WO2018043856A1 - 신규 프로모터 및 이의 용도 - Google Patents

신규 프로모터 및 이의 용도 Download PDF

Info

Publication number
WO2018043856A1
WO2018043856A1 PCT/KR2017/002964 KR2017002964W WO2018043856A1 WO 2018043856 A1 WO2018043856 A1 WO 2018043856A1 KR 2017002964 W KR2017002964 W KR 2017002964W WO 2018043856 A1 WO2018043856 A1 WO 2018043856A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
promoter
gfp
present application
vector
Prior art date
Application number
PCT/KR2017/002964
Other languages
English (en)
French (fr)
Inventor
이영미
이승빈
김성보
이지현
조승현
박승원
장진숙
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to DK17846781.7T priority Critical patent/DK3508580T3/da
Priority to CN201910568670.6A priority patent/CN110283823B/zh
Priority to ES17846781T priority patent/ES2907694T3/es
Priority to EP17846781.7A priority patent/EP3508580B1/en
Priority to PL17846781T priority patent/PL3508580T3/pl
Priority to RU2019105322A priority patent/RU2733425C1/ru
Priority to US16/327,581 priority patent/US10584338B2/en
Priority to JP2019510874A priority patent/JP6679803B2/ja
Priority to BR112019004161-3A priority patent/BR112019004161B1/pt
Priority to MYPI2019000906A priority patent/MY186296A/en
Priority to CN201780000208.5A priority patent/CN108026539B/zh
Publication of WO2018043856A1 publication Critical patent/WO2018043856A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/24—Preparation of compounds containing saccharide radicals produced by the action of an isomerase, e.g. fructose
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • the present application relates to a novel promoter, a vector comprising the same, a microorganism comprising the promoter or the vector, and a method of producing a target substance using the microorganism.
  • Patent No. 10-0924065 One such method is a method of inducing overexpression of a target gene in a microorganism, which requires a highly efficient gene expression system. Since promoters are one of the most involved factors in gene expression systems, useful promoter development is essential.
  • E. coli-derived tac promoters are widely known as strong promoters, and in the case of coryneform microorganisms, strong promoters have been developed by modifying the promoter of its own genes (Gene, 102, 93-98, 1991; Microbiology, 142, 1297-1309, 1996 ). For example, a promoter derived from Corynebacterium ammoniagenesis is known to be about 10% improved over the tac promoter reported in conventional E. coli (Biotechnol. Lett. 25, 1311-1316, 2003). ).
  • the present inventors have made diligent efforts to find a promoter capable of strongly inducing gene expression in Corynebacterium sp. Microorganisms. As a result, the present inventors have developed a novel synthetic promoter of the present application and confirmed high expression activity compared to known promoters. The application was completed.
  • An object of the present application is a novel nucleic acid molecule having promoter activity, a gene expression cassette comprising the nucleic acid molecule and a gene of interest, a recombinant vector comprising the nucleic acid molecule or the gene expression cassette, a recombinant microorganism comprising the vector And it provides a method for producing a target material using the recombinant microorganism.
  • novel promoters of the present invention may have a variety of activities depending on the microorganism that induces expression of the gene of interest. Accordingly, when it is necessary to control the activity of the gene of interest as needed in the production of the target material, the novel promoter of the present invention can be used to efficiently produce the target material.
  • Figure 1 shows the results of the GFP assay measuring the strength of the novel promoters.
  • A shows the results of GFP assay of new promoters based on Corynebacterium glutamicum ATCC13032.
  • B shows the results of GFP assay of new promoters based on Corynebacterium glutamicum ATCC13869.
  • Figure 2 shows the HPLC results confirming the production of psychos.
  • A Corynebacterium glutamicum ATCC13032 / CJ4-ATPE-2
  • B Corynebacterium glutamicum ATCC13032 / SPL1-ATPE-2
  • C Corynebacterium glutamicum ATCC13032 Results after reaction with fructose substrate using / SPL7-ATPE-2.
  • Figure 3 shows the HPLC results confirming the tagatose production.
  • A Corynebacterium glutamicum ATCC13032 / CJ4-TN (m)
  • B Corynebacterium glutamicum ATCC13032 / SPL13-TN (m) results after reaction with fructose substrate to be.
  • the present application provides a nucleic acid molecule having a promoter activity consisting of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 3 in one aspect.
  • promoter means that a non-translated nucleic acid sequence upstream of a coding region, i.e., a polymerase, comprises a binding site for a polymerase and has a transcription initiation activity to an mRNA of a promoter subgene. Refers to the DNA region to initiate the transcription of the gene.
  • the promoter may be located at the 5 'region of the mRNA transcription start site.
  • nucleic acid molecule having a promoter activity consisting of any one nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 3 (ie, SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3) is SPL1, SPL7, respectively. And SPL13.
  • the nucleic acid molecule having the promoter activity may also be referred to as a promoter, and all of the terms described above may be used herein.
  • the promoter of the present application can bring about expression of a target gene operably linked with a nucleic acid molecule having the promoter activity in a desired microorganism, and can be used as a universal promoter.
  • the promoter sequences of the present application can be modified by conventionally known mutagenesis methods such as direct evolution and site-directed mutagenesis.
  • the promoter is at least 70%, specifically at least 80%, more specifically at least 90%, more specifically at least 95%, and more specifically at least 70% of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 Nucleotide sequences having at least 98% and most specifically at least 99% homology and showing similar promoter activity may be included without limitation.
  • nucleotide sequence having such homology if it is a nucleotide sequence having promoter activity, it should be interpreted that a nucleotide sequence in which some sequences are deleted, modified, substituted, or added is also included in the nucleic acid molecule range of the present application.
  • the expression consisting of the nucleotide sequence of SEQ ID NO: 1, 2 or 3 is the addition of nucleotides that can occur during the process of connecting to the target gene, such as the use of restriction enzymes, when the promoter is linked to the target gene, and And / or deletions, and / or variations.
  • control sequences for prokaryotes may include, but are not limited to, promoters, optional operator sequences, and ribosomal binding sites.
  • Nucleic acid molecules having a promoter activity of the present application can constitute a sequence for controlling gene expression as described above, as required by those skilled in the art.
  • nucleic acid molecule having a promoter activity consisting of any one nucleotide sequence selected from the group consisting of 1 to 3, a probe that can be prepared from a known gene sequence, for example, SEQ ID NOs: 1 to 3 of the present invention
  • Any nucleotide sequence having a promoter activity of the present application by hydration under strict conditions with complementary sequences for all or part of the nucleotide sequence of may be included without limitation.
  • homology refers to the percent identity between two polynucleotide or polypeptide moieties. Homology between sequences from one moiety to another can be determined by known art. For example, using standard software that calculates parameters such as score, identity and similarity, in particular BLAST 2.0, or by hybridization experiments used under defined stringent conditions Appropriate hybridization conditions, which are defined within the scope of the art, are well known to those skilled in the art, and are well known to those skilled in the art (e.g. J.
  • stringent conditions refers to conditions that enable specific hybridization between polynucleotides. Such conditions are described specifically in the literature (eg, J. Sambrook et al., Homology). For example, genes with high homology, 80% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly specifically 99% or more homologous genes 60 ° C., 1 ⁇ SSC, 0.1% SDS, specifically 60 ° C., 0.1 ⁇ SSC, 0.1, which is a condition for hybridizing with each other and not having homologous genes with each other, or washing conditions for normal Southern hybridization.
  • hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of the hybridization.
  • the term “complementary” is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, with respect to nucleotide bases, adenosine is complementary to thymine and cytosine is complementary to guanine.
  • the present application may also include isolated nucleic acid fragments that are complementary to the entire sequence as well as substantially similar nucleic acid sequences.
  • polynucleotides having homology can be detected using hybridization conditions including hybridization steps at Tm values of 55 ° C. and using the conditions described above.
  • the Tm value may be 60 ° C, 63 ° C or 65 ° C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • Proper stringency for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides and variables are well known in the art (see Sambrook et al., Supra, 9.50-9.51, 11.7-11.8).
  • Nucleic acid molecules having the promoter activity of the present application can be isolated or prepared using standard molecular biology techniques. For example, it may be prepared using standard synthesis techniques using an automated DNA synthesizer, but is not limited thereto.
  • the present application provides, as another aspect, a gene expression cassette comprising a nucleic acid molecule of the present application and a gene of interest.
  • nucleic acid molecule of the present application is as described above.
  • gene expression cassette in the present application means a unit cassette capable of expressing a gene of interest, including a promoter and a gene of interest, and operably linked downstream of the promoter. Inside or outside the gene expression cassette may include a variety of factors that can help efficient expression of the gene of interest.
  • the gene expression cassette may include a transcription termination signal, a ribosomal binding site, and a translation termination signal in addition to a promoter operably linked to the gene of interest.
  • target gene means a gene encoding a protein to be expressed in a microorganism.
  • the target gene may be a saccharide conversion enzyme, a gene encoding an amino acid biosynthesis related enzyme, a gene encoding an enzyme related to reducing power, a gene encoding an enzyme related to organic acid biosynthesis, or a gene encoding a protein related to the release of the target product.
  • sugars e.g., psychos or tagatose
  • L-amino acids e.g., L-lysine, L-valine
  • organic acids e.g., it is not limited thereto.
  • the target gene may be a saccharide conversion enzyme, a gene encoding an amino acid biosynthesis related enzyme, a gene encoding an enzyme related to reducing power, a gene encoding an enzyme related to organic acid biosynthesis, or a gene encoding a protein related to the release of the target product.
  • a gene encoding a cosmos epimerase, a gene encoding a tagatose epimerase or a gene encoding a tagaturonate epimerase, a NADP dependent glyceraldehyde-3-phosphate dehydrogenase Genes encoding, or genes encoding branched chain amino acid aminotransferases, but are not limited thereto.
  • Said cosmos epimerase can be expressed as ATPE, it means a cosmos-3-epimerase having the activity of converting fructose to psychose.
  • tagaturonate epimerase or tagatose epimerase can be designated as UxaE, and convert fructose acid to tagatose acid.
  • an enzyme having an activity of converting fructose to tagatose can be designated as UxaE, and convert fructose acid to tagatose acid.
  • the NADP dependent glyceraldehyde-3-phosphate dehydrogenase can be expressed as GapN, and glyceraldehyde-3-phosphate (glyceraldehyde 3 phosphate) as a substrate to 3-phosphoglycerate (3-phosphoglycerate) It means an enzyme having an activity to convert.
  • the branched chain amino acid aminotransferase (branched-chain amino-acid aminotransferase) may be referred to as IlvE, and means an enzyme of the last stage in the biosynthetic pathway of branched chain amino acids.
  • the sequence of the gene encoding ATPE, the gene encoding UxaE, the gene encoding GapN, the gene encoding IlvE can be easily obtained by those skilled in the art through a known database such as GenBank of the National Institutes of Health.
  • the gene encoding ATPE, the gene encoding UxaE, the gene encoding GapN, the gene encoding IlvE are merely exemplary as one of the target genes that can be operably linked to the nucleic acid molecule having the promoter activity of the present application.
  • the promoter of the present application may be used as a target gene without limitation as long as the gene can be expressed from a microorganism as a general-purpose promoter.
  • operatively linked means that the gene sequence and the promoter sequence are functionally linked so that the nucleic acid sequence having the promoter activity of the present invention initiates and mediates transcription of the gene of interest. do. Operable linkages can be prepared using known genetic recombination techniques, and site-specific DNA cleavage and ligation can be made using, but are not limited to, cleavage and ligation enzymes in the art.
  • the present application provides a recombinant vector comprising a nucleic acid molecule of the present application or a gene expression cassette of the present application.
  • the nucleic acid molecule and the gene expression cassette are as described above.
  • vector in the present application is an artificial DNA molecule that carries a genetic material to express a gene of interest in a suitable host, specifically a DNA preparation containing a nucleotide sequence of a gene operably linked to a suitable regulatory sequence. do.
  • regulatory sequences may include, in addition to the promoters of the present application capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation.
  • the present invention is not limited thereto.
  • the vector used in the present application is not particularly limited as long as it can be expressed in the host cell, and any vector known in the art may be used to transform the host cell.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, ⁇ LB3, ⁇ BL4, ⁇ IXII, ⁇ ASHII, ⁇ APII, ⁇ t10, ⁇ t11, Charon4A, Charon21A, etc.
  • a vector for inserting a chromosome in a host cell may replace an endogenous promoter in a chromosome with a nucleic acid molecule having a promoter activity of the present application. Insertion of the nucleic acid molecule into the chromosome can be by any method known in the art, for example by homologous recombination.
  • the vector of the present application may be inserted into a chromosome by causing homologous recombination, the vector may further include a selection marker for confirming whether the chromosome is inserted.
  • Selection markers are used to select cells transformed with a vector, i.e., to confirm the insertion of a nucleic acid molecule of interest, and confer a selectable phenotype such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or expression of surface proteins. Markers can be used. In an environment in which a selective agent is treated, only cells expressing a selection marker survive or exhibit different expression traits, so that transformed cells can be selected.
  • transformation herein means introducing a vector comprising a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotides may include all of them, as long as they can be expressed in the host cell, either inserted into the chromosome of the host cell or located outside the chromosome.
  • the polynucleotide includes DNA and RNA encoding a target protein, and may be introduced in any form as long as it can be introduced into and expressed in a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression, or in the form of a vector including the same.
  • An expression cassette or vector comprising the polynucleotide may include, for example, a nucleic acid molecule having a promoter activity consisting of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 of the present application, and thus It may also be a vector to which the gene of interest is not operably linked.
  • the nucleic acid molecule having the promoter activity may be replaced by homologous recombination with an endogenous promoter in a host cell (eg, Corynebacterium microorganism).
  • a host cell eg, Corynebacterium microorganism
  • the transformation method may include any method of introducing a nucleic acid into a cell, and may be performed by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method and the like, but is not limited thereto.
  • the present application provides, as another aspect, a recombinant microorganism comprising a recombinant vector comprising a nucleic acid molecule having the promoter activity, the gene expression cassette or a gene expression cassette of the present application.
  • nucleic acid molecule The nucleic acid molecule, gene expression cassette and recombinant vector having the promoter activity are as described above.
  • the gene expression cassette and the recombinant vector may be introduced into the microorganism by transformation.
  • microorganism includes both wild-type microorganisms and microorganisms in which natural or artificial genetic modification has occurred, and a certain mechanism is weakened due to the insertion of an external gene or an enhanced or weakened activity of an endogenous gene.
  • the concept includes both microorganisms that have been enhanced or fortified.
  • the microorganism may be included without limitation as long as the microorganism capable of operating as a promoter by introducing a nucleic acid molecule having a promoter activity of the present application.
