WO2012149646A1

WO2012149646A1 - Mirna inhibitors and their uses

Info

Publication number: WO2012149646A1
Application number: PCT/CA2012/000423
Authority: WO
Inventors: Burton YANG
Original assignee: Sunnybrook Research Institute
Priority date: 2011-05-05
Filing date: 2012-05-04
Publication date: 2012-11-08

Abstract

The invention relates to miRNA inhibitors and their use for modulation of expression of miRNA targets. In particular the invention relates to a miRNA inhibitor of a miRNA comprising at least one polynucleotide having a sequence complementary to a truncated sequence of the miRNA or sequence complementary thereto, and one or more nucleotides of a loop region of a pre-miRNA sequence from which the miRNA is generated.

Description

TITLE: miRNA Inhibitors and Their Uses

FIELD OF THE INVENTION

The field of this invention is miRNA inhibitors and their use for modulation of miRNA targets.

BACKGROUND OF THE INVENTION

Over the past few years, microRNAs (miRNAs) have emerged as a prominent class of gene regulators (1 ). miRNAs are single- stranded RNA of 18-24 nucleotides (2,3) and function as guide molecules in post-transcriptional gene silencing by partially complementing with the 3 '-untranslated region (UTR) of their target mRNAs, leading to translational repression (4). miRNA genes are transcribed to generate long primary transcripts, which are processed by the RNase III type enzyme Drosha to produce precursor miRNAs (pre-miRNAs) in the nucleus (5). Pre-miRNAs are then exported to the cytoplasm by exportin-5 (6). Following arrival in the cytoplasm, pre-miRNAs are subjected to secondary processing by Dicer, a cytoplasmic RNase Ill-type enzyme (7, 8). By silencing various target mRNAs, miRNAs have key roles in diverse regulatory pathways, including in control of development (9), cell differentiation (10), apoptosis (1 1 -13), cell proliferation (14), division (15), protein secretion (16), and viral infection (17, 18).

Most importantly, miRNAs have been known to play roles in cancer development (19-22). The widespread role of miRNAs in cancer makes them valuable targets for therapeutic intervention. Currently antisense miRNAs, which base-pairs with specific miRNAs in competition with cellular mRNAs, are widely used to inhibit miRNA activity. There are some drawbacks with this approach. The small antisense nucleotides are unstable and may interact with the miRNA leading to co-processing by Dicer, which could then facilitate production of mature miRNA. This would increase the production of mature miRNA, enhancing miRNA functions rather than inhibiting them.

SUMMARY OF THE INVENTION

Applicant has developed an approach to modulate miRNAs that can modulate the functions of mature miRNAs by binding to them and/or inducing mis-processing of the target miRNA producing a non-functional truncated miRNA. The miRNA inhibitors are sometimes referred to herein as miR-PIRATE or microRNA-interacting RNA— producing imperfect RNA and tangling endogenous miRNA. Applicant transfected cells with synthetic miR-PIRATE, and the miR-PIRATE was able to specifically pirate and silence a mature miRNA, and thus could be clinically applied for miRNA intervention.

The invention provides a miRNA inhibitor of a miRNA comprising at least one polynucleotide having a sequence complementary to (i) a truncated sequence of the miRNA (i.e. truncated miRNA sequence) or sequence complementary thereto, and (ii) one or more nucleotides of a loop region of a pre -miRNA sequence from which the miRNA is generated.

The invention provides a miRNA inhibitor of a target miRNA comprising at least one polynucleotide having a sequence complementary to (i) a truncated sequence of the target miRNA (i.e. truncated target miRNA sequence) or sequence complementary thereto, and (ii) one or more nucleotides of a loop region of a pre- miRNA sequence from which the miRNA is generated.

A miRNA inhibitor of the invention can modulate activity of a miRNA, in particular a target miRNA, or a pre-miRNA from which a miRNA is generated. The miRNA inhibitor can bind to a miRNA (in particular target miRNA) and/or induce mis-processing of a miRNA (in particular target miRNA).

The invention provides a miRNA inhibitor of a target miRNA comprising at least one polynucleotide having a sequence complementary to (i) a truncated sequence of the target miRNA (i.e. truncated target miRNA sequence) or sequence complementary thereto, and (ii) one or more nucleotides of a loop region of a pre- miRNA sequence from which the miRNA is generated, wherein the miRNA inhibitor can bind to the target miRNA or induce mis-processing of the target miRNA.

The invention also relates to a miRNA inhibitor of a target miRNA comprising at least one polynucleotide sequence that is complementary to (i) a truncated sequence of a strand of a miRNA duplex, and (ii) one or more nucleotides of the loop region of a pre-miRNA, wherein the target miRNA is produced by processing of the pre- miRNA to the miRNA duplex and cleavage of the miRNA duplex.

The invention also relates to a miRNA inhibitor of a target miRNA comprising at least one polynucleotide sequence that is sufficiently complementary to hybridize to a sequence of a pre-miRNA comprising a truncated sequence of the target miRNA or sequence complementary thereto, and, one or more nucleotides of a loop region of the pre-miRNA.

In aspects of the invention, the nucleotides of the truncated sequence of the target miRNA and loop region nucleotides are contiguous. In an embodiment, the invention relates to a miRNA inhibitor of a target miRNA comprising at least one polynucleotide sequence that is sufficiently complementary to hybridize to a sequence of a pre-miRNA from which the target miRNA is generated, the pre-miRNA sequence comprising a truncated sequence of the target miRNA or a sequence complementary thereto, and one or more nucleotides of a loop region of the pre-miRNA contiguous to the truncated sequence.

In an aspect, the present invention relates to a miRNA inhibitor of a target miRNA of the formula [A - B]_n where A is a polynucleotide complementary to a truncated sequence of the target miRNA or a sequence complementary thereto, and one or more nucleotides of a loop region of a pre-miRNA sequence from which the target miRNA is generated; B is an optional spacer; and, n is 1 to 32.

In another aspect, the present invention relates to a miRNA inhibitor of a target miRNA of the formula [A - B]_n where A is a polynucleotide sufficiently complementary to a sequence of a pre-miRNA comprising a truncated sequence of the target miRNA or sequence complementary thereto, and, one or more nucleotides of a loop region of the pre-miRNA; B is an optional spacer; and, n is 1 to 32.

The invention relates to vectors comprising a miRNA inhibitor of the invention. In an aspect, an expression vector may be used to deliver a miRNA inhibitor to a cell or subject. The invention also relates to cells, in particular target cells or host cells comprising the miRNA inhibitors of the invention. In some embodiments, the invention provides host cells comprising the vectors of the present invention. The vectors of the present disclosure may comprise one or more regulatory sequence.

The present invention also features a pharmaceutical composition comprising a miRNA inhibitor of the invention. In an aspect the pharmaceutical composition comprises an effective amount of a miRNA inhibitor of the invention. In an aspect the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, excipient or diluent. In one embodiment, the composition is formulated for injection. In another embodiment, the pharmaceutical composition is combined with a kit for administration, for example for parenteral or catheter administration.

The present invention further provides a method of modulating gene expression in a cell comprising contacting the cell with a miRNA inhibitor of the invention. Contact with the miRNA inhibitor may cause a change in gene expression in the cell in comparison to gene expression in a cell not in contact with the miRNA inhibitor.

In an aspect, the invention provides a method of inhibiting gene expression modulated by a target miRNA in a cell or subject. In an embodiment, the method includes contacting the cell with an effective amount of a miRNA inhibitor comprising a polynucleotide that is sufficiently complementary to hybridize to nucleotides of a sequence of a pre-miRNA comprising a truncated target miRNA sequence or a sequence complementary thereto and one or more nucleotides of the loop region of the pre-miRNA.

In an aspect, the invention provides a method of increasing levels of a RNA or protein that are encoded by a target gene whose expression is down-regulated by a target miRNA by administering a miRNA inhibitor of the target miRNA of the invention. The miRNA inhibitor reduces or inhibits binding of the target miRNA to the target gene thereby increasing levels of the RNA or protein.

In an aspect, the invention provides a method of modulating a target miRNA in a cell or subject comprising administering to the cell or subject a miRNA inhibitor of the target miRNA of the invention, thereby modulating activity of the target miRNA. In an aspect, the invention provides a method of reducing the levels of a target miRNA in a cell or subject comprising administering to the cell or subject a miRNA inhibitor of the target miRNA of the invention, thereby reducing the levels of the target miRNA. Such methods include contacting the cell or subject with the miRNA inhibitor for a time sufficient to allow uptake of the miRNA inhibitor into the cell.

In an aspect, the invention provides a method of increasing expression of a target gene or gene product encoded by the target gene by providing a miRNA inhibitor of the invention which binds to or mis-processes a target miRNA that binds a mRNA transcribed from the target gene. The binding of the miRNA inhibitor to the target miRNA (or in some aspects the complementary sequence) can cause an increase in mRNA expression. In the case of a subject, the method can be used to increase expression of a target gene or gene product encoded by the target gene and treat a condition associated with a low level of expression of the gene.

The invention also relates to a method of misprocessing in a cell or subject a target miRNA, or pre-miRNA for the target miRNA, comprising administering to the cell or subject a polynucleotide that is sufficiently complementary to hybridize to a sequence of a pre-miRNA for the target miRNA comprising a truncated target miRNA sequence or sequence complementary thereto, and one or more nucleotides of a loop region of the pre-miRNA, thereby misprocessing the miRNA or pre-miRNA. In aspects of the invention, the polynucleotide is sufficiently complementary to hybridize to contiguous nucleotides of a sequence of a pre-miRNA comprising a truncated target miRNA sequence or sequence complementary thereto, and one or more loop region nucleotides.

The present invention also provides methods of treating or preventing a miRNA condition in a subject comprising administering to a subject a miRNA inhibitor or composition of the invention. The present invention also provides methods of treating or preventing a miRNA condition associated with a target miRNA in a subject comprising administering to a subject a miRNA inhibitor of the target miRNA of the invention or composition comprising such miRNA inhibitor. In particular, a miRNA inhibitor of the invention can be delivered to a cell or subject to inhibit or reduce the activity of a target miRNA such as when aberrant or undesired target miRNA activity is linked to a disease or disorder.

The present invention also relates to the use of a miRNA inhibitor or composition of the invention to treat or prevent a miRNA condition or in the preparation of a medicament for treating or preventing a miRNA condition or a miRNA condition associated with a target. The present invention also relates to the use of a miRNA inhibitor or composition of the invention to inhibit or reduce the activity of a target miRNA such as when aberrant or undesired target miRNA activity is linked to a disease or disorder.

In another aspect of the invention, a library of miRNA inhibitors comprising a plurality of oligonucleotides designed to target a plurality of miRNA is provided.

Also provided in the present invention is a method of identifying a miRNA inhibitor that modulates gene expression comprising: (a) contacting a cell with a library comprising a plurality of miRNA inhibitors of the invention designed to target a plurality of miRNA in the host cell; (b) analyzing a gene expression profile of the cell to determine the gene whose expression is modulated by contact with the library; and (c) identifying the miRNA inhibitor within the library that modulates gene expression. In another aspect, the method comprises identifying the gene being modulated by the library. A target miRNA may modulate apoptosis, fat metabolism, development, differentiation, proliferation, or stress response. In some embodiments, a target miRNA may be selected from the group of miR-1 , miR-133, miR-206, miR-208, miR-22, miR-26, miR-29, miR-30, miR-98, miR-128, miR-143, miR-145 and miR- 378. In aspects of the invention the target miRNA is overexpressed in a condition or disease selected from the group of immune disease, neurological disease, developmental disease, cardiovascular, skeletal disease, or cancer. In aspects of the invention, the cancer may be selected from the group consisting of: leukemia, lymphoma, gastric cancer, lung cancer, liver cancer and prostate cancer. In some embodiments, the target miRNA may be encoded from the miR-17-92 cluster or miR- 106-363 cluster. In other embodiments, the miRNA may be miR-21 , miR-150, miR- 155, miR-375, miR-1 -1 , miR-1 -2 or miR- 133. The target miRNA may be overexpressed and/or secreted by tumor cells.

In other aspects, the target miRNA is a viral miRNA. In some embodiments, the viral target miRNA is from rotavirus, influenza virus, parainfluenza virus, respiratory synctyial virus, herpes virus, Flavivirus, human immunodeficiency virus, hepatitis virus, human papillomavirus, Epstein-Barr virus, Ebola virus, Rous sarcoma virus, human rhinovirus, Variola virus, and poliovirus.

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the invention are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

DESCRIPTION OF THE DRAWINGS

The invention will now be described in relation to the drawings in which: Fig 1. Generation of a construct interfering miR-378 biogenesis and function (a) Generation of a miR-Pirate-378 expression construct that contains sixteen sequences of 'ggtaacacacaggacctggagtc' [SEQ ID NO. 1 ]. (b) The pre-miR-378 is hypothesized to be misprocessed by the miR-Pirate-378 product to produce truncated miR-378 containing the sequence ' 5 ' gacuccagguccuguguguuacc ' [SEQ ID NO. 2]. The bolded underlined nucleotides are part of the mature miR-378, while the non- underlined sequence is from the loop of pre -miR-378. [SEQ ID NOs 1 to 10] Fig 2. Expression of miR-378 affected by miR-Pirate-378. Total RNAs were isolated from astrocytoma cell line U87 and breast cancer cell line 4T1 (a), and transgenic mice (b) expressing miR-Pirate-378, followed by RT-PCR analysis of miRPirate-378 or mature miR-378 levels. Controls were either cells transfected with GFP or wildtype mice. In all cases, expression of miR-Pirate-378 was significantly higher while expression of mature miR-378 was significantly lower in the miR-Pirate- 378 groups than in the control groups, (c) Total RNAs were isolated from astrocytoma cells or transgenic mice expressing miRPirate- 378 and subjected to RT-PCR. The PCR products were cloned (C I , C2, C3 ... from cells and Ml , M2, ... from mice) and sequenced. The sequences obtained from pre-miR-378 are listed [SEQ ID NOs. 1 1 to 15] (d) Cell lysate prepared from miR-378-transfected cells was analyzed on Western blot probed with anti-vimentin and anti-actin antibodies simultaneously. The miR- 378-transfected cells expressed lower levels of vimentin than the GFP-transfected cells. Expression of vimentin was also tested with RT-PCR (right panel), (e) Vimentin 3'-UTR was found to be the potential target of miR-378 and was thus inserted into the luciferase reporter vector pMir-Report. Mutations were generated on the potential target sequence (bold). Lower, U343 cells were co-transfected with the miR-378 construct and the luciferase reporter construct harboring vimentin 3'-UTR (VIM-luc) or mutant vimentin 3'UTR (VIM-luc -mut). As a negative control, the luciferase reporter construct was engineered with a non-related fragment of cDNA (Ctrl). Luciferase activity assays indicated that the miR-378 construct repressed luciferase activity when it harbored the vimentin 3 '-UTR, which was abolished when the potential miR-378 target site was mutated. Significant differences are indicated by asterisks. Error bars, SD (n=3), ** p<0.01. [SEQ ID NOs. 16 to 20] (f) Cell lysate prepared from the hearts of the miR-Pirate-378 transgenic mice was analyzed on Western blot probed with antibodies against SuFu and vimentin. The same membranes were probed for GADPH levels to confirm equal loading.

