Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
  • C07K16/2863—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
  • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
  • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
  • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P17/00—Drugs for dermatological disorders
  • A61P17/06—Antipsoriatics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P19/00—Drugs for skeletal disorders
  • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/02—Immunomodulators
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
  • C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
  • C07K16/3007—Carcino-embryonic Antigens
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/32—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
  • C07K16/46—Hybrid immunoglobulins
  • C07K16/468—Immunoglobulins having two or more different antigen binding sites, e.g. multifunctional antibodies
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
  • C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
  • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
  • C07K2317/32—Immunoglobulins specific features characterized by aspects of specificity or valency specific for a neo-epitope on a complex, e.g. antibody-antigen or ligand-receptor
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
  • C07K2317/52—Constant or Fc region; Isotype
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
  • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
  • C07K2317/565—Complementarity determining region [CDR]
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
  • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
  • C07K2317/567—Framework region [FR]
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
  • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
  • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
  • C07K2317/64—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising a combination of variable region and constant region components
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
  • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
  • C07K2317/94—Stability, e.g. half-life, pH, temperature or enzyme-resistance
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide

Definitions

• the present invention relates to protein and polypeptide constructs that comprise single variable domains that are linked to an Fc portion.
• the invention relates to such constructs that comprise immunoglobulin single variable domains that are linked to an Fc portion that is derived from IgE (as further described herein).
• the immunoglobulin single variable domains may for example be a domain antibody (or an immunoglobulin variable domain that is suitable for use as a domain antibody), a single domain antibody (or an immunoglobulin variable domain that is suitable for use as a single domain antibody), a "dAb” (or an immunoglobulin variable domain that is suitable for use as a dAb) or a Nanobody (as defined herein, and including but not limited to a V HH sequence); or any suitable fragment of any one thereof.
• the invention also relates to polypeptide chains that form part of such constructs and/or that can be used to form such constructs.
• the invention further relates to nucleotide sequences and nucleic acids that encode or can be used to express such constructs or polypeptide chains; to methods for producing such constructs and polypeptides chains; to compositions (and in particular pharmaceutical compositions) that comprise such constructs or polypeptide chains; and to uses of such constructs, polypeptide chains or compositions.
• single variable domains can be linked to Fc portions.
• the naturally occurring "heavy chain antibodies” from Camelidae comprise naturally occurring single variable domains (called "V HH domains") that are linked via a hinge region to an Fc portion.
• V HH domains naturally occurring single variable domains
• these heavy chain antibodies lack the C H I domain that is present in conventional 4-chain antibodies, with the V HH being directly linked - via the hinge - to the C R 2 domain of the Fc portion.
• EP 0 698 097 and its divisional application EP 1 621 554 also describe that V HH domains can be linked to a human Fc portion.
• WO 04/068820 describes so-called "dAb's" that are linked to an effector group. The examples given are constructs that comprise dAb's linked to the Fc of IgGl.
• WO 02/056910 also describes constructs in which binding domains that include at least one immunoglobulin variable region polypeptide are linked, via a suitable linker, to C R 2/C H 3 constant regions.
• the C H 2 and C H 3 regions of human IgG or human IgA are mentioned.
• the immunoglobulin variable region polypeptide may be all or a portion or fragment of heavy chain or light chain V-region, provided it is capable of specifically binding an antigen. It should however be noted that in the examples of WO 02/056910, the immunoglobulin variable region polypeptide is comprised of an ScFv fragment (in which the antigen binding site is formed jointly by the V H and V L domains that form the ScFv fragment).
• constructs described in these references all comprise two polypeptide chains, in which each polypeptide chain comprises one single variable domain that is linked, usually via a suitable hinge region or linker, to two constant domains that, in the final construct, form the Fc portion. These constructs bind to the intended antigen via the two antigen-binding sites that are present on each of the single variable domains.
• immunoglobulin isotypes There are five general classes of immunoglobulin isotypes, namely IgG, IgA, IgM, IgE and IgD. All consist of heavy chains and light chains comprising variable domains and constant domains.
• the heavy chains of immunoglobulins of the IgG, IgA and IgD isotypes contain 3 constant domains (referred to as C H I 3 C H 2 and C H 3 in the case of IgG; as C ⁇ l, C ⁇ 2 and C ⁇ 3 in the case of IgA; and as CgI, Cg2 and Cg3 in the case of IgD)
• the heavy chains of the IgM and IgE isotypes comprise 4 constant domains (referred to as C ⁇ l, C ⁇ 2, C ⁇ 3 and C ⁇ 4 in the case of IgM and as C E 1, C ⁇ 2, C ⁇ 3 and C ⁇ 4 in the case of IgE).
• IgE binds to the Fc ⁇ receptors on mast cells and basophils (which are the main effectors of IgE-mediated immune reactions), as well as to Fc ⁇ receptors on other Fc e receptor-bearing cells, such as B-cells, T- cells, dendritic cells, monocytes, alveolar macrophages, eosinophils and platelets. It is also known that there are at least two IgE receptors, i.e.
• the high-affinity IgE receptor Fc ⁇ Rl to which IgE binds with an affinity that is two to five orders greater than the affinity of IgG for its high-affinity receptor, Fc ⁇ RI