  • the microorganism may be a microorganism of the genus Corynebacterium, more specifically, Corynebacterium glutamicum, Corynebacterium ammonia genes, Brevibacterium lactofermentum ( Brevibacterium) lactofermentum), Brevibacterium Plastic pan (Brevibacterium flavum), Corynebacterium thermo amino to Ness (Corynebacterium thermoaminogenes), Corynebacterium epi syeonseu (Corynebacterium efficiens ) and the like. More specifically, it may be Corynebacterium glutamicum, but is not limited thereto.
  • the present application provides a method of cultivating a recombinant microorganism of the present application in a medium; And (b) recovering the target substance produced from the microorganism or the culture medium of the microorganism.
  • object of interest in the present application can be selected from the group consisting of sugars (eg, psycos or tagatose), L-amino acids (eg, L-lysine, L-valine), organic acids, enzymes, and combinations thereof.
  • saccharides means carbohydrates that have a sweet taste, and may be selected from the group consisting of glucose, fructose, galactose, allulose, tagatose, xylose, lactose, sucrose, and combinations thereof. It is not limited.
  • amino acid or "L-amino acid” generally refers to a basic structural unit of a protein in which an amino group and a carboxy group are bonded to the same carbon atom.
  • the amino acids are for example glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine, arginine, histidine, phenylalanine, tyrosine, tryptophan, proline , And combinations thereof, but is not limited thereto.
  • the “organic acid” is an acidic organic compound, and may be, for example, an organic compound containing a carboxy group and a sulfone group. Specific examples of the organic acid may include lactic acid, acetic acid, succinic acid, butyric acid, palmitic acid, oxalic acid, tartaric acid, citric acid, tartaric acid, propionic acid, hexenoic acid, capric acid, caprylic acid, gylic acid, or citric acid, This is not restrictive.
  • the "enzyme” is a protein catalyst that mediates chemical reactions in living organisms. Specifically, the enzyme acts as a catalyst to lower the activation energy of the reaction by binding to a substrate to form an enzyme-substrate complex.
  • the target product includes any target substance that can be produced due to the expression of the target gene operably linked to the promoter of the present application, and is not limited by the above examples.
  • the term "culture” refers to the growth of microorganisms under appropriately artificially controlled environmental conditions.
  • a method for producing a target substance using a recombinant microorganism may be performed using a method well known in the art.
  • the culture may be continuously cultured in a batch process, an injection batch or a repeated fed batch process, but is not limited thereto.
  • the medium used for cultivation must meet the requirements of the particular strain in an appropriate manner.
  • Culture media for strains of the genus Corynebacterium or Escherichia are known (e.g., Manual of Methods for General Bacteriology. American Society for Bacteriology.Washington D.C., USA, 1981).
  • Sugar sources that can be used include glucose and sucrose, lactose, fructose, maltose, starch, sugars and carbohydrates such as cellulose, soybean oil, sunflower oil, castor oil, coconut oil, and the like, palmitic acid, stearic acid, linoleic acid Fatty acids, such as glycerol, alcohols such as ethanol, gluconic acid, acetic acid, organic acids such as pyruvic acid, may be included, but are not limited thereto, and these materials may be used individually or as a mixture.
  • Nitrogen sources that may be used may include peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, It is not limited to this. Nitrogen sources can also be used individually or as a mixture. Personnel that may be used may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts.
  • the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate required for growth.
  • essential growth substances such as amino acids and vitamins can be used.
  • suitable precursors to the culture medium may be used.
  • its substrate may be included in the medium.
  • fructose which is a substrate of a cosmos epimerase, tagatose epimerase or tagaturonate epimerase, may be included.
  • the above-mentioned raw materials may be added batchwise or continuously in a manner appropriate to the culture during the culturing process.
  • Such various culture methods are disclosed, for example, in "Biochemical Engineering” by James M. Lee, Prentice-Hall International Editions, pp 138-176.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acid compounds such as phosphoric acid or sulfuric acid can be used in an appropriate manner to adjust the pH of the culture.
  • antifoaming agents such as fatty acid polyglycol esters can be used to inhibit bubble generation.
  • Oxygen or an oxygen-containing gas eg, air
  • the temperature of the culture is usually 20 ° C to 45 ° C, specifically 25 ° C to 40 ° C, but may be changed depending on conditions, but is not limited thereto.
  • the method for producing a target substance of the present application may include recovering the target substance from the microorganism of the present application or the culture medium of the present application, and recovering the target substance from the culture medium of the microorganism or the microorganism.
  • the method can be used to isolate or recover the desired material using suitable reactions known in the art. For example, treatment with protein precipitants (salting method), centrifugation, extraction, ultrasonic crushing, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography Various chromatography, such as these, and these methods may be combined, but it is not limited to these examples.
  • the recovery step may include a purification process, and those skilled in the art may select and utilize as needed from a variety of known purification processes.
  • Example 1 Confirmation of target gene expression inducing activity of a novel promoter
  • promoters In order to synthesize a novel promoter for inducing the expression of a gene of interest, various promoter sequences from Corynebacterium microorganisms and Escherichia microorganisms were analyzed. From this, promoters having the nucleotide sequences of SEQ ID NOs: 1, 2 and 3 were identified. It was synthesized and named SPL1, SPL7 and SPL13, respectively.
  • An ORF (Open Reading Frame) of the GFP gene was obtained by performing PCR using primers of SEQ ID NO: 6 and SEQ ID NO: 7, including a PstI / EcoRV cleavage site, using a pGFPuv vector (clontech, USA). PCR was denatured at 94 ° C. for 5 minutes, followed by 30 times of 94 ° C. denaturation, 55 ° C. 30 seconds annealing, and 72 ° C. 1 minute polymerization, and then polymerized at 72 ° C. for 7 minutes. As a result, a gene fragment (SEQ ID NO: 14) containing a GFP ORF of about 716 bp was obtained.
  • SPL1, SPL7 and SPL13 were linked to GFP by operably linking ORFs of GFP genes treated with KpnI, EcoRV and SPL1, SPL7 and SPL13 with PstI and EcoRV, respectively, using DNA conjugation enzymes.
  • Recombinant vector was constructed and named pSPL1-GFP, pSPL7-GFP and pSPL13-GFP, respectively.
  • P117-CJ4-GFP comprising the vector pECCG117 and the recombinant vectors pSPL1-GFP, pSPL7-GFP and pSPL13-GFP prepared above and the conventionally known promoter pcj4 (Korean Patent No. 10-0620092) were selected from Corynebacterium glue. Tamicum ATCC13032 and ATCC13869 were each transformed with an electric pulse method (Appl. Microbiol. Biothcenol. (1999) 52: 541-545), and then Luria autani (LB) agar containing 25 mg / L of kanamycin (kanamycin) Transformed strains were obtained in the medium.
  • LB Luria autani
  • the strains obtained on the basis of ATCC13032 were Corynebacterium glutamicum ATCC13032 / pECCG117, Corynebacterium glutamicum ATCC13032 / SPL1-GFP, Corynebacterium glutamicum ATCC13032 / SPL7-GFP, Corynebacterium glutamicum Tamicum ATCC13032 / SPL13-GFP and Corynebacterium glutamicum ATCC13032 / CJ4-GFP.
  • strains obtained based on ATCC13869 were Corynebacterium glutamicum ATCC13869 / pECCG117, Corynebacterium glutamicum ATCC13869 / SPL1-GFP, Corynebacterium glutamicum ATCC13869 / SPL7-GFP, and Corynebacterium Glutacum ATCC13869 / SPL13-GFP and Corynebacterium glutamicum ATCC13869 / CJ4-GFP.
  • ATCC13032 / SPL7-GFP Six strains of ATCC13032 / SPL7-GFP, ATCC13032 / SPL13-GFP and ATCC13032 / SPL1-GFP, ATCC13869 / SPL7-GFP, ATCC13869 / SPL13-GFP, and ATCC13869 / SPL1-GFP obtained by the transformation above were CA01, respectively.
  • the numbers KCCM11971P, KCCM11972P, KCCM11973P, KCCM11974P, KCCM11975P and KCCM11976P have been assigned.
  • Nebacterium glutamicum ATCC13032 / SPL1-GFP, Corynebacterium glutamicum ATCC13032 / SPL7-GFP, Corynebacterium glutamicum ATCC13032 / SPL13-GFP, Corynebacterium glutamicum ATCC13869 / pECCG117, Cory Nebacterium glutamicum ATCC13869 / CJ4-GFP, Corynebacterium glutamicum ATCC13869 / SPL1-GFP, Corynebacterium glutamicum ATCC13869 / SPL7-GFP and Corynebacterium glutamicum ATCC13869 / SPL13-GFP Was cultured in the following manner, and
  • the cells were collected from the culture by centrifugation (5,000 rpm, 15 minutes), washed twice with 50 mM Tris-HCl (pH 8.0) buffer, and then suspended in the same buffer. After adding 1.25 g of glass beads per 1.5 ml of the suspension, the cells were crushed for 6 minutes using a bead beater, and the supernatant was collected by centrifugation (15,000 rpm, 20 minutes). Protein concentration was quantified by the Bradford method. The same amount of cell extract was irradiated with excitation light at 488 nm using the method of Laure Gory et al.
  • SPL1, SPL7 and SPL13 all exhibit promoter activity in two kinds of Corynebacterium glutamicum and higher fluorescence sensitivity than pcj4, which is known as a strong promoter in Corynebacterium glutamicum. Indicated. As a result, it can be seen that SPL1, SPL7, and SPL13 are very potent promoters capable of expressing a gene of interest in Corynebacterium glutamicum.
  • SPL1 and SPL7 were used to construct vectors for Corynebacterium strains with enhanced expression of ATPE (Phycose Epimerizing Enzyme derived from Acrobacterium cumerfaciens ATCC 33970).
  • ATPE Physical Enzyme derived from Acrobacterium cumerfaciens ATCC 33970.
  • PCR (30 seconds at 94 ° C, 30 seconds at 55 ° C, 30 minutes at 72 ° C for 30 minutes) was carried out using primers SEQ ID NOs: 9 and 10. It was performed to amplify the Open Reading Frame (ORF) of the ATPE gene.
  • the ATPE-2 obtained by the PCR was BD In- By operably linking with the Fusion kit, finally, vectors pSPL1-ATPE-2 and pSPL7-ATPE-2 for the Corynebacterium strain were prepared.
  • the prepared pSPL1-ATPE-2 vector and pSPL7-ATPE-2 vector were introduced into ATCC13032 strain using electroporation to prepare SPL1-ATPE-2 and SPL7-ATPE-2 strains.
  • the strain prepared through the above procedure was cultured using a medium having the same composition as in Example 1, and then the ATPE activity was measured.
  • ATCC13032 / pECCG117 strain and ATCC13032 / CJ4-ATPE-2 strain were used as controls.
  • Each strain incubated overnight in LB solid medium in a 30 ° C. incubator was inoculated in 25 mL medium, which was then shake-cultured for 24 hours in a 30 ° C. incubator, followed by centrifugation to remove the supernatant and EPPS solution (pH 8.0 ), The obtained cells were dissolved in the EPPS solution (pH 8.0), followed by addition of 1 mg / ml POESA and centrifugation after 1 hour reaction at room temperature. Then, the pellet obtained by centrifugation was dissolved in EPPS solution (pH 8.0), and the reaction was stopped at 50 ° C. for 3 hours by adding a substrate of 350 g / L fructose solution.
  • Corynebacterium glutamicum ATCC13032 / SPL1-ATPE-2 and ATCC13032 / SPL7-ATPE-2 are each more productive than those of Corynebacterium glutamicum ATCC13032 / CJ4-ATPE-2. 321%, 258% improved. From this, it can be seen that when using the promoters SPL1 and SPL7 of the present application, the amount of expression of the gene encoding ATPE is increased to significantly increase ATPE activity.
  • thermogram was cloned from Neapolitana-derived tagatose epimerase enzyme (UxaE) to prepare a vector for a Corynebacterium strain. It was.
  • pET28a-TN (m) vector SEQ ID NO: 11
  • PCR was carried out with primers of SEQ ID NOs: 12 and 13 (30 seconds at 94 ° C, 30 seconds at 55 ° C, 1 minute reaction at 72 ° C for 30 minutes). Times), ORF (Open Reading Frame) of TN (m) gene was amplified.
  • the amplified gene TN (m) and the vectors CJ4-GFP and SPL13-GFP for the strains of Corynebacterium were treated with restriction enzymes EcoRV and PstI, followed by ligation, and finally the vector pCJ4-TN for strains of Corynebacterium. (m) and pSPL13-TN (m) were produced.
  • the prepared pCJ4-TN (m) vector and pSPL13-TN (m) vector were introduced into ATCC13032 strain using electroporation to prepare ATCC13032 / CJ4-TN (m) and SPL13-TN (m) strains.
  • the strain prepared through the above process was cultured and pretreated in the same manner as the medium and the culture conditions described in Example 1 to obtain a strain for the activity of UxaE.
  • Activity evaluation was performed by changing only the substrate amount, reaction temperature and time in the same manner as in Example 2-1 (reaction at 60 ° C. for 2 hours with the addition of 100 g / L fructose solution). Thereafter, the supernatant was recovered by centrifugation and the amount of tagatose produced by HPLC analysis ((A) and (B) of FIG. 2). Tagatose production after the reaction is shown in Table 3 below.
  • L-amino acid is the enzyme of ilvE (Ncgl2123) encoding a branched-chain amino-acid aminotransferase, a key gene for valine biosynthesis, to confirm L-valine production capacity.
  • ilvE enzyme of ilvE
  • pECCG117-CJ7-ilvE and pECCG117-SPL7-ilvE vectors were constructed as follows.
  • the NCgl2123 gene was amplified about 1104 bp PCR fragment having EcoRV at the 5 'end and PstI restriction site at the 3' end.
  • the obtained PCR fragment was purified and mixed with EcoECV and PstI restriction enzyme-treated pECCG117-CJ7-GFP and pECCG117-SPL7-GFP, respectively, and linked using an In-fusion cloning kit to prepare a vector. These were named pECCG117-CJ7-ilvE and pECCG117-SPL7-ilvE, respectively.
  • the recombinant vector pECCG117-CJ7-ilvE, pECCG117-SPL7-ilvE, and pECCG117 vector produced above were transformed by electropulse into the production strain Corynebacterium glutamicum KCCM11201P (Korean Patent No. 10-1117022). After the transformation strain was obtained in LB agar medium containing 25mg / L kanamycin (kanamycin). The obtained strains were named KCCM11201P / pECCG117, KCCM11201P / CJ7-ilvE and KCCM11201P / SPL7-ilvE, respectively.
  • L-valine production capacity of the three transformed strains were cultured and analyzed by the following method.
  • glucose 50 g of glucose, 20 g of (NH 4 ) 2 SO 4, 20 g of Corn Steep Solids, 1 g of KH 2 PO 4 , 0.5 g of MgSO 4 ⁇ 7H 2 O, 200 ⁇ g of biotin (based on 1 liter of distilled water) .
  • L-amino acids are NADP dependent glyceraldehyde-3-phosphate dehydrogenase (GapN) enzyme activity derived from known Streptococcus mutants to confirm L-lysine production capacity.
  • GapN NADP dependent glyceraldehyde-3-phosphate dehydrogenase
  • the nucleotides of the wild type Corynebacterium glutamicum ATCC13032 are based on the NIH Genbank of the National Institutes of Health, so as to be inserted into the transposon gene NCgl2392 in the Corynebacterium microorganism.
  • PCR was performed using 16 and SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19 as primers (30 seconds at 94 ° C, 30 seconds at 55 ° C, 30 minutes at 72 ° C for 1 minute), and the NCgl2392 gene. Fragments containing 5 'and 3' ends were amplified, respectively.
  • pECCG122-Pcj7-gapN1 Karl Patent No.
  • SEQ ID NOs: 20 and 21 were used as primers for PCR (30 seconds at 94 ° C, 30 seconds at 55 ° C, 2 minutes at 72 ° C). The reaction was performed 30 times) to amplify Pcj7-gapN1, using the pECCG122-Pcj7-gapN1 vector and the SPL13-GFP vector prepared in Example 1 to SEQ ID NO: 22 and SEQ ID NO: 23, SEQ ID NO: 24 And PCR (30 seconds at 94 ° C., 30 seconds at 55 ° C., 30 minutes at 72 ° C., 1 time reaction at 30 ° C.) was performed to amplify SPL13 and gapN genes, respectively.
  • PDZTn-Pcj7-gapN1 and pDZTn-SPL13-gapN1 vectors were prepared by cloning with the NCgl2392 gene fragment prepared above in a pDZ vector (Korean Patent No. 0924065) that is not replicable in Corynebacterium glutamicum.
  • KCCM11016P with improved lysine production capacity
  • the microorganism was disclosed as KFCC10881, re-deposited by the International Depository under the Budapest Treaty, and received the accession number as KCCM11016P, Korea Patent No. 10-0159812).
  • Vectors of each of pDZTn-Pcj7-gapN1 and pDZTn-SPL13-gapN1 were subjected to the electropulse method (Appl. Microbiol.
  • L-lysine production capacity of the three transformed strains were analyzed by culturing in the following manner.
  • Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and shaken at 200 rpm for 20 hours at 30 ° C.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was then inoculated with 1 ml of the seed culture and shaken at 200 rpm for 72 hours at 30 ° C.
  • the concentration of L-lysine was analyzed using HPLC (SHIMADZU, LC-20AD).
  • Glucose 20 g Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO 4 7H 2 O 0.5 g, Biotin 100 ⁇ g, Thiamine HCl 1000 ⁇ g, Calcium- 2000 ⁇ g pantothenic acid, 2000 ⁇ g nicotinamide (based on 1 liter of distilled water)
  • the SPL1, SPL7 and SPL13 promoters of the present application can significantly increase the expression of the target gene in recombinant microorganisms compared to the conventionally known promoters, thereby providing an effective expression system.
  • it can be usefully used in various industrial fields to produce a high yield of the desired products, for example, sugars, functional materials and amino acids.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 출원은 신규한 프로모터, 이를 포함하는 벡터, 상기 프로모터 또는 벡터를 포함하는 미생물, 및 상기 미생물을 이용하여 목적 물질을 생산하는 방법에 관한 것이다.