Fig 3. Expression of miR-Pirate-378 decreases cell survival and colony formation, (a) The miR-Pirate-378- or GFP-transfected 4T1 or U87 cells were cultured in serum-free medium. Examination of cell survival indicated that the cells transfected with miR-Pirate-378 decreased cell survival compared with the GFP- transfected cells, (b) The cells were cultured in soft agar for 36 days. Cells expressing miR-Pirate-378 formed significantly less and smaller colonies than those expressing GFP. (c) The miR-378- or GFP-transfected U87 cells were cultured in serum-free medium, or serum-containing medium and treated with C2-ceramide, Cytarabine, or Methotrexate. Expression of miR-378 enhanced cell survival and drug-resistance, (d) The miR-Pirate-378- or GFP-transfected U87 cells were cultured in serum-free medium, or serum-containing medium and treated with C2-ceramide, Cytarabine, or Methotrexate. Expression of miR-Pirate-378 decreased cell survival and enhanced the effect of the chemotherapeutic drugs.

Fig 4. Functions of miR-Pirate-98. (a) 4T1 cells stably transfected with miR- 98, miR-Pirate-98, or control GFP were seeded on tissue cultures plates containing 5% FBS and studied in proliferation assays. *P < 0.05, **P< 0.01. Error bars, SEM (n=4). (b) 4T1 cells stably transfected with miR-98, miR-Pirate-98, or a control vector were seeded on tissue cultures plates in serum-free conditions. Cell survival was monitored by counting the viable cells. **P< 0.01. Error bars indicate SEM (n=4). (c) 4T1 cells (103) transfected with miR-98, miR-Pirate-98, or GFP were mixed with 0.3% low melting agarose containing 10% FBS and plated on 0.66% agarose-coated 6-well plates. Four weeks after cell inoculation, colonies were examined and photographed. Colonies were counted. Typical colonies from each group are shown (Lower Panel), (d) The GFP-, miR-98-, and miR-Pirate-98-transfected cells were mixed with Ypen cells and inoculated in Matrigel, followed by examination of tube formation. The Ypen cells formed larger complexes and longer tubes when mixed with the miR-Pirate-98-expressing cells compared with the GFP- and miR-98- transfected cells, (e) 4T1 cells stably transfected with miR-98, miR-Pirate-98, or GFP were inoculated onto matrigel in trans-well inserts. Three days after inoculation, the cells were stained with DII to examine cell invasion. The cells expressing miR-Pirate- 98 exhibited stronger invasive activity than the others (Left). A typical invasion field is shown (Right), (f) 4T1 cells transfected with miR-98, miR-Pirate-98, or control GFP were injected subcutaneously into Balb/c regular mice. Mouse survival was monitored, (g) Tumors formed by cells transfected with miR-98, miR-Pirate-98, or GFP were subjected to H&E staining. Invasion of the tumor cells with stromal muscles (marked by dotted lines) occurred extensively for the iniR-Pirate-98- transfected cells than for the GFP-transfected cells. The miR-98 cells showed little invasive activity. Scale bars, 100 μιη. (h) The tumor sections were subjected to immunohistochemistry probed with anti-CD34 antibody to visualize blood vessels (arrows). Scale bar, 80 μηι. (i) Cell lysates were prepared from tumors formed by 4T1 cells stably transfected with mir-98, miR-Pirate-98, or control GFP. The lysates were subjected to Western blot analysis for expression of ADAM-15 and MMP-1 1. The same membranes were probed for actin expression to confirm equal loading. Expression of miR-98 repressed expression of these proteins compared with GFP control, while expression of miR-Pirate-98 played opposite effects.

Fig. 5. Functions of synthesized miR-pirate. Mouse breast cancer cells 4T1

(a), human brain tumor cell line U87 (b), and U87 (c) were transiently transfected with miR-pirate-378, miR-pirate-98, and miR-pirate- 17, respectively. RNAs were isolated and subjected to real-time PCR analysis of the levels of miR-pirate-378, miRpirate-98, miR-pirate-17, and mature miR-378, miR-98, and miR-17. (d) U87 cells were also transfected with regular miR-378 inhibitor along with the related miR-pirate sequences. Levels of miR-378 were analyzed by real-time PCR.

Fig. 6. (a) MT-1 and A431 cells were transiently transfected with a construct expressing the antisense of miR-199a*. Real-time PCR analysis showed up-regulation of miR-199a*. (b) Primers used to specifically amplify the pirated miRs [SEQ ID NOs. 21 -23].

Fig. 7. (a) Sequences obtained after cloning of the PCR products. Upper, five clones from U87 cells transfected with miR-378, Lower, four clones obtained from miR-pirate-378 transgenic mice. .[SEQ ID NOs. 24 to 38] (b) Structure of luciferase reporter construct containing the 3'UTR of vimentin, the mutant construct, or the construct containing a non-related fragment.[SEQ ID NOs. 39 to 43]

Fig. 8. Generation of a construct interfering miR-98 biogenesis and function, (a) Generation of a miR-Pirate-98 expression construct that contains sixteen sequences of 'ugagguaguaaguuguauuguu'[SEQ ID NO: 44]. (b) The pre-miR-98 is hypothesized to be misprocessed by the miR-Pirate-98 product to produce truncated miR-98 containing the sequence 'S'uaguaagiiuguauuguuguggg' [SEQ ID NO: 45]. The bolded underlined nucleotides are part of the mature miR-98, while the non- underlined sequence is from the loop of pre-miR-98. [SEQ ID NOs. 40 to 53]

Fig. 9. (a) 4T1 cells stably transfected with miR-98, miR-pirate-98, or a control vector were seeded on Petri dishes in serum-free conditions, followed by examination of cell survival, (b) The tumor sections were subjected to immunohistochemistry probed with anti-CD34 antibody to detect blood vessels (arrows). Large number of vacuoles, a sign of unhealthy and dead cells, could be detected in the miR-98 tumor, but not in the other two groups, (c) Cell lysates were prepared from the 4T1 cells stably transfected with mir-98, miRpirate-98, or control GFP. The lysates were subject to Western blot analysis for expression of ADAM-15 and MMP-1 1. The same membranes were probed for actin expression to confirm equal loading. Expression of iniR-98 repressed expression of these proteins compared with GFP control, while expression of miR-pirate-98 played opposite effects.

DETAILED DESCRIPTION OF THE INVENTION

Glossary

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The following definitions supplement those in the art and are directed to the present application and are not to be imputed to any related or unrelated case. Although any methods and materials similar or equivalent to those described herein can be used in the practice of the invention, particular materials and methods are described herein.

Numerical ranges recited herein by endpoints include all numbers and fractions subsumed within that range (e.g. 1 to 5 includes 1 , 1.5, 2, 2.75, 3, 3.90, 4, and 5). It is also to be understood that all numbers and fractions thereof are presumed to be modified by the term "about." The term "about" means plus or minus 0.1 to 50%, 5-50%, or 10-40%, preferably 10-20%, more preferably 10% or 15%, of the number to which reference is being made. As used herein and in the appended claims, the singular forms "a", "an", and "the" include plural reference unless the context clearly dictates otherwise.

As used herein, the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

The term "contiguous" refers to a continuous, finite, sequence of units wherein each unit has physical contact with at least one other unit in the sequence. For example, a contiguous sequence of nucleotides or nucleic acids is physically connected by phosphodiester bonds. Generally, contiguous refers to the coverage of the region without gaps.

"MicroRNA" and "miRNA" refer to short, single-stranded RNA molecules approximately 21 -23 nucleotides in length that are partially complementary to one or more mRNA molecules (target mRNAs). MiRNAs down-regulate gene expression by inhibiting translation or by targeting the mRNA for degradation or deadenylation. MiRNAs base-pair with miRNA recognition elements (MREs) located on their mRNA targets, usually on the 3 ^'-UTR, through a region called the 'seed region' which includes nucleotides 2-8 from the 5 '-end of the miRNA. Matches between a miRNA and its target are generally asymetrical. The complementarity of seven or more bases to the 5 '-end miRNA has been found to be sufficient for regulation.

MiRNAs are first transcribed as primary transcripts (pri-miRNA) by RNA polymerase II or RNA polymerase III. Generally, a pri-miRNA comprises a double stranded stem of about 33 base pairs, a terminal loop and two flanking unstructured single-stranded segments. Pri-miRNA is processed by a protein complex which consists of an RNase III enzyme (Drosha), and a double stranded-RNA binding protein (DGCR8 or DiGeorge syndrome critical region 8 gene) resulting in a short 70- nucleotide stem-loop structure called pre-miRNA. The pre-miRNA is transported from the nucleus to the cytoplasm by Exportin-5 (Exp-5) by the action of RanGTPase. In the cytoplasm, Dicer (an RNAse III endonuclease) cleaves the pre-miRNAs into short RNA duplexes termed miRNA duplexes. After cleavage, the miRNA duplex is unwound by an RNA helicase and the mature miRNA strand binds to its target mRNAs, and the complementary strand (i.e. passenger strand) is degraded.

Additional information related to miRNAs generally, as well as a database of known published miRNAs and searching tools for mining the database can be found in the art including the following references. The sequences of several hundred miRNAs from a variety of different species, including humans, may be found at the microRNA registry (Griffiths-Jones, Nucl. Acids Res. 2004 32:D109-D1 1 1 ), as found at the world-wide website of the Sanger Institute (Cambridge, UK) (which may be accessed by typing "www" followed by ".sanger.ac.uk/cgi- bin/Rfam//MiV«a/browse.pl" into the address bar of a typical internet browser). The sequences of all of the microRNAs deposited at the microRNA registry, include more than 300 microRNA sequences from humans (see Lagos-Quintana et al, Science 294:853-858 (2001); Grad et al, Mol Cell 1 1 : 1253-1263 (2003); Mourelatos et al, Genes Dev 16:720-728 (2002); Lagos-Quintana et al, Curr Biol 12:735-739 (2002); Lagos-Quintana et al, RNA 9: 175-179 (2003); Dostie et al, RNA 9: 180-186 (2003); Lim et al, Science 299: 1540 (2003); Houbaviy et al, Dev Cell 5:351 -358 (2003); Michael et al, Mol Cancer Res 1 :882-891 (2003); Kim et al, Proc Natl Acad Sci USA 101 :360-365 (2004); Suh et al, Dev Biol 270:488-498 (2004); Kasashima et al, Biochem Biophys Res Commun 322:403-410 (2004); Xie et al, Nature 434:338-345 (2005); and Jiang Q., Wang Y., Hao Y., Juan L., Teng M., Zhang X., Li M., Wang G., Liu Y., (2009) miR2Disease: a manually curated database for microRNA deregulation in human disease. Nucleic Acids Res 37:D98-104.).

"Pre-miRNA" or "pre-miR" refers to a short 70-nucleotide stem-loop structure processed from a pri-miRNA. A pre-miRNA comprises a stem or double stranded region (i.e., a region of a nucleic acid molecule that is in a double stranded conformation via hydrogen bonding between the nucleotides) and a loop region of unpaired nucleotides at the terminal end of the stem. The unpaired nucleotides of the loop region of a pre-miRNA are also referred to herein as 'loop region nucleotides" or "nucleotides of the loop region". The double stranded region includes the mature miRNA sequence (that binds to a target mRNA) hydrogen bonded to its complementary sequence. In aspects of the invention, the mature miRNA sequence is a target miRNA sequence.

As used herein, the term "gene" refers to a genomic gene comprising transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (e.g., introns, 5 ' and 3 '-untranslated sequences). The tenn "gene" encompasses sequences including without limitation: a coding sequence; a promoter region; a transcriptional regulatory sequence; a non-expressed DNA segment that is a specific recognition sequence for regulatory proteins; a non- expressed DNA segment that contributes to gene expression, (e.g., a DNA segment that can be transcribed into a 3' untranslated region of an mRNA, which is in turn targeted and bound by miRNAs); a DNA segment designed to have desired parameters; or combinations thereof. Typically a gene comprises a coding strand (or sense strand) and a non-coding strand. A coding strand refers to a nucleic acid sequence that has the same sequence of nucleotides as an mRNA from which the gene product is translated. A "template strand" or "antisense strand" refers to a nucleic acid sequence that is complementary to a coding/sense strand. However, for genes that do not encode polypeptide products, such as miRNA genes, the term "coding strand" is used to refer to the strand comprising the miRNA. The strand comprising the miRNA is a sense strand with respect to the miRNA precursor, but it would be antisense with respect to its target RNA (i.e., the miRNA hybridizes to the target RNA because it comprises a sequence that is antisense to the target RNA). The terms "nucleic acid", "polynucleotide", and "nucleic acid molecule" refer to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), or fragments generated by any of ligation, scission, endonuclease action, and exonuclease action. Nucleic acids can comprise monomers that are naturally occurring nucleotides (such as deoxyribonucleotides and ribonucleotides), or analogs of naturally occurring nucleotides (e.g., alpha-enantiomeric forms of naturally occurring nucleotides), or a combination of both. Nucleic acids can be either single stranded or double stranded. In aspects of the invention a nucleic acid, polynucleotide or nucleic acid molecule is an engineered, isolated, artificial or synthetic nucleic acid, polynucleotide or nucleic acid molecule.

A polynucleotide may have one or more modifications, including inclusion of one or more modified nucleotide. A "modified nucleotide" may have modifications in sugar moieties and/or in pyrimidine or purine base moieties. Examples of sugar modifications include replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars functionalized as ethers or esters. An entire sugar moiety may be replaced with sterically and electronically similar structures, for example, aza-sugars and carbocyclic sugar analogs. Base modifications include, without limitation, alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes.

In aspects of the invention, a polynucleotide may be comprised of one or more "locked nucleic acids". "Locked nucleic acids" (LNAs) are modified ribonucleotides that contain an extra bridge between the 2' and 4' carbons of the ribose sugar moiety resulting in a "locked" conformation that gives enhanced thermal stability. In other aspects of the invention, a polynucleotide may be comprised of one or more sugar modifications such as 2'-0-alkyl (e.g. 2'-0-methyl, 2'-0-methoxyethyl), 2'-fluoro, and 4'-thio modifications. In still other aspects a polynucleotide may be comprised of one or more backbone modifications, such as one or more phosphorothioate, morpholino, or phosphonocarboxylate linkages (see, for example, U.S. Pat. Nos. 6,693, 187 and 7,067,641). Other modifications to enhance stability and improve efficacy are known in the art and are suitable for use in the the present invention (see for example, the modifications described in U.S. Pat. No. 6,838,283, and US Published. Application Nos. 2009/0203893 and 2010/0222413). In aspects of the invention phosphodiester bonds or analogs of such linkages may link nucleic acid monomers. Examples of analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like.

The term "nucleic acid", "polynucleotide" or "nucleic acid molecule" also includes "peptide nucleic acids", which comprise naturally occurring or modified nucleic acid bases attached to a polyamide backbone.

In some embodiments, RNA polynucleotides may have modified backbones including those with one or more modified internucleotide linkages that are phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'- alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3' amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments modified RNA polynucleotide backbones do not include a phosphorus atom and are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These backbones include morpholinio linkages (in part formed from the sugar moiety of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulphone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulphamate backbones; methyleneimino and methylenehydrazino backbones; sulphonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CI¾ component parts. (See also, for example, U.S. Pat. Application Nos. 20050032068; 20080255065; 20080268441 ; 20090143319; and 20090143326; and references cited therein).