• the low affinity receptor Fc ⁇ RII also known as CD23. It has been suggested that, of the IgE-mediated immune responses, binding of IgE to Fc ⁇ RI (as expressed on mast cells, basophils and eosinophils) triggers cytotoxic cell killing (ADCC) and that binding of IgE to CD23 is responsible for triggering phagocytosis (ADCP), and also facilitates antigen presentation and stimulates T helper cells and so a Th2 response.
• ADCC cytotoxic cell killing
• ADCP phagocytosis
• the term "Fc portion" is generally used to refer to a constant region dimer that lacks the C H I domain (in case of an IgG. This term will be used more generally herein to refer to the constant region dimer of an IgG that lacks C H I , of an IgA that lacks C ⁇ l, of an IgD that lacks CgI, of an IgM that lacks C ⁇ l, and of an IgE that lacks C ⁇ l .
• the Fc portion comprises C G 2, C ⁇ 3 and C e 4).
• the Fc portion of an immunoglobulin is also responsible for the effector functions (depending on the isotype and subtype of the immunoglobulin), the Fc portion (or at least the parts or domains thereof that are capable of providing the relevant effector functions) are also sometimes referred to as "effector groups". Accordingly, depending on the context, the terms “Fc portion” and “effector group” will be used interchangeably herein.
• the present invention provides constructs that comprise two polypeptide chains, in which each polypeptide chain comprises at least one single variable domain that is linked, optionally via a suitable linker or hinge region, to one or more constant domains, wherein the constant domains from the first polypeptide chain and the second polypeptide chains together form (or are capable of forming) an Fc portion that is capable of effecting one or more IgE- mediated immune responses (as defined herein) and/or that is capable of binding to either the Fc ⁇ RI receptor and/or the Fc ⁇ RII receptor (as further described herein).
• an Fc portion will also be referred to herein as an "IgE-derived Fc portion" .
• constructs provided by the invention comprise an IgE-derived Fc portion (as defined herein) that is linked (optionally via a suitable linker or hinge region) to two single variable domains (also as defined herein, with each polypeptide chain that forms the IgE- derived Fc portion being linked to at least one single variable domain).
• constructs may for example be as described in EP 1 621 554, WO 02/056910 or WO 02/056910, but comprising an IgE-derived Fc portion (as defined herein) instead of an IgG- or IgA-derived Fc portion, as described in these references.
• the invention also relates to a protein or polypeptide that comprises or essentially consists of a construct of the invention.
• the invention further relates to a polypeptide chain that forms part of a construct of the invention and/or that is capable of forming (or can be used to form) a construct of the invention (i.e. together with another such polypeptide chain).
• polypeptide chains which are also generally referred to herein as "polypeptide chains of the invention", and which may be as further described herein), and their use in forming the constructs of the invention, form further aspects of the invention.
• these polypeptide chains of the invention may also be used as such (i.e. without interaction with another polypeptide chain and/or not as part of a construct of the invention).
• the invention further relates to nucleotide sequences or nucleic acids that encode and/or that can be used to express a construct of the invention and/or a polypeptide chain of the invention.
• nucleotide sequences or nucleic acids which are also generally referred to herein as "nucleic acids of the invention" may be as further described herein.
• the invention further relates to methods for producing the constructs and polypeptides of the invention; to compositions (and in particular pharmaceutical compositions) that comprise one or more constructs or polypeptide chains of the invention; and to uses of the constructs or polypeptide chains of the invention or of compositions comprising them. Such methods, compositions and uses may be as further described herein.
• Figure 1 schematically shows a preferred, but non-limiting example of a construct of the invention, which construct comprises two polypeptide chains of the invention (1) and (2), which each comprise a single variable domain (3) that is linked via an optional hinge or linker (4) to three constant domains (5), (6) and (7), which together with the constant domains from the other polypeptide chain of the invention form the IgE derived Fc portion (8).
• the three constant domains (5), (6) and (7) are preferably the constant domains C ⁇ 2, C ⁇ 3 and C ⁇ 4 of human IgE, respectively, so that the IgE derived Fc portion (8) is the Fc portion of human IgE.
• Figure 2 schematically shows a specific, but non-limiting example of a construct of the invention, which construct comprises two polypeptide chains of the invention (1) and (2), which each comprise two single variable domains (3) and (9) that are linked to each other via an optional linker (10) and that are linked via an optional hinge or linker (4) to three constant domains (5), (6) and (7), which together with the constant domains from the other polypeptide chain of the invention form the IgE derived Fc portion (8).
• the three constant domains (5), (6) and (7) are preferably the constant domains C ⁇ 2, C ⁇ 3 and C ⁇ 4 of human IgE, respectively, so that the IgE derived Fc portion (8) is the Fc portion of human IgE.
• the two single variable domains (3) and (9) may be essentially the same (i.e. directed against the same target or antigen, such as against the same antigenic determinant, epitope, part or domain on the same target) to allow for high(er) avidity binding to the intended antigen.
• Figure 3 schematically shows a non-limiting example of a polypeptide of the invention, comprising a single variable domain (3) that is linked via an optional hinge or linker (4) to three constant domains (5), (6) and (7).
• a polypeptide chain may be used to form a construct of the invention (i.e. with another polypeptide chain of the invention), but may also be used as such (i.e. without interaction with another polypeptide chain of the invention), for example when the Fc ⁇ chain (or an variant, analog, part of fragment thereof) that is formed by the constant domains is monomeric (i.e. non self-associating).
• Figure 4 schematically shows a non-limiting example of a specific, but non-limiting polypeptide of the invention, comprising two single variable domains (3) and (9) that are linked to each other via an optional linker (10) and that are linked via an optional hinge or linker (4) to three constant domains (5), (6) and (7).
