WO2000037504A2 - Human monoclonal antibodies to ctla-4 - Google Patents
Human monoclonal antibodies to ctla-4 Download PDFInfo
- Publication number
- WO2000037504A2 WO2000037504A2 PCT/US1999/030895 US9930895W WO0037504A2 WO 2000037504 A2 WO2000037504 A2 WO 2000037504A2 US 9930895 W US9930895 W US 9930895W WO 0037504 A2 WO0037504 A2 WO 0037504A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- ctla
- seq
- assay
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2818—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
Definitions
- CDR-4 cytotoxic T-lymphocyte antigen 4
- Nucleotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly contiguous heavy and light chain sequences spanning the complementarity determining regions (CDRs), specifically from within FRl and/or CDRl through CDR3 and/or within FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein.
- T cells and B cells have been extensively studied and characterized in connection with the regulation of immune response. From these studies, the role of T cells appear, in many cases, to be particularly important in disease prevention and treatment. T cells possess very complex systems for controlling their interactions. Interactions between T cells utilize numerous receptors and soluble factors for the process. Thus, what effect any particular signal may have on the immune response generally varies and depends on the particular factors, receptors and counter-receptors that are involved in the pathway. The pathways for down- regulating responses are as important as those required for activation.
- Thymic education leading to T-cell tolerance is one mechanism for preventing an immune response to a particular antigen.
- Other mechanisms, such as secretion of suppressive cytokines, are also known.
- Activation of T cells requires not only stimulation through the antigen receptor (T cell receptor (TCR)), but additional signaling through co- stimulatory surface molecules such as CD28.
- TCR antigen receptor
- the ligands for CD28 are the B7- 1 (CD80) and B7-2 (CD86) proteins, which are expressed on antigen-presenting cells such as dendritic cells, activated B-cells or monocytes that interact with T- cell CD28 or CTLA-4 to deliver a costimulatory signal.
- EAE allergic encephalomyelitis
- B7 and CD28 are co-stimulatory signaling pathways that appear to be sufficient to trigger the maturation and proliferation of antigen specific T-cells.
- a variety of viruses and tumors may block T cell activation and proliferation, leading to insufficient activity or non-reactivity of the host's immune system to the infected or transformed cells.
- anergy may be at least partly responsible for the failure of the host to clear the pathogenic or tumorgenic cells.
- T-cells required two types of signals from the antigen presenting cell (APC) for activation and subsequent differentiation to effector function.
- APC antigen presenting cell
- B7- 1 CD80
- B7-2 B7-2
- CTLA-4 Human CTLA-4 was identified and cloned shortly thereafter by Dariavach et al. Eur. J. Immunol 18:1901-1905 (1988). The murine and human CTLA-4 molecules possess approximately 76% overall sequence homology and approach complete sequence identity in their cytoplasmic domains (Dariavach et al. Eur. J. Immunol. 18:1901-1905 (1988)). CTLA-4 is a member of the immunoglobulin (lg) superfamily of proteins.
- the lg superfamily is a group of proteins that share key structural features of either a variable (V) or constant (C) domain of lg molecules.
- Members of the lg superfamily include, but are not limited to, the immunoglobulins themselves, major histocompatibihty complex (MHC) class molecules (i.e., MHC class I and II), and TCR molecules.
- MHC major histocompatibihty complex
- CTLA-4 was a second receptor for B7.
- the blast cells also infiltrated liver, heart, lung, and pancreas tissue, and amounts of serum immunoglobulin were elevated and their T cells proliferated spontaneously and strongly when stimulated through the T cell receptor, however, they were sensitive to cell death induced by cross-linking of the Fas receptor and by gamma irradiation.
- CTLA-4 acts as a negative regulator of T cell activation and is vital for the control of lymphocyte homeostasis.
- Allison and Krummel Science 270:932-933 (1995) discussed the work of Waterhouse et al. as demonstrative that CTLA-4 acts to down regulate T-cell responsiveness or has an inhibitory signaling role in T-cell activation and development.
- CTLA-4 regulates the intensity of the autoimmune response in EAE, attenuating inflammatory cytokine production and clinical disease manifestations. See also Hurwitz et al. J Neuroimmunol 73:57-62 (1997) and Cepero et al. J Exp Med 188:199-204 (1998) (an anti-CTLA-4 hairpin ribozyme that specifically abrogates CTLA-4 expression after gene transfer into a murine T-cell model).
- T cells exposed to tolerogenic antigen in the presence of both IL-12 and anti-CTLA-4 antibody were not anergized, and behaved identically to T cells which have encountered immunogenic antigen.
- CTLA-4 engagement which leads to a block in the ability of T cells to proliferate
- IL-12 which prevents the differentiation of T cells into Thl effector cells.
- the combination of IL-12 and anti-CTLA-4 antibody was sufficient to convert a normally tolerogenic stimulus to an immunogenic one.
- Kwon et al. PNAS USA 94:8099-103 (1997) established a syngeneic murine prostate cancer model and examined two distinct manipulations intended to elicit an antiprostate cancer response through enhanced T cell costimulation: (i) provision of direct costimulation by prostate cancer cells transduced to express the B7.1 ligand and (ii) in vivo antibody- mediated blockade of T cell CTLA-4, which prevents T cell down-regulation. It was demonstrated that in vivo antibody-mediated blockade of CTLA-4 enhanced antiprostate cancer immune responses. Also, Yang et al.
- Certain tumors such as the SMI mammary carcinoma, were refractory to anti-CTLA-4 immunotherapy.
- CTLA-4 blockade and a vaccine consisting of granulocyte-macrophage colony-stimulating factor- expressing SMI cells, regression of parental SMI tumors was observed, despite the ineffectiveness of either treatment alone.
- This combination therapy resulted in long-lasting immunity to SMI and depended on both CD4(+) and CD8(+) T cells.
- CTLA-4 blockade acts at the level of a host- derived antigen-presenting cell.
- CTLA-4 can potently inhibit T cell activation in the absence of CD28, indicating that antagonism of a TCR-mediated signal is sufficient to explain the inhibitory effect of CTLA-4.
- Lin et al. J Exp Med 188: 199-204 (1998) studied rejection of heart allografts in CD28-deficient mice. H-2(q) hearts were transplanted into allogeneic wild-type or CD28 -deficient mice (H-2(b)). Graft rejection was delayed in CD28-deficient compared with wild-type mice. Treatment of wild-type recipients with CTLA-4- immunoglobulin (lg), or with anti-B7-l plus anti-B7-2 mAbs significantly prolonged allograft survival.
- CTLA-4-Ig In contrast, treatment of CD28-deficient mice with CTLA-4-Ig, anti-B7-l plus anti-B7-2 mAbs, or a blocking anti-CTLA-4 mAb induced acceleration of allograft rejection.
- This increased rate of graft rejection was associated with more severe mononuclear cell infiltration and enhanced levels of IFN-gamma and IL-6 transcripts in donor hearts of untreated wild-type and CTLA-4-Ig- or anti-CTLA-4 mAb-treated CD28-deficient mice.
- the negative regulatory role of CTLA-4 extends beyond its potential ability to prevent CD28 activation through ligand competition. Even in the absence of CD28, CTLA-4 plays an inhibitory role in the regulation of allograft rejection.
- CTLA-4 has been investigated. For example, Alegre et al. J Immunol 157:4762-70 (1996) proposed that surface CTLA-4 is rapidly internalized, which may explain the low levels of expression generally detected on the cell surface. They concluded that both CD28 and IL-2 play important roles in the up-regulation of CTLA-4 expression. In addition, the cell surface accumulation of CTLA-4 appeared to be primarily regulated by its rapid endocytosis. Also, Castan et al. Immunology 90:265-71 (1997) based on in situ immunohistological analyses of the expression of CTLA-4, suggested that germinal center T cells, which were CTLA-4 positive, could be important to immune regulation.
- CTLA-4 in view of the broad and pivotal role that CTLA-4 appears to possess in immune responsiveness, it would be desirable to generate antibodies to CTLA-4 that can be utilized effectively in immunotherapy. Moreover, it would be desirable to generate antibodies against CTLA-4 that can be utilized in chronic diseases in which repeat administrations of the antibodies are required.
- Figure 1 provides a series of nucleotide and an amino acid sequences of heavy chain and kappa light chain immunoglobulin molecules in accordance with the invention: 4.1.1 (Figure 1A), 4.8.1 (Figure IB), 4.14.3 (Figure 1C), 6.1.1 (Figure ID), 3.1.1 (Figure IE), 4.10.2 ( Figure IF), 2.1.3 ( Figure 1G), 4.13.1 ( Figure 1H), 11.2.1 (Figure II), 11.6.1 (Figure U), 11.7.1 ( Figure IK), 12.3.1.1 ( Figure IL), and 12.9.1.1 (Figure 1M).
- Figure 2 provides a sequence alignment between the predicted heavy chain amino acid sequences from the clones 4.1.1, 4.8.1, 4.14.3, 6.1.1, 3.1.1, 4.10.2, 4.13.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, and 12.9.1.1 and the germline DP-50 (3-33) amino acid sequence. Differences between the DP-50 germline sequence and that of the sequence in the clones are indicated in bold. The Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibodies as shaded.
- Figure 3 provides a sequence alignment between the predicted heavy chain amino acid sequence of the clone 2.1.3 and the germline DP-65 (4-31) amino acid sequence. Differences between the DP-65 germline sequence and that of the sequence in the clone are indicated in bold. The Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibody as underlined.
- Figure 4 provides a sequence alignment between the predicted kappa light chain amino acid sequence of the clones 4.1.1, 4.8.1, 4.14.3, 6.1.1, 4.10.2, and 4.13.1 and the germline A27 amino acid sequence. Differences between the A27 germline sequence and that of the sequence in the clone are indicated in bold.
- the Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibody as underlined. Apparent deletions in the CDRls of clones 4.8.1, 4.14.3, and 6.1.1 are indicated with "0s".
- Figure 5 provides a sequence alignment between the predicted kappa light chain amino acid sequence of the clones 3.1.1, 11.2.1, 11.6.1, and 11.7.1 and the germline 012 amino acid sequence. Differences between the 012 germline sequence and that of the sequence in the clone are indicated in bold.
- the Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibody as underlined.
- Figure 6 provides a sequence alignment between the predicted kappa light chain amino acid sequence of the clone 2.1.3 and the germline A10/A26 amino acid sequence. Differences between the A10/A26 germline sequence and that of the sequence in the clone are indicated in bold.
- the Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibody as underlined.
- Figure 7 provides a sequence alignment between the predicted kappa light chain amino acid sequence of the clone 12.3.1 and the germline A17 amino acid sequence. Differences between the A17 germline sequence and that of the sequence in the clone are indicated in bold. The Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibody as underlined.
- Figure 8 provides a sequence alignment between the predicted kappa light chain amino acid sequence of the clone 12.9.1 and the germline A3/A19 amino acid sequence. Differences between the A3/A19 germline sequence and that of the sequence in the clone are indicated in bold. The Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibody as underlined.
- Figure 9 provides a summary of N-terminal amino acid sequences generated through direct protein sequencing of the heavy and light chains of the antibodies.
- Figure 10 provides certain additional characterizing information about certain of the antibodies in accordance with the invention.
- Figure 10 A data related to clones 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.14.3, and 6.1.1 is summarized. Data related to concentration, isoelectric focusing (IEF), SDS-PAGE, size exclusion chromatography, liquid chromatography/mass spectroscopy (LCMS), mass spectroscopy (MALDI), light chain N-terminal sequences is provided. Additional detailed information related to IEF is provided in Figure 10B; related to SDS-PAGE is provided in 10C; and SEC of the 4.1.1 antibody in 10D.
- IEF isoelectric focusing
- SDS-PAGE size exclusion chromatography
- LCMS liquid chromatography/mass spectroscopy
- MALDI mass spectroscopy
- Figure 11 shows the expression of B7-1 and B7-2 on Raji cells using anti-CD80-PE and anti-CD86-PE mAbs.
- Figure 12 shows the concentration dependent enhancement of IL-2 production in the T cell blast/Raj i assay induced by anti-CTLA-4 blocking antibodies (BNI3, 4.1.1, 4.8.1, and 6.1.1).
- Figure 13 shows the concentration dependent enhancement of IFN- ⁇ production in the T cell blast/Raji assay induced by anti-CTLA-4 blocking antibodies (BNI3, 4.1.1, 4.8.1, and 6.1.1)(same donor T cells).
- Figure 14 shows the mean enhancement of IL-2 production in T cells from 6 donors induced by anti-CTLA-4 blocking antibodies in the T cell blast/Raji assay.
- Figure 15 shows the mean enhancement of IFN- ⁇ production in T cells from 6 donors induced by anti-CTLA-4 blocking antibodies in the T cell blast/Raji assay.
- Figure 16 shows the enhancement of IL-2 production in hPBMC from 5 donors induced by anti-CTLA-4 blocking mAbs as measured at 72 hours after stimulation with SEA.
- Figure 17 shows the enhancement of IL-2 production in whole blood from 3 donors induced by anti-CTLA-4 blocking mAbs as measured at 72 and 96 hours after stimulation with SEA.
- Figure 18 shows the inhibition of tumor growth with an anti -murine
- CTLA-4 antibody in a murine fibrosarcoma tumor model.
- Figure 19 shows enhancement of IL-2 production induced by anti- CTLA4 antibodies (4.1.1 and 11.2.1) of the invention in a 72 hour T blast/Raji and Superantigen (whole blood and peripheral blood mononuclear cells from 6 donors) assays.
- Figure 20 shows dose dependent enhancement of IL-2 production induced by anti-CTLA4 antibodies (4.1.1 and 11.2.1) of the invention in a 72 hour T blast/Raji assay.
- Figure 21 shows dose dependent enhancement of IL-2 production induced by anti-CTLA4 antibodies (4.1.1 and 11.2.1) of the invention in a 72 hour Superantigen whole blood assay stimulated with 100 ng/ml superantigen.
- Figure 22 provides a series of additional nucleotide and amino acid sequences of the following anti-CTLA-4 antibody chains: full length 4.1.1 heavy chain (cDNA 22(a), genomic 22(b), and amino acid 22(c)), full length aglycosylated 4.1.1 heavy chain (cDNA 22(d) and amino acid 22(e)), 4.1.1 light chain (cDNA 22(f) and amino acid 22(g)), full length 4.8.1 heavy chain (cDNA 22(h) and amino acid 22(i)), 4.8.1 light chain (cDNA 22(j) and amino acid 22(k)), full length 6.1.1 heavy chain (cDNA 22(1) and amino acid 22(m)), 6.1.1 light chain (cDNA 22(n) and amino acid 22(o)), full length 11.2.1 heavy chain (cDNA 22(p) and amino acid 22(q)), and 11.2.1 light chain (cDNA 22 (r) and amino acid 22(s)).
- an antibody that is capable of binding CTLA-4, comprising a heavy chain variable region amino acid sequence that comprises a contiguous amino acid sequence from within an FRl sequence through an FR3 sequence that is encoded by a human V H 3-33 family gene and that comprises at least one of the amino acid substitutions in the CDRl sequences, CDR2 sequences, or framework sequences shown in Figure 2.
- the amino acid sequence comprises a sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO-11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, and SEQ ID NO:70.
- the antibody further comprises a light chain variable region amino acid sequence comprising a sequence selected from the group consisting of a sequence comprising SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69, and SEQ ID NO:71.
- an antibody comprising a heavy chain amino acid sequence comprising SEQ ID NO:l and a light chain variable amino acid sequence comprising SEQ ID NO: 14.
- an antibody comprising a heavy chain amino acid sequence comprising SEQ ID NO:2 and a light chain variable amino acid sequence comprising SEQ ID NO:15.
- an antibody comprising a heavy chain amino acid sequence comprising SEQ ID NO:4 and a light chain variable amino acid sequence comprising SEQ ID NO: 17.
- an isolated human monoclonal antibody that is capable of binding to CTLA-4.
- antibody is capable of competing for binding with CTLA-4 with an antibody selected from the group consisting of 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, and 12.9.1.1.
- the antibody possesses a substantially similar binding specificity to CTLA-4 as an antibody selected from the group consisting of 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, and 12.9.1.1.
- the antibody is selected from the group consisting of 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, and 12.9.1.1.
- the antibody is not cross reactive with CTLA-4 from lower mammalian species, preferably the lower mammalian species comprises mouse, rat, and rabbit and more preferably mouse and rat.
- the antibody is cross reactive with CTLA-4 from primates, preferably the primates comprise cynomolgous and rhesus monkeys.
- the antibody possesses a selectivity for CTLA-4 over CD28, B7-2, CD44, and hlgGl of greater than about 100:1 and preferably about 500:1 or greater.
- the binding affinity of the antibody is about 10 "9 M or greater and preferably about 10 "10 M or greater.
- the antibody inhibits binding between CTLA-4 and B7-2 with an IC 50 of lower than about 100 nM and preferably lower than about 0.38 nM.
- the antibody inhibits binding between CTLA-4 and B7-1 with an IC 50 of lower than about 100 nM or greater and preferably lower than about 0.50 nM.
- the antibody enhances IL-2 production in a T cell blast/Raji assay by about 500 pg/ml or greater and preferably by about 3846 pg/ml or greater.
- the antibody enhances IFN- ⁇ production in a T cell blast/Raji assay by about 500 pg/ml or greater and preferably by about 1233 pg/ml or greater.
- the antibody enhances IL-2 production in a hPBMC or whole blood superantigen assay by about 500 pg/ml or greater.
- the antibody enhances IL-2 production in a hPBMC or whole blood superantigen assay by about 500 pg/ml or preferably 1500 pg/ml or greater or by greater than about 30% or preferably 50%) relative to control.
- a humanized antibody that possesses a substantially similar binding specificity to CTLA-4 as an antibody selected from the group consisting of 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, and 12.9.1.1.
- the antibody is not cross reactive with CTLA-4 from lower mammalian species, preferably the lower mammalian species comprises mouse, rat, and rabbit and preferably mouse and rat.
- the antibody is cross reactive with CTLA-4 from primates, preferably the primates comprise cynomolgous and rhesus monkeys.
- the antibody possesses a selectivity for CTLA-4 over CD28, B7-2, CD44, and hlgGl of greater than about 100:1 and preferably about 500:1 or greater.
- the binding affinity of the antibody is about 10 "9 M or greater and preferably about 10 "10 M or greater.
- the antibody inhibits binding between CTLA-4 and B7-2 with an IC 50 of lower than about 100 nM and preferably lower than about 0.38 nM.
- the antibody inhibits binding between CTLA-4 and B7-1 with an IC50 of lower than about 100 nM or greater and preferably lower than about 0.50 nM.
- the antibody enhances IL-2 production in a T cell blast/Raji assay by about 500 pg/ml or greater and preferably by about 3846 pg/ml or greater. In another preferred embodiment, the antibody enhances IFN- ⁇ production in a T cell blast/Raji assay by about 500 pg/ml or greater and preferably by about 1233 pg/ml or greater. In another preferred embodiment, the antibody induces IL-2 production in a hPBMC or whole blood superantigen assay by about 500 pg/ml or greater.
- the antibody enhances IL-2 production in a hPBMC or whole blood superantigen assay by about 500 pg/ml or preferably 1500 pg/ml or greater or by greater than about 30%) or preferably 50%> relative to control.
- an antibody that binds to CTLA-4 comprising a heavy chain amino acid sequence comprising human FRl, FR2, and FR3 sequences encoded by a human N H 3-33 gene family operably linked in frame with a CDRl, a CDR2, and a CDR3 sequence, the CDRl, CDR2, and CDR3 sequences being independently selected from the CDRl, CDR2, and CDR3 sequences illustrated in Figure 2.
- an antibody that binds to CTLA-4 comprising a heavy chain amino acid sequence comprising human FRl, FR2, and FR3 sequences encoded by a human V H 3-33 gene family operably linked in frame with a CDRl, a CDR2, and a CDR3 sequence, which antibody has the following properties: a binding affinity for CTLA-4 of about 10 "9 or greater; inhibits binding between CTLA-4 and B7-1 with an IC 50 of about 100 nM or lower; inhibits binding between CTLA-4 and B7-2 with an IC 50 of about 100 nM or lower; and enhances cytokine production in an assay of human T cells by 500 pg/ml or greater.
- an antibody that binds to CTLA-4 comprising a heavy chain amino acid sequence comprising FRl, FR2, and FR3 sequences operably linked in frame with a CDRl, a CDR2, and a CDR3 sequence independently selected from the CDRl, CDR2, and CDR3 sequences illustrated in Figures 2 and 3, which antibody has the following properties: a binding affinity for CTLA-4 of about 10 "9 or greater; inhibits binding between CTLA-4 and B7-1 with an IC 50 of about 100 nM or lower; inhibits binding between CTLA-4 and B7-2 with an IC 50 of about 100 nM or lower; and enhances cytokine production in an assay of human T cells by 500 pg/ml or greater.
- a cell culture system for assaying T cell stimulation comprising a culture of human T cell blasts co-cultured with a Raji cell line.
- the T cell blasts are washed prior to culture with the Raji cell line.
- an assay for measuring T cell stimulation comprising: providing a culture of human T cell blasts and a Raji cell line; contacting the culture with an agent; and measuring cytokine production by the culture.
- a functional assay for screening a moiety for T cell stimulatory function comprising: providing a culture of human T cell blasts and a Raji cell line; contacting the culture with the moiety; and assessing cytokine production by the culture.
- a T cell stimulatory assay for CTLA-4 inhibitory function comprising contacting a culture comprising human T cell blasts and a Raji cell line with an agent and assessing cytokine production by the culture.
- a method for screening an agent for T cell stimulatory activity comprising: contacting the agent with a cell culture comprising human T cell blasts and a Raji cell line; and assessing cytokine production by the culture.
- the T cell blasts are washed prior to culture with the Raji cell line.
- the cytokine is IL-2 or IFN- ⁇ .
- cytokine production is measured in supernatant isolated from the culture.
- the agent is an antibody and preferably binds to CTLA-4.
- an assay for measuring T cell stimulation comprising: providing a population of human peripheral blood mononuclear cells or human whole blood stimulated with staphylococcus enterotoxin A; contacting the culture with an agent; and measuring cytokine production by the cell population.
- a functional assay for screening a moiety for T cell stimulatory function comprising: providing a population of human peripheral blood mononuclear cells or human whole blood stimulated with staphylococcus enterotoxin A; contacting the culture with the moiety; and assessing cytokine production by the cell population.
- a T cell stimulatory assay for CTLA-4 inhibitory function comprising contacting a population of human peripheral blood mononuclear cells or human whole blood stimulated with staphylococcus enterotoxin A with an agent and assessing cytokine production by the cell population.
- a method for screening an agent for T cell stimulatory activity comprising: contacting the agent with a population of human peripheral blood mononuclear cells or human whole blood stimulated with staphylococcus enterotoxin A; and assessing cytokine production by the cell population.
- the cytokine in a preferred embodiment, is IL-2. In another preferred embodiment, cytokine production is measured in supernatant isolated from the culture. In a preferred embodiment, the agent is an antibody and preferably binds to CTLA-4.
- nucleotide sequences encoding and amino acid sequences comprising heavy and light chain immunoglobulin molecules, particularly sequences corresponding to a contiguous heavy and light chain sequences from FRl and CDRl through CDR3 and FR4, are provided. Further provided are antibodies having similar binding properties and antibodies (or other antagonists) having similar functionality as antibodies disclosed herein. Hybridomas expressing such immunoglobulin molecules and monoclonal antibodies are also provided. Definitions
- isolated polynucleotide shall mean a polynucleotide of genomic, cDNA, or synthetic origin or some combination thereof, which by virtue of its origin the "isolated polynucleotide” (1) is not associated with all or a portion of a polynucleotide in which the "isolated polynucleotide” is found in nature, (2) is operably linked to a polynucleotide which it is not linked to in nature, or (3) does not occur in nature as part of a larger sequence.
- isolated protein means a protein of cDNA, recombinant RNA, or synthetic origin or some combination thereof, which by virtue of its origin, or source of derivation, the "isolated protein” (1) is not associated with proteins found in nature, (2) is free of other proteins from the same source, e.g. free of murine proteins, (3) is expressed by a cell from a different species, or (4) does not occur in nature.
- polypeptide as used herein as a generic term to refer to native protein, fragments, or analogs of a polypeptide sequence.
- native protein, fragments, and analogs are species of the polypeptide genus.
- Preferred polypeptides in accordance with the invention comprise the human heavy chain immunoglobulin molecules and the human kappa light chain immunoglobulin molecules represented in Figure 1, as well as antibody molecules formed by combinations comprising the heavy chain immunoglobulin molecules with light chain immunoglobulin molecules, such as the kappa light chain immunoglobulin molecules, and vice versa, as well as fragments and analogs thereof.
- naturally-occurring refers to the fact that an object can be found in nature.
- a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory or otherwise is naturally-occurring .
- operably linked refers to positions of components so described are in a relationship permitting them to function in their intended manner.
- a control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.
- control sequence refers to polynucleotide sequences which are necessary to effect the expression and processing of coding sequences to which they are ligated. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence; in eukaryotes, generally, such control sequences include promoters and transcription termination sequence.
- control sequences is intended to include, at a minimum, all components whose presence is essential for expression and processing, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences.
- polynucleotide as referred to herein means a polymeric form of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide.
- the term includes single and double stranded forms of DNA.
- oligonucleotide includes naturally occurring, and modified nucleotides linked together by naturally occurring, and non-naturally occurring oligonucleotide linkages.
- Oligonucleotides are a polynucleotide subset generally comprising a length of 200 bases or fewer. Preferably oligonucleotides are 10 to 60 bases in length and most preferably 12, 13, 14, 15, 16, 17, 18, 19, or 20 to 40 bases in length. Oligonucleotides are usually single stranded, e.g. for probes; although oligonucleotides may be double stranded, e.g. for use in the construction of a gene mutant. Oligonucleotides of the invention can be either sense or antisense oligonucleotides.
- nucleotides includes deoxyribonucleotides and ribonucleotides.
- modified nucleotides includes nucleotides with modified or substituted sugar groups and the like.
- oligonucleotide linkages includes oligonucleotides linkages such as phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroamlothioate, phoshoraniladate, phosphoroamidate, and the like. See e.g., LaPlanche et al. Nucl Acids Res.
- oligonucleotide can include a label for detection, if desired.
- the term "selectively hybridize” referred to herein means to detectably and specifically bind.
- Polynucleotides, oligonucleotides and fragments thereof in accordance with the invention selectively hybridize to nucleic acid strands under hybridization and wash conditions that minimize appreciable amounts of detectable binding to nonspecific nucleic acids.
- High stringency conditions can be used to achieve selective hybridization conditions as known in the art and discussed herein.
- the nucleic acid sequence homology between the polynucleotides, oligonucleotides, and fragments of the invention and a nucleic acid sequence of interest will be at least 80%>, and more typically with preferably increasing homologies of at least 85%, 90%, 95%, 99%>, and 100%.
- Two amino acid sequences are homologous if there is a partial or complete identity between their sequences. For example, 85%o homology means that 85%> of the amino acids are identical when the two sequences are aligned for maximum matching. Gaps (in either of the two sequences being matched) are allowed in maximizing matching; gap lengths of 5 or less are preferred with 2 or less being more preferred. Alternatively and preferably, two protein sequences (or polypeptide sequences derived from them of at least 30 amino acids in length) are homologous, as this term is used herein, if they have an alignment score of at more than 5 (in standard deviation units) using the program ALIGN with the mutation data matrix and a gap penalty of 6 or greater.
- the two sequences or parts thereof are more preferably homologous if their amino acids are greater than or equal to 50%> identical when optimally aligned using the ALIGN program.
- the term "corresponds to” is used herein to mean that a polynucleotide sequence is homologous (i.e., is identical, not strictly evolutionarily related) to all or a portion of a reference polynucleotide sequence, or that a polypeptide sequence is identical to a reference polypeptide sequence.
- the term “complementary to” is used herein to mean that the complementary sequence is homologous to all or a portion of a reference polynucleotide sequence.
- the nucleotide sequence "TATAC” corresponds to a reference sequence “TATAC” and is complementary to a reference sequence "GTATA”.
- reference sequence is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA or gene sequence given in a sequence listing or may comprise a complete cDNA or gene sequence. Generally, a reference sequence is at least 18 nucleotides or 6 amino acids in length, frequently at least 24 nucleotides or 8 amino acids in length, and often at least 48 nucleotides or 16 amino acids in length.
- two polynucleotides or amino acid sequences may each (1) comprise a sequence (i.e., a portion of the complete polynucleotide or amino acid sequence) that is similar between the two molecules, and (2) may further comprise a sequence that is divergent between the two polynucleotides or amino acid sequences
- sequence comparisons between two (or more) molecules are typically performed by comparing sequences of the two molecules over a "comparison window" to identify and compare local regions of sequence similarity.
- a “comparison window”, as used herein, refers to a conceptual segment of at least 18 contiguous nucleotide positions or 6 amino acids wherein a polynucleotide sequence or amino acid sequence may be compared to a reference sequence of at least 18 contiguous nucleotides or 6 amino acid sequences and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions, deletions, substitutions, and the like (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
- Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl Math.
- sequence identity means that two polynucleotide or amino acid sequences are identical (i.e., on a nucleotide-by-nucleotide or residue-by- residue basis) over the comparison window.
- percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) or residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
- substantially identical denotes a characteristic of a polynucleotide or amino acid sequence, wherein the polynucleotide or amino acid comprises a sequence that has at least 85 percent sequence identity, preferably at least 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison window of at least 18 nucleotide (6 amino acid) positions, frequently over a window of at least 24-48 nucleotide (8-16 amino acid) positions, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the sequence which may include deletions or additions which total 20 percent or less of the reference sequence over the comparison window.
- the reference sequence may be a subset of a larger sequence.
- Examples of unconventional amino acids include: 4-hydroxyproline, ⁇ -carboxy glutamate, ⁇ -N,N,N-trimethyllysine, ⁇ -N- acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3- methylhistidine, 5-hydroxylysine, ⁇ -N-methylarginine, and other similar amino acids and imino acids (e.g., 4-hydroxyproline).
- the lefthand direction is the amino terminal direction and the righthand direction is the carboxy-terminal direction, in accordance with standard usage and convention.
- the lefthand end of single-stranded polynucleotide sequences is the 5' end; the lefthand direction of double-stranded polynucleotide sequences is referred to as the 5' direction.
- the direction of 5' to 3' addition of nascent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA and which are 5' to the 5' end of the RNA transcript are referred to as "upstream sequences"; sequence regions on the DNA strand having the same sequence as the RNA and which are 3' to the 3' end of the RNA transcript are referred to as "downstream sequences".
- the term "substantial identity” means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least 80 percent sequence identity, preferably at least 90 percent sequence identity, more preferably at least 95 percent sequence identity, and most preferably at least 99 percent sequence identity.
- residue positions which are not identical differ by conservative amino acid substitutions.
- Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains.
- a group of amino acids having aliphatic side chains is glycine, alanine, valine, Ieucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine.
- Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine- tyrosine, lysine-arginine, alanine-valine, glutamic-aspartic, and asparagine-glutamine.
- amino acid sequences of antibodies or immunoglobulin molecules are contemplated as being encompassed by the present invention, providing that the variations in the amino acid sequence maintain at least 75%, more preferably at least 80%, 90%>, 95%, and most preferably 99%.
- conservative amino acid replacements are contemplated. Conservative replacements are those that take place within a family of amino acids that are related in their side chains.
- More preferred families are: serine and threonine are aliphatic-hydroxy family; asparagine and glutamine are an amide-containing family; alanine, valine, Ieucine and isoleucine are an aliphatic family; and phenylalanine, tryptophan, and tyrosine are an aromatic family.
- Structural and functional domains can be identified by comparison of the nucleotide and/or amino acid sequence data to public or proprietary sequence databases.
- computerized comparison methods are used to identify sequence motifs or predicted protein conformation domains that occur in other proteins of known structure and/or function. Methods to identify protein sequences that fold into a known three-dimensional structure are known. Bowie et al. Science 253:164 (1991).
- sequence motifs and structural conformations that may be used to define structural and functional domains in accordance with the invention.
- Preferred amino acid substitutions are those which: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinities, and (4) confer or modify other physicochemical or functional properties of such analogs.
- Analogs can include various muteins of a sequence other than the naturally-occurring peptide sequence. For example, single or multiple amino acid substitutions (preferably conservative amino acid substitutions) may be made in the naturally-occurring sequence (preferably in the portion of the polypeptide outside the domain(s) forming intermolecular contacts.
- a conservative amino acid substitution should not substantially change the structural characteristics of the parent sequence (e.g., a replacement amino acid should not tend to break a helix that occurs in the parent sequence, or disrupt other types of secondary structure that characterizes the parent sequence).
- Examples of art-recognized polypeptide secondary and tertiary structures are described in Proteins, Structures and Molecular Principles (Creighton, Ed., W. H. Freeman and Company, New York (1984)); Introduction to Protein Structure (C. Branden and J. Tooze, eds., Garland Publishing, New York, NN. (1991)); and Thornton et at. Nature 354:105 (1991), which are each incorporated herein by reference.
- polypeptide fragment refers to a polypeptide that has an amino-terminal and/or carboxy-terminal deletion, but where the remaining amino acid sequence is identical to the corresponding positions in the naturally-occurring sequence deduced, for example, from a full-length cD ⁇ A sequence. Fragments typically are at least 5, 6, 8 or 10 amino acids long, preferably at least 14 amino acids long, more preferably at least 20 amino acids long, usually at least 50 amino acids long, and even more preferably at least 70 amino acids long.
- analog refers to polypeptides which are comprised of a segment of at least 25 amino acids that has substantial identity to a portion of a deduced amino acid sequence and which has at least one of the following properties: (1) specific binding to CTLA-4, under suitable binding conditions, (2) ability to block CTLA-4 binding with its receptors, or (3) ability to inhibit CTLA-4 expressing cell growth in vitro or in vivo.
- polypeptide analogs comprise a conservative amino acid substitution (or addition or deletion) with respect to the naturally-occurring sequence.
- Analogs typically are at least 20 amino acids long, preferably at least 50 amino acids long or longer, and can often be as long as a full-length naturally- occurring polypeptide.
- Peptide analogs are commonly used in the pharmaceutical industry as non-peptide drus with properties analogous to those of the template peptide. These types of non-peptide compound are termed "peptide mimetics" or "peptidomimetics”. Fauchere, J. Adv. Drug Res. 15:29 (1986); Veber and Freidinger TINS p.392 (1985); and Evans et al. J. Med. Chem. 30:1229 (1987), which are incorporated herein by reference. Such compounds are often developed with the aid of computerized molecular modeling. Peptide mimetics that are structurally similar to therapeutically useful peptides may be used to produce an equivalent therapeutic or prophylactic effect.
- a paradigm polypeptide i.e., a polypeptide that has a biochemical property or pharmacological activity
- Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type may be used to generate more stable peptides.
- constrained peptides comprising a consensus sequence or a substantially identical consensus sequence variation may be generated by methods known in the art (Rizo and Gierasch Ann. Rev. Biochem. 61:387 (1992), incorporated herein by reference); for example, by adding internal cysteine residues capable of forming intramolecular disulfide bridges which cyclize the peptide.
- “Antibody” or “antibody peptide(s)” refer to an intact antibody, or a binding fragment thereof that competes with the intact antibody for specific binding.
- Binding fragments are produced by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact antibodies. Binding fragments include Fab, Fab', F(ab') 2 , Fv, and single-chain antibodies. An antibody other than a "bispeciflc" or "bifunctional” antibody is understood to have each of its binding sites identical. An antibody substantially inhibits adhesion of a receptor to a counterreceptor when an excess of antibody reduces the quantity of receptor bound to counterreceptor by at least about 20%, 40%, 60% or 80%>, and more usually greater than about 85% (as measured in an in vitro competitive binding assay).
- epitopic determinants includes any protein determinant capable of specific binding to an immunoglobulin or T-cell receptor.
- Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
- An antibody is said to specifically bind an antigen when the dissociation constant is ⁇ 1 ⁇ M, preferably ⁇ 100 nM and most preferably ⁇ 10 nM.
- agent is used herein to denote a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an extract made from biological materials.
- label refers to incorporation of a detectable marker, e.g., by incorporation of a radiolabeled amino acid or attachment to a polypeptide of biotinyl moieties that can be detected by marked avidin (e.g., streptavidin containing a fluorescent marker or enzymatic activity that can be detected by optical or colorimetric methods). In certain situations, the label or marker can also be therapeutic. Various methods of labeling polypeptides and glycoproteins are known in the art and may be used.
- labels for polypeptides include, but are not limited to, the following: radioisotopes or radionuclides (e.g., 3 H, 14 C, l 5 N, 35 S, 90 Y, 99 Tc, 11 'in, 125 I, 131 I), fluorescent labels (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic labels (e.g., horseradish peroxidase, ⁇ -galactosidase, luciferase, alkaline phosphatase), chemiluminescent, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g., Ieucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags).
- labels are attached by spacer arms of various lengths to reduce potential steric hindrance.
- pharmaceutical agent or drug refers to a chemical compound or composition capable of inducing a desired therapeutic effect when properly administered to a patient.
- Other chemistry terms herein are used according to conventional usage in the art, as exemplified by The McGraw-Hill Dictionary of Chemical Terms (Parker, S., Ed., McGraw-Hill, San Francisco (1985)), incorporated herein by reference).
- anti-plastic agent is used herein to refer to agents that have the functional property of inhibiting a development or progression of a neoplasm in a human, particularly a malignant (cancerous) lesion, such as a carcinoma, sarcoma, lymphoma, or leukemia. Inhibition of metastasis is frequently a property of antineoplastic agents.
- substantially pure means an object species is the predominant species present (i.e., on a molar basis it is more abundant than any other individual species in the composition), and preferably a substantially purified fraction is a composition wherein the object species comprises at least about 50 percent (on a molar basis) of all macromolecular species present. Generally, a substantially pure composition will comprise more than about 80 percent of all macromolecular species present in the composition, more preferably more than about 85%, 90%, 95%, and 99%. Most preferably, the object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species.
- patient includes human and veterinary subjects.
- the basic antibody structural unit is known to comprise a tetramer.
- Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light” (about 25 kDa) and one "heavy” chain (about 50-70 kDa).
- the amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition.
- the carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function.
- Human light chains are classified as kappa and lambda light chains.
- Heavy chains are classified as mu, delta, gamma, alpha, or epsilon, and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively.
- the variable and constant regions are joined by a "J" region of about 12 or more amino acids, with the heavy chain also including a "D” region of about 10 more amino acids. See generally, Fundamental Immunology Ch. 7 (Paul, W., ed., 2nd ed. Raven Press, NN. (1989)) (incorporated by reference in its entirety for all purposes).
- the variable regions of each light/heavy chain pair form the antibody binding site.
- an intact IgG antibody has two binding sites. Except in bifunctional or bispecific antibodies, the two binding sites are the same.
- the chains all exhibit the same general structure of relatively conserved framework regions (FR) joined by three hyper variable regions, also called complementarity determining regions or CDRs.
- the CDRs from the two chains of each pair are aligned by the framework regions, enabling binding to a specific epitope.
- both light and heavy chains comprise the domains FRl, CDRl, FR2, CDR2, FR3, CDR3 and FR4.
- the assignment of amino acids to each domain is in accordance with the definitions of Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991)), or Chothia & Lesk J. Mol. Biol. 196:901-917 (1987); Chothia et al. Nature 342:878-883 (1989).