Polynucleotides can be cloned, synthesized, recombinantly altered, mutagenized, or subjected to combinations of these techniques. Recombinant DNA and molecular cloning techniques used to isolate nucleic acids are known in the art. (See for example, the methods described by Sambrook and Russell (2001). Molecular Cloning: A Laboratory Manual (3rd ed.), Cold Spring Harbor Laboratory Press). Base pair changes, deletions, or small insertions to polynucleotides can also be obtained using methods known in the art (see for example, Sambrook & Russell, 2001 ).

The phrase "operatively linked", when describing the relationship between two nucleic acid regions, refers to a juxtaposition wherein the regions are in a relationship permitting them to function in their intended manner. For example, a regulatory sequence "operatively linked" to a coding sequence can be ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the regulatory sequences. In some embodiments, the phrase refers to a promoter connected to a coding sequence such that transcription of that coding sequence is controlled and regulated by the promoter. Techniques for operatively linking a promoter to a coding sequence are known in the art. The phrase "operatively linked" may also refer to a transcription termination sequence that is connected to a nucleic acid sequence in such a way that termination of transcription of that sequence is controlled by that transcription termination sequence.

The term "regulatory sequence" refers to polynucleotide sequences, such as initiation signals, enhancers, regulators, promoters, and termination sequences, which are necessary or desirable to affect the expression of coding and non-coding sequences to which they are operatively linked. The term "regulatory sequence" is intended to include, at a minimum, components the presence of which can influence expression, and can also include additional components the presence of which is advantageous, for example, leader sequences and fusion partner sequences.

Exemplary regulatory sequences are described in the art (see for example Goeddel, Methods Enzymol. 185:3-7 (1990)). In certain embodiments, the regulatory sequence is a promotor. The regulatory sequence may be a transcription termination sequence (for example, an RNA polymerase III termination sequence). In certain instances, transcriptional terminators are also responsible for correct mRNA polyadenylation.

A "promoter" refers to a nucleotide sequence within a gene that is positioned 5' to a coding sequence and functions to direct transcription of the coding sequence. A promoter may be synthetic or a naturally-derived molecule which conferrs, activates or enhances expression of a nucleic acid. A promoter region comprises a transcriptional start site, and can additionally include one or more transcriptional regulatory elements. Regulatory elements may enhance expression or alter the spatial or temporal expression of a nucleic acid. A promoter may be derived from sources including viral, bacterial, fungal, plants, insects and animals. A promoter can be selected to provide an optimum level and pattern of expression of a polynucleotide following transfection or transformation. A promoter can also be selected that is regulated in response to specific physiologic signals permitting inducible expression of the gene product.

In some aspects of the invention, the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, SV40 late promoter, the Rous sarcoma virus long terminal repeat (RSV-LTR) promoter, rat insulin promoter, bacteriophage T7 promoter, bacateriophage T3 promoter, SP6 promoter, Pol III (e.g., U6 or Pol III Hl -RNA promoter), Pol II promoter or glyceraldehyde-3-phosphate dehydrogenase promoter may be employed. The use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art to achieve expression of a coding sequence of interest is contemplated as well, provided that the levels of expression are sufficient for a desired purpose. In embodiments of the invention illustrated herein the CMV promoter is employed but other promoters could have been used for the same purpose.

A "spacer' is a sequence linking units of polynucleotides [A] in a miRNA inhibitor as described herein. A spacer may have up to 30 nucleotides, more usually not more than about 20 nucleotides, and in some embodiments at least about 16, 10, or 5 nucleotides. Usually the number of nucleotides in each spacer in a miRNA inhibitor will not differ by more than 4 nucleotides, usually not more than 2 nucleotides or 1 nucleotide. The particular spacer will be selected to provide the optimum activity of the miRNA inhibitor. The spacer may be a naturally occurring linking group from a naturally occurring RNA, a truncated naturally occurring linking group, truncated by from 1 to 6 nucleotides, a poly-U or -A, or combination thereof, random, alternating or block, abasic nucleotides, or portions of one with another. The spacer may be selected to provide minimal interference with the binding of the miRNA inhibitor with the target miRNA, minimize cross-reactivity with non-target miRNA, and provide for optimum binding of the miRNA inhibitor and the target miRNA. Examples of suitable spacers are shown in Table 1.

As used herein, the terms "polypeptide", "protein", and "peptide", refer to a polymer of the 20 protein amino acids, or amino acid analogs, regardless of its size or function. As used herein, the terms "protein", "polypeptide", and "peptide" are used interchangeably herein when referring to a gene product. The term "polypeptide" encompasses proteins of all functions. Examples of polypeptides include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments, and other equivalents, variants and analogs of the foregoing. A "fragment" of a polypeptide refers to a polypeptide in which amino acid residues are deleted as compared to a reference polypeptide, but where the remaining amino acid sequence is usually identical to the corresponding positions in the reference polypeptide. Deletions may occur at the amino-terminus or carboxy-terminus of the reference polypeptide, or alternatively both. A fragment may be at least 5, 6, 8 or 10 amino acids long, at least 14 amino acids long, at least 20, 30, 40 or 50 amino acids long, at least 75 amino acids long, or at least 100, 150, 200, 300, 500 or more amino acids long. A fragment may retain one or more of the biological activities of the reference polypeptide.

The term "primer" refers to a sequence comprising in some embodiments two or more deoxyribonucleotides or ribonucleotide. A primer may comprise more than three, more than eight, or at least about 20 nucleotides of an exonic or intronic region.

The term "vector" refers to a nucleic acid capable of transporting another nucleic acid to which it has been linked. A vector includes those capable of autonomous replication and expression of nucleic acids to which they are linked. A vector can be used to deliver a polynucleotide or nucleic acid of interest to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. The term "vector" includes an autonomously replicating plasmid or a virus. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like. "Expression vectors" are vectors capable of directing the expression of genes to which they are operatively linked. Expression vectors for use in recombinant techniques are generally in the form of plasmids but other forms of expression vectors which serve equivalent functions may be utilized. An expression vector may be replicated in a living cell, or it can be made synthetically. The terms "expression construct," "expression vector," and "vector," may be used interchangeably herein to demonstrate the application of the invention in a general, illustrative sense, and are not intended to limit the invention.

An expression vector comprises regulatory sequences operatively linked to a polynucleotide or nucleic acid of interest. An expression vector generally comprises a promoter, transcription termination sequences, and sequences required for proper expression of the nucleotide sequence. A construct comprising the nucleotide sequence of interest can be chimeric, or it can be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.

As used herein, the term "gene expression" and like terms include the cellular processes by which a biologically active polypeptide is produced from a DNA sequence and exhibits a biological activity in a cell. Thus, gene expression includes transcription and translation, and post-transcriptional and post-translational processes that can affect a biological activity of a gene or gene product, and in particular RNA synthesis, processing, and transport, polypeptide synthesis, transport, and post- translational modification of polypeptides. In some embodiments, the term refers to translation.

As used herein, the term "complementary" refer to a nucleic acid or polynucleotide that can form one or more hydrogen bonds with another nucleic acid or polynucleotide sequence by either traditional Watson-Crick or other non-traditional types of interactions. Generally the binding free energy for a nucleic acid molecule or polynucleotide with its complementary sequence is sufficient to allow the relevant function of the nucleic acid or polynucleotide to proceed. A skilled artisan could readily determine binding free energies for nucleic acid molecules or polynucleotides. In aspects of the invention, a complementary sequence is substantially complementary or sufficiently complementary to hydridize to a second sequence.

"Substantially complementary" or "sufficiently complementary to hybridize" may mean that a first sequence has significant percent identity (e.g. at least 95%, 98%, 99% or 100%) to the complement of a second sequence, or that the two sequences hydridize under stringent hybridization conditions.

As used herein, the phrases "percent identity" and "percent identical," refers to two or more sequences or subsequences that have in some embodiments at least 60%, 70%, 80%, 85%, or 90%, and in some embodiments at least 95%, 96%, 97%, 98%, or 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a standard sequence comparison algorithm or by visual inspection. Percent identity may exist in a region of the sequences that is at least about 5 residues in length, at least about 10 residues in length, at least about 20 residues in length, at least about 50 residues in length or at least about 100 residues. Alignment for purposes of determining percent identity can be achieved in various conventional ways, for instance, using publicly available computer software including the GCG program package (Devereux J. et al., Nucleic Acids Research 12( 1 ): 387, 1984); BLASTP, BLASTN, and FASTA (Atschul, S.F. et al. J. Molec. Biol. 215: 403-410, 1990). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al. NCBI NLM NIH Bethesda, Md. 20894; Altschul, S. et al. J. Mol. Biol. 215: 403-410, 1990). Skilled artisans can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

Two nucleic acid or polynucleotide sequences may also be considered substantially complementary or sufficiently complementary if they specifically or substantially hybridize to each other under stringent conditions. In the context of nucleic acid hybridization, a reference nucleic acid molecule may be referred to as the "probe sequence" and a test nucleic acid molecule, often found within a heterogeneous population of nucleic acid molecules may be referred to as a "test sequence". A hybridization assay may include probe sequences that are complementary to or mimic in some embodiments at least an about 5 to 500, 5 to 200, 5 to 100, 5 to 50, 5 to 40, 5 to 30, 5 to 25 or 5 to 20 nucleotide sequence of a nucleic acid. In some embodiments the probes comprise at least about 5 to 20, 5 to 25, 5 to 30, 5 to 50, 10 to 50, 10 to 100 nucleotides or up to the full length of a given gene or polynucleotide. Such probes may be prepared, for example, by chemical synthesis, by nucleic acid amplification technology, or by introducing selected sequences into recombinant vectors for recombinant production.

Hybridization conditions are known to those skilled in the art or can be determined by the skilled artisan without undue experimentation (see for example, Ausubel et al., (eds) Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. ( 1989), 6.3.1 -6.3.6). By way of non-limiting example, hybridization can be carried out in 5x SSC, 4x SSC, 3x SSC, 2x SSC, l x SSC, or 0.2x SSC for at least about 1 hour, 2 hours, 5 hours, 12 hours, or 24 hours (see Sambrook & Russell, supra, 2001 , for a description of SSC buffer and other hybridization conditions). Hybridization temperatures can be increased to adjust the stringency of the reaction, for example, from about 25°C (room temperature), to about 45°C, 50°C, 55°C, 60°C, or 65 °C. Other agents affecting the stringency can be included in the hybridization assay; for example, 50% formamide which increases the stringency of hybridization at a defined temperature.

A hybridization reaction may be followed by one or two or more wash steps which can have the same or different salinity and temperature. For example, the temperature of the wash step can be increased to adjust the stringency from about 25°C (room temperature), to about 45°C, 50°C, 55°C, 60°C, 65°C, or higher. Detergents such as SDS can be used in the wash step(s). For example, hybridization can be followed by two wash steps at 65°C each for about 20 minutes in 2x SSC, 0.1 % SDS, and optionally two additional wash steps at 65°C each for about 20 minutes in 0.2x SSC, 0.1 % SDS.

An example of stringent hybridization conditions includes overnight hybridization at 42°C in a solution of 50% formamide, 10 X Denhardt's (0.2% Ficoll, 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin) and 200 mg/ml of denatured carrier DNA, e.g., sheared salmon sperm DNA, followed by two wash steps at 65°C, each for about 20 minutes in 2x SSC, 0.1 % SDS, and two wash steps at 65°C each for about 20 minutes in 0.2x SSC, 0.1 % SDS. In another example, a hybridization may be conducted at 6.0 x sodium chloride/sodium citrate (SSC) at about 45°C, followed by a wash of 2.0 x SSC at 50°C, or at 42°C in a solution containing 6xSCC, 0.5% SDS and 50% formamide followed by washing in a solution of O. lx SCC and 0.5% SDS at 68°C.

The term "isolated" refers to molecules separated from other molecules. The term also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. An isolated nucleic acid includes nucleic acid fragments that are not naturally occurring and would not be found in nature. The term "isolated" also refers to polypeptides that are isolated from other cellular proteins, and the term encompasses both purified and recombinant polypeptides. The term "isolated", when used in the context of an "isolated cell", refers to a cell that has been removed from its natural environment, for example, as a part of an organ, tissue, or organism.

As used herein, the term "modulate" refers to an increase, decrease, or other alteration of any, or all, chemical and biological activities or properties of a biochemical entity. In some embodiments, the term refers to a change in gene expression or expression of an RNA molecule, or to an activity of one or more genes or proteins that is upregulated or downregulated, such that expression, level, or activity is greater than or less than that observed in the absence of the modulator. In some embodiments, the term means "inhibit" or "suppress.

As used herein, the terms "inhibit", "suppress", or "down regulate", refer to an activity whereby a polypeptide, gene expression, activity of a polynucleotide (e.g., a miRNA), or a level of a RNA or protein is reduced below that observed in the absence of an implementation of the present invention. In some embodiments, inhibition with a miRNA inhibitor of the invention results in a decrease in the expression level of a miRNA. In some embodiments, gene expression with a miRNA inhibitor of the invention is greater in the presence of the inhibitor than in its absence. In some embodiments, inhibition with a miRNA inhibitor is associated with a decreased rate of degradation of a target RNA. In some embodiments, inhibition with a miRNA inhibitor of the invention results in an expression level of a gene product from a target gene that is above that level observed in the absence of the inhibitor.

In some embodiments, inhibition with a miRNA inhibitor of the invention results in an increase in the expression level of a miRNA. In some embodiments, gene expression with a miRNA inhibitor of the invention is less in the presence of the inhibitor than in its absence. In some embodiments, inhibition with a miRNA inhibitor is associated with an increased rate of degradation of a target RNA. In some embodiments, inhibition with a miRNA inhibitor of the invention results in an expression level of a gene product from a target gene that is below that level observed in the absence of the inhibitor.

In some embodiments, a miRNA, such as for example an endogenous miRNA, can be inhibited by a miRNA inhibitor of the invention, resulting in an increase in expression of a gene targeted by the miRNA, as compared to the level of gene expression (e.g., production of a gene product) when the miRNA is not inhibited.

The terms "subject" and "patient" are used interchangeably herein, and refer to an animal including a warm-blooded animal such as a mammal, which is afflicted with or suspected of having, at risk of, or being pre-disposed to a condition, disease or disorder described herein. Mammal includes without limitation any members of the Mammalia. In general, the terms refer to a human. The terms also include domestic animals bred for food, sport, or as pets, including horses, cows, sheep, poultry, fish, pigs, cats, dogs, and zoo animals, goats, apes (e.g. gorilla or chimpanzee), and rodents such as rats and mice. The methods herein for use on subjects/patients contemplate prophylactic as well as curative use. Typical subjects for treatment include persons susceptible to, suffering from or that have suffered a condition or disease described herein.

