.g., VOYHTmiR- 102 is the name of the sequence and does not necessarily mean that miR-102 is part of the sequence).
  • the constructs comprising the pri-miRNA cassettes containing guide strands targeting HTT and passenger strands were engineered into AAV-miRNA expression vectors (either ss or sc).
  • the AAV-miRNA expression vector construct from ITR to ITR, recited 5’ to 3’ comprises a mutant or wild type ITR, a promoter (either a CMV (which includes an SV40 intron), U6, H1, CBA (which includes a CMVie enhancer, a CB promoter and an SV40 intron), the pri-miRNA cassette containing guide sequence targeting HTT and passenger sequence (from Table 3), a rabbit globin polyA and wild type ITR.
  • a promoter either a CMV (which includes an SV40 intron)
  • U6, H1, CBA which includes a CMVie enhancer, a CB promoter and an SV40 intron
  • the pri-miRNA cassette containing guide sequence targeting HTT and passenger sequence from Table
  • AAV-miRNA expression vectors are packaged in AAV1 (either as ss or sc) with a CBA promoter (AAV1.CBA.iHtt), formulated in phosphate buffered saline (PBS) with 0.001% F-68 and administered to YAC128 mice to assess efficacy.
  • AAV1 vectors are administered to YAC128 mice 7-12 weeks of age via bilateral intrastriatal infusion at a dose of approximately 1E10 to 3E10 vg in 5 uL over 10 minutes per hemisphere.
  • a control group is treated with vehicle (PBS with 0.001% F-68).
  • AAV-miRNA expression vectors are packaged in AAV1 with a CBA promoter (AAV1.CBA.iHtt), formulated in phosphate buffered saline (PBS) with 0.001% F-68 and administered to non-human primates by intraparenchymal brain infusion.
  • a control group is treated with vehicle (PBS with 0.001% F-68).
  • the relative expression of HTT mRNA, guide to passenger ratio, and the precision of 5’ end processing is determined in various tissue samples at a pre-determined time post-dosing.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Psychology (AREA)
  • Virology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
PCT/US2017/033281 2016-05-18 2017-05-18 Compositions and methods of treating huntington's disease Ceased WO2017201258A1 (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
JP2018560628A JP7220080B2 (ja) 2016-05-18 2017-05-18 ハンチントン病治療組成物及び方法
SG11201809643UA SG11201809643UA (en) 2016-05-18 2017-05-18 Compositions and methods of treating huntington's disease
BR112018073472A BR112018073472A2 (pt) 2016-05-18 2017-05-18 composições e métodos de tratamento da doença de huntington
KR1020187033504A KR102427379B1 (ko) 2016-05-18 2017-05-18 헌팅톤 질환을 치료하기 위한 조성물 및 방법
IL297576A IL297576B2 (en) 2016-05-18 2017-05-18 Compositions and methods of treating huntington's disease
AU2017268382A AU2017268382B2 (en) 2016-05-18 2017-05-18 Compositions and methods of treating Huntington's disease
MX2018014152A MX2018014152A (es) 2016-05-18 2017-05-18 Composiciones y métodos para tratar la enfermedad de huntington.
US16/302,140 US11951121B2 (en) 2016-05-18 2017-05-18 Compositions and methods for treating Huntington's disease
CA3024449A CA3024449A1 (en) 2016-05-18 2017-05-18 Compositions and methods of treating huntington's disease
KR1020227025973A KR20220108216A (ko) 2016-05-18 2017-05-18 헌팅톤 질환을 치료하기 위한 조성물 및 방법
RU2018140499A RU2764587C2 (ru) 2016-05-18 2017-05-18 Способы и композиции для лечения хореи гентингтона
CN201780043501.XA CN109831916B (zh) 2016-05-18 2017-05-18 治疗亨廷顿氏舞蹈病的组合物和方法
EP17800155.8A EP3458589A4 (en) 2016-05-18 2017-05-18 COMPOSITIONS AND METHODS FOR TREATING MORBUS HUNTINGTON
IL262763A IL262763A (en) 2016-05-18 2018-11-04 Preparations and methods for treating Huntington's disease
US18/591,756 US20240415868A1 (en) 2016-05-18 2024-02-29 Compositions and methods for treating huntington's disease

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201662338113P 2016-05-18 2016-05-18
US62/338,113 2016-05-18
US201762485049P 2017-04-13 2017-04-13
US62/485,049 2017-04-13

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/302,140 A-371-Of-International US11951121B2 (en) 2016-05-18 2017-05-18 Compositions and methods for treating Huntington's disease
US18/591,756 Continuation US20240415868A1 (en) 2016-05-18 2024-02-29 Compositions and methods for treating huntington's disease

Publications (1)

Publication Number Publication Date
WO2017201258A1 true WO2017201258A1 (en) 2017-11-23

Family

ID=60325655

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/033281 Ceased WO2017201258A1 (en) 2016-05-18 2017-05-18 Compositions and methods of treating huntington's disease

Country Status (13)

Country Link
US (2) US11951121B2 (OSRAM)
EP (1) EP3458589A4 (OSRAM)
JP (1) JP7220080B2 (OSRAM)
KR (2) KR20220108216A (OSRAM)
CN (1) CN109831916B (OSRAM)
AU (1) AU2017268382B2 (OSRAM)
BR (1) BR112018073472A2 (OSRAM)
CA (1) CA3024449A1 (OSRAM)
IL (2) IL297576B2 (OSRAM)
MX (1) MX2018014152A (OSRAM)
RU (1) RU2764587C2 (OSRAM)
SG (1) SG11201809643UA (OSRAM)
WO (1) WO2017201258A1 (OSRAM)

Cited By (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019213183A1 (en) * 2018-04-30 2019-11-07 The Trustees Of The University Of Pennsylvania In utero crispr-mediated therapeutic editing of genes
WO2019241486A1 (en) 2018-06-13 2019-12-19 Voyager Therapeutics, Inc. Engineered 5' untranslated regions (5' utr) for aav production
WO2019222444A3 (en) * 2018-05-16 2019-12-26 Voyager Therapeutics, Inc. Directed evolution of aav to improve tropism for cns
WO2020010042A1 (en) * 2018-07-02 2020-01-09 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis and disorders associated with the spinal cord
WO2020023612A1 (en) 2018-07-24 2020-01-30 Voyager Therapeutics, Inc. Systems and methods for producing gene therapy formulations
WO2020072844A1 (en) 2018-10-05 2020-04-09 Voyager Therapeutics, Inc. Engineered nucleic acid constructs encoding aav production proteins
WO2020072849A1 (en) 2018-10-04 2020-04-09 Voyager Therapeutics, Inc. Methods for measuring the titer and potency of viral vector particles
WO2020081490A1 (en) 2018-10-15 2020-04-23 Voyager Therapeutics, Inc. EXPRESSION VECTORS FOR LARGE-SCALE PRODUCTION OF rAAV IN THE BACULOVIRUS/Sf9 SYSTEM
WO2020104469A1 (en) * 2018-11-19 2020-05-28 Uniqure Ip B.V. Method and means to deliver mirna to target cells
WO2020150556A1 (en) 2019-01-18 2020-07-23 Voyager Therapeutics, Inc. Methods and systems for producing aav particles
WO2020172624A1 (en) * 2019-02-22 2020-08-27 Life Technologies Corporation Suspension system for adeno associated virus production
WO2020223274A1 (en) 2019-04-29 2020-11-05 Voyager Therapeutics, Inc. SYSTEMS AND METHODS FOR PRODUCING BACULOVIRAL INFECTED INSECT CELLS (BIICs) IN BIOREACTORS
WO2021030125A1 (en) 2019-08-09 2021-02-18 Voyager Therapeutics, Inc. Cell culture medium for use in producing gene therapy products in bioreactors
WO2021041485A1 (en) 2019-08-26 2021-03-04 Voyager Therapeutics, Inc. Controlled expression of viral proteins
WO2021072129A2 (en) 2019-10-08 2021-04-15 Trustees Of Boston College Proteins containing multiple, different unnatural amino acids and methods of making and using such proteins
EP3684388A4 (en) * 2017-09-22 2021-09-22 Voyager Therapeutics, Inc. COMPOSITIONS AND METHODS OF TREATMENT OF HUNTINGTON'S DISEASE
WO2021222636A1 (en) 2020-04-29 2021-11-04 The Broad Institute, Inc. Machine learning accelerated protein engineering through fitness prediction
WO2022032153A1 (en) 2020-08-06 2022-02-10 Voyager Therapeutics, Inc. Cell culture medium for use in producing gene therapy products in bioreactors
WO2022040239A1 (en) 2020-08-17 2022-02-24 Massachusetts Institute Of Technology Shank3 gene therapy approaches
WO2022074464A2 (en) 2020-03-05 2022-04-14 Neotx Therapeutics Ltd. Methods and compositions for treating cancer with immune cells
US20220213482A1 (en) * 2019-09-16 2022-07-07 Uniqure Ip B.V. Targeting misspliced transcripts in genetic disorders
US11434502B2 (en) 2017-10-16 2022-09-06 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis (ALS)
WO2022187473A2 (en) 2021-03-03 2022-09-09 Voyager Therapeutics, Inc. Controlled expression of viral proteins
WO2022187548A1 (en) 2021-03-03 2022-09-09 Voyager Therapeutics, Inc. Controlled expression of viral proteins
US11542506B2 (en) 2014-11-14 2023-01-03 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
WO2023034994A1 (en) * 2021-09-03 2023-03-09 Biomarin Pharmaceutical Inc. Aav capsid compositions and methods for delivery
US11603542B2 (en) 2017-05-05 2023-03-14 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
US11634742B2 (en) 2020-07-27 2023-04-25 Anjarium Biosciences Ag Compositions of DNA molecules, methods of making therefor, and methods of use thereof
WO2023164545A1 (en) 2022-02-23 2023-08-31 Massachusetts Institute Of Technology Methods for upregulating shank3 expression
US11865190B2 (en) 2018-10-09 2024-01-09 The University Of British Columbia Compositions and systems comprising transfection-competent vesicles free of organic-solvents and detergents and methods related thereto
WO2024054983A1 (en) 2022-09-08 2024-03-14 Voyager Therapeutics, Inc. Controlled expression of viral proteins
WO2024145474A2 (en) 2022-12-29 2024-07-04 Voyager Therapeutics, Inc. Compositions and methods for regulating mapt
US12071625B2 (en) 2014-11-14 2024-08-27 Voyager Therapeutics, Inc. Modulatory polynucleotides
US12084659B2 (en) 2016-05-18 2024-09-10 Voyager Therapeutics, Inc. Modulatory polynucleotides
US12116385B2 (en) 2021-10-08 2024-10-15 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
WO2024226761A2 (en) 2023-04-26 2024-10-31 Voyager Therapeutics, Inc. Compositions and methods for treating amyotrophic lateral sclerosis
WO2024233422A1 (en) 2023-05-05 2024-11-14 Massachusetts Institute Of Technology Shank3 gene therapy approaches
WO2025122644A1 (en) 2023-12-05 2025-06-12 Voyager Therapeutics, Inc. Compositions and methods for regulating mapt
WO2025160434A1 (en) * 2024-01-26 2025-07-31 Genzyme Corporation Artificial micrornas targeting huntington's disease