Description

신규 프로모터 및 이의 용도
본 출원은 신규한 프로모터, 이를 포함하는 벡터, 상기 프로모터 또는 벡터를 포함하는 미생물, 및 상기 미생물을 이용하여 목적 물질을 생산하는 방법에 관한 것이다.
미생물을 이용하여 사료, 의약품, 식품 등의 다양한 용도로 사용 가능한 아미노산 또는 유용 물질 등의 목적 물질을 고역가로 생산하기 위해서 생합성 경로 상 유전자 조작 및/또는 외부 유전자 도입 등의 노력이 계속되어 왔다 (대한민국 등록특허 제10-0924065호). 이와 같은 방법 중 하나로, 미생물에서 목적 유전자의 과발현을 유도하는 방법이 있는데, 이를 위해서는 고효율의 유전자 발현 시스템이 필요하다. 프로모터는 유전자 발현 시스템에 가장 크게 관여하는 요소 중 하나이므로, 유용한 프로모터 개발이 필수적이라 할 수 있다.
대장균 유래 tac 프로모터는 강한 프로모터로 널리 알려져 있으며, 코리네형 미생물의 경우, 자체 유전자의 프로모터를 변형시켜서 강한 프로모터를 개발해 왔다(Gene, 102, 93-98, 1991; Microbiology, 142, 1297-1309, 1996). 예를 들어, 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenesis) 유래 프로모터의 경우, 종래 대장균에서 보고된 tac 프로모터와 비교해서 약 10% 향상된 것이 공지되어 있다(Biotechnol. Lett. 25, 1311-1316, 2003). 또한, 코리네박테리움 암모니아게네스 유래의 강한 프로모터로서, 다양한 세기의 Pcj1~7 프로모터가 개발되었으며, tac 프로모터보다 10배 이상의 강력한 프로모터 활성을 갖는다(대한민국 등록 특허 제10-0620092). 또한 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)에서 강한 프로모터로 활성을 가지도록 합성한 Po2 프로모터가 개발되었다(대한민국 등록 특허 제10-1632642). 그러나 대장균 유전자 발현 시스템과 비교하여 코리네박테리움속 미생물에서도 높은 발현 효율을 나타내는 시스템이 필요한 바, 프로모터의 개발 필요성이 여전히 대두되고 있는 실정이다.
이러한 배경 하에, 본 발명자들은 코리네박테리움 속 미생물에서 유전자 발현을 강하게 유도할 수 있는 프로모터를 발굴하기 위하여 예의 노력하였고, 그 결과 본 출원의 신규 합성 프로모터를 개발하여 공지된 프로모터에 비하여 높은 발현 활성을 확인함으로써 본 출원을 완성하였다.
본 발명자들은 코리네박테리움 속 미생물에서 유전자 발현을 강하게 유도할 수 있는 프로모터를 발굴하기 위하여 예의 노력하였고, 그 결과 본 출원의 신규 합성 프로모터를 개발하여 공지된 프로모터에 비하여 높은 발현 활성을 확인함으로써 본 출원을 완성하였다.
본 출원의 목적은 프로모터 활성을 갖는 신규한 핵산 분자, 상기 핵산 분자 및 목적 유전자를 포함하는 유전자 발현 카세트, 상기 핵산 분자 또는 상기 유전자 발현 카세트를 포함하는 재조합 벡터, 상기 프로모터 또는 벡터를 포함하는 재조합 미생물 및 상기 재조합 미생물을 이용하여 목적 물질을 생산하는 방법을 제공하는 것이다.
본 발명의 신규한 프로모터는 목적 유전자의 발현을 유도하는 미생물에 따라 다양한 활성을 가질 수 있다. 이에 따라, 목적 물질을 생산 시 필요에 따라 목적 유전자의 활성을 조절해야 하는 경우 본 발명의 신규한 프로모터를 사용할 수 있어 효율적으로 목적 물질을 생산할 수 있다.
도 1은 신규한 프로모터들의 세기를 측정한 GFP assay 결과를 나타낸 것이다. (A)는 코리네박테리움 글루타미쿰 ATCC13032 기반의 신규 프로모터들의 GFP assay 결과이다. (B)는 코리네박테리움 클루타미쿰 ATCC13869기반의 신규 프로모터들의 GFP assay 결과이다.
도 2은 사이코스 생산을 확인한 HPLC 결과를 나타낸 것이다. (A)는 코리네박테리움 글루타미쿰 ATCC13032/CJ4-ATPE-2, (B)는 코리네박테리움 글루타미쿰 ATCC13032/SPL1-ATPE-2, (C)는 코리네박테리움 글루타미쿰 ATCC13032/SPL7-ATPE-2를 이용하여 프럭토스 기질과 반응한 후의 결과이다.
도 3는 타가토스 생산을 확인한 HPLC 결과를 나타낸 것이다. (A)는 코리네박테리움 글루타미쿰 ATCC13032/CJ4-TN(m), (B)는 코리네박테리움 글루타미쿰 ATCC13032/SPL13-TN(m)을 이용하여 프럭토스 기질과 반응한 후의 결과이다.
본 출원의 목적을 달성하기 위하여, 본 출원은 하나의 양태로서 서열번호 1 내지 3으로 이루어진 군에서 선택된 어느 하나의 뉴클레오티드 서열로 이루어진 프로모터 활성을 갖는 핵산 분자를 제공한다.
본 출원에서 용어 "프로모터"란 폴리머라제에 대한 결합 부위를 포함하고 프로모터 하위 유전자의 mRNA로의 전사 개시 활성을 가지는, 암호화 영역의 상위(upstream)의 비 해독된 핵산서열, 즉, 폴리머라제가 결합하여 유전자의 전사를 개시하도록 하는 DNA 영역을 말한다. 상기 프로모터는 mRNA 전사 개시부위의 5' 부위에 위치할 수 있다.
본 출원에서 상기 서열번호 1 내지 3으로 이루어진 군에서 선택된 어느 하나의 뉴클레오티드 서열(즉, 서열번호 1, 서열번호 2 또는 서열번호 3의 뉴클레오티드 서열)로 이루어진 프로모터 활성을 갖는 핵산 분자는 각각 SPL1, SPL7 및 SPL13으로 명명하였다. 상기 프로모터 활성을 갖는 핵산 분자는 프로모터로도 명명될 수 있으며, 본 명세서에서는 상기 기술된 용어가 모두 사용될 수 있다.
본 출원의 프로모터는 목적하는 미생물에서 상기 프로모터 활성을 갖는 핵산 분자와 작동 가능하게 연결된 목적 유전자의 발현을 가져올 수 있으며, 범용 프로모터로 사용될 수 있다.
또한, 본 출원의 프로모터 서열은 종래 알려진 돌연변이 유발법, 예를 들면 방향성 진화법(direct evolution) 및 부위특이적 돌연변이법(site-directed mutagenesis) 등에 의하여 변형될 수 있다. 따라서 상기 프로모터는 상기 서열번호 1, 서열번호 2 또는 서열번호 3의 뉴클레오티드 서열과 70 % 이상, 구체적으로는 80 % 이상, 보다 구체적으로는 90 % 이상, 더욱 구체적으로는 95 % 이상, 보다 더욱 구체적으로는 98 % 이상, 가장 구체적으로는 99 % 이상의 상동성을 나타내며 유사한 프로모터 활성을 나타내는 뉴클레오티드 서열도 제한 없이 포함될 수 있다. 또한, 이러한 상동성을 가지는 뉴클레오티드 서열로서, 프로모터 활성을 가지는 뉴클레오티드 서열이라면, 일부 서열이 결실, 변형, 치환, 또는 부가된 뉴클레오티드 서열도 본 출원의 핵산 분자 범위에 포함되는 것으로 해석되어야 한다.
특히, 상기에서 서열번호 1, 2 또는 3의 뉴클레오티드 서열로 이루어진다는 표현은 해당 프로모터를 목적 유전자에 연결하여 사용할 때, 제한효소 사용과 같이 목적 유전자에 연결하는 과정 중에 발생할 수 있는 뉴클레오티드의 추가, 및/또는 삭제, 및/또는 변이 등의 경우를 배제하지 않는다.
구체적으로, 유전자의 전사를 실시하기 위한 프로모터 외에 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열 및 전사 및 해독의 종결을 조절하는 DNA를 포함할 수 있다. 예를 들면, 원핵생물에 적합한 조절 서열은 프로모터, 임의의 오퍼레이터 서열 및 리보좀 결합 부위를 포함할 수 있으나, 이에 한정되지 않는다. 본 출원의 프로모터 활성을 갖는 핵산분자는 통상의 당업자에 의해 필요에 따라 상기한 바와 같은 유전자 발현 조절을 위한 서열을 구성할 수 있다.
또한 1 내지 3으로 이루어진 군에서 선택된 어느 하나의 뉴클레오티드 서열로 이루어진 프로모터 활성을 갖는 핵산 분자는, 공지의 유전자 서열로부터 조제될 수 있는 프로브(probe), 예를 들면, 본 발명의 서열번호 1 내지 3의 뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여 본 출원의 프로모터 활성을 갖는 뉴클레오티드 서열이라면 제한 없이 포함할 수 있다
본 출원에서 용어, "상동성"은 두 개의 폴리뉴클레오티드 또는 폴리펩타이드 모이어티(moiety) 사이의 동일성의 퍼센트를 말한다. 하나의 모이어티로부터 다른 하나의 모이어티까지의 서열 간 상동성은 알려진 당해 기술에 의해 결정될 수 있다. 예를 들면, 점수(score), 동일성(identity) 및 유사도(similarity) 등의 매개 변수(parameter)들을 계산하는 표준 소프트웨어, 구체적으로 BLAST 2.0을 이용하거나, 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다.
상기 “엄격한 조건”이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌 (예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성이 높은 유전자끼리, 80% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화의 세척 조건인 60℃, 1×SSC, 0.1% SDS, 구체적으로는 60℃, 0.1×SSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1×SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다. 혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, “상보적”은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, 뉴클레오티드 염기에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다. 구체적으로, 상동성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다. 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
본 출원의 프로모터 활성을 갖는 핵산 분자는 표준 분자 생물학 기술을 이용하여 분리 또는 제조할 수 있다. 예를 들어, 자동화된 DNA 합성기를 이용하는 표준 합성 기술을 이용하여 제조할 수 있으나, 이에 제한되는 것은 아니다.
본 출원은 다른 하나의 양태로서, 본 출원의 핵산 분자 및 목적 유전자를 포함하는, 유전자 발현 카세트를 제공한다.
본 출원의 핵산 분자는 앞서 설명한 바와 같다.
본 출원에서 용어 "유전자 발현 카세트"란, 프로모터와 목적 유전자를 포함하고 있어서, 프로모터 하류에 작동 가능하게 연결되어 있는 목적 유전자를 발현시킬 수 있는 단위 카세트를 의미한다. 이와 같은 유전자 발현 카세트의 내부 또는 외부에는 상기 목적 유전자의 효율적인 발현을 도울 수 있는 다양한 인자가 포함될 수 있다. 상기 유전자 발현 카세트는 통상 상기 목적 유전자에 작동 가능하게 연결되어 있는 프로모터(promoter) 외에 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다.
본 출원에서 용어, "목적 유전자"는 미생물에서 발현시키고자 하는 단백질을 코딩하는 유전자를 의미한다.
예를 들면, 당류(예컨대, 사이코스 또는 타가토스), L-아미노산(예컨대, L-라이신, L-발린), 유기산 및 효소 이들의 조합으로 구성된 군으로부터 선택된 산물의 생산에 관여하는 유전자일 수 있으나, 이에 제한되는 것은 아니다. 구체적으로 목적 유전자는 당류 전환 효소, 아미노산 생합성 관련된 효소를 코딩하는 유전자, 환원력에 관련된 효소를 코딩하는 유전자, 유기산 생합성에 관련된 효소를 코딩하는 유전자, 목적 산물의 배출에 관련된 단백질을 코딩하는 유전자일 수 있으나, 이에 제한 되는 것은 아니다. 더욱 구체적으로는 사이코스 에피머화 효소를 코딩하는 유전자, 타가토스 에피머화 효소를 코딩하는 유전자 또는 타가투로네이트 에피머화 효소를 코딩하는 유전자, NADP 의존적 글리세르알데하이드-3-포스페이트 디하이드로지나제를 코딩하는 유전자, 또는 분지쇄 아미노산 아미노트랜스퍼라아제를 코딩하는 유전자가 포함되나, 이에 제한되지 않는다.
상기 사이코스 에피머화 효소는 ATPE로 표기할 수 있으며, 프럭토스를 사이코스로 전환시키는 활성을 갖는 사이코스-3-에피머화 효소를 의미한다. 또한, 타가투로네이트 에피머화 효소 또는 타가토스 에피머화 효소(한국 등록특허 제 10-1550796호의 헥수론산 C4-에피머화 효소)는 UxaE로 표기할 수 있으며, 프럭토스산을 타가토스산으로 전환시키거나 프럭토스를 타가토스로 전환시키는 활성을 갖는 효소를 의미한다. 상기 NADP 의존적 글리세르알데하이드-3-포스페이트 디하이드로지나제는 GapN으로 표기할 수 있으며, 글리세르알데히드-3-포스페이트 (glyceraldehyde 3 phosphate)를 기질로 하여 3-포스포글리세레이트 (3-phosphoglycerate)로 전환시키는 활성을 갖는 효소를 의미한다. 상기 분지쇄 아미노산 아미노트랜스퍼라아제(branched-chain amino-acid aminotransferase)는 IlvE로 표기할 수 있으며, 분지쇄 아미노산의 생합성 경로에서 마지막 단계의 효소를 의미한다. 상기 ATPE를 코딩하는 유전자, UxaE를 코딩하는 유전자, GapN을 코딩하는 유전자, IlvE를 코딩하는 유전자의 서열은 미국 국립보건원의 GenBank와 같은 공지의 데이터 베이스를 통하여 당업자가 용이하게 입수할 수 있다. 상기 ATPE를 코딩하는 유전자, UxaE를 코딩하는 유전자, GapN을 코딩하는 유전자, IlvE를 코딩하는 유전자는 본 출원의 프로모터 활성을 갖는 핵산 분자에 작동 가능하게 연결될 수 있는 목적 유전자 중 하나로서 단지 예시적인 것이며, 본 출원의 프로모터는 범용 프로모터로써 미생물로부터 발현될 수 있는 유전자라면 제한 없이 목적 유전자로 이용될 수 있다. 본 출원에서 용어, "작동 가능하게 연결"(operatively linked)이란 본 발명의 프로모터 활성을 갖는 핵산 서열이 목적 유전자의 전사를 개시 및 매개하도록, 상기 유전자 서열과 프로모터 서열이 기능적으로 연결되어 있는 것을 의미한다. 작동 가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있으나, 이에 제한되지 않는다.
본 출원은 또 다른 하나의 양태로서, 본 출원의 핵산 분자 또는 본 출원의 유전자 발현 카세트를 포함하는 재조합 벡터를 제공한다.
상기 핵산 분자 및 상기 유전자 발현 카세트는 앞서 설명한 바와 같다.
본 출원의 용어 "벡터"는 적합한 숙주 내에서 목적 유전자를 발현시킬 수 있도록 유전 물질을 보유하는 인위적 DNA 분자로, 구체적으로 적합한 조절 서열에 작동 가능하게 연결된 유전자의 뉴클레오티드 서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 본 출원의 프로모터 외에 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있으나, 이에 제한되지 않는다.
본 출원에서 사용되는 벡터는 숙주세포 내에서 발현 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용하여 숙주세포를 형질전환시킬 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, λLB3, λBL4, λⅨII, λASHII, λAPII, λt10, λt11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 본 출원에서 사용 가능한 벡터는 특별히 제한되는 것이 아니며 공지된 발현 벡터를 사용할 수 있다. 또한, 숙주세포 내 염색체 삽입용 벡터를 통해 염색체 내에 내재적 프로모터를 본 출원의 프로모터 활성을 갖는 핵산 분자로 교체시킬 수 있다. 상기 핵산 분자의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있다. 그 예로 pECCG117, pDZ, pACYC177, pACYC184, pCL, pUC19, pBR322, pMW118, pCC1BAC, pCES208, pXMJ19 벡터 등을 사용할 수 있으나, 이에 제한되지 않는다. 본 출원의 벡터는 상동재조합을 일으켜서 염색체 내로 삽입될 수 있으므로 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본원에서 용어 "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함하며, 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트 (expression cassette)의 형태 또는 이를 포함하는 벡터의 형태로 숙주세포에 도입될 수 있다. 상기 폴리뉴클레오티드를 포함하는 발현 카세트 또는 벡터는 예를 들어, 본 출원의 상기 서열번호 1, 서열번호 2 또는 서열번호 3의 뉴클레오티드 서열로 이루어진, 프로모터 활성을 갖는 핵산 분자를 포함하는 것일 수 있으며, 이에 목적 유전자가 작동 가능하게 연결되지 않은 벡터일 수도 있다. 이의 경우에도, 상기 프로모터 활성을 갖는 핵산 분자는 숙주 세포(예컨대, 코리네박테리움 속 미생물) 내의 내재적 프로모터와 상동 재조합에 의해 교체될 수 있다. 이에 의해 숙주 세포의 내재적 유전자를 발현시킬 수 있다.