As used herein, the term "treating" refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of and/or reduce incidence of one or more symptoms or features of a particular condition. Treatment may be administered to a subject who does not exhibit signs of a condition and/or exhibits only early signs of the condition for the purpose of decreasing the risk of developing pathology associated with the condition. Thus, depending on the state of the subject, the term in some aspects of the invention may refer to preventing a condition, and includes preventing the onset, or preventing the symptoms associated with a condition. The term also includes maintaining the condition and/or symptom such that the condition and/or symptom do not progress in severity. A treatment may be either performed in an acute or chronic way. The term also refers to reducing the severity of a condition or symptoms associated with such condition prior to affliction with the condition. Such prevention or reduction of the severity of a condition prior to affliction refers to administration of a therapy to a subject that is not at the time of administration afflicted with the condition. Preventing also includes preventing the recurrence of a condition, or of one or more symptoms associated with such condition. The terms "treatment" and "therapeutically" refer to the act of treating, as "treating" is defined above. The purpose of intervention is to combat the condition and includes the administration of therapy to prevent or delay the onset of the symptoms or complications, or alleviate the symptoms or complications, or eliminate the condition.

The term "pharmaceutically acceptable carrier, excipient, or vehicle" refers to a medium which does not interfere with the effectiveness or activity of an active ingredient and which is not toxic to the hosts to which it is administered. A carrier, excipient, or vehicle includes diluents, binders, adhesives, lubricants, disintegrates, bulking agents, wetting or emulsifying agents, pH buffering agents, and miscellaneous materials such as absorbants that may be needed in order to prepare a particular composition. Examples of carriers, excipients etc include but are not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, calcium carbonate, calcium phosphate, various sugars such as lactose, glucose, or sucrose, or types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols and physiologically compatible solvents, and combinations thereof. The use of such media and agents for an active substance is well known in the art.

"Effective amount" relates to the amount or dose of an active compound or composition (e.g., a mRNA inhibitor, a composition comprising a miRNA inhibitor or a vector comprising a miRNA inhibitor) that will lead to one or more desired or measurable biological response. A therapeutically effective amount of a substance can vary according to factors such as the disease state, age, sex, and weight of the subject, and the ability of the substance to elicit a desired response in the subject. Dosage regime may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. Preferably, a minimal dose is administered, and the dose is escalated in the absence of dose- limiting toxicity to a minimally effective amount.

As used herein, the term "cell" is used in its usual biological sense and includes eukaryotic or prokaryotic cells. In embodiments of the invention, the cell is present in an organism, for example, a vertebrate subject. A cell may be a somatic or germ cell, and it may be totipotent, pluripotent, or differentiated to any degree, dividing or non-dividing. A cell may also be derived from or comprise a gamete or embryo, a stem cell, or a fully differentiated cell. A cell may be a target cell.

A "target cell" refers to a cell, into which it is desired to insert a miRNA inhibitor or composition of the invention, or to otherwise effect a modification from conditions known to be standard in the unmodified cell. Additionally, a nucleic acid sequence can enter a target cell as a component of a plasmid or other vector or as a naked sequence. In some embodiments, a "target cell" refers to a cell that contains a target miRNA and into which a miRNA inhibitor or composition of the present invention is intended to be introduced.

As used herein, the term "host cell" may be a naturally occurring cell or a transformed cell that comprises a vector and supports the replication of the vector. The term includes cells into which an expression vector is initially introduced, and also to the progeny or potential progeny of such cells. Host cells may be cultured cells, explants, in vivo cells and the like.

The term "target gene" refers to a gene that may be targeted for modulation using the inhibitors, compositions and methods of the present invention. In aspects, a target gene may comprise a nucleic acid sequence the expression level of which, either at the mRNA or polypeptide level, is upregulated by a miRNA. In other aspects, a target gene may comprise a nucleic acid sequence the expression level of which, either at the mRNA or polypeptide level, is down regulated by a miRNA. A target gene may be derived from a cell, an endogenous gene, a transgene, or exogenous genes. Examples of exogenous genes include genes of a pathogen, such as a virus. A cell containing a target gene can be derived from or contained in any cell or organism, for example a plant, animal, protozoan, virus, bacterium, or fungus.

A "target RNA" refers to a RNA molecule (for example, an mRNA molecule encoding a gene product) that is a target for modulation. In some embodiments the target RNA is encoded by a target gene. In aspects of the invention, a "target RNA" refers to the transcript of a target gene to which a miRNA is intended to bind, leading to modulation of the expression of the target gene.

A "target miRNA" is a miRNA that binds to or modulates a target gene that may be modulated or is associated with a miRNA condition. In aspects of the invention, a target miRNA upregulates gene expression of a target gene. In aspects of the invention, a target miRNA downregulates gene expression of a target gene.

A "condition(s) associated with miRNA" or "miRNA condition(s)" refers to any disease, disorder, syndrome or combination of manifestations or symptoms recognized or diagnosed as a disorder involving or modulated by a target miRNA or target gene. In aspects of the invention, the miRNA condition is a condition where the miRNA is upregulated and/or miRNA levels are increased, or the miRNA silences a target gene (i.e. decreases translation or increases degradation).

In aspects of the invention the miRNA condition involves cellular processes, such as apoptosis, fat metabolism, development, differentiation, proliferation, immune response, and stress response. Examples of such cellular processes include without limitation fat metabolism involving miR- 14, immune responses (absence of miR- 155), differentiation of human B cells, involving miR-1 81 (Chen et al., Science 303: 83-86 (2004)), insulin secretion regulated by miR-373 (Poy et al., Nature 432:226-230 (2004)), and regulation of viral infections (Lecellier, C. H., et al., Science 308:557- 560 (2005); Sullivan et al, Nature 435:682-686 (2005)).

In aspects of the invention a target miRNA has been associated with diseases, such as cancer, immune diseases, neurological disease, developmental disease, as well as viral infections. Cancers such as chronic lymphocytic leukemia, pediatric Burkitt's lymphoma, gastric cancer, lung cancer, prostate cancer, and large cell lymphoma have been correlated with defects in miRNA expression. (See for example, O'Donnell et al., Nature 435:839-843 (2005); Carmen et al, Genes Dev 16:2733-2742 (2002).

In one embodiment, the miRNA inhibitors of the invention target miRNA that are upregulated in tumor cells. For example, miR-21 is upregulated in lung tumor cells; miR-155 is overexpressed in diffuse large B cell lymphoma (DLBCL) or in Burkitt's Lymphoma [Eis et al., Proc. Natl. Acad. Sci. U.S.A. 102:3627-3632 (2005); Metzler et al., Genes Chromosom. Cancer 39: 167-1.69 (2004)]; miR-155 overexpression has been linked to oncogenesis and upregulation of multiple transcripts in malignant lymphoma cells [Costinean et al, Proc. Natl. Acad. Sci. USA 103:7024-7029 (2006)]; the miR-17-92 polycistron is substantially increased in human B-cell lymphomas [He et al., Nature 435:828-833 (2005)]; miR-106-363 has been implicated in T-cell leukemia [Landais et al. Cancer Res. 67:5699-707 (2007)]; miR-15/16/195 may have roles in stimulating cell growth and cancer development; the miR- 17/20/ 106, miR-19, and miR-25/32/95 families are involved in promoting growth and proliferation (US Pat. Application 2006/0185027); and miR-20 and miR- 106 may be involved in apoptosis.

A number of other miRNAs involved in cancer may also serve as targets for the miRNA inhibitors of the present invention. For example, miR-101, miR-202, miR-216, miR- 138, miR-7, miR- 19a, miR- 9b and miR- 19a may also be targeted for cancer treatments. Other putative targets include miR-103, miR-107, miR-145, miR- 203, miR-124a, miR-221 , miR-222, miR- 124a, miR-34, miR-25, miR-92, miR-24, miR-143, miR-22, miR-125a, miR- 125b, let-7a, miR-124a, miR-128, miR-135b, miR- 19a, miR-1 , miR-219, miR-23a, miR-26a, miR-27a, miR-29b, miR-138, or miR-34 which are each thought to have a role in cancer. miRNAs that are overexpressed in cancers may be identified by performing miRNA expression profiles of human cancers compared to control groups (See for example, Mak et al, Nature 435:834-838 (2005)). Other target miRNAs may include miRNA that are expressed in human prostate cancers, such as miR-100, miR-125b, miR-141 , miR-143, miR-205, or miR- 296 (Mitchell et al, Proc. Natl. Acad. Sci. USA 105: 10 13-10518 (2008)). The target miRNA targets may be secreted by tumor cells, such as miR- 141.

Particular target miRNAs associated with cancer that may be targeted with a miRNA inhibitor of the invention include without limitation, miR-17-5p (e.g., breast cancer, hepatocellular carcinoma), miR-24 (e.g., oral carcinoma), miR-98 (e.g., small- cell lung cancer), miR-199a (e.g., invasive squamous cell carcinoma), miR-378 (e.g., breast cancer), miR-93 (e.g., small-cell lung cancer, breast cancer), miR-345 (e.g., breast cancer, hepatocellular carcinoma), miR-207, and miR-let7 (e.g., pancreatic cancer, ovarian cancer, breast cancer).

Target miRNAs associated with the mammalian immune system may be targeted with a miRNA inhibitor of the invention to modulate the immune system. For example, miR-155 has a role in regulating T cell-dependent antibody responses [That et al., Science 316:604-608 (2007)]; elimination of miR-155 has been associated with immunosuppression [That et al., Science 316:604-608 (2007), Rodriguez et al., Science 316:608-611 (2007)]; and miR-150 may downregulate mRNAs that are important for pre- and pro-B cell formation, development or function [Zhou et al., Proc. Natl. Acad. Sci. USA 104:7080-7085 (2007)]. Other target miRNAs include miR-133 or miR-133b, which are involved in the development of the T-cell surface glycoprotein CD4 precursor; miR- 125b involved in control development of immune system cells; miR-125b and miR-125a which may be involved in arthritis; MiR-19a which has been implicated in autoimmune diseases, such as rheumatoid arthritis, systemic lupus erythematosus, Bechcet's disease, systemic sclerosis, and osteoarthritis; miR-29b which may be involved in some types of autoimmune disease, such as autoimmune uveitis; let-7a which may be involved in arthritis, osteogenesis imperfecta, and similar indications; and miR-34 which may be involved in diabetes mellitus.

MiRNA conditions include inflammatory conditions or diseases, including but not limited to, acute allergic reactions, development of atropic diseases, and exacerbations of existing atopic conditions. A miRNA inhibitor of the invention may target a miRNA that modulates cytokines implicated in in atopic diseases such as IL-4 and IL-13, or transcription factors implicated in the differentiation of TH2-type lymphocytes such as c-Maf, NF-AT, NF-IL-6, AP-1 , STAT-6, and GATA-3.

MiRNA conditions also include neurodegenerative diseases such as Alzheimer's, disease. A miRNA inhibitor of the invention may target a miRNA that modulates expression of a gene involved in neural regulation pathways. In an embodiment, miR-1 or miR-206 can be targeted which have been found to regulate BDNF which has been found to be decreased in late-stage Alzheimer's disease. In another embodiment, miR-101 can be targeted which may regulate Ras-related protein RAP-IB, expression of which may cause neurite growth. Other target miRNAs for neurodegenerative diseases may include miR-218, miR-101 , and miR- 23a.

MiRNA conditions also include cardiovascular or skeletal diseases. For example, cardiac and skeletal muscle-specific miRNAs can be targeted with the methods and compositions of the invention, including but not limited to, miR-1 , miR- 1 -2, miR-133, and miR-208 (van Rooij et al., Science 316:575-579 (2007); Chien, Nature 447:389-390 (2007); U.S. Published Application No. 20060246491 ).

MiRNA inhibitors of the present invention may target viral miRNA and thus be useful in the treatment of viral diseases. miRNAs may function to enable virus pathogenesis and contribute to virus-induced transformation. Therefore, targeting viral miRNA may be useful for treating viral infections and/or symptoms. Target miRNAs include without limitation miRNAs associated with the Herepesviridae family [e.g, oncogenic Marek's disease virus type 1 (MDV-1 ) and MDV-2 (Burnside et al, J. Virol. 80: 8778-8786 (2006); Yao et al., J. Virol. 81 :7164-7170 (2007)]; the oncogenic gamma herpesviruses, Kaposi's sarcoma herpesvirus, Espstein-Barr virus rotavirus, influenza virus, parainfluenza virus, respiratory synctyial virus, herpes virus, Flavivirus, human immunodeficiency virus, hepatitis virus, human papillomavirus, Ebola vims, Rous sarcoma virus, human rhinovirus, and poliovirus, and in particular HIV-1 , HIV-2, HSV-1 , HSV-2, hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, hepatitis G, rotavirus A, rotavirus B, rotavirus C, avian influenza virus, and human influenza virus. Examples of influenza viruses include influenza A, influenza B, and/or influenza C, and in particular, serotypes H1N1 , H2N2, H3N2, H5N1 , H7N7, H1N2, H9N2, H7N2, H7N3, or H10N7.

A 'chemotherapeutic treatment" includes without limitation chemotherapeutic agents, chemotherapeutic agent supplementary potentiating agents and radioactive agents. A chemotherapeutic agent may be selected from the group of gemcitabine, telozolomid, nitrosoureas, Vinca alkaloids, antagonists of purine and pyrimidines bases, cytostatic antibiotics, camphotecine derivatives, anti-estrogenes, anti-androgens and analogs of gonadotropin releasing hormone. Examples of chemotherapeutic agents include without limitation, amifostine (ethyol), cisplatin and/or other platinum compounds, including carboplatin and/or oxaliplatin, dacarbazine, dactinomycin, mechlorethamine (nitrogen mustard), streptozocin, cyclophosphamide, carmustine, lomustine, doxorubicin (adriamycin), doxorubicin lipo (doxil), gemcitabine (gemzar), daunorubicin, daunorubicin lipo (daunoxome), procarbazine, mitomycin, cytarabine, etoposide, methotrexate, 5-fluorouracil, vinblastine, vincristine, bleomycin, paclitaxel (taxol), docetaxel (taxotere), aldesleukin, asparaginase, busulfan, carboplatin, cladribine, camptothecin, CPT-1 1 , 10- hydroxy-7-ethyl-camptothecin (SN38), dacarbazine, floxuridine, fludarabine, C2-ceramide, hydroxyurea, ifosfamide, idarubicin, cytarabine, mesna, interferon alpha, interferon beta, irinotecan, mitoxantrone, topotecan, leuprolide, megestrol, melphalan, mercaptopurine, plicamycin, mitotane, pegaspargase, pentostatin, pipobroman, plicamycin, streptozocin, tamoxifen, teniposide, testolactone, thioguanine, thiotepa, uracil mustard, vinorelbine, chlorambucil and combinations thereof. In aspects of the invention the chemotherapeutic agent is C2-ceramide, cytarabine, and/or methotrexate.

miRNA Inhibitors

The invention provides a miRNA inhibitor of a miRNA comprising at least one polynucleotide having a sequence complementary to (i) a truncated sequence of the miRNA (i.e. truncated miRNA sequence) or sequence complementary thereto, and (ii) one or more nucleotides of a loop region of a pre-miRNA sequence from which the miRNA is generated.

The invention provides a miRNA inhibitor of a target miRNA comprising at least one polynucleotide having a sequence complementary to (i) a truncated sequence of the target miRNA (i.e. truncated target miRNA sequence) or sequence complementary thereto, and (ii) one or more loop region nucleotides of a pre-miRNA sequence from which the miRNA is generated.