- a bispecific or bifunctional antibody is an artificial hybrid antibody having two different heavy/light chain pairs and two different binding sites.
- Bispecific antibodies can be produced by a variety of methods including fusion of hybridomas or linking of Fab' fragments. See, e.g., Songsivilai & Lachmann Clin. Exp. Immunol 79: 315-321 (1990), Kostelny et al. J. Immunol. 148:1547- 1553 (1992).
- bispecific antibodies may be formed as "diabodies” (Holliger et al. "'Diabodies': small bivalent and bispecific antibody fragments” PNAS USA 90:6444-6448 (1993)) or "Janusins" (Traunecker et al.
- bispecific single chain molecules target cytotoxic lymphocytes on HIV infected cells
- Bispecific antibodies do not exist in the form of fragments having a single binding site (e.g., Fab, Fab', and Fv).
- Human antibodies avoid certain of the problems associated with antibodies that possess murine or rat variable and/or constant regions.
- the presence of such murine or rat derived proteins can lead to the rapid clearance of the antibodies or can lead to the generation of an immune response against the antibody by a patient.
- murine or rat derived antibodies it has been postulated that one can develop humanized antibodies or generate fully human antibodies through the introduction of human antibody function into a rodent so that the rodent would produce antibodies having fully human sequences.
- XenoMouseTM strains were engineered with yeast artificial chromosomes (YACs) containing 245 kb and 190 kb-sized germline configuration fragments of the human heavy chain locus and kappa light chain locus, respectively, which contained core variable and constant region sequences.
- YACs yeast artificial chromosomes
- the human lg containing YACs proved to be compatible with the mouse system for both rearrangement and expression of antibodies and were capable of substituting for the inactivated mouse lg genes.
- minilocus an exogenous lg locus is mimicked through the inclusion of pieces (individual genes) from the lg locus.
- V H genes one or more D H genes
- J H genes one or more J H genes
- a mu constant region preferably a gamma constant region
- minilocus approach is the rapidity with which constructs including portions of the lg locus can be generated and introduced into animals.
- a significant disadvantage of the minilocus approach is that, in theory, insufficient diversity is introduced through the inclusion of small numbers of V, D, and J genes. Indeed, the published work appears to support this concern. B-cell development and antibody production of animals produced through use of the minilocus approach appear stunted. Therefore, research surrounding the present invention has consistently been directed towards the introduction of large portions of the lg locus in order to achieve greater diversity and in an effort to reconstitute the immune repertoire of the animals.
- HAMA Human anti-mouse antibody
- HACA human anti-chimeric antibody
- mR ⁇ A is isolated from a hybridoma or other cell producing the antibody and used to produce cD ⁇ A.
- the cD ⁇ A of interest may be amplified by the polymerase chain reaction using specific primers (U.S. Pat. ⁇ os. 4,683,195 and 4,683,202).
- a library is made and screened to isolate the sequence of interest.
- the D ⁇ A sequence encoding the variable region of the antibody is then fused to human constant region sequences.
- the sequences of human constant regions genes may be found in Kabat et al. (1991) Sequences of Proteins of Immunological Interest, ⁇ .I.H. publication no. 91-3242. Human C region genes are readily available from known clones. The choice of isotype will be guided by the desired effector functions, such as complement fixation, or activity in antibody-dependent cellular cytotoxicity.
- Preferred isotypes are IgGl, IgG2, IgG3 and IgG4.
- Particularly preferred isotypes for antibodies of the invention are IgG2 and IgG4. Either of the human light chain constant regions, kappa or lambda, may be used.
- the chimeric, humanized antibody is then expressed by conventional methods.
- Antibody fragments such as Fv, F(ab') 2 and Fab may be prepared by cleavage of the intact protein, e.g. by protease or chemical cleavage.
- a truncated gene is designed.
- a chimeric gene encoding a portion of the F(ab') 2 fragment would include DNA sequences encoding the CHI domain and hinge region of the H chain, followed by a translational stop codon to yield the truncated molecule.
- consensus sequences encoding the heavy and light chain J regions may be used to design oligonucleotides for use as primers to introduce useful restriction sites into the J region for subsequent linkage of V region segments to human C region segments.
- C region cDNA can be modified by site directed mutagenesis to place a restriction site at the analogous position in the human sequence.
- Expression vectors include plasmids, retro viruses, cosmids, YACs, EBV derived episomes, and the like.
- a convenient vector is one that encodes a functionally complete human CH or CL immunoglobulin sequence, with appropriate restriction sites engineered so that any VH or VL sequence can be easily inserted and expressed.
- splicing usually occurs between the splice donor site in the inserted J region and the splice acceptor site preceding the human C region, and also at the splice regions that occur within the human CH exons. Polyadenylation and transcription termination occur at native chromosomal sites downstream of the coding regions.
- the resulting chimeric antibody may be joined to any strong promoter, including retroviral LTRs, e.g. SV-40 early promoter, (Okayama et al. Mol. Cell. Bio. 3:280 (1983)), Rous sarcoma virus LTR (Gorman et al. P.N.A.S. 19:6111 (1982)), and moloney murine leukemia virus LTR (Grosschedl et al. Cell 41:885 (1985)); native lg promoters, etc.
- retroviral LTRs e.g. SV-40 early promoter, (Okayama et al. Mol. Cell. Bio. 3:
- human antibodies or antibodies from other species can be generated through display-type technologies, including, without limitation, phage display, retroviral display, ribosomal display, and other techniques, using techniques well known in the art and the resulting molecules can be subjected to additional maturation, such as affinity maturation, as such techniques are well known in the art.
- Wright and Harris, supra. Hanes and Plucthau PNAS USA 94:4937-4942 (1997) (ribosomal display), Parmley and Smith Gene 73:305-318 (1988) (phage display), Scott TIBS 17:241-245 (1992), Cwirla et al. PNAS USA 87:6378-6382 (1990), Russel et al. Nucl.
- CTLA-4 expressing cells it is generally not desirable to kill CTLA-4 expressing cells. Rather, one generally desires to simply inhibit CTLA-4 binding with its ligands to mitigate T cell down regulation.
- One of the major mechanisms through which antibodies kill cells is through fixation of complement and participation in CDC.
- the constant region of an antibody plays an important role in connection with an antibody's ability to fix complement and participate in CDC.
- isotypes of antibodies that are capable of complement fixation and CDC, including, without limitation, the following: murine IgM, murine IgG2a, murine IgG2b, murine IgG3, human IgM, human IgGl, and human IgG3.
- isotypes that do not include, without limitation, human IgG2 and human IgG4.
- antibodies that are generated need not initially possess a particular desired isotype but, rather, the antibody as generated can possess any isotype and the antibody can be isotype switched thereafter using conventional techniques that are well known in the art. Such techniques include the use of direct recombinant techniques (see e.g., U.S. Patent No. 4,816,397), cell-cell fusion techniques (see e.g., U.S. Patent Application No. 08/730,639, filed October 11, 1996), among others.
- a myeloma or other cell line is prepared that possesses a heavy chain with any desired isotype and another myeloma or other cell line is prepared that possesses the light chain.
- Such cells can, thereafter, be fused and a cell line expressing an intact antibody can be isolated.
- the majority of the CTLA-4 antibodies discussed herein are human anti-CTLA-4 IgG2 antibody. Since such antibodies possess desired binding to the CTLA-4 molecule, any one of such antibodies can be readily isotype switched to generate a human IgG4 isotype, for example, while still possessing the same variable region (which defines the antibody's specificity and some of its affinity).
- antibody candidates are generated that meet desired "structural" attributes as discussed above, they can generally be provided with at least certain additional “functional” attributes that are desired through isotype switching.
- the design of other therapeutic modalities including other antibodies, other antagonists, or chemical moieties other than antibodies is facilitated.
- Such modalities include, without limitation, antibodies having similar binding activity or functionality, advanced antibody therapeutics, such as bispecific antibodies, immunotoxins, and radiolabeled therapeutics, generation of peptide therapeutics, gene therapies, particularly intrabodies, antisense therapeutics, and small molecules.
- advanced antibody therapeutics such as bispecific antibodies, immunotoxins, and radiolabeled therapeutics
- generation of peptide therapeutics such as bispecific antibodies, immunotoxins, and radiolabeled therapeutics
- gene therapies particularly intrabodies, antisense therapeutics, and small molecules.
- the effector function of the antibodies of the invention may be changed by isotype switching to an IgGl, IgG2, IgG3, IgG4, IgD, IgA, IgE, or IgM for various therapeutic uses.
- bispecific antibodies can be generated that comprise (i) two antibodies one with a specificity to CTLA-4 and another to a second molecule that are conjugated together, (ii) a single antibody that has one chain specific to CTLA-4 and a second chain specific to a second molecule, or (iii) a single chain antibody that has specificity to CTLA-4 and the other molecule.
- Such bispecific antibodies can be generated using techniques that are well known for example, in connection with (i) and (ii) see e.g., Fanger et al. Immunol Methods 4:72-81 (1994) and Wright and Harris, supra, and in connection with (iii) see e.g., Traunecker et al. Int. J. Cancer (Suppl) 7:51-52 (1992).
- antibodies can be modified to act as immunotoxins utilizing techniques that are well known in the art. See e.g., Vitetta Immunol Today 14:252 (1993). See also U.S. Patent No. 5,194,594.
- modified antibodies can also be readily prepared utilizing techniques that are well known in the art. See e.g., Junghans et al. in Cancer Chemotherapy and Biotherapy 655-686 (2d edition, Chafher and Longo, eds., Lippincott Raven (1996)). See also U.S. Patent Nos. 4,681,581, 4,735,210, 5,101,827, 5,102,990 (RE 35,500), 5,648,471, and 5,697,902.
- Each of immunotoxins and radiolabeled molecules would be likely to kill cells expressing CTLA-4, and particularly those cells in which the antibodies of the invention are effective.
- therapeutic peptides can be generated that are directed against CTLA-4.
- Design and screening of peptide therapeutics is discussed in connection with Houghten et al. Biotechniques 13:412-421 (1992), Houghten PNAS USA 82:5131-5135 (1985), Pinalla et al. Biotechniques 13:901-905 (1992), Blake and Litzi-Davis BioConjugate Chem. 3:510-513 (1992).
- Immunotoxins and radiolabeled molecules can also be prepared, and in a similar manner, in connection with peptidic moieties as discussed above in connection with antibodies.
- Important information related to the binding of an antibody to an antigen can be gleaned through phage display experimentation. Such experiments are generally accomplished through panning a phage library expressing random peptides for binding with the antibodies of the invention to determine if peptides can be isolated that bind. If successful, certain epitope information can be gleaned from the peptides that bind.
- phage libraries expressing random peptides can be purchased from New England Biolabs (7-mer and 12-mer libraries, Ph.D. -7 Peptide 7-mer Library Kit and Ph.D. -12 Peptide 12-mer Library Kit, respectively) based on a bacteriophage Ml 3 system.
- Each of 7-mer and 12-mer libraries are panned or screened in accordance with the manufacturer's recommendations in which plates were coated with an antibody to capture the appropriate antibody (a goat anti-human IgG Fc for an IgG antibody for example) followed by washing.
- Bound phage are eluted with 0.2 M glycine-HCl, pH 2.2. After 3 rounds of selection/amplification at constant stringency (0.5% Tween), through use of DNA sequencing, one can characterize clones from the libraries that are reactive with one or more of the antibodies. Reactivity of the peptides can be determined by ELISA. For an additional discussion of epitope analysis of peptides see also Scott, J.K. and Smith, G.P.
- Genetic materials encoding an antibody of the invention may be included in a suitable expression system (whether viral, attenuated viral, non-viral, naked, or otherwise) and administered to a host for in vivo generation of the antibody in the host.
- Small molecule therapeutics can also be envisioned in accordance with the present invention.
- Drugs can be designed to modulate the activity of CTLA- 4 based upon the present invention.
- Knowledge gleaned from the structure of the CTLA-4 molecule and its interactions with other molecules in accordance with the present invention, such as the antibodies of the invention, CD28, B7, B7-1, B7-2, and others can be utilized to rationally design additional therapeutic modalities.
- rational drug design techniques such as X-ray crystallography, computer-aided (or assisted) molecular modeling (CAMM), quantitative or qualitative structure-activity relationship (QSAR), and similar technologies can be utilized to focus drug discovery efforts.
- Rational design allows prediction of protein or synthetic structures which can interact with the molecule or specific forms thereof which can be used to modify or modulate the activity of CTLA-4. Such structures can be synthesized chemically or expressed in biological systems. This approach has been reviewed in Capsey et al. Genetically Engineered Human Therapeutic Drugs (Stockton Press, NY (1988)). Indeed, the rational design of molecules (either peptides, peptidomimetics, small molecules, or the like) based upon known, or delineated, structure-activity relationships with other molecules (such as antibodies in accordance with the invention) has become generally routine. See, e.g., Fry et al.
- formulations include, for example, powders, pastes, ointments, jellies, waxes, oils, lipids, lipid (cationic or anionic) containing vesicles (such as LipofectinTM), DNA conjugates, anhydrous absorption pastes, oil-in-water and water-in-oil emulsions, emulsions carbowax (polyethylene glycols of various molecular weights), semi-solid gels, and semi-solid mixtures containing carbowax. Any of the foregoing mixtures may be appropriate in treatments and therapies in accordance with the present invention, provided that the active ingredient in the formulation is not inactivated by the formulation and the formulation is physiologically compatible and tolerable with the route of administration.
- Antibodies in accordance with the invention are preferably prepared through the utilization of a transgenic mouse that has a substantial portion of the human antibody producing genome inserted but that is rendered deficient in the production of endogenous, murine, antibodies. Such mice, then, are capable of producing human immunoglobulin molecules and antibodies and are deficient in the production of murine immunoglobulin molecules and antibodies. Technologies utilized for achieving the same are disclosed in the patents, applications, and references disclosed in the Background, herein. In particular, however, a preferred embodiment of transgenic production of mice and antibodies therefrom is disclosed in U.S. Patent Application Serial No. 08/759,620, filed December 3, 1996, the disclosure of which is hereby incorporated by reference. See also Mendez et al.
- the antibodies derived from hybridoma cell lines discussed herein are designated 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, and 12.9.1.1.
- Each of the antibodies produced by the aforementioned cell lines are either fully human IgG2 or IgG4 heavy chains with human kappa light chains.
- antibodies in accordance with the invention possess very high affinities, typically possessing Kd's of from about 10 "9 through about 10 "11 M, when measured by either solid phase or solution phase.
- antibodies in accordance with the present invention can be expressed in cell lines other than hybridoma cell lines. Sequences encoding the cDNAs or genomic clones for the particular antibodies can be used for transformation of a suitable mammalian or nonmammalian host cells. Transformation can be by any known method for introducing polynucleotides into a host cell, including, for example packaging the polynucleotide in a virus (or into a viral vector) and transducing a host cell with the virus (or vector) or by transfection procedures known in the art, as exemplified by U.S. Patent Nos.
- Mammalian cell lines available as hosts for expression are well known in the art and include many immortalized cell lines available from the American Type Culture Collection (ATCC), including but not limited to Chinese hamster ovary (CHO) cells, NSO 0 , HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), and a number of other cell lines.
- ATCC American Type Culture Collection
- Non-mammalian cells including but not limited to bacterial, yeast, insect, and plants can also be used to express recombinant antibodies.
- Site directed mutagenesis of the antibody CH2 domain to eliminate glycosylation may be preferred in order to prevent changes in either the immunogenicity, pharmacokinetic, and/or effector functions resulting from non-human glycosylation.
- the expression methods are selected by determining which system generates the highest expression levels and produce antibodies with constitutive CTLA-4 binding properties.
- antibodies of the invention can be enhanced using a number of known techniques.
- glutamine sythetase and DHFR gene expression systems are common approaches for enhancing expression under certain conditions.
- High expressing cell clones can be identified using conventional techniques, such as limited dilution cloning and Microdrop technology.
- the GS system is discussed in whole or part in connection with European Patent Nos. 0 216 846, 0 256 055, and 0 323 997 and European Patent Application No. 89303964.4.
- Antibodies of the invention can also be produced transgenically through the generation of a mammal or plant that is transgenic for the immunoglobulin heavy and light chain sequences of interest and production of the antibody in a recoverable form therefrom.
- antibodies can be produced in, and recovered from, the milk of goats, cows, or other mammals. See, e.g., U.S. Patent Nos. 5,827,690, 5,756,687, 5,750,172, and 5,741,957.
- Antibodies in accordance with the present invention have been analyzed structurally and functionally. In connection with the structures of the antibodies, amino acid sequences of the heavy and kappa light chains have been predicted based on cDNA sequences obtained through RT-PCR of the hybridomas. See Examples 3 and 4 and Figures 1-8. N-terminal sequencing of the antibodies was also conducted in confirmation of the results discussed in Examples 3 and 4. See Example 5 and Figure 9. Kinetic analyses of the antibodies were conducted to determine affinities. See Example 2.
- Antibodies in accordance with the invention (and particularly the 4.1.1, 4.8.1, and 6.1.1 antibodies of the invention) have high affinities (4.1.1 :1.63 X 10 10 1/M; 4.8.1:3.54 X 10 10 1/M; and 6.1.1:7.2 X 10 9 1/M). Further, antibodies were analyzed by isoelectric focusing (IEF), reducing gel electrophoresis (SDS- PAGE), size exclusion chromatography, liquid chromatography/mass spectroscopy, and mass spectroscopy and antibody production by the hybridomas was assessed. See Example 6 and Figure 10.
- antibodies in accordance with the present invention proved to be potent inhibitors of CTLA-4 and its binding to its ligands of the B7 family of molecules.
- antibodies in accordance with the present invention were demonstrated to block CTLA-4 binding to either B7-1 or B7-2. See Example 7. Indeed, many of the antibodies in accordance with the invention possess nanomolar and subnanomolar IC 50 s with respect to inhibiting CTLA-4 binding to B7-1 and B7- 2. Further, antibodies of the invention possess excellent selectivity for CTLA-4 as compared to CD28, CD44, B7-2, or hlgGl. See Example 8.
- Selectivity is a ratio that reflects the degree of preferential binding of a molecule with a first agent as compared to the molecules binding with a second, and optionally other molecules.
- selectivity refers to the degree of preferential binding of an antibody of the invention to CTLA-4 as compared to the antibody's binding to other molecules such as CD28, CD44, B7-2, or hlgGl.
- Selectivity values of antibodies of the invention greater than 500:1 are common.
- Antibodies of the invention have also been demonstrated to induce or enhance expression of certain cytokines (such as IL-2 and IFN- ⁇ ) by cultured T cells in a T cell blast model. See Examples 9 and 10 and Figures 12-17. Further, it is expected that antibodies of the invention will inhibit the growth of tumors in appropriate in vivo tumor models. The design of which models are discussed in Example 11 and 12.
- the 4.1.1, 4.8.1, and 6.1.1 antibodies of the invention possess highly desirable properties.
- Their structural characteristics, functions, or activities provide criteria that facilitate the design or selection of additional antibodies or other molecules as discussed above. Such criteria include one or more of the following:
- Cross reacts with primate CTLA-4 including, preferably, cynomolgous and rhesus CTLA-4;
- An enhancement of cytokine production in one or more in vitro assays for example:
- IL-2 production is enhanced by about 30, 35, 40, 45, 50 percent or more relative to control in the assay.
- the desirable functional properties discussed above can often result from binding to and inhibition of CTLA4 by a molecule (i.e., antibody, antibody fragment, peptide, or small molecule) in a similar manner as an antibody of the invention (i.e., binding to the same or similar epitope of the CTLA4 molecule).
- the molecule may either be administered directly (i.e., direct administration to a patient of such molecules).
- the molecule may be "administered" indirectly (i.e., a peptide or the like that produces an immune response in a patient (similar to a vaccine) wherein the immune response includes the generation of antibodies that bind to the same or similar epitope or an antibody or fragment that is produced in situ after administration of genetic materials that encode such antibodies or fragments thereof which bind to the same or similar epitope).
- a peptide or the like that produces an immune response in a patient (similar to a vaccine) wherein the immune response includes the generation of antibodies that bind to the same or similar epitope or an antibody or fragment that is produced in situ after administration of genetic materials that encode such antibodies or fragments thereof which bind to the same or similar epitope.
- the 11.2.1 antibody of the invention binds to human, cynomologous, and marmoset CTLA4 at the about the same rate and has about the same relative off-rate for each of the three.
- This information further indicates that the 4.1.1 and 11.2.1 antibodies of the invention bind to different epitopes on CTLA4.
- Marmoset CTLA4 possesses two important changes at residues 105 and 106 relative to human CTLA4. Such differences are a Ieucine to methionine change at residue 105 and a glycine to serine change at residue 106.
- each of the category B through D antibodies of the invention appear to possess similar functional properties and appear to have the potential to act as strong anti-CTLA4 therapeutic agents. Further, each of the molecules certain cross-competition in their binding for CTLA4. However, as will be observed from the above discussion, each of the molecules in the different categories appear to bind to separate conformational epitopes on CTLA4. From the foregoing, it will be appreciated that the epitope information discussed above indicates that antibodies (or other molecules, as discussed above) that cross-compete with antibodies of the invention will likely have certain therapeutic potential in accordance with the present invention.
- antibodies (or other molecules, as discussed above) that cross- compete with antibodies of the invention will likely have certain additional therapeutic potential in accordance with the present invention.
- antibodies (or other molecules, as discussed above) that cross-compete with antibodies of the invention i.e., cross-compete with category B, C and/or D antibodies
- antibodies (i) that cross-compete with antibodies of the invention i.e., cross-compete with category B, C and/or D antibodies) and that (i) are not reduced in their binding to marmoset CTLA4 (similar to the 11.2.1 antibody) or (ii) are reduced in their binding to marmoset CTLA4 (similar to the 4.1.1 antibody) will likely have certain additional therapeutic potential in accordance with the present invention.
- Antibodies (or other molecules, as discussed above) that compete with categories A and E may also have certain therapeutic potential.
- Antibodies of the invention were prepared, selected, and assayed in accordance with the present Example.
- Three distinct immunogens were prepared for immunization of the XenoMouseTM mice: (i) a CTLA-4-IgG fusion protein, (ii) a CTLA-4 peptide, and (iii) 300.19 murine lymphoma cells transfected with a mutant of CTLA-4 (Y201V) that is constitutively expressed on the cell surface.
- the cDNA encoding the mature extracellular domain of CTLA-4 was PCR amplified from human thymus cDNA library (Clontech) using primers designed to published sequence (Eur. J Immunol 18:1901-1905 (1988)). The fragment was directionally subcloned into pSR5, a Sindbis virus expression plasmid (InVitrogen), between the human oncostatin M signal peptide and human IgG gamma 1 (IgGl) CH1/CH2/CH3 domains. The fusion protein does not contain a hinge domain but contains cysteine 120 in the extracellular domain of CTLA-4 to form a covalent dimer. The resulting vector was called CTLA-4-IgGl/pSR5.
- CTLA-4-IgGl cDNA in the vector was sequence confirmed in both strands.
- the amino acid sequence the CTLA4-Ig protein is shown below.
- the mature extracellular domain for CD44 was PCR amplified from human lymphocyte library (Clontech) and subcloned into pSinRep5 to generate a control protein with the identical IgGl tail.
- the cDNAs for mature extracellular domain of CD28 were PCR amplified from human lymphocyte library (Clontech) and then subcloned into pCDM8 (J. Immunol. 151 : 5261-71 (1993)) to produce a human IgGl fusion protein containing both thrombin cleavage and hinge regions.
- Marmoset, Cynomologous, and Rhesus CTLA4 were cloned from mRNA isolated from PHA stimulated PBMCs using standard techniques of degenerate PCR. Sequencing demonstrated that rhesus and cynomologous amino acid sequence were identical with three differences from mature human CTLA4 extracellular domain (S13N, I17T and L105M).
- Marmoset demonstrated ten amino acid differences from the mature human CTLA4 extracellular domain (V21A, N33I, A41T, A51G, 541, S71F, Q75K, T88M, L105M and G106S).
- Site directed mutagenesis was used to make single point mutations of all amino acids different in marmoset CTLA4 to map amino acids important for interation of the antibodies with human CTLA4-IgG.
- Mutations of human and marmoset CTLA-IgG for epitope mapping were generated by matchmaker site-directed mutagenesis (Promega).
- the IgG fusion proteins were produced by transient transfection of Cos7 cells and purified using standard Protein A techniques. Mutant CTLA4-IgG proteins were evaluated for binding to antibodies by immunoblotting and using BIAcore analyses.
- Recombinant Sindbis virus was generated by electroporating (Gibco) Baby Hamster Kidney cells with SP6 in vitro transcribed CTLA-4-IgGl/pSR5 mR ⁇ A and DH-26S helper mR ⁇ A as described by InNitrogen. Forty eight hours later recombinant virus was harvested and titered for optimal protem expression in Chinese hamster ovary cells (CHO-K1).
- CHO-K1 cells were cultured in suspension in DMEM/F12 (Gibco) containing 10%> heat-inactivated fetal bovine serum (Gibco), non-essential amino acids (Gibco), 4mM glutamine (Gibco), penicillin/streptomycin (Gibco), lOmM Hepes pH 7.5 (Gibco).
- DMEM/F12 Gibco
- the CHO-K1 cells were resuspended at lxlO 7 cells/ml in DMEM/F12 and incubated with Sindbis virus for one hour at room temperature.
- Cells were then diluted to lxl0 6 /ml in DMEM/F12 containing 1% fetal bovine serum depleted of bovine IgG using protein A sepharose (Pharmacia), non- essential amino acids, 4mM glutamine, 12.5mM Hepes pH 7.5, and penicillin/streptomycin. Forty eight hours post-infection cells were pelleted and conditioned media was harvested and supplemented with complete protease inhibitor tablets (Boehringer Mannheim), pH adjusted to 7.5, and filtered 0.2 ⁇ (Nalgene).
- FPLC protein A HiTrap column
- the column was washed with 30 bed volumes of PBS and eluted with 0.1M glycine/HCl pH 2.8 at lml/min. Fractions (1ml) were immediately neutralized to pH 7.5 with Tris pH 9. The fractions containing CTLA-4-IgGl were identified by SDS-PAGE and then concentrated using centriplus 50 (Amicon) before applying to sepharose 200 column (Pharmacia) at lml/min using PBS as the solvent.
- CTLA-4-IgGl migrated as a single band on SDS-PAGE using colloidal coomassie staining (Novex). Under non-reducing conditions CTLA-4-IgGl was a dimer (lOOkDa), that reduced to a 50kDa monomer when treated with 50mM DTT. Amino acid sequencing of the purified CTLA-4-IgGl in solution confirmed the N-terminus of CTLA-4 (MHVAQPAVVLAS), and that the oncostatin-M signal peptide was cleaved from the mature fusion protein
- CTLA-4-IgGl bound to immobilized B7.1-IgG in a concentration dependent manner and the binding was blocked by a hamster-anti-human anti- CTLA-4 antibody (BNI3: PharMingen).
- BNI3 hamster-anti-human anti- CTLA-4 antibody
- the sterile CTLA-4-IgG was endotoxin free and quantitated by OD280 using 1.4 as the extinction coefficient.
- the yield of purified CTLA-4-IgG ranged between 0.5-3mgs/liter of CHO-K1 cells.
- CTLA-4 peptide was prepared as described below:
- NMP N-Methylpyrrolidinone
- TFE 2,2,2-Trifluoroethanol
- DCM Dichloromethane
- FMOC Fluorenyl Methoxycarbonyl. All reagents were supplied by Perkin Elmer, with the following exceptions: TFE, Aldrich Chemical, FMOC-PAL-PEG resin, Perseptive Biosystems.
- Fmoc-Arg(PMC)- OH, FMOC-Asn(Trt)-OH, FMOC-Asp(tBu)-OH, FMOC-Cys(Trt)-OH, FMOC- Glu(tBu)-OH, FMOC-Gln(Trt)-OH, FMOC-His(Boc)-OH, FMOC-Lys(BOC)- OH, FMOC-Ser(tBu)-OH, FMOC-Thr(tBu)-OH and FMOC-Tyr(tBu)-OH were used for those amino acids requiring side chain protecting groups
- Peptide synthesis was performed on a Perkin-Elmer 431 A, retrofitted with feedback monitoring via UV absorbance at 301nm (Perkin-Elmer Model 759A detector).
- the peptide sequence was assembled on a FMOC-PAL-PEG resin using conditional double coupling cycles. Forced double couplings were performed at cycles 10,11,18,19,20 and 28 through 33.
- the resin was washed with a 50%) mixture of DCM and TFE at the completion of each acylation cycle, followed by capping of unreacted amino groups with acetic anhydride in NMP. Resin was removed from the reactor after completing cycle 49 and the remainder continued to completion.
- Peptide cleavage from the resin was performed using Reagent K (King et al. International Journal of Protein and Peptide Research 36:255-266 (1990)) for 6 hours on 415mg of resin affording 186mg crude CTLA-4 peptide.
- CTLA-4 cDNA was PCR amplified from human thymus cDNA library (Stratagene) and subcloned into pIRESneo (Clontech). A mutation of CTLA-4 that results in constitutive cell surface expression was introduced using MatchMaker Mutagenesis System (Promega). Mutation of tyrosine, Y201 to valine inhibits binding of the adaptin protein AP50 that is responsible for the rapid internalization of CTLA-4 (Chuang et al. J. Immunol. 159:144-151 (1997)).
- Mycoplasma-free 300.19 murine lymphoma cells were cultured in RPMI-1640 containing 10%> fetal calf serum, non-essential amino acids, penicillin streptomycin, 2mM glutamine, 12.5mM Hepes pH 7.5, and 25uM beta-mercaptoethanol. Cells were electroporated (3xl0 6 /0.4ml serum free RPMI) in a 1ml chamber with 20ug CTLA-4-Y201V/pIRESneo using 200V/1180uF (Gibco CellPorator). Cells were rested for 10 minutes and then 8mls of prewarmed complete RPMI media.
- XenoMouse mice (8 to 10 weeks old) were immunized (i) subcutaneously at the base of tails with lxlO 7 300.19 cells that were transfected to express CTLA-4 as described above, resuspended in phosphate buffered saline (PBS) with complete Freund's adjuvant, or (ii) subcutaneously at the base of tail with (a) 10 ⁇ g the CTLA-4 fusion protein or (b) 10 ⁇ g CTLA-4 peptide, emulsified with complete Freund's adjuvant. In each case, the dose was repeated three or four times in incomplete Freund's adjuvant.
- PBS phosphate buffered saline
- mice received a final injection of the immunogen or cells in PBS.
- Spleen and/or lymph node lymphocytes from immunized mice were fused with the [murine non-secretory myeloma P3 cell line] and were subjected to HAT selection as previously described (Galfre, G. and Milstein, C, "Preparation of monoclonal antibodies: strategies and procedures.” Methods Enzymol. 73:3-46 (1981)).
- a large panel of hybridomas all secreting CTLA-4 specific human IgG ⁇ or IgG 4 ⁇ (as detected below) antibodies were recovered.
- ELISA assay ELISA for determination of antigen-specific antibodies in mouse serum and in hybridoma supernatants was carried out as described (Coligan et al., Unit 2.1, "Enzyme-linked immunosorbent assays," in Current protocols in immunology (1994)) using CTLA-4-Ig fusion protein to capture the antibodies.
- CTLA-4-Ig fusion protein For animals that are immunized with the CTLA-4-Ig fusion protein, we additionally screen for non-specific reactivity against the human lg portion of the fusion protein. This is accomplished using ELISA plates coated with human IgGl as a negative control for specificity.
- ELISA plates are coated with 100 ⁇ l/well of the antigen in plate coating buffer (0.1 M Carbonate Buffer, pH 9.6 and NaHCO 3 (MW 84) 8.4g/L). Plates are then incubated at 4°C overnight. After incubation, coating buffer is removed and the plate is blocked with 200 ⁇ l/well blocking buffer (0.5%> BSA, 0.1%) Tween 20, 0.01%> Thimerosal in lx PBS) and incubated at room temperature for 1 hour. Alternatively, the plates are stored in refrigerator with blocking buffer and plate sealers. Blocking buffer is removed and 50 ⁇ l/well of hybridoma supernatant, serum or other hybridoma supernatant (positive control) and HAT media or blocking buffer (negative control) is added.
- plate coating buffer 0.1 M Carbonate Buffer, pH 9.6 and NaHCO 3 (MW 84) 8.4g/L. Plates are then incubated at 4°C overnight. After incubation, coating buffer is removed and the plate is blocked with 200
- the plates are incubated at room temperature for 2 hours. After incubation, the plate is washed with washing buffer (lx PBS).
- the detecting antibody i.e., mouse anti- human IgG2-HRP (SB, #9070-05) for IgG2 antibodies or mouse anti-human IgG4-HRP (SB #9200-05) for IgG4 antibodies
- the detecting antibody is added at lOO ⁇ l/well (mouse anti-human IgG2-HRP @ 1:2000 or mouse anti-human IgG4-HRP @ 1 :1000 (each diluted in blocking buffer)).
- the plates are incubated at room temperature for 1 hour and then washed with washing buffer.
- Affinity measurement of purified human monoclonal antibodies, Fab fragments, or hybridoma supernatants by plasmon resonance was carried out using the BIAcore 2000 instrument, using general procedures outlined by the manufacturers.
- Kinetic analysis of the antibodies was carried out using antigens immobilized onto the sensor surface at a low density.
- Three surfaces of the BIAcore sensorchip were immobililized with the CTLA-4-Ig fusion protein at a density ranging from approximately 390-900 using CTLA-4-Ig fusion protein at 20 or 50 ⁇ g/ml in 10 mM sodium acetate at pH 5.0 using the amine coupling kit supplied by the manufacturer (BIAcore, Inc.).
- the fourth surface of the BIAcore sensorchip was immobilized with IgGl (900 RU) and was used as a negative control surface for non-specific binding.
- Kinetic analysis was performed at a flow rate of 25 or 50 microliters per minute and dissociation (kd or k off ) and association (ka or k on ) rates were determined using the software provided by the manufacturer (BIA evaluation 3.0) that allows for global fitting calculations.
- antibodies prepared in accordance with the invention possess high affinities and binding constants.
- PCR products were also cloned into pCRII using a TA cloning kit (Invitrogen) and both strands were sequenced using Prism dye-terminator sequencing kits and an ABI 377 sequencing machine. All sequences were analyzed by alignments to the "V BASE sequence directory" (Tomlinson et al., MRC Centre for Protein Engineering, Cambridge, UK) using MacVector and Geneworks software programs.
- each of the antibodies 4.1.1, 4.8.1, 11.2.1, and 6.1.1 were subjected to full length DNA sequences.
- Poly(A) + mRNA was isolated from approximately 4 X 10 6 hybridoma cells using mRNA Direct kit (Dynal). The mRNA was reverse transcribed using oligo-dT(18) and the Advantage RT/PCR kit (Clonetech).
- V Base The Variable region database (V Base) was used to design amplification primers beginning at the ATG start site of the heavy chain DP50 gene (5'- TATCTAAGCTTCTAGACTCGACCGCCACCATGGAGTTTGGGCTGAGC TG-3') and to the stop codon of the IgG2 constant region (5'- TTCTCTGATCAGAATTCCTATCATTTACCCGGAGACAGGGAGAGCT- 3').
- An optimal Kozak sequence (ACCGCCACC) was added 5' to the ATG start site.
- the same method was used to design a primer to the ATG start site of the kappa chain A27 gene (5'-
- TCTTCAAGCTTGCCCGGGCCCGCCACCATGGAAACCCCAGCGCAG -3' the stop codon of the kappa constant region (5'- TTCTTTGATCAGAATTCTCACTAACACTCTCCCCTGTTGAAGC-3').
- the 012 cDNA was cloned by using a primer to the ATG start site (5'- TCTTCAAGCTTGCCCGGGCCCGCCACCATGGACATGAGGGTCCCCGC T-3) and the kappa constant region stop codon primer above.
- the heavy chain cDNAs were also cloned as genomic constructs by site directed mutagenesis to add an Nhel site at the end of the variable J domain and subcloning an Nhel- fragment containing the genomic IgG2 CH1/Hinge/CH2/CH3 regions.
- the point mutation to generate Nhel site does not alter the amino acid sequence from germline.
- the primer pairs were used to amplify the cDNAs using Advantage High Fidelity PCR Kit (Clonetech). Sequence of the PCR was obtained by direct sequencing using dye-terminator sequencing kits and an ABI sequencing machine.
- the PCR product was cloned into pEE glutamine synthetase mammalian expression vectors (Lonza) and three clones were sequenced to confirm somatic mutations. For each clone, the sequence was verified on both strands in at least three reactions.
- An aglycosylated 4.1.1 antibody was generated by site directed mutagenesis of N294Q in the CH2 domain.
- Recombinant antibodies were produced by transient trasnfection of Cos7 cells in IgG depleted FCS and purified using standard Protein A sepharose techniques. Stable transfectants were generated by electroporation of murine NSO cells and selection in glutamine free media.
- Recombinant 4.1.1 with or without glycosylation exhibited identical specificity and affinity for CTLA4 in the in vitro ELISA and BIAcore assays.
- the DP-50 gene is also referred to as a V H 3-33 family gene. Only one antibody that was selected on the basis of CTLA-4 binding and preliminary in vitro functional assays showed a heavy chain gene utilization other than DP-50. That clone, 2.1.3, utilizes a DP-65 heavy chain variable region and is an IgG4 isotype. The DP-65 gene is also referred to as a V H 4-31 family gene. On the other hand, the clone, 4.9.1, which possesses a DP-47 heavy chain variable region binds to CTLA-4 but does not inhibit binding to B7-1 or B7-2.
- Bias is indicative of a preferred binding motif of the antibody-antigen interaction with respect to the combined properties of binding to the antigen and functional activity.
- Figure 1 provides nucleotide and predicted amino acid sequences of the heavy and kappa light chains of the clones 4.1.1 (Figure 1A), 4.8.1 (Figure IB), 4.14.3 (Figure IC), 6.1.1 (Figure ID), 3.1.1 (Figure IE), 4.10.2 (Figure IF), 2.1.3 ( Figure 1G), 4.13.1 ( Figure 1H), 11.2.1 (Figure II), 11.6.1 (Figure 1J), 11.7.1 (Figure IK), 12.3.1.1 ( Figure IL), and 12.9.1.1 (Figure 1M).
- Figures 1A, IB, and ID extended sequences of the antibodies 4.1.1, 4.8.1, and 6.1.1 were obtained by full length cloning of the cDNAs as described above.
- the signal peptide sequence or the bases encoding the same
- sequences utilized for the 5' PCR reaction are underlined.
- Figure 2 provides a sequence alignment between the predicted heavy chain amino acid sequences from the clones 4.1.1, 4.8.1, 4.14.3, 6.1.1, 3.1.1, 4.10.2, 4.13.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, and 12.9.1.1 and the germline DP-50 (3-33) amino acid sequence. Differences between the DP-50 germline sequence and that of the sequence in the clones are indicated in bold. The Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibodies as shaded.
- Figure 3 provides a sequence alignment between the predicted heavy chain amino acid sequence of the clone 2.1.3 and the germline DP-65 (4-31) amino acid sequence. Differences between the DP-65 germline sequence and that of the sequence in the clone are indicated in bold. The Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibody as underlined.