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SG11201909868YA (en) * 2017-05-05 2019-11-28 Voyager Therapeutics Inc Compositions and methods of treating huntington's disease
WO2019060726A1 (en) * 2017-09-22 2019-03-28 Genzyme Corporation Variant rnai
CN112980837B (zh) * 2019-12-13 2023-07-04 深圳艾码生物科技有限公司 一种抑制HTT基因表达的siRNA及其前体和应用
JP2025503910A (ja) * 2022-01-27 2025-02-06 アスクレピオス バイオファーマシューティカル, インコーポレイテッド 神経疾患を処置するための組成物
WO2024129992A1 (en) * 2022-12-15 2024-06-20 President And Fellows Of Harvard College Enhancers driving expression in motor neurons
WO2024137931A1 (en) * 2022-12-21 2024-06-27 Icahn School Of Medicine At Mount Sinai Inhibition of zbtb7a

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090118206A1 (en) * 2003-09-12 2009-05-07 University Of Massachusetts Rna interference for the treatment of gain-of-function disorders
US20110212520A1 (en) * 2002-08-05 2011-09-01 University Of Iowa Research Foundation Rna interference suppression of neurodegenerative diseases and methods of use thereof
US20140004565A1 (en) * 2009-07-06 2014-01-02 Alnylam Pharmaceuticals, Inc. Cell-based bioprocessing
WO2015191508A1 (en) * 2014-06-09 2015-12-17 Voyager Therapeutics, Inc. Chimeric capsids
US20160355808A1 (en) * 2015-04-03 2016-12-08 University Of Massachusetts OLIGONUCLEOTIDE COMPOUNDS FOR TARGETING HUNTINGTIN mRNA