상기 형질전환 하는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법 (electroporation), 인산칼슘 (CaPO4) 침전, 염화칼슘 (CaCl2) 침전, 미세주입법 (microinjection), 폴리에틸렌글리콜 (PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
본 출원은 또 다른 하나의 양태로서, 본 출원의 상기 프로모터 활성을 가지는 핵산 분자, 상기 유전자 발현 카세트 혹은 유전자 발현 카세트를 포함하는 재조합 벡터를 포함하는, 재조합 미생물을 제공한다.
상기 프로모터 활성을 가지는 핵산 분자, 유전자 발현 카세트와 재조합 벡터는 앞서 설명한 바와 같다.
상기 유전자 발현 카세트와 재조합 벡터는 형질전환에 의해 미생물에 도입될 수 있다.
또한 상기 형질전환은 앞서 설명한 바와 같다.
본 출원에서 용어 "미생물"은 야생형 미생물이나, 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 약화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물을 모두 포함하는 개념이다. 본 출원에서 미생물은 본 출원의 프로모터 활성을 갖는 핵산 분자가 도입되어 프로모터로 작동할 수 있는 미생물이라면 제한 없이 포함될 수 있다.
구체적으로 상기 미생물은 코리네박테리움 속 미생물일 수 있으며, 더욱 구체적으로는 코리네박테리움 글루타미쿰, 코리네박테리움 암모니아게네스, 브레비박테리움 락토퍼멘텀 (Brevibacterium lactofermentum), 브레비박테리움 플라범 (Brevibacterium flavum), 코리네박테리움 써모아미노게네스 (Corynebacterium thermoaminogenes), 코리네박테리움 에피션스 (Corynebacterium efficiens) 등 일 수 있다. 보다 더욱 구체적으로는 코리네박테리움 글루타미쿰일 수 있으나, 이에 제한되지 않는다.
본 출원은 또 다른 하나의 양태로서, (a) 본 출원의 재조합 미생물을 배지에서 배양하는 단계; 및 (b) 상기 미생물 또는 상기 미생물을 배양한 배지로부터 생산된 목적 물질을 회수하는 단계를 포함하는, 목적 물질을 생산하는 방법을 제공한다.
본 출원에서 용어 “목적 물질” 당류(예컨대, 사이코스 또는 타가토스), L-아미노산(예컨대, L-라이신, L-발린), 유기산, 효소 및 이들의 조합으로 구성된 군으로부터 선택될 수 있다. 상기 “당류”는 단맛이 나는 탄수화물을 의미하며, 예를 들어 글루코스, 프럭토스, 갈락토스, 알룰로스, 타가토스, 자일로스, 락토스, 수크로스 및 이들의 조합으로 구성된 군으로부터 선택될 수 있으나, 이에 제한되지 않는다.
상기 “아미노산” 또는 “L-아미노산”은 일반적으로 아미노기와 카르복시기가 동일한 탄소 원자에 결합되어 있는 단백질의 기본 구성단위를 의미한다. 상기 아미노산은 예를 들어, 글리신, 알라닌, 발린, 로이신, 아이소로이신, 트레오닌, 세린, 시스테인, 글루타민, 메치오닌, 아스파라트산, 아스파라긴, 글루탐산, 라이신, 알지닌, 히스티딘, 페닐알라닌, 티로신, 트립토판, 프롤린, 및 이들의 조합으로 구성된 군으로부터 선택될 수 있으나, 이에 제한되지 않는다. 상기 “유기산”은 산성을 띠는 유기화합물로, 예를 들어, 카복시기와 설폰기가 들어 있는 유기화합물일 수 있다. 유기산의 구체적인 예로써 젖산, 아세트산, 숙신산, 뷰티르산, 팔미트산, 옥살산, 타르타르산, 구연산, 주석산, 프로피온산, 헥센산, 카프린산, 카프릴산, 길초산, 또는 시트르산을 포함할 수 있으나, 이에 제한되지 않는다. 상기 “효소”는 생명체 내부의 화학 반응을 매개하는 단백질 촉매로, 구체적으로, 효소는 기질과 결합하여 효소-기질 복합체를 형성함으로써 반응의 활성화 에너지를 낮추는 촉매 역할을 한다. 예를 들어, 당류(예컨대, 사이코스 또는 타가토스)의 생산에 관여하는 효소가 있을 수 있으며, 더욱 구체적으로 사이코스 에피머화 효소, 타가토스 에피머화 효소 또는 타가투로네이트 에피머화 효소가 포함되나, 이에 제한되지 않는다. 상기 목적 산물은, 본 출원의 프로모터와 작동 가능하게 연결된 목적유전자의 발현으로 인하여 생산될 수 있는 목적 물질이면 모두 포함하며, 상기 예시로 인하여 제한되는 것은 아니다.
본 출원에서 용어 "배양"은 미생물을 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다. 본 출원에서 재조합 미생물을 이용하여 목적 물질을 생산하는 방법은 당업계에 널리 알려져 있는 방법을 이용하여 수행할 수 있다. 구체적으로, 상기 배양은 배치 공정, 주입 배치 또는 반복 주입 배치 공정(fed batch or repeated fed batch process)에서 연속식으로 배양할 수 있으나, 이에 제한되는 것은 아니다.
배양에 사용되는 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 한다. 코리네박테리움 속 또는 에스케리키아 속 균주에 대한 배양 배지는 공지되어 있다 (예를 들면, Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981). 사용될 수 있는 당원으로는 글루코오스, 수크로스, 락토오스, 프럭토스, 말토오스, 전분, 셀룰로오스와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 글루콘산, 아세트산, 피루브산과 같은 유기산이 포함될 수 있으나, 이에 제한되는 것은 아니며, 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있다. 사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산 암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함될 수 있으나, 이에 제한되는 것은 아니다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있다. 사용될 수 있는 인원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함될 수 있으나, 이에 제한되는 것은 아니다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있다. 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장 물질이 사용될 수 있다. 또한, 배양 배지에 적절한 전구체들이 사용될 수 있다. 구체적으로는 목적 산물로써 효소를 생산하는 경우, 이의 기질을 배지에 포함할 수 있다. 예를 들어, 사이코스 에피머화 효소, 타가토스 에피머화 효소 또는 타가투로네이트 에피머화 효소의 기질이 되는 프럭토스가 포함될 수 있다. 상기된 원료들은 배양과정에서 배양물에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있다. 이러한 다양한 배양 방법은 예를 들어 문헌 ("Biochemical Engineering" by James M. Lee, Prentice-Hall International Editions, pp 138-176)에 개시되어 있다.
수산화나트륨, 수산화칼륨, 암모니아와 같은 기초 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다. 또한, 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 호기 상태를 유지하기 위해 배양물 내로 산소 또는 산소-함유 기체 (예, 공기)를 주입할 수 있다. 배양물의 온도는 보통 20℃ 내지 45℃ , 구체적으로는 25℃ 내지 40℃ 일 수 있으나, 조건에 따라 변경이 가능하며, 이에 제한되지 않는다.
본 출원의 목적 물질을 생산하는 방법은, 본 출원의 미생물 또는 상기 미생물을 배양한 배지로부터 목적 물질을 회수하는 단계를 포함할 수 있으며, 상기 미생물 또는 상기 미생물을 배양한 배지로부터 목적 물질을 회수하는 방법은 당업계에 공지된 적합한 반응을 이용하여 목적 물질을 분리 또는 회수 할 수 있다. 예를 들어, 단백질 침전제에 의한 처리(염석법), 원심분리, 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피등의 각종 크로마토 그래피 및 이들의 방법을 조합한 것일 수 있으나, 이들 예에 한정되는 것은 아니다. 상기 회수 단계는 정제 공정을 포함할 수 있으며, 당업자는 공지된 여러 정제 공정 중 필요에 따라 선택하여 활용할 수 있다.
본 출원의 이해를 돕기 위하여 실시예 등을 들어 상세하게 설명하기로 한다. 그러나, 본 출원에 따른 실시예들은 여러가지 다른 형태로 변형될 수 있으며, 본 출원의 범위가 하기 실시예들에 한정되는 것으로 해석되어서는 안된다. 본 출원의 실시예들은 당업계에서 평균적인 지식을 가진 자에게 본 출원을 보다 완전하게 설명하기 위해 제공되는 것이다.
실시예 1: 신규 프로모터의 목적 유전자 발현 유도 활성 확인
1-1. 신규 프로모터 서열을 함유하는 재조합 벡터 제작
목적 유전자의 발현을 유도하는 신규 프로모터를 합성하기 위해 코리네박테리움 속 미생물과 에세리키아 속 미생물 유래의 다양한 프로모터 서열을 분석하였으며, 이로부터 서열번호 1, 2 및 3의 뉴클레오티드 서열을 갖는 프로모터를 합성하고, 이를 각각 SPL1, SPL7 및 SPL13으로 명명하였다.
합성 제작한 프로모터 SPL1, SPL7 및 SPL13을 주형으로, KpnI/EcoRⅤ 절단부위를 포함하는 서열번호 4 및 서열번호 5의 프라이머를 이용하여 PCR [Sambrook et al, Molecular Cloning, a Laboratory Manual (1989), Cold Spring Harbor Laboratories]을 수행하였다. PCR 조건은 94℃ 에서 5 분간 변성 후, 94℃ 30 초 변성, 60℃ 30 초 어닐링, 72℃ 30 초 신장을 30 회 반복한 후, 72℃ 에서 7 분간 신장반응을 수행하였다. 그 결과, 약 300 bp의 SPL1, SPL7 및 SPL13을 수득하였다.
GFP 유전자의 ORF (Open Reading Frame)는 pGFPuv 벡터 (clontech 사, 미국)를 주형으로, PstI/EcoRⅤ 절단부위를 포함하는 서열번호 6 및 서열번호 7의 프라이머를 이용하여 PCR을 수행하여 수득하였다. PCR은 94℃ 에서 5 분간 변성 후, 94℃ 30 초 변성, 55℃ 30 초 어닐링, 72℃ 1 분 중합을 30 회 반복한 후, 72℃ 에서 7 분간 중합반응을 수행하였다. 그 결과, 약 716 bp의 GFP ORF를 포함하는 유전자 절편(서열번호 14)을 수득하였다.
대장균과 코리네형 세균에서 발현 가능한 셔틀벡터인 pECCG117(Biotechnology letters vol 13, No. 10, p. 721-726(1991), 대한민국 등록특허 제 10-1992-0007401)의 PstI과 KpnI 위치에, 제한효소 KpnI, EcoRⅤ로 처리된 각각의 SPL1, SPL7 및 SPL13과 PstI, EcoRⅤ으로 처리된, GFP 유전자의 ORF를 DNA 접합 효소를 이용하여 작동 가능하게 연결함으로써 최종적으로, SPL1, SPL7 및 SPL13이 각각 GFP와 연결되어 있는 재조합 벡터를 제작하였고, 이를 각각 pSPL1-GFP, pSPL7-GFP 및 pSPL13-GFP라 명명하였다.
1-2. 형질전환 균주의 제작
벡터 pECCG117 및 상기에서 제작된 재조합 벡터 pSPL1-GFP, pSPL7-GFP 및 pSPL13-GFP와 종래 공지된 프로모터 pcj4 (대한민국 등록특허 제 10-0620092호)를 포함하는 p117-CJ4-GFP를 코리네박테리움 글루타미쿰 ATCC13032와 ATCC13869에 전기펄스법(Appl. Microbiol. Biothcenol.(1999) 52:541-545)으로 각각 형질전환한 후, 카나마이신 (kanamycin) 25 mg/L를 함유한 루리아 버타니(LB) 한천배지에서 형질전환 균주를 획득하였다. ATCC13032 기반으로 획득한 균주를 각각 코리네박테리움 글루타미쿰 ATCC13032/pECCG117, 코리네박테리움 글루타미쿰 ATCC13032/SPL1-GFP, 코리네박테리움 글루타미쿰 ATCC13032/SPL7-GFP, 코리네박테리움 글루타미쿰 ATCC13032/SPL13-GFP 및 코리네박테리움 글루타미쿰 ATCC13032/CJ4-GFP라 명명하였다. 또한 ATCC13869 기반으로 획득한 균주를 각각 코리네박테리움 글루타미쿰 ATCC13869/pECCG117, 코리네박테리움 글루타미쿰 ATCC13869/SPL1-GFP, 코리네박테리움 글루타미쿰 ATCC13869/SPL7-GFP, 코리네박테리움 글루타미쿰 ATCC13869/SPL13-GFP 및 코리네박테리움 글루타미쿰 ATCC13869/CJ4-GFP라 명명하였다.
상기에서 형질 전환하여 획득한 ATCC13032/SPL7-GFP, ATCC13032/SPL13-GFP 및 ATCC13032/SPL1-GFP, ATCC13869/SPL7-GFP, ATCC13869/SPL13-GFP 및 ATCC13869/SPL1-GFP 6종의 균주는, 각각 CA01-2301, CA01-2302, CA01-2303, CA01-2304, CA01-2305 및 CA01-2306으로 명명한 후 부다페스트 조약 하에 국제기탁기관인 한국미생물보존센터(KCCM)에 2017년 2월 17일자에 기탁하여 수탁번호 KCCM11971P, KCCM11972P, KCCM11973P, KCCM11974P, KCCM11975P 및 KCCM11976P 를 부여받았다.
1-3. 신규 프로모터의 활성 확인
SPL1, SPL7 및 SPL13 프로모터의 활성을 확인하기 위해, 실시예 1-2에서 획득한 형질전환 균주인 코리네박테리움 글루타미쿰 ATCC13032/pECCG117, 코리네박테리움 글루타미쿰 ATCC13032/CJ4-GFP, 코리네박테리움 글루타미쿰 ATCC13032/SPL1-GFP, 코리네박테리움 글루타미쿰 ATCC13032/SPL7-GFP, 코리네박테리움 글루타미쿰 ATCC13032/SPL13-GFP, 코리네박테리움 글루타미쿰 ATCC13869/pECCG117, 코리네박테리움 글루타미쿰 ATCC13869/CJ4-GFP, 코리네박테리움 글루타미쿰 ATCC13869/SPL1-GFP, 코리네박테리움 글루타미쿰 ATCC13869/SPL7-GFP 및 코리네박테리움 글루타미쿰 ATCC13869/SPL13-GFP를 하기와 같은 방법으로 배양하고, GFP 활성을 측정하였다.
배지(포도당 20 g, 황산암모늄 5 g, 효모 추출물 5g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7ㆍH2O 0.5 g, 바이오틴 150 ㎍, 티아민 염산염 1.5 mg, 칼슘 판토테인산 3 mg, 니코틴아마이드 3 mg (증류수 1 L 기준), pH 7.2) 25 ml가 담긴 플라스크에 형질전환된 코리네박테리움 글루타미쿰 균주들을 각각 접종하고 30℃ 에서 20 시간 동안 진탕 배양하였다. 배양액으로부터 원심분리 (5,000 rpm, 15 분)를 통하여 균체를 수거하여, 50 mM Tris-HCl (pH 8.0) 완충용액으로 2 회 세척한 후, 동 완충용액으로 현탁하였다. 현탁액 1.5 ml 당 1.25 g의 글래스 비드 (glass bead)를 첨가한 후, 비드 비터 (bead beater)를 이용, 6 분간 균체를 파쇄한 다음, 원심분리 (15,000 rpm, 20 분)를 통하여 상층액을 수거하여, 브레드포드 방법에 의한 단백질 농도를 정량하였다. 동일양의 균체 추출물에 대하여 Laure Gory 등의 방법 (FEMS Microbiology Letters 194, 127-133, 2001)을 이용하여 488 nm에서 여기광을 조사하고, 511 nm 발출광을 LS-50B spectrophotometer (Perkin-Elmer) 기기를 이용하여 측정함으로써, GFP 유전자의 발현 정도를 측정하였다 (표 1).
균주 형광감도
ATCC13032/pECCG117 0.0
ATCC13032/CJ4-GFP 850.2
ATCC13032/SPL1-GFP 3197.4
ATCC13032/SPL7-GFP 3097.7
ATCC13032/SPL13-GFP 3051.1