- Figure 4 provides a sequence alignment between the predicted kappa light chain amino acid sequence of the clones 4.1.1, 4.8.1, 4.14.3, 6.1.1, 4.10.2, and 4.13.1 and the germline A27 amino acid sequence. Differences between the A27 germline sequence and that of the sequence in the clone are indicated in bold.
- the Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibody as underlined. Apparent deletions in the CDRls of clones 4.8.1, 4.14.3, and 6.1.1 are indicated with "0s".
- Figure 5 provides a sequence alignment between the predicted kappa light chain amino acid sequence of the clones 3.1.1, 11.2.1, 11.6.1, and 11.7.1 and the germline 012 amino acid sequence. Differences between the 012 germline sequence and that of the sequence in the clone are indicated in bold. The Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibody as underlined.
- Figure 6 provides a sequence alignment between the predicted kappa light chain amino acid sequence of the clone 2.1.3 and the germline A10/A26 amino acid sequence. Differences between the A10/A26 germline sequence and that of the sequence in the clone are indicated in bold. The Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibody as underlined.
- Figure 7 provides a sequence alignment between the predicted kappa light chain amino acid sequence of the clone 12.3.1 and the germline A17 amino acid sequence. Differences between the A17 germline sequence and that of the sequence in the clone are indicated in bold. The Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibody as underlined.
- Figure 8 provides a sequence alignment between the predicted kappa light chain amino acid sequence of the clone 12.9.1 and the germline A3/A19 amino acid sequence. Differences between the A3/A19 germline sequence and that of the sequence in the clone are indicated in bold. The Figure also shows the positions of the CDRl, CDR2, and CDR3 sequences of the antibody as underlined.
- Figure 22 provides a series of additional nucleotide and amino acid sequences of the following anti-CTLA-4 antibody chains:
- 4.1.1 full length 4.1.1 heavy chain (cDNA 22(a), genomic 22(b), and amino acid 22(c)); full length aglycosylated 4.1.1 heavy chain (cDNA 22(d) and amino acid 22(e));
- 6.1.1 full length 6.1.1 heavy chain (cDNA 22(1) and amino acid 22(m));
- CTLA-4 molecule Further, such substitutions could have significant effect upon the affinity of the antibodies.
- Figure 9 also provides the molecular weight of the heavy and light chains as determined by mass spectroscopy (MALDI).
- MALDI mass spectroscopy
- Figure 10 provides certain additional characterizing information about certain of the antibodies in accordance with the invention.
- data related to clones 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.14.3, and 6.1.1 is summarized. The following data is provided: Concentration, isoelectric focusing (IEF), SDS- PAGE, size exclusion chromatography, FACS, mass spectroscopy (MALDI), and light chain N-terminal sequences.
- Protein concentration was determined at 280 nm from a UV scan (200-
- SEC Size exclusion chromatography
- T cells human peripheral T cells were prepared and stimulated for 48 hours. T cells were washed once, resuspended in FACS buffer at lxlO 6 cells/ 100 ul and stained for CD3 surface expression with 10 ul of anti-CD3-FITC (Immunotech, Marseille, France) for 30 minutes at room temperature. Cells were washed twice, then fixed, permeabilized (Fix and Perm, Caltag), and stained for intracellular CTLA-4 expression with 10 ul anti- CD152-PE (Pharmingen). Flow cytometry was performed using a Becton Dickinson FACSort. Quadrants were set by analysis of relevant isotype control antibodies (Caltag).
- anti-CTLA-4 antibodies have been demonstrated to possess certain powerful immune modulation activities.
- the following experiments were carried out in order to determine if antibodies in accordance with the present invention possessed such activities.
- the experiments were designed to assess ability of the antibodies to inhibit the interaction between CTLA-4 and B7 molecules, be selective as between CTLA- 4 and B7 molecules and CD28, and promote T cell cytokine production, including, but not limited to IL-2 and/or IFN- ⁇ expression.
- examination of cross-reactivity of antibodies of the invention with certain human tissues and CTLA-4 molecules in other species was undertaken.
- Needham, MA were pre-mixed for 15 minutes and then added to the B7-Ig coated plate (60 ul total volume) and incubated at RT for 1.5 hours. Plates were washed 3X and 50 ⁇ l of a 1 to 1000 dilution of HRP-labeled mouse anti-human IgG4 antibody (Zymed, San Francisco, CA, #05-3820) was added and incubated at RT for 1 hour. Plates were washed 3X and 50 ⁇ l TMB Microwell peroxidase substrate (Kirkegaard & Perry, Gaithersburg, MD, #50- 76-04) was added and incubated at RT for 20 minutes, and then 50 ⁇ l IN H 2 SO 4 was added to the plate.
- HRP-labeled mouse anti-human IgG4 antibody Zymed, San Francisco, CA, #05-3820
- Table IIIA and IIIB The results from the assay are provided in Table IIIA and IIIB.
- Table IIIA results are shown for a variety of antibodies in accordance with the invention.
- Table IIIB results are shown comparing the 4.1.1 antibody of the invention with the 11.2.1 antibody of the invention from a separate experiment.
- a 96-well FluroNUNC plate (Nunc Cat No.475515) was platecoated with four antigens: CTLA-4/Ig, CD44/Ig, CD28/Ig, and B7.2/Ig (antigens generated in-house).
- the antigens were platecoated overnight at +4°C at lug/ml lOOul/well in 0.1M sodium bicarbonate buffer, pH 9.6.
- the plate was then washed with PBST (PBS + 0.1% Tween-20) three times using a NUNC plate washer.
- the plate was blocked with PBST+0.5%BSA at 150 ul/well.
- the plate was incubated at RT for 1 hour then washed with PBST three times.
- the anti-CTLA-4 antibodies of the invention were diluted in block at 1 ⁇ g/ml and were added to the plate.
- the plate was incubated at RT for 1 hour then washed with PBST three times.
- the wells that contained the antibodies of the invention were then treated with 100 ⁇ l/well anti-human IgG2-HRP (Southern Biotech Cat No.9070-05) at a 1 :4000 dilution in block.
- one row was treated with anti -human IgG (Jackson Cat No. 209-035-088) to normalize for platecoating. This antibody was diluted to 1 :5000 in block and added at 100 ul/well.
- CTLA-4-HRP Human CTLA-4-HRP
- Anti-human CTLA-4-HRP Pharmingen Cat No. 345815/Custom HRP conjugated
- This antibody was used at 0.05 ug/ml diluted in block.
- the plate was incubated at RT for 1 hour then washed with PBST three times.
- LBA chemiluminescent substrate (Pierce) was added at 100 ⁇ l/well and the plate was incubated on a plateshaker for 5 min. The plate was then read using a lumi-imager for a 2 min. exposure.
- IGEN CTLA-4-Ig Selectivity Binding Assay Materials and Methods
- Beads were diluted 1 to 10 with blocking buffer and 25 ⁇ l of the coated beads were added to 12x75 mm polypropylene tubes. All samples were tested in duplicate. 50 ⁇ l test antibody (1 ⁇ g/ml final concentration) or blocking buffer was added to the tubes and incubated for 30 minutes on the Origen 1.5 Analyzer carousel (IGEN International, Inc., Gaithersburg, MD) at RT, vortexing at 100 rpm. 25 ⁇ l of ruthenylated murine anti-human IgGl, IgG2 or IgG4 (Zymed, Inc.
- Freshly isolated human T cells were prepared by using Histopaque (Sigma, St. Louis, MO #A-70543) and T-kwik (Lympho-Kwik, One Lambda, Canoga Park, CA, #LK-50-T), and stimulated with PHA (1 ⁇ g/ml) (Purified Phytohemagglutinin, Murex Diagnostics Ltd. Dartford, England, #HA 16) in medium (RPMI 1640 containing L-glutamine, MEM non-essential amino acids, penicillin, streptomycin, 25 mM Hepes and 10%o FBS) at a concentration of lxlO 6 cells/ml and incubated at 37°C for 2 days.
- the cells were washed and diluted in medium to 2xl0 6 cells/ml.
- Raji cells (Burkitt lymphoma, Human ATCC No.: CCL 86 Class II American Type Culture Collection Rockville, MD) were treated with mitomycin C (Sigma St. Louis, MO, # M-4287) (25 ⁇ g/ml) for one hour at 37°C.
- the Raji cells were washed 4X in PBS and resuspended at 2xl0 6 cells/ml.
- Human T cell blasts (5xl0 5 /ml), Raji cells (5xl0 5 /ml) and anti-CTLA-4 antibodies or an isotyped-matched control antibody at various concentrations were added to 96-well microtiter plates and the plates were incubated at 37°C for 72 hours. Total volume per well was 200 ⁇ l. Seventy- two hours post stimulation, the plates were spun down and supernatant removed and frozen for later determination of IL-2 (Quantikine IL-2 ELISA kit, R&D Systems, Minneapolis, MN, #D2050) and IFN- ⁇ (Quantikine IFN-g ELISA kit, R&D Systems).
- Cytokine enhancement was defined as the difference between cytokine levels in cultures containing an anti-CTLA-4 blocking mAb versus an isotype-matched control antibody.
- Raji cells were washed lx with FACS buffer (PBS containing 2% heat inactivated FCS, 0.025%) sodium azide).
- FACS buffer PBS containing 2% heat inactivated FCS, 0.025%) sodium azide.
- Cell pellets were resuspended in FACS buffer at 1x10° cells/100 ⁇ l and incubated with 10 ⁇ l of anti-CD80-PE (Becton Dickinson, San Jose, CA) or anti-CD86-PE (Pharmingen, San Diego, CA) for 30 minutes at room temperature. Cells were washed twice and resuspended in 1 ml FACS buffer.
- Flow cytometry was performed using a Becton Dickinson FACSort. Histogram markers were set by analysis of relevant isotype control antibodies (Caltag, Bur
- T-cell IL-2 upregulation In general, we have developed an assay that can be used for rapid determination of T-cell IL-2 upregulation. As will be appreciated, stimulation of T cells is B7 and CD28 dependent. Further, washed T blasts do not make detectable IL-2 and Raji cells do not make detectable IL-2 even when stimulated with LPS or PWM. However, in combination, the T blasts co- cultured with Raji cells can model B7, CTLA-4, and CD28 signaling events and the effects of antibodies thereon can be assessed.
- Figure 11 shows the expression of B7-1 and B7-2 on Raji cells using anti-CD80-PE and anti-CD86-PE mAbs using flow cytometry (FACs) as described in Example 6.
- Figure 12 shows the concentration dependent enhancement of IL-2 production in the T cell blast/Raji assay induced by CTLA-4 blocking antibodies (BNI3 (PharMingen) and the 4.1.1, 4.8.1, and 6.1.1 antibodies of the invention).
- Figure 13 shows the concentration dependent enhancement of IFN- ⁇ production in the T cell blast/Raji assay induced by CTLA-4 blocking antibodies (BNI3 (PharMingen) and the 4.1.1, 4.8.1, and 6.1.1 antibodies of the invention) (same donor T cells).
- CTLA-4 blocking antibodies BNI3 (PharMingen) and the 4.1.1, 4.8.1, and 6.1.1 antibodies of the invention
- Figure 14 shows the mean enhancement of IL-2 production in T cells from 6 donors induced by CTLA-4 blocking antibodies in the T cell blast/Raji assay. It is interesting to consider that the mAb, CT4.9.1, binds to CTLA4 but does not block B7 binding. Thus, simply binding to CTLA-4 is insufficient by itself to provide a functional antibody of the invention.
- Figure 15 shows the mean enhancement of IFN- ⁇ production in T cells from 6 donors induced by CTLA-4 blocking antibodies in the T cell blast/Raji assay.
- Figure 19 shows a comparison between the 4.1.1 and 11.2.1 antibodies of the invention at a concentration of 30 ⁇ g/ml in the 72 hour T cell blast/Raji assay as described in this Example 9 and the Superantigen assay described in Example 10.
- Figure 20 shows the concentration dependent enhancement of IL-2 production in the T cell blast/Raji assay induced by the 4.1.1 and 11.2.1 CTLA4 antibodies of the invention.
- Table IVc provides information related to mean enhancement and range of enhancement of cytokine response in the Raji and SEA assays of the invention.
- Each of the experiments included in the results are based on antibody at a dose of 30 ⁇ g/ml and measured at 72 hours. Numbers of donors used in the experiments as well as responses are shown.
- Human PBMC were prepared using Accuspin. Microtiter plates were precoated with an anti-CD3 antibody (leu4, Becton Dickinson) (60 ng/ml) and incubated for 2 hours at 37°C. hPBMC were added to the wells at 200,000 cells per well. Staphylcoccus enterotoxin A (SEA) (Sigma) was added to the wells at 100 ng/ml. Antibodies were added to the wells, usually at 30 ⁇ g/ml. Cells were then stimulated for 48, 72 or 96 hours. Plates were centrifuged at the desired time-point and supematants were removed from the wells. Thereafter, supematants were checked for IL-2 production using ELISA (R&D Systems).
- SEA Staphylcoccus enterotoxin A
- results are shown from measurement of whole blood, analyzing the difference in induction of IL-2 production in the blood of 3 donors as measured at 72 and 96 hours after stimulation.
- mice Female A/J mice (6-8 weeks old) were injected subcutaneously on the dorsal side of the neck with 0.2 ml of SalN tumor cells (lxl 0 6 ) (Baskar 1995).
- Anti-murine CTLA-4 or an isotype matched control antibody (PharMingen, San Diego, CA, 200 ug/animal) were injected intraperitioneally on days 0, 4, 7 and 14 following the injection of tumor cells.
- Tumor measurements were taken during the course of the 3-4 week experiments using a Starrett SPC Plus electronic caliper (Athol, MA) and tumor size was expressed as the surface area covered by tumor growth (mm ).
- Figure 18 shows the inhibition of tumor growth with an anti-murine CTLA-4 antibody in a murine fibrosarcoma tumor model.
- animals treated with anti-CTLA-4 had a reduction in tumor growth as compared to animals treated with an isotype control antibody.
- anti-murine CTLA4 mAbs are capable of inhibiting growth of a fibrosarcoma in a mouse tumor model.
- a xenograft SCID mouse model was designed to test the eradication of established tumors and their derived metastases.
- SCID mice are provided with grafted human T cells and are implanted with patient-derived non-small cell lung cell (NSCL) or colorectal carcinoma (CC) cells. Implantation is made into the gonadal fat pads of SCID mice. The tumors are allowed to grow, and thereafter removed. The mice develop humanlike tumor and liver metastases.
- NSCL non-small cell lung cell
- CC colorectal carcinoma
Landscapes
- Health & Medical Sciences (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Pain & Pain Management (AREA)
- Rheumatology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (33)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR9916853-7A BR9916853A (pt) | 1998-12-23 | 1999-12-23 | Anticorpos monoclonais humanos ao ctla-4 |
| HUP1300750 HU1300750D0 (hu) | 1998-12-23 | 1999-12-23 | CTLA-4 elleni humán monoklonális ellenanyagok |
| APAP/P/2001/002213A AP1590A (en) | 1998-12-23 | 1999-12-23 | Human monoclonal antibodies to CTLA-4. |
| EP18200101.6A EP3553085A1 (en) | 1998-12-23 | 1999-12-23 | Human momoclonal antibodies to ctla-4 |
| HK02102809.5A HK1041274B (zh) | 1998-12-23 | 1999-12-23 | 抗ctla-4的人单克隆抗体 |
| UA2001075213A UA76936C2 (en) | 1998-12-23 | 1999-12-23 | Human monoclonal antibody binding the antigen-4 of cytotoxic t-lymphocyte (ctla-4), nucleic acid, cell line, method of obtaining transgenic mammal, method to increase producing il-2 or ifn-? in the t-cells of a patient, method to treat and pharmaceutical composition used in treatment of cancer, inflammation or autoimmune disease, including the antibody |
| AT99966644T ATE458008T1 (de) | 1998-12-23 | 1999-12-23 | Humane monoklonale antikörper gegen ctla-4 |
| NZ512553A NZ512553A (en) | 1998-12-23 | 1999-12-23 | Human monoclonal antibodies to cytotoxic T lymphocyte antigen 4 (CTLA-4) |
| MXPA01006422A MXPA01006422A (es) | 1998-12-23 | 1999-12-23 | Anticuerpos monoclonales humanos de ctla-4. |
| HRP20130077AA HRP20130077A2 (hr) | 1998-12-23 | 1999-12-23 | Humana monoklonalna protutjela za ctla-4 |
| BRPI9916853A BRPI9916853B8 (pt) | 1998-12-23 | 1999-12-23 | anticorpo monoclonal ou um fragmento de ligação a antígeno do mesmo que se liga especificamente ao antígeno do linfócito t citotóxico 4 (ctla-4) e ácido nucleico |
| EP09007161.4A EP2112166B1 (en) | 1998-12-23 | 1999-12-23 | Human monoclonal antibodies to ctla-4 |
| CN99813642.5A CN1328571B (zh) | 1998-12-23 | 1999-12-23 | 抗ctla-4的人单克隆抗体 |
| SK914-2001A SK288057B6 (sk) | 1998-12-23 | 1999-12-23 | Human monoclonal antibody that binds to CTLA-4, pharmaceutical composition comprising same, cell line that produces antibody, nucleic acid and method for production of human CTLA-4 antibody |
| EA200100698A EA006972B1 (ru) | 1998-12-23 | 1999-12-23 | Моноклональное антитело человека к ctla-4 и способы его применения |
| SI9931041T SI1141028T1 (sl) | 1998-12-23 | 1999-12-23 | Človeška monoklonska protitelesa proti CTLA |
| EEP200100336A EE05483B1 (et) | 1998-12-23 | 1999-12-23 | CTLA-4 vastased inimese monoklonaalsed antikehad |
| SK5035-2011A SK288274B6 (sk) | 1998-12-23 | 1999-12-23 | Monoklonálna protilátka proti CTLA-4, spôsob jej výroby, farmaceutická kompozícia, bunková línia, izolovaná nukleová kyselina, hostiteľská bunka, transgénny cicavec a použitie monoklonálnej protilátky |
| JP2000589573A JP3793693B2 (ja) | 1998-12-23 | 1999-12-23 | Ctla−4に対するヒトモノクローナル抗体 |
| EP99966644A EP1141028B1 (en) | 1998-12-23 | 1999-12-23 | Human monoclonal antibodies to ctla-4 |
| HRP20010551AA HRP20010551B1 (hr) | 1998-12-23 | 1999-12-23 | Humana monoklonalna antitijela za ctla-4 |
| DE69942037T DE69942037D1 (de) | 1998-12-23 | 1999-12-23 | Humane monoklonale antikörper gegen ctla-4 |
| DK99966644.9T DK1141028T3 (da) | 1998-12-23 | 1999-12-23 | Humane monoklonale antistoffer til CTLA-4 |
| IL14379799A IL143797A0 (en) | 1998-12-23 | 1999-12-23 | Human monoclonal antibodies to cytotoxic t lymphocyte antigen 4 |
| HU0104604A HU229566B1 (en) | 1998-12-23 | 1999-12-23 | Human monoclonal antibodies to ctla-4 |
| AU22149/00A AU772676B2 (en) | 1998-12-23 | 1999-12-23 | Human monoclonal antibodies to CTLA-4 |
| CA2356215A CA2356215C (en) | 1998-12-23 | 1999-12-23 | Human monoclonal antibodies to ctla-4 |
| IL143797A IL143797A (en) | 1998-12-23 | 2001-06-17 | Human monoclonal antibodies to cytotoxic t lymphocyte antigen 4 |
| IS5974A IS2798B (is) | 1998-12-23 | 2001-06-22 | Einræktuð mótefni úr mönnum gegn CTLA-4 |
| NO20013147A NO332618B1 (no) | 1998-12-23 | 2001-06-22 | Monoklonalt antistoff som binder til cytotoksisk T-lymfocytt antigen 4 (CTLA-4) eller et antigen-bindende fragment derav, fremgangsmate for fremstilling derav, farmasoytisk sammensetning inneholdende slike, cellelinje som danner antistoffet eller fragmentet, isolert nukleinsyre som koder for dette, vertscelle omfattende den isolerte nukleinsyre samt anvendelse derav |
| BG105722A BG65899B1 (bg) | 1998-12-23 | 2001-07-20 | Човешки моноклонални антитела за ctla-4 |
| NO20120398A NO337037B1 (no) | 1998-12-23 | 2012-03-30 | Humane monoklonale antistoff mot CTLA-4 |
| CY20181101358T CY1121451T1 (el) | 1998-12-23 | 2018-12-19 | Ανθρωπινα μονοκλωνικα αντισωματα κατα του ctla-4 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US11364798P | 1998-12-23 | 1998-12-23 | |
| US60/113,647 | 1998-12-23 |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2000037504A2 true WO2000037504A2 (en) | 2000-06-29 |
| WO2000037504A3 WO2000037504A3 (en) | 2000-09-14 |
| WO2000037504A9 WO2000037504A9 (en) | 2000-11-02 |
Family
ID=22350712
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1999/030895 Ceased WO2000037504A2 (en) | 1998-12-23 | 1999-12-23 | Human monoclonal antibodies to ctla-4 |
Country Status (41)
Cited By (502)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001014424A3 (en) * | 1999-08-24 | 2001-09-20 | Medarex Inc | Human ctla-4 antibodies and their uses |
| EP1262193A1 (en) * | 2001-05-23 | 2002-12-04 | Pfizer Products Inc. | Use of human anti-CTLA-4 antibodies for treatment of cancer |
| WO2003002713A3 (en) * | 2001-06-26 | 2003-08-14 | Abgenix Inc | Antibodies to opgl |
| WO2003085089A2 (en) | 2002-03-29 | 2003-10-16 | Schering Corporation | Human monoclonal antibodies to interleukin-5 and methods and compositions comprising same |
| WO2003086459A1 (en) | 2002-04-12 | 2003-10-23 | Medarex, Inc. | Methods of treatement using ctla-4 antibodies |
| WO2005003298A2 (en) | 2003-05-30 | 2005-01-13 | Medarex, Inc. | Surrogate therapeutic endpoint for anti-ctla-4 based immunotherapy of disease |
| WO2005019270A3 (en) * | 2003-08-14 | 2005-06-23 | Dyax Corp | Endotheliase-2 ligands |
| WO2006003179A2 (en) | 2004-07-01 | 2006-01-12 | Novo Nordisk A/S | Antibodies binding to receptors kir2dl1, -2, 3 but not kir2ds4 and their therapeutic use |
| EP1549678A4 (en) * | 2002-09-30 | 2006-01-18 | Pfizer Prod Inc | HYBRIDOMAS THAT PRODUCE HIGH CONCENTRATIONS OF ANTIBODIES TO THE HUMAN SEQUENCE |
| EP1495053A4 (en) * | 2001-10-11 | 2006-05-31 | Amgen Inc | SPICIAL BINDING AGENTS FOR ANGIOPO TINE-2 |
| WO2005092380A3 (en) * | 2004-03-26 | 2006-06-15 | Pfizer Prod Inc | Uses of anti-ctla-4 antibodies |
| US7078492B2 (en) | 2001-05-16 | 2006-07-18 | Abgenix, Inc. | Human antipneumococcal antibodies from non-human animals |
| WO2006101691A1 (en) * | 2005-03-23 | 2006-09-28 | Pfizer Products Inc. | Therapy of prostate cancer with ctla4 antibodies and hormonal therapy |
| WO2006096488A3 (en) * | 2005-03-08 | 2006-11-30 | Pharmacia & Upjohn Co Llc | Composition comprising human igg2 antibody and chelating agent |
| WO2006056464A3 (en) * | 2004-11-26 | 2007-01-18 | Pieris Proteolab Ag | Compound with affinity for the cytotoxic t lymphocyte-associated antigen (ctla-4) |
| WO2007024715A2 (en) | 2005-08-19 | 2007-03-01 | Abbott Laboratories | Dual variable domain immunoglobin and uses thereof |
| WO2007067959A2 (en) | 2005-12-07 | 2007-06-14 | Medarex, Inc. | Ctla-4 antibody dosage escalation regimens |
| WO2007100098A1 (ja) | 2006-03-03 | 2007-09-07 | Kyoto University | 細胞表面機能分子の細胞外領域多量体 |
| WO2008112193A1 (en) | 2007-03-12 | 2008-09-18 | Dana-Farber Cancer Institute | Prognostic, diagnostic, and cancer therapeutic uses of fanci and fanci modulating agents |
| EP1974749A1 (en) | 2001-04-26 | 2008-10-01 | Biogen Idec MA Inc. | Cripto blocking antibodies and uses thereof |
| WO2009009116A2 (en) | 2007-07-12 | 2009-01-15 | Tolerx, Inc. | Combination therapies employing gitr binding molecules |
| US7494779B2 (en) | 2004-06-14 | 2009-02-24 | Li-Te Chin | Method for producing human antibodies to human CD152 with properties of agonist, antagonist, or inverse agonist |
| WO2009045370A2 (en) | 2007-09-28 | 2009-04-09 | Intrexon Corporation | Therapeutic gene-switch constructs and bioreactors for the expression of biotherapeutic molecules, and uses thereof |
| WO2009100140A1 (en) * | 2008-02-04 | 2009-08-13 | Medarex, Inc. | Anti-clta-4 antibodies with reduced blocking of binding of ctla-4 to b7 and uses thereof |
| US7605238B2 (en) * | 1999-08-24 | 2009-10-20 | Medarex, Inc. | Human CTLA-4 antibodies and their uses |
| US7611702B2 (en) | 2005-11-08 | 2009-11-03 | Medarex, Inc. | TNF-alpha blocker treatment for enterocolitis associated with immunostimulatory therapeutic antibody therapy |
| EP2116556A1 (en) | 2008-05-09 | 2009-11-11 | Abbott GmbH & Co. KG | Antibodies to receptor of advanced glycation end products (rage) and uses thereof |
| WO2009149185A2 (en) | 2008-06-03 | 2009-12-10 | Abbott Laboratories | Dual variable domain immunoglobulins and uses thereof |
| EP2161336A1 (en) | 2005-05-09 | 2010-03-10 | ONO Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
| EP2194067A2 (en) | 2001-01-05 | 2010-06-09 | Pfizer Inc. | Antibodies to insulin-like growth factor I receptor (IGF-IR) |
| WO2010083456A1 (en) | 2009-01-15 | 2010-07-22 | Imdaptive Inc. | Adaptive immunity profiling and methods for generation of monoclonal antibodies |
| US7767207B2 (en) | 2000-02-10 | 2010-08-03 | Abbott Laboratories | Antibodies that bind IL-18 and methods of inhibiting IL-18 activity |
| US7794718B2 (en) | 2007-11-01 | 2010-09-14 | Perseid Therapeutics, LLC | Immunosuppressive polypeptides and nucleic acids |
| WO2010104815A1 (en) | 2009-03-10 | 2010-09-16 | Abbott Laboratories | Antibodies binding to pivka-ii amino acids 13-27 |
| US7807159B2 (en) | 2005-04-25 | 2010-10-05 | Amgen Fremont Inc. | Antibodies to myostatin |
| US7812135B2 (en) | 2005-03-25 | 2010-10-12 | Tolerrx, Inc. | GITR-binding antibodies |
| AU2006228095B2 (en) * | 2001-10-11 | 2010-11-04 | Amgen Inc. | Angiopoietin-2 specific binding agents |
| US7867494B2 (en) | 2007-04-02 | 2011-01-11 | Amgen Fremont Inc. | Anti-IgE antibodies |
| EP2287195A2 (en) | 2004-07-01 | 2011-02-23 | Novo Nordisk A/S | Pan-KIR2DL NK-receptor antibodies and their use in diagnostik and therapy |
| WO2011025964A2 (en) | 2009-08-29 | 2011-03-03 | Abbott Laboratories | Therapeutic dll4 binding proteins |
| WO2011045704A1 (en) | 2009-10-12 | 2011-04-21 | Pfizer Inc. | Cancer treatment |
| US7932372B2 (en) | 2004-01-09 | 2011-04-26 | Amgen Fremont Inc. | Antibodies to MAdCAM |
| EP2322215A2 (en) | 2004-07-16 | 2011-05-18 | Pfizer Products Inc. | Combination treatment for non-hematologic malignancies using an anti-IGF-1R antibody |
| WO2011070045A1 (en) | 2009-12-08 | 2011-06-16 | Abbott Gmbh & Co. Kg | Monoclonal antibodies against the rgm a protein for use in the treatment of retinal nerve fiber layer degeneration |
| EP2343086A2 (en) | 2001-11-09 | 2011-07-13 | Pfizer Products Inc. | Antibodies to CD40 |
| WO2011130377A2 (en) | 2010-04-15 | 2011-10-20 | Abbott Laboratories | Amyloid-beta binding proteins |
| EP2385070A1 (en) | 2003-11-12 | 2011-11-09 | Abbott Laboratories | Il-18 binding proteins |
| WO2011143562A2 (en) | 2010-05-14 | 2011-11-17 | Abbott Laboratories | Il-1 binding proteins |
| WO2011146382A1 (en) | 2010-05-17 | 2011-11-24 | Bristol-Myers Squibb Company | Improved immunotherapeutic dosing regimens and combinations thereof |
| US8071323B2 (en) | 2006-04-07 | 2011-12-06 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Human monoclonal antibodies that bind human insulin like growth factors and their use |
| WO2012006500A2 (en) | 2010-07-08 | 2012-01-12 | Abbott Laboratories | Monoclonal antibodies against hepatitis c virus core protein |
| WO2012018476A1 (en) | 2010-07-26 | 2012-02-09 | Abbott Laboratories | Antibodies relating to pivka-ii and uses thereof |
| US8119129B2 (en) | 2008-08-01 | 2012-02-21 | Bristol-Myers Squibb Company | Combination of anti-CTLA4 antibody with dasatinib for the treatment of proliferative diseases |
| WO2012024650A2 (en) | 2010-08-19 | 2012-02-23 | Abbott Laboratories | Anti-ngf antibodies and their use |
| EP2444421A1 (en) | 2005-04-26 | 2012-04-25 | Pfizer Inc. | P-Cadherin antibodies |
| EP2447283A2 (en) | 2005-09-07 | 2012-05-02 | Amgen Fremont Inc. | Human monoclonal antibodies to activin receptor-like kinase-1 (ALK-1) |
| WO2012072806A1 (en) * | 2010-12-02 | 2012-06-07 | Pieris Ag | Muteins of human lipocalin 2 with affinity for ctla-4 |
| WO2012082073A1 (en) | 2010-12-14 | 2012-06-21 | National University Of Singapore | Human monoclonal antibody with specificity for dengue virus serotype 1 e protein and uses thereof |
| WO2012088094A2 (en) | 2010-12-21 | 2012-06-28 | Abbott Laboratories | Il-1 binding proteins |
| WO2012121775A2 (en) | 2010-12-21 | 2012-09-13 | Abbott Laboratories | Dual variable domain immunoglobulins and uses thereof |
| EP2500354A2 (en) | 2005-08-19 | 2012-09-19 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| EP2511301A2 (en) | 2006-08-04 | 2012-10-17 | Medimmune Limited | Human antibodies to ERBB2 |
| WO2013013029A1 (en) * | 2011-07-19 | 2013-01-24 | The Board Of Trustees Of The University Of Illinois | Anti-clta4, anti-glut2 protein for the treatment of type 1 diabetes |
| US8389692B2 (en) | 2005-04-28 | 2013-03-05 | Mochida Pharmaceutical Co., Ltd. | Anti-platelet membrane glycoprotein VI monoclonal antibody |
| US8420083B2 (en) | 2009-10-31 | 2013-04-16 | Abbvie Inc. | Antibodies to receptor for advanced glycation end products (RAGE) and uses thereof |
| WO2013063095A1 (en) | 2011-10-24 | 2013-05-02 | Abbvie Inc. | Immunobinders directed against sclerostin |
| WO2013063114A1 (en) | 2011-10-24 | 2013-05-02 | Abbvie Inc. | Immunobinders directed against tnf |
| WO2013068902A1 (en) | 2011-11-08 | 2013-05-16 | Pfizer Inc. | Methods of treating inflammatory disorders using anti-m-csf antibodies |
| EP2594590A1 (en) | 2007-12-14 | 2013-05-22 | Bristol-Myers Squibb Company | Binding molecules to the human OX40 receptor |
| WO2013090635A2 (en) | 2011-12-14 | 2013-06-20 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of iron-related disorders |
| WO2013090633A2 (en) | 2011-12-14 | 2013-06-20 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of iron-related disorders |
| US8475790B2 (en) | 2008-10-06 | 2013-07-02 | Bristol-Myers Squibb Company | Combination of CD137 antibody and CTLA-4 antibody for the treatment of proliferative diseases |
| WO2013112922A1 (en) | 2012-01-27 | 2013-08-01 | AbbVie Deutschland GmbH & Co. KG | Composition and method for diagnosis and treatment of diseases associated with neurite degeneration |
| WO2013138702A2 (en) | 2012-03-15 | 2013-09-19 | Bristol-Myers Squibb Company | Methods for predicting gastrointestinal immune-related adverse events (gi-irae) in patients treated with modulation of the co-stimulatory pathway |
| WO2013142796A2 (en) | 2012-03-23 | 2013-09-26 | Bristol-Myers Squibb Company | Methods of treatments using ctla4 antibodies |
| WO2013155447A1 (en) | 2012-04-13 | 2013-10-17 | Children's Medical Center Corporation | Tiki inhibitors |
| WO2013164754A2 (en) | 2012-05-04 | 2013-11-07 | Pfizer Inc. | Prostate-associated antigens and vaccine-based immunotherapy regimens |
| WO2013169971A1 (en) | 2012-05-10 | 2013-11-14 | Bristol-Myers Squibb Company | Anti-tumor antibodies as predictive or prognostic biomarkers of efficacy and survival in ipilimumab-treated patients |
| US8586714B2 (en) | 2009-09-01 | 2013-11-19 | Abbvie, Inc. | Dual variable domain immunoglobulins and uses thereof |
| WO2014008218A1 (en) | 2012-07-02 | 2014-01-09 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof |
| US8680239B2 (en) | 2000-12-22 | 2014-03-25 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Use of RGM and its modulators |
| US8710191B2 (en) | 2008-08-18 | 2014-04-29 | Pfizer Inc. | Antibodies to CCR2 |
| US8716450B2 (en) | 2009-10-15 | 2014-05-06 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| US8722855B2 (en) | 2009-10-28 | 2014-05-13 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| US8735546B2 (en) | 2010-08-03 | 2014-05-27 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| WO2014100542A1 (en) | 2012-12-21 | 2014-06-26 | Abbvie, Inc. | High-throughput antibody humanization |
| AU2012200203B2 (en) * | 2005-03-08 | 2014-07-03 | Pfizer Products Inc. | Anti-CTLA-4 Antibody Compositions |
| EP2769737A1 (en) | 2009-07-20 | 2014-08-27 | Bristol-Myers Squibb Company | Combination of an anti-CTLA4 antibody with etoposide for the synergistic treatment of proliferative diseases |
| US8822645B2 (en) | 2008-07-08 | 2014-09-02 | Abbvie Inc. | Prostaglandin E2 dual variable domain immunoglobulins and uses thereof |
| EP2772269A2 (en) | 2009-03-05 | 2014-09-03 | Abbvie Inc. | IL-17 binding proteins |
| WO2014144355A2 (en) | 2013-03-15 | 2014-09-18 | Abbott Laboratories | Anti-gp73 monoclonal antibodies and methods of obtaining the same |
| WO2014153056A2 (en) | 2013-03-14 | 2014-09-25 | Parkash Gill | Cancer treatment using antibodies that bing cell surface grp78 |
| US8906864B2 (en) | 2005-09-30 | 2014-12-09 | AbbVie Deutschland GmbH & Co. KG | Binding domains of proteins of the repulsive guidance molecule (RGM) protein family and functional fragments thereof, and their use |
| EP2810654A1 (en) | 2008-07-08 | 2014-12-10 | AbbVie Inc. | Prostaglandin E2 binding proteins and uses thereof |
| US8962803B2 (en) | 2008-02-29 | 2015-02-24 | AbbVie Deutschland GmbH & Co. KG | Antibodies against the RGM A protein and uses thereof |
| US8987418B2 (en) | 2013-03-15 | 2015-03-24 | Abbvie Inc. | Dual specific binding proteins directed against IL-1β and/or IL-17 |
| WO2015063647A1 (en) | 2013-11-01 | 2015-05-07 | Pfizer Inc. | Vectors for expression of prostate-associated antigens |
| US9029508B2 (en) | 2008-04-29 | 2015-05-12 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| WO2015069770A1 (en) | 2013-11-05 | 2015-05-14 | Cognate Bioservices, Inc. | Combinations of checkpoint inhibitors and therapeutics to treat cancer |
| WO2015069703A1 (en) | 2013-11-06 | 2015-05-14 | Bristol-Myers Squibb Company | Immunotherapeutic dosing regimens and combinations thereof |
| US9035027B2 (en) | 2008-06-03 | 2015-05-19 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| US9045551B2 (en) | 2012-11-01 | 2015-06-02 | Abbvie Inc. | Anti-DLL4/VEGF dual variable domain immunoglobulin and uses thereof |
| US9046513B2 (en) | 2010-08-26 | 2015-06-02 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| US9062101B2 (en) | 2010-08-14 | 2015-06-23 | AbbVie Deutschland GmbH & Co. KG | Amyloid-beta binding proteins |
| EP2905030A1 (en) | 2008-08-11 | 2015-08-12 | E. R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3) and uses thereof |
| US9115195B2 (en) | 2010-03-02 | 2015-08-25 | Abbvie Inc. | Therapeutic DLL4 binding proteins |
| US9120870B2 (en) | 2011-12-30 | 2015-09-01 | Abbvie Inc. | Dual specific binding proteins directed against IL-13 and IL-17 |
| EP2921177A2 (en) | 2010-07-09 | 2015-09-23 | AbbVie Inc. | Dual variable domain immunoglobulins and uses thereof |