Family Cites Families (428)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2640638B1 (fr) 1988-12-20 1991-02-15 Commissariat Energie Atomique Bioreacteur et dispositif pour la culture de cellules animales
AU7906691A (en) 1990-05-23 1991-12-10 United States of America, as represented by the Secretary, U.S. Department of Commerce, The Adeno-associated virus (aav)-based eucaryotic vectors
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
US5252479A (en) 1991-11-08 1993-10-12 Research Corporation Technologies, Inc. Safe vector for gene therapy
US5587308A (en) 1992-06-02 1996-12-24 The United States Of America As Represented By The Department Of Health & Human Services Modified adeno-associated virus vector capable of expression from a novel promoter
US6268213B1 (en) 1992-06-03 2001-07-31 Richard Jude Samulski Adeno-associated virus vector and cis-acting regulatory and promoter elements capable of expressing at least one gene and method of using same for gene therapy
US5693531A (en) 1993-11-24 1997-12-02 The United States Of America As Represented By The Department Of Health And Human Services Vector systems for the generation of adeno-associated virus particles
EP0755454B1 (en) 1994-04-13 2008-02-13 The Rockefeller University Aav-mediated delivery of dna to cells of the nervous system
US5658785A (en) 1994-06-06 1997-08-19 Children's Hospital, Inc. Adeno-associated virus materials and methods
US20020159979A1 (en) 1994-06-06 2002-10-31 Children's Hospital, Inc. Adeno-associated virus materials and methods
US6204059B1 (en) 1994-06-30 2001-03-20 University Of Pittsburgh AAV capsid vehicles for molecular transfer
US5856152A (en) 1994-10-28 1999-01-05 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV vector and methods of use therefor
US5625048A (en) 1994-11-10 1997-04-29 The Regents Of The University Of California Modified green fluorescent proteins
EP0796339A1 (en) 1994-12-06 1997-09-24 Targeted Genetics Corporation Packaging cell lines for generation of high titers of recombinant aav vectors
US5652224A (en) 1995-02-24 1997-07-29 The Trustees Of The University Of Pennsylvania Methods and compositions for gene therapy for the treatment of defects in lipoprotein metabolism
US5741657A (en) 1995-03-20 1998-04-21 The Regents Of The University Of California Fluorogenic substrates for β-lactamase and methods of use
US6281010B1 (en) 1995-06-05 2001-08-28 The Trustees Of The University Of Pennsylvania Adenovirus gene therapy vehicle and cell line
US5756283A (en) 1995-06-05 1998-05-26 The Trustees Of The University Of Pennsylvania Method for improved production of recombinant adeno-associated viruses for gene therapy
US5688676A (en) 1995-06-07 1997-11-18 Research Foundation Of State University Of New York In vitro packaging of adeno-associated virus DNA
US5741683A (en) 1995-06-07 1998-04-21 The Research Foundation Of State University Of New York In vitro packaging of adeno-associated virus DNA
US6676935B2 (en) 1995-06-27 2004-01-13 Cell Genesys, Inc. Tissue specific adenoviral vectors
US6197293B1 (en) 1997-03-03 2001-03-06 Calydon, Inc. Adenovirus vectors specific for cells expressing androgen receptor and methods of use thereof
WO1997008298A1 (en) 1995-08-30 1997-03-06 Genzyme Corporation Chromatographic purification of adenovirus and aav
US6265389B1 (en) 1995-08-31 2001-07-24 Alkermes Controlled Therapeutics, Inc. Microencapsulation and sustained release of oligonucleotides
US5858351A (en) 1996-01-18 1999-01-12 Avigen, Inc. Methods for delivering DNA to muscle cells using recombinant adeno-associated virus vectors
US5846528A (en) 1996-01-18 1998-12-08 Avigen, Inc. Treating anemia using recombinant adeno-associated virus virions comprising an EPO DNA sequence
US5962313A (en) 1996-01-18 1999-10-05 Avigen, Inc. Adeno-associated virus vectors comprising a gene encoding a lyosomal enzyme
US5952221A (en) 1996-03-06 1999-09-14 Avigen, Inc. Adeno-associated virus vectors comprising a first and second nucleic acid sequence
US7026468B2 (en) 1996-07-19 2006-04-11 Valentis, Inc. Process and equipment for plasmid purification
CA2264499A1 (en) 1996-09-06 1998-03-12 The Trustees Of The University Of Pennsylvania Methods using cre-lox for production of recombinant adeno-associated viruses
WO1998009657A2 (en) 1996-09-06 1998-03-12 Trustees Of The University Of Pennsylvania Method for recombinant adeno-associated virus-directed gene therapy
JP2001500015A (ja) 1996-09-06 2001-01-09 トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア T7ポリメラーゼを利用する組換えアデノ随伴ウイルスの誘導可能な製造方法
US5866552A (en) 1996-09-06 1999-02-02 The Trustees Of The University Of Pennsylvania Method for expressing a gene in the absence of an immune response
US20020037867A1 (en) 1999-02-26 2002-03-28 James M. Wilson Method for recombinant adeno-associated virus-directed gene therapy
WO1998010087A1 (en) 1996-09-06 1998-03-12 Trustees Of The University Of Pennsylvania Chimpanzee adenovirus vectors
AU4645697A (en) 1996-09-11 1998-04-02 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Aav4 vector and uses thereof
US7732129B1 (en) 1998-12-01 2010-06-08 Crucell Holland B.V. Method for the production and purification of adenoviral vectors
JP4492826B2 (ja) 1996-11-20 2010-06-30 イントロジェン セラピューティクス,インコーポレイテッド アデノウイルスベクターの産生および精製のための改良された方法
CA2270285A1 (en) 1996-12-18 1998-06-25 Targeted Genetics Corporation Aav split-packaging genes and cell lines comprising such genes for use in the production of recombinant aav vectors
US6156303A (en) 1997-06-11 2000-12-05 University Of Washington Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom
US6710036B2 (en) 1997-07-25 2004-03-23 Avigen, Inc. Induction of immune response to antigens expressed by recombinant adeno-associated virus
US6251677B1 (en) 1997-08-25 2001-06-26 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
US6566118B1 (en) 1997-09-05 2003-05-20 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
US6995006B2 (en) 1997-09-05 2006-02-07 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of released recombinant AAV vectors
AU9774998A (en) 1997-09-19 1999-04-12 Trustees Of The University Of Pennsylvania, The Method for gene transfer using bcl2 and compositions useful therein
EP1015619A1 (en) 1997-09-19 2000-07-05 The Trustees Of The University Of Pennsylvania Methods and cell line useful for production of recombinant adeno-associated viruses
CA2303768C (en) 1997-09-19 2009-11-24 The Trustees Of The University Of Pennsylvania Methods and vector constructs useful for production of recombinant aav
US6642051B1 (en) 1997-10-21 2003-11-04 Targeted Genetics Corporation Amplifiable adeno-associated virus(AAV) packaging cassettes for the production of recombinant AAV vectors
IT1297074B1 (it) 1997-11-21 1999-08-03 Angeletti P Ist Richerche Bio Forme ormone-dipendenti delle proteine rep del virus adeno-associato (aav-2), sequenze di dna codificanti per esse, vettori che le
NZ505325A (en) 1997-12-23 2003-07-25 Crucell Holland B Adeno-associated virus and adenovirus chimeric recombinant viruses useful for the integration of foreign genetic information into the chromosomal dna of target cells
US6410300B1 (en) 1998-01-12 2002-06-25 The University Of North Carolina At Chapel Hill Methods and formulations for mediating adeno-associated virus (AAV) attachment and infection and methods for purifying AAV
AU2882899A (en) 1998-02-26 1999-09-15 Trustees Of The University Of Pennsylvania, The Stable protection from dystrophic sarcolemmal degeneration and restoration of the sarcoglycan complex
US6953690B1 (en) 1998-03-20 2005-10-11 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
US6521426B1 (en) 1998-04-08 2003-02-18 Istituto Di Ricerche Di Biologia Molecolare P. Angeletti S.P.A. Preparation of recombinant adenovirus carrying a rep gene of adeno-associated virus
FR2778413B1 (fr) 1998-05-07 2000-08-04 Immunotech Sa Nouveaux reactifs et methode de lyse des erythrocytes
WO1999058700A1 (en) 1998-05-11 1999-11-18 Ariad Gene Therapeutics, Inc. Multiviral compositions and uses thereof
US6436392B1 (en) 1998-05-20 2002-08-20 University Of Iowa Research Foundation Adeno-associated virus vectors
EP1849872A1 (en) 1998-05-20 2007-10-31 University Of Iowa Research Foundation Adeno-associated virus vectors and uses thereof
WO1999061643A1 (en) 1998-05-27 1999-12-02 University Of Florida Method of preparing recombinant adeno-associated virus compositions by using an iodixananol gradient
EP1082445A2 (en) 1998-05-27 2001-03-14 Cell Genesys, Inc. Adeno-associated viral vector-mediated expression of factor viii activity
US6984517B1 (en) 1998-05-28 2006-01-10 The United States Of America As Represented By The Department Of Health And Human Services AAV5 vector and uses thereof
WO1999061601A2 (en) 1998-05-28 1999-12-02 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Aav5 vector and uses thereof
GB2338236B (en) 1998-06-13 2003-04-09 Aea Technology Plc Microbiological cell processing
US6900049B2 (en) 1998-09-10 2005-05-31 Cell Genesys, Inc. Adenovirus vectors containing cell status-specific response elements and methods of use thereof
US6416992B1 (en) 1998-10-13 2002-07-09 Avigen, Inc. Compositions and methods for producing recombinant adeno-associated virus
US6200560B1 (en) 1998-10-20 2001-03-13 Avigen, Inc. Adeno-associated virus vectors for expression of factor VIII by target cells
EP1124976A1 (en) 1998-10-27 2001-08-22 Crucell Holland B.V. Improved aav vector production
US6759237B1 (en) 1998-11-05 2004-07-06 The Trustees Of The University Of Pennsylvania Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same
US6689600B1 (en) 1998-11-16 2004-02-10 Introgen Therapeutics, Inc. Formulation of adenovirus for gene therapy
US6759050B1 (en) 1998-12-03 2004-07-06 Avigen, Inc. Excipients for use in adeno-associated virus pharmaceutical formulations, and pharmaceutical formulations made therewith
US6225113B1 (en) 1998-12-04 2001-05-01 Genvec, Inc. Use of trans-activation and cis-activation to modulate the persistence of expression of a transgene in an at least E4-deficient adenovirus
US6387368B1 (en) 1999-02-08 2002-05-14 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
DE19905501B4 (de) 1999-02-10 2005-05-19 MediGene AG, Gesellschaft für molekularbiologische Kardiologie und Onkologie Verfahren zur Herstellung eines rekombinanten Adeno-assoziierten Virus, geeignete Mittel hierzu sowie Verwendung zur Herstellung eines Arzneimittels
US6509150B1 (en) 1999-03-05 2003-01-21 Universite De Nantes Compositions and methods for recombinant Adeno-Associated Virus production
US6258595B1 (en) 1999-03-18 2001-07-10 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
JP4693244B2 (ja) 1999-03-18 2011-06-01 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア 組換えアデノ随伴ウイルスのヘルパー無しの生産のための組成物および方法
JP2002542805A (ja) 1999-04-30 2002-12-17 ユニバーシティ オブ フロリダ アデノ随伴ウイルス送達リボザイム組成物および使用方法
AU2409200A (en) 1999-06-02 2000-12-28 Trustees Of The University Of Pennsylvania, The Compositions and methods useful for production of recombinant viruses which require helper viruses
JP4969002B2 (ja) 1999-06-08 2012-07-04 ユニバーシテイ・オブ・アイオワ・リサーチ・フアウンデーシヨン rAAV形質導入を増加するための化合物および方法
WO2001014539A2 (en) 1999-08-20 2001-03-01 Johns Hopkins University School Of Medicine Methods and compositions for the construction and use of fusion libraries
US6365394B1 (en) 1999-09-29 2002-04-02 The Trustees Of The University Of Pennsylvania Cell lines and constructs useful in production of E1-deleted adenoviruses in absence of replication competent adenovirus
EP1218035A2 (en) 1999-09-29 2002-07-03 The Trustees Of The University Of Pennsylvania Rapid peg-modification of viral vectors
US7241447B1 (en) 1999-10-07 2007-07-10 University Of Iowa Research Foundation Adeno-associated virus vectors and uses thereof
WO2001025465A1 (en) 1999-10-07 2001-04-12 University Of Iowa Research Foundation Adeno-associated viruses and uses thereof
WO2001032711A2 (en) 1999-10-21 2001-05-10 Board Of Trustees Of The University Of Arkansas Adeno-associated virus aav rep78 major regulatory protein, mutants thereof and uses thereof
WO2001036623A2 (en) 1999-11-05 2001-05-25 Avigen, Inc. Ecdysone-inducible adeno-associated virus expression vectors
WO2001036603A2 (en) 1999-11-17 2001-05-25 Avigen, Inc. Recombinant adeno-associated virus virions for the treatment of lysosomal disorders
EP1240345A2 (en) 1999-12-10 2002-09-18 Ariad Gene Therapeutics, Inc. Methods for expression of genes in primates
WO2001068888A2 (en) 2000-03-14 2001-09-20 Neurologix, Inc. Production of chimeric capsid vectors
US7638120B2 (en) 2000-03-14 2009-12-29 Thomas Jefferson University High transgene expression of a pseudotyped adeno-associated virus type
US6468524B1 (en) 2000-03-22 2002-10-22 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services AAV4 vector and uses thereof
US6855314B1 (en) 2000-03-22 2005-02-15 The United States Of America As Represented By The Department Of Health And Human Services AAV5 vector for transducing brain cells and lung cells
US7048920B2 (en) 2000-03-24 2006-05-23 Cell Genesys, Inc. Recombinant oncolytic adenovirus for human melanoma
KR20080023768A (ko) 2000-03-30 2008-03-14 화이트헤드 인스티튜트 포 바이오메디칼 리서치 Rna 간섭의 rna 서열 특이적인 매개체
GB0009887D0 (en) 2000-04-20 2000-06-07 Btg Int Ltd Cytotoxic agents
US7125705B2 (en) 2000-04-28 2006-10-24 Genzyme Corporation Polynucleotides for use in recombinant adeno-associated virus virion production
WO2001083692A2 (en) 2000-04-28 2001-11-08 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
US20030013189A1 (en) 2000-04-28 2003-01-16 Wilson James M. Compositions and methods useful for non-invasive delivery of therapeutic molecules to the bloodstream
US20020106381A1 (en) 2000-06-13 2002-08-08 High Katherine A. Methods for administering recombinant adeno-associated virus virions to humans previously exposed to adeno-associated virus
US7045299B2 (en) 2000-07-18 2006-05-16 Takeda Pharmaceutical Company Limited Physiologically active peptide and use thereof
US6593123B1 (en) 2000-08-07 2003-07-15 Avigen, Inc. Large-scale recombinant adeno-associated virus (rAAV) production and purification
US6329181B1 (en) 2000-08-07 2001-12-11 Neurologix, Inc. Helper functions for recombinant vector production
WO2002014487A2 (en) 2000-08-17 2002-02-21 Keiya Ozawa Adeno-associated virus-mediated delivery of angiogenic factors
DE10066104A1 (de) 2000-09-08 2003-01-09 Medigene Ag Wirtszellen zur Verpackung von rekombinantem Adeno-assoziiertem Virus (rAAV), Verfahren zu ihrer Herstellung und deren Verwendung