ATCC13869/pECCG117 0.0
ATCC13869/CJ4-GFP 921.7
ATCC13869/SPL1-GFP 3342.3
ATCC13869/SPL7-GFP 3425.5
ATCC13869/SPL13-GFP 3287.3
상기 표 1에 나타낸 바와 같이, SPL1, SPL7 및 SPL13은 모두 2종의 코리네박테리움 글루타미쿰에서 프로모터 활성을 나타내며, 코리네박테리움 글루타미쿰에서 강한 프로모터로 공지되어 있는 pcj4 보다 높은 형광 감도를 나타내었다. 상기의 결과로 SPL1, SPL7, SPL13는 코리네박테리움 글루타미쿰에서 목적 유전자를 발현시킬 수 있는 아주 강력한 프로모터임을 알 수 있다.
실시예 2. 목적 물질 생산능 평가
2-1. 사이코스 생산능 평가
(1) SPL1 및 SPL7 프로모터 서열을 포함하는 ATPE 발현용 벡터 및 형질전환 균주의 제작
SPL1 및 SPL7를 이용하여 ATPE (아크로박테리움 쿠머파시엔스 ATCC 33970 유래의 사이코스 에피머화 효소)의 발현이 증대된 코리네박테리움 균주용 벡터를 제작하였다. pET24-ATPE-2 벡터 (서열번호 8)를 주형으로 하고, 서열번호 9 및 10의 프라이머로 PCR (94℃ 에서 30 초, 55℃ 에서 30 초, 72℃ 에서 1 분간의 반응을 30 회)을 수행하여, ATPE 유전자의 ORF (Open Reading Frame)를 증폭하였다. 증폭한 ATPE 유전자와 상기 실시예 1에서 제작된 코리네박테리움 균주용 벡터 pSPL1-GFP 및 pSPL7-GFP를 제한효소 EcoRV와 PstI으로 처리한 후, 상기 PCR을 통해 수득한 ATPE-2를 BD In-Fusion kit를 이용하여 작동 가능하게 연결함으로써 최종적으로 코리네박테리움 균주용 벡터 pSPL1-ATPE-2와 pSPL7-ATPE-2를 제작하였다.
상기 제작된 pSPL1-ATPE-2 벡터와 pSPL7-ATPE-2 벡터를 ATCC13032 균주에 전기천공법을 이용하여 도입하여, SPL1-ATPE-2와 SPL7-ATPE-2 균주를 제작하였다.
(2) 형질전환 균주의 사이코스 생산능 평가
상기 과정을 거쳐 제작한 균주를 실시예 1과 동일한 조성의 배지를 이용하여 배양한 후 ATPE의 활성을 측정하였다. ATCC13032/pECCG117 균주 및 ATCC13032/CJ4-ATPE-2 균주는 대조군으로 사용하였다.
30 ℃ 배양기에서 LB 고체 배지 중에 밤새 배양한 각각의 균주를 25 mL 배지에 접종한 다음, 이를 30 ℃ 배양기에서 24 시간 동안 진탕 배양하였으며, 배양 후 원심분리를 통해 상등액을 제거하고 EPPS 용액 (pH 8.0)를 이용하여 수득된 균체를 세척하고, 확보된 펠렛을 EPPS 용액 (pH 8.0)에 용해시킨 후 1 mg/ml의 POESA 첨가하여 실온에서 1 시간 반응 후 원심분리하였다. 그 다음, 원심분리하여 얻은 펠렛을 EPPS 용액 (pH 8.0)에 용해시키고, 기질인 350 g/L 프럭토스 용액을 첨가하여 50 ℃에서 3 시간 반응시킨 후, 열처리를 통해 반응을 정지시켰다. 이후 원심분리를 통해 상등액을 회수하고 HPLC 분석을 통해 사이코스 생성량을 측정하였다 (도 1의 (A), (B) 및 (C)). 반응 후 사이코스 생성량을 하기 표 2에 표시하였다.
균주 프럭토스(g/L) 사이코스(g/L)
ATCC13032/pECCG117 348.7 0
ATCC13032/CJ4-ATPE-2 329.9 18.8
ATCC13032/SPL1-ATPE-2 263.2 79.2
ATCC13032/SPL7-ATPE-2 280.1 67.4
표 2에 표시된 바와 같이, 코리네박테리움 글루타미쿰 ATCC13032/SPL1-ATPE-2 및 ATCC13032/SPL7-ATPE-2는 코리네박테리움 글루타미쿰 ATCC13032/CJ4-ATPE-2 보다 사이코스 생산성이 각 321%, 258% 향상된 것을 확인하였다. 이로부터, 본 출원의 프로모터 SPL1 및 SPL7를 사용하였을 때, ATPE를 코딩하는 유전자의 발현량이 증가되어 ATPE 활성이 현저하게 증가되었음을 확인할 수 있다.
2-2. 타가토스 생산능 평가
(1) SPL13 프로모터 서열을 포함하는 UxaE 발현용 벡터 및 형질전환 균주 제작
GFP가 삽입되어 있는 CJ4-GFP와 실시예 1에서 제작된 SPL13-GFP를 이용하여 써모토가 네아폴리타나 유래의 타가토스 에피머화 효소 유전자 (UxaE)를 클로닝하여 코리네박테리움 균주용 벡터를 제작하였다. pET28a-TN(m) 벡터 (서열번호 11)를 주형으로 하고, 서열번호 12 및 13의 프라이머로 PCR을 수행 (94℃ 에서 30 초, 55℃ 에서 30 초, 72℃ 에서 1 분간의 반응을 30 회)하여, TN(m) 유전자의 ORF(Open Reading Frame)를 증폭하였다. 증폭한 유전자 TN(m)과 코리네박테리움 균주용 벡터 CJ4-GFP 및 SPL13-GFP를 제한효소 EcoRV와 PstI으로 처리한 후, 라이게이션을 수행하여 최종적으로 코리네박테리움 균주용 벡터 pCJ4-TN(m)와 pSPL13-TN(m)를 제작하였다.
상기 제작된 pCJ4-TN(m) 벡터와 pSPL13-TN(m) 벡터를 ATCC13032 균주에 전기천공법을 이용하여 도입하여 ATCC13032/CJ4-TN(m)와 SPL13-TN(m) 균주를 제작하였다.
(2) 형질전환 균주의 타가토스 생산능 평가
상기 과정을 거쳐 제작한 균주를 실시예 1에서 기술한 배지 및 배양 조건과 동일하게 배양 및 전처리 한 후 UxaE의 활성용 균주를 확보하였다. 활성 평가는 실시예 2-1과 동일한 방법으로 기질 양, 반응 온도 및 시간만을 변경하여 수행하였다(100 g/L 프럭토스 용액을 첨가하여 60 ℃에서 2 시간 반응). 이후 원심분리를 통해 상등액을 회수하고 HPLC 분석을 통해 타가토스 생성량을 측정하였다 (도면 2의 (A) 및 (B)). 반응 후 타가토스 생성량을 하기 표 3에 표시하였다.
균주 프럭토스(g/L) 타가토스(g/L)
ATCC13032/pECCG117 100 0
ATCC13032/CJ4-TN(m) 92.2 6.9
ATCC13032/SPL13-TN(m) 82.7 16.8
표 3에 표시된 바와 같이, 코리네박테리움 글루타미쿰 ATCC13032/SPL13-TN(m)는 코리네박테리움 글루타미쿰 ATCC13032/CJ4-TN(m)보다 타가토스 생산성이 143%향상되었음을 확인하였다. 이로부터, 본 출원의 프로모터 SPL13을 사용하였을 때, UxaE를 코딩하는 유전자의 발현량이 증가되어 UxaE 활성이 현저하게 증가되었음을 확인할 수 있다.
2-3. 발린 생산능 평가
(1) SPL7 프로모터 서열을 포함하는 pECCG117 - SPL7 - ilvE 벡터 및 형질전환 균주의 제작
L-아미노산의 대표적인 하나의 예로, L-발린 생산능을 확인하기 위하여, 발린 생합성 주요 유전자인, 분지쇄 아미노산 아미노트랜스퍼라아제(branched-chain amino-acid aminotransferase)을 코딩하는 ilvE(Ncgl2123)의 효소 활성을 강화하기 위해서 다음과 같이 pECCG117-CJ7-ilvE와 pECCG117-SPL7-ilvE 벡터를 제작하였다. 구체적으로 ATCC14067 염색체를 주형으로(template)하여 하기의 서열번호14 및 서열번호15을 프라이머로 이용하여 PCR(94 ℃에서 30 초, 55 ℃에서 30 초, 72 ℃에서 1 분간의 반응을 30 회)을 수행한 결과, NCgl2123 유전자 5'말단에 EcoRV와 3'말단에 PstI 제한효소 자리를 가지는 약 1104bp PCR 단편을 증폭하였다. 상기 얻어진 PCR 단편을 정제하고 EcoRV와 PstI 제한효소 처리된 pECCG117-CJ7-GFP와 pECCG117-SPL7-GFP와 각각 혼합하여, 인 퓨전 클로닝 키트(In-fusion cloning Kit)를 이용하여 연결해 벡터를 제작하였고, 이를 각각 pECCG117-CJ7-ilvE와 pECCG117-SPL7-ilvE라 각각 명명하였다.
서열번호 14 5' GAGATCAAAACAGATATCATGACGTCATTAGAGTTC 3'
서열번호 15 5' ATCCCCCGGGCTGCAGTTAGCCAACCAGTGGGTA 3'
상기의 제작된 재조합 벡터 pECCG117-CJ7-ilvE와 pECCG117-SPL7-ilvE 및 pECCG117 벡터를 각각 발린 생산균주 코리네박테리움 글루타미쿰 KCCM11201P(한국 등록특허 제10-1117022호)에 전기펄스법으로 형질전환 후 카나마이신(kanamycin) 25mg/L 를 함유한 LB 한천배지에서 형질전환 균주를 획득하였다. 상기의 획득된 균주를 각각 KCCM11201P/pECCG117, KCCM11201P/CJ7-ilvE 및 KCCM11201P/SPL7-ilvE라 명명하였다.
(2) 형질전환 균주의 발린 생산능 평가
상기의 형질 전환된 3종 균주들의 L-발린 생산능을 아래와 같은 방법으로 배양하여 분석하였다.
생산 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1백금이의 상기 균주들을 접종하고 30 ℃에서 72시간 동안, 200 rpm에서 진탕 배양하였다. 배양종료 후 HPLC(SHIMADZU LC-20AD)를 이용하여 L-발린의 농도를 분석하였다.
<생산배지 (pH7.2)>
포도당 50 g, (NH4)2SO4 20 g, 옥수수 침지 고형분(Corn Steep Solids) 20 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 200 ㎍ (증류수 1리터 기준).
상기 배양 및 분석을 반복수행 하였으며, 분석된 L-발린의 농도는 [표 4]과 같다.
균주 L-발린 (g/L)
배치1 배치2 배치3 평균
대조군 KCCM11201P/pECCG117 2.7 2.9 2.9 2.8
1 KCCM11201P/CJ7-ilvE 3.1 3.2 3.4 3.2
2 KCCM11201P/SPL7-ilvE 3.9 4.0 3.8 3.9
표 4에 표시된 바와 같이, 기공지된 프로모터가 도입된 코리네박테리움 글루타미쿰 KCCM11201P/CJ7-ilvE 보다 본 출원의 프로모터가 도입된 KCCM11201P/SPL7-ilvE 균주의 발린 생산능이 21.8% 향상되었음을 확인하였다. 대조군인 KCCM11201P/pECCG117 보다는 39.2% 향상된 결과를 확인하였다. 상기 결과로부터 본 출원의 SPL7 프로모터가 ilvE 유전자의 발현을 강화하여, 해당 유전자가 코딩하는 효소 활성이 현저하게 증가하였음을 확인할 수 있다.
2-4. 라이신 생산능 평가
(1) SPL13 프로모터 서열을 포함하는 pDZTn - SPL13 - gapN1 벡터 및 형질전환 균주의 제작
L-아미노산의 대표적인 하나의 예로, L-라이신 생산능을 확인하기 위하여, 공지된 스트렙토코크스 뮤탄스(Streptococcus mutants)로부터 유래하는 NADP 의존적 글리세르알데하이드-3-포스페이트 디하이드로지나제(GapN) 효소 활성을 강화하기 위해서 다음과 같이 벡터를 제작하였다.
코리네박테리움속 미생물에서의 트랜스포존 유전자 NCgl2392에 삽입되어지도록, 미국 국립보건원의 유전자은행(NIH Genbank)을 근거로 하여, 야생형 코리네박테리움 글루타미쿰 ATCC13032의 염색체를 주형으로 하여 하기의 서열번호16 및 서열번호17, 서열번호18 및 서열번호19을 프라이머로 이용하여 PCR(94 ℃에서 30 초, 55 ℃에서 30 초, 72 ℃에서 1 분간의 반응을 30 회)을 수행한 결과, NCgl2392 유전자 5'말단과 3'말단이 각각 포함된 단편을 증폭하였다. pECCG122-Pcj7-gapN1 (대한민국 등록특허 제10-1182033) 벡터를 이용하여 하기의 서열번호20 및 21를 프라이머로 이용하여 PCR(94 ℃에서 30 초, 55 ℃에서 30 초, 72 ℃에서 2 분간의 반응을 30 회)을 수행한 결과, Pcj7-gapN1을 증폭하였고, pECCG122-Pcj7-gapN1 벡터와 실시예 1에서 제작한 SPL13-GFP 벡터를 이용하여 하기의 서열번호22 및 서열번호23, 서열번호24 및 서열번호21를 프라이머로 이용하여 PCR(94 ℃에서 30 초, 55 ℃에서 30 초, 72 ℃에서 1 분간의 반응을 30 회)을 수행한 결과, SPL13, gapN 유전자를 각각 증폭하였고, 이를 상기에 제작한 NCgl2392 유전자 단편과 함께 코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDZ 벡터(한국등록특허 제0924065호)에 클로닝하여 pDZTn-Pcj7-gapN1과 pDZTn-SPL13-gapN1 벡터를 제작 하였다.
서열번호 16 5' ATCCTCTAGAGTCGACCAAATGCTCCAACCGTCCGT 3'
서열번호 17 5' CTCGAGGAACTCATTCCTTCTGCTCG 3'
서열번호 18 5' TCTAGAACTAGTGGGCCCGACATCTAATAACCGGGCAG 3'
서열번호 19 5' ATGCCTGCAGGTCGACGCAGACGCACTCGACTACAC 3'
서열번호 20 5' GAATGAGTTCCTCGAGAGAAACATCCCAGCGCTACT 3'
서열번호 21 5' GCCCACTAGTTCTAGATTATTTGATATCAAATACGA 3'
서열번호 22 5' GAATGAGTTCCTCGAGGGCGCTTCATGTCAACAATC 3'
서열번호 23 5' ATTGTTTTGTCATATGTGTTTTGATCTCCTCCAATA 3'
서열번호 24 5' CATATGACAAAACAATATAAAAA 3'
라이신 생산능이 향상된 KCCM11016P (상기 미생물은 KFCC10881로 공개되었다가, 부다페스트 조약하인 국제기탁기관에 재 기탁되어 KCCM11016P로 기탁번호를 부여받음, 한국 등록특허 제10-0159812호) 균주를 모균주로 상기의 제작한 pDZTn-Pcj7-gapN1과 pDZTn-SPL13-gapN1 각각의 벡터를 전기펄스법(Appl. Microbiol.
Biothcenol.(1999) 52:541-545)으로 형질전환 후 카나마이신(kanamycin) 25mg/L를 함유한 선별배지에서 형질 전환균주를 획득하였다. 2차 재조합과정(crossover)으로 게놈상에 gapN1 유전자가 삽입된 콜로니를 선별하고자 서열번호 20 및 21 프라이머쌍, 서열번호 21 및 22의 프라이머 쌍을 사용하여 각각 Pcj7-gapN1과 SPL13-gapN1이 삽입된 균주를 획득하였다. 획득한 각각의 균주는 KCCM11016P/CJ7-gapN1과 KCCM11016P/SPL13-gapN1으로 명명하였다.
(2) 형질전환 균주의 라이신 생산능 평가
상기의 형질 전환된 3종 균주들의 L-라이신 생산능을 아래와 같은 방법으로 배양하여 분석하였다.
종 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 72시간 동안, 200 rpm에서 진탕 배양하였다. HPLC (SHIMADZU, LC-20AD)를 이용하여 L-라이신의 농도를 분석하였다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 배양 및 분석을 반복수행 하였으며, 분석된 L-라이신의 농도는 [표 5]과 같다.
균주 L-라이신(g/L)
배치1 배치2 배치3 평균
대조군 KCCM11016P 42.3 43.1 41.2 42.2
1 KCCM11016P/CJ7-gapN1 47.6 49.1 49.2 48.3
2 KCCM11016P/SPL13-gapN1 51.0 51.5 52.9 51.8
표 5에 표시된 바와 같이, 기공지된 프로모터가 도입된 코리네박테리움 글루타미쿰 KCCM11016P/CJ7-gapN1 보다 본 출원의 프로모터가 도입된 KCCM11016P/SPL13-gapN1 균주의 라이신 생산능이 7.2% 향상되었음을 확인하였다. 대조군인 KCCM11016P보다는 22.7% 향상된 결과를 확인하였다. 상기 결과로부터 본 출원의 SPL13 프로모터가 gapN1 유전자의 발현을 강화하여, 해당 유전자가 코딩하는 효소 활성이 현저하게 증가하였음을 확인할 수 있다.
상기 결과를 모두 종합하면, 본 출원의 SPL1, SPL7 및 SPL13 프로모터는 종래 공지된 프로모터에 비하여 재조합 미생물에서 목적 유전자의 발현을 현저하게 증가시킬 수 있으므로, 이를 이용하여 효과적인 발현 시스템을 제공할 수 있을 뿐만 아니라 목적산물, 예를 들어, 당류, 기능성 소재 및 아미노산을 고수율로 생산하고자 하는 다양한 산업 분야에 유용하게 사용될 수 있다.
Figure PCTKR2017002964-appb-I000001
Figure PCTKR2017002964-appb-I000002
Figure PCTKR2017002964-appb-I000003
Figure PCTKR2017002964-appb-I000004
Figure PCTKR2017002964-appb-I000005
Figure PCTKR2017002964-appb-I000006