| US9150644B2 (en) | 2011-04-12 | 2015-10-06 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Human monoclonal antibodies that bind insulin-like growth factor (IGF) I and II |
| WO2015184099A1 (en) | 2014-05-28 | 2015-12-03 | 4-Antibody Ag | Anti-gitr antibodies and methods of use thereof |
| WO2015187835A2 (en) | 2014-06-06 | 2015-12-10 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof |
| US9212224B2 (en) | 2012-05-15 | 2015-12-15 | Bristol-Myers Squibb Company | Antibodies that bind PD-L1 and uses thereof |
| EP2962731A1 (en) | 2008-01-08 | 2016-01-06 | Bristol-Myers Squibb Company | Combination of ipilimumab and paclitaxel for the treatment of cancer |
| WO2016033555A1 (en) | 2014-08-28 | 2016-03-03 | Halozyme, Inc. | Combination therapy with a hyaluronan-degrading enzyme and an immune checkpoint inhibitor |
| WO2016044234A1 (en) | 2014-09-16 | 2016-03-24 | Eric Tsao | Anti-egfr antibody and uses of same |
| WO2016061286A2 (en) | 2014-10-14 | 2016-04-21 | Halozyme, Inc. | Compositions of adenosine deaminase-2 (ada2), variants thereof and methods of using same |
| WO2016081748A2 (en) | 2014-11-21 | 2016-05-26 | Bristol-Myers Squibb Company | Antibodies against cd73 and uses thereof |
| WO2016090070A1 (en) | 2014-12-04 | 2016-06-09 | Bristol-Myers Squibb Company | Combination of anti-cs1 and anti-pd1 antibodies to treat cancer (myeloma) |
| WO2016109310A1 (en) | 2014-12-31 | 2016-07-07 | Checkmate Pharmaceuticals, Llc | Combination tumor immunotherapy |
| WO2016127052A1 (en) | 2015-02-05 | 2016-08-11 | Bristol-Myers Squibb Company | Cxcl11 and smica as predictive biomarkers for efficacy of anti-ctla4 immunotherapy |
| WO2016130898A2 (en) | 2015-02-13 | 2016-08-18 | Sorrento Therapeutics, Inc. | Antibody therapeutics that bind ctla4 |
| WO2016146261A1 (en) | 2015-03-16 | 2016-09-22 | Amal Therapeutics Sa | Combination of an immune checkpoint modulator and a complex comprising a cell penetrating peptide, a cargo and a tlr peptide agonist for use in medicine |
| AU2014240252B2 (en) * | 2005-03-08 | 2016-10-06 | Pfizer Products Inc | Anti-CTLA-4 Antibody Compositions |
| WO2016191397A1 (en) | 2015-05-22 | 2016-12-01 | Td2 Inc. | Benzamide and active compound compositions and methods of use |
| WO2016196228A1 (en) | 2015-05-29 | 2016-12-08 | Bristol-Myers Squibb Company | Antibodies against ox40 and uses thereof |
| WO2017003990A1 (en) | 2015-06-29 | 2017-01-05 | Bristol-Myers Squibb Company | Immunotherapeutic dosing regimens comprising pomalidomide and an anti-cs1 antibody for treating cancer |
| WO2017004016A1 (en) | 2015-06-29 | 2017-01-05 | The Rockefeller University | Antibodies to cd40 with enhanced agonist activity |
| WO2017009842A2 (en) | 2015-07-16 | 2017-01-19 | Biokine Therapeutics Ltd. | Compositions and methods for treating cancer |
| WO2017021913A1 (en) | 2015-08-04 | 2017-02-09 | Glaxosmithkline Intellectual Property Development Limited | Combination treatments and uses and methods thereof |
| WO2017025871A1 (en) | 2015-08-07 | 2017-02-16 | Glaxosmithkline Intellectual Property Development Limited | Combination therapy comprising anti ctla-4 antibodies |
| US9617334B2 (en) | 2012-06-06 | 2017-04-11 | Zoetis Services Llc | Caninized anti-NGF antibodies and methods thereof |
| WO2017079215A1 (en) | 2015-11-03 | 2017-05-11 | Glycomimetics, Inc. | Methods and compositions for the production of monoclonal antibodies, hematopoietic stem cells, and methods of using the same |
| WO2017079746A2 (en) | 2015-11-07 | 2017-05-11 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and immune checkpoint blockade for the treatment of cancer |
| WO2017079202A1 (en) | 2015-11-02 | 2017-05-11 | Board Of Regents, The University Of Texas System | Methods of cd40 activation and immune checkpoint blockade |
| EP3170840A1 (en) | 2003-09-10 | 2017-05-24 | Warner-Lambert Company LLC | Antibodies to m-csf |
| WO2017087678A2 (en) | 2015-11-19 | 2017-05-26 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof |
| US9670276B2 (en) | 2012-07-12 | 2017-06-06 | Abbvie Inc. | IL-1 binding proteins |
| WO2017106061A1 (en) | 2015-12-14 | 2017-06-22 | Macrogenics, Inc. | Bispecific molecules having immunoreactivity with pd-1 and ctla-4, and methods of use thereof |
| WO2017120612A1 (en) | 2016-01-10 | 2017-07-13 | Modernatx, Inc. | Therapeutic mrnas encoding anti ctla-4 antibodies |
| US9714290B2 (en) | 2011-03-09 | 2017-07-25 | Antitope Limited | Humanised anti CTLA-4 antibodies |
| WO2017152085A1 (en) | 2016-03-04 | 2017-09-08 | Bristol-Myers Squibb Company | Combination therapy with anti-cd73 antibodies |
| WO2017160754A1 (en) | 2016-03-15 | 2017-09-21 | Mersana Therapeutics,Inc. | Napi2b-targeted antibody-drug conjugates and methods of use thereof |
| WO2017160599A1 (en) | 2016-03-14 | 2017-09-21 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Use of cd300b antagonists to treat sepsis and septic shock |
| WO2017157964A1 (en) | 2016-03-16 | 2017-09-21 | Amal Therapeutics Sa | Combination of an immune checkpoint modulator and a complex comprising a cell penetrating peptide, a cargo and a tlr peptide agonist for use in medicine |
| WO2017173334A1 (en) | 2016-04-01 | 2017-10-05 | Checkmate Pharmaceuticals, Inc. | Fc receptor-mediated drug delivery |
| WO2017173091A1 (en) | 2016-03-30 | 2017-10-05 | Musc Foundation For Research Development | Methods for treatment and diagnosis of cancer by targeting glycoprotein a repetitions predominant (garp) and for providing effective immunotherapy alone or in combination |
| US9790478B2 (en) | 2013-03-14 | 2017-10-17 | Abbott Laboratories | HCV NS3 recombinant antigens and mutants thereof for improved antibody detection |
| WO2017184619A2 (en) | 2016-04-18 | 2017-10-26 | Celldex Therapeutics, Inc. | Agonistic antibodies that bind human cd40 and uses thereof |
| WO2017192874A1 (en) | 2016-05-04 | 2017-11-09 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Albumin-binding immunomodulatory compositions and methods of use thereof |
| WO2017201352A1 (en) | 2016-05-18 | 2017-11-23 | Modernatx, Inc. | Mrna combination therapy for the treatment of cancer |
| WO2017210181A1 (en) | 2016-05-30 | 2017-12-07 | Geovax Inc. | Compositions and methods for generating an immune response to hepatitis b virus |
| WO2017210335A1 (en) | 2016-06-01 | 2017-12-07 | Bristol-Myers Squibb Company | Imaging methods using 18f-radiolabeled biologics |
| US9840554B2 (en) | 2015-06-15 | 2017-12-12 | Abbvie Inc. | Antibodies against platelet-derived growth factor (PDGF) |
| US9841427B2 (en) | 2013-03-14 | 2017-12-12 | Abbott Laboratories | HCV antigen-antibody combination assay and methods and compositions for use therein |
| WO2017220988A1 (en) | 2016-06-20 | 2017-12-28 | Kymab Limited | Multispecific antibodies for immuno-oncology |
| US9868961B2 (en) | 2006-03-30 | 2018-01-16 | The Regents Of The University Of California | Methods and compositions for localized secretion of anti-CTLA-4 antibodies |
| WO2018013818A2 (en) | 2016-07-14 | 2018-01-18 | Bristol-Myers Squibb Company | Antibodies against tim3 and uses thereof |
| WO2018025221A1 (en) | 2016-08-04 | 2018-02-08 | Glaxosmithkline Intellectual Property Development Limited | Anti-icos and anti-pd-1 antibody combination therapy |
| US9913856B2 (en) | 2011-08-30 | 2018-03-13 | Astex Pharmaceuticals, Inc. | Drug formulations |
| WO2018064165A2 (en) | 2016-09-27 | 2018-04-05 | Board Of Regents, The University Of Texas System | Methods for enhancing immune checkpoint blockade therapy by modulating the microbiome |
| WO2018067474A1 (en) | 2016-10-03 | 2018-04-12 | Abbott Laboratories | Improved methods of assessing gfap status in patient samples |
| WO2018071668A1 (en) | 2016-10-12 | 2018-04-19 | Board Of Regents, The University Of Texas System | Methods and compositions for tusc2 immunotherapy |
| US9951125B2 (en) | 2006-11-30 | 2018-04-24 | Abbvie Inc. | Aβ conformer selective anti-Aβ globulomer monoclonal antibodies |
| WO2018081621A1 (en) | 2016-10-28 | 2018-05-03 | Bristol-Myers Squibb Company | Methods of treating urothelial carcinoma using an anti-pd-1 antibody |
| WO2018089423A1 (en) | 2016-11-09 | 2018-05-17 | Musc Foundation For Research Development | Cd38-nad+ regulated metabolic axis in anti-tumor immunotherapy |
| WO2018094225A1 (en) | 2016-11-17 | 2018-05-24 | Board Of Regents, The University Of Texas System | Compounds with anti-tumor activity against cancer cells bearing egfr or her2 exon 20 mutations |
| WO2018098401A1 (en) | 2016-11-23 | 2018-05-31 | Translational Drug Development, Llc | Benzamide and active compound compositions and methods of use |
| WO2018098269A2 (en) | 2016-11-23 | 2018-05-31 | Mersana Therapeutics, Inc. | Peptide-containing linkers for antibody-drug conjugates |
| WO2018100535A1 (en) | 2016-12-01 | 2018-06-07 | Glaxosmithkline Intellectual Property Development Limited | Combination therapy |
| WO2018099978A1 (en) | 2016-11-29 | 2018-06-07 | Horst Lindhofer | Combination of t-cell redirecting multifunctional antibodies with immune checkpoint modulators and uses thereof |
| WO2018100534A1 (en) | 2016-12-01 | 2018-06-07 | Glaxosmithkline Intellectual Property Development Limited | Combination therapy |
| WO2018111902A1 (en) | 2016-12-12 | 2018-06-21 | Multivir Inc. | Methods and compositions comprising viral gene therapy and an immune checkpoint inhibitor for treatment and prevention of cancer and infectious diseases |
| WO2018110515A1 (ja) | 2016-12-12 | 2018-06-21 | 第一三共株式会社 | 抗体-薬物コンジュゲートと免疫チェックポイント阻害剤の組み合わせ |
| EP3339445A1 (en) | 2006-09-08 | 2018-06-27 | AbbVie Bahamas Ltd. | Interleukin -13 binding proteins |
| WO2018152396A1 (en) | 2017-02-17 | 2018-08-23 | Innate Tumor Immunity, Inc. | Substituted imidazo-quinolines as nlrp3 modulators |
| EP3366703A1 (en) | 2017-02-28 | 2018-08-29 | Ralf Kleef | Immune checkpoint therapy with hyperthermia |
| WO2018156973A1 (en) | 2017-02-24 | 2018-08-30 | Board Of Regents, The University Of Texas System | Assay for detection of early stage pancreatic cancer |
| WO2018160538A1 (en) | 2017-02-28 | 2018-09-07 | Mersana Therapeutics, Inc. | Combination therapies of her2-targeted antibody-drug conjugates |
| WO2018167778A1 (en) | 2017-03-12 | 2018-09-20 | Yeda Research And Development Co. Ltd. | Methods of diagnosing and prognosing cancer |
| WO2018167780A1 (en) | 2017-03-12 | 2018-09-20 | Yeda Research And Development Co. Ltd. | Methods of prognosing and treating cancer |
| WO2018175942A1 (en) | 2017-03-23 | 2018-09-27 | Abbott Laboratories | Methods for aiding in the diagnosis and determination of the extent of traumatic brain injury in a human subject using the early biomarker ubiquitin carboxy-terminal hydrolase l1 |
| WO2018183928A1 (en) | 2017-03-31 | 2018-10-04 | Bristol-Myers Squibb Company | Methods of treating tumor |
| US10093733B2 (en) | 2014-12-11 | 2018-10-09 | Abbvie Inc. | LRP-8 binding dual variable domain immunoglobulin proteins |
| WO2018187613A2 (en) | 2017-04-07 | 2018-10-11 | Bristol-Myers Squibb Company | Anti-icos agonist antibodies and uses thereof |
| WO2018191531A1 (en) | 2017-04-15 | 2018-10-18 | Abbott Laboratories | Methods for aiding in the hyperacute diagnosis and determination of traumatic brain injury in a human subject using early biomarkers |
| WO2018200823A1 (en) | 2017-04-28 | 2018-11-01 | Abbott Laboratories | Methods for aiding in the hyperacute diagnosis and determination of traumatic brain injury using early biomarkers on at least two samples from the same human subject |
| WO2018200430A1 (en) | 2017-04-26 | 2018-11-01 | Bristol-Myers Squibb Company | Methods of antibody production that minimize disulfide bond reduction |
| WO2018218056A1 (en) | 2017-05-25 | 2018-11-29 | Birstol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
| WO2018218169A1 (en) | 2017-05-25 | 2018-11-29 | Abbott Laboratories | Methods for aiding in the determination of whether to perform imaging on a human subject who has sustained or may have sustained an injury to the head using early biomarkers |
| WO2018222783A1 (en) | 2017-05-30 | 2018-12-06 | Abbott Laboratories | Methods for aiding in diagnosing and evaluating a mild traumatic brain injury in a human subject using cardiac troponin i and early biomarkers |
| WO2018222711A2 (en) | 2017-05-30 | 2018-12-06 | Bristol-Myers Squibb Company | Compositions comprising a combination of an anti-lag-3 antibody, a pd-1 pathway inhibitor, and an immunotherapeutic agent |
| WO2018226336A1 (en) | 2017-06-09 | 2018-12-13 | Providence Health & Services - Oregon | Utilization of cd39 and cd103 for identification of human tumor reactive cells for treatment of cancer |
| WO2019010131A1 (en) | 2017-07-03 | 2019-01-10 | Abbott Laboratories | IMPROVED METHODS FOR MEASURING CARBOXY TERMINATION HYDROLASE LEVELS OF UBIQUITIN L1 IN BLOOD |
| WO2019014402A1 (en) | 2017-07-14 | 2019-01-17 | Innate Tumor Immunity, Inc. | MODULATORS OF NLRP3 |
| WO2019014572A1 (en) | 2017-07-14 | 2019-01-17 | Pfizer, Inc. | ANTIBODIES DIRECTED AGAINST MADCAM |
| US10183988B2 (en) | 2013-06-07 | 2019-01-22 | Duke University | Anti-Complement factor H antibodies |
| WO2018089293A3 (en) * | 2016-11-08 | 2019-01-24 | Qilu Puget Sound Biotherapeutics Corporation | ANTI-PD1 ANTI-CTLA4 ANTIBODIES |
| US10197573B2 (en) | 2013-03-14 | 2019-02-05 | Abbott Laboratories | HCV core lipid binding domain monoclonal antibodies |
| US10208109B2 (en) | 2005-11-30 | 2019-02-19 | Abbvie Inc. | Monoclonal antibodies against amyloid beta protein and uses thereof |
| EP3444271A1 (en) | 2013-08-08 | 2019-02-20 | Cytune Pharma | Il-15 and il-15raplha sushi domain based modulokines |
| WO2019075090A1 (en) | 2017-10-10 | 2019-04-18 | Tilos Therapeutics, Inc. | ANTI-LAP ANTIBODIES AND USES THEREOF |
| WO2019075468A1 (en) | 2017-10-15 | 2019-04-18 | Bristol-Myers Squibb Company | TUMOR TREATMENT METHODS |
| WO2019089921A1 (en) | 2017-11-01 | 2019-05-09 | Bristol-Myers Squibb Company | Immunostimulatory agonistic antibodies for use in treating cancer |
| WO2019094360A1 (en) | 2017-11-07 | 2019-05-16 | The Board Of Regents Of The University Of Texas System | Targeting lilrb4 with car-t or car-nk cells in the treatment of cancer |
| WO2019104289A1 (en) | 2017-11-27 | 2019-05-31 | Mersana Therapeutics, Inc. | Pyrrolobenzodiazepine antibody conjugates |
| WO2019112860A1 (en) | 2017-12-09 | 2019-06-13 | Abbott Laboratories | Methods for aiding in diagnosing and evaluating a traumatic brain injury in a human subject using a combination of gfap and uch-l1 |
| WO2019113525A2 (en) | 2017-12-09 | 2019-06-13 | Abbott Laboratories | Methods for aiding in the diagnosis and evaluation of a subject who has sustained an orthopedic injury and that has or may have sustained an injury to the head, such as mild traumatic brain injury (tbi), using glial fibrillary acidic protein (gfap) and/or ubiquitin carboxy-terminal hydrolase l1 (uch-l1) |
| WO2019118826A1 (en) | 2017-12-15 | 2019-06-20 | Board Of Regents, The University Of Texas System | Methods and compositions for treating cancer using exosomes-associated gene editing |
| WO2019126691A1 (en) | 2017-12-21 | 2019-06-27 | Mersana Therapeutics, Inc. | Pyrrolobenzodiazepine antibody conjugates |
| US10336820B2 (en) | 2008-02-20 | 2019-07-02 | Amgen Inc. | Antibodies directed to angiopoietin-1 and angiopoietin-2 and uses thereof |
| WO2019133747A1 (en) | 2017-12-27 | 2019-07-04 | Bristol-Myers Squibb Company | Anti-cd40 antibodies and uses thereof |
| WO2019140229A1 (en) | 2018-01-12 | 2019-07-18 | Bristol-Myers Squibb Company | Antibodies against tim3 and uses thereof |
| WO2019144098A1 (en) | 2018-01-22 | 2019-07-25 | Bristol-Myers Squibb Company | Compositions and methods of treating cancer |
| US10376535B2 (en) | 2015-03-26 | 2019-08-13 | University Of Rochester | Therapy for malignant disease |
| WO2019175113A1 (en) | 2018-03-12 | 2019-09-19 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of caloric restriction mimetics for potentiating chemo-immunotherapy for the treatment of cancers |
| WO2019183040A1 (en) | 2018-03-21 | 2019-09-26 | Five Prime Therapeutics, Inc. | ANTIBODIES BINDING TO VISTA AT ACIDIC pH |
| WO2019185551A1 (en) | 2018-03-25 | 2019-10-03 | Snipr Biome Aps. | Treating & preventing microbial infections |
| WO2019191279A2 (en) | 2018-03-27 | 2019-10-03 | Board Of Regents, The University Of Texas System | Compounds with anti-tumor activity against cancer cells bearing her2 exon 19 mutations |
| WO2019191676A1 (en) | 2018-03-30 | 2019-10-03 | Bristol-Myers Squibb Company | Methods of treating tumor |
| US10449251B2 (en) | 2014-08-01 | 2019-10-22 | Akeso Biopharma, Inc. | Anti-CTLA4 monoclonal antibody or its antigen binding fragments, pharmaceutical compositions and uses |
| WO2019204665A1 (en) | 2018-04-18 | 2019-10-24 | Xencor, Inc. | Pd-1 targeted heterodimeric fusion proteins containing il-15/il-15ra fc-fusion proteins and pd-1 antigen binding domains and uses thereof |
| WO2019204592A1 (en) | 2018-04-18 | 2019-10-24 | Xencor, Inc. | Il-15/il-15ra heterodimeric fc fusion proteins and uses thereof |
| US10456415B2 (en) | 2005-09-29 | 2019-10-29 | Astex Pharmaceuticals, Inc. | Oligonucleotide analogues incorporating 5-aza-cytosine therein |
| WO2019209896A1 (en) | 2018-04-25 | 2019-10-31 | Innate Tumor Immunity, Inc. | Nlrp3 modulators |
| US10464976B2 (en) | 2003-01-31 | 2019-11-05 | AbbVie Deutschland GmbH & Co. KG | Amyloid β(1-42) oligomers, derivatives thereof and antibodies thereto, methods of preparation thereof and use thereof |
| US10463049B2 (en) | 2015-05-06 | 2019-11-05 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| EP3563836A1 (en) | 2013-03-01 | 2019-11-06 | Astex Pharmaceuticals, Inc. | Drug combinations |
| US10485764B2 (en) | 2015-07-02 | 2019-11-26 | Otsuka Pharmaceutical Co., Ltd. | Lyophilized pharmaceutical compositions |
| EP3574919A1 (en) | 2011-07-13 | 2019-12-04 | AbbVie Inc. | Methods and compositions for treating asthma using anti-il-13 antibodies |
| WO2019232319A1 (en) | 2018-05-31 | 2019-12-05 | Peloton Therapeutics, Inc. | Compositions and methods for inhibiting cd73 |
| CN110545844A (zh) * | 2017-02-21 | 2019-12-06 | 瑞美德生物医药科技有限公司 | 使用结合细胞毒性t淋巴细胞抗原-4(ctla-4)的抗体的癌症治疗 |
| WO2019241358A2 (en) | 2018-06-12 | 2019-12-19 | The Regents Of The University Of California | Single-chain bispecific chimeric antigen receptors for the treatment of cancer |
| US10519190B2 (en) | 2017-08-03 | 2019-12-31 | Otsuka Pharmaceutical Co., Ltd. | Drug compound and purification methods thereof |
| WO2020014327A2 (en) | 2018-07-11 | 2020-01-16 | Five Prime Therapeutics, Inc. | Antibodies binding to vista at acidic ph |
| WO2020014543A2 (en) | 2018-07-11 | 2020-01-16 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| WO2020014132A2 (en) | 2018-07-09 | 2020-01-16 | Five Prime Therapeutics, Inc. | Antibodies binding to ilt4 |
| US10538581B2 (en) | 2005-11-30 | 2020-01-21 | Abbvie Inc. | Anti-Aβ globulomer 4D10 antibodies |
| WO2020037092A1 (en) | 2018-08-16 | 2020-02-20 | Innate Tumor Immunity, Inc. | Imidazo[4,5-c]quinoline derived nlrp3-modulators |
| WO2020037094A1 (en) | 2018-08-16 | 2020-02-20 | Innate Tumor Immunity, Inc. | Substitued 4-amino-1h-imidazo[4,5-c]quinoline compounds and improved methods for their preparation |
| WO2020036635A2 (en) | 2018-03-19 | 2020-02-20 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and cd122/cd132 agonists for the treatment of cancer |
| WO2020037091A1 (en) | 2018-08-16 | 2020-02-20 | Innate Tumor Immunity, Inc. | Imidazo[4,5-c]quinoline derived nlrp3-modulators |
| EP3617230A1 (en) | 2018-09-03 | 2020-03-04 | BioInvent International AB | Novel antibodies and nucleotide sequences, and uses thereof |
| WO2020048942A1 (en) | 2018-09-04 | 2020-03-12 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for enhancing cytotoxic t lymphocyte-dependent immune responses |
| EP3626744A1 (en) | 2015-05-29 | 2020-03-25 | AbbVie Inc. | Anti-cd40 antibodies and uses thereof |
| WO2020058372A1 (en) | 2018-09-19 | 2020-03-26 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical composition for the treatment of cancers resistant to immune checkpoint therapy |
| WO2020057645A1 (zh) | 2018-09-21 | 2020-03-26 | 信达生物制药(苏州)有限公司 | 新型白介素2及其用途 |
| WO2020057646A1 (zh) | 2018-09-21 | 2020-03-26 | 信达生物制药(苏州)有限公司 | 新型白介素2及其用途 |
| US10604574B2 (en) | 2016-06-30 | 2020-03-31 | Oncorus, Inc. | Oncolytic viral delivery of therapeutic polypeptides |
| WO2020072821A2 (en) | 2018-10-03 | 2020-04-09 | Xencor, Inc. | Il-12 heterodimeric fc-fusion proteins |
| WO2020070053A1 (en) | 2018-10-01 | 2020-04-09 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of inhibitors of stress granule formation for targeting the regulation of immune responses |
| WO2020076969A2 (en) | 2018-10-10 | 2020-04-16 | Tilos Therapeutics, Inc. | Anti-lap antibody variants and uses thereof |
| WO2020077276A2 (en) | 2018-10-12 | 2020-04-16 | Xencor, Inc. | Pd-1 targeted il-15/il-15ralpha fc fusion proteins and uses in combination therapies thereof |
| WO2020086724A1 (en) | 2018-10-23 | 2020-04-30 | Bristol-Myers Squibb Company | Methods of treating tumor |
| WO2020092385A1 (en) | 2018-10-29 | 2020-05-07 | Mersana Therapeutics, Inc. | Cysteine engineered antibody-drug conjugates with peptide-containing linkers |
| WO2020102501A1 (en) | 2018-11-16 | 2020-05-22 | Bristol-Myers Squibb Company | Anti-nkg2a antibodies and uses thereof |
| WO2020106621A1 (en) | 2018-11-19 | 2020-05-28 | Board Of Regents, The University Of Texas System | A modular, polycistronic vector for car and tcr transduction |
| EP3659622A1 (en) | 2013-08-08 | 2020-06-03 | Cytune Pharma | Combined pharmaceutical composition |
| WO2020113029A2 (en) | 2018-11-28 | 2020-06-04 | Board Of Regents, The University Of Texas System | Multiplex genome editing of immune cells to enhance functionality and resistance to suppressive environment |
| WO2020112781A1 (en) | 2018-11-28 | 2020-06-04 | Bristol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
| WO2020112493A1 (en) | 2018-11-29 | 2020-06-04 | Board Of Regents, The University Of Texas System | Methods for ex vivo expansion of natural killer cells and use thereof |
| WO2020109355A1 (en) | 2018-11-28 | 2020-06-04 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and kit for assaying lytic potential of immune effector cells |
| EP3522922A4 (en) * | 2016-10-10 | 2020-06-10 | Crown Bioscience, Inc. (Taicang) | NEW ANTI-CTLA4 ANTIBODIES |
| WO2020115262A1 (en) | 2018-12-07 | 2020-06-11 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of cd26 and cd39 as new phenotypic markers for assessing maturation of foxp3+ t cells and uses thereof for diagnostic purposes |
| WO2020123453A2 (en) | 2018-12-11 | 2020-06-18 | Theravance Biopharma R&D Ip, Llc | Alk5 inhibitors |
| WO2020127059A1 (en) | 2018-12-17 | 2020-06-25 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of sulconazole as a furin inhibitor |
| WO2020136235A1 (en) | 2018-12-28 | 2020-07-02 | Transgene Sa | M2-defective poxvirus |
| WO2020150113A1 (en) | 2019-01-14 | 2020-07-23 | Innate Tumor Immunity, Inc. | Substituted quinazolines as nlrp3 modulators, for use in the treatment of cancer |
| WO2020150114A1 (en) | 2019-01-14 | 2020-07-23 | Innate Tumor Immunity, Inc. | Heterocyclic nlrp3 modulators, for use in the treatment of cancer |
| WO2020150115A1 (en) | 2019-01-14 | 2020-07-23 | Innate Tumor Immunity, Inc. | Nlrp3 modulators |
| WO2020148338A1 (en) | 2019-01-15 | 2020-07-23 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Mutated interleukin-34 (il-34) polypeptides and uses thereof in therapy |
| WO2020150116A1 (en) | 2019-01-14 | 2020-07-23 | Innate Tumor Immunity, Inc. | Nlrp3 modulators |
| EP3691643A1 (en) | 2017-09-29 | 2020-08-12 | Bristol-Myers Squibb Company | Compositions and methods of treating cancer |
| EP3694872A1 (en) | 2017-10-12 | 2020-08-19 | Board Of Regents, The University Of Texas System | T cell receptors for immunotherapy |
| WO2020169472A2 (en) | 2019-02-18 | 2020-08-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods of inducing phenotypic changes in macrophages |
| US10760075B2 (en) | 2018-04-30 | 2020-09-01 | Snipr Biome Aps | Treating and preventing microbial infections |
| WO2020182993A1 (en) | 2019-03-13 | 2020-09-17 | Etherna Immunotherapies Nv | Mrna vaccine |
| WO2020198676A1 (en) | 2019-03-28 | 2020-10-01 | Bristol-Myers Squibb Company | Methods of treating tumor |
| WO2020198672A1 (en) | 2019-03-28 | 2020-10-01 | Bristol-Myers Squibb Company | Methods of treating tumor |
| WO2020201362A2 (en) | 2019-04-02 | 2020-10-08 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods of predicting and preventing cancer in patients having premalignant lesions |
| WO2020208060A1 (en) | 2019-04-09 | 2020-10-15 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of sk2 inhibitors in combination with immune checkpoint blockade therapy for the treatment of cancer |
| WO2020212484A1 (en) | 2019-04-17 | 2020-10-22 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treatment of nlrp3 inflammasome mediated il-1beta dependent disorders |
| WO2020227711A1 (en) | 2019-05-09 | 2020-11-12 | FUJIFILM Cellular Dynamics, Inc. | Methods for the production of hepatocytes |
| US10836830B2 (en) | 2015-12-02 | 2020-11-17 | Agenus Inc. | Antibodies and methods of use thereof |
| WO2020236562A1 (en) | 2019-05-17 | 2020-11-26 | Cancer Prevention Pharmaceuticals, Inc. | Methods for treating familial adenomatous polyposis |
| WO2020243563A1 (en) | 2019-05-30 | 2020-12-03 | Bristol-Myers Squibb Company | Multi-tumor gene signatures for suitability to immuno-oncology therapy |
| WO2020243329A1 (en) | 2019-05-28 | 2020-12-03 | The Regents Of The University Of California | Methods for treating small cell neuroendocrine and related cancers |
| WO2020243570A1 (en) | 2019-05-30 | 2020-12-03 | Bristol-Myers Squibb Company | Cell localization signature and combination therapy |
| WO2020243568A1 (en) | 2019-05-30 | 2020-12-03 | Bristol-Myers Squibb Company | Methods of identifying a subject suitable for an immuno-oncology (i-o) therapy |
| WO2020247974A1 (en) | 2019-06-03 | 2020-12-10 | The University Of Chicago | Methods and compositions for treating cancer with collagen binding drug carriers |
| WO2020247973A1 (en) | 2019-06-03 | 2020-12-10 | The University Of Chicago | Methods and compositions for treating cancer with cancer-targeted adjuvants |
| US10865238B1 (en) | 2017-05-05 | 2020-12-15 | Duke University | Complement factor H antibodies |
| WO2020249693A1 (en) | 2019-06-11 | 2020-12-17 | Alkermes Pharma Ireland Limited | Compositions and methods for subcutaneous administration of cancer immunotherapy |
| WO2020260685A1 (en) | 2019-06-27 | 2020-12-30 | Etherna Immunotherapies Nv | Combination therapy |
| WO2021003432A1 (en) | 2019-07-02 | 2021-01-07 | Fred Hutchinson Cancer Research Center | Recombinant ad35 vectors and related gene therapy improvements |
| WO2021009188A1 (en) | 2019-07-15 | 2021-01-21 | Intervet International B.V. | Caninized antibodies to human and canine ctla-4 |
| WO2021009187A1 (en) | 2019-07-15 | 2021-01-21 | Intervet International B.V. | Caninized antibodies against canine ctla-4 |
| WO2021025177A1 (en) | 2019-08-06 | 2021-02-11 | Astellas Pharma Inc. | Combination therapy involving antibodies against claudin 18.2 and immune checkpoint inhibitors for treatment of cancer |
| US10927154B2 (en) | 2014-01-13 | 2021-02-23 | Pieris Pharmaceuticals Gmbh | Multi-specific polypeptide useful for localized tumor immunomodulation |
| EP3789399A1 (en) | 2014-11-21 | 2021-03-10 | Bristol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
| WO2021055627A1 (en) | 2019-09-17 | 2021-03-25 | Bial- Biotech Investments, Inc. | Substituted n-heterocyclic carboxamides as acid ceramidase inhibitors and their use as medicaments |
| WO2021055612A1 (en) | 2019-09-17 | 2021-03-25 | BIAL-BioTech Investments, Inc. | Substituted imidazole carboxamides and their use in the treatment of medical disorders |
| WO2021055630A1 (en) | 2019-09-17 | 2021-03-25 | Bial- Biotech Investments, Inc. | Substituted, saturated and unsaturated n-heterocyclic carboxamides and related compounds for their use in the treatment of medical disorders |
| WO2021055994A1 (en) | 2019-09-22 | 2021-03-25 | Bristol-Myers Squibb Company | Quantitative spatial profiling for lag-3 antagonist therapy |
| WO2021055698A1 (en) | 2019-09-19 | 2021-03-25 | Bristol-Myers Squibb Company | Antibodies binding to vista at acidic ph |
| WO2021062244A1 (en) | 2019-09-25 | 2021-04-01 | Surface Oncology, Inc. | Anti-il-27 antibodies and uses thereof |
| WO2021061789A1 (en) | 2019-09-23 | 2021-04-01 | The Regents Of The University Of Michigan | Compositions and methods for increasing the efficacy of immunotherapies and vaccines |
| EP3800201A1 (en) | 2019-10-01 | 2021-04-07 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Cd28h stimulation enhances nk cell killing activities |
| WO2021064184A1 (en) | 2019-10-04 | 2021-04-08 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical composition for the treatment of ovarian cancer, breast cancer or pancreatic cancer |
| WO2021067863A2 (en) | 2019-10-03 | 2021-04-08 | Xencor, Inc. | Targeted il-12 heterodimeric fc-fusion proteins |
| WO2021072298A1 (en) | 2019-10-11 | 2021-04-15 | Genentech, Inc. | Pd-1 targeted il-15/il-15ralpha fc fusion proteins with improved properties |
| US10982002B2 (en) | 2018-03-12 | 2021-04-20 | Zoetis Services Llc | Anti-NGF antibodies and methods thereof |
| WO2021079958A1 (ja) | 2019-10-25 | 2021-04-29 | 第一三共株式会社 | 抗garp抗体と免疫調節剤の組み合わせ |
| WO2021087458A2 (en) | 2019-11-02 | 2021-05-06 | Board Of Regents, The University Of Texas System | Targeting nonsense-mediated decay to activate p53 pathway for the treatment of cancer |
| WO2021092221A1 (en) | 2019-11-06 | 2021-05-14 | Bristol-Myers Squibb Company | Methods of identifying a subject with a tumor suitable for a checkpoint inhibitor therapy |
| WO2021092380A1 (en) | 2019-11-08 | 2021-05-14 | Bristol-Myers Squibb Company | Lag-3 antagonist therapy for melanoma |
| WO2021092220A1 (en) | 2019-11-06 | 2021-05-14 | Bristol-Myers Squibb Company | Methods of identifying a subject with a tumor suitable for a checkpoint inhibitor therapy |
| WO2021102468A1 (en) | 2019-11-22 | 2021-05-27 | Theravance Biopharma R&D Ip, Llc | Substituted 1,5-naphthyridines or quinolines as alk5 inhibitors |
| WO2021106978A1 (ja) | 2019-11-27 | 2021-06-03 | サイトリミック株式会社 | 医薬組成物 |
| WO2021113644A1 (en) | 2019-12-05 | 2021-06-10 | Multivir Inc. | Combinations comprising a cd8+ t cell enhancer, an immune checkpoint inhibitor and radiotherapy for targeted and abscopal effects for the treatment of cancer |
| WO2021127554A1 (en) | 2019-12-19 | 2021-06-24 | Bristol-Myers Squibb Company | Combinations of dgk inhibitors and checkpoint antagonists |
| WO2021142203A1 (en) | 2020-01-10 | 2021-07-15 | Innate Tumor Immunity, Inc. | Nlrp3 modulators |
| WO2021155113A1 (en) | 2020-01-29 | 2021-08-05 | Board Of Regents, The University Of Texas System | Use of egfr/her2 tyrosine kinase inhibitors and/or her2/her3 antibodies for the treatment of cancers with nrg1 fusions |
| WO2021155130A1 (en) | 2020-01-29 | 2021-08-05 | Board Of Regents, The University Of Texas System | Use of poziotinib for the treatment of cancers with nrg1 fusions |
| WO2021159024A1 (en) | 2020-02-05 | 2021-08-12 | Larimar Therapeutics, Inc. | Tat peptide binding proteins and uses thereof |
| WO2021158938A1 (en) | 2020-02-06 | 2021-08-12 | Bristol-Myers Squibb Company | Il-10 and uses thereof |
| WO2021167908A1 (en) | 2020-02-17 | 2021-08-26 | Board Of Regents, The University Of Texas System | Methods for expansion of tumor infiltrating lymphocytes and use thereof |
| WO2021170750A1 (en) | 2020-02-28 | 2021-09-02 | Orega Biotech | Combination therapies based on ctla4 and il-17b inhibitors |
| EP3876955A1 (en) | 2018-11-09 | 2021-09-15 | Pierian Biosciences, LLC | Methods and compositions for determining the composition of a tumor microenvironment |
| WO2021183428A1 (en) | 2020-03-09 | 2021-09-16 | Bristol-Myers Squibb Company | Antibodies to cd40 with enhanced agonist activity |
| WO2021203131A1 (en) | 2020-03-31 | 2021-10-07 | Theravance Biopharma R&D Ip, Llc | Substituted pyrimidines and methods of use |
| WO2021207449A1 (en) | 2020-04-09 | 2021-10-14 | Merck Sharp & Dohme Corp. | Affinity matured anti-lap antibodies and uses thereof |
| WO2021211331A1 (en) | 2020-04-13 | 2021-10-21 | Abbott Point Of Care Inc. | METHODS, COMPLEXES AND KITS FOR DETECTING OR DETERMINING AN AMOUNT OF A ß-CORONAVIRUS ANTIBODY IN A SAMPLE |
| WO2021216920A1 (en) | 2020-04-22 | 2021-10-28 | Iovance Biotherapeutics, Inc. | Systems and methods for coordinating manufacturing of cells for patient-specific immunotherapy |
| WO2021216670A1 (en) | 2020-04-21 | 2021-10-28 | University Of Rochester | Inhibitors of human epididymus protein 4 |
| WO2021231732A1 (en) | 2020-05-15 | 2021-11-18 | Bristol-Myers Squibb Company | Antibodies to garp |
| WO2021237068A2 (en) | 2020-05-21 | 2021-11-25 | Board Of Regents, The University Of Texas System | T cell receptors with vgll1 specificity and uses thereof |
| WO2021245071A1 (en) | 2020-06-03 | 2021-12-09 | Mv Biotherapeutics Sa | Combination of an atp-hydrolyzing enzyme and an immune checkpoint modulator and uses thereof |
| WO2021247908A1 (en) | 2020-06-03 | 2021-12-09 | Bionecure Therapeutics, Inc. | Trophoblast cell-surface antigen-2 (trop-2) antibodies |