FR2813891B1 (fr) 2000-09-14 2005-01-14 Immunotech Sa Reactif multifonctionnel pour erythrocytes mettant en jeu des carbamates et applications
JP2002153278A (ja) 2000-11-22 2002-05-28 Hisamitsu Pharmaceut Co Inc ウイルスベクターの製造に用いられる細胞、その製法およびその細胞を用いたウイルスベクターの製造方法
WO2002070719A2 (en) 2001-01-19 2002-09-12 Trustees Of The University Of Pennsylvania Regulatable gene expression system
FR2821624B1 (fr) * 2001-03-01 2004-01-02 Sod Conseils Rech Applic Nouveau polynucleotide utilisable pour moduler la proliferation des cellules cancereuses
CA2441454A1 (en) 2001-03-14 2002-09-19 Avigen, Inc. Recombinant adeno-associated virus-mediated gene transfer via retroductal infusion of virions
US20060217331A1 (en) * 2001-05-18 2006-09-28 Sirna Therapeutics, Inc. Chemically modified double stranded nucleic acid molecules that mediate RNA interference
US20040136963A1 (en) 2001-06-22 2004-07-15 The Trustees Of The University Of Pennsylvania Simian adenovirus vectors and methods of use
JP4399255B2 (ja) 2001-06-22 2010-01-13 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア 細菌の形質転換体を迅速に選別する方法および新規なサルアデノウイルス蛋白質
ES2606290T3 (es) 2001-07-12 2017-03-23 University Of Massachusetts Producción in vivo de ARN de interferencia pequeños que median el silenciamiento génico
EP1900815B1 (en) 2001-07-12 2016-09-07 University of Massachusetts In vivo production of small interfering RNAs that mediate gene silencing
US8241622B2 (en) 2001-07-13 2012-08-14 University Of Iowa Research Foundation Adeno-associated virus vectors with intravector heterologous terminal palindromic sequences
EP1279740A1 (en) 2001-07-26 2003-01-29 Vrije Universiteit Brussel Recombinant vector derived from adeno-associated virus for gene therapy
ES2564553T3 (es) 2001-08-08 2016-03-23 The Trustees Of The University Of Pennsylvania Procedimiento para purificar vectores víricos que tienen proteínas que se unen a ácido siálico
US20030092161A1 (en) 2001-09-19 2003-05-15 The Trustees Of The University Of Pennsylvania Compositions and methods for production of recombinant viruses, and uses therefor
IL161100A0 (en) 2001-09-28 2004-08-31 Max Planck Gesellschaft Identification of novel genes coding for small temporal rnas
EP1572893B1 (en) 2001-11-09 2009-01-07 THE GOVERNMENT OF THE UNITED STATES OF AMERICA as represented by THE SECRETARY of the DEPARTMENT OF HEALTH AND HUMAN SERVICES Production of adeno-associated virus in insect cells
US6723551B2 (en) 2001-11-09 2004-04-20 The United States Of America As Represented By The Department Of Health And Human Services Production of adeno-associated virus in insect cells
SG168422A1 (en) 2001-11-13 2011-02-28 Univ Pennsylvania A method of detecting and/or identifying adeno-associated virus (aav) sequences and isolating novel sequences identified thereby
HU230364B1 (hu) 2001-11-21 2016-03-29 The Trustees Of The University Of Pennsylvania Simian adenovírus nukleinsav és aminosav-szekvencia, azt tartalmazó vektorok, és eljárások annak alkalmazására
EP1944043A1 (en) 2001-11-21 2008-07-16 The Trustees of the University of Pennsylvania Simian adenovirus nucleic acid and amino acid sequences, vectors containing same, and methods of use
JP4550421B2 (ja) 2001-12-12 2010-09-22 メイン・ファ−マ・インタ−ナショナル・プロプライエタリ−・リミテッド ウイルスの保存のための組成物
JP4810062B2 (ja) 2001-12-17 2011-11-09 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア アデノ随伴ウイルス(aav)血清型8の配列
ES2526341T3 (es) 2001-12-17 2015-01-09 The Trustees Of The University Of Pennsylvania Secuencias de serotipo 9 de virus adeno-asociado (AAV), vectores que las contienen, y usos de las mismas
AU2002359786A1 (en) 2001-12-19 2003-07-09 Hiroaki Mizukami Adeno-associated virus-mediated delivery of gdnf to skeletal muscles
AU2003202026A1 (en) 2002-01-16 2003-09-02 Dynal Biotech Asa Method for isolating nucleic acids and protein from a single sample
GB0208390D0 (en) 2002-04-11 2002-05-22 Univ London Adeno-associated virus producer system
US20030198620A1 (en) 2002-04-16 2003-10-23 Keiya Ozawa Method of treating amino acid metabolic disorders using recombinant adeno-associated virus virions
EP1359217B1 (en) 2002-04-29 2006-12-13 The Trustees of The University of Pennsylvania Method for direct rescue and amplification of integrated viruses from cellular DNA of tissues
NZ535944A (en) 2002-04-30 2007-11-30 Oncolytics Biotech Inc Viral purification method comprising a simple extraction step in which a detergent is directly added to the cell culture, thereafter, cell debris is removed from the extraction mixture by filtration or centrifugation
AU2003295312B2 (en) 2002-05-01 2008-08-14 University Of Florida Research Foundation, Inc. Improved rAAV expression systems for genetic modification of specific capsid proteins
DK1504126T3 (da) 2002-05-03 2014-06-10 Univ Duke Fremgangsmåde til regulering af genekspression
US7326555B2 (en) 2002-05-14 2008-02-05 Merck & Co., Inc. Methods of adenovirus purification
US7419817B2 (en) 2002-05-17 2008-09-02 The United States Of America As Represented By The Secretary Department Of Health And Human Services, Nih. Scalable purification of AAV2, AAV4 or AAV5 using ion-exchange chromatography
US20070015238A1 (en) 2002-06-05 2007-01-18 Snyder Richard O Production of pseudotyped recombinant AAV virions
US20050255086A1 (en) * 2002-08-05 2005-11-17 Davidson Beverly L Nucleic acid silencing of Huntington's Disease gene
US20040241854A1 (en) 2002-08-05 2004-12-02 Davidson Beverly L. siRNA-mediated gene silencing
US20040137471A1 (en) 2002-09-18 2004-07-15 Timothy Vickers Efficient reduction of target RNA's by single-and double-stranded oligomeric compounds
EP1418185A1 (en) 2002-11-11 2004-05-12 Aventis Pharma Deutschland GmbH Use of EDG2 receptor in an animal model of heart failure
US7169612B2 (en) 2002-11-11 2007-01-30 Sanofi-Aventis Deutschland Gmbh Use of EDG2 receptor in an animal model of heart failure
US7618948B2 (en) 2002-11-26 2009-11-17 Medtronic, Inc. Devices, systems and methods for improving and/or cognitive function through brain delivery of siRNA
EP1611231A4 (en) 2003-02-21 2008-08-13 Penn State Res Found RNA-INTERFERING COMPOSITIONS AND METHODS THEREOF
WO2004075861A2 (en) 2003-02-26 2004-09-10 Children's Hospital, Inc. Recombinant adeno-associated virus production
US20070172460A1 (en) 2003-03-19 2007-07-26 Jurgen Kleinschmidt Random peptide library displayed on aav vectors
WO2004108922A2 (en) 2003-04-25 2004-12-16 The Trustees Of The University Of Pennsylvania Use of aav comprising a capsid protein from aav7 or aav8 for the delivery of genes encoding apoprotein a or e genes to the liver
US7589189B2 (en) 2003-05-14 2009-09-15 Japan Science And Technology Agency Inhibition of the expression of huntingtin gene
US8927269B2 (en) 2003-05-19 2015-01-06 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Avian adenoassociated virus and uses thereof
JP4559429B2 (ja) 2003-05-21 2010-10-06 ジェンザイム・コーポレーション 空キャプシドを実質的に含まない組換えaavビリオン調製物を生成するための方法
ATE485394T1 (de) * 2003-06-02 2010-11-15 Univ Massachusetts Verfahren und zusammensetzungen zur verbesserung der wirksamkeit und spezifität von fnai
EP1486567A1 (en) 2003-06-11 2004-12-15 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Improved adeno-associated virus (AAV) vector for gene therapy
JP4888876B2 (ja) 2003-06-13 2012-02-29 田平 武 アルツハイマー病の治療のための組換えアデノ随伴ウィルスベクター
PL2357189T3 (pl) 2003-06-19 2017-08-31 Genzyme Corporation Wiriony AAV o zmniejszonej immunoreaktywności i ich zastosowanie
EP1636370B1 (en) 2003-06-20 2014-04-16 The Trustees of The University of Pennsylvania Methods of generating chimeric adenoviruses and uses for such chimeric adenoviruses
US7291498B2 (en) 2003-06-20 2007-11-06 The Trustees Of The University Of Pennsylvania Methods of generating chimeric adenoviruses and uses for such chimeric adenoviruses
US9441244B2 (en) 2003-06-30 2016-09-13 The Regents Of The University Of California Mutant adeno-associated virus virions and methods of use thereof
WO2005012537A2 (en) 2003-07-25 2005-02-10 Genvec, Inc. Adenoviral vector-based vaccines
EP1648914A4 (en) 2003-07-31 2009-12-16 Regulus Therapeutics Inc OLIGOMERIC COMPOUNDS AND COMPOSITIONS USEFUL FOR MODULATING SMALL NON-CODING RNA
EP3910063A1 (en) 2003-09-30 2021-11-17 The Trustees of The University of Pennsylvania Adeno-associated virus (aav) clades, sequences, vectors containing same, and uses therefor
JP4790619B2 (ja) 2003-10-27 2011-10-12 ロゼッタ インファーマティクス エルエルシー 遺伝子サイレンシングのためのsiRNAを設計する方法
ES2361000T3 (es) 2004-04-28 2011-06-13 The Trustees Of The University Of Pennsylvania Suministro secuencial de moléculas inmunogénicas mediante administraciones de un adenovirus y de un virus adeno-asociado.
HUE060433T2 (hu) 2004-06-01 2023-03-28 Genzyme Corp Készítmények és eljárások AAV vektor aggregációjának megelõzésére
CA2568150A1 (en) 2004-06-21 2006-01-05 Medtronic, Inc. Medical systems and methods for delivering compositions to cells
CA2581714C (en) 2004-10-05 2017-09-12 Avigen, Inc. Stepped cannula
JPWO2006043354A1 (ja) 2004-10-20 2008-05-22 独立行政法人放射線医学総合研究所 組込型の低線量放射線誘導性ベクター
US7901921B2 (en) 2004-10-22 2011-03-08 Oncolytics Biotech Inc. Viral purification methods
AU2005307737C1 (en) 2004-11-18 2013-08-29 The Board Of Trustees Of The University Of Illinois Multicistronic siRNA constructs to inhibit tumors
CN1286981C (zh) 2004-11-30 2006-11-29 华中科技大学同济医学院附属同济医院 表达人类cyp2j2反义基因的重组腺相关病毒及其制备方法
CA2596588C (en) 2005-01-31 2017-06-27 University Of Iowa Research Foundation Nucleic acid silencing of huntington's disease gene
AU2006210443B2 (en) 2005-02-03 2011-01-27 Benitec, Inc. RNAi expression constructs
US8614101B2 (en) 2008-05-20 2013-12-24 Rapid Pathogen Screening, Inc. In situ lysis of cells in lateral flow immunoassays
US7625570B1 (en) 2005-03-10 2009-12-01 The Regents Of The University Of California Methods for purifying adeno-associated virus
WO2006102072A2 (en) 2005-03-23 2006-09-28 The Trustees Of The University Of Pennsylvania Use of a pa131 polypeptide in treatment of atherosclerosis
EP3409296A1 (en) 2005-04-07 2018-12-05 The Trustees of the University of Pennsylvania Method of increasing the function of an aav vector
WO2006119432A2 (en) 2005-04-29 2006-11-09 The Government Of The U.S.A., As Rep. By The Sec., Dept. Of Health & Human Services Isolation, cloning and characterization of new adeno-associated virus (aav) serotypes
BRPI0611379A2 (pt) 2005-05-02 2010-08-31 Genzyme Corp terapia genética para distúrbios neurometabólicos
CA2619534A1 (en) 2005-08-18 2007-02-22 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating neurological disease
US9089667B2 (en) 2005-08-23 2015-07-28 The Regents Of The University Of California Reflux resistant cannula and system for chronic delivery of therapeutic agents using convection-enhanced delivery
EP1857552A1 (en) 2006-05-20 2007-11-21 Cargill Incorporated Thermostable xylose isomerase enzyme
PL1945779T3 (pl) 2005-10-20 2013-08-30 Uniqure Ip Bv Ulepszone wektory AAV produkowane w komórkach owadzich
EP2325315B1 (en) * 2005-10-28 2014-05-07 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of huntingtin gene
EP2007795B1 (en) 2006-03-30 2016-11-16 The Board Of Trustees Of The Leland Stanford Junior University Aav capsid proteins
MX2008012219A (es) 2006-04-03 2008-10-02 Santaris Pharma As Composicion farmaceutica que comprende oligonucleotidos antisentido anti-miarn.
JP5268890B2 (ja) 2006-04-28 2013-08-21 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Aavの規模適応性の製造方法
CN101495624A (zh) 2006-04-28 2009-07-29 宾夕法尼亚州立大学托管会 衣壳免疫原性降低的经修饰aav载体及其用途
ATE455558T1 (de) 2006-04-28 2010-02-15 Univ Pennsylvania Modifiziertes adenovirus-hexon-protein und anwendungen davon
WO2007130519A2 (en) 2006-05-02 2007-11-15 Government Of The Usa, As Represented By The Secretary, Department Of Health And Human Services Viral nucleic acid microarray and method of use
WO2007139982A2 (en) 2006-05-25 2007-12-06 Sangamo Biosciences, Inc. Methods and compositions for gene inactivation
CA2655957C (en) 2006-06-21 2016-05-03 Amsterdam Molecular Therapeutics (Amt) B.V. Vectors with modified initiation codon for the translation of aav-rep78 useful for production of aav in insect cells
ES2428067T3 (es) 2006-07-21 2013-11-05 California Institute Of Technology Introducción selectiva de genes para la vacunación con células dendríticas
CN101501193B (zh) * 2006-08-11 2013-07-03 普罗森那技术公司 用于治疗与dna重复不稳定性相关的遗传病的方法和手段
EP2061891B1 (en) 2006-08-24 2012-04-11 Virovek, Inc. Expression in insect cells of genes with overlapping open reading frames, methods and compositions therefor
CA2693178C (en) 2006-11-29 2018-12-04 Nationwide Children's Hospital, Inc. Myostatin inhibition for enhancing muscle and/or improving muscle function
EP2089520B1 (en) 2006-11-29 2014-01-08 University of Iowa Research Foundation Alternative export pathways for vector expressed RNA interference
US9611302B2 (en) 2007-04-09 2017-04-04 University Of Florida Research Foundation, Inc. High-transduction-efficiency RAAV vectors, compositions, and methods of use
EP3492596A1 (en) 2007-04-09 2019-06-05 University of Florida Research Foundation, Inc. Raav vector compositions having tyrosine-modified capsid proteins and methods for use
US9725485B2 (en) 2012-05-15 2017-08-08 University Of Florida Research Foundation, Inc. AAV vectors with high transduction efficiency and uses thereof for gene therapy
WO2008128251A1 (en) 2007-04-17 2008-10-23 The Children's Hospital Of Philadelphia Humanized viral vectors and methods of use thereof
EP2152874A2 (en) 2007-04-26 2010-02-17 University of Iowa Research Foundation Rna interference suppression of neurodegenerative diseases and methods of use thereof
ES2602610T3 (es) 2007-05-31 2017-02-21 Medigene Ag Proteína estructural mutada de un parvovirus
ES2549122T3 (es) 2007-05-31 2015-10-23 University Of Iowa Research Foundation Reducción de toxicidad por interferencia de ARN desviada de su diana
EP2012122A1 (en) 2007-07-06 2009-01-07 Medigene AG Mutated parvovirus structural proteins as vaccines
US8841437B2 (en) 2008-06-20 2014-09-23 The Board Of Trustees Of The Leland Stanford Junior University Precursor miRNA loop-modulated target regulation
RU2491344C2 (ru) 2007-06-29 2013-08-27 Ф.Хоффманн-Ля Рош Аг Промотор
EP2176283B1 (en) 2007-07-14 2016-11-02 University of Iowa Research Foundation Methods and compositions for treating brain diseases
EP2019143A1 (en) 2007-07-23 2009-01-28 Genethon CNS gene delivery using peripheral administration of AAV vectors