Claims (7)

  1. 서열번호 1 내지 3으로 이루어진 군에서 선택된 어느 하나의 뉴클레오티드 서열로 이루어진, 프로모터 활성을 갖는 핵산 분자.
  2. 제1항의 핵산 분자 및 목적 유전자를 포함하는, 유전자 발현 카세트.
  3. 제1항의 핵산 분자 또는 제2항의 유전자 발현 카세트를 포함하는, 재조합 벡터.
  4. 제1항의 핵산 분자 또는 제3항의 벡터를 포함하는, 코리네박테리움 속 재조합 미생물.
  5. 제4항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰 또는 코리네박테리움 암모니아게네스인, 재조합 미생물.
  6. (a) 제4항의 재조합 미생물을 배지에서 배양하는 단계; 및
    (b) 상기 미생물 또는 상기 미생물을 배양한 배지로부터 목적 물질을 회수하는 단계를 포함하는, 목적 물질을 생산하는 방법.
  7. 제6항에 있어서, 상기 목적 물질은 사이코스, 타가토스 또는 아미노산인 방법.
PCT/KR2017/002964 2016-08-31 2017-03-20 신규 프로모터 및 이의 용도 WO2018043856A1 (ko)

Priority Applications (11)

Application Number Priority Date Filing Date Title
DK17846781.7T DK3508580T3 (da) 2016-08-31 2017-03-20 Ny promotor og anvendelse deraf
CN201910568670.6A CN110283823B (zh) 2016-08-31 2017-03-20 新型启动子及其应用
ES17846781T ES2907694T3 (es) 2016-08-31 2017-03-20 Nuevo promotor y uso del mismo
EP17846781.7A EP3508580B1 (en) 2016-08-31 2017-03-20 Novel promoter and use thereof
PL17846781T PL3508580T3 (pl) 2016-08-31 2017-03-20 Nowy promotor i jego zastosowanie
RU2019105322A RU2733425C1 (ru) 2016-08-31 2017-03-20 Новый промотор и его применение
US16/327,581 US10584338B2 (en) 2016-08-31 2017-03-20 Promoter and use thereof
JP2019510874A JP6679803B2 (ja) 2016-08-31 2017-03-20 新規プロモーター及びその用途
BR112019004161-3A BR112019004161B1 (pt) 2016-08-31 2017-03-20 Molécula de ácido nucleico que possui uma atividade promotora, cassete de expressão gênica, vetor recombinante, micro-organismo recombinante do gênero corynebacterium e método de produzir um produto-alvo
MYPI2019000906A MY186296A (en) 2016-08-31 2017-03-20 Novel promoter and use thereof
CN201780000208.5A CN108026539B (zh) 2016-08-31 2017-03-20 新型启动子及其应用

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20160111810 2016-08-31
KR10-2016-0111810 2016-08-31

Publications (1)

Publication Number Publication Date
WO2018043856A1 true WO2018043856A1 (ko) 2018-03-08

Family

ID=60035461

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/002964 WO2018043856A1 (ko) 2016-08-31 2017-03-20 신규 프로모터 및 이의 용도

Country Status (13)

Country Link
US (1) US10584338B2 (ko)
EP (1) EP3508580B1 (ko)
JP (1) JP6679803B2 (ko)
KR (1) KR101783170B1 (ko)
CN (4) CN110283823B (ko)
BR (1) BR112019004161B1 (ko)
DK (1) DK3508580T3 (ko)
ES (1) ES2907694T3 (ko)
HU (1) HUE057965T2 (ko)
MY (1) MY186296A (ko)
PL (1) PL3508580T3 (ko)
RU (1) RU2733425C1 (ko)
WO (1) WO2018043856A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111670252A (zh) * 2018-03-20 2020-09-15 Cj第一制糖株式会社 新型启动子及其应用
RU2787592C1 (ru) * 2021-05-07 2023-01-11 СиДжей ЧеилДжеданг Корпорейшн Новый промотор и его применение