• a polypeptide chain may be used to form a construct of the invention (i.e. with another polypeptide chain of the invention), but may also be used as such (i.e. without interaction with another polypeptide chain of the invention), for example when the Fc ⁇ chain that is formed by the constant domains is monomeric (i.e. non self-associating).
• the two single variable domains (3) and (9) may be different (as described in the co-pending International patent application by Ablynx N.V. entitled ''Immunoglobulin constructs") or may be the same. It should also be noted that, unless specifically defined otherwise herein, all terms used in the present specification either have the meaning given to them in the prior art cited herein (and in particular given to them in WO 06/122 825 or WO 06/122786), or otherwise have their usual meaning in the art, which will be clear to the skilled person. Reference is for example made to the standard handbooks, such as Sambrook et al, "Molecular Cloning: A Laboratory Manual” ( 2nd.Ed.), VoIs. 1-3, Cold Spring Harbor Laboratory Press (1989); F.
• the single variable domains that are present in the constructs of the invention may be any variable domain that forms a single antigen binding unit.
• such single variable domains will be amino acid sequences that essentially consist of 4 framework regions (FRl to FR4 respectively) and 3 complementarity determining regions (CDRl to CDR3 respectively); or any suitable fragment of such an amino acid sequence (which will then usually contain at least some of the amino acid residues that form at least one of the CDR' s, as further described herein).
• Such single variable domains and fragments are most preferably such that they comprise an immunoglobulin fold or are capable for forming, under suitable conditions, an immunoglobulin fold.
• the single variable domain may for example comprise a light chain variable domain sequence (e.g.
• V L -sequence or a suitable fragment thereof; or a heavy chain variable domain sequence (e.g. a V ⁇ -sequence or V HH sequence) or a suitable fragment thereof; as long as it is capable of forming a single antigen binding unit (i.e. a functional antigen binding unit that essentially consists of the single variable domain, such that the single antigen binding domain does not need to interact with another variable domain to form a functional antigen binding unit, as is for example the case for the variable domains that are present in for example conventional antibodies and ScFv fragments that need to interact with another variable domain - e.g. through a V H /V L interaction - to form a functional antigen binding domain).
• a single antigen binding unit i.e. a functional antigen binding unit that essentially consists of the single variable domain, such that the single antigen binding domain does not need to interact with another variable domain to form a functional antigen binding unit, as is for example the case for the variable domains that are present in for example
• the single variable domain may be a domain antibody (or an amino acid sequence that is suitable for use as a domain antibody), a single domain antibody (or an amino acid sequence that is suitable for use as a single domain antibody), a "dAb” (or an amino acid sequence that is suitable for use as a dAb) or a Nanobody (as defined herein, and including but not limited to a V HH sequence); other single variable domains, or any suitable fragment of any one thereof.
• dAb or an amino acid sequence that is suitable for use as a dAb
• Nanobody as defined herein, and including but not limited to a V HH sequence
• the amino acid sequence of the invention may be a NanobodyTM or a suitable fragment thereof.
• Nanobody®, Nanobodies® and Nanoclone® are trademarks ofAblynx N, V.J
• WO 94/04678, WO 95/04079 and WO 96/34103 of the Vrije Universiteit Brussel WO 94/25591, WO 99/37681, WO 00/40968, WO 00/43507, WO 00/65057, WO 01/40310, WO 01/44301, EP 1 134231 and WO 02/48193 of Unilever; WO 97/49805, WO 01/21817, WO 03/035694, WO 03/054016
• Nanobodies in particular V HH sequences and partially humanized Nanobodies
• the single variable domains used in the constructs of the invention may be directed against (as defined in WO 06/122 825) any suitable antigen.
• suitable antigens and of single variable domains directed against those antigens will be clear to the skilled person based on the disclosure herein, and for example include the antigens and single variable domains mentioned in the prior art cited herein as well as the antigens and "dAb's" mentioned and described in the patent applications of Domantis Ltd. or Domantis Inc..
• the single variable domains used in the constructs of the invention may in particular be directed against one or more antigens that are expressed by cancer cells and/or that are associated with cancer cells, such as the antigens that are commonly used as targets for cancer therapy (such as for cancer immunotherapy using antibodies or antibody-based therapeutics).
• antigens include, but are not limited to B-cell or T-cell lymphoma B- and T-cell receptor idiotypic sequences, respectively, CD 19, CD23 (low affinity IgE receptor), Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), CD52 (CAMPATH-I antigen), CD80 (B7-1), GD3 (ganglioside cancer marker), MUCl (glycoprotein cancer marker), EpCAM (epithelial cell adhesion molecule cancer marker), RAAGl 2 (glycoprotein cancer marker), CD55 (Decay Accelerating Factor (DAF), binds complement C3b), MAGE-I ("melanoma antigen gene-1, a cancer associated antigen-1" presented to cytotoxic anti-cancer T-cells), MAGE-3, MAGE-IO, NY-ESO-I, HER-2, EGFR, IGFR, VEGFR, CEA, CD38, CDl 38 and CD56 and other antigens
• the single variable domains when directed against HER-2, they may for example be (a Nanobody that is) directed against the Herceptin® binding site on HER2 (and in particular against domain IV of HER2, and more in particular against the C-terminus of domain IV of HER2) and/or that is capable of competing with Herceptin® for binding to HER-2; or be (a Nanobody that is) directed against the Omnitarg® binding site on HER2 (and in particular against domain II of HER2, and more in particular against the middle of domain II of HER2) and/or that is capable of competing with Omnitarg® for binding to HER-2.
• a Nanobody that is directed against the Herceptin® binding site on HER2 and in particular against domain IV of HER2, and more in particular against the C-terminus of domain IV of HER2
• Omnitarg® binding site on HER2 and in particular against domain II of HER2, and more in particular against the middle of domain II of HER2
• Omnitarg® for binding to HER-2.
• single domain antibodies may in particular be directed against antigens associated with activated and/or autoreactive T- or B -lymphocytes.