The invention provides a miRNA inhibitor of a target miRNA comprising at least one polynucleotide having a sequence complementary to (i) a truncated sequence of the target miRNA (i.e. truncated target miRNA sequence) or sequence complementary thereto, and (ii) one or more loop region nucleotides of a pre-miRNA sequence from which the miRNA is generated, wherein the miRNA inhibitor can bind to the target miRNA or induce mis-processing of the target miRNA.

The invention also relates to a miRNA inhibitor of a target miRNA comprising at least one polynucleotide sequence that is substantially complementary or sufficiently complementary to hybridize to a sequence of a pre-miRNA comprising a truncated sequence of the target miRNA or sequence complementary thereto, and, one or more nucleotides of the loop region of the pre-miRNA.

In aspects of the invention, the nucleotides of the truncated sequence of the target miRNA and loop region nucleotides are continguous.

In an embodiment, the invention relates to a miRNA inhibitor of a target miRNA comprising at least one polynucleotide sequence that is substantially complementary or sufficiently complementary to hybridize to a sequence of a pre- miRNA from which the target miRNA is generated, the pre-miRNA sequence comprising a truncated sequence of the target miRNA or a sequence complementary thereto, and one or more loop region nucleotides contiguous to the truncated sequence.

Conditions under which the polynucleotide of a miRNA inhibitor can hybridize to a pre-miRNA sequence include, for example, physiological conditions. The polynucleotide can hybridize to the pre -miRNA sequence to a greater or lesser degree based on complementarity of the miRNA inhibitor polynucleotide sequence to the nucleotides or contiguous nucleotides of the pre-miRNA sequence. The miRNA inhibitor need only share complementary with the pre-miRNA sequence as is necessary to modulate a desired amount of pre-miRNA or target miRNA activity under a particular set of conditions.

In aspects of the invention, the miRNA inhibitor comprises at least 2-32, 2 to 20, 2 to 26, 2 to 15, 2 to 10 or 2 to 5 polynucleotide or polynucleotide sequences.

In an aspect, the present invention relates to a miRNA inhibitor of a target miRNA of the formula [A - B]„ where A is a polynucleotide complementary to a truncated sequence of the target miRNA or a sequence complementary thereto, and one or more nucleotides of a loop region of a pre-miRNA sequence from which the target miRNA is generated; B is an optional spacer; and, n is 1 to 32, 1 to 30, 1 to 25, 1 to 20, 1 to 16, 1 to 10, 1 to 8, 1 to 5, 1 to 6 or 1 to 3. In embodiments, n is 1. In another aspect, the present invention relates to a miRNA inhibitor of a target miRNA of the formula [A - B]_n where A is a polynucleotide sufficiently complementary to a sequence of a pre -miRNA comprising a truncated sequence of the target miRNA or sequence complementary thereto, and, one or more nucleotides of a loop region of the pre-miRNA; B is an optional spacer; and, n is 1 to 32, 1 to 30, 1 to 25, 1 to 20, 1 to 16, 1 to 10, 1 to 8, 1 to 5, 1 to 6 or 1 to 3. In embodiments, n is 1.

In embodiments of the invention, a truncated sequence of the target miRNA comprises a mature target miRNA sequence absent 1 to 10, 1 to 8, 1 to 7, 1 to 5, 1 to 3, 1 or 2 nucleotides from the 5' end. In aspects of the invention, the truncated sequence of the target miRNA comprises a mature target miRNA sequence absent absent 1 to 10, 1 to 8, 1 to 5, or 1 to 3, 1 or 2 nucleotides from the 3' end. In embodiments of the invention, a truncated sequence of a target miRNA is selected which comprises a target or mature miRNA sequence with at least 2, 3, 4 or 5, preferably at least 3, nucleotides of the seed region of the mature miRNA (i.e. generally nucleotides 2-8 from the 5 -end) deleted.

In aspects of the invention, the miRNA inhibitor comprises a sequence complementary to 2 to 10 contiguous loop region nucleotides of a pre-miRNA sequence, in particular, 2 to 8, 2 to 7, 2 to 5 or 2 to 3 loop region nucleotides. In other aspects, the miRNA inhibitor comprises a sequence complementary to 2 to 10, 2 to 7, 2 to 5 or 2 to 3 contiguous loop region nucleotides that are contiguous to the truncated sequence of the target miRNA in the pre-miRNA.

In aspects of the invention the miRNA inhibitor comprises one or more spacer (e.g., B in the formula [A - B]_n). In aspects of the invention a miRNA inhibitor comprises 1 -32, 1 -30, 1 -25, 1 -20, 1 -16, 1 -15, 1 -10, 1 -8, 1 -5 or 1 -3 spacers. In some embodiments a spacer may have up to 30 nucleotide units, more usually not more than about 20 nucleotide units, in particular 15, 10 5, or 2 or less nucleotide units. In some embodiments, the spacer has at least about 16 nucleotide units. In some embodiments, the number of nucleotides in each spacer will not differ by more than 4 nucleotides, usually not more than 2 nucleotides or 1 nucleotide. In some embodiments, the spacer is a naturally occurring linking group from a naturally occurring RNA. In other embodiments, the spacer is a truncated naturally occurring linking group, truncated by from 1 to 6 nucleotides. In some embodiments, the spacer may be a poly-U or -A, or combination thereof. Examples of spacers that may be employed in the invention are shown in Table 1. In embodiments of the invention, the polynucleotide of the miRNA inhibitor is sufficiently or substantially complementary to a truncated sequence of the target miRNA and loop region nucleotides, pre-miRNA sequence or strand of miRNA duplex. In aspects of the mvention the polynucleotide has at least about 95%, 96%, 97%, 98%, 99%, or 100%, preferably 100%, complementarity. In aspects of the invention the polynucleotide has at least about 95%, 96%, 97%, 98%, 99%, or 100%, preferably 100%, complementarity.

In some embodiments, miRNA inhibitors comprise polynucleotides having one or more modifications.

Examples of miRNA inhibitors of the invention are shown in Table 2.

A miRNA inhibitor of the invention may be prepared by recombinant techniques using either prokaryotic or eukaryotic host cells. Alternatively, a miRNA inhibitor may be synthesized using commercially available synthesizers in known ways.

In an aspect, a miRNA inhibitor of a target miRNA of the invention may be prepared by (a) identifying a pre-miRNA sequence comprising a mature or target miRNA sequence and loop region nucleotides; and (b) recombinantly producing or synthesizing a polynucleotide that is sufficiently complementary to hybridize to a sequence of a pre-miRNA comprising a truncated target miRNA sequence or a sequence complementary thereto, and one or more loop region nucleotides. In particular aspects of the invention, a miRNA inhibitor is prepared which comprises two or more polynucleotides separated by spacers. Thus, in step (b) the method may involve recombinantly producing or synthesizing a nucleic acid molecule comprising two or more of the polynucleotides separated by spacers. A truncated target miRNA sequence may be selected which comprises a target or mature miRNA sequence absent 1 to 10, 1 to 8, 1 to 7, 1 to 5, 1 to 3, 1 or 2 nucleotides from the 5' or 3' end. In embodiments of the invention, a truncated target miRNA sequence is selected which comprises a target or mature miRNA sequence with at least 2, 3, 4 or 5, preferably at least 3, nucleotides in the seed region of the mature miRNA (i.e. generally nucleotides 2-8 from the 5-end) deleted. In aspects of the invention, a sequence complementary to 2 to 10, 2 to 8, 2 to 7, 2 to 5 or 2 to 3 contiguous loop region nucleotides are included in the miRNA inhibitor.

MiRNA inhibitors of the invention may be used to eludicate the function of a target miRNA. In an aspect, the invention provides a method of determining the function of a target miRNA comprising administering to cells a miRNA inhibitor of the target miRNA of the invention, and assaying for molecular, physiological or biological changes to the cells. In aspects of the invention, proliferation of the cells is assayed and reduced proliferation compared with control cells indicates that the target miRNA increases cell growth. In an embodiment, proliferation of the cells is assayed and increased proliferation compared with control cells indicates that the target miRNA inhibits cell growth. In embodiments of the invention, the cells are tumor cells. In other aspects, the levels of the target gene or target gene product of the target miRNA are assayed. In embodiments of the invention, an increase in target gene, target mRNA and/or gene product indicates that the target miRNA silences or represses the target mRNA. In other embodiments, a decrease in target gene, target mRNA and/or gene product indicates that the target miRNA enhances or increases a target mRNA or target gene product.

Pharmaceutical Compositions

The invention contemplates pharmaceutical compositions comprising one or more miRNA inhibitors. In aspects of the invention, pharmaceutical compositions are provided comprising one or more miRNA inhibitor of the invention and one or more chemotherapeutic agent.

Compositions of the invention preferably comprise pharmaceutically acceptable carriers, excipients, or vehicles. Suitable pharmaceutically acceptable carriers, excipients, or vehicles and their formulations are described in standard formulation treatises, e.g., Remington's Pharmaceutical Sciences by E. W. Martin. See also Wang, Y. J. and Hanson, M. A. "Parenteral Formulations of Proteins and Peptides: Stability and Stabilizers," Journal of Parental Science and Technology, Technical Report No. 10, Supp. 42:2S (1988). For human administration, compositions should meet sterility, pyrogenicity and general safety and purity standards as required by the US Food and Drug Administration Office of Biologies standards, and corresponding standards in other countries.

Compositions of the invention may be administered in a manner compatible with the dosage formulation and in an effective amount. The compositions may be administered in a variety of dosage forms such as injectable solutions, oral dosage forms such as pills, tablets, capsules, drug release capsules and the like. For parenteral administration in an aqueous solution, for example, the solution generally can be suitably buffered and the liquid diluent rendered isotonic for example with sufficient saline or glucose. Aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration.

miRNA inhibitors and compositions of the invention may be administered by any method known to those in the art suitable for delivery to the targeted organ, tissue, or cell type. This includes oral, nasal, or buccal administration. Alternatively, administration may be by intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection, or by direct injection into a tissue. In certain embodiments of the invention, one or more miRNA inhibitors or compositions may be administered by parenteral administration, such as intravenous injection, intraarterial injection, intrapericardial injection, or subcutaneous injection, or by direct injection into the tissue (e.g., cardiac tissue). In some embodiments, the miRNA inhibitor is administered by oral, transdermal, intraperitoneal, subcutaneous, sustained release, controlled release, delayed release, suppository, or sublingual routes of administration. In other embodiments, the miRNA inhibitors may be administered by a catheter system.

An expression vector may be used to deliver a miRNA inhibitor to a cell or subject. Expression vectors may be introduced into cells in a number of ways. In certain embodiments of the invention, the expression vector construct comprises a virus or engineered construct derived from a viral genome. Viruses that have the ability to enter cells via receptor-mediated endocytosis, to integrate into a host cell or target cell genome and express viral genes stably and efficiently may also be useful for the transfer of foreign genes into mammalian cells (See for example, Ridgeway, In: Vectors: A survey of molecular cloning vectors and their uses, Rodriguez and Denhardt (Eds.), Stoneham: Butterworth, 467-492, 1988; Baichwal and Sugden, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum Press, 1 17-148, 1986; and Temin, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum Press, 149-188, 1986).

In an aspect of methods of the invention, in vivo delivery involves the use of an adenovirus expression vector. An adenovirus vector is generally selected that is replication defective, or at least conditionally defective. An adenovirus may be of any of the different known serotypes or subgroups A-F, in particular adenovirus type 5 of subgroup C. Adenovirus vectors have been used in eukaryotic gene expression and vaccine development [Levrero et al., Gene 101 : 195-202, 1991 ; Gomez-Foix A. M., et al, J Biol Chem 267:25129-25134, 1992; Grunhaus, A., and M. S. Horwitz, Semin. Virol. 3: 237-252, 1992; Graham, F. L., and L. Prevec. 1991. Manipulation of adenovirus vectors. In: Methods in Molecular Biology (Vol. 7), Gene Transfer and Expression Protocols, ed. E. J. Murray, The Humana Press Inc., Clifton, N.J.]. Recombinant adenovirus has also been shown to be useful for gene therapy (Stratford- Perricaudet, L., and M. Perricaudet. 1991. Gene transfer into animals: the promise of adenovirus, p. 51 -61 , In: Human Gene Transfer, Eds, O. Cohen-Haguenauer and M. Boiron, Editions John Libbey Eurotext, France; Rich, D. P., L. A. Couture, L. M. Cardoza, V. M. Guiggio, D. Armentano, P. C. Espino, K. Hehir, M. J. Welsh, A. E. Smith, and R. J. Gregory. 1993. Development and analysis of recombinant adenoviruses for gene therapy of cystic fibrosis. Hum. Gene Ther. 4: 461 -476). Studies in administering recombinant adenovirus to different tissues include trachea instillation [(Rosenfeld, M. A., et al, (1991 ) Science 252: 431 -434; Rosenfeld, M. A., et al, (1992) Cell 68: 143-155)], muscle injection (Ragot, T., et al, (1993), Nature 361 : 647-650), peripheral intravenous injections (Herz, J., and R. D. Gerard, (1993) Proc. Natl. Acad. Sci. USA 90: 2812-2816) and stereotactic inoculation into the brain (Le Gal La Salle, G., et al, (1993) Science 259: 988-990).

Retroviral vectors may be suitable for expressing miRNA inhibitors of the invention in cells. Vectors derived from other viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986), adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986) and herpesviruses may be employed. (See also, Friedmann, (1989) Science, 244: 1275-1281 ; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., (1988) Gene, 68: 1-10, 1988; Horwich et al., (1990) J. Virol, 64:642-650, 1990).

An expression vector may be delivered into a cell in vitro, as in laboratory procedures for transforming cells lines, or in vivo or ex vivo, as in the treatment of certain disease states. One mechanism for delivery is via viral infection where the expression construct is encapsidated in an infectious viral particle.

The invention also contemplates non-viral methods for the transfer of expression vectors into mammalian cells. Examples of such methods include without limitation, calcium phosphate precipitation (Graham and Van Der Eb, 1973 Virology, 52:456-467; Chen and Okayama, 1987, Mol. Cell Biol, 7:2745-2752,; Rippe et al., 1990, Mol Cell Biol., 10:689-695), DEAE-dextran (Gopal, 1985, Mol. Cell Biol., 5: 1 188-1 190), electroporation (Tur-Kaspa et al„ 1986, Mol. Cell Biol, 6:716-718; Potter et al, 1984, Proc. Nat'l Acad. Sci. USA, 81 :7161 -7165), direct microinjection (Harland and Weintraub, 1985, Cell Biol, 101 : 1094-1099), DNA-loaded liposomes (Nicolau and Sene, 1982, Biochem. Biophys. Acta, 721 : 1 85- 190; Fraley et al., 1979, Proc. Nat'l Acad. Sci. USA, 76:3348-3352) and lipofectamine-DNA complexes, cell sonication (Fechheimer et al, 1987, Proc. Nat'l Acad. Sci. USA, 84: 8463-8467), gene bombardment using high velocity microprojectiles (Yang et al., 1990, Proc. Nat'l Acad. Sci. USA, 87:9568-9572), and receptor-mediated transfection (Wu and Wu, 1987, J. Biol. Chem., 262:4429-4432; Wu and Wu, 1988, Biochemistry, 27: 887-892).