Families Citing this family (104)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102003911B1 (ko) 2018-02-23 2019-07-25 씨제이제일제당 주식회사 마이코스포린 유사 아미노산을 생산하는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산방법
KR102035844B1 (ko) * 2018-02-23 2019-10-23 씨제이제일제당 주식회사 L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
KR101968317B1 (ko) 2018-02-23 2019-04-11 씨제이제일제당 주식회사 신규 l-트립토판 배출 단백질 및 이를 이용한 l-트립토판을 생산하는 방법
KR101947959B1 (ko) 2018-05-28 2019-02-13 씨제이제일제당 (주) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
CN109097361B (zh) * 2018-08-28 2020-02-14 江南大学 启动子、其载体及其应用
KR102112240B1 (ko) 2018-09-28 2020-05-18 씨제이제일제당 주식회사 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법
KR101996769B1 (ko) 2018-12-21 2019-10-01 씨제이제일제당 (주) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
KR102204917B1 (ko) 2019-04-22 2021-01-20 씨제이제일제당 주식회사 L-히스티딘 생산능이 강화된 미생물 및 이를 이용한 히스티딘 생산방법
KR102221040B1 (ko) 2019-05-09 2021-03-03 씨제이제일제당 주식회사 L-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산을 생산하는 방법
KR102472559B1 (ko) 2019-06-28 2022-12-01 씨제이제일제당 주식회사 황 함유 아미노산 또는 그 유도체의 제조방법
KR102472558B1 (ko) 2019-06-28 2022-12-01 씨제이제일제당 주식회사 황 함유 아미노산 또는 그 유도체 제조방법
KR102153534B1 (ko) * 2019-09-02 2020-09-09 씨제이제일제당 주식회사 신규한 프로모터 및 이를 이용한 아미노산 생산 방법
KR102183209B1 (ko) 2019-09-09 2020-11-26 씨제이제일제당 주식회사 L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법
KR102377500B1 (ko) 2019-10-28 2022-03-23 씨제이제일제당 주식회사 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법
KR102147381B1 (ko) 2019-11-22 2020-08-24 씨제이제일제당 주식회사 아세토하이드록시산 신타제 신규 변이체 및 이를 포함하는 미생물
KR102316445B1 (ko) 2019-11-29 2021-10-26 씨제이제일제당 주식회사 신규 세린 프로테아제 변이체
KR102143964B1 (ko) 2019-12-06 2020-08-12 씨제이제일제당 주식회사 신규한 분지쇄 아미노산 아미노트랜스퍼라제 변이체 및 이를 이용한 류신 생산방법
KR102182497B1 (ko) 2019-12-20 2020-11-24 씨제이제일제당 주식회사 내막 단백질의 변이체 및 이를 이용한 목적 산물 생산 방법
KR102399441B1 (ko) 2020-01-20 2022-05-18 씨제이제일제당 주식회사 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조 방법
KR102207867B1 (ko) * 2020-01-21 2021-01-26 씨제이제일제당 주식회사 Nadp 의존적 글리세르알데하이드-3-포스페이트 디하이드로지나제를 포함하는 미생물을 이용하여 ｌ-아미노산을 생산하는 방법
KR102198072B1 (ko) 2020-03-04 2021-01-04 씨제이제일제당 주식회사 글루타민 신테타아제 변이형 폴리펩티드 및 이를 이용한 l-글루타민 생산 방법
KR102311391B1 (ko) * 2020-05-21 2021-10-12 씨제이제일제당 주식회사 L- 분지쇄 아미노산 생산능이 강화된 미생물 및 이를 이용하여 l-분지쇄 아미노산을 생산하는 방법
KR102647745B1 (ko) 2020-05-27 2024-03-14 씨제이제일제당 주식회사 신규 l-타이로신 배출 단백질 변이체 및 이를 이용한 l-타이로신을 생산하는 방법
KR102246288B1 (ko) 2020-08-13 2021-04-29 씨제이제일제당 주식회사 퓨트레신 생산 미생물 및 이를 이용한 퓨트레신 생산방법
KR102344689B1 (ko) 2020-09-01 2021-12-29 씨제이제일제당 주식회사 L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
JP2023540315A (ja) 2020-09-09 2023-09-22 シージェイ チェイルジェダン コーポレーション Ｌ－グルタミン酸生産組換え微生物及びそれを用いたｌ－グルタミン酸製造方法
KR102414743B1 (ko) 2020-09-09 2022-06-29 씨제이제일제당 주식회사 신규 o-포스포세린 배출 단백질 및 이를 이용한 o-포스포세린, 시스테인 및 이의 유도체의 생산 방법
JP2023550131A (ja) 2020-11-20 2023-11-30 シージェイ チェイルジェダン コーポレーション Ｌ－グルタミン生産能が向上した微生物及びそれを用いたｌ－グルタミン生産方法
KR102464883B1 (ko) 2020-12-11 2022-11-09 씨제이제일제당 주식회사 신규한 감마-아미노부티르산 퍼미에이즈 변이체 및 이를 이용한 이소류신 생산 방법
KR102470602B1 (ko) 2020-12-11 2022-11-25 씨제이제일제당 주식회사 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법
KR102257841B1 (ko) 2021-01-15 2021-05-28 씨제이제일제당 주식회사 신규한 피토엔 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
KR102259337B1 (ko) 2021-01-15 2021-06-01 씨제이제일제당 주식회사 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
KR102254631B1 (ko) 2021-01-15 2021-05-21 씨제이제일제당 주식회사 신규한 펩타이드 메티오닌 설폭사이드 환원효소 변이체 및 이를 이용한 imp 생산 방법
KR102254209B1 (ko) 2021-01-15 2021-05-18 씨제이제일제당 (주) 신규한 dna 중합효소 ⅲ 감마 및 타우 서브유닛 변이체 및 이를 이용한 l-라이신 생산 방법
KR102261851B1 (ko) 2021-01-15 2021-06-04 씨제이제일제당 (주) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
KR102287112B1 (ko) 2021-01-25 2021-08-06 씨제이제일제당 주식회사 신규한 쿠퍼익스포팅 P-type 에이티피에이즈 A 변이체 및 이를 이용한 L-트립토판 생산 방법
KR102284727B1 (ko) 2021-01-25 2021-08-02 씨제이제일제당 주식회사 신규한 단백질 HtrL 변이체 및 이를 이용한 L-트립토판 생산 방법
KR102284726B1 (ko) 2021-01-25 2021-08-02 씨제이제일제당 주식회사 신규한 타우토머레이즈 pptA 변이체 및 이를 이용한 L-트립토판 생산 방법
KR102287111B1 (ko) 2021-01-25 2021-08-06 씨제이제일제당 주식회사 신규한 데옥시구아노신트리포스페이트 트리포스포하이드로레이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
KR102287113B1 (ko) 2021-01-25 2021-08-06 씨제이제일제당 주식회사 신규한 하이드로레이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
KR102284725B1 (ko) 2021-01-25 2021-08-02 씨제이제일제당 주식회사 신규한 페로체라테이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
KR102287114B1 (ko) 2021-01-25 2021-08-06 씨제이제일제당 주식회사 신규한 사이토신 퍼미에이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
KR102284728B1 (ko) 2021-01-25 2021-08-02 씨제이제일제당 주식회사 신규한 H(+)/Cl(-) 익스체인지 트랜스포터 변이체 및 이를 이용한 L-트립토판 생산 방법
KR102281365B1 (ko) 2021-01-26 2021-07-22 씨제이제일제당 (주) 신규한 프롤린 탈수소효소 변이체 및 이를 이용한 l-발린 생산 방법
KR102281367B1 (ko) 2021-01-26 2021-07-22 씨제이제일제당 (주) 신규한 5,10-메틸렌테트라하이드로폴레이트 리덕타제 변이체 및 이를 이용한 l-발린 생산 방법
KR102281359B1 (ko) 2021-01-26 2021-07-22 씨제이제일제당 (주) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
KR102281361B1 (ko) 2021-01-26 2021-07-22 씨제이제일제당 (주) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
KR102281362B1 (ko) 2021-01-26 2021-07-22 씨제이제일제당 (주) 신규한 스퍼미딘 신타제 변이체 및 이를 이용한 l-발린 생산 방법
KR102281360B1 (ko) 2021-01-26 2021-07-22 씨제이제일제당 (주) 신규한 atp 포스포리보실트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
KR102281364B1 (ko) 2021-01-26 2021-07-22 씨제이제일제당 (주) 신규한 우레아제 부속 단백질 변이체 및 이를 이용한 l-발린 생산 방법
KR102495918B1 (ko) 2021-01-26 2023-02-06 씨제이제일제당 주식회사 aroG 알돌라아제 (Phospho-2-dehydro-3-deoxyheptonate aldolase) 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
KR102281366B1 (ko) 2021-01-26 2021-07-22 씨제이제일제당 (주) 신규한 테트라하이드로디피콜리네이트 n-숙시닐트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
KR102281363B1 (ko) 2021-01-26 2021-07-22 씨제이제일제당 (주) 신규한 시스테인 설피네이트 디설피나제 변이체 및 이를 이용한 l-발린 생산 방법
KR102277403B1 (ko) 2021-01-27 2021-07-14 씨제이제일제당 주식회사 신규한 리보뉴클레아제 p 변이체 및 이를 이용한 l-글루탐산 생산 방법
KR102277404B1 (ko) 2021-01-27 2021-07-14 씨제이제일제당 주식회사 신규한 갈락토사이드 o-아세틸트랜스퍼라제 변이체 및 이를 이용한 l-글루탐산 생산 방법
KR102254635B1 (ko) 2021-01-27 2021-05-21 씨제이제일제당 주식회사 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
KR102281368B1 (ko) 2021-01-28 2021-07-23 씨제이제일제당 (주) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
KR102258159B1 (ko) 2021-01-29 2021-05-27 씨제이제일제당 (주) 신규한 말레이트 디하이드로게나제 변이체 및 이를 이용한 l-라이신 생산 방법
KR102344057B1 (ko) 2021-01-29 2021-12-27 씨제이제일제당 (주) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
KR102284729B1 (ko) 2021-01-29 2021-08-02 씨제이제일제당 주식회사 신규한 시아네이트 트랜스포터 패밀리 단백질변이체 및 이를 이용한 l-트립토판 생산 방법
KR102291553B1 (ko) 2021-01-29 2021-08-18 씨제이제일제당 (주) 신규한 프리모솜 조립 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
KR102277034B1 (ko) 2021-01-29 2021-07-13 씨제이제일제당 (주) 신규한 dahp 신타아제 변이체 및 이를 이용한 l-라이신 생산 방법
KR102527096B1 (ko) 2021-02-01 2023-04-28 씨제이제일제당 주식회사 프리페네이트 탈수 효소 (Prephenate dehydratase) 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
KR102527102B1 (ko) 2021-03-05 2023-04-28 씨제이제일제당 주식회사 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
KR102649245B1 (ko) 2021-03-08 2024-03-21 씨제이제일제당 주식회사 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법
KR102525074B1 (ko) 2021-03-10 2023-04-24 씨제이제일제당 주식회사 신규한 시트레이트 신타아제 변이체 및 이를 이용한 o-아세틸-l-호모세린 또는 l-메티오닌 생산 방법
KR102613549B1 (ko) 2021-03-12 2023-12-13 씨제이제일제당 주식회사 신규 세린 프로테아제 변이체
KR102306007B1 (ko) 2021-04-07 2021-09-27 씨제이제일제당 (주) 신규한 슈가 포터 계열 mfs 트랜스포터 변이체 및 이를 이용한 l-발린 생산 방법
KR20220139085A (ko) 2021-04-07 2022-10-14 씨제이제일제당 (주) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
KR102281369B1 (ko) 2021-04-07 2021-07-22 씨제이제일제당 (주) 신규한 디히드로리포일 아세틸기전이효소 변이체 및 이를 이용한 l-발린 생산 방법
KR102306010B1 (ko) 2021-04-07 2021-09-27 씨제이제일제당 (주) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
KR102306009B1 (ko) 2021-04-07 2021-09-27 씨제이제일제당 (주) 신규한 WhiB 계열 전사 조절자 WhcA 변이체 및 이를 이용한 L-발린 생산 방법
KR102281370B1 (ko) 2021-04-07 2021-07-22 씨제이제일제당 (주) 신규한 2-이소프로필말레이트합성효소 변이체 및 이를 이용한 l-발린 생산 방법
KR102281371B1 (ko) 2021-04-07 2021-07-22 씨제이제일제당 (주) 신규한 글리세르알데히드-3-인산탈수소효소 변이체 및 이를 이용한 l-발린 생산 방법
KR102306008B1 (ko) 2021-04-07 2021-09-27 씨제이제일제당 (주) 신규한 전사 조절자 변이체 및 이를 이용한 l-발린 생산 방법
KR102314885B1 (ko) 2021-04-12 2021-10-18 씨제이제일제당 (주) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
KR102314884B1 (ko) 2021-04-12 2021-10-18 씨제이제일제당 (주) 신규한 세포분해 막단백질 변이체 및 이를 이용한 l-라이신 생산 방법
KR102338875B1 (ko) 2021-04-12 2021-12-10 씨제이제일제당 (주) 신규한 당 인산염 이성질화효소/에피머레이즈 변이체 및 이를 이용한 l-라이신 생산 방법
KR102303747B1 (ko) 2021-04-12 2021-09-16 씨제이제일제당 (주) 신규한 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체 및 이를 이용한 l-라이신 생산 방법
KR102273639B1 (ko) 2021-04-20 2021-07-06 씨제이제일제당 주식회사 신규한 이중기능성 메틸렌테트라히드로폴레이트 탈수소효소/메테닐테트라하이드로폴레이트 사이클로하이드롤라아제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
KR102284731B1 (ko) 2021-04-28 2021-08-02 씨제이제일제당 주식회사 신규한 아이소시트르산 디하이드로게네이즈 키나아제/포스파타제 효소 변이체 및 이를 이용한 l-트립토판 생산 방법
KR102284730B1 (ko) 2021-04-28 2021-08-02 씨제이제일제당 주식회사 신규한 수용성 피리딘 뉴클레오티드 트랜스수소효소 변이체 및 이를 이용한 l-트립토판 생산 방법
KR102279137B1 (ko) 2021-04-29 2021-07-19 씨제이제일제당 주식회사 신규한 아데닌 포스포리보실기 전이효소 변이체 및 이를 이용한 imp 생산 방법
KR102277410B1 (ko) 2021-04-29 2021-07-14 씨제이제일제당 주식회사 신규한 이중기능성 pyr 오페론 전사조절자/우라실 포스포리보실 전달 효소 변이체 및 이를 이용한 IMP 생산 방법
CN113994002B (zh) * 2021-05-07 2022-06-03 Cj第一制糖株式会社 新型启动子及其用途
KR20220157144A (ko) 2021-05-20 2022-11-29 씨제이제일제당 (주) 신규 프로모터 및 이의 용도
KR102634303B1 (ko) 2021-05-21 2024-02-06 씨제이제일제당 주식회사 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
KR20220168151A (ko) 2021-06-14 2022-12-22 연세대학교 산학협력단 활성이 증가된 변이체 선별을 위한 방법
KR20220163754A (ko) 2021-06-03 2022-12-12 씨제이제일제당 (주) 신규한 YhhS 변이체 및 이를 이용한 O-포스포세린, 시스테인 및 이의 유도체의 생산방법
KR102600520B1 (ko) 2021-06-09 2023-11-09 씨제이제일제당 주식회사 제라닐제라닐 피로포스페이트 신타아제 변이체 및 이를 이용한 테트라테르펜, 이의 전구체, 및 테트라테르펜을 전구체로 하는 물질의 생산방법
KR20220166947A (ko) 2021-06-11 2022-12-20 씨제이제일제당 (주) 신규한 MdtH 변이체 및 이를 이용한 O-포스포세린, 시스테인 및 이의 유도체의 생산방법
EP4349994A1 (en) 2021-06-25 2024-04-10 CJ Cheiljedang Corporation Novel method for producing poly-4-hydroxybutyrate and 1,4-butanediol
KR102665227B1 (ko) 2021-06-30 2024-05-10 씨제이제일제당 주식회사 고농도 l-글루탐산을 생산하기 위한 균주 및 이를 이용한 l-글루탐산 생산방법
KR102611977B1 (ko) 2021-07-15 2023-12-08 씨제이제일제당 주식회사 신규한 베타-카로틴 15,15 -옥시게네이즈 변이체 및 이를 이용한 레티노이드 생산방법
KR20230016505A (ko) 2021-07-26 2023-02-02 씨제이제일제당 (주) LacI 계열 DNA 결합 전사 조절자의 활성이 약화된 미생물 및 이를 이용한 L-글루탐산의 생산방법
KR102619598B1 (ko) 2021-08-23 2023-12-29 씨제이제일제당 주식회사 신규한 아세토하이드록시산 신타아제 소단위체 변이체 및 이를 이용한 l-발린 생산 방법
KR20230031624A (ko) 2021-08-27 2023-03-07 씨제이제일제당 (주) 신규한 초산 대사 조절자 a 변이체 및 이를 이용한 l-분지쇄 아미노산 생산 방법
KR102419166B1 (ko) 2021-09-23 2022-07-08 씨제이제일제당 주식회사 신규한 글루타민 가수분해 gmp 합성효소 변이체 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
KR20230042953A (ko) 2021-09-23 2023-03-30 씨제이제일제당 (주) 고농도 l-글루탐산을 생산하기 위한 균주 및 이를 이용한 l-글루탐산 생산방법
WO2023054881A1 (ko) 2021-09-29 2023-04-06 씨제이제일제당 (주) 신규한 아세토하이드록시산 신테아제 변이체 및 이를 이용한 l-이소류신 생산방법
KR20230045990A (ko) 2021-09-29 2023-04-05 씨제이제일제당 (주) 신규한 아세토하이드록시산 신테아제 변이체 및 이를 이용한 l-이소류신 생산방법
KR20230054183A (ko) 2021-10-15 2023-04-24 씨제이제일제당 (주) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
KR20230059451A (ko) 2021-10-26 2023-05-03 씨제이제일제당 (주) LysE 변이체 및 이를 이용한 L-아르기닌 생산방법
EP4257689A1 (en) * 2021-12-29 2023-10-11 Daesang Corporation Novel promoter variant for constitutive expression and use thereof