• antigens will be clear to the skilled person, and for example include, but are not limited to CD25 (IL2 receptor), CD69 (early activation antigen), CDl 52 (CTLA4), CDl 54 (CD40L), CD95 (Apo-1, Fas), CD 178 (Fas ligand, FasL), CD 134 (OX-40), CD96 (T cell ACTivation Increased Late Expression (TACTILE)), CD97 (GRl), CD26 (Dipeptidyl peptidase IV).
• each polypeptide chain of the invention may comprise not one, but two or more (such as three and preferably two) single variable domains, which may be directly linked to each other or optionally be linked to each other via one or more suitable linkers.
• a construct of the invention (in which each polypeptide chain comprises two single variable domains) is schematically shown in Figure 2, with the corresponding polypeptide chain of the invention being schematically shown in Figure 4.
• the single variable domains in each polypeptide chain may be essentially the same (in which case the constructs and polypeptide chains may for example bind with higher affinity to the intended or desired target or antigen, compared to corresponding constructs of the invention that comprise only a single variable domain in each polypeptide chain; or they may be different from each other (i.e. may be directed against different antigens or targets, and may in particular be directed against different epitopes, antigenic determinants, parts, domains or subunits of the same target or antigen).
• such a construct or polypeptide chain may for example be as further described in the co-pending International patent application by Ablynx N.V. entitled "Immunoglobulin constructs", which has the same filing date as the present application, but comprising an IgE-derived Fc portion.
• the polypeptide chains in such a construct may each comprise at least one single variable domain (such as a Nanobody) that is directed against the Herceptin® binding site on HER2 (and in particular against domain IV of HER2, and more in particular against the C-terminus of domain IV of HER2) and/or that is capable of competing with Herceptin® for binding to HER-2, that is linked (directly or via a suitable linker) to at least one single variable domain (such as a Nanobody) that is directed against the Omnitarg® binding site on HER2 (and in particular against domain II of HER2, and more in particular against the middle of domain II of HER2) and/or that is capable of competing with Omnitarg® for binding to HER-2.
• a single variable domain such as a Nanobody
• Such a construct or polypeptide chain is further preferably such that it capable of (simultaneously) binding to both the Omnitarg® binding site on HER2 (and in particular against domain II of HER2, and more in particular against the middle of domain II of HER2) as well as the Herceptin® binding site on HER2 (and in particular against domain IV of HER2, and more in particular against the C-terminus of domain IV of HER2), most preferably so as to allow binding with increased avidity and also intramolecular binding and/or recognition.
• the two single variable domains in each polypeptide chain may be linked to each other via a suitable linker, for which reference is made to the International patent application of Ablynx N. V. with the same filing date as the present application, entitled "Amino acid sequences directed against HER2 and polypeptides comprising the same for the treatment of cancers and/or tumors" (see for example Example 19).
• each of the polypeptide chains that together form the construct of the invention also comprise one or more constant domains that, together with the constant domains of the other polypeptide chain present in the construct, forms an Fc portion that is capable of effecting one or more IgE-mediated immune responses (as defined herein) and/or that is capable of binding to either the Fc ⁇ RI receptor and/or the Fc ⁇ RII receptor (as further described herein).
• an Fc portion will also be referred to herein as an "IgE-derived Fc portion".
• the IgE-derived Fc portion used in the constructs of the invention is the Fc portion of IgE, in particular of human IgE.
• the IgE-derived Fc portion may be any dimer formed by two polypeptide chains that is capable of binding to either the Fc ⁇ RI receptor and/or the Fc ⁇ RII receptor, and in particular of binding to either the Fc ⁇ RI receptor and/or the Fc ⁇ RII receptor so as to induce receptor-mediated signalling and/or more generally one or more cellular responses and/or immune responses that are mediated by these receptors (i.e. one or more of the cellular or immune responses that are usually triggered by the binding of IgE to the receptor. These cellular and/or immune responses are also referred to herein as "IgE- mediaied immune responses").
• Such polypeptide chains will usually be comprised of one or more (and in particular two and preferably three) immunoglobulin constant domains (and in particular heavy chain constant domains) that are capable of forming such an Fc portion.
• the IgE-derived Fc portion present in the constructs of the invention may be such that it is capable of binding to Fc ⁇ RI with an affinity (expressed as the K a value) better than 10 6 M “1 , preferably better than 10 8 M “1 , more preferably better than 10 9 M “1 , such as with a K a value of about 10 10 M “1 or 10 n M “1 ; and/or such that that it is capable of binding to Fc ⁇ RII with an affinity (expressed as the K 3 value) better than 10 6 M "1 , preferably better than 10 7 M "! , such as with a K a value of about 10 8 M '1 .
• the IgE-derived Fc portion may also be a chimeric Fc portion that is capable of effecting one or more IgE-mediated immune responses and/or of binding to Fc ⁇ RI and/or Fc ⁇ RII (as described herein).
• a chimeric Fc portion will usually be comprised of one or more immunoglobulin constant domains (and preferably essentially consist of two constant domains, and more preferably three constant domains), and will usually at least comprise at least one or more parts, fragments, amino acid stretches or domains of the Fc portion of IgE (i.e.
• immunoglobulins for example, from the Fc portions of an IgG, IgA, IgM or IgD
• Suitable chimeric Fc portions will be clear to the skilled person based on the disclosure herein, and/or can be generated by the skilled person based on the disclosure herein, optionally after a limited degree of routine experimentation.
• a chimeric Fc portion will at least comprise C ⁇ 4 (or a suitable part of fragment thereof) and may also comprise C ⁇ 3 (or a suitable part of fragment thereof) and/or C ⁇ 2 (or a suitable part of fragment thereof).
• the IgE-derived Fc portion may also be a part or fragment of the Fc portion of IgE (or suitable combination of two or more parts or fragments from the Fc portion of IgE) that is still capable of (forming an Fc portion that is capable of) effecting one or more IgE-mediated immune responses and/or of binding to Fc ⁇ RI and/or Fc ⁇ RII (as described herein).