In certain embodiments, gene transfer may be performed under ex vivo conditions. Ex vivo gene therapy refers to the isolation of cells from an animal, the delivery of a nucleic acid (e.g. miRNA inhibitor) into the cells in vitro, and then the return of the modified cells back into an animal. This may involve the surgical removal of tissue/organs from an animal or the primary culture of cells and tissues.

Cells or tissues containing miRNA inhibitors of the present invention may be identified in vitro or in vivo by including a marker in an expression construct. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression construct. Selectable markers may be drug selection markers, for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol. Enzymes such as herpes simplex virus thymidine kinase or chloramphenicol acetyl transferase may be employed. Immunologic markers can also be employed. Further examples of selectable markers are well known to one of skill in the art.

Delivery of miRNA inhibitors and compositions of the invention to cells or tissue may be enhanced by carrier-mediated delivery including, but not limited to, cationic liposomes, cyclodextrins, porphyrin derivatives, branched chain dendrimers, polyethylenimine polymers, nanoparticles and microspheres (Dass C R. J Pharm Pharmacol 2002; 54( l):3-27). [See also, U.S. Published Application Nos. 2008/0241 198 ; 2009/0124534; 2009/0124777; 2005/0008617; and references cited therein] .

Kits

Any of the miRNA inhibitors or compositions described herein may be comprised in a kit. A kit may contain one, two or more, three or more, four or more, five or more, or six miRNA inhibitors. All possible combinations of miRNA inhibitors are contemplated by the invention. The kit may further include water and/or buffers to stabilize the mirRNA inhibitors. The kit may also include one or more transfection reagent(s) to facilitate delivery of the inhibitors to cells. The components of the kits may be packaged either in aqueous media or in lyophilized form. A kit may comprise container means including at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit may also contain a second, third or other additional container into which the additional components may be separately placed. For example, a kit may also comprise a second container means for containing a sterile, pharmaceutically acceptable buffer and/or other diluent. However, a kit may comprise various combinations of components that may be comprised in a vial. A kit may also include any other reagent containers in close confinement for commercial sale. For example, a kit may include injection or blow-molded plastic containers into which the desired vials are retained. Kits may also include components that preserve or maintain the miRNA inhibitors or that protect against their degradation. For example, the components may be RNAse-free or protect against RNAses.

The components of a kit may be provided in one and/or more liquid solutions, in particular an aqueous solution, preferably a sterile aqueous solution. The components of a kit may also be provided as dried powder(s) that can be reconstituted by the addition of a suitable solvent which may be provided in another container means.

A kit will also include instructions for using the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented. A kit may also include utensils or devices for administering a miRNA inhibitor or other kit component by various administration routes, such as parenteral or catheter administration.

Therapeutic Methods

The present invention further provides a method of modulating gene or gene product expression in a cell, in particular a target cell, comprising contacting the cell with a miRNA inhibitor of the invention. Contact with the miRNA inhibitor may cause a change in gene or gene product expression in the cell in comparison to gene or gene product expression in a cell not in contact with the miRNA inhibitor. The present invention also provides a miRNA inhibitor or composition of the invention for use in modulating gene or gene product expression in a cell, and the use of a miRNA inhibitor or composition of the invention in the manufacture of a medicament for use in modulating gene or gene product expression in a cell. In an aspect, the invention provides a method of increasing levels of a RNA or protein that are encoded by a target gene whose expression is down-regulated by a target miRNA by administering a miRNA inhibitor of the target miRNA of the invention. The miRNA inhibitor reduces or inhibits binding of the target miRNA to the target gene thereby increasing levels of the RNA or protein.

In an aspect, the invention provides a method of modulating a target miRNA in a cell or subject comprising administering to the cell or subject a miRNA inhibitor of the target miRNA, thereby modulating activity of the target miRNA. In an aspect, the invention provides a method of reducing the levels of a target miRNA in a cell or subject comprising administering to the cell or subject a miRNA inhibitor of the target miRNA of the invention, thereby reducing the levels of the target miRNA. In an aspect, the invention provides a method of reducing the levels of a target miRNA in a cell or subject comprising administering to the cell or subject a miRNA inhibitor comprising a polynucleotide that is sufficiently complementary to hybridize to a sequence of a pre-miRNA comprising a truncated target miRNA sequence or sequence complementary thereto, and one or more loop region nucleotides, thereby reducing the levels of the target miRNA. Such method includes contacting the cell or subject with the miRNA inhibitor for a time sufficient to allow uptake of the miRNA inhibitor into the cell.

In an aspect, the invention provides a method of increasing expression of a target gene or gene product encoded by the target gene by providing a miRNA inhibitor of the invention which binds to or mis-processes a target miRNA that binds a mRNA transcribed from the target gene. In an aspect, the invention provides a method of increasing expression of a target gene or gene product by providing a miRNA inhibitor comprising a polynucleotide that is sufficiently complementary to hybridize to a sequence of a pre-miRNA comprising a truncated target miRNA sequence or sequence complementary thereto, and one or more loop region nucleotides, wherein the target miRNA sequence hybridizes to a mRNA transcribed from the target gene. The binding of the miRNA inhibitor to the target miRNA (or in some aspects the complementary sequence) can cause an increase in mRNA expression. In the case of a subject, the method can be used to increase expression of a target gene or target gene product and treat a condition associated with a low level of expression of the gene or gene product. The invention also relates to a method of misprocessing in a cell or subject a target miRNA or pre-miRNA for a target miRNA comprising administering to the cell or subject a polynucleotide that is sufficiently complementary to hybridize to a sequence of the pre-miRNA comprising a truncated target miRNA sequence or sequence complementary thereto, and one or more loop region nucleotides, thereby misprocessing the miRNA or pre-miRNA. In aspects of the invention, the polynucleotide is sufficiently complementary to hybridize to contiguous nucleotides of a sequence of a pre-miRNA comprising a truncated target miRNA sequence or sequence complementary thereto, and one or more loop region nucleotides.

In an aspect, the invention provides a method of inhibiting gene expression modulated by a target miRNA in a cell or subject. In an embodiment, the method includes contacting the cell with an effective amount of a miRNA inhibitor comprising a polynucleotide that is sufficiently complementary to hybridize to a sequence of a pre-miRNA comprising a truncated sequence of the target miRNA or a sequence complementary thereto and one or more loop region nucleotides. In an aspect, the method includes contacting the cell with an effective amount of a miRNA inhibitor comprising a polynucleotide that is sufficiently complementary to hybridize to a sequence of a pre-miRNA comprising a truncated sequence of the target miRNA or sequence complementary thereto, and one or more loop region nucleotides.

The invention further provides a method of enhancing cell survival comprising administering to a subject in need thereof a miRNA inhibitor or composition of the invention.

The invention further provides a method of disrupting or inhibiting tumorigenesis comprising administering to a subject in need thereof a miRNA inhibitor or composition of the invention. In an aspect of the invention, a method is provided for treating in a subject breast cancer associated with miR-17-5p comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 66.

In an aspect of the invention, a method is provided for treating in a subject breast cancer associated with miR-17-5p comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 66.

In an aspect of the invention, a method is provided for treating in a subject breast cancer associated with miR-378 comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 70.

In an aspect of the invention, a method is provided for treating in a subject breast cancer associated with miR-378 comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 70.

In an aspect of the invention, a method is provided for treating in a subject breast cancer associated with miR-93 comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 71.

In an aspect of the invention, a method is provided for treating in a subject breast cancer associated with miR-93 comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 71.

In an aspect of the invention, a method is provided for treating in a subject breast cancer associated with miR-345 comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 72.

In an aspect of the invention, a method is provided for treating in a subject breast cancer associated with miR-345 comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 72.

In an aspect of the invention, a method is provided for treating in a subject breast cancer associated with miR-let7 comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 74.

In an aspect of the invention, a method is provided for treating in a subject breast cancer associated with miR-let7 comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 74.

In an aspect of the invention, a method is provided for treating in a subject a heptacellular carcinoma associated with miR-17-5p comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 66. In an aspect of the invention, a method is provided for treating in a subject a heptacellular carcinoma associated with miR-17-5p comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 66.

In an aspect of the invention, a method is provided for treating in a subject a heptacellular carcinoma associated with miR-345 comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 72.

In an aspect of the invention, a method is provided for treating in a subject a heptacellular carcinoma associated with miR-345 comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 72.

In an aspect of the invention, a method is provided for treating in a subject an oral carcinoma associated with miR-24 comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 67.

In an aspect of the invention, a method is provided for treating in a subject an oral carcinoma associated with miR-24 comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 67.

In an aspect of the invention, a method is provided for treating in a subject a small-cell lung cancer associated with miR-98 comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 68.

In an aspect of the invention, a method is provided for treating in a subject a small-cell lung cancer associated with miR-98 comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 68.

In an aspect of the invention, a method is provided for treating in a subject a small-cell lung cancer associated with miR-93 comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 71.

In an aspect of the invention, a method is provided for treating in a subject a small-cell lung cancer associated with miR-93 comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 71.

In an aspect of the invention, a method is provided for treating in a subject an invasive squamous cell carcinoma associated with miR-199 comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 69.

In an aspect of the invention, a method is provided for treating in a subject an invasive squamous cell carcinoma associated with miR-199 comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 69. In an aspect of the invention, a method is provided for treating in a subject pancreatic cancer associated with miR-let7 comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 74.

In an aspect of the invention, a method is provided for treating in a subject pancreatic cancer associated with miR-let7 comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 74.

In an aspect of the invention, a method is provided for treating in a subject ovarian cancer associated with miR-let7 comprising administering to a subject in need thereof a miRNA inhibitor of SEQ ID NO. 74.

In an aspect of the invention, a method is provided for treating in a subject ovarian cancer associated with miR-let7 comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 74.

In an aspect of the invention, a method is provided for treating breast cancer comprising administering to a subject in need thereof an effective amount of one or more of a miRNA inhibitor of SEQ ID NO. 66, a miRNA inhibitor of SEQ ID NO. 70, a miRNA inhibitor of SEQ ID NO. 71 , a miRNA inhibitor of SEQ ID NO. 72, and a miRNA inhibitor of SEQ ID NO. 74.

In an aspect of the invention, a method is provided for treating heptacellular carcinoma comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 66 and/or a miRNA inhibitor of SEQ ID NO. 72.

In an aspect of the invention, a method is provided for treating an oral carcinoma comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 67.

In an aspect of the invention, a method is provided for treating small-cell lung cancer comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 68 and/or a miRNA inhibitor of SEQ ID NO. 71.

In an aspect of the invention, a method is provided for treating an invasive squamous cell carcinoma comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 69.

In an aspect of the invention, a method is provided for treating pancreatic cancer comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 74. In an aspect of the invention, a method is provided for treating ovarian cancer comprising administering to a subject in need thereof an effective amount of a miRNA inhibitor of SEQ ID NO. 74.

The invention further provides a method of enhancing the effects of a chemotherapeutic treatment comprising administering to a subject in need thereof a miRNA inhibitor or composition of the invention. The invention further provides a combination treatment for treating cancer comprising administering to a subject in need thereof a miRNA inhibitor or composition of the invention in combination with a chemotherapeutic treatment.

An effective amount or dose of a miRNA inhibitor or composition of the invention which will be effective in the treatment of a miRNA condition will depend on the nature of the condition, and can be determined by standard clinical techniques. The precise dose to be employed will also depend on the route of administration, and the seriousness of the condition, and should be decided according to the judgement of the practitioner and each patient's circumstances.

Administration of a miRNA inhibitor or composition of the invention can be at a dosage on the order of about 0.00001 mg to about 3 mg, in particular about 0.3 to 3 mg, more particularly 0.0001 to 0.001 mg.

For administration to subjects, miRNA inhibitors of the invention can be provided in a unit dosage form comprising a therapeutically effective amount of miRNA inhibitor. A "unit dosage'" refers to a unitary i.e. a single dose which is capable of being administered to a subject, and which may be readily handled and packed, remaining as a physically and chemically stable unit dose comprising the active agents as such or a mixture with one or more pharmaceutically acceptable excipients, carriers, or vehicles.

A miRNA inhibitor or composition of the invention can be administered as a unit dose less than about 75 mg per kg of bodyweight or less than about 70, 60, 50, 40, 30, 20, 10, 5, 2 1 , 0.1 , 0.5, 0.1 , .05, .01 , .005, .001 or .0005 mg per kg of bodyweight. A unit dose may be administered by injection (e.g. intravenous or intramuscular), intrathecally or directly into a tissue or organ, inhalation, or a topical application.

A dosage or unit dose may be administered one or more times per day, in particular 1 or 2 times per day, and it may be administered to a subject for about or at least about 1 week, 2 weeks to 4 weeks, 2 weeks to 6 weeks, 2 weeks to 8 weeks, 2 weeks to 10 weeks, 2 weeks to 12 weeks, 2 weeks to 14 weeks, 2 weeks to 16 weeks, 2 weeks to 6 months, 2 weeks to 12 months, 2 weeks to 18 months, or 2 weeks to 24 months, periodically or continuously. Following successful treatment it may be desirable for a subject to undergo maintenance therapy to prevent recurrence of the condition.

An effective dose may be administered in a single dose or in two or more doses as desired or considered appropriate in the circumstances. A delivery device such as a pump or semi-permanent stant or reservoir may be employed to facilitate repeated or frequent infusions.

The following non-limiting example is illustrative of the present invention:

Example 1

The following materials and methods were used in the study described in this example.

Construct Generation

A miRNA construct expressing miR-378 was designed and DNA sequences were synthesized by a biotech company (Top Gene Technologies, Montreal). Using a similar approach, an antisense sequence to miR-378 was inserted in the expression vector producing a miR-Pirate-378 construct. In brief, the primers for miR-Pirate-378 were designed by PCR to incorporate an anti miR-378 sequence into the expression vector, followed by restriction digestion and ligation to produce a miR-Pirate-378 construct. Using similar approaches, expression constructs of miR-98, miR-pirate-98, and miRpirate- 17 were also generated.

Real-time PCR and RNA analysis

Total RNAs were isolated from cell cultures by using the mirVana miRNA Isolation Kit (Ambion) according to the manufacturer's instructions. RT-PCRs were performed as previously described (29). For mature miRNA analysis, total RNAs were extracted from -l x l O⁶ cells, followed by first strand cDNA synthesis using 1 μg RNA. Briefly, PCRs were performed with a QuantiMir-RT Kit. To perform these experiments, other kits were also used including Qiagen miScript Reverse Transcription Kit, cat#218060, miScript Primer Assay, cat#21841 1 , and miScriptSYBR GreenPCR Kit, cat#21 8073. The primers specific for mature miR-98 were purchased from Qiagen.