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR920007401B1 (ko) 1990-06-21 1992-08-31 제일제당 주식회사 다발성 절단부위를 지닌 대장균과 코리네형 세균에서 발현 가능한 신규 셔틀벡터
KR0159812B1 (ko) 1995-12-20 1998-11-16 손경식 코리네박테리움 글루타미컴 씨에이치 77 및 이 균주를 이용한 l-라이신의 제조 방법
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
KR20110101010A (ko) * 2010-03-05 2011-09-15 씨제이제일제당 (주) 개량된 프로모터 및 이를 이용한 ｌ-라이신의 생산 방법
KR101117022B1 (ko) 2011-08-16 2012-03-16 씨제이제일제당 (주) Ｌ-발린 생산능이 향상된 미생물 및 이를 이용한 ｌ-발린 제조방법
KR101182033B1 (ko) 2009-07-08 2012-09-11 씨제이제일제당 (주) 외래종 유래의 글리세르알데하이드-3-포스페이트 디하이드로지나제의 활성을 획득한 코리네박테리움 속의 ｌ-라이신 생산방법
KR20140066553A (ko) * 2012-11-23 2014-06-02 삼성전자주식회사 코리네박테리움 속 균주의 신규 프로모터
KR20150001341A (ko) * 2013-06-27 2015-01-06 백광산업 주식회사 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
KR101481142B1 (ko) * 2013-03-04 2015-01-15 한국과학기술원 코리네박테리아 발현용 합성프로모터
KR101550796B1 (ko) 2013-06-05 2015-09-07 씨제이제일제당 (주) 타가토스의 제조방법
KR101632642B1 (ko) 2015-01-29 2016-06-22 씨제이제일제당 주식회사 신규한 프로모터 및 그의 용도

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19548222A1 (de) * 1995-12-22 1997-06-26 Forschungszentrum Juelich Gmbh Verfahren zur mikrobiellen Herstellung von Aminosäuren durch gesteigerte Aktivität von Exportcarriern
KR100930203B1 (ko) * 2008-01-28 2009-12-07 씨제이제일제당 (주) 개량된 프로모터 및 이를 이용한 ｌ-라이신의 생산 방법
KR100987281B1 (ko) * 2008-01-31 2010-10-12 씨제이제일제당 (주) 개량된 프로모터 및 이를 이용한 ｌ-라이신의 생산 방법
CN101698844B (zh) * 2009-06-29 2012-01-04 中国科学院微生物研究所 一种来源于谷氨酸棒杆菌的启动子及其应用
KR101335853B1 (ko) * 2011-12-01 2013-12-02 씨제이제일제당 (주) Ｌ-아미노산 및 리보플라빈을 동시에 생산하는 미생물 및 이를 이용한 ｌ-아미노산 및 리보플라빈을 생산하는 방법
KR20140140215A (ko) * 2013-05-28 2014-12-09 경상대학교산학협력단 사이코스 3-에피머라제 효소를 코딩하는 폴리뉴클레오티드를 포함하는 코리네박테리움 및 이를 이용한 사이코스의 생산 방법
CN107109443B (zh) * 2014-11-06 2021-11-02 庆尚大学校产学协力团 阿洛酮糖的制备方法
CN104611249B (zh) * 2014-11-17 2019-06-11 中国科学院天津工业生物技术研究所 一种利用醛缩酶全细胞合成d-阿洛酮糖的方法

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR920007401B1 (ko) 1990-06-21 1992-08-31 제일제당 주식회사 다발성 절단부위를 지닌 대장균과 코리네형 세균에서 발현 가능한 신규 셔틀벡터
KR0159812B1 (ko) 1995-12-20 1998-11-16 손경식 코리네박테리움 글루타미컴 씨에이치 77 및 이 균주를 이용한 l-라이신의 제조 방법
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
KR101182033B1 (ko) 2009-07-08 2012-09-11 씨제이제일제당 (주) 외래종 유래의 글리세르알데하이드-3-포스페이트 디하이드로지나제의 활성을 획득한 코리네박테리움 속의 ｌ-라이신 생산방법
KR20110101010A (ko) * 2010-03-05 2011-09-15 씨제이제일제당 (주) 개량된 프로모터 및 이를 이용한 ｌ-라이신의 생산 방법
KR101117022B1 (ko) 2011-08-16 2012-03-16 씨제이제일제당 (주) Ｌ-발린 생산능이 향상된 미생물 및 이를 이용한 ｌ-발린 제조방법
KR20140066553A (ko) * 2012-11-23 2014-06-02 삼성전자주식회사 코리네박테리움 속 균주의 신규 프로모터
KR101481142B1 (ko) * 2013-03-04 2015-01-15 한국과학기술원 코리네박테리아 발현용 합성프로모터
KR101550796B1 (ko) 2013-06-05 2015-09-07 씨제이제일제당 (주) 타가토스의 제조방법
KR20150001341A (ko) * 2013-06-27 2015-01-06 백광산업 주식회사 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
KR101632642B1 (ko) 2015-01-29 2016-06-22 씨제이제일제당 주식회사 신규한 프로모터 및 그의 용도

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
"Current Protocols in Molecular Biology", JOHN WILEY & SONS, INC.
"Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
APPL. MICROBIOL. BIOTECHNOL., vol. 52, 1999, pages 541 - 545
BIOTECHNOL. LETT., vol. 25, 2003, pages 1311 - 1316
BIOTECHNOLOGY LETTERS, vol. 13, no. 10, 1991, pages 721 - 726
DATABASE NUCLEOTIDE 30 January 2014 (2014-01-30), BAUMGART M. ET AL.: "Corynebacterium glutamicum MB001, complete genome", XP055588897, retrieved from NCBI Database accession no. CP005959.1 *
GENE, vol. 102, 1991, pages 93 - 98
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
JAMES M. LEE: "Biochemical Engineering", PRENTICE-HALL INTERNATIONAL, pages: 138 - 176
LAURE GORY ET AL., FEMS MICROBIOLOGY LETTERS, vol. 194, 2001, pages 127 - 133
MICROBIOLOGY, vol. 142, 1996, pages 1297 - 1309
SAMBROOK ET AL.: "Molecular Cloning, a Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORIES
See also references of EP3508580A4

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111670252A (zh) * 2018-03-20 2020-09-15 Cj第一制糖株式会社 新型启动子及其应用
EP3722428A4 (en) * 2018-03-20 2021-03-31 CJ Cheiljedang Corporation NOVEL PROMOTER AND USE OF IT
US11603534B2 (en) 2018-03-20 2023-03-14 Cj Cheiljedang Corporation Promoter and use thereof
CN111670252B (zh) * 2018-03-20 2023-12-12 Cj第一制糖株式会社 新型启动子及其应用
RU2787592C1 (ru) * 2021-05-07 2023-01-11 СиДжей ЧеилДжеданг Корпорейшн Новый промотор и его применение
RU2787780C1 (ru) * 2021-05-07 2023-01-12 СиДжей ЧеилДжеданг Корпорейшн Новый промотор и его применение

Also Published As

Publication number Publication date
EP3508580A4 (en) 2020-03-18
JP2019528075A (ja) 2019-10-10
CN110283823A (zh) 2019-09-27
CN108559746B (zh) 2021-09-03
EP3508580B1 (en) 2022-01-12
EP3508580A1 (en) 2019-07-10
US20190185857A1 (en) 2019-06-20
CN108026539A (zh) 2018-05-11
RU2733425C1 (ru) 2020-10-01
CN110283823B (zh) 2023-05-12
KR101783170B1 (ko) 2017-09-29
JP6679803B2 (ja) 2020-04-15
CN108559747A (zh) 2018-09-21
HUE057965T2 (hu) 2022-06-28
PL3508580T3 (pl) 2022-04-25
ES2907694T3 (es) 2022-04-26
US10584338B2 (en) 2020-03-10
CN108559747B (zh) 2021-08-31
BR112019004161A2 (pt) 2019-09-03
DK3508580T3 (da) 2022-03-07
BR112019004161B1 (pt) 2021-07-27
CN108026539B (zh) 2019-06-07
MY186296A (en) 2021-07-06
CN108559746A (zh) 2018-09-21

Similar Documents

Publication Publication Date Title
WO2018043856A1 (ko) 신규 프로모터 및 이의 용도
WO2021162459A1 (ko) 변이형 LysE를 포함하는 미생물, 및 이를 이용한 L-아미노산 생산 방법
KR101632642B1 (ko) 신규한 프로모터 및 그의 용도
WO2019160301A1 (ko) 시트레이트 신타아제의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 l-아미노산 생산방법
CN108884449B (zh) 新型异丙基苹果酸合酶变异体及使用其生产l-亮氨酸的方法
KR100789270B1 (ko) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및그를 이용하여 ｌ-라이신을 생산하는 방법
WO2016021932A1 (ko) 피드백 저항성 아세토하이드록시산 신타아제 변이체 및 이를 이용한 l-발린의 생산방법
WO2020122505A1 (ko) L-글루탐산 생산능이 향상된 변이 균주 및 이를 이용한 l-글루탐산의 제조 방법
WO2014142463A1 (ko) L-발린 생산능이 향상된 균주 및 이를 이용한 l-발린 생산방법
WO2019117398A1 (ko) 5&#39;-이노신산을 생산하는 미생물 및 이를 이용한 5&#39;-이노신산의 생산 방법
WO2020022547A1 (ko) 신규 5&#39;-이노신산 디하이드로게나아제 및 이를 이용한 5&#39;-이노신산 제조방법
WO2015064917A1 (ko) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신 생산방법
WO2017034165A1 (ko) L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
WO2017007159A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2017034164A1 (ko) L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
WO2018093033A1 (ko) L-라이신을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신의 생산방법
WO2020067618A1 (ko) 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법
WO2021125494A1 (ko) 다중약물 유출펌프 변이체, 상기 변이체를 코딩하는 폴리뉴클레오티드, 상기 변이체를 포함하는 미생물, 및 이를 이용하여 비올라세인 또는 디옥시비올라세인을 제조하는 방법
WO2022225320A1 (ko) 신규한 포스포글리세린산 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022149865A2 (ko) GlxR 단백질 변이체 또는 이를 이용한 쓰레오닌 생산방법
WO2016159536A1 (ko) 신규 프로모터 및 이의 용도
WO2024019216A1 (ko) L-아르기닌 또는 l-시트룰린 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 또는 l-시트룰린의 생산 방법
WO2021133030A1 (ko) 사이토크롬 c 활성이 강화된 l-아미노산 생산 미생물 및 이를 이용한 l-아미노산 생산방법
WO2023063547A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR102360900B1 (ko) 신규한 폴리펩티드 및 이를 이용한 l-류신의 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17846781

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2019510874

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019004161

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2017846781

Country of ref document: EP

Effective date: 20190401

ENP Entry into the national phase

Ref document number: 112019004161

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190228