PT2173888T (pt) 2007-07-26 2016-11-17 Uniqure Ip Bv Resumo
CN105018492B (zh) 2007-08-27 2018-08-24 北京强新生物科技有限公司 不对称干扰rna的组合物及其用途
CA2698011C (en) 2007-09-04 2015-12-29 Her Majesty The Queen In Right Of Canada As Represented By The Minister Of Health Porcine adeno-associated viruses
JP2010538675A (ja) 2007-09-19 2010-12-16 アムステルダム モレキュラー セラピューティクス ビー.ブイ. タンパク質産生の改善のためのaav複製機構の使用
CA2706258C (en) 2007-11-28 2017-06-06 The Trustees Of The University Of Pennsylvania Simian subfamily e adenoviruses sadv-39, -25.2, -26, -30, -37, and -38 and uses thereof
KR101614369B1 (ko) 2007-11-28 2016-04-21 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 유인원 아과 c 아데노바이러스 sadv-40, -31, 및 -34 및 그것의 사용
AU2008331905B2 (en) 2007-11-28 2014-09-18 The Trustees Of The University Of Pennsylvania Simian subfamily B adenovirus SAdV-28 and uses thereof
AU2009209408B2 (en) 2008-01-29 2015-06-11 Beacon Therapeutics Limited Recombinant virus production using mammalian cells in suspension
CN102007209B (zh) 2008-02-19 2013-11-13 阿姆斯特丹分子治疗(Amt)股份有限公司 细小病毒rep和cap蛋白在昆虫细胞中的表达优化
JP5661476B2 (ja) 2008-03-04 2015-01-28 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア サルアデノウイルスSAdV−36、−42.1、−42.2および−44ならびにそれらの用途
WO2009134681A2 (en) 2008-04-30 2009-11-05 The Trustees Of The University Of Pennsylvania Aav7 viral vectors for targeted delivery of rpe cells
US8632764B2 (en) 2008-04-30 2014-01-21 University Of North Carolina At Chapel Hill Directed evolution and in vivo panning of virus vectors
EP2291191A4 (en) * 2008-05-09 2014-01-22 Sinai School Medicine METHODS FOR PREVENTING AND TREATING NEURODEGENERATIVE DISEASES
EP2910637A1 (en) 2008-05-20 2015-08-26 University of Florida Research Foundation, Inc. Vectors for delivery of light-sensitive proteins and methods of use
US9217155B2 (en) 2008-05-28 2015-12-22 University Of Massachusetts Isolation of novel AAV'S and uses thereof
US20110171262A1 (en) 2008-06-17 2011-07-14 Andrew Christian Bakker Parvoviral capsid with incorporated gly-ala repeat region
US8945885B2 (en) 2008-07-03 2015-02-03 The Board Of Trustees Of The Leland Stanford Junior University Minicircle DNA vector preparations and methods of making and using the same
WO2010014857A2 (en) 2008-07-30 2010-02-04 University Of Massachusetts Chromosome therapy
EA201170506A1 (ru) 2008-09-29 2011-12-30 Амстердам Молекьюлар Терапьютикс (Амт) Б.В. Генная терапия порфобилиногендезаминазой
AU2009308293B2 (en) 2008-10-22 2015-02-05 Genentech, Inc. Modulation of axon degeneration
US8940290B2 (en) 2008-10-31 2015-01-27 The Trustees Of The University Of Pennsylvania Simian adenoviruses SAdV-43, -45, -46, -47, -48, -49, and -50 and uses thereof
US9415121B2 (en) 2008-12-19 2016-08-16 Nationwide Children's Hospital Delivery of MECP2 polynucleotide using recombinant AAV9
WO2010093784A2 (en) 2009-02-11 2010-08-19 The University Of North Carolina At Chapel Hill Modified virus vectors and methods of making and using the same
EP2403867B1 (en) 2009-03-04 2019-05-22 Deutsches Krebsforschungszentrum Assembly activating protein (aap) and its use for the manufacture of parvovirus particles essential consisting of vp3
US20120093775A1 (en) 2009-03-27 2012-04-19 Proyecto De Biomedicina Cima, S.L. Methods and compositions for the treatment of cirrhosis and liver fibrosis
ES2724122T3 (es) 2009-04-30 2019-09-06 Univ Pennsylvania Composiciones para dirigir células de las vías respiratorias de conducción que comprenden construcciones de virus adenoasociado
EP2435575A2 (en) 2009-05-28 2012-04-04 Deutsches Krebsforschungszentrum Modified aav capsid polypeptides
WO2010138263A2 (en) 2009-05-28 2010-12-02 University Of Massachusetts Novel aav 's and uses thereof
CN102575232B (zh) 2009-05-29 2015-07-22 宾夕法尼亚大学托管会 猿腺病毒41及其应用
SMT201800554T1 (it) 2009-06-16 2018-11-09 Genzyme Corp Metodi migliorati per la purificazione di vettori di aav ricombinanti
EP2451823A4 (en) 2009-07-06 2013-07-03 Alnylam Pharmaceuticals Inc COMPOSITIONS AND METHODS FOR ENHANCING THE PRODUCTION OF A BIOLOGICAL PRODUCT
JP5828838B2 (ja) 2009-07-15 2015-12-09 カリミューン, インコーポレーティッド ヒト免疫不全ウイルス阻害のための二重ベクター
EP2292781A1 (en) 2009-08-17 2011-03-09 Genethon Baculovirus-based production of biopharmaceuticals free of contaminating baculoviral virions
WO2011038187A1 (en) 2009-09-25 2011-03-31 The Trustees Of The University Of Pennsylvania Controlled adeno-associated virus (aav) diversification and libraries prepared therefrom
US20120309816A1 (en) 2009-11-09 2012-12-06 Genepod Therapeutics Ab Novel viral vector construct for neuron specific optimized continuous DOPA synthesis in vivo
CN102741405B (zh) 2009-11-19 2015-03-04 国立大学法人冈山大学 提高基因表达的系统和保持有该系统的载体
WO2011069529A1 (en) 2009-12-09 2011-06-16 Curevac Gmbh Mannose-containing solution for lyophilization, transfection and/or injection of nucleic acids
ES2683695T3 (es) 2010-01-12 2018-09-27 The University Of North Carolina At Chapel Hill Repeticiones terminales invertidas restrictivas para vectores virales
ES2628889T3 (es) 2010-02-05 2017-08-04 The University Of North Carolina At Chapel Hill Composiciones y métodos para la transducción mejorada del parvovirus
US9228174B2 (en) 2010-03-11 2016-01-05 Uniqure Ip B.V. Mutated rep encoding sequences for use in AAV production
WO2011117258A2 (en) 2010-03-22 2011-09-29 Association Institut De Myologie Methods of increasing efficiency of vector penetration of target tissue
WO2011126808A2 (en) 2010-03-29 2011-10-13 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
US9315825B2 (en) 2010-03-29 2016-04-19 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
WO2011122950A1 (en) 2010-04-01 2011-10-06 Amsterdam Molecular Therapeutics (Amt) Ip B.V. Monomeric duplex aav vectors
US9272053B2 (en) 2010-04-23 2016-03-01 University Of Massachusetts AAV-based treatment of cholesterol-related disorders
EP3540055A1 (en) 2010-04-23 2019-09-18 University of Massachusetts Cns targeting aav vectors and methods of use thereof
CA2833905C (en) 2010-04-23 2019-09-10 University Of Massachusetts Multicistronic expression constructs
US8927514B2 (en) 2010-04-30 2015-01-06 City Of Hope Recombinant adeno-associated vectors for targeted treatment
US9839696B2 (en) 2010-04-30 2017-12-12 City Of Hope Recombinant adeno-associated vectors for targeted treatment
US8808684B2 (en) 2010-09-10 2014-08-19 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Epidermal growth factor receptor (EGFR) and methods of use in adenoviral-associated virus type 6 (AAV6) transduction
JP5010760B2 (ja) 2010-10-05 2012-08-29 タカラバイオ株式会社 ウイルスベクターの製造方法
US8663624B2 (en) 2010-10-06 2014-03-04 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
EP2634253B1 (en) 2010-10-27 2016-05-11 Jichi Medical University Adeno-associated virus virions for transferring genes into neural cells
EP2637702A4 (en) 2010-11-11 2014-11-26 Univ Miami METHODS, COMPOSITIONS, CELLS AND KITS FOR TREATING ISCHEMIC INJURIES
EP2643465B1 (en) 2010-11-23 2016-05-11 The Trustees Of The University Of Pennsylvania Subfamily e simian adenovirus a1321 and uses thereof
EP2673286B1 (en) 2011-02-12 2019-07-03 University of Iowa Research Foundation Therapeutic compounds
SG10202007803QA (en) 2011-02-17 2020-09-29 Univ Pennsylvania Compositions and methods for altering tissue specificity and improving aav9-mediated gene transfer
GB201103062D0 (en) 2011-02-22 2011-04-06 Isis Innovation Method
EP2500434A1 (en) 2011-03-12 2012-09-19 Association Institut de Myologie Capsid-free AAV vectors, compositions, and methods for vector production and gene delivery
EP2700399B1 (en) 2011-04-18 2017-05-31 National Center of Neurology and Psychiatry Drug delivery particles and method for producing same
EP2699688A1 (en) 2011-04-20 2014-02-26 The Trustees Of The University Of Pennsylvania Regimens and compositions for aav-mediated passive immunization of airborne pathogens
LT3254703T (lt) 2011-04-22 2020-05-25 The Regents Of The University Of California Adenoasocijuoto viruso virionai su variantine kapside ir jų panaudojimo būdai
WO2012149646A1 (en) 2011-05-05 2012-11-08 Sunnybrook Research Institute Mirna inhibitors and their uses
US9249425B2 (en) 2011-05-16 2016-02-02 The Trustees Of The University Of Pennslyvania Proviral plasmids and production of recombinant adeno-associated virus
US9598468B2 (en) 2011-05-18 2017-03-21 University Of Florida Research Foundation, Incorporated Polypeptides and vectors for targeting HER2/neu expressing cells and uses thereof
CN103518132B (zh) 2011-06-06 2015-11-25 拜奥卡蒂斯股份有限公司 通过离子型表面活性剂选择性裂解细胞
WO2012177906A1 (en) * 2011-06-21 2012-12-27 Alnylam Pharmaceuticals, Inc. Assays and methods for determining activity of a therapeutic agent in a subject
BR112014001863A2 (pt) 2011-07-27 2017-02-21 Genethon sistemas de expressão baculovírus melhorados
EP2990477B8 (en) 2011-09-08 2018-10-31 uniQure IP B.V. Removal of contaminating viruses from aav preparations
WO2013036889A1 (en) 2011-09-09 2013-03-14 University Of Washington Retrograde transport peptide and use of same for delivery to central nervous system
ES2609860T3 (es) 2011-10-28 2017-04-24 The University Of North Carolina At Chapel Hill Línea celular para la producción de virus adenoasociado
US10640785B2 (en) 2011-11-22 2020-05-05 The Children's Hospital Of Philadelphia Virus vectors for highly efficient transgene delivery
WO2013078199A2 (en) 2011-11-23 2013-05-30 Children's Medical Center Corporation Methods for enhanced in vivo delivery of synthetic, modified rnas
KR102107482B1 (ko) 2012-02-14 2020-05-08 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 심혈관 질환 및 다른 증상에 대한 파라크린 유전자의 전신 전달 및 조절 발현
CN104520428B (zh) 2012-02-17 2018-09-21 费城儿童医院 将基因转移到细胞、器官和组织的aav载体组合物和方法
MX374399B (es) 2012-02-29 2025-03-06 Sangamo Biosciences Inc Composiciones y sus usos para tratar y prevenir la enfermedad de huntington.
CA2870736C (en) 2012-04-18 2021-11-02 The Children's Hospital Of Philadelphia Composition and methods for highly efficient gene transfer using aav capsid variants
US20140162319A2 (en) 2012-05-02 2014-06-12 Sangeetha Hareendran Nucleotide sequences, methods, kit and a recombinant cell thereof
US9163259B2 (en) 2012-05-04 2015-10-20 Novartis Ag Viral vectors for the treatment of retinal dystrophy
CA2871920C (en) 2012-05-08 2021-03-09 Merck Sharp & Dohme Corp. Permeable glycosidase inhibitors and uses thereof
JP6385920B2 (ja) 2012-05-09 2018-09-05 オレゴン ヘルス アンド サイエンス ユニバーシティー アデノ随伴ウイルスプラスミド及びベクター
TWI775096B (zh) 2012-05-15 2022-08-21 澳大利亞商艾佛蘭屈澳洲私營有限公司 使用腺相關病毒(aav)sflt-1治療老年性黃斑部退化(amd)
KR20150014505A (ko) 2012-05-18 2015-02-06 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 아과 e 원숭이 아데노바이러스 a1302, a1320, a1331 및 a1337 및 이것들의 사용
RU2679843C2 (ru) 2012-07-06 2019-02-13 Юниверсити Оф Айова Рисерч Фаундейшн Векторные композиции с модифицированным аденоассоциированным вирусом
WO2014007120A1 (ja) 2012-07-06 2014-01-09 タカラバイオ株式会社 アデノ随伴ウイルスベクターの産生細胞
CA2879514C (en) 2012-07-17 2020-04-14 Universite De Geneve Nucleic acids for down-regulation of gene expression
PT2879719T (pt) 2012-08-01 2018-10-08 Ohio State Innovation Foundation Administração intratecal do vírus adeno-associado 9 recombinante
EP3738974A1 (en) 2012-09-28 2020-11-18 The University of North Carolina at Chapel Hill Aav vectors targeted to oligodendrocytes
JP6363958B2 (ja) 2012-12-25 2018-07-25 タカラバイオ株式会社 Aav変異体
SG11201505272QA (en) 2013-01-08 2015-08-28 Benitec Biopharma Ltd Age-related macular degeneration treatment
DK2954051T3 (da) 2013-02-08 2019-07-08 Univ Pennsylvania Modificeret kapsid til genoverførsel til behandling af nethinden
CA2905952A1 (en) 2013-03-13 2014-10-02 The Children's Hospital Of Philadelphia Adeno-associated virus vectors and methods of use thereof
US9447433B2 (en) 2013-03-15 2016-09-20 The University Of North Carolina At Chapel Hill Synthetic adeno-associated virus inverted terminal repeats
WO2014144844A1 (en) 2013-03-15 2014-09-18 The Board Of Trustees Of The Leland Stanford Junior University tRNA DERIVED SMALL RNAs (tsRNAs) INVOLVED IN CELL VIABILITY
HK1220488A1 (zh) 2013-03-15 2017-05-05 The Children's Hospital Of Philadelphia 含有填充者/填充物多核苷酸序列的载体及其使用方法
AU2014251099B2 (en) 2013-04-08 2019-01-17 The University Of Kansas Chimeric adeno-associated virus/ bocavirus parvovirus vector
EP2792742A1 (en) 2013-04-17 2014-10-22 Universitätsklinikum Hamburg-Eppendorf (UKE) Gene-therapy vectors for treating cardiomyopathy
EP2986635B1 (en) 2013-04-18 2018-10-03 Fondazione Telethon Effective delivery of large genes by dual aav vectors
CN109652385A (zh) 2013-04-20 2019-04-19 全国儿童医院研究所 外显子2靶向U7snRNA多核苷酸构建体的重组腺相关病毒递送
US9719106B2 (en) 2013-04-29 2017-08-01 The Trustees Of The University Of Pennsylvania Tissue preferential codon modified expression cassettes, vectors containing same, and uses thereof
CA2912678C (en) 2013-05-15 2023-10-10 Regents Of The University Of Minnesota Adeno-associated virus mediated gene transfer to the central nervous system
US10006049B2 (en) 2013-05-16 2018-06-26 University Of Florida Research Foundation, Incorporated Hairpin mRNA elements and methods for the regulation of protein translation
WO2014194132A1 (en) 2013-05-31 2014-12-04 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof
WO2014201308A1 (en) 2013-06-12 2014-12-18 Washington University Endothelial-targeted adenoviral vectors, methods and uses therefor
US20160122727A1 (en) 2013-06-13 2016-05-05 Shire Human Genetic Therapies, Inc. Messenger rna based viral production
PH12016500162B1 (en) 2013-07-22 2024-02-21 Childrens Hospital Philadelphia Variant aav and compositions, methods and uses for gene trnsfer to cells, organs, and tissues
RU2018128780A (ru) 2013-07-26 2018-12-05 Юниверсити Оф Айова Рисерч Фаундейшн Способы и композиции для лечения болезней мозга
ITTO20130669A1 (it) 2013-08-05 2015-02-06 Consiglio Nazionale Ricerche Vettore adeno-associato ricombinante muscolo-specifico e suo impiego nel trattamento di patologie muscolari
US11078464B2 (en) 2013-08-30 2021-08-03 Amgen Inc. High titer recombinant AAV vector production in adherent and suspension cells
EP3564379A1 (en) 2013-09-13 2019-11-06 California Institute of Technology Selective recovery
US20160354489A1 (en) 2013-09-26 2016-12-08 Universitat Autònome de Barcelona Gene therapy compositions for use in the prevention and/or treatment of non-alcoholic fatty liver disease
EP3633041A3 (en) 2013-09-26 2020-07-29 University of Florida Research Foundation, Inc. Synthetic combinatorial aav capsid library for targeted gene therapy