Luciferase Activity Assays U343 cells were cultured on 24-well tissue culture plates at a density of 3x l 0⁴ cells per well in DMEM containing 10% FBS. The cultures were maintained at 37°C for 24 hrs, followed by co-transfection with the luciferase reporter constructs and miRNAs using Lipofectamine 2000 following the methods recently described (23, 30). The cells were then collected and lysed with a luciferase specific lysis buffer from a Luciferase Assay Kit (Promega). The mixture of cell lysates was centrifuged at 3000 rpm for 5 min. The supernatants were transferred into a black 96- well plate (3x 10 μΐ) for luciferase activity measurement and into a transparent 96-well plate (3x50 μΐ) for β-gal activity analysis. For the luciferase activity measurement, luciferase assay reagent (70 μΐ) was added to each well and luciferase activity was measured using microplate scintillation and luminescence counter (Packard, Perkin Elmer). For the internal control of β-gal activity, 90 μΐ of assay reagent (4 mg/ml ONPG, 0.5M MgSC , β-mercaptoethanol and 0.4 M sodium phosphate buffer) was added to each well. The plate was then incubated at 37°C for 60 min. The absorbance at 410 nm was measured by using a microplate reader (Bio-Tek Instruments, Inc.). Cell survival assay

Cells (1.5xl 0⁵ cells/well or 2 l 0³cells/well) were seeded on 35 mm Petri dishes in DMEM containing 0- 10% FBS, and incubated for different time periods. The cell numbers were counted using trypan blue staining as described (3 J).

Western Blotting

Cell lysates were prepared from cells seeded in 6-well plates at 10⁶ cells/well by lysing the cells in each well with 100 μΐ lysis buffer containing protease inhibitors. Protein concentrations were measured by Bio-Rad protein assay kit. Lysates containing 30-80 μ protein were subjected to SDS-PAGE. The separated proteins were transferred to a nitrocellulose membrane followed by immunostaining with a primary antibody overnight at 4°C. Next day, the membrane was washed and incubated with HRP-conjugated goat-anti-mouse secondary antibody for 2 hours at room temperature followed by ECL detection. After detection of appropriate protein bands, the blot was re-probed with anti-P-actin antibody or anti-GAPDH antibody to confirm equal loading of samples.

Colony formation in soft agarose gel

A versican G3 construct, previously generated (32), was stably expressed in U87 cells as described (33). Colony formation was assessed using a method described previously (34). Briefly, 10³ cells were mixed in 0.3% low-melting agarose in DMEM supplemented with 10% FBS and plated on 0.66% agarose-coated 6-well tissue culture plates. Four weeks after cell inoculation, colonies were examined and photographed. Complexes containing more than 100 cells were counted as large colonies, while small colonies contained 30- 100 cells per colony.

Tumorigenicity assays and immunohistochemistry

Five-week-old Balb/c strain mice were injected with miR-98-, anti-miR-98-, or control vector-transfected 4T1 cells (5 x lO³ cells) subcutaneously. Analysis of tumorigenesis and immunohistochemistry were performed as previously described (33, 34, 36). Briefly, tumor sections derived from the miR-98, anti-miR-98, or control tumors were stained with hematoxylin and eosin (H&E) and immunostained with antibodies against CD34 to visualize blood vessels. In situ cell death was analyzed using the In situ cell death detection kit (Roche Diagnostics, Indiana polis, IN). Sections were also immunostained for expression of ALK4 and ALK7.

The study and study results are discussed below.

To solve the problems associated with using antisense to silence miRNAs, expression constructs were designed and generated that produce large fragments of RNA containing sixteen repeat sequences with sufficient homology to the target miRNA (Fig. l a). The homology is sufficient to block miRNA functions but does not allow co-processing with the full-length miRNA. The expressed products have partial homology with the mature miRNA. This would allow the products to be co-processed with the miRNA producing a product containing a truncated sequence of the miRNA (Fig. lb). The truncated miRNA would lose its normal functions, because at least three nucleotides in the ^ilseed" region were designed to be absent in the antisense construct. As a result, with or without processing, the miRNA could no longer repress gene expression. In this model, the RNA product can function in two ways. It can interfere with the process of targeting the pre-miRNA, leading to the production of imperfect mature miRNAs. It can also bind with an accumulation of targeting miRNA. The RNA transcript has the capacity to interact with sixteen miRNA of interest, forming a large complex and thereby arresting the functions of the original mature miRNA and the imperfect miRNA. The construct is sometimes referred to as miR-Pirate, meaning microRNA-inter acting RNA— Producing imperfect RNA and tangling endogenous miRNA {miR-Pirate).

To test whether this model can work in vitro and in vivo, miR-378 was employed as the first example and a construct named miR-Pirate-378 was generated. To confirm that transfection of miR-Pirate-378 caused misprocessing of endogenous miR-378, primers that specially amplified misprocessed miR-378 as well as pre-miR- 378 were designed (Fig. 6b). The GFP-transfected cells produced very low levels of misprocessed miR-378, while the miR-Pirate-378 -transfected U87 cells and 4T1 cells produced extremely high levels of the imperfect miR-378 (Fig. 7, Fig. 2a, Upper). On the other hand, the miR-Pirate-378-transfected U87 cells and 4T1 cells produced significantly lower levels of the mature miR-378 than the mock-transfected U87 and 4T1 cells (Fig 7. 2a, Lower). In the miR-Pirate-378-transgenic mice, the levels of imperfect miR-378 were significantly higher than that in the wildtype mice, but the difference was not as great as in the cell lines (Fig 7. 2b, Upper). These results suggest that the expression levels of miR-Pirate-378 in the transgenic mice were not as great as that in the cell lines. It is not unusual that the cell lines expressed higher levels of a transgene than transgenic mice. On the other hand, the levels of miR-378 decreased significantly in the transgenic mice (Fig. 2b, Lower) due to misprocessing of the endogenous miR-378. The RT-PCR products were cloned and sequenced to validate the products. Five clones obtained from the cells transfected with miR-Pirate- 378 started with 5'GGTAAC [SEQ ID NO. 54] (Fig. 2c), which is a sequence in the pre-miR-378 but not in the mature miR-378. The miR-Pirate-378 construct was designed to be co-processed by the miR-Pirate-378 product and the endogenous pre- miR-378, producing 5'GGUAAC... [SEQ ID NO. 55] RNAs. As expected, the ending sequence of all clones varied, since it is dependent on the activity of Dicer. Nevertheless, four clones obtained from the transgenic mice showed exactly the same sequence (Fig. 2c), suggesting that the function of Dicer when acting on miR-Pirate- 378 is dictated by an endogenous mechanism. The sequences of the cloned inserts linked to the cloning vector are provided in Fig. 7a.

The study was extended to identify targets of miR-378. Computational analysis showed that a great number of mRNAs were potential targets of miR-378, including Fus-1 and SuFu (23). In this study, other potential targets were also analyzed and the expression of vimentin was found to be repressed by miR-378 transfection. Vimentin expression was examined in cells stably transfected with miR- 378 using anti-vimentin monoclonal antibody. Repression of endogenous vimentin expression was confirmed by Western blot probed with antivimentin antibody. A clear reduction in vimentin expression was detected in cells transfected with miR-378, as compared with the control group (Fig. 2d). RT-PCR analysis detected little difference, indicating that miR-378 repressed vimentin expression at the translational level. Vimentin is expressed as an embryonic cytoskeleton molecule (24). It regulates a great number of cell activities including cell adhesion, migration, and signaling pathway (25). To confirm targeting by miR-378, a fragment of the vimentin 3'-UTR containing the miRNA target sequence, or a fragment whose miR target site was mutated was integrated (Fig. 2e, upper, nucleotides 4645-4676, GeneBank excess number NM_016169), into a luciferase reporter vector (pMIRReport, Ambion, Fig. 7b). Luciferase activity was significantly repressed in the construct harboring the miR- 378 target sequence, as compared with the control vector harboring a nonrelated fragment (Ctrl) or the mutated sequence (Fig 2e, lower). Three individual experiments produced similar results.

The affect of expression of miR-Pirate-378 on vimentin expression was next examined. Heart tissues obtained from miR-Pirate-378 transgenic and wildtype mice were subjected to Western blot analysis probed with anti-vimentin antibody. A clear up-regulation of vimentin expression was detected in the transgenic mice as compared with the wildtype mice (Fig. 2f, left). It was previously demonstrated that miR-378 targets Sufu (23). In this study, whether expression of miR-Pirate-378 was able to enhance Sufu expression in the transgenic mice expressing miR-Pirate-378 was examined. A prominent up-regulation of Sufu was observed in western blot (Fig. 2f, right). This result confirmed that expression of miR-Pirate-378 decreased the ability of endogenous miR-378 to inhibit expression of its targets. It was previously reported that cells transfected with a miR-378 expression construct were able to survive better in serum-free medium (23). In this study, whether expression of miR-Pirate-378 could inhibit the function of endogenous miR-378 was examined. Astrocytoma cell line U87 and breast cancer cell line 4T1 were transiently transfected with the miR-Pirate-378 construct or a control vector. Survival assays indicated that expression of miR-Pirate- 378 significantly decreased cell survival compared with the controls (Fig. 3a). A colony formation assay was performed and the cells transfected with miR-Pirate-378 were found to form smaller and less colonies than the controls (Fig. 3b). This is in consistent with previous results in which it was found that expression of miR-378 enhanced colony formation (23). Expression of miR-378 was also found to increase cell survival in serum-free medium. In this study, cells transfected with miR-378 were observed to be resistant to various drug-induced death (Fig. 3c). On the other hand, cells stably transfected with miR-Pirate-378 died faster and were sensitive to treatments of the chemo-drugs C2-ceramide, Cytarabine, and Methotrexate (Fig. 3d).

The experiments suggest that the miR-Pirate-378 is a powerful tool in suppressing endogenous miR-378 activity. To corroborate these results, a miR-Pirate was developed against another miRNA, miR-98, using the same approach of generating a construct expressing miR-98 and a construct expressing miR-Pirate-98 (Fig. 8). Cells expressing miR-98 showed reduced proliferation compared with cells expressing GFP (Fig. 4a). Expression of miR-Pirate-98 enhanced cell proliferation significantly compared with the control cells or cells expressing miR-98. In addition, transfection with miR-Pirate-98 enhanced cell survival while transfection with miR- 98 inhibited proliferation under serum-free conditions compared with the control (Fig. 4b, Fig. 9a). In colony-forming assays, 4T1 cells expressing miR-Pirate-98 formed larger and a greater number of colonies per plate while cells expressing miR-98 formed less and smaller colonies than the control cells (Fig. 4c). In the presence of the miR-Pirate-98-transfected cells, Ypen cells formed longer tube-like structures compared with the controls, but they formed smaller complexes when mixed with the miR-98-expressing cells (Fig. 4d).

The miR-98, or miR-Pirate-98, or GFP-transfected 4T1 cells were also inoculated on matrigel in trans-well inserts, followed by 3-day incubation and examination of cell invasion. Expression of miR-98 inhibited cell invasion while expression of miR-Pirate-98 promoted cell invasion as compared with the cells transfected with GFP (Fig. 4e). These results indicate that expression of miR-98 inhibited endothelial cell activities.

To further confirm the effects observed for miR-98, cell lines transfected with miR-98, miR-Pirate-98, or the control vector were injected subcutaneously into Balb/c regular mice. Tumor formation was monitored and mice were sacrificed once tumors reached the size limit set by the Sunnybrook Animal Care Committee. Mice injected with cell lines expressing miR-98 survived longer than when injected with the control vector while mice injected with miR-Pirate-98 survived shorter than the controls (Fig. 4f), suggesting an inhibitory effect of miR-98 on tumor growth. The tumors were sectioned for histological analysis. Since the breast cancer cells 4T1 are highly metastatic, local invasion of the tumor cells was detected which mixed with stromal smooth muscles. However, expression of miR-98 inhibited local invasion while overexpression of miR-Pirate-98 promoted local invasion compared with the control cells (Fig. 4g). The tumors were also tested for CD34 expression. The tumors formed by miR-Pirate-98-transfected cells contained larger and a higher amount of blood vessels than those formed by control- or miR-98-transfected cells (Fig. 4h). The miR- 98-derived tumor cells appeared unhealthy and possessed many vacuoles, suggesting that miR-98 can disrupt tumorigenesis (Fig. 9b).

Computational analysis indicated that ADAM- 15 and MMP- 1 1 are potential targets of miR-98. In Western blot assays, expression of ADAM- 15 and MMP-1 1 was repressed in the cells expressing miR-98 (Fig. 9c) and in the miR-98 tumors (Fig. 4i) as compared with its expression in the cells transfected with GFP and in the GFP tumors, respectively. On the other hand, expression of AD AM- 15 and MMP- 1 1 were up-regulated in the cells expressing miR-Pirate-98 and in the miR-Pirate-98 tumors as compared with its expression in the cells transfected with GFP and in the GFP tumors, respectively. ADAM 15 and MMPl l are known to play important roles in tumor invasion (26, 27). Inhibition of MMPs and ADAMs have been extensively shown to inhibit tumor progression (27, 28). This suggests that down regulation of MMP-1 1 and ADAM- 15 by miR-98 can explain tumorigenic properties of breast cancer cells since they are the key regulators of tumor invasion.

To explore the possibility of using miR-pirate as an approach for gene therapy, miR-pirate was synthesized chemically and its functions were tested. Mouse breast cancer cells 4T1 , human brain tumor cell line U343, and U87 were transiently transfected with miR-pirate-378, miR-pirate-98, and miR-pirate- 17, respectively, followed by real-time PCR analysis of the levels of miR-pirate-378 (Fig. 5a), miR- pirate-98 (Fig. 5b), and miR-pirate- 17 (Fig. 5c), and mature miR-378, miR-98, and miR- 17. Transfection with miR-pirate not only induced production of miR-pirate product, but also decreased mature miRNA levels. The miR-pirate oligos were more powerful in reduction of mature miRNAs than the regular miRNA inhibitors (Fig. 5d). These results indicate that the chemically synthesized miR-pirate interrupted the normal processing of endogenous miRNAs, implying the potential use for gene therapy. Most importantly, the miR-Pirate is more powerful than the regular miR inliibitor in the reduction of miRNA levels.

The results demonstrated that miR-PIRATE could inhibit endogenous miRNA functions powerfully and specifically due to its dual roles in inducing mis-processing of pre-miRNA and arresting the guided strand of the miRNA. The specific function of miR-PIRATE can be employed as a tool to analyze the function of a single miRNA without affecting it neighbourhood miRNA(s) genetically. This is superior to the gene knock-out approach which affects miRNA at the genomic level and will interrupt the neighbourhood miRNAs. It should be noted that although the miR-PIRATE can specifically block the function of the target miRNA, it could also affect the process of the passenger strand due to the lack of the guided strand. The powerful function of the chemically synthetic miR-PIRATE in pirating the endogenous miRNAs makes it an ideal approach in clinical application.