| WO2021247836A1 (en) | 2020-06-03 | 2021-12-09 | Board Of Regents, The University Of Texas System | Methods for targeting shp-2 to overcome resistance |
| WO2021253041A1 (en) | 2020-06-10 | 2021-12-16 | Theravance Biopharma R&D Ip, Llc | Naphthyridine derivatives useful as alk5 inhibitors |
| WO2021260675A1 (en) | 2020-06-24 | 2021-12-30 | Yeda Research And Development Co. Ltd. | Agents for sensitizing solid tumors to treatment |
| US11214619B2 (en) | 2018-07-20 | 2022-01-04 | Surface Oncology, Inc. | Anti-CD112R compositions and methods |
| WO2022003156A1 (en) | 2020-07-02 | 2022-01-06 | Oncurious Nv | Ccr8 non-blocking binders |
| WO2022003568A1 (en) | 2020-06-30 | 2022-01-06 | Dcprime B.V. | Use of leukemia-derived cells in ovarian cancer vaccines |
| WO2022010847A1 (en) | 2020-07-07 | 2022-01-13 | Cancure, Llc | Mic antibodies and binding agents and methods of using the same |
| WO2022008519A1 (en) | 2020-07-07 | 2022-01-13 | BioNTech SE | Therapeutic rna for hpv-positive cancer |
| EP3942024A1 (en) | 2019-03-18 | 2022-01-26 | The Regents of the University of California | Augmentation of t-cell activation by oscillatory forces and engineered antigen-presenting cells |
| WO2022020661A1 (en) | 2020-07-24 | 2022-01-27 | The University Of Rochester | Inhibitors of interleukin-1 receptor-associated kinases 1 and 4 |
| WO2022020636A2 (en) | 2020-07-24 | 2022-01-27 | Amgen Inc. | Immunogens derived from sars-cov2 spike protein |
| US11242393B2 (en) | 2018-03-23 | 2022-02-08 | Bristol-Myers Squibb Company | Antibodies against MICA and/or MICB and uses thereof |
| WO2022031804A1 (en) | 2020-08-04 | 2022-02-10 | Abbott Laboratories | Improved methods and kits for detecting sars-cov-2 protein in a sample |
| WO2022047412A1 (en) | 2020-08-31 | 2022-03-03 | Bristol-Myers Squibb Company | Cell localization signature and immunotherapy |
| WO2022047189A1 (en) | 2020-08-28 | 2022-03-03 | Bristol-Myers Squibb Company | Lag-3 antagonist therapy for hepatocellular carcinoma |
| US11274152B2 (en) | 2013-09-20 | 2022-03-15 | Bristol-Myers Squibb Company | Combination of anti-LAG-3 antibodies and anti-PD-1 antibodies to treat tumors |
| US11291718B2 (en) | 2016-10-11 | 2022-04-05 | Cytlimic Inc. | Method for treating cancer by administering a toll-like receptor agonist and LAG-3 IgG fusion protein |
| WO2022074464A2 (en) | 2020-03-05 | 2022-04-14 | Neotx Therapeutics Ltd. | Methods and compositions for treating cancer with immune cells |
| WO2022087402A1 (en) | 2020-10-23 | 2022-04-28 | Bristol-Myers Squibb Company | Lag-3 antagonist therapy for lung cancer |
| WO2022104109A1 (en) | 2020-11-13 | 2022-05-19 | Catamaran Bio, Inc. | Genetically modified natural killer cells and methods of use thereof |
| US11338027B2 (en) | 2016-09-21 | 2022-05-24 | Amal Therapeutics Sa | Fusion comprising a cell penetrating peptide, a multi epitope and a TLR peptide agonist for treatment of cancer |
| WO2022115611A1 (en) | 2020-11-25 | 2022-06-02 | Catamaran Bio, Inc. | Cellular therapeutics engineered with signal modulators and methods of use thereof |
| US11351252B2 (en) | 2016-06-05 | 2022-06-07 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| WO2022120179A1 (en) | 2020-12-03 | 2022-06-09 | Bristol-Myers Squibb Company | Multi-tumor gene signatures and uses thereof |
| WO2022120388A2 (en) | 2020-12-04 | 2022-06-09 | Tidal Therapeutics, Inc. | Ionizable cationic lipids and lipid nanoparticles, and methods of synthesis and use thereof |
| WO2022119841A1 (en) | 2020-12-01 | 2022-06-09 | Abbott Laboratories | Use of one or more biomarkers to determine traumatic brain injury (tbi) in a subject having received a head computerized tomography scan that is negative for a tbi |
| US11359028B2 (en) | 2016-11-09 | 2022-06-14 | Agenus Inc. | Anti-OX40 antibodies and anti-GITR antibodies |
| US11359013B2 (en) | 2005-06-08 | 2022-06-14 | Emory University | Methods and compositions for the treatment of persistent infections and cancer by inhibiting the programmed cell death 1 (PD-1) pathway |
| WO2022130206A1 (en) | 2020-12-16 | 2022-06-23 | Pfizer Inc. | TGFβr1 INHIBITOR COMBINATION THERAPIES |
| WO2022136650A1 (en) | 2020-12-24 | 2022-06-30 | Oncurious Nv | Murine cross-reactive human ccr8 binders |
| WO2022136255A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Treatment schedule for cytokine proteins |
| WO2022136647A1 (en) | 2020-12-24 | 2022-06-30 | Oncurious Nv | Human ccr8 binders |
| WO2022136266A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Therapeutic rna for treating cancer |
| WO2022136649A1 (en) | 2020-12-24 | 2022-06-30 | Oncurious Nv | Non-blocking human ccr8 binders |
| WO2022135667A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Therapeutic rna for treating cancer |
| WO2022147147A1 (en) | 2020-12-30 | 2022-07-07 | Abbott Laboratories | Methods for determining sars-cov-2 antigen and anti-sars-cov-2 antibody in a sample |
| WO2022146947A1 (en) | 2020-12-28 | 2022-07-07 | Bristol-Myers Squibb Company | Antibody compositions and methods of use thereof |
| WO2022146948A1 (en) | 2020-12-28 | 2022-07-07 | Bristol-Myers Squibb Company | Subcutaneous administration of pd1/pd-l1 antibodies |
| EP4029950A1 (en) | 2016-04-29 | 2022-07-20 | Board of Regents, The University of Texas System | Targeted measure of transcriptional activity related to hormone receptors |
| EP4029508A1 (en) | 2014-10-10 | 2022-07-20 | Idera Pharmaceuticals, Inc. | Treatment of cancer using tlr9 agonists and checkpoint inhibitors |
| US11396647B2 (en) | 2020-01-07 | 2022-07-26 | Board Of Regents, The University Of Texas System | Human methylthioadenosine/adenosine depleting enzyme variants for cancer therapy |
| WO2022159492A1 (en) | 2021-01-19 | 2022-07-28 | William Marsh Rice University | Bone-specific delivery of polypeptides |
| WO2022157715A1 (en) | 2021-01-22 | 2022-07-28 | Dcprime B.V. | Methods of tumor vaccination |
| WO2022165214A1 (en) | 2021-01-29 | 2022-08-04 | Board Of Regents, The University Of Texas System | Methods of treating cancer with kinase inhibitors |
| KR20220119433A (ko) | 2019-12-27 | 2022-08-29 | 추가이 세이야쿠 가부시키가이샤 | 항ctla-4 항체 및 그의 사용 |
| WO2022190058A1 (en) | 2021-03-12 | 2022-09-15 | Dcprime B.V. | Methods of vaccination and use of cd47 blockade |
| WO2022212876A1 (en) | 2021-04-02 | 2022-10-06 | The Regents Of The University Of California | Antibodies against cleaved cdcp1 and uses thereof |
| EP4070799A1 (en) | 2021-04-08 | 2022-10-12 | Nuvamid SA | Compositions for the improvement of sport performance |
| WO2022217022A1 (en) | 2021-04-10 | 2022-10-13 | Profoundbio Us Co. | Folr1 binding agents, conjugates thereof and methods of using the same |
| US11479608B2 (en) | 2016-08-23 | 2022-10-25 | Akeso Biopharma, Inc. | Anti-CTLA4 antibodies |
| EP4079310A1 (en) | 2021-04-20 | 2022-10-26 | Nuvamid SA | Nmn and derivatives for its use in the treatment of alpha-synucleinopathies |
| EP4079311A1 (en) | 2021-04-20 | 2022-10-26 | Nuvamid SA | Nmn and derivatives for its use in the treatment of depression and/or anxiety in patients having a form of parkinsonism |
| WO2022226317A1 (en) | 2021-04-23 | 2022-10-27 | Profoundbio Us Co. | Anti-cd70 antibodies, conjugates thereof and methods of using the same |
| WO2022223622A1 (en) | 2021-04-20 | 2022-10-27 | Institut Curie | Compositions and methods for use in immunotherapy |
| US11491204B2 (en) | 2015-04-07 | 2022-11-08 | Cytlimic Inc. | Composition comprising poly I:C and LAG-3-IGG fusion protein |
| WO2022245920A1 (en) | 2021-05-18 | 2022-11-24 | Abbott Laboratories | Methods of evaluating brain injury in a pediatric subject |
| WO2022251359A1 (en) | 2021-05-26 | 2022-12-01 | Theravance Biopharma R&D Ip, Llc | Bicyclic inhibitors of alk5 and methods of use |
| WO2022261018A1 (en) | 2021-06-07 | 2022-12-15 | Providence Health & Services - Oregon | Cxcr5, pd-1, and icos expressing tumor reactive cd4 t cells and their use |
| WO2022266034A1 (en) | 2021-06-14 | 2022-12-22 | Abbott Laboratories | Methods of diagnosing or aiding in diagnosis of brain injury caused by acoustic energy, electromagnetic energy, an over pressurization wave, and/or blast wind |
| WO2023280790A1 (en) | 2021-07-05 | 2023-01-12 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Gene signatures for predicting survival time in patients suffering from renal cell carcinoma |
| WO2023285552A1 (en) | 2021-07-13 | 2023-01-19 | BioNTech SE | Multispecific binding agents against cd40 and cd137 in combination therapy for cancer |
| US11564986B2 (en) | 2015-07-16 | 2023-01-31 | Onkosxcel Therapeutics, Llc | Approach for treatment of cancer via immunomodulation by using talabostat |
| WO2023014922A1 (en) | 2021-08-04 | 2023-02-09 | The Regents Of The University Of Colorado, A Body Corporate | Lat activating chimeric antigen receptor t cells and methods of use thereof |
| WO2023028501A1 (en) | 2021-08-23 | 2023-03-02 | Immunitas Therapeutics, Inc. | Anti-cd161 antibodies and uses thereof |
| WO2023034777A1 (en) | 2021-08-31 | 2023-03-09 | Abbott Laboratories | Methods and systems of diagnosing brain injury |
| WO2023056268A1 (en) | 2021-09-30 | 2023-04-06 | Abbott Laboratories | Methods and systems of diagnosing brain injury |
| WO2023056361A1 (en) | 2021-09-29 | 2023-04-06 | Board Of Regents, The University Of Texas System | Anti-hsp70 antibodies and therapeutic uses thereof |
| WO2023060136A1 (en) | 2021-10-05 | 2023-04-13 | Cytovia Therapeutics, Llc | Natural killer cells and methods of use thereof |
| WO2023061930A1 (en) | 2021-10-11 | 2023-04-20 | BioNTech SE | Therapeutic rna for lung cancer |
| WO2023068382A2 (en) | 2021-10-20 | 2023-04-27 | Takeda Pharmaceutical Company Limited | Compositions targeting bcma and methods of use thereof |
| WO2023077090A1 (en) | 2021-10-29 | 2023-05-04 | Bristol-Myers Squibb Company | Lag-3 antagonist therapy for hematological cancer |
| WO2023076880A1 (en) | 2021-10-25 | 2023-05-04 | Board Of Regents, The University Of Texas System | Foxo1-targeted therapy for the treatment of cancer |
| US11643463B2 (en) | 2017-05-19 | 2023-05-09 | Wuxi Biologics (Shanghai) Co., Ltd. | Monoclonal antibodies to cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) |
| WO2023092099A1 (en) | 2021-11-19 | 2023-05-25 | Ardeagen Corporation | Gpc3 binding agents, conjugates thereof and methods of using the same |
| WO2023102384A1 (en) | 2021-11-30 | 2023-06-08 | Abbott Laboratories | Use of one or more biomarkers to determine traumatic brain injury (tbi) in a subject having received a head computerized tomography scan that is negative for a tbi |
| WO2023114978A1 (en) | 2021-12-17 | 2023-06-22 | Abbott Laboratories | Systems and methods for determining uch-l1, gfap, and other biomarkers in blood samples |
| WO2023118411A1 (en) | 2021-12-23 | 2023-06-29 | Etherna Immunotherapies Nv | Immunostimulatory mrna compositions and uses thereof |
| WO2023129942A1 (en) | 2021-12-28 | 2023-07-06 | Abbott Laboratories | Use of biomarkers to determine sub-acute traumatic brain injury (tbi) in a subject having received a head computerized tomography (ct) scan that is negative for a tbi or no head ct scan |
| WO2023147371A1 (en) | 2022-01-26 | 2023-08-03 | Bristol-Myers Squibb Company | Combination therapy for hepatocellular carcinoma |
| WO2023150652A1 (en) | 2022-02-04 | 2023-08-10 | Abbott Laboratories | Lateral flow methods, assays, and devices for detecting the presence or measuring the amount of ubiquitin carboxy-terminal hydrolase l1 and/or glial fibrillary acidic protein in a sample |
| US11723975B2 (en) | 2017-05-30 | 2023-08-15 | Bristol-Myers Squibb Company | Compositions comprising an anti-LAG-3 antibody or an anti-LAG-3 antibody and an anti-PD-1 or anti-PD-L1 antibody |
| WO2023164638A1 (en) | 2022-02-25 | 2023-08-31 | Bristol-Myers Squibb Company | Combination therapy for colorectal carcinoma |
| WO2023168404A1 (en) | 2022-03-04 | 2023-09-07 | Bristol-Myers Squibb Company | Methods of treating a tumor |
| WO2023170606A1 (en) | 2022-03-08 | 2023-09-14 | Alentis Therapeutics Ag | Use of anti-claudin-1 antibodies to increase t cell availability |
| WO2023178192A1 (en) | 2022-03-15 | 2023-09-21 | Compugen Ltd. | Il-18bp antagonist antibodies and their use in monotherapy and combination therapy in the treatment of cancer |
| WO2023178329A1 (en) | 2022-03-18 | 2023-09-21 | Bristol-Myers Squibb Company | Methods of isolating polypeptides |
| WO2023176881A1 (ja) | 2022-03-16 | 2023-09-21 | 第一三共株式会社 | 多重特異的分子と免疫チェックポイント阻害剤の組み合わせ |
| EP4249066A2 (en) | 2014-12-23 | 2023-09-27 | Bristol-Myers Squibb Company | Antibodies to tigit |
| WO2023196987A1 (en) | 2022-04-07 | 2023-10-12 | Bristol-Myers Squibb Company | Methods of treating tumor |
| WO2023211972A1 (en) | 2022-04-28 | 2023-11-02 | Medical University Of South Carolina | Chimeric antigen receptor modified regulatory t cells for treating cancer |
| US11807686B2 (en) | 2017-05-30 | 2023-11-07 | Bristol-Myers Squibb Company | Treatment of LAG-3 positive tumors |
| WO2023213763A1 (en) | 2022-05-02 | 2023-11-09 | Transgene | Poxvirus encoding a binding agent comprising an anti- pd-l1 sdab |
| WO2023213764A1 (en) | 2022-05-02 | 2023-11-09 | Transgene | Fusion polypeptide comprising an anti-pd-l1 sdab and a member of the tnfsf |
| WO2023228095A1 (en) | 2022-05-24 | 2023-11-30 | Daiichi Sankyo Company, Limited | Dosage regimen of an anti-cdh6 antibody-drug conjugate |
| WO2023235847A1 (en) | 2022-06-02 | 2023-12-07 | Bristol-Myers Squibb Company | Antibody compositions and methods of use thereof |
| WO2023240156A1 (en) | 2022-06-08 | 2023-12-14 | Tidal Therapeutics, Inc. | Ionizable cationic lipids and lipid nanoparticles, and methods of synthesis and use thereof |
| US11859003B2 (en) | 2017-08-21 | 2024-01-02 | Adagene Inc. | Method for treating cancer using anti-CD137 antibody |
| WO2024006876A1 (en) | 2022-06-29 | 2024-01-04 | Abbott Laboratories | Magnetic point-of-care systems and assays for determining gfap in biological samples |
| WO2024003353A1 (en) | 2022-07-01 | 2024-01-04 | Transgene | Fusion protein comprising a surfactant-protein-d and a member of the tnfsf |
| US11865081B2 (en) | 2017-12-29 | 2024-01-09 | Virogin Biotech Canada Ltd. | Oncolytic viral delivery of therapeutic polypeptides |
| WO2024023750A1 (en) | 2022-07-28 | 2024-02-01 | Astrazeneca Uk Limited | Combination of antibody-drug conjugate and bispecific checkpoint inhibitor |
| WO2024028794A1 (en) | 2022-08-02 | 2024-02-08 | Temple Therapeutics BV | Methods for treating endometrial and ovarian hyperproliferative disorders |
| EP4319755A1 (en) | 2021-04-08 | 2024-02-14 | Board of Regents, The University of Texas System | Compounds and methods for theranostic targeting of parp activity |
| KR20240024255A (ko) | 2021-06-25 | 2024-02-23 | 추가이 세이야쿠 가부시키가이샤 | 항ctla-4 항체의 사용 |
| KR20240024213A (ko) | 2021-06-25 | 2024-02-23 | 추가이 세이야쿠 가부시키가이샤 | 항ctla-4 항체 |
| WO2024052356A1 (en) | 2022-09-06 | 2024-03-14 | Institut National de la Santé et de la Recherche Médicale | Inhibitors of the ceramide metabolic pathway for overcoming immunotherapy resistance in cancer |
| WO2024059708A1 (en) | 2022-09-15 | 2024-03-21 | Abbott Laboratories | Biomarkers and methods for differentiating between mild and supermild traumatic brain injury |
| US11952681B2 (en) | 2018-02-02 | 2024-04-09 | Adagene Inc. | Masked activatable CD137 antibodies |
| WO2024086827A2 (en) | 2022-10-20 | 2024-04-25 | Repertoire Immune Medicines, Inc. | Cd8 t cell targeted il2 |
| US11981921B2 (en) | 2022-04-15 | 2024-05-14 | Iovance Biotherapeutics, Inc. | TIL expansion processes using specific cytokine combinations and/or AKTi treatment |
| WO2024112571A2 (en) | 2022-11-21 | 2024-05-30 | Iovance Biotherapeutics, Inc. | Two-dimensional processes for the expansion of tumor infiltrating lymphocytes and therapies therefrom |
| WO2024126457A1 (en) | 2022-12-14 | 2024-06-20 | Astellas Pharma Europe Bv | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and immune checkpoint inhibitors |
| WO2024137776A1 (en) | 2022-12-21 | 2024-06-27 | Bristol-Myers Squibb Company | Combination therapy for lung cancer |
| WO2024163477A1 (en) | 2023-01-31 | 2024-08-08 | University Of Rochester | Immune checkpoint blockade therapy for treating staphylococcus aureus infections |
| US12076375B2 (en) | 2022-06-29 | 2024-09-03 | Snipr Biome Aps | Treating and preventing E coli infections |
| US12084655B2 (en) | 2018-04-09 | 2024-09-10 | Checkmate Pharmaceuticals | Packaging oligonucleotides into virus-like particles |
| US12091681B2 (en) | 2020-03-27 | 2024-09-17 | Mendus B.V. | Ex vivo use of modified cells of leukemic origin for enhancing the efficacy of adoptive cell therapy |
| WO2024196952A1 (en) | 2023-03-20 | 2024-09-26 | Bristol-Myers Squibb Company | Tumor subtype assessment for cancer therapy |
| WO2024204629A1 (ja) | 2023-03-29 | 2024-10-03 | 第一三共株式会社 | 抗cd25抗体及び抗cd25抗体-薬物コンジュゲート |
| WO2024211475A1 (en) | 2023-04-04 | 2024-10-10 | Abbott Laboratories | Use of biomarkers to determine whether a subject has sustained, may have sustained or is suspected of sustaining a subacute acquired brain injury (abi) |
| WO2024213767A1 (en) | 2023-04-14 | 2024-10-17 | Institut National de la Santé et de la Recherche Médicale | Engraftment of mesenchymal stromal cells engineered to stimulate immune infiltration in tumors |
| WO2024226971A1 (en) | 2023-04-28 | 2024-10-31 | Abbott Point Of Care Inc. | Improved assays, cartridges, and kits for detection of biomarkers, including brain injury biomarkers |
| WO2024261302A1 (en) | 2023-06-22 | 2024-12-26 | Institut National de la Santé et de la Recherche Médicale | Nlrp3 inhibitors, pak1/2 inhibitors and/or caspase 1 inhibitors for use in the treatment of rac2 monogenic disorders |
| EP4484445A1 (en) | 2023-06-26 | 2025-01-01 | Universität zu Köln | Hcmv neutralizing antibodies |
| WO2025003753A1 (en) | 2023-06-26 | 2025-01-02 | Compugen Ltd. | Il-18bp antagonist antibodies and their use in monotherapy and combination therapy in the treatment of cancer |
| WO2025003193A1 (en) | 2023-06-26 | 2025-01-02 | Institut National de la Santé et de la Recherche Médicale | Sertraline and indatraline for disrupting intracellular cholesterol trafficking and subsequently inducing lysosomal damage and anti-tumor immunity |
| US12195536B2 (en) | 2017-10-06 | 2025-01-14 | The Wistar Institute Of Anatomy And Biology | DNA monoclonal antibodies targeting CTLA-4 for the treatment and prevention of cancer |
| WO2025012417A1 (en) | 2023-07-13 | 2025-01-16 | Institut National de la Santé et de la Recherche Médicale | Anti-neurotensin long fragment and anti-neuromedin n long fragment antibodies and uses thereof |
| WO2025038763A1 (en) | 2023-08-15 | 2025-02-20 | Bristol-Myers Squibb Company | Ceramic hydroxyapatite chromatography flow through method |
| WO2025050009A2 (en) | 2023-09-01 | 2025-03-06 | Children's Hospital Medical Center | Identification of targets for immunotherapy in melanoma using splicing-derived neoantigens |
| US12246031B2 (en) | 2018-02-13 | 2025-03-11 | Checkmate Pharmaceuticals, Inc. | Compositions and methods for tumor immunotherapy |
| WO2025061993A1 (en) | 2023-09-21 | 2025-03-27 | Domain Therapeutics | Anti-ccr8 monoclonal antibodies and their therapeutic use |
| WO2025061994A1 (en) | 2023-09-21 | 2025-03-27 | Domain Therapeutics | Anti-ccr8 monoclonal antibodies and their therapeutic use |
| EP4548979A2 (en) | 2015-09-11 | 2025-05-07 | Nascent Biotech, Inc. | Enhanced delivery of drugs to the brain |
| EP4559477A2 (en) | 2020-05-13 | 2025-05-28 | Adagene AG | Compositions and methods for treating cancer |
| WO2025120866A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| WO2025120867A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and anti-vegfr2 antibodies |
| WO2025121445A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| EP4570256A2 (en) | 2020-11-05 | 2025-06-18 | Board of Regents, The University of Texas System | Engineered t cell receptors targeting egfr antigens and methods of use |
| EP4574165A1 (en) | 2023-12-21 | 2025-06-25 | Egle Therapeutics | Immunocytokine for cancer treatment |
| WO2025133175A1 (en) | 2023-12-21 | 2025-06-26 | Egle Therapeutics | Immunocytokine for cancer treatment |
| WO2025145207A1 (en) | 2023-12-29 | 2025-07-03 | Bristol-Myers Squibb Company | Combination therapy of kras inhibitor and treg-depleting agent |
| US12365729B2 (en) | 2020-05-13 | 2025-07-22 | Disc Medicine, Inc. | Anti-hemojuvelin (HJV) antibodies for treating myelofibrosis |
| US12371511B2 (en) | 2011-06-30 | 2025-07-29 | Chugai Seiyaku Kabushiki Kaisha | Heterodimerized polypeptide |
| US12384845B2 (en) | 2018-12-26 | 2025-08-12 | Xilio Development, Inc. | Activatable masked anti-CTLA4 binding proteins |
| WO2025174825A2 (en) | 2024-02-12 | 2025-08-21 | Aera Therapeutics, Inc. | Delivery compositions |
| WO2025184211A1 (en) | 2024-02-27 | 2025-09-04 | Bristol-Myers Squibb Company | Anti-ceacam5 antibody drug conjugates |
| WO2025184208A1 (en) | 2024-02-27 | 2025-09-04 | Bristol-Myers Squibb Company | Anti-ceacam5 antibodies and uses thereof |
| US12415857B2 (en) | 2021-06-25 | 2025-09-16 | Chugai Seiyaku Kabushiki Kaisha | Anti-CTLA-4 antibody and use thereof |
| WO2025202222A1 (en) | 2024-03-25 | 2025-10-02 | Institut National de la Santé et de la Recherche Médicale | Therapeutic use of sting and tlrs agonists to induce p16 expression in immune cells |
| WO2025210175A1 (en) | 2024-04-04 | 2025-10-09 | Centre National De La Recherche Scientifique | Mutant csf-1r extracellular domain fusion molecules and therapeutic uses thereof |
| WO2025217096A1 (en) | 2024-04-08 | 2025-10-16 | University Of Rochester | Inhibitors of leucine-rich repeat kinase 2 (lrrk2) and medical uses thereof |
| WO2025217094A1 (en) | 2024-04-08 | 2025-10-16 | University Of Rochester | Interleukin receptor-associated kinase (irak) protac degraders and medical use thereof |
| WO2025245489A1 (en) | 2024-05-24 | 2025-11-27 | Bristol-Myers Squibb Company | Treatment of tumors in subjects having fgl-1 positive samples |
| WO2025248505A1 (en) | 2024-05-31 | 2025-12-04 | Wayne State University | Methods for treating endometrial and ovarian hyperproliferative disorders |
| WO2026012976A1 (en) | 2024-07-08 | 2026-01-15 | Institut National de la Santé et de la Recherche Médicale | Use of inhibitor of gasdermind for treatment of rac2 monogenic disorders |
| WO2026033885A1 (en) | 2024-08-08 | 2026-02-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| US12553031B2 (en) | 2021-03-25 | 2026-02-17 | Iovance Biotherapeutics, Inc. | Methods and compositions for T-cell coculture potency assays and use with cell therapy products |
| US12553029B2 (en) | 2020-10-06 | 2026-02-17 | Iovance Biotherapeutics, Inc. | Treatment of NSCLC patients with tumor infiltrating lymphocyte therapies |
| US12551515B2 (en) | 2018-11-21 | 2026-02-17 | Board Of Regents Of The University Of Texas System | Methods and compositions for treating cancer |
| WO2026039642A1 (en) | 2024-08-16 | 2026-02-19 | Ardeagen Corporation | Anti-mesothelin antibody conjugates and methods of use thereof |
| US12558351B2 (en) | 2019-03-22 | 2026-02-24 | Duke University | Compositions and methods for enhancing cancer immune checkpoint therapy |
| WO2026052851A2 (en) | 2024-09-09 | 2026-03-12 | Institut National de la Santé et de la Recherche Médicale | Inhibitor of ciliogenesis for use in a method of preventing therapeutic resistance in cancer |
| WO2026072557A2 (en) | 2024-09-24 | 2026-04-02 | Genzyme Corporation | Ionizable cationic lipids and lipid nanoparticles, and methods of synthesis and use thereof |
Families Citing this family (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| HN2004000285A (es) | 2003-08-04 | 2006-04-27 | Pfizer Prod Inc | ANTICUERPOS DIRIGIDOS A c-MET |
| JP2006265155A (ja) * | 2005-03-23 | 2006-10-05 | Link Genomics Kk | 癌の免疫療法 |
| JP5224707B2 (ja) * | 2005-04-28 | 2013-07-03 | 持田製薬株式会社 | 抗血小板膜糖蛋白質viモノクローナル抗体 |
| KR20080030656A (ko) * | 2005-07-07 | 2008-04-04 | 콜레이 파마시티컬 그룹, 인코포레이티드 | 암 치료를 위한 항-CTLA-4 항체 및 CpG-모티프-함유합성 올리고데옥시뉴클레오티드의 조합 요법 |
| CN100443503C (zh) * | 2005-07-18 | 2008-12-17 | 四川大学华西医院 | 人源化ctla-4单链抗体与人穿孔素通道形成肽p34的重组免疫毒素 |
| US7612181B2 (en) | 2005-08-19 | 2009-11-03 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| US7919079B2 (en) * | 2006-03-31 | 2011-04-05 | Biosante Pharmaceuticals, Inc. | Cancer immunotherapy compositions and methods of use |
| US8895004B2 (en) | 2007-02-27 | 2014-11-25 | AbbVie Deutschland GmbH & Co. KG | Method for the treatment of amyloidoses |
| KR101012267B1 (ko) * | 2008-08-29 | 2011-02-08 | 주식회사 세이프로드 | 파손이 방지되는 차선규제봉 및 차선규제봉 시공방법 |
| TWI606063B (zh) * | 2012-08-23 | 2017-11-21 | 艾澤西公司 | 結合至158p1d7蛋白之抗體藥物結合物(adc) |
| WO2016070769A1 (zh) * | 2014-11-04 | 2016-05-12 | 北京韩美药品有限公司 | 同时阻断b7/cd28和il6/il6r/gp130信号通路的重组融合蛋白 |
| WO2016074580A1 (zh) * | 2014-11-14 | 2016-05-19 | 中国科学院上海生命科学研究院 | 一种提高cd4阳性t淋巴细胞存活率和活性的试剂及其应用 |
| CN104387453A (zh) * | 2014-12-08 | 2015-03-04 | 深圳市同康生物医药有限公司 | 树突状细胞靶向肽及编码基因及应用 |
| NL2017270B1 (en) * | 2016-08-02 | 2018-02-09 | Aduro Biotech Holdings Europe B V | New anti-hCTLA-4 antibodies |
| CN116478289A (zh) * | 2017-05-19 | 2023-07-25 | 上海药明生物技术有限公司 | 一种新的ctla-4单克隆抗体 |
| TWI799432B (zh) * | 2017-07-27 | 2023-04-21 | 美商再生元醫藥公司 | 抗ctla-4抗體及其用途 |
| CN108003238B (zh) * | 2017-11-30 | 2021-02-02 | 常州费洛斯药业科技有限公司 | 一种能特异识别ctla-4的全人源单克隆抗体或抗体片段及其方法和用途 |
| SG11202005692WA (en) * | 2017-12-20 | 2020-07-29 | Harbour Biomed Shanghai Co Ltd | Antibodies binding ctla-4 and uses thereof |
| US20230167177A1 (en) * | 2018-03-19 | 2023-06-01 | WuXi Biologics Ireland Limited | Novel anti-ctla-4 antibody polypeptide |
| US20200318200A1 (en) | 2019-04-02 | 2020-10-08 | The Brigham And Women's Hospital, Inc. | Methods for Identifying Progression of a Primary Melanoma |
| WO2021024742A1 (ja) * | 2019-08-06 | 2021-02-11 | 国立大学法人筑波大学 | 細胞傷害アッセイ方法 |
| EP4051321A4 (en) | 2019-10-30 | 2023-11-22 | Duke University | IMMUNOTHERAPY WITH COMBINATION THERAPY INCLUDING AN IMMUNOTOXIN |
| CN112359052B (zh) * | 2020-08-20 | 2023-01-03 | 山东兴瑞生物科技有限公司 | 抗EpCAM嵌合抗原受体的编码基因、制备方法、具有该基因的质粒、免疫细胞及其应用 |
| KR20230119179A (ko) * | 2020-12-10 | 2023-08-16 | 우시 바이올로직스 아일랜드 리미티드 | P-캐드히린에 대한 항체 및 이의 용도 |
| JP2024541476A (ja) * | 2021-11-24 | 2024-11-08 | デイナ ファーバー キャンサー インスティチュート,インコーポレイテッド | Ctla-4に対する抗体及びその使用方法 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4816397A (en) | 1983-03-25 | 1989-03-28 | Celltech, Limited | Multichain polypeptides or proteins and processes for their production |
| US5151510A (en) | 1990-04-20 | 1992-09-29 | Applied Biosystems, Inc. | Method of synethesizing sulfurized oligonucleotide analogs |
Family Cites Families (74)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3180193A (en) | 1963-02-25 | 1965-04-27 | Benedict David | Machines for cutting lengths of strip material |
| US4399216A (en) | 1980-02-25 | 1983-08-16 | The Trustees Of Columbia University | Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials |
| US4681581A (en) | 1983-12-05 | 1987-07-21 | Coates Fredrica V | Adjustable size diaper and folding method therefor |
| US4740461A (en) | 1983-12-27 | 1988-04-26 | Genetics Institute, Inc. | Vectors and methods for transformation of eucaryotic cells |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| EP0216846B2 (en) | 1985-04-01 | 1995-04-26 | Celltech Limited | Transformed myeloma cell-line and a process for the expression of a gene coding for a eukaryotic polypeptide employing same |
| US5776093A (en) | 1985-07-05 | 1998-07-07 | Immunomedics, Inc. | Method for imaging and treating organs and tissues |
| US4735210A (en) | 1985-07-05 | 1988-04-05 | Immunomedics, Inc. | Lymphographic and organ imaging method and kit |
| US5101827A (en) | 1985-07-05 | 1992-04-07 | Immunomedics, Inc. | Lymphographic and organ imaging method and kit |
| GB8601597D0 (en) | 1986-01-23 | 1986-02-26 | Wilson R H | Nucleotide sequences |
| US4959455A (en) | 1986-07-14 | 1990-09-25 | Genetics Institute, Inc. | Primate hematopoietic growth factors IL-3 and pharmaceutical compositions |
| US4912040A (en) | 1986-11-14 | 1990-03-27 | Genetics Institute, Inc. | Eucaryotic expression system |
| US5750172A (en) | 1987-06-23 | 1998-05-12 | Pharming B.V. | Transgenic non human mammal milk |
| GB8717430D0 (en) | 1987-07-23 | 1987-08-26 | Celltech Ltd | Recombinant dna product |
| US5648471A (en) | 1987-12-03 | 1997-07-15 | Centocor, Inc. | One vial method for labeling antibodies with Technetium-99m |
| GB8809129D0 (en) | 1988-04-18 | 1988-05-18 | Celltech Ltd | Recombinant dna methods vectors and host cells |
| GB8823869D0 (en) | 1988-10-12 | 1988-11-16 | Medical Res Council | Production of antibodies |
| US5175384A (en) | 1988-12-05 | 1992-12-29 | Genpharm International | Transgenic mice depleted in mature t-cells and methods for making transgenic mice |
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| DK0486622T3 (da) | 1989-08-09 | 1999-07-19 | Rhomed Inc | Direkte radiomærkning af antistoffer og andre proteiner med technetium eller rhenium |
| US5633076A (en) | 1989-12-01 | 1997-05-27 | Pharming Bv | Method of producing a transgenic bovine or transgenic bovine embryo |
| DE69120146T2 (de) | 1990-01-12 | 1996-12-12 | Cell Genesys Inc | Erzeugung xenogener antikörper |
| WO1996033735A1 (en) * | 1995-04-27 | 1996-10-31 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| FR2664073A1 (fr) | 1990-06-29 | 1992-01-03 | Thomson Csf | Moyens de marquage d'objets, procede de realisation et dispositif de lecture. |
| US5165424A (en) | 1990-08-09 | 1992-11-24 | Silverman Harvey N | Method and system for whitening teeth |
| WO1993012227A1 (en) | 1991-12-17 | 1993-06-24 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5789650A (en) | 1990-08-29 | 1998-08-04 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5814318A (en) | 1990-08-29 | 1998-09-29 | Genpharm International Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US6300129B1 (en) | 1990-08-29 | 2001-10-09 | Genpharm International | Transgenic non-human animals for producing heterologous antibodies |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| DE69133557D1 (de) | 1990-08-29 | 2007-03-15 | Pharming Intellectual Pty Bv | Homologe rekombination in säugetier-zellen |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5770429A (en) | 1990-08-29 | 1998-06-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| ATE158021T1 (de) | 1990-08-29 | 1997-09-15 | Genpharm Int | Produktion und nützung nicht-menschliche transgentiere zur produktion heterologe antikörper |
| US5194594A (en) | 1990-09-07 | 1993-03-16 | Techniclone, Inc. | Modified antibodies |
| WO1992022670A1 (en) | 1991-06-12 | 1992-12-23 | Genpharm International, Inc. | Early detection of transgenic embryos |
| WO1992022645A1 (en) | 1991-06-14 | 1992-12-23 | Genpharm International, Inc. | Transgenic immunodeficient non-human animals |
| CA2580812A1 (en) | 1991-06-27 | 1993-01-07 | Bristol-Myers Squibb Company | Ctla4 receptor, fusion proteins containing it and uses thereof |
| US5770197A (en) | 1991-06-27 | 1998-06-23 | Bristol-Myers Squibb Company | Methods for regulating the immune response using B7 binding molecules and IL4-binding molecules |
| WO1993004169A1 (en) | 1991-08-20 | 1993-03-04 | Genpharm International, Inc. | Gene targeting in animal cells using isogenic dna constructs |
| US5777085A (en) | 1991-12-20 | 1998-07-07 | Protein Design Labs, Inc. | Humanized antibodies reactive with GPIIB/IIIA |
| ATE208374T1 (de) | 1992-02-18 | 2001-11-15 | Otsuka Kagaku Kk | Beta-laktam und cepham verbindungen und ihre herstellung |
| US5714350A (en) | 1992-03-09 | 1998-02-03 | Protein Design Labs, Inc. | Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region |
| US5733743A (en) | 1992-03-24 | 1998-03-31 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| AU4541093A (en) | 1992-06-18 | 1994-01-24 | Genpharm International, Inc. | Methods for producing transgenic non-human animals harboring a yeast artificial chromosome |
| ES2301158T3 (es) | 1992-07-24 | 2008-06-16 | Amgen Fremont Inc. | Produccion de anticuerpos xenogenicos. |
| US5773253A (en) | 1993-01-22 | 1998-06-30 | Bristol-Myers Squibb Company | MYPPPY variants of CTL A4 and uses thereof |
| WO1994019935A1 (en) | 1993-03-09 | 1994-09-15 | Genzyme Corporation | Isolation of components of interest from milk |
| JPH08509612A (ja) | 1993-04-26 | 1996-10-15 | ジェンファーム インターナショナル インコーポレイテッド | 異種抗体を産生することができるトランスジェニック非ヒト動物 |
| CA2164288A1 (en) | 1993-06-04 | 1994-12-22 | Barbara Ensoli | Method for treating kaposi's sarcoma with antisense oligonucleotides |
| EP0665852A1 (en) | 1993-07-09 | 1995-08-09 | Amgen Boulder Inc. | Recombinant ctla4 polypeptides and methods for making the same |
| CA2167091A1 (en) | 1993-07-26 | 1995-02-02 | Gordon J. Freeman | B7-2: ctl a4/cd 28 counter receptor |
| US5625825A (en) | 1993-10-21 | 1997-04-29 | Lsi Logic Corporation | Random number generating apparatus for an interface unit of a carrier sense with multiple access and collision detect (CSMA/CD) ethernet data network |
| US5827690A (en) | 1993-12-20 | 1998-10-27 | Genzyme Transgenics Corporatiion | Transgenic production of antibodies in milk |
| ES2153895T3 (es) | 1994-03-08 | 2001-03-16 | Dana Farber Cancer Inst Inc | Metodos para modular la insensibilidad de celulas t. |
| US6719972B1 (en) * | 1994-06-03 | 2004-04-13 | Repligen Corporation | Methods of inhibiting T cell proliferation or IL-2 accumulation with CTLA4- specific antibodies |