• Such parts or fragments will usually at least comprise C ⁇ 4 (or a suitable part of fragment thereof) and may also comprise C ⁇ 3 (or a suitable part of fragment thereof) and/or C ⁇ 2 (or a suitable part of fragment thereof).
• the Fc portion may also (be used to) confer upon the constructs the invention an increased half-life in vivo.
• the IgE --derived Fc portion may still have some or all of the effector functions of the IgE - derived Fc portion (or have these effector functions, but at a reduced level still suitable for the intended use), but when the IgE-derived Fc portion is solely used to provide for increased half-life, also a suitable mutant, variant part or fragment of an IgE-derived Fc portion may be used that has no or essentially no effector functions.
• Half-life can generally be defined as the time taken for the serum concentration of the polypeptide to be reduce by 50%, in vivo, for example due to degradation of the ligand and/or clearance or sequestration of the ligand by natural mechanisms.
• Methods for pharmacokinetic analysis and determination of half-life are familiar to those skilled in the art. Details may be found in Kenneth, A et al: Chemical Stability of Pharmaceuticals: A Handbook for Pharmacists and in Peters et al, Pharmacokinete analysis: A Practical Approach (1996). Reference is also made to "Pharmacokinetics", M Gibaldi & D Perron, published by Marcel Dekker, 2nd revised edition (1982).
• the constructs or polypeptides of the invention may have a half-life in a mammal (such as a mouse, rat or monkey) and/or in man that is at least 25%, preferably at least 50%, more preferably at least 70%, such as about 80% or 90% or more, of a naturally occurring IgE in said mammal or in man.
• the constant domains used in a polypeptide chain of the invention may be such that they allow the polypeptide chain of the invention to be used (i.e. for antigen-binding, for example for therapeutic purposes) as such, i.e. without forming part of a construct of the invention.
• the constant domains may be naturally occurring, synthetic or semisynthetic analogs, variants, parts or fragments of constant domains (e.g. derived from IgE or other immunoglobulins) that, when combined in a polypeptide chain of the invention, confer upon the polypeptide chain a reduced (or essentially no) tendency to self-associate into dimmers (i.e.
• Such monomeric (i.e. not self-associating) Fc ⁇ chain variants, or fragments thereof, may for example be as described in Helm et al., J Biol Chem 1996 271 7494.
• monomeric Fc ⁇ chain variants are preferably such that they are still capable of binding to the high and/or low affinity IgE receptor (as described herein for the IgE-derived Fc portion), and/or such that they still have some or all of the effector functions of the IgE -derived Fc portion (or at a reduced level still suitable for the intended use).
• the monomeric Fc ⁇ chain may be used to confer increased half-life upon the polypeptide chain, in which case the monomeric Fc ⁇ chain may also have no or essentially no effector functions.
• the parts, fragments, amino acid stretches or domains that make up the IgE-derived Fc portion are preferably all or essentially all derived from human Fc portions, including human IgE Fc portions.
• the constant domains may be the C ⁇ 2, C R 3 and C ⁇ 4 domains of human IgE.
• the parts, fragments, amino acid stretches or domains that make up the IgE-derived Fc portion are derived from one or more other species of mammal, such as rat, mouse, rabbit, or primates such as rhesus monkey, baboon or cynomolgous monkey.
• the IgE-derived Fc portion may be in full or in part be derived from parts, fragments, amino acid stretches or domains of the Fc portion of IgE from the species of mammal used in said animal model.
• the IgE-derived Fc portion may also be the Fc portion of IgE from another species of mammal, such as rat, mouse, rabbit, or primates such as rhesus monkey, baboon or cynomolgous monkey.
• the constant domains that form the IgE-derived Fc portion may be suitably linked to the single variable domains, either directly (which is less preferred), via a suitable hinge region or linker (which is most preferred), or even (although much less preferred) via a suitable constant domain (such as a C ⁇ l, C 8 I, C ⁇ l or preferably CnI or CJ domain, which may in turn be linked to the Fc portion via a suitable linker).
• the hinge region or linker may be any suitable hinge region or linker, and suitable hinge regions and linkers, which will usually comprise or essentially consist of a suitable amino acid sequence, will be clear to the skilled person based on the disclosure herein.
• suitable hinge regions that naturally occur in immunoglobulins such as the hinge region of IgG' s or the hinge region from Camelid heavy chain antibodies, see for example EP 0 698 097 or the linkers described in WO 96/34103
• suitable analogs, variants, homologs, parts or fragments thereof including synthetic or semisynthetic analogs, variants, homologs, parts or fragments, for example hinge regions that have been engineered so as not to contain cysteine residues, see for example WO 07/085814), as well as the synthetic and semi-synthetic linkers mentioned in WO 04/068820 and WO 02/056910.
• a naturally occurring C ⁇ l domain or a suitable variant thereof may be used as (or instead of)
• the single variable domains that are present in the two polypeptide chains that from the construct of the invention will be the essentially same (i.e. be comprised of essentially the same amino acid sequence), or at least directed to the same antigen.
• the constant domains that are present in both of the polypeptide chains that form the construct of the invention will be essentially the same (i.e. be comprised of essentially the same amino acid sequence).
• both polypeptide chains that form the construct of the invention will comprise essentially the same single variable domains and essentially the same constant domains, so that the constructs of the invention will usually be comprised of two polypeptide chains that have essentially the same (variable and constant) domains and more in particular essentially the same sequence.
• the invention in its broadest sense is not limited thereto, and for example also comprises constructs in which the single variable domains in each of the two polypeptide chains are directed against different epitopes on the same target or antigen, constructs in which the two polypeptide chains that form the construct of the invention comprise different hinge regions or linkers, or even constructs in which the two polypeptide chains that form the construct of the invention comprise different constant domains (as long as the constant domains of the two polypeptide chains are still capable of forming an IgE-derived Fc portion as defined herein).