NZ758025A (en) 2013-10-11 2022-07-01 Massachusetts Eye & Ear Infirmary Methods of predicting ancestral virus sequences and uses thereof
WO2015060722A1 (en) 2013-10-24 2015-04-30 Uniqure Ip B.V. Aav-5 pseudotyped vector for gene therapy for neurological diseases
US20160272687A1 (en) 2013-11-08 2016-09-22 The Board Of Trustees Of The University Of Arkansas Adeno-associated virus "x" oncogene
EP3068905A4 (en) 2013-11-11 2017-07-05 Sangamo BioSciences, Inc. Methods and compositions for treating huntington's disease
WO2015081101A1 (en) 2013-11-26 2015-06-04 The United States Of America, As Represented By The Secretary Department Of Health And Human Services Adeno-associated virus vectors for treatment of glycogen storage disease
KR102245861B1 (ko) 2013-11-29 2021-04-28 다카라 바이오 가부시키가이샤 아데노 수반 바이러스의 정량 방법
SG11201604505QA (en) 2013-12-03 2016-07-28 Agency Science Tech & Res Tailed Mirtron Effectors For RNAi-Mediated Gene Silencing
GB201322798D0 (en) 2013-12-20 2014-02-05 Oxford Biomedica Ltd Production system
WO2015106273A2 (en) 2014-01-13 2015-07-16 Trustees Of Boston University Methods and assays relating to huntingtons disease and parkinson's disease
GB201401707D0 (en) 2014-01-31 2014-03-19 Sec Dep For Health The Adeno-associated viral vectors
GB201403684D0 (en) 2014-03-03 2014-04-16 King S College London Vector
WO2015127128A2 (en) 2014-02-19 2015-08-27 University Of Massachusetts Recombinant aavs having useful transcytosis properties
WO2015124546A1 (en) 2014-02-19 2015-08-27 Fundación Centro Nacional De Investigaciones Cardiovasculares Carlos Iii- Cnic Aav vectors for the treatment of ischemic and non-ischemic heart disease
US20170007720A1 (en) 2014-02-21 2017-01-12 University Of Florida Research Foundation, Inc. Methods and compositions for gene delivery to on bipolar cells
EP3450571B1 (en) 2014-02-24 2023-04-05 Celgene Corporation Methods of using an activator of cereblon for neural cell expansion and the treatment of central nervous system disorders
EP3113787B1 (en) 2014-03-04 2019-12-04 University of Florida Research Foundation, Inc. Improved raav vectors and methods for transduction of photoreceptors and rpe cells
ES2990174T3 (es) 2014-03-10 2024-11-29 Uniqure Ip Bv Vectores de AAV mejorados producidos en células de insecto
JP6756700B2 (ja) 2014-03-18 2020-09-16 ユニバーシティ オブ マサチューセッツ 筋萎縮性側索硬化症を処置するためのrAAVベースの組成物および方法
EP2933335A1 (en) 2014-04-18 2015-10-21 Genethon A method of treating peripheral neuropathies and motor neuron diseases
WO2015164778A1 (en) 2014-04-25 2015-10-29 The Trustees Of The University Of Pennysylvania Ldlr variants and their use in compositions for reducing cholesterol levels
EP3134522B1 (en) 2014-04-25 2021-10-06 University of Massachusetts Recombinant aav vectors useful for reducing immunity against transgene products
LT3137497T (lt) * 2014-05-02 2021-07-26 Genzyme Corporation Aav vektoriai, skirti tinklainės ir cns genų terapijai
AU2015255877B2 (en) 2014-05-08 2020-03-26 Chdi Foundation, Inc. Methods and compositions for treating huntington's disease
EP3142706A1 (en) 2014-05-16 2017-03-22 Vrije Universiteit Brussel Genetic correction of myotonic dystrophy type 1
RU2711147C2 (ru) 2014-05-20 2020-01-15 Юниверсити Оф Айова Рисерч Фаундейшн Терапевтические соединения для лечения болезни хантингтона
EP3160980B1 (en) 2014-05-28 2020-05-20 The Regents of the University of California HYBRID tRNA/pre-miRNA MOLECULES AND METHODS OF USE
WO2015192063A1 (en) 2014-06-13 2015-12-17 Yasuhiro Ikeda Methods and materials for increasing viral vector infectivity
US10781459B2 (en) 2014-06-20 2020-09-22 University Of Florida Research Foundation, Incorporated Methods of packaging multiple adeno-associated virus vectors
WO2016004319A1 (en) 2014-07-02 2016-01-07 University Of Florida Research Foundation, Inc. Compositions and methods for purifying recombinant adeno-associated virus
US10023846B2 (en) 2014-07-10 2018-07-17 Takara Bio Inc. Production method for non-enveloped virus particles
WO2016019364A1 (en) 2014-08-01 2016-02-04 The Trustees Of The University Of Pennsylvania Compositions and methods for self-regulated inducible gene expression
WO2016054554A1 (en) 2014-10-03 2016-04-07 University Of Massachusetts Heterologous targeting peptide grafted aavs
JP6842410B2 (ja) 2014-10-03 2021-03-17 ユニバーシティ オブ マサチューセッツ 新規の高効率ライブラリーにより同定されるaavベクター
RU2738421C2 (ru) 2014-10-21 2020-12-14 Юниверсити Оф Массачусетс Варианты рекомбинантных aav и их применения
KR20170096998A (ko) 2014-11-05 2017-08-25 보이저 테라퓨틱스, 인크. 파킨슨병의 치료를 위한 aadc 폴리뉴클레오티드
WO2016077687A1 (en) 2014-11-14 2016-05-19 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (als)
WO2016077689A1 (en) 2014-11-14 2016-05-19 Voyager Therapeutics, Inc. Modulatory polynucleotides
WO2016081927A2 (en) 2014-11-21 2016-05-26 University Of Florida Research Foundation, Inc. Genome-modified recombinant adeno-associated virus vectors
AU2015349759B2 (en) 2014-11-21 2022-01-06 The University Of North Carolina At Chapel Hill Aav vectors targeted to the central nervous system
EA037696B1 (ru) 2014-12-24 2021-05-12 ЮНИКЕР АйПи Б.В. Супрессия гена гентингтина, индуцированная рнк-интерференцией
AU2015374043B2 (en) 2014-12-30 2021-05-13 University Of Iowa Research Foundation Methods and compositions for treating brain diseases
US10907176B2 (en) 2015-01-14 2021-02-02 The University Of North Carolina At Chapel Hill Methods and compositions for targeted gene transfer
MX2017009336A (es) 2015-01-16 2017-11-15 Voyager Therapeutics Inc Polinucleótidos dirigidos al sistema nervioso central.
US20180008727A1 (en) 2015-01-30 2018-01-11 The Regents Of The University Of California Spinal subpial gene delivery system
US20180030096A1 (en) 2015-02-03 2018-02-01 University Of Florida Research Foundation, Inc. Recombinant aav1, aav5, and aav6 capsid mutants and uses thereof
CR20170407A (es) 2015-02-10 2017-11-14 Genzyme Corp Mejora del suministro de partículas virales al cuerpo estriado y al córtex
MA40819B1 (fr) 2015-02-10 2020-04-30 Genzyme Corp Variant d'arni
US20180245073A1 (en) 2015-02-23 2018-08-30 Voyager Therapeutics, Inc. Regulatable expression using adeno-associated virus (aav)
AU2016235421A1 (en) 2015-03-20 2017-10-12 Bluebird Bio, Inc. Vector formulations
WO2016154344A1 (en) 2015-03-24 2016-09-29 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof
JP6892433B2 (ja) 2015-04-03 2021-06-23 ユニバーシティ・オブ・マサチューセッツUniversity Of Massachusetts 十分に安定化された非対称sirna
US10081659B2 (en) 2015-04-06 2018-09-25 The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services Adeno-associated vectors for enhanced transduction and reduced immunogenicity
TWI707951B (zh) 2015-04-08 2020-10-21 美商健臻公司 過大腺相關載體之製造
CN115094062A (zh) 2015-04-16 2022-09-23 埃默里大学 用于肝脏中蛋白质表达的重组启动子和载体及其用途
US11020443B2 (en) 2015-04-23 2021-06-01 University Of Massachusetts Modulation of AAV vector transgene expression
US11046955B2 (en) 2015-04-24 2021-06-29 University Of Massachusetts Modified AAV constructs and uses thereof
AU2016256894B2 (en) 2015-05-07 2020-11-26 Massachusetts Eye And Ear Infirmary Methods of delivering an agent to the eye
EP3294398A4 (en) 2015-05-11 2019-01-09 Alcyone Lifesciences, Inc. SYSTEM AND METHOD FOR THE ADMINISTRATION OF MEDICAMENTS
CA2985786A1 (en) 2015-05-12 2016-11-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Aav isolate and fusion protein comprising nerve growth factor signal peptide and parathyroid hormone
US20170067028A1 (en) 2015-05-15 2017-03-09 Douglas J. Ballon Radiolabeling of adeno associated virus
US10729790B2 (en) 2015-05-26 2020-08-04 Salk Institute For Biological Studies Motor neuron-specific expression vectors
WO2016196507A1 (en) 2015-05-29 2016-12-08 University Of Iowa Research Foundation Methods of delivery of transgenes for treating brain diseases
US11266748B2 (en) 2015-07-02 2022-03-08 University Of Florida Research Foundation, Incorporated Recombinant adeno-associated virus vectors to target medullary thyroid carcinoma
ES2895652T3 (es) 2015-07-07 2022-02-22 Inst Nat Sante Rech Med Métodos y composiciones farmacéuticas para expresar un polinucleótido de interés en el sistema nervioso periférico de un sujeto
US20170007669A1 (en) 2015-07-07 2017-01-12 Mayo Foundation For Medical Education And Research Peptide-mediated delivery of active agents across the blood-brain barrier
US20180216133A1 (en) 2015-07-17 2018-08-02 The Trustees Of The University Of Pennsylvania Compositions and methods for achieving high levels of transduction in human liver cells
US20180214576A1 (en) 2015-07-28 2018-08-02 University Of Massachusetts Transgenic expression of dnasei in vivo delivered by an adeno-associated virus vector
CA2994160C (en) 2015-07-30 2021-08-10 Massachusetts Eye And Ear Infirmary Ancestral virus sequences and uses thereof
US20180201937A1 (en) 2015-08-04 2018-07-19 The University Of Chicago Inhibitors of cacna1a/alpha1a subunit internal ribosomal entry site (ires) and methods of treating spinocerebellar ataxia type 6
US10435441B2 (en) 2015-09-23 2019-10-08 Sangamo Therapeutics, Inc. HTT repressors and uses thereof
PT3356390T (pt) 2015-09-28 2021-04-21 Univ Florida Métodos e composições para vetores virais que se evadem a anticorpos
EP4530350A3 (en) 2015-10-09 2025-06-25 Genzyme Corporation Improved flare (flow cytometry attenuated reporter expression) technology for rapid bulk sorting
WO2017062983A1 (en) 2015-10-09 2017-04-13 The Children's Hospital Of Philadelphia Compositions and methods for treating huntington's disease and related disorders
US10123969B2 (en) 2015-10-15 2018-11-13 Wisconsin Alumni Research Foundation Osmotic enhancement of drug/therapeutic delivery to the brain following infusion or injection into the cerebrospinal fluid
US12188037B2 (en) 2015-10-22 2025-01-07 University Of Florida Research Foundation, Incorporated Synthetic combinatorial AAV3 capsid library
WO2017070516A1 (en) 2015-10-22 2017-04-27 University Of Massachusetts Prostate-targeting adeno-associated virus serotype vectors
DK3364997T5 (da) 2015-10-22 2024-09-30 Univ Massachusetts Aspartoacylase genterapi til behandling af canavans sygdom
SG11201803218PA (en) 2015-10-23 2018-05-30 Univ Iowa Res Found Methods for treating neurodegenerative diseases using gene therapy to delay disease onset and progression while providing cognitive protection
EP3368563A1 (en) 2015-10-28 2018-09-05 The Trustees Of The University Of Pennsylvania Intrathecal administration of adeno-associated-viral vectors for gene therapy
EP3368054A4 (en) 2015-10-28 2019-07-03 Voyager Therapeutics, Inc. REGULATORY EXPRESSION USING THE ADENO-ASSOCIATED VIRUS (AAV)
US10633662B2 (en) 2015-11-10 2020-04-28 The Board Of Trustees Of The Leland Stanford Junior University Methods and compositions for modulating AAV infection
MX2018006682A (es) 2015-12-01 2018-09-26 Spark Therapeutics Inc Metodos escalables para producir vector viral adenoasociado (aav) recombinante en un sistema de cultivo celular en suspension libre de suero adecuado para su uso clinico.
US20170151416A1 (en) 2015-12-01 2017-06-01 Invivo Therapeutics Corporation Methods and Systems for Delivery of a Trail of a Therapeutic Substance into an Anatomical Space
US10406244B2 (en) 2015-12-02 2019-09-10 The Board Of Trustees Of The Leland Stanford Junior University AAV vectors with expanded packaging capacity
WO2017096164A1 (en) 2015-12-02 2017-06-08 The Board Of Trustees Of The Leland Stanford Junior University Novel recombinant adeno-associated virus capsids with enhanced human skeletal muscle tropism
WO2017093330A1 (en) 2015-12-03 2017-06-08 Genethon Compositions and methods for improving viral vector efficiency
WO2017100674A1 (en) 2015-12-11 2017-06-15 The Trustees Of The University Of Pennsylvania Scalable purification method for aav1
WO2017100671A1 (en) 2015-12-11 2017-06-15 California Institute Of Technology TARGETING PEPTIDES FOR DIRECTING ADENO-ASSOCIATED VIRUSES (AAVs)
EP3387117B1 (en) 2015-12-11 2022-11-23 The Trustees Of The University Of Pennsylvania Scalable purification method for aav8
ES2918998T3 (es) 2015-12-11 2022-07-21 Univ Pennsylvania Método de purificación escalable para AAVrh10
CN116478254A (zh) 2015-12-14 2023-07-25 北卡罗来纳大学教堂山分校 增强细小病毒载体递送的修饰衣壳蛋白
EP3411059A4 (en) 2016-02-02 2019-10-16 University Of Massachusetts METHOD FOR INCREASING THE EFFECTIVENESS OF THE SYSTEMIC DELIVERY OF AVV GENES TO THE CENTRAL NERVOUS SYSTEM
EP3426787A1 (en) 2016-03-07 2019-01-16 University of Iowa Research Foundation Aav-mediated expression using a synthetic promoter and enhancer
US11155817B2 (en) 2016-03-18 2021-10-26 The Children's Hospital Of Philadelphia Therapeutic for treatment of diseases including the central nervous system
EP3235516B1 (en) 2016-04-22 2019-06-26 Georg-August-Universität Göttingen Stiftung Öffentlichen Rechts Universitätsmedizin Regulatable adeno-associated virus (aav) vector
US20190224339A1 (en) 2016-04-29 2019-07-25 Voyager Therapeutics, Inc. Compositions for the treatment of disease
EP3452495B1 (en) 2016-05-03 2021-06-23 Children's Medical Research Institute Adeno-associated virus polynucleotides, polypeptides and virions
WO2017192750A1 (en) 2016-05-04 2017-11-09 Oregon Health & Science University Recombinant adeno-associated viral vectors
CA3024448C (en) 2016-05-18 2025-09-09 Voyager Therapeutics, Inc. MODULATING POLYNUCLEOTIDES
US10457940B2 (en) 2016-09-22 2019-10-29 University Of Massachusetts AAV treatment of Huntington's disease
SG11201909777YA (en) 2017-05-05 2019-11-28 Voyager Therapeutics Inc Modulatory polynucleotides
SG11201909868YA (en) 2017-05-05 2019-11-28 Voyager Therapeutics Inc Compositions and methods of treating huntington's disease
WO2018220211A1 (en) 2017-06-02 2018-12-06 Institut National De La Sante Et De La Recherche Medicale (Inserm) Viral vector combining gene therapy and genome editing approaches for gene therapy of genetic disorders
GB201714027D0 (en) 2017-09-01 2017-10-18 Proqr Therapeutics Ii Bv Antisense oligonucleotides for the treatment of huntington's disease
WO2019060726A1 (en) 2017-09-22 2019-03-28 Genzyme Corporation Variant rnai
WO2019079240A1 (en) 2017-10-16 2019-04-25 Voyager Therapeutics, Inc. TREATMENT OF AMYOTROPHIC LATERAL SCLEROSIS (ALS)
US20210355454A1 (en) 2018-07-24 2021-11-18 Voyager Therapeutics, Inc. Systems and methods for producing gene therapy formulations
US20220275367A1 (en) 2019-07-24 2022-09-01 Voyager Therapeutics, Inc. Compositions and methods for treating huntington's disease