| US5643763A (en) | 1994-11-04 | 1997-07-01 | Genpharm International, Inc. | Method for making recombinant yeast artificial chromosomes by minimizing diploid doubling during mating |
| US5703057A (en) | 1995-04-07 | 1997-12-30 | Board Of Regents The University Of Texas System | Expression library immunization |
| WO1996034096A1 (en) | 1995-04-28 | 1996-10-31 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US5811097A (en) | 1995-07-25 | 1998-09-22 | The Regents Of The University Of California | Blockade of T lymphocyte down-regulation associated with CTLA-4 signaling |
| US6025130A (en) | 1996-04-04 | 2000-02-15 | Mercator Genetics, Inc. | Hereditary hemochromatosis gene |
| JP2000516594A (ja) * | 1996-07-26 | 2000-12-12 | スミスクライン・ビーチャム・コーポレイション | 免疫細胞介在全身性疾患の改良された治療法 |
| CA2722378C (en) | 1996-12-03 | 2015-02-03 | Amgen Fremont Inc. | Human antibodies that bind tnf.alpha. |
| JP2001523958A (ja) * | 1997-03-21 | 2001-11-27 | ブライハム アンド ウィミンズ ホスピタル,インコーポレイテッド | 免疫療法のctla−4結合ペプチド |
| US6235883B1 (en) * | 1997-05-05 | 2001-05-22 | Abgenix, Inc. | Human monoclonal antibodies to epidermal growth factor receptor |
| EP1212422B1 (en) * | 1999-08-24 | 2007-02-21 | Medarex, Inc. | Human ctla-4 antibodies and their uses |
| EP2228698B1 (en) | 2005-03-14 | 2012-06-27 | Omron Corporation | Programmable controller system |
| US8209741B2 (en) | 2007-09-17 | 2012-06-26 | Microsoft Corporation | Human performance in human interactive proofs using partial credit |
| JP6071725B2 (ja) | 2013-04-23 | 2017-02-01 | カルソニックカンセイ株式会社 | 電気自動車の駆動力制御装置 |
| JP6943759B2 (ja) | 2017-12-28 | 2021-10-06 | 株式会社東海理化電機製作所 | シフト装置 |
| US11284893B2 (en) | 2019-04-02 | 2022-03-29 | Covidien Lp | Stapling device with articulating tool assembly |
-
1999
- 1999-12-23 CZ CZ20012349A patent/CZ302706B6/cs not_active IP Right Cessation
- 1999-12-23 GE GE4453A patent/GEP20053594B/en unknown
- 1999-12-23 HU HUP1300750 patent/HU1300750D0/hu not_active Application Discontinuation
- 1999-12-23 JP JP2000589573A patent/JP3793693B2/ja not_active Expired - Lifetime
- 1999-12-23 AP APAP/P/2001/002213A patent/AP1590A/en active
- 1999-12-23 HR HRP20130077AA patent/HRP20130077A2/hr not_active Application Discontinuation
- 1999-12-23 HK HK02102809.5A patent/HK1041274B/zh not_active IP Right Cessation
- 1999-12-23 RS YUP-455/01A patent/RS51309B/sr unknown
- 1999-12-23 ES ES99966644T patent/ES2340745T3/es not_active Expired - Lifetime
- 1999-12-23 DK DK99966644.9T patent/DK1141028T3/da active
- 1999-12-23 EP EP09007161.4A patent/EP2112166B1/en not_active Expired - Lifetime
- 1999-12-23 NZ NZ512553A patent/NZ512553A/xx not_active IP Right Cessation
- 1999-12-23 SI SI9931041T patent/SI1141028T1/sl unknown
- 1999-12-23 SG SG200305551-4A patent/SG143018A1/en unknown
- 1999-12-23 SI SI9931084T patent/SI2112166T1/sl unknown
- 1999-12-23 MX MXPA01006422A patent/MXPA01006422A/es active IP Right Grant
- 1999-12-23 BR BRPI9916853A patent/BRPI9916853B8/pt unknown
- 1999-12-23 IL IL14379799A patent/IL143797A0/xx active IP Right Grant
- 1999-12-23 HU HU0104604A patent/HU229566B1/hu unknown
- 1999-12-23 EA EA200100698A patent/EA006972B1/ru not_active IP Right Cessation
- 1999-12-23 HR HRP20010551AA patent/HRP20010551B1/hr not_active IP Right Cessation
- 1999-12-23 SG SG200803369-8A patent/SG156547A1/en unknown
- 1999-12-23 OA OA00100166A patent/OA11917A/en unknown
- 1999-12-23 PL PL349266A patent/PL210435B1/pl unknown
- 1999-12-23 PT PT99966644T patent/PT1141028E/pt unknown
- 1999-12-23 SK SK5035-2011A patent/SK288274B6/sk not_active IP Right Cessation
- 1999-12-23 KR KR1020077015213A patent/KR100849443B1/ko not_active Expired - Lifetime
- 1999-12-23 TR TR2002/00735T patent/TR200200735T2/xx unknown
- 1999-12-23 SK SK914-2001A patent/SK288057B6/sk not_active IP Right Cessation
- 1999-12-23 ID IDW00200101614A patent/ID29991A/id unknown
- 1999-12-23 EE EEP200100336A patent/EE05483B1/xx unknown
- 1999-12-23 ES ES09007161T patent/ES2706547T3/es not_active Expired - Lifetime
- 1999-12-23 WO PCT/US1999/030895 patent/WO2000037504A2/en not_active Ceased
- 1999-12-23 BR BR9916853-7A patent/BR9916853A/pt not_active IP Right Cessation
- 1999-12-23 AU AU22149/00A patent/AU772676B2/en not_active Expired
- 1999-12-23 DE DE69942037T patent/DE69942037D1/de not_active Expired - Lifetime
- 1999-12-23 PL PL384501A patent/PL214003B1/pl unknown
- 1999-12-23 CN CN99813642.5A patent/CN1328571B/zh not_active Expired - Lifetime
- 1999-12-23 CZ CZ20110342A patent/CZ303703B6/cs not_active IP Right Cessation
- 1999-12-23 PT PT90071614T patent/PT2112166T/pt unknown
- 1999-12-23 KR KR1020057012533A patent/KR100856446B1/ko not_active Expired - Lifetime
- 1999-12-23 AT AT99966644T patent/ATE458008T1/de active
- 1999-12-23 LT LTEP09007161.4T patent/LT2112166T/lt unknown
- 1999-12-23 CA CA2356215A patent/CA2356215C/en not_active Expired - Lifetime
- 1999-12-23 UA UA2001075213A patent/UA76936C2/uk unknown
- 1999-12-23 KR KR1020017007965A patent/KR100617337B1/ko not_active Expired - Lifetime
- 1999-12-23 TR TR2001/01831T patent/TR200101831T2/xx unknown
- 1999-12-23 EP EP99966644A patent/EP1141028B1/en not_active Expired - Lifetime
- 1999-12-23 EP EP18200101.6A patent/EP3553085A1/en not_active Withdrawn
- 1999-12-23 DK DK09007161.4T patent/DK2112166T3/en active
-
2001
- 2001-06-17 IL IL143797A patent/IL143797A/en not_active IP Right Cessation
- 2001-06-22 NO NO20013147A patent/NO332618B1/no not_active IP Right Cessation
- 2001-06-22 IS IS5974A patent/IS2798B/is unknown
- 2001-06-25 CU CU20010147A patent/CU23292B7/es not_active IP Right Cessation
- 2001-07-12 ZA ZA200105742A patent/ZA200105742B/en unknown
- 2001-07-18 CR CR6425A patent/CR6425A/es unknown
- 2001-07-20 BG BG105722A patent/BG65899B1/bg unknown
-
2004
- 2004-09-28 JP JP2004281376A patent/JP2005087215A/ja active Pending
-
2008
- 2008-05-13 CR CR9972A patent/CR9972A/xx unknown
-
2011
- 2011-03-03 IS IS8950A patent/IS8950A/is unknown
-
2012
- 2012-03-30 NO NO20120398A patent/NO337037B1/no not_active IP Right Cessation
-
2018
- 2018-12-19 CY CY20181101358T patent/CY1121451T1/el unknown
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4816397A (en) | 1983-03-25 | 1989-03-28 | Celltech, Limited | Multichain polypeptides or proteins and processes for their production |
| US5151510A (en) | 1990-04-20 | 1992-09-29 | Applied Biosystems, Inc. | Method of synethesizing sulfurized oligonucleotide analogs |
Non-Patent Citations (13)
| Title |
|---|
| ALEGRE ET AL., J IMMUNOL, vol. 157, 1996, pages 4762 - 70 |
| BLAUG, SEYMOUR: "Remington's Pharmaceutical Sciences (15th ed,", 1975, MACK PUBLISHING COMPANY |
| C. BRANDEN AND J. TOOZE,: "Introduction to Protein Structure", 1991, GARLAND PUBLISHING |
| CASTAN ET AL., IMMUNOLOGY, vol. 90, 1997, pages 265 - 71 |
| CREIGHTON,: "Proteins, Structures and Molecular Principles", 1984, W H. FREEMAN AND COMPANY |
| LAPLANCHE ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 9081 |
| POWELL ET AL.: "Compendium of excipients for parenteral formulations", PDA J PHARM SCI TECHNOL., vol. 52, 1998, pages 238 - 311 |
| STEC ET AL., J. AM. CHEM. SOC., vol. 106, 1984, pages 6077 |
| STEIN ET AL., NUCL. ACIDS RES., vol. 16, 1988, pages 3209 |
| THORNTON, NATURE, vol. 354, 1991, pages 105 |
| UHLMANN; PEYMAN, CHEMICAL REVIEWS, vol. 90, 1990, pages 543 |
| ZON ET AL., ANTI-CANCER DRUG DESIGN, vol. 6, 1991, pages 539 |
| ZON ET AL.: "Oligonucleotides and Analogues: A Practical Approach", 1991, OXFORD UNIVERSITY PRESS, pages: 87 - 108 |
Cited By (862)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7605238B2 (en) * | 1999-08-24 | 2009-10-20 | Medarex, Inc. | Human CTLA-4 antibodies and their uses |
| EP1792991A1 (en) * | 1999-08-24 | 2007-06-06 | Medarex, Inc. | Human CTLA-4 antibodies and their uses |
| WO2001014424A3 (en) * | 1999-08-24 | 2001-09-20 | Medarex Inc | Human ctla-4 antibodies and their uses |
| EP2829609A1 (en) * | 1999-08-24 | 2015-01-28 | E. R. Squibb & Sons, L.L.C. | Human CTLA-4 antibodies and their uses |
| EP3214175A1 (en) * | 1999-08-24 | 2017-09-06 | E. R. Squibb & Sons, L.L.C. | Human ctla-4 antibodies and their uses |
| US7767207B2 (en) | 2000-02-10 | 2010-08-03 | Abbott Laboratories | Antibodies that bind IL-18 and methods of inhibiting IL-18 activity |
| US8680239B2 (en) | 2000-12-22 | 2014-03-25 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Use of RGM and its modulators |
| EP2796468A2 (en) | 2001-01-05 | 2014-10-29 | Pfizer Inc | Antibodies to insulin-like growth factor I receptor |
| EP2194067A2 (en) | 2001-01-05 | 2010-06-09 | Pfizer Inc. | Antibodies to insulin-like growth factor I receptor (IGF-IR) |
| EP2316486A2 (en) | 2001-04-26 | 2011-05-04 | Biogen Idec MA Inc. | Cripto blocking antibodies and uses thereof |
| EP1974749A1 (en) | 2001-04-26 | 2008-10-01 | Biogen Idec MA Inc. | Cripto blocking antibodies and uses thereof |
| US7078492B2 (en) | 2001-05-16 | 2006-07-18 | Abgenix, Inc. | Human antipneumococcal antibodies from non-human animals |
| KR100531707B1 (ko) * | 2001-05-23 | 2005-11-30 | 화이자 프로덕츠 인크. | 항-ctla-4 항체의 용도 |
| EP1262193A1 (en) * | 2001-05-23 | 2002-12-04 | Pfizer Products Inc. | Use of human anti-CTLA-4 antibodies for treatment of cancer |
| NO343687B1 (no) * | 2001-06-26 | 2019-05-06 | Amgen Inc | OPGL bindende antistoff og farmasøytisk sammensetning derav |
| US8409578B2 (en) | 2001-06-26 | 2013-04-02 | Amgen Inc. | Methods for treating bone loss with antibodies to OPGL |
| WO2003002713A3 (en) * | 2001-06-26 | 2003-08-14 | Abgenix Inc | Antibodies to opgl |
| US8058418B2 (en) | 2001-06-26 | 2011-11-15 | Amgen Inc. | Polynucleotides encoding heavy and light chains of antibodies to OPGL |
| EA021242B1 (ru) * | 2001-06-26 | 2015-05-29 | Эмджен Фримонт Инк. | Антитела к остеопротегерин лиганду (опгл) |
| EA021242B9 (ru) * | 2001-06-26 | 2015-11-30 | Эмджен Фримонт Инк. | Антитела к остеопротегерин лиганду (опгл) |
| US7364736B2 (en) | 2001-06-26 | 2008-04-29 | Amgen Inc. | Antibodies to OPGL |
| EP1495053A4 (en) * | 2001-10-11 | 2006-05-31 | Amgen Inc | SPICIAL BINDING AGENTS FOR ANGIOPO TINE-2 |
| US7521053B2 (en) | 2001-10-11 | 2009-04-21 | Amgen Inc. | Angiopoietin-2 specific binding agents |
| EP2272869A3 (en) * | 2001-10-11 | 2011-05-11 | Amgen Inc. | Angiopoietin-2 specific binding agents |
| AU2006228095B2 (en) * | 2001-10-11 | 2010-11-04 | Amgen Inc. | Angiopoietin-2 specific binding agents |
| EP2343086A2 (en) | 2001-11-09 | 2011-07-13 | Pfizer Products Inc. | Antibodies to CD40 |
| WO2003085089A2 (en) | 2002-03-29 | 2003-10-16 | Schering Corporation | Human monoclonal antibodies to interleukin-5 and methods and compositions comprising same |
| US7422742B2 (en) | 2002-03-29 | 2008-09-09 | Schering Corporation | Methods for using human monoclonal antibodies to interleukin-5 |
| US7141653B2 (en) | 2002-03-29 | 2006-11-28 | Schering Corporation | Human monoclonal antibodies to interleukin-5 |
| JP2005529873A (ja) * | 2002-04-12 | 2005-10-06 | メダレックス インコーポレイテッド | Ctla−4抗体を使用した治療の方法 |
| EP1503794A4 (en) * | 2002-04-12 | 2005-06-15 | Medarex Inc | TREATMENT PROCEDURE USING CTLA-4 ANTIBODIES |
| WO2003086459A1 (en) | 2002-04-12 | 2003-10-23 | Medarex, Inc. | Methods of treatement using ctla-4 antibodies |
| EP1549678A4 (en) * | 2002-09-30 | 2006-01-18 | Pfizer Prod Inc | HYBRIDOMAS THAT PRODUCE HIGH CONCENTRATIONS OF ANTIBODIES TO THE HUMAN SEQUENCE |
| US10464976B2 (en) | 2003-01-31 | 2019-11-05 | AbbVie Deutschland GmbH & Co. KG | Amyloid β(1-42) oligomers, derivatives thereof and antibodies thereto, methods of preparation thereof and use thereof |
| US7465446B2 (en) | 2003-05-30 | 2008-12-16 | Medarex, Inc. | Surrogate therapeutic endpoint for anti-CTLA4-based immunotherapy of disease |
| US7744875B2 (en) | 2003-05-30 | 2010-06-29 | Medarex, Inc. | Surrogate therapeutic endpoint for anti-CTLA-4 based immunotherapy of disease |
| WO2005003298A2 (en) | 2003-05-30 | 2005-01-13 | Medarex, Inc. | Surrogate therapeutic endpoint for anti-ctla-4 based immunotherapy of disease |
| US7273610B2 (en) | 2003-08-14 | 2007-09-25 | Dyax Corp. | Endotheliase-2 ligands |
| WO2005019270A3 (en) * | 2003-08-14 | 2005-06-23 | Dyax Corp | Endotheliase-2 ligands |
| EP3170840A1 (en) | 2003-09-10 | 2017-05-24 | Warner-Lambert Company LLC | Antibodies to m-csf |
| US9718883B2 (en) | 2003-09-10 | 2017-08-01 | Amgen Fremont Inc. | Antibodies to M-CSF |
| US10280219B2 (en) | 2003-09-10 | 2019-05-07 | Amgen Fremont Inc. | Antibodies to M-CSF |
| EP2395020A2 (en) | 2003-11-12 | 2011-12-14 | Abbott Laboratories | IL-18 binding proteins |
| EP2385070A1 (en) | 2003-11-12 | 2011-11-09 | Abbott Laboratories | Il-18 binding proteins |
| EP2460830A2 (en) | 2003-11-12 | 2012-06-06 | Abbott Laboratories | IL-18 binding proteins |
| EP2460829A2 (en) | 2003-11-12 | 2012-06-06 | Abbott Laboratories | IL-18 binding proteins |
| US9328169B2 (en) | 2004-01-09 | 2016-05-03 | Pfizer Inc. | Human antibodies that bind human MAdCAM |
| US10259872B2 (en) | 2004-01-09 | 2019-04-16 | Pfizer, Inc. | Antibodies to MAdCAM |
| USRE45847E1 (en) | 2004-01-09 | 2016-01-19 | Pfizer Inc. | Antibodies to MAdCAM |
| US7932372B2 (en) | 2004-01-09 | 2011-04-26 | Amgen Fremont Inc. | Antibodies to MAdCAM |
| WO2005092380A3 (en) * | 2004-03-26 | 2006-06-15 | Pfizer Prod Inc | Uses of anti-ctla-4 antibodies |
| US7494779B2 (en) | 2004-06-14 | 2009-02-24 | Li-Te Chin | Method for producing human antibodies to human CD152 with properties of agonist, antagonist, or inverse agonist |
| US8158386B2 (en) | 2004-06-14 | 2012-04-17 | Li-Te Chin | Method for producing human antibodies with properties of agonist, antagonist, or inverse agonist |
| US8021860B2 (en) | 2004-06-14 | 2011-09-20 | Li-Te Chin | Method for producing human antibodies to a self physiological receptor by site-directed in vitro immunization of human lymphocytes |
| EP2287195A2 (en) | 2004-07-01 | 2011-02-23 | Novo Nordisk A/S | Pan-KIR2DL NK-receptor antibodies and their use in diagnostik and therapy |
| WO2006003179A2 (en) | 2004-07-01 | 2006-01-12 | Novo Nordisk A/S | Antibodies binding to receptors kir2dl1, -2, 3 but not kir2ds4 and their therapeutic use |
| EP2335727A2 (en) | 2004-07-16 | 2011-06-22 | Pfizer Products Inc. | Combination treatment for non-hematologic malignancies using an anti-IGF-1R antibody |
| EP2322215A2 (en) | 2004-07-16 | 2011-05-18 | Pfizer Products Inc. | Combination treatment for non-hematologic malignancies using an anti-IGF-1R antibody |
| EP2322217A2 (en) | 2004-07-16 | 2011-05-18 | Pfizer Products Inc. | Combination treatment for non-hematologic malignancies using an anti-IGF-1R antibody |
| WO2006056464A3 (en) * | 2004-11-26 | 2007-01-18 | Pieris Proteolab Ag | Compound with affinity for the cytotoxic t lymphocyte-associated antigen (ctla-4) |
| US7892827B2 (en) | 2004-11-26 | 2011-02-22 | Pieris Ag | Compound with affinity for the cytotoxic T lymphocyte-associated antigen (CTLA-4) |
| EP2899277A1 (en) * | 2004-11-26 | 2015-07-29 | Pieris AG | Compound with affinity for the cytotoxic T lymphocyte-associated antigen (CTLA-4) |
| EP2620450A3 (en) * | 2005-03-08 | 2014-01-08 | Pfizer Products Inc. | Anti-CTLA-4 antibody compositions |
| WO2006096491A3 (en) * | 2005-03-08 | 2007-03-29 | Pharmacia & Upjohn Co Llc | Anti-ctla-4 antibody compositions |
| AU2012200203B2 (en) * | 2005-03-08 | 2014-07-03 | Pfizer Products Inc. | Anti-CTLA-4 Antibody Compositions |
| AU2006220829B2 (en) * | 2005-03-08 | 2011-10-13 | Pfizer Products Inc. | Anti-CTLA-4 antibody compositions |
| EP2311491A1 (en) | 2005-03-08 | 2011-04-20 | Pharmacia & Upjohn Company LLC | Composition comprising an antibody against macrophage colony-stimulating factor (M-CSF) and a chelating agent |
| AU2014240252B2 (en) * | 2005-03-08 | 2016-10-06 | Pfizer Products Inc | Anti-CTLA-4 Antibody Compositions |
| US9487581B2 (en) | 2005-03-08 | 2016-11-08 | Pfizer Inc. | Anti-CTLA-4 antibody compositions |
| EP2620450A2 (en) | 2005-03-08 | 2013-07-31 | Pharmacia & Upjohn Company LLC | Anti-CTLA-4 antibody compositions |
| WO2006096488A3 (en) * | 2005-03-08 | 2006-11-30 | Pharmacia & Upjohn Co Llc | Composition comprising human igg2 antibody and chelating agent |
| WO2006101691A1 (en) * | 2005-03-23 | 2006-09-28 | Pfizer Products Inc. | Therapy of prostate cancer with ctla4 antibodies and hormonal therapy |
| US10570209B2 (en) | 2005-03-25 | 2020-02-25 | Gitr, Inc. | Methods for inducing or enhancing an immune response by administering agonistic glucocorticoid-induced TNFR-family-related receptor (GITR) antibodies |
| US7812135B2 (en) | 2005-03-25 | 2010-10-12 | Tolerrx, Inc. | GITR-binding antibodies |
| US8388967B2 (en) | 2005-03-25 | 2013-03-05 | Gitr, Inc. | Methods for inducing or enhancing an immune response by administering agonistic GITR-binding antibodies |
| US9028823B2 (en) | 2005-03-25 | 2015-05-12 | Gitr, Inc. | Methods of inducing or enhancing an immune response in a subject by administering agonistic GITR binding antibodies |
| US9493572B2 (en) | 2005-03-25 | 2016-11-15 | Gitr, Inc. | GITR antibodies and methods of inducing or enhancing an immune response |
| US10030074B2 (en) | 2005-03-25 | 2018-07-24 | Gitr, Inc. | Methods of inducing or enhancing an immune response in a subject having cancer by administering GITR antibodies |
| US7807159B2 (en) | 2005-04-25 | 2010-10-05 | Amgen Fremont Inc. | Antibodies to myostatin |
| EP2295466A2 (en) | 2005-04-25 | 2011-03-16 | Pfizer Inc. | Antibodies to myostatin |
| EP2444419A1 (en) | 2005-04-26 | 2012-04-25 | Pfizer Inc. | P-Cadherin antibodies |
| EP2444421A1 (en) | 2005-04-26 | 2012-04-25 | Pfizer Inc. | P-Cadherin antibodies |
| EP2444420A1 (en) | 2005-04-26 | 2012-04-25 | Pfizer Inc. | P-Cadherin antibodies |
| US8389692B2 (en) | 2005-04-28 | 2013-03-05 | Mochida Pharmaceutical Co., Ltd. | Anti-platelet membrane glycoprotein VI monoclonal antibody |
| US8524870B2 (en) | 2005-04-28 | 2013-09-03 | Mochida Pharmaceutical Co., Ltd. | Anti-platelet membrane glycoprotein VI monoclonal antibody |
| EP2418278A2 (en) | 2005-05-09 | 2012-02-15 | Ono Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
| EP2439272A2 (en) | 2005-05-09 | 2012-04-11 | Ono Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
| EP2439273A2 (en) | 2005-05-09 | 2012-04-11 | Ono Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
| EP2161336A1 (en) | 2005-05-09 | 2010-03-10 | ONO Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
| EP3530736A2 (en) | 2005-05-09 | 2019-08-28 | ONO Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1 (pd-1) and methods for treating cancer using anti-pd-1 antibodies alone or in combination with other immunotherapeutics |
| US11359013B2 (en) | 2005-06-08 | 2022-06-14 | Emory University | Methods and compositions for the treatment of persistent infections and cancer by inhibiting the programmed cell death 1 (PD-1) pathway |
| EP2495257A2 (en) | 2005-08-19 | 2012-09-05 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| EP2500357A2 (en) | 2005-08-19 | 2012-09-19 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| EP2520588A1 (en) | 2005-08-19 | 2012-11-07 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| EP2500352A1 (en) | 2005-08-19 | 2012-09-19 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| EP2500355A2 (en) | 2005-08-19 | 2012-09-19 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| WO2007024715A2 (en) | 2005-08-19 | 2007-03-01 | Abbott Laboratories | Dual variable domain immunoglobin and uses thereof |
| EP2500354A2 (en) | 2005-08-19 | 2012-09-19 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| EP2500359A2 (en) | 2005-08-19 | 2012-09-19 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| EP2500353A2 (en) | 2005-08-19 | 2012-09-19 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| EP2500358A2 (en) | 2005-08-19 | 2012-09-19 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| EP2500356A2 (en) | 2005-08-19 | 2012-09-19 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| EP2960253A1 (en) | 2005-09-07 | 2015-12-30 | Amgen Fremont Inc. | Human monoclonal antibodies to activin receptor-like kinase-1 |
| EP3381945A1 (en) | 2005-09-07 | 2018-10-03 | Amgen Fremont Inc. | Human monoclonal antibodies to activin receptor-like kinase-1 |
| EP2447283A2 (en) | 2005-09-07 | 2012-05-02 | Amgen Fremont Inc. | Human monoclonal antibodies to activin receptor-like kinase-1 (ALK-1) |
| US10456415B2 (en) | 2005-09-29 | 2019-10-29 | Astex Pharmaceuticals, Inc. | Oligonucleotide analogues incorporating 5-aza-cytosine therein |
| US8906864B2 (en) | 2005-09-30 | 2014-12-09 | AbbVie Deutschland GmbH & Co. KG | Binding domains of proteins of the repulsive guidance molecule (RGM) protein family and functional fragments thereof, and their use |
| US7611702B2 (en) | 2005-11-08 | 2009-11-03 | Medarex, Inc. | TNF-alpha blocker treatment for enterocolitis associated with immunostimulatory therapeutic antibody therapy |
| US10538581B2 (en) | 2005-11-30 | 2020-01-21 | Abbvie Inc. | Anti-Aβ globulomer 4D10 antibodies |
| US10208109B2 (en) | 2005-11-30 | 2019-02-19 | Abbvie Inc. | Monoclonal antibodies against amyloid beta protein and uses thereof |
| US10323084B2 (en) | 2005-11-30 | 2019-06-18 | Abbvie Inc. | Monoclonal antibodies against amyloid beta protein and uses thereof |
| WO2007067959A2 (en) | 2005-12-07 | 2007-06-14 | Medarex, Inc. | Ctla-4 antibody dosage escalation regimens |
| US9062111B2 (en) | 2005-12-07 | 2015-06-23 | Medarex, L.L.C. | CTLA-4 antibody dosage escalation regimens |
| US8110194B2 (en) | 2005-12-07 | 2012-02-07 | Medarex, Inc. | CTLA-4 antibody dosage escalation regimens |
| EP2889309A1 (en) | 2006-03-03 | 2015-07-01 | Ono Pharmaceutical Co., Ltd. | Tetramer of extracellular domain of PD-L1 |
| EP2468765A1 (en) | 2006-03-03 | 2012-06-27 | ONO Pharmaceutical Co., Ltd. | Multimer of extracellular domain of cell surface functional molecule |
| WO2007100098A1 (ja) | 2006-03-03 | 2007-09-07 | Kyoto University | 細胞表面機能分子の細胞外領域多量体 |
| US9868961B2 (en) | 2006-03-30 | 2018-01-16 | The Regents Of The University Of California | Methods and compositions for localized secretion of anti-CTLA-4 antibodies |
| US8071323B2 (en) | 2006-04-07 | 2011-12-06 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Human monoclonal antibodies that bind human insulin like growth factors and their use |
| EP2511301A2 (en) | 2006-08-04 | 2012-10-17 | Medimmune Limited | Human antibodies to ERBB2 |
| US10086076B2 (en) | 2006-09-08 | 2018-10-02 | Abbvie Inc. | Interleukin-13 binding proteins |
| EP3910065A1 (en) | 2006-09-08 | 2021-11-17 | AbbVie Bahamas Ltd. | Interleukin -13 binding proteins |
| EP3339445A1 (en) | 2006-09-08 | 2018-06-27 | AbbVie Bahamas Ltd. | Interleukin -13 binding proteins |
| EP3524685A1 (en) | 2006-09-08 | 2019-08-14 | AbbVie Bahamas Ltd. | Interleukin -13 binding proteins |
| US11344621B2 (en) | 2006-09-08 | 2022-05-31 | Abbvie, Inc. | Interleukin-13 binding proteins |
| US9951125B2 (en) | 2006-11-30 | 2018-04-24 | Abbvie Inc. | Aβ conformer selective anti-Aβ globulomer monoclonal antibodies |
| WO2008112193A1 (en) | 2007-03-12 | 2008-09-18 | Dana-Farber Cancer Institute | Prognostic, diagnostic, and cancer therapeutic uses of fanci and fanci modulating agents |
| US7867494B2 (en) | 2007-04-02 | 2011-01-11 | Amgen Fremont Inc. | Anti-IgE antibodies |
| US9241992B2 (en) | 2007-07-12 | 2016-01-26 | Gitr, Inc. | Combination therapies employing GITR binding molecules |
| WO2009009116A2 (en) | 2007-07-12 | 2009-01-15 | Tolerx, Inc. | Combination therapies employing gitr binding molecules |
| US8591886B2 (en) | 2007-07-12 | 2013-11-26 | Gitr, Inc. | Combination therapies employing GITR binding molecules |
| WO2009045370A2 (en) | 2007-09-28 | 2009-04-09 | Intrexon Corporation | Therapeutic gene-switch constructs and bioreactors for the expression of biotherapeutic molecules, and uses thereof |
| US9724430B2 (en) | 2007-09-28 | 2017-08-08 | Intrexon Corporation | Therapeutic gene-switch constructs and bioreactors for the expression of biotherapeutic molecules, and uses thereof |
| US7794718B2 (en) | 2007-11-01 | 2010-09-14 | Perseid Therapeutics, LLC | Immunosuppressive polypeptides and nucleic acids |
| US8445230B2 (en) | 2007-11-01 | 2013-05-21 | Perseid Therapeutics Llc | Immunosuppressive polypeptides and nucleic acids |
| US8318176B2 (en) | 2007-11-01 | 2012-11-27 | Perseid Therapeutics Llc | Immunosuppressive polypeptides and nucleic acids |
| US8071095B2 (en) | 2007-11-01 | 2011-12-06 | Perseid Therapeutics, LLC | Immunosuppressive polypeptides and nucleic acids |
| US8496935B2 (en) | 2007-11-01 | 2013-07-30 | Perseid Therapeutics Llc | Immunosuppressive polypeptides and nucleic acids |
| US8491899B2 (en) | 2007-11-01 | 2013-07-23 | Perseid Therapeutics Llc | Immunosuppressive polypeptides and nucleic acids |
| US8283447B2 (en) | 2007-11-01 | 2012-10-09 | Perseid Therapeutics Llc | Immunosuppressive polypeptides and nucleic acids |
| US8268587B2 (en) | 2007-11-01 | 2012-09-18 | Perseid Therapeutics Llc | Immunosuppressive polypeptides and nucleic acids |
| EP2851374A1 (en) | 2007-12-14 | 2015-03-25 | Bristol-Myers Squibb Company | Binding molecules to the human OX40 receptor |
| EP3239178A1 (en) | 2007-12-14 | 2017-11-01 | Bristol-Myers Squibb Company | Binding molecules to the human ox40 receptor |
| EP2594590A1 (en) | 2007-12-14 | 2013-05-22 | Bristol-Myers Squibb Company | Binding molecules to the human OX40 receptor |
| EP2962731A1 (en) | 2008-01-08 | 2016-01-06 | Bristol-Myers Squibb Company | Combination of ipilimumab and paclitaxel for the treatment of cancer |
| US8263073B2 (en) | 2008-02-04 | 2012-09-11 | Medarex, Inc. | Anti-CTLA-4 antibodies with reduced blocking of binding of CTLA-4 to B7 and uses thereof |
| WO2009100140A1 (en) * | 2008-02-04 | 2009-08-13 | Medarex, Inc. | Anti-clta-4 antibodies with reduced blocking of binding of ctla-4 to b7 and uses thereof |
| US10336820B2 (en) | 2008-02-20 | 2019-07-02 | Amgen Inc. | Antibodies directed to angiopoietin-1 and angiopoietin-2 and uses thereof |
| EP3309173A1 (en) | 2008-02-29 | 2018-04-18 | AbbVie Deutschland GmbH & Co KG | Monoclonal antibodies against the rgm a protein and uses thereof |
| US9605069B2 (en) | 2008-02-29 | 2017-03-28 | AbbVie Deutschland GmbH & Co. KG | Antibodies against the RGM a protein and uses thereof |
| US8962803B2 (en) | 2008-02-29 | 2015-02-24 | AbbVie Deutschland GmbH & Co. KG | Antibodies against the RGM A protein and uses thereof |
| US9029508B2 (en) | 2008-04-29 | 2015-05-12 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| EP2899209A1 (en) | 2008-04-29 | 2015-07-29 | Abbvie Inc. | Dual Variable Domain Immunoglobulins and uses thereof |
| EP2500361A1 (en) | 2008-05-09 | 2012-09-19 | Abbott GmbH & Co. KG | Antibodies to receptor of advanced glycation end products (rage) and uses thereof |
| EP3059248A1 (en) | 2008-05-09 | 2016-08-24 | Abbvie Deutschland GmbH & Co. KG | Antibodies to receptor of advanced glycation end products (rage) and uses thereof |
| US8323651B2 (en) | 2008-05-09 | 2012-12-04 | Abbott Laboratories | Antibodies to receptor of advanced glycation end products (RAGE) and uses thereof |
| EP2116556A1 (en) | 2008-05-09 | 2009-11-11 | Abbott GmbH & Co. KG | Antibodies to receptor of advanced glycation end products (rage) and uses thereof |
| US9394363B2 (en) | 2008-05-09 | 2016-07-19 | AbbVie Deutschland GmbH & Co. KG | Antibodies to receptor of advanced glycation end products (RAGE) and uses thereof |
| WO2009149185A2 (en) | 2008-06-03 | 2009-12-10 | Abbott Laboratories | Dual variable domain immunoglobulins and uses thereof |
| EP3002299A1 (en) | 2008-06-03 | 2016-04-06 | AbbVie Inc. | Dual variable domain immunoglobulins and uses thereof |
| US9109026B2 (en) | 2008-06-03 | 2015-08-18 | Abbvie, Inc. | Dual variable domain immunoglobulins and uses thereof |
| US9035027B2 (en) | 2008-06-03 | 2015-05-19 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| EP2810654A1 (en) | 2008-07-08 | 2014-12-10 | AbbVie Inc. | Prostaglandin E2 binding proteins and uses thereof |
| US8822645B2 (en) | 2008-07-08 | 2014-09-02 | Abbvie Inc. | Prostaglandin E2 dual variable domain immunoglobulins and uses thereof |
| US8119129B2 (en) | 2008-08-01 | 2012-02-21 | Bristol-Myers Squibb Company | Combination of anti-CTLA4 antibody with dasatinib for the treatment of proliferative diseases |
| US8685394B2 (en) | 2008-08-01 | 2014-04-01 | Bristol-Myers Squibb Company | Combination of anti-CTLA4 antibody with diverse therapeutic regimens for the synergistic treatment of proliferative diseases |
| US9320811B2 (en) | 2008-08-01 | 2016-04-26 | Bristol-Myers Squibb Company | Combination of anti-CTLA4 antibody with diverse therapeutic regimens for the synergistic treatment of proliferative diseases |
| EP4147714A1 (en) | 2008-08-11 | 2023-03-15 | E. R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (lag-3) and uses thereof |
| US10344089B2 (en) | 2008-08-11 | 2019-07-09 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| EP3597216A1 (en) | 2008-08-11 | 2020-01-22 | E. R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (lag-3) and uses thereof |
| US11236164B2 (en) | 2008-08-11 | 2022-02-01 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| US11236165B2 (en) | 2008-08-11 | 2022-02-01 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind Lymphocyte Activation Gene-3 (LAG-3), and uses thereof |
| US10988536B2 (en) | 2008-08-11 | 2021-04-27 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| US11236163B2 (en) | 2008-08-11 | 2022-02-01 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| US10988535B2 (en) | 2008-08-11 | 2021-04-27 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| US11001630B2 (en) | 2008-08-11 | 2021-05-11 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation Gene-3 (LAG-3), and uses thereof |
| US11530267B2 (en) | 2008-08-11 | 2022-12-20 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| EP2905030A1 (en) | 2008-08-11 | 2015-08-12 | E. R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3) and uses thereof |
| US11512130B2 (en) | 2008-08-11 | 2022-11-29 | E.R. Squibb & Sons, L.L.C. | Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| US9238691B2 (en) | 2008-08-18 | 2016-01-19 | Pfizer Inc. | Nucleic acids encoding antibodies to CCR2 |
| US8710191B2 (en) | 2008-08-18 | 2014-04-29 | Pfizer Inc. | Antibodies to CCR2 |
| US8475790B2 (en) | 2008-10-06 | 2013-07-02 | Bristol-Myers Squibb Company | Combination of CD137 antibody and CTLA-4 antibody for the treatment of proliferative diseases |
| EP3059337A1 (en) | 2009-01-15 | 2016-08-24 | Adaptive Biotechnologies Corporation | Adaptive immunity profiling and methods for generation of monoclonal antibodies |
| WO2010083456A1 (en) | 2009-01-15 | 2010-07-22 | Imdaptive Inc. | Adaptive immunity profiling and methods for generation of monoclonal antibodies |
| EP2810652A2 (en) | 2009-03-05 | 2014-12-10 | AbbVie Inc. | IL-17 binding proteins |
| US9663587B2 (en) | 2009-03-05 | 2017-05-30 | Abbvie Inc. | IL-17 binding proteins |
| EP2772269A2 (en) | 2009-03-05 | 2014-09-03 | Abbvie Inc. | IL-17 binding proteins |
| WO2010104815A1 (en) | 2009-03-10 | 2010-09-16 | Abbott Laboratories | Antibodies binding to pivka-ii amino acids 13-27 |
| US8283162B2 (en) | 2009-03-10 | 2012-10-09 | Abbott Laboratories | Antibodies relating to PIVKAII and uses thereof |
| EP2769737A1 (en) | 2009-07-20 | 2014-08-27 | Bristol-Myers Squibb Company | Combination of an anti-CTLA4 antibody with etoposide for the synergistic treatment of proliferative diseases |
| EP3659596A1 (en) | 2009-07-20 | 2020-06-03 | Bristol-Myers Squibb Company | Combination of anti-ctla4 antibody with paclitaxel for the synergistic treatment of proliferative diseases |
| EP2947098A1 (en) | 2009-07-20 | 2015-11-25 | Bristol-Myers Squibb Company | Combination of anti-ctla4 antibody with gemcitabine for the synergistic treatment of proliferative diseases |
| EP3029070A1 (en) | 2009-08-29 | 2016-06-08 | AbbVie Inc. | Therapeutic dll4 binding proteins |
| US8623358B2 (en) | 2009-08-29 | 2014-01-07 | Abbvie Inc. | Therapeutic DLL4 binding proteins |
| US9132190B2 (en) | 2009-08-29 | 2015-09-15 | Abbvie Inc. | Therapeutic DLL4 binding proteins |
| WO2011025964A2 (en) | 2009-08-29 | 2011-03-03 | Abbott Laboratories | Therapeutic dll4 binding proteins |
| US9469688B2 (en) | 2009-08-29 | 2016-10-18 | Abbvie Inc. | Therapeutic DLL4 binding proteins |
| US8586714B2 (en) | 2009-09-01 | 2013-11-19 | Abbvie, Inc. | Dual variable domain immunoglobulins and uses thereof |
| US9119839B2 (en) | 2009-10-12 | 2015-09-01 | Pfizer Inc. | Cancer treatment |
| US8435516B2 (en) | 2009-10-12 | 2013-05-07 | Pfizer Inc. | Cancer treatment |
| WO2011045704A1 (en) | 2009-10-12 | 2011-04-21 | Pfizer Inc. | Cancer treatment |
| EP2949671A1 (en) | 2009-10-12 | 2015-12-02 | Pfizer Inc | Cancer treatment |
| US8716450B2 (en) | 2009-10-15 | 2014-05-06 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| US8722855B2 (en) | 2009-10-28 | 2014-05-13 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| US9067996B2 (en) | 2009-10-31 | 2015-06-30 | Abbvie Inc. | Antibodies to receptor for advanced glycation end products (RAGE) and uses thereof |
| US8420083B2 (en) | 2009-10-31 | 2013-04-16 | Abbvie Inc. | Antibodies to receptor for advanced glycation end products (RAGE) and uses thereof |
| WO2011070045A1 (en) | 2009-12-08 | 2011-06-16 | Abbott Gmbh & Co. Kg | Monoclonal antibodies against the rgm a protein for use in the treatment of retinal nerve fiber layer degeneration |