Table 1 - Spacers

5'GCTAGCCCATCGCG [SEQ ID NO. 56]

5'ATCGATCG [SEQ ID NO. 57]

5 'GCGAA AGGTCTCGAT [SEQ ID NO. 58]

5 'GACG ACTATCG [SEQ ID NO. 59]

5 'GACGACCTATCG [SEQ ID NO. 60]

5 'CCAGCTACGGATCCCCATCGCG [SEQ ID NO. 61 ]

5'GATCG [SEQ ID NO. 62]

5'CCAGCTACGAATTCCCATCGCG [SEQ ID NO. 63]

5'CCAGCTACGGTACCCCATCGCG [SEQ ID NO. 64]

5 'CCAGCTACAAGCTT [SEQ ID NO. 65]

Table 2 - miRNA Inhibitors

Anti-miR-378 5' ggtaacacacaggacctggagtc [SEQ ID NO. 2]

Anti-miR-98 5 'ugagguaguaaguuguauuguu [SEQ ID N0.44]

Anti-miR-17-5p 5'atatcactacctgcactgtaagca [SEQ ID NO. 66]

Anti-miR-24 5' ctcctgttcctgctgaactg [SEQ ID NO. 67]

Anti-miR-98 5' acccacaacaatacaacttacta [SEQ ID NO. 68]

Anti-miR-1 9a* 5 ' gcctaaccaatgtgcagact [SEQ ID NO. 69]

Anti-miR-378 5' ggtaacacacaggacctggagtc [SEQ ID NO. 70]

Anti-miR-93 5 ' atcacactacctgcacgaacag [SEQ ID NO. 71 ]

Anti-miR-345 5 ' catcacgagccctggactagga [SEQ ID NO. 72]

Anti-miR-207 5' aaagagagggaggagagccag [SEQ ID NO. 73]

Anti-miR-let7 5 ' aactatacaacatacctacctca [SEQ ID NO. 74] Full Citations for Publications

1. D. P. Bartel, Cell 116, 281 (Jan 23, 2004).

2. G. Hutvagner, P. D. Zamore, Science 297, 2056 (Sep 20, 2002).

3. E. Lund, S. Guttinger, A. Calado, J. E. Dahlberg, U. Kutay, Science 303, 95 (Jan 2, 2004).

4. H. Seitz et al, Nat Genet 34, 261 (Jul, 2003).

5. Y. Lee et al , Nature 425, 415 (Sep 25, 2003).

6. Y. Zeng, B. R. Cullen, Nucleic Acids Res 32, 4776 (2004).

7. Y. S. Lee et al, Cell 117, 69 (Apr 2, 2004).

8. J. H. Mansfield et al, Nat Genet 36, 1079 (Oct, 2004).

9. Y. Zhao, E. Saraal, D. Srivastava, Nature 436, 214 (Jul 14, 2005).

10. H. Kawasaki, K. Taira, Nature 426, 100 (Nov 6, 2003).

1 1. J. A. Chan, A. M. Krichevsky, K. S. Kosik, Cancer Res 65, 6029 (Jul 15, 2005).

12. Y. Chen, R. L. Stallings, Cancer Res 67, 976 (Feb 1 , 2007).

13. A. Cimmino et al, Proc Natl Acad Sci U S A 102, 13944 (Sep 27, 2005).

14. S. Cost ean et al , Proc Natl Acad Sci U S A 103, 7024 (May 2, 2006).

15. C. M. Croce, G. A. Calin, Cell 122, 6 (Jul 15, 2005).

16. C. C. Mello, M. P. Czech, Nat Med 10, 1297 (Dec, 2004).

17. R. Triboulet et al , Science 315, 1579 (Mar 16, 2007).

18. P. Chellappan, R. Vanitharani, C. M. Fauquet, Proc Natl Acad Sci U S A 102, 10381 (Jul

19, 2005).

19. S. Volinia et al , Proc Natl Acad Sci U S A 103, 2257 (Feb 14, 2006).

20. J. M. Thomson et al, Genes Dev 20, 2202 (Aug 15, 2006).

21. P. S. Eis et al , Proc Natl Acad Sci U S A 102, 3627 (Mar 8, 2005).

22. G. A. Calin, C. M. Croce, Cancer Res 66, 7390 (Aug 1 , 2006).

23. D. Y. Lee, Z. Deng, C. H. Wang, B. B. Yang, Proc Natl Acad Sci U S A 104, 20350 (Dec

18. 2007).

24. Q. F. Li et al, J Biol Chem 281, 34716 (Nov 10, 2006).

25. J. Ivaska, H. M. Pallari, J. Nevo, J. E. Eriksson, Exp Cell Res 313, 2050 (Jun 10, 2007).

26. D. Eletto et al, J Cell Physiol (Mar 31 , 2008).

27. A. J. Najy, K. C. Day, M. L. Day, Cancer Res 68, 1092 (Feb 15, 2008). 28. M. Egeblad, Z. Werb, Nat Rev Cancer 2, 161 (Mar, 2002).

29. D. P. LaPierre et al. , Cancer Res 67, 4742 (May 15, 2007).

30. C. H. Wang et al, PLoS ONE 3, e2420 (2008).

31. W. Sheng et αί , ΜοΙ Βίο! Cell 16, 1330 (Mar, 2005).

32. Y. Zhang, L. Cao, C. G. Kiani, B. L. Yang, B. B. Yang, J Biol Chem 273, 33054 (1998).

33. Y. Wu et al. , J Biol Chem 276, 14178 (Apr 27, 2001).

34. D. Busse et al., J Biol Chem 275, 6987 (Mar 10, 2000). The present invention is not to be limited in scope by the specific embodiments described herein, since such embodiments are intended as but single illustrations of one aspect of the invention and any functionally equivalent embodiments are within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

All publications, patents and patent applications referred to herein are incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. All publications, patents and patent applications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing the antibodies, methodologies etc. which are reported therein which might be used in connection with the invention. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

Sequences

SEQ ID NO. 1

ggtaacacacaggacctggagtc

SEQ ID NO. 2

gacuccagguccuguguguuacc

SEQ ID NO. 3

aggcuccugacuccagguccuguguguuaccuagaaa

SEQ ID NO. 4

uccggagacugagguucaggucacgauaaagaucc SEQ ID NO. 5

aggcuccugacuceagguccuguguguuaccuagaaauagcacu

SEQ ID NO. 6

cugagguccaggacacacaaaugg

SEQ ID NO 7

cuccugacuccagguccugugu

SEQ ID NO.8

uguguccuggaccucaguccuc

SEQ ID NO. 9

ccauuguguguccuggaccucag

SEQ ID NO. 10

gguaacacacaggaccuggagucaucgaucggguaacacacaggaccuggagucgcga

SEQ ID NO. 1 1

ggtaacacacaggacctgGAGTC

SEQ ID NO. 12

ggtaacacacaggacctg

SEQ ID NO. 13

ggtaacacacaggacctgGAGTCatcg

SEQ ID NO. 14

ggtaacacacaggacctgGAGTCatcga

SEQ ID NO. 1 5

ggtaacacacaggacctgGAGT

SEQ ID NO. 16 AAACAGUCUUUCAAGUGCCU UUCUGCAGUUUUUCAGGAG SEQ ID NO. 17

UGUGUCCU SEQ ID NO. 1 8

GGACCUC S EQ ID NO. 1 9

AGUCCUC SEQ ID NO. 20

AAACAGCUUUCAAGUGCCUUUCUGCAGUUUUAGUCCUC SEQ ID NO. 21

TCCAGGTCCTGTGTGTTACCTA SEQ ID NO. 22

TTACAGTGCAGGTAGTGATATGT SEQ ID NO. 23

TAAGTTGTATTGTTGTGGGGTA S EQ ID NO. 24

gaattcgcccttggtaacacacaggacctgGAGTC

SEQ ID NO. 25

ccagc

SEQ ID NO. 26

aaaaaaaaaaaaaaaatctaggaagtcgacctcggcatgcgtaactggtgctcgattcaagggcgaattc SEQ ID NO. 27

atcgagt

SEQ ID NO. 28

aaaaaaaaaaaaaaaaaatctaggaagtcgacctcggcatgcgtaactggtgctcgattcaagggcgaattc

SEQ ID NO. 29

Gaattcgcccttggtaacacacaggacctg

SEQ ID NO. 30

aagtccgatagtcgt

SEQ ID NO. 3 1

gaattcgcccttggtaacacacaggacctgGAGT

SEQ ID NO. 32

atcg SEQ ID NO. 33

aaaaaaaaaaaaaaatctaggaagtcgacctcggcatgcgtaactggtgctcgattcaagggcgaattc

SEQ ID NO. 34

aaaaac

SEQ ID NO. 35

gaattcgcccttggtaacacacaggacctgacaacatcctggttgctcctatctgattaaaaaaaaaaaaaaaaaatctagga ag tcgacctcggcatgcgtaactggtgctcgattcaagggcgaattc

SEQ ID NO. 36

ccccagagaaagaaaaaaaaaaaaaaaaatctaggaagtcgacctcggcatgcgtaactggtgctcgattcaagggcga attc

SEQ ID NO. 37

Gaattcgcccttggtaacacacaggacctgacaacatcctggttgctcctatctgatt

SEQ ID NO. 38

aaaaaaaaaaaaaaaaatctaggaagtcgacctcggcatgcgtaactggtgctcgattcaagggcgaattc

SEQ ID NO. 39

ActagtTaaaaattgcacacactcagtgcagcaatatattaccagcaagaataaaaaagaaatccatatcttaaagaaaca gctttcaagtgcctttctgcagtttttcaggagcgcaagatag

SEQ ID NO. 40

ActagtTaaaaattgcacacactcagtgcagcaatatttaccagcaagaataaaaaagaaatccatatcttaaagaaacag ctttcaagtgccttlctgcagttttAGTCCTCcgcaagatag

SEQ ID NO. 41

gagctc

SEQ ID NO. 42

actagttaatggagccacatgtatagatggcctcaatacatttacttgcctgtgtctaccaagctat

SEQ ID NO. 43

cattttatcccatgaggaacaagtcttcgtgaaccgtattgggcacgactaccagtggattggcctcaatgacaagatgtttga gcgtgatttcgagctc

SEQ ID NO. 44

ugagguaguaaguuguauuguu

SEQ ID NO. 45

uaguaaguuguauuguuguggg

SEQ ID NO. 46

uuguuauguugaaugauggagu

SEQ ID NO. 47

agggugagguaguaaguuguauuguugugggguagggauauuaggccccaauuagaaga SEQ ID NO. 48

Uccuuucaucauucaacauaucaauagaagauuaaccccggauuuagggauggggug SEQ ID NO. 49

agggugagguaguaaguuguauuguugugggguagggauauuag

SEQ ID NO. 50

atcattcaacataacaacaccca

SEQ ID NO. 5 1

Uuguuauguugaaugauggagu

SEQ ID NO. 52

Ggguguuguuauguugaaugau

SEQ ID NO. 53

acccacaacaatacaacttactaaucgaucgacccacaacaatacaacttactagcga SEQ ID NO. 54

GGTAAC

SEQ ID NO. 55

GGUAAC

SEQ ID NO. 56

5 'GCTAGCCCATCGCG

SEQ ID NO. 57

5 ^'ATCGATCG

SEQ ID NO. 58

5 ^'GCGAAAGGTCTCGAT

SEQ ID NO. 59

5 ^'GACGACTATCG

SEQ ID NO. 60

5 'GACGACCTATCG

SEQ ID NO. 61

5 'CCAGCTACGGATCCCCATCGCG

SEQ ID NO. 62

5 'GATCG

SEQ ID NO. 63

5 ^"CCAGCTACG AATTCCC ATCGCG

SEQ ID NO. 64 5 'CCAGCTACGGTACCCCATCGCG

SEQ ID NO. 65

5 'CCAGCTACAAGCTT

SEQ ID NO. 66

Anti-miR-17-5p

5 'atatcactacctgcactgtaagca

SEQ ID NO. 67

5 ^' ctcctgttcctgctgaactg

SEQ ID NO. 68

Anti-miR-98

5 ' acccacaacaatacaacttacta

SEQ ID NO. 69

Anti-miR- 199a*

5 ^' gcctaaccaatgtgcagact

SEQ ID NO. 70

Anti-miR-378

5 ' ggtaacacacaggacctggagtc

SEQ ID NO. 71

Anti-miR-93

5 ^' atcacactacctgcacgaacag

SEQ ID NO. 72

Anti-miR-345

5 ^" catcacgagccctggactagga

SEQ ID NO. 73

Anti-miR-207

5 ^" aaagagagggaggagagccag

SEQ ID NO. 74

Anti-miR~let7

5 'aactatacaacatacctacctca

Claims

What is Claimed Is:

1. A miRNA inhibitor of a target miRNA comprising at least one polynucleotide having a sequence complementary to (i) a truncated sequence of the target miRNA, or sequence complementary thereto, and (ii) one or more nucleotides of the loop region of a pre-miRNA sequence from which the miRNA is generated.

2. A miRNA inhibitor of claim 1 , wherein the miRNA inhibitor can bind to the target miRNA or induce mis-processing of the target miRNA.

3. A miRNA inhibitor of a target miRNA comprising at least one polynucleotide sequence that is sufficiently complementary to hybridize to a sequence of a pre-miRNA comprising a truncated sequence of the target miRNA or sequence complementary thereto, and, one or more nucleotides of the loop region.

4. A miRNA inhibitor of claim 1 , 2 or 3 of the formula [A - B]„ where A is a polynucleotide sufficiently complementary to a sequence of a pre-miRNA comprising a truncated sequence of the target miRNA or sequence complementary thereto, and, one or more nucleotides of the loop region; B is an optional spacer; and, n is 1 to 32.

5. A miRNA of claim 1 , 2, 3 or 4 wherein the truncated sequence of the target miRNA and nucleotides of the loop region are contiguous.

6. A miRNA inhibitor of any one of claims 1 to 5, wherein the truncated sequence of the target miRNA comprises or consists of a target miRNA sequence absent 1 to 10 nucleotides from the 3' or 5' end.

7. A miRNA inhibitor of any one of claims 1 to 6 wherein the nucleotides of the loop region comprise 2 to 10 contiguous nucleotides of the loop region of the native pre-miRNA.

8. A miRNA inhibitor of any one of claims 1 to 7 wherein the sequence of the polynucleotide is at least about 95%, 96%, 97%, 98%, 99%, or 100% complementary to the contiguous nucleotides of the pre-miRNA from which the target miRNA is generated.

9. A miRNA inhibitor of any one of claims 1 to 3 and 5 to 8 comprising one or more spacer.

10. A miRNA inliibitor of claim 9 wherein the spacer is 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30 or more nucleotides.

1 1. A miRNA inhibitor of any one of claims 1 to 10 wherein the target miRNA is overexpressed and/or secreted by tumor cells.

12. A miRNA inhibitor of any one of claims 1 to 10 wherein the target miRNA is miR-17-5p, miR-24, miR-98, miR-199a, miR-378, miR-93, miR-345, miR- 207 or miR-let7.

13. A miRNA inhibitor of claim 1 comprising the sequence of SEQ ID NO. 2, 44, 66, 67, 68, 69, 70, 71 , 72, 73, or 74.

14. A vector comprising a miRNA inhibitor of any one of claims 1 to 13.

15. A cell comprising a vector of claim 14.

16. A pharmaceutical composition comprising a miRNA inhibitor of any one of claims 1 to 13.

17. A pharmaceutical composition comprising a miRNA inhibitor of any one of claims 1 to 13 and another chemotherapeutic agent.

18. A method of modulating a target miRNA in a cell or subject comprising administering to the cell or subject a miRNA inhibitor of the target miRNA as claimed in any one of claims 1 to 13 claim, thereby modulating activity of the target miRNA.

19. A method of increasing levels of a RNA or protein that are encoded by a target gene whose expression is down-regulated by a target miRNA by administering a miRNA inhibitor of the target miRNA as claimed in any one of claims 1 to 13, whereby the miRNA inhibitor reduces or inhibits binding of the target miRNA to the target gene thereby increasing levels of the RNA or protein.

20. A method of treating or preventing a miRNA condition associated with a target miRNA in a subject comprising administering to a subject a miRNA inhibitor of the target miRNA as claimed in any one of claims 1 to 13.