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110212520A1 (en) * 2002-08-05 2011-09-01 University Of Iowa Research Foundation Rna interference suppression of neurodegenerative diseases and methods of use thereof
US20090118206A1 (en) * 2003-09-12 2009-05-07 University Of Massachusetts Rna interference for the treatment of gain-of-function disorders
US20140004565A1 (en) * 2009-07-06 2014-01-02 Alnylam Pharmaceuticals, Inc. Cell-based bioprocessing
WO2015191508A1 (en) * 2014-06-09 2015-12-17 Voyager Therapeutics, Inc. Chimeric capsids
US20160355808A1 (en) * 2015-04-03 2016-12-08 University Of Massachusetts OLIGONUCLEOTIDE COMPOUNDS FOR TARGETING HUNTINGTIN mRNA

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
AUYEUNG ET AL.: "Beyond secondary structure: primary-sequence determinants license pri-miRNA hairpins for processing", CELL, vol. 152, no. 4, 2013, pages 844 - 858, XP028979903 *

Cited By (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12071625B2 (en) 2014-11-14 2024-08-27 Voyager Therapeutics, Inc. Modulatory polynucleotides
US12123002B2 (en) 2014-11-14 2024-10-22 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
US11542506B2 (en) 2014-11-14 2023-01-03 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
US12084659B2 (en) 2016-05-18 2024-09-10 Voyager Therapeutics, Inc. Modulatory polynucleotides
US11603542B2 (en) 2017-05-05 2023-03-14 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
EP3684388A4 (en) * 2017-09-22 2021-09-22 Voyager Therapeutics, Inc. COMPOSITIONS AND METHODS OF TREATMENT OF HUNTINGTON'S DISEASE
US12116589B2 (en) 2017-10-16 2024-10-15 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis (ALS)
US11434502B2 (en) 2017-10-16 2022-09-06 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis (ALS)
US20240075164A1 (en) * 2018-04-30 2024-03-07 The Trustees Of The University Of Pennsylvania In utero crispr-mediated therapeutic editing of genes
WO2019213183A1 (en) * 2018-04-30 2019-11-07 The Trustees Of The University Of Pennsylvania In utero crispr-mediated therapeutic editing of genes
WO2019222444A3 (en) * 2018-05-16 2019-12-26 Voyager Therapeutics, Inc. Directed evolution of aav to improve tropism for cns
WO2019241486A1 (en) 2018-06-13 2019-12-19 Voyager Therapeutics, Inc. Engineered 5' untranslated regions (5' utr) for aav production
WO2020010042A1 (en) * 2018-07-02 2020-01-09 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis and disorders associated with the spinal cord
US20210254103A1 (en) * 2018-07-02 2021-08-19 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis and disorders associated with the spinal cord
CN112567035A (zh) * 2018-07-02 2021-03-26 沃雅戈治疗公司 肌萎缩侧索硬化症及脊髓相关病症的治疗
WO2020023612A1 (en) 2018-07-24 2020-01-30 Voyager Therapeutics, Inc. Systems and methods for producing gene therapy formulations
CN112770812A (zh) * 2018-07-24 2021-05-07 沃雅戈治疗公司 产生基因治疗制剂的系统和方法
WO2020072849A1 (en) 2018-10-04 2020-04-09 Voyager Therapeutics, Inc. Methods for measuring the titer and potency of viral vector particles
WO2020072844A1 (en) 2018-10-05 2020-04-09 Voyager Therapeutics, Inc. Engineered nucleic acid constructs encoding aav production proteins
US11865190B2 (en) 2018-10-09 2024-01-09 The University Of British Columbia Compositions and systems comprising transfection-competent vesicles free of organic-solvents and detergents and methods related thereto
US11980673B2 (en) 2018-10-09 2024-05-14 The University Of British Columbia Compositions and systems comprising transfection-competent vesicles free of organic-solvents and detergents and methods related thereto
WO2020081490A1 (en) 2018-10-15 2020-04-23 Voyager Therapeutics, Inc. EXPRESSION VECTORS FOR LARGE-SCALE PRODUCTION OF rAAV IN THE BACULOVIRUS/Sf9 SYSTEM
WO2020104469A1 (en) * 2018-11-19 2020-05-28 Uniqure Ip B.V. Method and means to deliver mirna to target cells
CN113631225A (zh) * 2019-01-18 2021-11-09 沃雅戈治疗公司 用于生产aav颗粒的方法和系统
JP2022522995A (ja) * 2019-01-18 2022-04-21 ボイジャー セラピューティクス インコーポレイテッド Aav粒子を生成するための方法及びシステム
WO2020150556A1 (en) 2019-01-18 2020-07-23 Voyager Therapeutics, Inc. Methods and systems for producing aav particles
US12077784B2 (en) 2019-02-22 2024-09-03 Life Technologies Corporation Suspension system for adeno associated virus production
CN113454101A (zh) * 2019-02-22 2021-09-28 生命技术公司 用于腺相关病毒产生的悬浮系统
WO2020172624A1 (en) * 2019-02-22 2020-08-27 Life Technologies Corporation Suspension system for adeno associated virus production
US11608491B2 (en) 2019-02-22 2023-03-21 Life Technologies Corporation Suspension system for adeno associated virus production
WO2020223274A1 (en) 2019-04-29 2020-11-05 Voyager Therapeutics, Inc. SYSTEMS AND METHODS FOR PRODUCING BACULOVIRAL INFECTED INSECT CELLS (BIICs) IN BIOREACTORS
WO2021030125A1 (en) 2019-08-09 2021-02-18 Voyager Therapeutics, Inc. Cell culture medium for use in producing gene therapy products in bioreactors
WO2021041485A1 (en) 2019-08-26 2021-03-04 Voyager Therapeutics, Inc. Controlled expression of viral proteins
US20220213482A1 (en) * 2019-09-16 2022-07-07 Uniqure Ip B.V. Targeting misspliced transcripts in genetic disorders
WO2021072129A2 (en) 2019-10-08 2021-04-15 Trustees Of Boston College Proteins containing multiple, different unnatural amino acids and methods of making and using such proteins
WO2022074464A2 (en) 2020-03-05 2022-04-14 Neotx Therapeutics Ltd. Methods and compositions for treating cancer with immune cells
WO2021222636A1 (en) 2020-04-29 2021-11-04 The Broad Institute, Inc. Machine learning accelerated protein engineering through fitness prediction
US11634742B2 (en) 2020-07-27 2023-04-25 Anjarium Biosciences Ag Compositions of DNA molecules, methods of making therefor, and methods of use thereof
WO2022032153A1 (en) 2020-08-06 2022-02-10 Voyager Therapeutics, Inc. Cell culture medium for use in producing gene therapy products in bioreactors
WO2022040239A1 (en) 2020-08-17 2022-02-24 Massachusetts Institute Of Technology Shank3 gene therapy approaches
WO2022187548A1 (en) 2021-03-03 2022-09-09 Voyager Therapeutics, Inc. Controlled expression of viral proteins
WO2022187473A2 (en) 2021-03-03 2022-09-09 Voyager Therapeutics, Inc. Controlled expression of viral proteins
WO2023034994A1 (en) * 2021-09-03 2023-03-09 Biomarin Pharmaceutical Inc. Aav capsid compositions and methods for delivery
US12331082B2 (en) 2021-10-08 2025-06-17 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
US12116385B2 (en) 2021-10-08 2024-10-15 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
US12331081B2 (en) 2021-10-08 2025-06-17 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
WO2023164545A1 (en) 2022-02-23 2023-08-31 Massachusetts Institute Of Technology Methods for upregulating shank3 expression
WO2024054983A1 (en) 2022-09-08 2024-03-14 Voyager Therapeutics, Inc. Controlled expression of viral proteins
WO2024145474A2 (en) 2022-12-29 2024-07-04 Voyager Therapeutics, Inc. Compositions and methods for regulating mapt
WO2024226761A2 (en) 2023-04-26 2024-10-31 Voyager Therapeutics, Inc. Compositions and methods for treating amyotrophic lateral sclerosis
WO2024233422A1 (en) 2023-05-05 2024-11-14 Massachusetts Institute Of Technology Shank3 gene therapy approaches
WO2025122644A1 (en) 2023-12-05 2025-06-12 Voyager Therapeutics, Inc. Compositions and methods for regulating mapt
WO2025160434A1 (en) * 2024-01-26 2025-07-31 Genzyme Corporation Artificial micrornas targeting huntington's disease