• constructs of the invention may be prepared in any suitable manner known per se. Usually, such methods will either comprise joining two suitable polypeptide chains of the invention so as to form a construct of the invention (in which these polypeptide chains will usually be essentially identical in sequence, although the invention in its broadest sense is not limited thereto).
• the polypeptide chains of the invention may be prepared in any suitable manner, usually by suitably expressing, in a suitable host or host organism, a nucleic acid of the invention that encodes the desired polypeptide chain.
• constructs of the invention may be prepared by suitably co-expressing, in a suitable host or host organism, (suitable nucleic acids of the invention that encode) two suitable polypeptide chains of the invention (in which these polypeptide chains will again usually be essentially identical in sequence) so as to form a construct of the invention.
• the nucleic acids encoding the polypeptide chains of the invention may be prepared in any suitable manner, for example using PCR assembly using overlapping primers, by suitably linking (naturally occurring, synthetic or semi-synthetic) nucleotide sequences that encode the various parts of the desired polypeptide chain, or by de novo synthesis of the desired nucleic acid of the invention using an automated apparatus for synthesizing nucleic acid sequences with a predefined amino acid sequence.
• the particular codons used may also be chosen and/or optimized for the host or host organism to be used for the expression.
• nucleic acids of the invention may be provided and/or used in the form of a suitable genetic construct (such as a plasmid or expression vector), that may for example comprise - in addition to the nucleotide sequences that encodes the desired polypeptide chain - one or more regulatory elements and/or other suitable components of such constructs known per se. All this can be performed using methods and techniques known per se, for which reference is made to the prior art cited herein, such as WO 04/068820 and WO 02/056910.
• a nucleotide sequence encoding the desired single variable domain can be suitably linked to a nucleotide sequence that encodes the C ⁇ 2 5 C E 3 and C E 4 domains of human IgE, optionally via a nucleotide sequence that encodes a suitable linker or hinge region.
• the further expression, production, purification and isolation may be performed using techniques, vectors, host cells or host organisms known per se, for which reference is again made to for example WO 04/068820 and WO 02/056910.
• the invention relates to a host or host cell that expresses or is capable of expressing a construct of the invention or a polypeptide chain of the invention, or that contains a nucleotide sequence or nucleic acid that encodes a construct of the invention or a polypeptide chain of the invention.
• the invention further relates to methods for producing a construct of the invention or a polypeptide chain of the invention, comprising maintaining or cultivating such a host or host cell under conditions such that said host or host cell expresses or produces a construct of the invention or a polypeptide chain of the invention, and optionally comprising isolating the construct of the invention or polypeptide chain of the invention so expressed or produced.
• compositions that comprise at least one construct of the invention or a polypeptide chain of the invention.
• a composition may in particular be a pharmaceutical composition that comprises at least one construct of the invention and one or more pharmaceutically acceptable carriers, adjuvants or excipients.
• a pharmaceutical composition will be a (usually liquid and aqueous) composition that is suitable for injection or infusion, essentially similar to the formulations that are used for injection or infusion of conventional monoclonal antibodies, but containing one or more constructs of the invention instead of a conventional 4-chain monoclonal antibody.
• the constructs and compositions of the invention may be used for any suitable purpose, mainly depending upon the antigen(s) against which the single variable domains that are present in the construct are directed.
• the constructs and compositions of the invention may be used in the prevention and/or treatment of diseases and disorders that are associated with said target or antigen, i.e. by suitably administering the constructs or compositions to a subject that is at risk of and/or suffering from said disease or disorder.
• diseases and disorders, and suitable routes of administration and treatment regimens will be clear to the skilled person based on the disclosure herein.
• constructs of the invention can be made that are analogous to conventional therapeutic monoclonal antibodies (i.e. directed against the same target or antigen, but only containing two polypeptide chains as described herein, in which the single variable domains in each chain are directed against the relevant target or antigen), and that such constructs (and pharmaceutical compositions comprising the same) can be used for the prevention and/or treatment of the essentially same diseases and disorders as these conventional monoclonals, using essentially similar routes of administration and treatment regimens, which can easily be determined by the treating physician.
• the invention relates to (the use of) a construct of the invention that is directed against a desired or intended (therapeutically relevant) target or antigen (or of a pharmaceutical composition comprising the same) for the prevention or treatment of a disease or disorder associated with said target or antigen.
• the invention further relates to the use of a construct of the invention that is directed against a desired or intended (therapeutically relevant) target or antigen in the preparation of a pharmaceutical composition for the prevention or treatment of a disease or disorder associated with said target or antigen.
• the invention also relates to a method for preventing or treating a disease or disorder that is associated with a target or antigen, which method comprises administering, to a subject in need of such prevention or treatment, of a therapeutically active amount of a construct of the invention that is directed against said target or antigen (or of a pharmaceutical composition comprising the same).
• the construct of the invention is directed against a target or antigen that is associated with cancer or tumors, such as those described above.