| US9175075B2 (en) | 2009-12-08 | 2015-11-03 | AbbVie Deutschland GmbH & Co. KG | Methods of treating retinal nerve fiber layer degeneration with monoclonal antibodies against a retinal guidance molecule (RGM) protein |
| EP3680253A2 (en) | 2010-03-02 | 2020-07-15 | AbbVie Inc. | Therapeutic dll4 binding proteins |
| EP3072904A1 (en) | 2010-03-02 | 2016-09-28 | Abbvie Inc. | Therapeutic dll4 binding proteins |
| US9469689B2 (en) | 2010-03-02 | 2016-10-18 | Abbvie Inc. | Therapeutic DLL4 binding proteins |
| US9115195B2 (en) | 2010-03-02 | 2015-08-25 | Abbvie Inc. | Therapeutic DLL4 binding proteins |
| US9822171B2 (en) | 2010-04-15 | 2017-11-21 | AbbVie Deutschland GmbH & Co. KG | Amyloid-beta binding proteins |
| WO2011130377A2 (en) | 2010-04-15 | 2011-10-20 | Abbott Laboratories | Amyloid-beta binding proteins |
| WO2011143562A2 (en) | 2010-05-14 | 2011-11-17 | Abbott Laboratories | Il-1 binding proteins |
| WO2011146382A1 (en) | 2010-05-17 | 2011-11-24 | Bristol-Myers Squibb Company | Improved immunotherapeutic dosing regimens and combinations thereof |
| WO2012006500A2 (en) | 2010-07-08 | 2012-01-12 | Abbott Laboratories | Monoclonal antibodies against hepatitis c virus core protein |
| EP2921177A2 (en) | 2010-07-09 | 2015-09-23 | AbbVie Inc. | Dual variable domain immunoglobulins and uses thereof |
| WO2012018476A1 (en) | 2010-07-26 | 2012-02-09 | Abbott Laboratories | Antibodies relating to pivka-ii and uses thereof |
| US9120862B2 (en) | 2010-07-26 | 2015-09-01 | Abbott Laboratories | Antibodies relating to PIVKA-II and uses thereof |
| US8735546B2 (en) | 2010-08-03 | 2014-05-27 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| EP3252072A2 (en) | 2010-08-03 | 2017-12-06 | AbbVie Inc. | Dual variable domain immunoglobulins and uses thereof |
| US9493560B2 (en) | 2010-08-03 | 2016-11-15 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| US9062101B2 (en) | 2010-08-14 | 2015-06-23 | AbbVie Deutschland GmbH & Co. KG | Amyloid-beta binding proteins |
| US10047121B2 (en) | 2010-08-14 | 2018-08-14 | AbbVie Deutschland GmbH & Co. KG | Amyloid-beta binding proteins |
| WO2012024650A2 (en) | 2010-08-19 | 2012-02-23 | Abbott Laboratories | Anti-ngf antibodies and their use |
| EP4056589A1 (en) | 2010-08-19 | 2022-09-14 | Zoetis Belgium S.A. | Anti-ngf antibodies and their use |
| US9505829B2 (en) | 2010-08-19 | 2016-11-29 | Zoetis Belgium S.A. | Anti-NGF antibodies and their use |
| US10093725B2 (en) | 2010-08-19 | 2018-10-09 | Zoetis Belgium S.A. | Anti-NGF antibodies and their use |
| EP3333188A1 (en) | 2010-08-19 | 2018-06-13 | Zoetis Belgium S.A. | Anti-ngf antibodies and their use |
| US10125192B2 (en) | 2010-08-19 | 2018-11-13 | Zoetis Belgium S.A. | Caninized anti-NGF antibodies and their use |
| US9046513B2 (en) | 2010-08-26 | 2015-06-02 | Abbvie Inc. | Dual variable domain immunoglobulins and uses thereof |
| WO2012072806A1 (en) * | 2010-12-02 | 2012-06-07 | Pieris Ag | Muteins of human lipocalin 2 with affinity for ctla-4 |
| WO2012082073A1 (en) | 2010-12-14 | 2012-06-21 | National University Of Singapore | Human monoclonal antibody with specificity for dengue virus serotype 1 e protein and uses thereof |
| WO2012088094A2 (en) | 2010-12-21 | 2012-06-28 | Abbott Laboratories | Il-1 binding proteins |
| WO2012121775A2 (en) | 2010-12-21 | 2012-09-13 | Abbott Laboratories | Dual variable domain immunoglobulins and uses thereof |
| US9714290B2 (en) | 2011-03-09 | 2017-07-25 | Antitope Limited | Humanised anti CTLA-4 antibodies |
| US9676846B2 (en) | 2011-04-12 | 2017-06-13 | The United States Of America As Represented By The Secretary, Department Of Health And Human Services | Human monoclonal antibodies that bind insulin-like growth factor (IGF) I and II |
| US9150644B2 (en) | 2011-04-12 | 2015-10-06 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Human monoclonal antibodies that bind insulin-like growth factor (IGF) I and II |
| US12371511B2 (en) | 2011-06-30 | 2025-07-29 | Chugai Seiyaku Kabushiki Kaisha | Heterodimerized polypeptide |
| EP3574919A1 (en) | 2011-07-13 | 2019-12-04 | AbbVie Inc. | Methods and compositions for treating asthma using anti-il-13 antibodies |
| US9221911B2 (en) | 2011-07-19 | 2015-12-29 | Bellur S. Prabhakar | Anti-CLTA4, anti-GLUT2 protein for the treatment of type 1 diabetes |
| US10072081B2 (en) | 2011-07-19 | 2018-09-11 | The Board Of Trustees Of The University Of Illinois | Anti-CTLA4, anti-GLUT2 protein for the treatment of type 1 diabetes |
| US8822649B2 (en) | 2011-07-19 | 2014-09-02 | The Board Of Trustees Of The University Of Illinois | Anti-CLTA4, anti-GLUT2 protein for the treatment of type 1 diabetes |
| WO2013013029A1 (en) * | 2011-07-19 | 2013-01-24 | The Board Of Trustees Of The University Of Illinois | Anti-clta4, anti-glut2 protein for the treatment of type 1 diabetes |
| US10517886B2 (en) | 2011-08-30 | 2019-12-31 | Astex Pharmaceuticals, Inc. | Drug formulations |
| US9913856B2 (en) | 2011-08-30 | 2018-03-13 | Astex Pharmaceuticals, Inc. | Drug formulations |
| WO2013063095A1 (en) | 2011-10-24 | 2013-05-02 | Abbvie Inc. | Immunobinders directed against sclerostin |
| WO2013063114A1 (en) | 2011-10-24 | 2013-05-02 | Abbvie Inc. | Immunobinders directed against tnf |
| WO2013068902A1 (en) | 2011-11-08 | 2013-05-16 | Pfizer Inc. | Methods of treating inflammatory disorders using anti-m-csf antibodies |
| WO2013090635A2 (en) | 2011-12-14 | 2013-06-20 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of iron-related disorders |
| US10118958B2 (en) | 2011-12-14 | 2018-11-06 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of iron-related disorders |
| US12098189B2 (en) | 2011-12-14 | 2024-09-24 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of iron-related disorders |
| US12098192B2 (en) | 2011-12-14 | 2024-09-24 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of iron-related disorders |
| WO2013090633A2 (en) | 2011-12-14 | 2013-06-20 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of iron-related disorders |
| US10822403B2 (en) | 2011-12-14 | 2020-11-03 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of iron-related disorders |
| EP3800200A1 (en) | 2011-12-14 | 2021-04-07 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of iron-related disorders |
| US9636398B2 (en) | 2011-12-14 | 2017-05-02 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of iron-related disorders |
| US9120870B2 (en) | 2011-12-30 | 2015-09-01 | Abbvie Inc. | Dual specific binding proteins directed against IL-13 and IL-17 |
| WO2013112922A1 (en) | 2012-01-27 | 2013-08-01 | AbbVie Deutschland GmbH & Co. KG | Composition and method for diagnosis and treatment of diseases associated with neurite degeneration |
| US9102722B2 (en) | 2012-01-27 | 2015-08-11 | AbbVie Deutschland GmbH & Co. KG | Composition and method for the diagnosis and treatment of diseases associated with neurite degeneration |
| US9365643B2 (en) | 2012-01-27 | 2016-06-14 | AbbVie Deutschland GmbH & Co. KG | Antibodies that bind to repulsive guidance molecule A (RGMA) |
| EP3653647A1 (en) | 2012-01-27 | 2020-05-20 | AbbVie Deutschland GmbH & Co KG | Composition and method for diagnosis and treatment of diseases associated with neurite degeneration |
| US10106602B2 (en) | 2012-01-27 | 2018-10-23 | AbbVie Deutschland GmbH & Co. KG | Isolated monoclonal anti-repulsive guidance molecule A antibodies and uses thereof |
| EP3369746A1 (en) | 2012-01-27 | 2018-09-05 | AbbVie Deutschland GmbH & Co KG | Composition and method for diagnosis and treatment of diseases associated with neurite degeneration |
| WO2013138702A2 (en) | 2012-03-15 | 2013-09-19 | Bristol-Myers Squibb Company | Methods for predicting gastrointestinal immune-related adverse events (gi-irae) in patients treated with modulation of the co-stimulatory pathway |
| WO2013142796A2 (en) | 2012-03-23 | 2013-09-26 | Bristol-Myers Squibb Company | Methods of treatments using ctla4 antibodies |
| WO2013155447A1 (en) | 2012-04-13 | 2013-10-17 | Children's Medical Center Corporation | Tiki inhibitors |
| EP3563865A2 (en) | 2012-05-04 | 2019-11-06 | Pfizer Inc | Prostate-associated antigens and vaccine-based immunotherapy regimens |
| WO2013164754A2 (en) | 2012-05-04 | 2013-11-07 | Pfizer Inc. | Prostate-associated antigens and vaccine-based immunotherapy regimens |
| WO2013169971A1 (en) | 2012-05-10 | 2013-11-14 | Bristol-Myers Squibb Company | Anti-tumor antibodies as predictive or prognostic biomarkers of efficacy and survival in ipilimumab-treated patients |
| US10323092B2 (en) | 2012-05-15 | 2019-06-18 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US12590154B2 (en) | 2012-05-15 | 2026-03-31 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US10308714B2 (en) | 2012-05-15 | 2019-06-04 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US9212224B2 (en) | 2012-05-15 | 2015-12-15 | Bristol-Myers Squibb Company | Antibodies that bind PD-L1 and uses thereof |
| US9856320B2 (en) | 2012-05-15 | 2018-01-02 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US10316091B2 (en) | 2012-05-15 | 2019-06-11 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US10266595B2 (en) | 2012-05-15 | 2019-04-23 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US10316090B2 (en) | 2012-05-15 | 2019-06-11 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US10604575B2 (en) | 2012-05-15 | 2020-03-31 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US10072082B2 (en) | 2012-05-15 | 2018-09-11 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US10584170B2 (en) | 2012-05-15 | 2020-03-10 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US10266594B1 (en) | 2012-05-15 | 2019-04-23 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US10323093B2 (en) | 2012-05-15 | 2019-06-18 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US10138299B2 (en) | 2012-05-15 | 2018-11-27 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| EP3309175A1 (en) | 2012-05-15 | 2018-04-18 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting pd-1/pd-l1 signaling |
| US10577423B2 (en) | 2012-05-15 | 2020-03-03 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US10266596B1 (en) | 2012-05-15 | 2019-04-23 | Bristol-Myers Squibb Company | Cancer immunotherapy by disrupting PD-1/PD-L1 signaling |
| US9617334B2 (en) | 2012-06-06 | 2017-04-11 | Zoetis Services Llc | Caninized anti-NGF antibodies and methods thereof |
| US9951128B2 (en) | 2012-06-06 | 2018-04-24 | Zoetis Services Llc | Caninized anti-NGF antibodies and methods thereof |
| EP3795592A1 (en) | 2012-07-02 | 2021-03-24 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof |
| WO2014008218A1 (en) | 2012-07-02 | 2014-01-09 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof |
| EP3275899A1 (en) | 2012-07-02 | 2018-01-31 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof |
| US11345752B2 (en) | 2012-07-02 | 2022-05-31 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof |
| EP4553086A2 (en) | 2012-07-02 | 2025-05-14 | Bristol-Myers Squibb Company | Optimization of antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof |
| US9670276B2 (en) | 2012-07-12 | 2017-06-06 | Abbvie Inc. | IL-1 binding proteins |
| US9944720B2 (en) | 2012-11-01 | 2018-04-17 | Abbvie Inc. | Anti-DLL4/VEGF dual variable domain immunoglobulin and uses thereof |
| US9045551B2 (en) | 2012-11-01 | 2015-06-02 | Abbvie Inc. | Anti-DLL4/VEGF dual variable domain immunoglobulin and uses thereof |
| US9163093B2 (en) | 2012-11-01 | 2015-10-20 | Abbvie Inc. | Anti-DLL4/VEGF dual variable domain immunoglobulin and uses thereof |
| WO2014100542A1 (en) | 2012-12-21 | 2014-06-26 | Abbvie, Inc. | High-throughput antibody humanization |
| US9550986B2 (en) | 2012-12-21 | 2017-01-24 | Abbvie Inc. | High-throughput antibody humanization |
| EP3563836A1 (en) | 2013-03-01 | 2019-11-06 | Astex Pharmaceuticals, Inc. | Drug combinations |
| US9790478B2 (en) | 2013-03-14 | 2017-10-17 | Abbott Laboratories | HCV NS3 recombinant antigens and mutants thereof for improved antibody detection |
| US11428694B2 (en) | 2013-03-14 | 2022-08-30 | Abbott Laboratories | Detection methods employing HCV core lipid and DNA binding domain monoclonal antibodies |
| EP3916103A1 (en) | 2013-03-14 | 2021-12-01 | Abbott Laboratories | Hcv core lipid binding domain monoclonal antibodies |
| EP3564384A1 (en) | 2013-03-14 | 2019-11-06 | Abbott Laboratories | Hcv core lipid binding domain monoclonal antibodies |
| US10444242B2 (en) | 2013-03-14 | 2019-10-15 | Abbott Laboratories | Detection methods employing HCV core lipid and DNA binding domain monoclonal antibodies |
| WO2014153056A2 (en) | 2013-03-14 | 2014-09-25 | Parkash Gill | Cancer treatment using antibodies that bing cell surface grp78 |
| US10345311B2 (en) | 2013-03-14 | 2019-07-09 | Abbott Laboratories | Detection methods employing HCV core lipid and DNA binding domain monoclonal antibodies |
| US10197573B2 (en) | 2013-03-14 | 2019-02-05 | Abbott Laboratories | HCV core lipid binding domain monoclonal antibodies |
| US9841427B2 (en) | 2013-03-14 | 2017-12-12 | Abbott Laboratories | HCV antigen-antibody combination assay and methods and compositions for use therein |
| US9469686B2 (en) | 2013-03-15 | 2016-10-18 | Abbott Laboratories | Anti-GP73 monoclonal antibodies and methods of obtaining the same |
| US8987418B2 (en) | 2013-03-15 | 2015-03-24 | Abbvie Inc. | Dual specific binding proteins directed against IL-1β and/or IL-17 |
| US10308709B2 (en) | 2013-03-15 | 2019-06-04 | Abbott Laboratories | Anti-GP73 monoclonal antibodies and methods of obtaining the same |
| US11421023B2 (en) | 2013-03-15 | 2022-08-23 | Abbott Laboratories | Anti-GP73 monoclonal antibodies and methods of obtaining the same |
| WO2014144355A2 (en) | 2013-03-15 | 2014-09-18 | Abbott Laboratories | Anti-gp73 monoclonal antibodies and methods of obtaining the same |
| US9062108B2 (en) | 2013-03-15 | 2015-06-23 | Abbvie Inc. | Dual specific binding proteins directed against IL-1 and/or IL-17 |
| EP3527586A1 (en) | 2013-03-15 | 2019-08-21 | Abbott Laboratories | Anti-gp73 monoclonal antibodies and methods of obtaining the same |
| EP3124499A1 (en) | 2013-03-15 | 2017-02-01 | Abbott Laboratories | Anti-gp73 monoclonal antibodies and methods of obtaining the same |
| US12286471B2 (en) | 2013-06-07 | 2025-04-29 | Duke University | Inhibitors of complement factor H |
| US11897946B2 (en) | 2013-06-07 | 2024-02-13 | Duke University | Methods of inhibiting complement factor H (CFH) comprising administering an antibody that binds CFH |
| US11136380B2 (en) | 2013-06-07 | 2021-10-05 | Duke University | Anti-complement factor H antibodies |
| US10183988B2 (en) | 2013-06-07 | 2019-01-22 | Duke University | Anti-Complement factor H antibodies |
| EP3632467A1 (en) | 2013-06-07 | 2020-04-08 | Duke University | Inhibitors of complement factor h |
| EP3995507A1 (en) | 2013-08-08 | 2022-05-11 | Cytune Pharma | Il-15 and il-15ralpha sushi domain based on modulokines |
| EP3444271A1 (en) | 2013-08-08 | 2019-02-20 | Cytune Pharma | Il-15 and il-15raplha sushi domain based modulokines |
| EP3659622A1 (en) | 2013-08-08 | 2020-06-03 | Cytune Pharma | Combined pharmaceutical composition |
| EP4269441A2 (en) | 2013-08-08 | 2023-11-01 | Cytune Pharma | Il-15 and il-15ralpha sushi domain based on modulokines |
| US11274152B2 (en) | 2013-09-20 | 2022-03-15 | Bristol-Myers Squibb Company | Combination of anti-LAG-3 antibodies and anti-PD-1 antibodies to treat tumors |
| WO2015063647A1 (en) | 2013-11-01 | 2015-05-07 | Pfizer Inc. | Vectors for expression of prostate-associated antigens |
| EP3524262A1 (en) | 2013-11-01 | 2019-08-14 | Pfizer Inc | Vectors for expression of prostate-associated antigens |
| EP4461372A2 (en) | 2013-11-05 | 2024-11-13 | Cognate Bioservices, Inc. | Combinations of checkpoint inhibitors and therapeutics to treat cancer |
| WO2015069770A1 (en) | 2013-11-05 | 2015-05-14 | Cognate Bioservices, Inc. | Combinations of checkpoint inhibitors and therapeutics to treat cancer |
| WO2015069703A1 (en) | 2013-11-06 | 2015-05-14 | Bristol-Myers Squibb Company | Immunotherapeutic dosing regimens and combinations thereof |
| US10927154B2 (en) | 2014-01-13 | 2021-02-23 | Pieris Pharmaceuticals Gmbh | Multi-specific polypeptide useful for localized tumor immunomodulation |
| US10280226B2 (en) | 2014-05-28 | 2019-05-07 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
| US10800849B2 (en) | 2014-05-28 | 2020-10-13 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
| US10155818B2 (en) | 2014-05-28 | 2018-12-18 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
| EP3498295A1 (en) | 2014-05-28 | 2019-06-19 | Agenus Inc. | Anti-gitr antibodies and methods of use thereof |
| US11401335B2 (en) | 2014-05-28 | 2022-08-02 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
| US11897962B2 (en) | 2014-05-28 | 2024-02-13 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
| US10829559B2 (en) | 2014-05-28 | 2020-11-10 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
| US10577426B2 (en) | 2014-05-28 | 2020-03-03 | Agenus Inc. | Anti-GITR antibodies and methods of use thereof |
| WO2015184099A1 (en) | 2014-05-28 | 2015-12-03 | 4-Antibody Ag | Anti-gitr antibodies and methods of use thereof |
| EP3998079A1 (en) | 2014-06-06 | 2022-05-18 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof |
| EP3610924A1 (en) | 2014-06-06 | 2020-02-19 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof |
| WO2015187835A2 (en) | 2014-06-06 | 2015-12-10 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof |
| US10449251B2 (en) | 2014-08-01 | 2019-10-22 | Akeso Biopharma, Inc. | Anti-CTLA4 monoclonal antibody or its antigen binding fragments, pharmaceutical compositions and uses |
| US12447208B2 (en) | 2014-08-01 | 2025-10-21 | Akeso Biopharma, Inc. | Anti-CTLA4 monoclonal antibody or its antigen binding fragments, pharmaceutical compositions and uses |
| US11291720B2 (en) | 2014-08-01 | 2022-04-05 | Akeso Biopharma, Inc. | Anti-CTLA4 monoclonal antibody or its antigen binding fragments, pharmaceutical compositions and uses |
| WO2016033555A1 (en) | 2014-08-28 | 2016-03-03 | Halozyme, Inc. | Combination therapy with a hyaluronan-degrading enzyme and an immune checkpoint inhibitor |
| US11414489B2 (en) | 2014-08-28 | 2022-08-16 | Halozyme, Inc. | Combination therapy with a hyaluronan-degrading enzyme and an immune checkpoint inhibitor |
| WO2016044234A1 (en) | 2014-09-16 | 2016-03-24 | Eric Tsao | Anti-egfr antibody and uses of same |
| EP4029508A1 (en) | 2014-10-10 | 2022-07-20 | Idera Pharmaceuticals, Inc. | Treatment of cancer using tlr9 agonists and checkpoint inhibitors |
| US9969998B2 (en) | 2014-10-14 | 2018-05-15 | Halozyme, Inc. | Compositions of adenosine deaminase-2 (ADA2), variants thereof and methods of using same |
| WO2016061286A2 (en) | 2014-10-14 | 2016-04-21 | Halozyme, Inc. | Compositions of adenosine deaminase-2 (ada2), variants thereof and methods of using same |
| US11584923B2 (en) | 2014-10-14 | 2023-02-21 | Halozyme, Inc. | Compositions of adenosine deaminase-2 (ADA2), variants thereof and methods of using same |
| WO2016081748A2 (en) | 2014-11-21 | 2016-05-26 | Bristol-Myers Squibb Company | Antibodies against cd73 and uses thereof |
| EP3789399A1 (en) | 2014-11-21 | 2021-03-10 | Bristol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
| EP3725808A1 (en) | 2014-11-21 | 2020-10-21 | Bristol-Myers Squibb Company | Antibodies against cd73 and uses thereof |
| WO2016090070A1 (en) | 2014-12-04 | 2016-06-09 | Bristol-Myers Squibb Company | Combination of anti-cs1 and anti-pd1 antibodies to treat cancer (myeloma) |
| US10093733B2 (en) | 2014-12-11 | 2018-10-09 | Abbvie Inc. | LRP-8 binding dual variable domain immunoglobulin proteins |
| EP4249066A2 (en) | 2014-12-23 | 2023-09-27 | Bristol-Myers Squibb Company | Antibodies to tigit |
| EP3835312A1 (en) | 2014-12-31 | 2021-06-16 | Checkmate Pharmaceuticals, Inc. | Combination tumor immunotherapy |
| US10682365B2 (en) | 2014-12-31 | 2020-06-16 | Checkmate Pharmaceuticals, Inc. | Combination tumor immunotherapy |
| WO2016109310A1 (en) | 2014-12-31 | 2016-07-07 | Checkmate Pharmaceuticals, Llc | Combination tumor immunotherapy |
| WO2016127052A1 (en) | 2015-02-05 | 2016-08-11 | Bristol-Myers Squibb Company | Cxcl11 and smica as predictive biomarkers for efficacy of anti-ctla4 immunotherapy |
| EP3256165A4 (en) * | 2015-02-13 | 2018-10-24 | Sorrento Therapeutics, Inc. | Antibody therapeutics that bind ctla4 |
| US11155623B2 (en) | 2015-02-13 | 2021-10-26 | Sorrento Therapeutics, Inc. | Antibody therapeutics that bind CTLA4 |
| WO2016130898A2 (en) | 2015-02-13 | 2016-08-18 | Sorrento Therapeutics, Inc. | Antibody therapeutics that bind ctla4 |
| EP3949984A1 (en) * | 2015-02-13 | 2022-02-09 | Sorrento Therapeutics, Inc. | Antibody therapeutics that bind ctla4 |
| US10202453B2 (en) | 2015-02-13 | 2019-02-12 | Sorrento Therapeutics, Inc. | Antibody therapeutics that bind CTLA4 |
| EP4151231A1 (en) * | 2015-02-13 | 2023-03-22 | Sorrento Therapeutics, Inc. | Antibody therapeutics that bind ctla4 |
| WO2016146261A1 (en) | 2015-03-16 | 2016-09-22 | Amal Therapeutics Sa | Combination of an immune checkpoint modulator and a complex comprising a cell penetrating peptide, a cargo and a tlr peptide agonist for use in medicine |
| US12453762B2 (en) | 2015-03-16 | 2025-10-28 | Amal Therapeutics Sa | Complex comprising a cell penetrating peptide, a cargo and a TLR peptide agonist for treatment of glioblastoma |
| US12178788B2 (en) | 2015-03-16 | 2024-12-31 | Amal Therapeutics Sa | Complex comprising a cell penetrating peptide, a cargo and a TLR peptide agonist |
| US12220450B2 (en) | 2015-03-16 | 2025-02-11 | Amal Therapeutics Sa | Complex comprising a cell penetrating peptide, a cargo and a TLR peptide agonist for treatment of colorectal cancer |
| US10376535B2 (en) | 2015-03-26 | 2019-08-13 | University Of Rochester | Therapy for malignant disease |
| US11491204B2 (en) | 2015-04-07 | 2022-11-08 | Cytlimic Inc. | Composition comprising poly I:C and LAG-3-IGG fusion protein |
| US12502401B2 (en) | 2015-05-06 | 2025-12-23 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US12514869B2 (en) | 2015-05-06 | 2026-01-06 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10463049B2 (en) | 2015-05-06 | 2019-11-05 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11612617B2 (en) | 2015-05-06 | 2023-03-28 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10582712B2 (en) | 2015-05-06 | 2020-03-10 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11642363B2 (en) | 2015-05-06 | 2023-05-09 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US12514867B2 (en) | 2015-05-06 | 2026-01-06 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11517582B2 (en) | 2015-05-06 | 2022-12-06 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11547716B2 (en) | 2015-05-06 | 2023-01-10 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10506812B2 (en) | 2015-05-06 | 2019-12-17 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10561148B2 (en) | 2015-05-06 | 2020-02-18 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11844760B2 (en) | 2015-05-06 | 2023-12-19 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10624349B2 (en) | 2015-05-06 | 2020-04-21 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11147830B2 (en) | 2015-05-06 | 2021-10-19 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US10524477B2 (en) | 2015-05-06 | 2020-01-07 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US12226430B2 (en) | 2015-05-06 | 2025-02-18 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| US11400110B2 (en) | 2015-05-06 | 2022-08-02 | Snipr Technologies Limited | Altering microbial populations and modifying microbiota |
| WO2016191397A1 (en) | 2015-05-22 | 2016-12-01 | Td2 Inc. | Benzamide and active compound compositions and methods of use |
| EP4209228A1 (en) | 2015-05-22 | 2023-07-12 | Translational Drug Development, LLC | Benzamide and active compound compositions and methods of use |
| EP3718569A1 (en) | 2015-05-22 | 2020-10-07 | Translational Drug Development, LLC | Benzamide and active compound compositions and methods of use |
| WO2016196228A1 (en) | 2015-05-29 | 2016-12-08 | Bristol-Myers Squibb Company | Antibodies against ox40 and uses thereof |
| EP4047022A1 (en) | 2015-05-29 | 2022-08-24 | AbbVie Inc. | Anti-cd40 antibodies and uses thereof |
| EP3626744A1 (en) | 2015-05-29 | 2020-03-25 | AbbVie Inc. | Anti-cd40 antibodies and uses thereof |
| US9840554B2 (en) | 2015-06-15 | 2017-12-12 | Abbvie Inc. | Antibodies against platelet-derived growth factor (PDGF) |
| WO2017004016A1 (en) | 2015-06-29 | 2017-01-05 | The Rockefeller University | Antibodies to cd40 with enhanced agonist activity |
| US10925867B2 (en) | 2015-06-29 | 2021-02-23 | Bristol-Myers Squibb Company | Immunotherapeutic dosing regimens comprising pomalidomide and an anti-CS1 antibody for treating cancer |
| EP3950065A1 (en) | 2015-06-29 | 2022-02-09 | Bristol-Myers Squibb Company | Immunotherapeutic dosing regimens comprising pomalidomide and an anti-cs1 antibody for treating cancer |
| WO2017003990A1 (en) | 2015-06-29 | 2017-01-05 | Bristol-Myers Squibb Company | Immunotherapeutic dosing regimens comprising pomalidomide and an anti-cs1 antibody for treating cancer |
| US10485764B2 (en) | 2015-07-02 | 2019-11-26 | Otsuka Pharmaceutical Co., Ltd. | Lyophilized pharmaceutical compositions |
| WO2017009842A2 (en) | 2015-07-16 | 2017-01-19 | Biokine Therapeutics Ltd. | Compositions and methods for treating cancer |
| EP3744340A2 (en) | 2015-07-16 | 2020-12-02 | Biokine Therapeutics Ltd. | Compositions and methods for treating cancer |
| EP3943098A2 (en) | 2015-07-16 | 2022-01-26 | Biokine Therapeutics Ltd. | Compositions and methods for treating cancer |
| US11564986B2 (en) | 2015-07-16 | 2023-01-31 | Onkosxcel Therapeutics, Llc | Approach for treatment of cancer via immunomodulation by using talabostat |
| WO2017021913A1 (en) | 2015-08-04 | 2017-02-09 | Glaxosmithkline Intellectual Property Development Limited | Combination treatments and uses and methods thereof |
| WO2017025871A1 (en) | 2015-08-07 | 2017-02-16 | Glaxosmithkline Intellectual Property Development Limited | Combination therapy comprising anti ctla-4 antibodies |
| EP4548979A2 (en) | 2015-09-11 | 2025-05-07 | Nascent Biotech, Inc. | Enhanced delivery of drugs to the brain |
| WO2017079202A1 (en) | 2015-11-02 | 2017-05-11 | Board Of Regents, The University Of Texas System | Methods of cd40 activation and immune checkpoint blockade |
| WO2017079215A1 (en) | 2015-11-03 | 2017-05-11 | Glycomimetics, Inc. | Methods and compositions for the production of monoclonal antibodies, hematopoietic stem cells, and methods of using the same |
| WO2017079746A2 (en) | 2015-11-07 | 2017-05-11 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and immune checkpoint blockade for the treatment of cancer |
| WO2017087678A2 (en) | 2015-11-19 | 2017-05-26 | Bristol-Myers Squibb Company | Antibodies against glucocorticoid-induced tumor necrosis factor receptor (gitr) and uses thereof |
| US10836830B2 (en) | 2015-12-02 | 2020-11-17 | Agenus Inc. | Antibodies and methods of use thereof |
| US11447557B2 (en) | 2015-12-02 | 2022-09-20 | Agenus Inc. | Antibodies and methods of use thereof |
| US10954301B2 (en) | 2015-12-14 | 2021-03-23 | Macrogenics, Inc. | Bispecific molecules having immunoreactivity with PD-1 and CTLA-4, and methods of use thereof |
| US11840571B2 (en) | 2015-12-14 | 2023-12-12 | Macrogenics, Inc. | Methods of using bispecific molecules having immunoreactivity with PD-1 and CTLA-4 |
| WO2017106061A1 (en) | 2015-12-14 | 2017-06-22 | Macrogenics, Inc. | Bispecific molecules having immunoreactivity with pd-1 and ctla-4, and methods of use thereof |
| WO2017120612A1 (en) | 2016-01-10 | 2017-07-13 | Modernatx, Inc. | Therapeutic mrnas encoding anti ctla-4 antibodies |
| WO2017152085A1 (en) | 2016-03-04 | 2017-09-08 | Bristol-Myers Squibb Company | Combination therapy with anti-cd73 antibodies |
| WO2017160599A1 (en) | 2016-03-14 | 2017-09-21 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Use of cd300b antagonists to treat sepsis and septic shock |
| WO2017160754A1 (en) | 2016-03-15 | 2017-09-21 | Mersana Therapeutics,Inc. | Napi2b-targeted antibody-drug conjugates and methods of use thereof |
| EP4302782A2 (en) | 2016-03-15 | 2024-01-10 | Mersana Therapeutics, Inc. | Napi2b-targeted antibody-drug conjugates and methods of use thereof |
| US12214048B2 (en) | 2016-03-16 | 2025-02-04 | Amal Therapeutics Sa | Combination of an immune checkpoint modulator and a complex comprising a cell penetrating peptide, a cargo and a TLR peptide agonist for use in medicine |
| WO2017157964A1 (en) | 2016-03-16 | 2017-09-21 | Amal Therapeutics Sa | Combination of an immune checkpoint modulator and a complex comprising a cell penetrating peptide, a cargo and a tlr peptide agonist for use in medicine |
| WO2017173091A1 (en) | 2016-03-30 | 2017-10-05 | Musc Foundation For Research Development | Methods for treatment and diagnosis of cancer by targeting glycoprotein a repetitions predominant (garp) and for providing effective immunotherapy alone or in combination |
| WO2017173334A1 (en) | 2016-04-01 | 2017-10-05 | Checkmate Pharmaceuticals, Inc. | Fc receptor-mediated drug delivery |
| WO2017184619A2 (en) | 2016-04-18 | 2017-10-26 | Celldex Therapeutics, Inc. | Agonistic antibodies that bind human cd40 and uses thereof |
| EP4029950A1 (en) | 2016-04-29 | 2022-07-20 | Board of Regents, The University of Texas System | Targeted measure of transcriptional activity related to hormone receptors |
| WO2017192874A1 (en) | 2016-05-04 | 2017-11-09 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Albumin-binding immunomodulatory compositions and methods of use thereof |
| WO2017201352A1 (en) | 2016-05-18 | 2017-11-23 | Modernatx, Inc. | Mrna combination therapy for the treatment of cancer |
| WO2017210181A1 (en) | 2016-05-30 | 2017-12-07 | Geovax Inc. | Compositions and methods for generating an immune response to hepatitis b virus |
| WO2017210335A1 (en) | 2016-06-01 | 2017-12-07 | Bristol-Myers Squibb Company | Imaging methods using 18f-radiolabeled biologics |
| US12318445B2 (en) | 2016-06-05 | 2025-06-03 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US11351252B2 (en) | 2016-06-05 | 2022-06-07 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| US11471530B2 (en) | 2016-06-05 | 2022-10-18 | Snipr Technologies Limited | Selectively altering microbiota for immune modulation |
| WO2017220989A1 (en) | 2016-06-20 | 2017-12-28 | Kymab Limited | Anti-pd-l1 and il-2 cytokines |
| WO2017220988A1 (en) | 2016-06-20 | 2017-12-28 | Kymab Limited | Multispecific antibodies for immuno-oncology |
| WO2017220990A1 (en) | 2016-06-20 | 2017-12-28 | Kymab Limited | Anti-pd-l1 antibodies |
| US10604574B2 (en) | 2016-06-30 | 2020-03-31 | Oncorus, Inc. | Oncolytic viral delivery of therapeutic polypeptides |
| US11078280B2 (en) | 2016-06-30 | 2021-08-03 | Oncorus, Inc. | Oncolytic viral delivery of therapeutic polypeptides |
| US10077306B2 (en) | 2016-07-14 | 2018-09-18 | Bristol-Myers Squibb Company | Antibodies against TIM3 and uses thereof |
| EP4512829A2 (en) | 2016-07-14 | 2025-02-26 | Bristol-Myers Squibb Company | Antibodies against tim3 and uses thereof |
| US10533052B2 (en) | 2016-07-14 | 2020-01-14 | Bristol-Myers Squibb Company | Antibodies against TIM3 and uses thereof |
| WO2018013818A2 (en) | 2016-07-14 | 2018-01-18 | Bristol-Myers Squibb Company | Antibodies against tim3 and uses thereof |
| US11591392B2 (en) | 2016-07-14 | 2023-02-28 | Bristol-Myers Squibb Company | Antibodies against TIM3 and uses thereof |
| US12312403B2 (en) | 2016-07-14 | 2025-05-27 | Bristol-Myers Squibb Company | Antibodies against TIM3 and uses thereof |
| WO2018025221A1 (en) | 2016-08-04 | 2018-02-08 | Glaxosmithkline Intellectual Property Development Limited | Anti-icos and anti-pd-1 antibody combination therapy |
| US11479608B2 (en) | 2016-08-23 | 2022-10-25 | Akeso Biopharma, Inc. | Anti-CTLA4 antibodies |
| US12220387B2 (en) | 2016-09-21 | 2025-02-11 | Amal Therapeutics Sa | Fusion comprising a cell penetrating peptide, a multi epitope and a TLR peptide agonist for treatment of cancer |
| US11338027B2 (en) | 2016-09-21 | 2022-05-24 | Amal Therapeutics Sa | Fusion comprising a cell penetrating peptide, a multi epitope and a TLR peptide agonist for treatment of cancer |
| US12318413B2 (en) | 2016-09-27 | 2025-06-03 | Board Of Regents, The University Of Texas System | Methods for enhancing immune checkpoint blockade therapy by modulating the microbiome |
| US12310996B2 (en) | 2016-09-27 | 2025-05-27 | Board Of Regents, The University Of Texas System | Methods for enhancing immune checkpoint blockade therapy by modulating the microbiome |
| WO2018064165A2 (en) | 2016-09-27 | 2018-04-05 | Board Of Regents, The University Of Texas System | Methods for enhancing immune checkpoint blockade therapy by modulating the microbiome |
| US11395838B2 (en) | 2016-09-27 | 2022-07-26 | Board Of Regents, The University Of Texas System | Methods for enhancing immune checkpoint blockade therapy by modulating the microbiome |
| KR20230066654A (ko) | 2016-09-27 | 2023-05-16 | 더 보드 오브 리젠츠 오브 더 유니버시티 오브 텍사스 시스템 | 미생물유전체를 조정함으로써 면역 체크포인트 차단 요법을 증강시키는 방법 |
| EP4729943A2 (en) | 2016-10-03 | 2026-04-22 | Abbott Laboratories | Improved methods of assessing gfap status in patient samples |
| WO2018067468A1 (en) | 2016-10-03 | 2018-04-12 | Abbott Laboratories | Improved methods of assessing uch-l1 status in patient samples |