Also Published As

Publication number Publication date
CA3024449A1 (en) 2017-11-23
IL297576B1 (en) 2023-10-01
AU2017268382B2 (en) 2023-09-28
BR112018073472A2 (pt) 2019-08-27
KR20220108216A (ko) 2022-08-02
US20240415868A1 (en) 2024-12-19
MX2018014152A (es) 2019-03-28
US11951121B2 (en) 2024-04-09
IL262763A (en) 2018-12-31
AU2017268382A1 (en) 2018-11-29
KR20190005887A (ko) 2019-01-16
JP7220080B2 (ja) 2023-02-09
IL297576A (en) 2022-12-01
RU2018140499A3 (OSRAM) 2021-01-25
KR102427379B1 (ko) 2022-08-02
SG11201809643UA (en) 2018-12-28
RU2018140499A (ru) 2020-06-18
JP2019519219A (ja) 2019-07-11
US20190160091A1 (en) 2019-05-30
IL297576B2 (en) 2024-02-01
EP3458589A1 (en) 2019-03-27
CN109831916A (zh) 2019-05-31
EP3458589A4 (en) 2020-01-01
RU2764587C2 (ru) 2022-01-18
CN109831916B (zh) 2023-07-21

Similar Documents

Publication Publication Date Title
US11951121B2 (en) Compositions and methods for treating Huntington's disease
US20240226203A9 (en) Compositions and methods of treating huntington's disease
US20230295663A1 (en) Compositions and methods of treating amyotrophic lateral sclerosis (als)
US20220333131A1 (en) Modulatory polynucleotides
US11931375B2 (en) Treatment of amyotrophic lateral sclerosis (ALS)
JP7502991B2 (ja) 筋萎縮性側索硬化症(als)の治療
US20230399642A1 (en) Compositions and methods of treating huntington's disease
US20210254103A1 (en) Treatment of amyotrophic lateral sclerosis and disorders associated with the spinal cord
US20220168450A1 (en) Treatment of amyotrophic lateral sclerosis and disorders associated with the spinal cord

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 3024449

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2018560628

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20187033504

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112018073472

Country of ref document: BR

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17800155

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017268382

Country of ref document: AU

Date of ref document: 20170518

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2017800155

Country of ref document: EP

Effective date: 20181218

ENP Entry into the national phase

Ref document number: 112018073472

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20181114