• Such constructs of the invention are particularly suited for the treatment of various forms of cancer and tumors (including solid tumors), e.g. by slowing, stopping or reversing the growth of a tumor and/or by slowing, stopping or reversing the spread of metastases caused by the tumor; and it is envisaged that such constructs of the invention may have improved efficacy and/or other improved properties compared to similar constructs based on single variable domains (i.e.
• IgG- derived Fc portion (as described in EP 1 621 554, WO 04/068820 or WO 02/056910) instead of an IgE-derived Fc portion, and may also have improved properties (such as improved stability, ease of production, efficacy per gram of material, or tumor penetration) compared to 4-chain monocionals that comprise an IgE-derived Fc portion, such as those described in Karagiannis et al, supra.
• the efficacy of the constructs of the invention may be determined using suitable cellular assays (for example using a suitable tumor cell line) or animal models known per se, which may be suitably chosen by the skilled person.
• suitable tumor-associated antigens, constructs of the invention, pharmaceutical compositions, routes of administration and treatment regimens will be clear to the skilled person based on the disclosure herein, and may for example also include suitable combination treatments with other cytostatic agents and/or with surgery and/or radiation treatment.
• the invention relates to (the use of) a construct of the invention that is directed against a tumor-associated target or antigen (or of a pharmaceutical composition comprising the same) for the prevention or treatment of cancer (and in particular, for the prevention or treatment of tumors that express said tumor-associated target or antigen).
• the invention further relates to the use of a construct of the invention that is directed against a tumor-associated target or antigen in the preparation of a pharmaceutical composition for the prevention or treatment of cancer (and in particular, of tumors that (over)express said tumor-associated target or antigen).
• the invention also relates to a method for preventing or treating a cancer, which method comprises administering, to a subject in need of such prevention or treatment, of a therapeutically active amount of a construct of the invention that is directed against a tumor- associated target or antigen (i.e. a target or antigen expressed by the tumor to be treated) or of a pharmaceutical composition comprising the same.
• a tumor- associated target or antigen i.e. a target or antigen expressed by the tumor to be treated
• a pharmaceutical composition comprising the same.
• the invention also relates to a polypeptide chain that comprises at least one single variable domain that is linked, optionally via a suitable linker or hinge region, to one or more constant domains, in which the constant domains are capable of forming (i.e. with the constant domains of another such polypeptide chain) an Fc portion that is capable of effecting one or more IgE-mediated immune responses and/or that is capable of binding to either the Fc ⁇ RI receptor and/or the Fc ⁇ RII receptor.
• the constant domains are preferably such that they are capable of forming (i.e. with the constant domains of another such polypeptide chain) an IgE-derived Fc portion as further defined herein.
• the constant domains may be the C e 2, C E 3 and C ⁇ 4 domains of a mammalian IgE, and in particular of human IgE.
• SEQ ID NO's 1 to 12 (see also Table 1) and Figures 5 to 10 give some non-limiting examples of amino acid sequences and nucleic acid sequences of polypeptide chains of the invention that can be used to form constructs of the invention:
• SEQ ID NO:1 and Figure 5 A give an example of an amino acid sequence of a polypeptide chain of the invention comprising a humanized Nanobody against the carcinoembryonic antigen associated with cancer (CEA) that is fused via a C ⁇ l domain, serving here as native sequence variable region-Fc linker, to C ⁇ 2, C ⁇ 3 and C ⁇ 4 domains of human IgE.
• CEA carcinoembryonic antigen associated with cancer
• SEQ ID NO:3 and Figure 6A give an example of an amino acid sequence of a polypeptide chain of the invention comprising a Nanobody against EGFR that is linked via a glycine- serine linker and the native CJ- C E 2 linking sequence to the C ⁇ 2, C E 3 and C ⁇ 4 domains of human IgE.
• the corresponding nucleotide sequence is given in SEQ ID NO:4 and Figure 6B.
• SEQ ID NO:5 and Figure 7A give an example of an amino acid sequence of a polypeptide chain of the invention comprising a Nanobody against HER-2 (47D5, which is competitive for binding to HER-2 with pertuzumab (Omnitarg®)) that is linked via a glycine- serine linker and the native C ⁇ l- C ⁇ 2 linking sequence to the C ⁇ 2, C ⁇ 3 and C ⁇ 4 domains of human IgE,.
• the corresponding nucleotide sequence is given in SEQ ID NO: ⁇ and Figure 7B.
• SEQ ID NO: 7 and Figure 8 A give an example of an amino acid sequence of a polypeptide chain of the invention comprising a Nanobody against HER-2 (2D3, which is competitive for binding to HER-2 with trastuzumab (Herceptin®)) that is linked via a glycine-serine linker and the native C 6 I- C K 2 linking sequence to the C ⁇ 2, C ⁇ 3 and C ⁇ 4 domains of human IgE.
• the corresponding nucleotide sequence is given in SEQ ID NO:8 and Figure 8B.
• SEQ ID NO: 9 and Figure 9 A give an example of an amino acid sequence of a polypeptide chain of the invention comprising two different Nanobodies against HER-2 (i.e. 47D5 and 2D3, which together form a biparatopic Nanobody construct), that are linked via a glycine-serine linker and the native C 6 I- C ⁇ 2 linking sequence to the C ⁇ 2, C e 3 and C ⁇ 4 domains of human IgE.
• 47D5 and 2D3 are linked to each other via 35 a.a. Gly/Ser linker, which should allow both Nanobodies to bind to HER-2 (i.e. essentially simultaneously).
• the corresponding nucleotide sequence is given in SEQ ID NO: 10 and Figure 9B.
• SEQ ID NO:11 and Figure 1OA give another example of an amino acid sequence of a polypeptide chain of the invention comprising two different Nanobodies against HER-2 (i.e. 47D5 and 2D3, which together form a biparatopic Nanobody construct), that are linked via a glycine-serine linker and the native C e l- C ⁇ 2 linking sequence to the C ⁇ 2, C e 3 and C ⁇ 4 domains of human IgE.
• 47D5 and 2D3 are again linked to each other via 35 a.a. Gly/Ser linker, which should allow both Nanobodies to bind to HER-2 (i.e.
• CEAl_Hu-Cl-C2-C3-C4 IgE SEQ ID NO:1
• CEAl_Hu-Cl-C2-C3-C4 IgE SEQ ID NO:2 gaggtgcagctgctcgagtctgggggaggcttggtgcagcctggggggtctctgagactctcctgtgcagcctctggattc acattcagtaaatacgacatgagctgggtccgccaggctccagggaaggggctcgagtgggtctcacgtattagtagtggt ggt ggtggtagcacatactatgcagactccgtgaagggccgattcaccatctccagagacaacagtaagaacacgctgtatctg caaatgaacagtttgcgggccgaggacactgccgtgtattactgcgccaagccaacctacagtagcgact
• Her2 47D5-G/S-C2-3-4 IgE SEQ ID NO:6 AAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGGGGGTC

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Immunology (AREA)
• Life Sciences & Earth Sciences (AREA)
• Medicinal Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Pharmacology & Pharmacy (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Biophysics (AREA)
• Molecular Biology (AREA)
• Genetics & Genomics (AREA)
• Biochemistry (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Engineering & Computer Science (AREA)
• Oncology (AREA)
• Cell Biology (AREA)
• Rheumatology (AREA)
• Microbiology (AREA)
• Endocrinology (AREA)
• Epidemiology (AREA)
• Mycology (AREA)
• Dermatology (AREA)
• Neurosurgery (AREA)
• Pain & Pain Management (AREA)
• Biomedical Technology (AREA)
• Neurology (AREA)
• Orthopedic Medicine & Surgery (AREA)
• Physical Education & Sports Medicine (AREA)
• Peptides Or Proteins (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Applications Claiming Priority (8)

Publications (1)

Family

ID=40377235

Family Applications (5)

Family Applications After (4)

Country Status (12)

Cited By (25)

Families Citing this family (302)

Citations (4)

Family Cites Families (100)

• 2008
  • 2008-11-27 EP EP12192982.2A patent/EP2650311A3/en not_active Withdrawn
  • 2008-11-27 WO PCT/EP2008/066366 patent/WO2009068628A1/en not_active Ceased
  • 2008-11-27 CA CA2705890A patent/CA2705890A1/en not_active Abandoned
  • 2008-11-27 CN CN2008801255706A patent/CN101970490A/zh active Pending
  • 2008-11-27 WO PCT/EP2008/066363 patent/WO2009068625A2/en not_active Ceased
  • 2008-11-27 AU AU2008328779A patent/AU2008328779B2/en not_active Ceased
  • 2008-11-27 JP JP2010535387A patent/JP2011504740A/ja active Pending
  • 2008-11-27 CA CA2706200A patent/CA2706200A1/en active Pending
  • 2008-11-27 CA CA2706425A patent/CA2706425A1/en not_active Abandoned
  • 2008-11-27 WO PCT/EP2008/066369 patent/WO2009068631A1/en not_active Ceased
  • 2008-11-27 CA CA2706675A patent/CA2706675A1/en not_active Abandoned
  • 2008-11-27 MX MX2010005783A patent/MX2010005783A/es not_active Application Discontinuation
  • 2008-11-27 AU AU2008328784A patent/AU2008328784B2/en not_active Ceased
  • 2008-11-27 EP EP08854146A patent/EP2225278A2/en not_active Ceased
  • 2008-11-27 KR KR1020107014032A patent/KR20100097716A/ko not_active Withdrawn
  • 2008-11-27 WO PCT/EP2008/066365 patent/WO2009068627A2/en not_active Ceased
  • 2008-11-27 US US12/745,052 patent/US20110053865A1/en not_active Abandoned
  • 2008-11-27 EP EP08853257A patent/EP2215125A1/en not_active Withdrawn
  • 2008-11-27 EP EP08853848A patent/EP2220120A2/en not_active Withdrawn
  • 2008-11-27 BR BRPI0819656-7A patent/BRPI0819656A2/pt not_active IP Right Cessation
  • 2008-11-27 AU AU2008328781A patent/AU2008328781A1/en not_active Abandoned
  • 2008-11-27 AU AU2008328785A patent/AU2008328785A1/en not_active Abandoned
  • 2008-11-27 US US12/744,991 patent/US8975382B2/en active Active
  • 2008-11-27 EP EP08854349A patent/EP2215123A1/en not_active Withdrawn
  • 2008-11-27 US US12/745,023 patent/US20110189203A1/en not_active Abandoned
  • 2008-11-27 WO PCT/EP2008/066368 patent/WO2009068630A1/en not_active Ceased
  • 2008-11-28 US US12/744,970 patent/US20110028695A1/en not_active Abandoned
• 2010
  • 2010-05-13 IL IL205734A patent/IL205734A0/en unknown
  • 2010-06-07 ZA ZA2010/04057A patent/ZA201004057B/en unknown
• 2015
  • 2015-01-08 US US14/592,022 patent/US9969805B2/en active Active

Patent Citations (4)

Non-Patent Citations (7)

Also Published As

Similar Documents

Legal Events