| WO2018067474A1 (en) | 2016-10-03 | 2018-04-12 | Abbott Laboratories | Improved methods of assessing gfap status in patient samples |
| EP4521116A2 (en) | 2016-10-03 | 2025-03-12 | Abbott Laboratories | Improved methods of assessing uch-l1 status in patient samples |
| EP3522922A4 (en) * | 2016-10-10 | 2020-06-10 | Crown Bioscience, Inc. (Taicang) | NEW ANTI-CTLA4 ANTIBODIES |
| US11759518B2 (en) | 2016-10-11 | 2023-09-19 | Nec Corporation | Medicine for treating cancer by administering a toll-like receptor agonist and LAG-3 IgG fusion protein |
| US11291718B2 (en) | 2016-10-11 | 2022-04-05 | Cytlimic Inc. | Method for treating cancer by administering a toll-like receptor agonist and LAG-3 IgG fusion protein |
| WO2018071668A1 (en) | 2016-10-12 | 2018-04-19 | Board Of Regents, The University Of Texas System | Methods and compositions for tusc2 immunotherapy |
| US12485159B2 (en) | 2016-10-12 | 2025-12-02 | Board Of Regents, The University Of Texas System | Methods and compositions for TUSC2 immunotherapy |
| US11278592B2 (en) | 2016-10-12 | 2022-03-22 | Board Of Regents, The University Of Texas System | Methods and compositions for TUSC2 immunotherapy |
| WO2018081621A1 (en) | 2016-10-28 | 2018-05-03 | Bristol-Myers Squibb Company | Methods of treating urothelial carcinoma using an anti-pd-1 antibody |
| EP4491237A2 (en) | 2016-10-28 | 2025-01-15 | Bristol-Myers Squibb Company | Methods of treating urothelial carcinoma using an anti-pd-1 antibody |
| CN110312523B (zh) * | 2016-11-08 | 2024-04-26 | 齐鲁皮吉特湾生物治疗有限公司 | 抗pd1和抗ctla4抗体 |
| WO2018089293A3 (en) * | 2016-11-08 | 2019-01-24 | Qilu Puget Sound Biotherapeutics Corporation | ANTI-PD1 ANTI-CTLA4 ANTIBODIES |
| US11124570B2 (en) | 2016-11-08 | 2021-09-21 | Qilu Puget Sound Biotherapeutics Corporation | Anti-PD1 and anti-CTLA4 antibodies |
| CN110312523A (zh) * | 2016-11-08 | 2019-10-08 | 齐鲁皮吉特湾生物治疗有限公司 | 抗pd1和抗ctla4抗体 |
| EP3538137A2 (en) * | 2016-11-08 | 2019-09-18 | Qilu Puget Sound Biotherapeutics Corporation | Anti-pd1 and anti-ctla4 antibodies |
| US12037397B2 (en) | 2016-11-08 | 2024-07-16 | Qilu Puget Sound Biotherapeutics Corporation | Anti-PD1 and anti-CTLA4 antibodies |
| WO2018089423A1 (en) | 2016-11-09 | 2018-05-17 | Musc Foundation For Research Development | Cd38-nad+ regulated metabolic axis in anti-tumor immunotherapy |
| US11359028B2 (en) | 2016-11-09 | 2022-06-14 | Agenus Inc. | Anti-OX40 antibodies and anti-GITR antibodies |
| WO2018094225A1 (en) | 2016-11-17 | 2018-05-24 | Board Of Regents, The University Of Texas System | Compounds with anti-tumor activity against cancer cells bearing egfr or her2 exon 20 mutations |
| WO2018098401A1 (en) | 2016-11-23 | 2018-05-31 | Translational Drug Development, Llc | Benzamide and active compound compositions and methods of use |
| WO2018098269A2 (en) | 2016-11-23 | 2018-05-31 | Mersana Therapeutics, Inc. | Peptide-containing linkers for antibody-drug conjugates |
| WO2018099978A1 (en) | 2016-11-29 | 2018-06-07 | Horst Lindhofer | Combination of t-cell redirecting multifunctional antibodies with immune checkpoint modulators and uses thereof |
| WO2018099539A1 (en) | 2016-11-29 | 2018-06-07 | Horst Lindhofer | Combination of t-cell redirecting multifunctional antibodies with immune checkpoint modulators and uses thereof |
| WO2018100535A1 (en) | 2016-12-01 | 2018-06-07 | Glaxosmithkline Intellectual Property Development Limited | Combination therapy |
| WO2018100534A1 (en) | 2016-12-01 | 2018-06-07 | Glaxosmithkline Intellectual Property Development Limited | Combination therapy |
| US11273155B2 (en) | 2016-12-12 | 2022-03-15 | Daiichi Sankyo Company, Limited | Combination of antibody-drug conjugate and immune checkpoint inhibitor |
| WO2018110515A1 (ja) | 2016-12-12 | 2018-06-21 | 第一三共株式会社 | 抗体-薬物コンジュゲートと免疫チェックポイント阻害剤の組み合わせ |
| US12319736B2 (en) | 2016-12-12 | 2025-06-03 | Daiichi Sankyo Company, Limited | Combination of antibody-drug conjugate and immune checkpoint inhibitor |
| KR20250040100A (ko) | 2016-12-12 | 2025-03-21 | 다이이찌 산쿄 가부시키가이샤 | 항체-약물 콘주게이트와 면역 체크 포인트 저해제의 조합 |
| WO2018111902A1 (en) | 2016-12-12 | 2018-06-21 | Multivir Inc. | Methods and compositions comprising viral gene therapy and an immune checkpoint inhibitor for treatment and prevention of cancer and infectious diseases |
| KR20190095280A (ko) | 2016-12-12 | 2019-08-14 | 다이이찌 산쿄 가부시키가이샤 | 항체-약물 콘주게이트와 면역 체크 포인트 저해제의 조합 |
| WO2018152396A1 (en) | 2017-02-17 | 2018-08-23 | Innate Tumor Immunity, Inc. | Substituted imidazo-quinolines as nlrp3 modulators |
| EP3753938A1 (en) | 2017-02-17 | 2020-12-23 | Innate Tumor Immunity, Inc. | Substituted imidazo-quinolines as nlrp3 modulators |
| CN110545844A (zh) * | 2017-02-21 | 2019-12-06 | 瑞美德生物医药科技有限公司 | 使用结合细胞毒性t淋巴细胞抗原-4(ctla-4)的抗体的癌症治疗 |
| EP3585430A4 (en) * | 2017-02-21 | 2020-12-09 | REMD Biotherapeutics, Inc. | TREATMENT OF CANCER WITH ANTIBODIES THAT BIND TO T-CYTOTOXIC T-LYMPHOCYTES ANTIGEN-4 (CTLA-4) |
| WO2018156973A1 (en) | 2017-02-24 | 2018-08-30 | Board Of Regents, The University Of Texas System | Assay for detection of early stage pancreatic cancer |
| WO2018160538A1 (en) | 2017-02-28 | 2018-09-07 | Mersana Therapeutics, Inc. | Combination therapies of her2-targeted antibody-drug conjugates |
| EP3366703A1 (en) | 2017-02-28 | 2018-08-29 | Ralf Kleef | Immune checkpoint therapy with hyperthermia |
| WO2018158314A1 (en) | 2017-02-28 | 2018-09-07 | Ralf Kleef | Immune checkpoint therapy |
| WO2018167780A1 (en) | 2017-03-12 | 2018-09-20 | Yeda Research And Development Co. Ltd. | Methods of prognosing and treating cancer |
| WO2018167778A1 (en) | 2017-03-12 | 2018-09-20 | Yeda Research And Development Co. Ltd. | Methods of diagnosing and prognosing cancer |
| WO2018175942A1 (en) | 2017-03-23 | 2018-09-27 | Abbott Laboratories | Methods for aiding in the diagnosis and determination of the extent of traumatic brain injury in a human subject using the early biomarker ubiquitin carboxy-terminal hydrolase l1 |
| WO2018183928A1 (en) | 2017-03-31 | 2018-10-04 | Bristol-Myers Squibb Company | Methods of treating tumor |
| WO2018187613A2 (en) | 2017-04-07 | 2018-10-11 | Bristol-Myers Squibb Company | Anti-icos agonist antibodies and uses thereof |
| EP4697023A2 (en) | 2017-04-15 | 2026-02-18 | Abbott Laboratories | Methods for aiding in the hyperacute diagnosis and determination of traumatic brain injury in a human subject using early biomarkers |
| WO2018191531A1 (en) | 2017-04-15 | 2018-10-18 | Abbott Laboratories | Methods for aiding in the hyperacute diagnosis and determination of traumatic brain injury in a human subject using early biomarkers |
| WO2018200430A1 (en) | 2017-04-26 | 2018-11-01 | Bristol-Myers Squibb Company | Methods of antibody production that minimize disulfide bond reduction |
| WO2018200823A1 (en) | 2017-04-28 | 2018-11-01 | Abbott Laboratories | Methods for aiding in the hyperacute diagnosis and determination of traumatic brain injury using early biomarkers on at least two samples from the same human subject |
| US10865238B1 (en) | 2017-05-05 | 2020-12-15 | Duke University | Complement factor H antibodies |
| US12240906B2 (en) | 2017-05-19 | 2025-03-04 | Wuxi Biologics (Shanghai) Co., Ltd. | Monoclonal antibodies to cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) |
| US11643463B2 (en) | 2017-05-19 | 2023-05-09 | Wuxi Biologics (Shanghai) Co., Ltd. | Monoclonal antibodies to cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) |
| WO2018218169A1 (en) | 2017-05-25 | 2018-11-29 | Abbott Laboratories | Methods for aiding in the determination of whether to perform imaging on a human subject who has sustained or may have sustained an injury to the head using early biomarkers |
| EP4098662A1 (en) | 2017-05-25 | 2022-12-07 | Bristol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
| WO2018218056A1 (en) | 2017-05-25 | 2018-11-29 | Birstol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
| WO2018222711A2 (en) | 2017-05-30 | 2018-12-06 | Bristol-Myers Squibb Company | Compositions comprising a combination of an anti-lag-3 antibody, a pd-1 pathway inhibitor, and an immunotherapeutic agent |
| WO2018222784A1 (en) | 2017-05-30 | 2018-12-06 | Abbott Laboratories | Methods for aiding in diagnosing and evaluating a mild traumatic brain injury in a human subject using cardiac troponin i |
| US12049503B2 (en) | 2017-05-30 | 2024-07-30 | Bristol-Myers Squibb Company | Treatment of LAG-3 positive tumors |
| EP4245375A2 (en) | 2017-05-30 | 2023-09-20 | Bristol-Myers Squibb Company | Compositions comprising a combination of an anti-lag-3 antibody, a pd-1 pathway inhibitor, and an immunotherapeutic agent |
| WO2018222783A1 (en) | 2017-05-30 | 2018-12-06 | Abbott Laboratories | Methods for aiding in diagnosing and evaluating a mild traumatic brain injury in a human subject using cardiac troponin i and early biomarkers |
| US11723975B2 (en) | 2017-05-30 | 2023-08-15 | Bristol-Myers Squibb Company | Compositions comprising an anti-LAG-3 antibody or an anti-LAG-3 antibody and an anti-PD-1 or anti-PD-L1 antibody |
| US11807686B2 (en) | 2017-05-30 | 2023-11-07 | Bristol-Myers Squibb Company | Treatment of LAG-3 positive tumors |
| WO2018226336A1 (en) | 2017-06-09 | 2018-12-13 | Providence Health & Services - Oregon | Utilization of cd39 and cd103 for identification of human tumor reactive cells for treatment of cancer |
| EP4461825A2 (en) | 2017-06-09 | 2024-11-13 | Providence Health & Services - Oregon | Tumor-infiltrating t-cells for use in the treatment of cancer |
| WO2019010131A1 (en) | 2017-07-03 | 2019-01-10 | Abbott Laboratories | IMPROVED METHODS FOR MEASURING CARBOXY TERMINATION HYDROLASE LEVELS OF UBIQUITIN L1 IN BLOOD |
| WO2019014572A1 (en) | 2017-07-14 | 2019-01-17 | Pfizer, Inc. | ANTIBODIES DIRECTED AGAINST MADCAM |
| WO2019014402A1 (en) | 2017-07-14 | 2019-01-17 | Innate Tumor Immunity, Inc. | MODULATORS OF NLRP3 |
| US11802156B2 (en) | 2017-07-14 | 2023-10-31 | Pfizer Inc. | Antibodies to MAdCAM |
| US10519190B2 (en) | 2017-08-03 | 2019-12-31 | Otsuka Pharmaceutical Co., Ltd. | Drug compound and purification methods thereof |
| US12378319B2 (en) | 2017-08-21 | 2025-08-05 | Adagene Inc. | Anti-CD137 molecules and use thereof |
| US11859003B2 (en) | 2017-08-21 | 2024-01-02 | Adagene Inc. | Method for treating cancer using anti-CD137 antibody |
| EP3691643A1 (en) | 2017-09-29 | 2020-08-12 | Bristol-Myers Squibb Company | Compositions and methods of treating cancer |
| US12195536B2 (en) | 2017-10-06 | 2025-01-14 | The Wistar Institute Of Anatomy And Biology | DNA monoclonal antibodies targeting CTLA-4 for the treatment and prevention of cancer |
| US11230601B2 (en) | 2017-10-10 | 2022-01-25 | Tilos Therapeutics, Inc. | Methods of using anti-lap antibodies |
| WO2019075090A1 (en) | 2017-10-10 | 2019-04-18 | Tilos Therapeutics, Inc. | ANTI-LAP ANTIBODIES AND USES THEREOF |
| EP3694872A1 (en) | 2017-10-12 | 2020-08-19 | Board Of Regents, The University Of Texas System | T cell receptors for immunotherapy |
| US11919957B2 (en) | 2017-10-15 | 2024-03-05 | Bristol-Myers Squibb Company | Methods of treating tumor |
| WO2019075468A1 (en) | 2017-10-15 | 2019-04-18 | Bristol-Myers Squibb Company | TUMOR TREATMENT METHODS |
| WO2019089921A1 (en) | 2017-11-01 | 2019-05-09 | Bristol-Myers Squibb Company | Immunostimulatory agonistic antibodies for use in treating cancer |
| WO2019094360A1 (en) | 2017-11-07 | 2019-05-16 | The Board Of Regents Of The University Of Texas System | Targeting lilrb4 with car-t or car-nk cells in the treatment of cancer |
| WO2019104289A1 (en) | 2017-11-27 | 2019-05-31 | Mersana Therapeutics, Inc. | Pyrrolobenzodiazepine antibody conjugates |
| US11638760B2 (en) | 2017-11-27 | 2023-05-02 | Mersana Therapeutics, Inc. | Pyrrolobenzodiazepine antibody conjugates |
| WO2019113525A2 (en) | 2017-12-09 | 2019-06-13 | Abbott Laboratories | Methods for aiding in the diagnosis and evaluation of a subject who has sustained an orthopedic injury and that has or may have sustained an injury to the head, such as mild traumatic brain injury (tbi), using glial fibrillary acidic protein (gfap) and/or ubiquitin carboxy-terminal hydrolase l1 (uch-l1) |
| WO2019112860A1 (en) | 2017-12-09 | 2019-06-13 | Abbott Laboratories | Methods for aiding in diagnosing and evaluating a traumatic brain injury in a human subject using a combination of gfap and uch-l1 |
| WO2019118826A1 (en) | 2017-12-15 | 2019-06-20 | Board Of Regents, The University Of Texas System | Methods and compositions for treating cancer using exosomes-associated gene editing |
| WO2019126691A1 (en) | 2017-12-21 | 2019-06-27 | Mersana Therapeutics, Inc. | Pyrrolobenzodiazepine antibody conjugates |
| WO2019133747A1 (en) | 2017-12-27 | 2019-07-04 | Bristol-Myers Squibb Company | Anti-cd40 antibodies and uses thereof |
| US11306149B2 (en) | 2017-12-27 | 2022-04-19 | Bristol-Myers Squibb Company | Anti-CD40 antibodies and uses thereof |
| US11952427B2 (en) | 2017-12-27 | 2024-04-09 | Bristol-Myers Squibb Company | Anti-CD40 antibodies and uses thereof |
| US11865081B2 (en) | 2017-12-29 | 2024-01-09 | Virogin Biotech Canada Ltd. | Oncolytic viral delivery of therapeutic polypeptides |
| WO2019140229A1 (en) | 2018-01-12 | 2019-07-18 | Bristol-Myers Squibb Company | Antibodies against tim3 and uses thereof |
| US12129297B2 (en) | 2018-01-12 | 2024-10-29 | Bristol-Myers Squibb Company | Antibodies against TIM3 and uses thereof |
| WO2019144098A1 (en) | 2018-01-22 | 2019-07-25 | Bristol-Myers Squibb Company | Compositions and methods of treating cancer |
| US11952681B2 (en) | 2018-02-02 | 2024-04-09 | Adagene Inc. | Masked activatable CD137 antibodies |
| US12246031B2 (en) | 2018-02-13 | 2025-03-11 | Checkmate Pharmaceuticals, Inc. | Compositions and methods for tumor immunotherapy |
| US12084507B2 (en) | 2018-03-12 | 2024-09-10 | Zoetis Services Llc | Humanized anti-NGF antibodies and methods of treating pain thereof |
| US12049507B2 (en) | 2018-03-12 | 2024-07-30 | Zoetis Services Llc | Felinized anti-NGF antibodies and methods of treating pain |
| US12552871B2 (en) | 2018-03-12 | 2026-02-17 | Zoetis Services Llc | Nucleic acids encoding humanized anti-NGF antibodies |
| US12084506B2 (en) | 2018-03-12 | 2024-09-10 | Zoetis Services Llc | Methods of treating a canine and inhibiting NGF activity through use of anti-NGF antibodies |
| US10982002B2 (en) | 2018-03-12 | 2021-04-20 | Zoetis Services Llc | Anti-NGF antibodies and methods thereof |
| US12049509B2 (en) | 2018-03-12 | 2024-07-30 | Zoetis Services Llc | Nucleic acids encoding a canine antibody which binds nerve growth factor and vectors and host cells thereof |
| WO2019175113A1 (en) | 2018-03-12 | 2019-09-19 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of caloric restriction mimetics for potentiating chemo-immunotherapy for the treatment of cancers |
| US12049508B2 (en) | 2018-03-12 | 2024-07-30 | Zoetis Services Llc | Canine anti-NGF antibodies and methods of treating pain thereof |
| US12497459B2 (en) | 2018-03-12 | 2025-12-16 | Zoetis Services Llc | Nucleic acids encoding canine anti-NGF antibodies and methods thereof |
| US12454561B2 (en) | 2018-03-19 | 2025-10-28 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and CD122/CD132 agonists for the treatment of cancer |
| WO2020036635A2 (en) | 2018-03-19 | 2020-02-20 | Multivir Inc. | Methods and compositions comprising tumor suppressor gene therapy and cd122/cd132 agonists for the treatment of cancer |
| WO2019183040A1 (en) | 2018-03-21 | 2019-09-26 | Five Prime Therapeutics, Inc. | ANTIBODIES BINDING TO VISTA AT ACIDIC pH |
| US11242393B2 (en) | 2018-03-23 | 2022-02-08 | Bristol-Myers Squibb Company | Antibodies against MICA and/or MICB and uses thereof |
| EP4066851A1 (en) | 2018-03-25 | 2022-10-05 | SNIPR Biome ApS. | Treating & preventing microbial infections |
| EP4085923A1 (en) | 2018-03-25 | 2022-11-09 | SNIPR Biome ApS. | Treating and preventing microbial infections |
| WO2019185551A1 (en) | 2018-03-25 | 2019-10-03 | Snipr Biome Aps. | Treating & preventing microbial infections |
| WO2019191279A2 (en) | 2018-03-27 | 2019-10-03 | Board Of Regents, The University Of Texas System | Compounds with anti-tumor activity against cancer cells bearing her2 exon 19 mutations |
| WO2019191676A1 (en) | 2018-03-30 | 2019-10-03 | Bristol-Myers Squibb Company | Methods of treating tumor |
| US12084655B2 (en) | 2018-04-09 | 2024-09-10 | Checkmate Pharmaceuticals | Packaging oligonucleotides into virus-like particles |
| WO2019204665A1 (en) | 2018-04-18 | 2019-10-24 | Xencor, Inc. | Pd-1 targeted heterodimeric fusion proteins containing il-15/il-15ra fc-fusion proteins and pd-1 antigen binding domains and uses thereof |
| WO2019204592A1 (en) | 2018-04-18 | 2019-10-24 | Xencor, Inc. | Il-15/il-15ra heterodimeric fc fusion proteins and uses thereof |
| EP4353235A2 (en) | 2018-04-25 | 2024-04-17 | Innate Tumor Immunity, Inc. | Nlrp3 modulators |
| WO2019209896A1 (en) | 2018-04-25 | 2019-10-31 | Innate Tumor Immunity, Inc. | Nlrp3 modulators |
| US12448619B2 (en) | 2018-04-30 | 2025-10-21 | Snipr Biome Aps | Treating and preventing microbial infections |
| US11643653B2 (en) | 2018-04-30 | 2023-05-09 | Snipr Biome Aps | Treating and preventing microbial infections |
| US11421227B2 (en) | 2018-04-30 | 2022-08-23 | Snipr Biome Aps | Treating and preventing microbial infections |
| US11788085B2 (en) | 2018-04-30 | 2023-10-17 | Snipr Biome Aps | Treating and preventing microbial infections |
| US11485973B2 (en) | 2018-04-30 | 2022-11-01 | Snipr Biome Aps | Treating and preventing microbial infections |
| US10760075B2 (en) | 2018-04-30 | 2020-09-01 | Snipr Biome Aps | Treating and preventing microbial infections |
| US10920222B2 (en) | 2018-04-30 | 2021-02-16 | Snipr Biome Aps | Treating and preventing microbial infections |
| WO2019232319A1 (en) | 2018-05-31 | 2019-12-05 | Peloton Therapeutics, Inc. | Compositions and methods for inhibiting cd73 |
| WO2019241358A2 (en) | 2018-06-12 | 2019-12-19 | The Regents Of The University Of California | Single-chain bispecific chimeric antigen receptors for the treatment of cancer |
| WO2020014132A2 (en) | 2018-07-09 | 2020-01-16 | Five Prime Therapeutics, Inc. | Antibodies binding to ilt4 |
| US12226439B2 (en) | 2018-07-11 | 2025-02-18 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| WO2020014327A2 (en) | 2018-07-11 | 2020-01-16 | Five Prime Therapeutics, Inc. | Antibodies binding to vista at acidic ph |
| US12201653B2 (en) | 2018-07-11 | 2025-01-21 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| US12357661B2 (en) | 2018-07-11 | 2025-07-15 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| WO2020014543A2 (en) | 2018-07-11 | 2020-01-16 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| US12162941B2 (en) | 2018-07-20 | 2024-12-10 | Surface Oncology, LLC | Anti-CD112R compositions and methods |
| US11279758B2 (en) | 2018-07-20 | 2022-03-22 | Surface Oncology, Inc. | Anti-CD112R compositions and methods |
| US11214619B2 (en) | 2018-07-20 | 2022-01-04 | Surface Oncology, Inc. | Anti-CD112R compositions and methods |
| WO2020037091A1 (en) | 2018-08-16 | 2020-02-20 | Innate Tumor Immunity, Inc. | Imidazo[4,5-c]quinoline derived nlrp3-modulators |
| WO2020037094A1 (en) | 2018-08-16 | 2020-02-20 | Innate Tumor Immunity, Inc. | Substitued 4-amino-1h-imidazo[4,5-c]quinoline compounds and improved methods for their preparation |
| WO2020037092A1 (en) | 2018-08-16 | 2020-02-20 | Innate Tumor Immunity, Inc. | Imidazo[4,5-c]quinoline derived nlrp3-modulators |
| WO2020049001A1 (en) | 2018-09-03 | 2020-03-12 | Bioinvent International Ab | Novel antibodies and nucleotide sequences, and uses thereof |
| EP3617230A1 (en) | 2018-09-03 | 2020-03-04 | BioInvent International AB | Novel antibodies and nucleotide sequences, and uses thereof |
| US12291569B2 (en) | 2018-09-03 | 2025-05-06 | Bioinvent International Ab | Antibodies and nucleotide sequences, and uses thereof |
| WO2020048942A1 (en) | 2018-09-04 | 2020-03-12 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for enhancing cytotoxic t lymphocyte-dependent immune responses |
| WO2020058372A1 (en) | 2018-09-19 | 2020-03-26 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical composition for the treatment of cancers resistant to immune checkpoint therapy |
| US12269855B2 (en) | 2018-09-21 | 2025-04-08 | Innovent Biologics (Suzhou) Co., Ltd. | Interleukin-2 and use thereof |
| WO2020057645A1 (zh) | 2018-09-21 | 2020-03-26 | 信达生物制药(苏州)有限公司 | 新型白介素2及其用途 |
| US12551531B2 (en) | 2018-09-21 | 2026-02-17 | Innovent Biologics (Suzhou) Co., Ltd. | Interleukin-2 and use thereof |
| WO2020057646A1 (zh) | 2018-09-21 | 2020-03-26 | 信达生物制药(苏州)有限公司 | 新型白介素2及其用途 |
| WO2020070053A1 (en) | 2018-10-01 | 2020-04-09 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of inhibitors of stress granule formation for targeting the regulation of immune responses |
| WO2020072821A2 (en) | 2018-10-03 | 2020-04-09 | Xencor, Inc. | Il-12 heterodimeric fc-fusion proteins |
| US11130802B2 (en) | 2018-10-10 | 2021-09-28 | Tilos Therapeutics, Inc. | Anti-lap antibody variants |
| WO2020076969A2 (en) | 2018-10-10 | 2020-04-16 | Tilos Therapeutics, Inc. | Anti-lap antibody variants and uses thereof |
| WO2020077276A2 (en) | 2018-10-12 | 2020-04-16 | Xencor, Inc. | Pd-1 targeted il-15/il-15ralpha fc fusion proteins and uses in combination therapies thereof |
| US12479917B2 (en) | 2018-10-23 | 2025-11-25 | Bristol-Myers Squibb Company | Methods of treating NSCLC comprising administering platinum doublet chemotherapy followed by an anti-PD-1 antibody and an anti-CTLA-4 antibody |
| WO2020086724A1 (en) | 2018-10-23 | 2020-04-30 | Bristol-Myers Squibb Company | Methods of treating tumor |
| WO2020092385A1 (en) | 2018-10-29 | 2020-05-07 | Mersana Therapeutics, Inc. | Cysteine engineered antibody-drug conjugates with peptide-containing linkers |
| EP3876955A1 (en) | 2018-11-09 | 2021-09-15 | Pierian Biosciences, LLC | Methods and compositions for determining the composition of a tumor microenvironment |
| WO2020102501A1 (en) | 2018-11-16 | 2020-05-22 | Bristol-Myers Squibb Company | Anti-nkg2a antibodies and uses thereof |
| WO2020106621A1 (en) | 2018-11-19 | 2020-05-28 | Board Of Regents, The University Of Texas System | A modular, polycistronic vector for car and tcr transduction |
| US12551515B2 (en) | 2018-11-21 | 2026-02-17 | Board Of Regents Of The University Of Texas System | Methods and compositions for treating cancer |
| WO2020113029A2 (en) | 2018-11-28 | 2020-06-04 | Board Of Regents, The University Of Texas System | Multiplex genome editing of immune cells to enhance functionality and resistance to suppressive environment |
| WO2020109355A1 (en) | 2018-11-28 | 2020-06-04 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and kit for assaying lytic potential of immune effector cells |
| WO2020112781A1 (en) | 2018-11-28 | 2020-06-04 | Bristol-Myers Squibb Company | Antibodies comprising modified heavy constant regions |
| EP4471129A2 (en) | 2018-11-29 | 2024-12-04 | Board of Regents, The University of Texas System | Methods for ex vivo expansion of natural killer cells and use thereof |
| WO2020112493A1 (en) | 2018-11-29 | 2020-06-04 | Board Of Regents, The University Of Texas System | Methods for ex vivo expansion of natural killer cells and use thereof |
| WO2020115262A1 (en) | 2018-12-07 | 2020-06-11 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of cd26 and cd39 as new phenotypic markers for assessing maturation of foxp3+ t cells and uses thereof for diagnostic purposes |
| WO2020123453A2 (en) | 2018-12-11 | 2020-06-18 | Theravance Biopharma R&D Ip, Llc | Alk5 inhibitors |
| WO2020127059A1 (en) | 2018-12-17 | 2020-06-25 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of sulconazole as a furin inhibitor |
| US12384845B2 (en) | 2018-12-26 | 2025-08-12 | Xilio Development, Inc. | Activatable masked anti-CTLA4 binding proteins |
| US12435142B2 (en) | 2018-12-26 | 2025-10-07 | Xilio Development, Inc. | Anti-CTLA4 antibodies and methods of use thereof |
| KR20210110838A (ko) | 2018-12-28 | 2021-09-09 | 트랜스진 에스.에이. | M2 결함성 폭스바이러스 |
| WO2020136235A1 (en) | 2018-12-28 | 2020-07-02 | Transgene Sa | M2-defective poxvirus |
| US11779612B2 (en) | 2019-01-08 | 2023-10-10 | Actym Therapeutics, Inc. | Engineered immunostimulatory bacterial strains and uses thereof |
| WO2020150113A1 (en) | 2019-01-14 | 2020-07-23 | Innate Tumor Immunity, Inc. | Substituted quinazolines as nlrp3 modulators, for use in the treatment of cancer |
| WO2020150115A1 (en) | 2019-01-14 | 2020-07-23 | Innate Tumor Immunity, Inc. | Nlrp3 modulators |
| WO2020150116A1 (en) | 2019-01-14 | 2020-07-23 | Innate Tumor Immunity, Inc. | Nlrp3 modulators |
| WO2020150114A1 (en) | 2019-01-14 | 2020-07-23 | Innate Tumor Immunity, Inc. | Heterocyclic nlrp3 modulators, for use in the treatment of cancer |
| WO2020148338A1 (en) | 2019-01-15 | 2020-07-23 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Mutated interleukin-34 (il-34) polypeptides and uses thereof in therapy |
| WO2020169472A2 (en) | 2019-02-18 | 2020-08-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods of inducing phenotypic changes in macrophages |
| WO2020182993A1 (en) | 2019-03-13 | 2020-09-17 | Etherna Immunotherapies Nv | Mrna vaccine |
| EP3942024A1 (en) | 2019-03-18 | 2022-01-26 | The Regents of the University of California | Augmentation of t-cell activation by oscillatory forces and engineered antigen-presenting cells |
| US12558351B2 (en) | 2019-03-22 | 2026-02-24 | Duke University | Compositions and methods for enhancing cancer immune checkpoint therapy |
| WO2020198676A1 (en) | 2019-03-28 | 2020-10-01 | Bristol-Myers Squibb Company | Methods of treating tumor |
| WO2020198672A1 (en) | 2019-03-28 | 2020-10-01 | Bristol-Myers Squibb Company | Methods of treating tumor |
| WO2020201362A2 (en) | 2019-04-02 | 2020-10-08 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods of predicting and preventing cancer in patients having premalignant lesions |
| WO2020208060A1 (en) | 2019-04-09 | 2020-10-15 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Use of sk2 inhibitors in combination with immune checkpoint blockade therapy for the treatment of cancer |
| WO2020212484A1 (en) | 2019-04-17 | 2020-10-22 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for treatment of nlrp3 inflammasome mediated il-1beta dependent disorders |
| WO2020227711A1 (en) | 2019-05-09 | 2020-11-12 | FUJIFILM Cellular Dynamics, Inc. | Methods for the production of hepatocytes |
| WO2020236562A1 (en) | 2019-05-17 | 2020-11-26 | Cancer Prevention Pharmaceuticals, Inc. | Methods for treating familial adenomatous polyposis |
| WO2020243329A1 (en) | 2019-05-28 | 2020-12-03 | The Regents Of The University Of California | Methods for treating small cell neuroendocrine and related cancers |
| WO2020243568A1 (en) | 2019-05-30 | 2020-12-03 | Bristol-Myers Squibb Company | Methods of identifying a subject suitable for an immuno-oncology (i-o) therapy |
| WO2020243563A1 (en) | 2019-05-30 | 2020-12-03 | Bristol-Myers Squibb Company | Multi-tumor gene signatures for suitability to immuno-oncology therapy |
| WO2020243570A1 (en) | 2019-05-30 | 2020-12-03 | Bristol-Myers Squibb Company | Cell localization signature and combination therapy |
| WO2020247973A1 (en) | 2019-06-03 | 2020-12-10 | The University Of Chicago | Methods and compositions for treating cancer with cancer-targeted adjuvants |
| WO2020247974A1 (en) | 2019-06-03 | 2020-12-10 | The University Of Chicago | Methods and compositions for treating cancer with collagen binding drug carriers |
| WO2020249687A1 (en) | 2019-06-11 | 2020-12-17 | Alkermes Pharma Ireland Limited | Compositions and methods for cancer immunotherapy |
| WO2020249693A1 (en) | 2019-06-11 | 2020-12-17 | Alkermes Pharma Ireland Limited | Compositions and methods for subcutaneous administration of cancer immunotherapy |
| WO2020260685A1 (en) | 2019-06-27 | 2020-12-30 | Etherna Immunotherapies Nv | Combination therapy |
| WO2021003432A1 (en) | 2019-07-02 | 2021-01-07 | Fred Hutchinson Cancer Research Center | Recombinant ad35 vectors and related gene therapy improvements |
| US12552864B2 (en) | 2019-07-15 | 2026-02-17 | Intervet Inc. | Caninized antibodies to human CTLA-4 |
| US12435143B2 (en) | 2019-07-15 | 2025-10-07 | Intervet Inc. | Caninized antibodies against canine CTLA-4 |
| WO2021009188A1 (en) | 2019-07-15 | 2021-01-21 | Intervet International B.V. | Caninized antibodies to human and canine ctla-4 |
| WO2021009187A1 (en) | 2019-07-15 | 2021-01-21 | Intervet International B.V. | Caninized antibodies against canine ctla-4 |
| WO2021024020A1 (en) | 2019-08-06 | 2021-02-11 | Astellas Pharma Inc. | Combination therapy involving antibodies against claudin 18.2 and immune checkpoint inhibitors for treatment of cancer |
| WO2021025177A1 (en) | 2019-08-06 | 2021-02-11 | Astellas Pharma Inc. | Combination therapy involving antibodies against claudin 18.2 and immune checkpoint inhibitors for treatment of cancer |
| WO2021055612A1 (en) | 2019-09-17 | 2021-03-25 | BIAL-BioTech Investments, Inc. | Substituted imidazole carboxamides and their use in the treatment of medical disorders |
| WO2021055627A1 (en) | 2019-09-17 | 2021-03-25 | Bial- Biotech Investments, Inc. | Substituted n-heterocyclic carboxamides as acid ceramidase inhibitors and their use as medicaments |
| WO2021055630A1 (en) | 2019-09-17 | 2021-03-25 | Bial- Biotech Investments, Inc. | Substituted, saturated and unsaturated n-heterocyclic carboxamides and related compounds for their use in the treatment of medical disorders |
| WO2021055698A1 (en) | 2019-09-19 | 2021-03-25 | Bristol-Myers Squibb Company | Antibodies binding to vista at acidic ph |
| WO2021055994A1 (en) | 2019-09-22 | 2021-03-25 | Bristol-Myers Squibb Company | Quantitative spatial profiling for lag-3 antagonist therapy |
| EP4706684A2 (en) | 2019-09-23 | 2026-03-11 | The Regents of The University of Michigan | Compositions and methods for increasing the efficacy of immunotherapies and vaccines |
| WO2021061789A1 (en) | 2019-09-23 | 2021-04-01 | The Regents Of The University Of Michigan | Compositions and methods for increasing the efficacy of immunotherapies and vaccines |
| WO2021062244A1 (en) | 2019-09-25 | 2021-04-01 | Surface Oncology, Inc. | Anti-il-27 antibodies and uses thereof |
| EP3800201A1 (en) | 2019-10-01 | 2021-04-07 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Cd28h stimulation enhances nk cell killing activities |
| WO2021067863A2 (en) | 2019-10-03 | 2021-04-08 | Xencor, Inc. | Targeted il-12 heterodimeric fc-fusion proteins |
| WO2021064184A1 (en) | 2019-10-04 | 2021-04-08 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical composition for the treatment of ovarian cancer, breast cancer or pancreatic cancer |
| WO2021072298A1 (en) | 2019-10-11 | 2021-04-15 | Genentech, Inc. | Pd-1 targeted il-15/il-15ralpha fc fusion proteins with improved properties |
| KR20220088425A (ko) | 2019-10-25 | 2022-06-27 | 다이이찌 산쿄 가부시키가이샤 | 항 garp 항체와 면역 조절제의 조합 |
| WO2021079958A1 (ja) | 2019-10-25 | 2021-04-29 | 第一三共株式会社 | 抗garp抗体と免疫調節剤の組み合わせ |
| WO2021087458A2 (en) | 2019-11-02 | 2021-05-06 | Board Of Regents, The University Of Texas System | Targeting nonsense-mediated decay to activate p53 pathway for the treatment of cancer |
| WO2021092220A1 (en) | 2019-11-06 | 2021-05-14 | Bristol-Myers Squibb Company | Methods of identifying a subject with a tumor suitable for a checkpoint inhibitor therapy |
| WO2021092221A1 (en) | 2019-11-06 | 2021-05-14 | Bristol-Myers Squibb Company | Methods of identifying a subject with a tumor suitable for a checkpoint inhibitor therapy |
| WO2021092380A1 (en) | 2019-11-08 | 2021-05-14 | Bristol-Myers Squibb Company | Lag-3 antagonist therapy for melanoma |
| WO2021102468A1 (en) | 2019-11-22 | 2021-05-27 | Theravance Biopharma R&D Ip, Llc | Substituted 1,5-naphthyridines or quinolines as alk5 inhibitors |
| WO2021106978A1 (ja) | 2019-11-27 | 2021-06-03 | サイトリミック株式会社 | 医薬組成物 |
| WO2021113644A1 (en) | 2019-12-05 | 2021-06-10 | Multivir Inc. | Combinations comprising a cd8+ t cell enhancer, an immune checkpoint inhibitor and radiotherapy for targeted and abscopal effects for the treatment of cancer |
| WO2021127554A1 (en) | 2019-12-19 | 2021-06-24 | Bristol-Myers Squibb Company | Combinations of dgk inhibitors and checkpoint antagonists |
| KR20240035914A (ko) | 2019-12-27 | 2024-03-18 | 추가이 세이야쿠 가부시키가이샤 | 항ctla-4 항체 및 그의 사용 |
| KR20220119433A (ko) | 2019-12-27 | 2022-08-29 | 추가이 세이야쿠 가부시키가이샤 | 항ctla-4 항체 및 그의 사용 |
| US11591579B2 (en) | 2020-01-07 | 2023-02-28 | Board Of Regents, The University Of Texas System | Human methylthioadenosine/adenosine depleting enzyme variants for cancer therapy |
| US11396647B2 (en) | 2020-01-07 | 2022-07-26 | Board Of Regents, The University Of Texas System | Human methylthioadenosine/adenosine depleting enzyme variants for cancer therapy |
| WO2021142203A1 (en) | 2020-01-10 | 2021-07-15 | Innate Tumor Immunity, Inc. | Nlrp3 modulators |
| WO2021155113A1 (en) | 2020-01-29 | 2021-08-05 | Board Of Regents, The University Of Texas System | Use of egfr/her2 tyrosine kinase inhibitors and/or her2/her3 antibodies for the treatment of cancers with nrg1 fusions |
| WO2021155130A1 (en) | 2020-01-29 | 2021-08-05 | Board Of Regents, The University Of Texas System | Use of poziotinib for the treatment of cancers with nrg1 fusions |
| WO2021159024A1 (en) | 2020-02-05 | 2021-08-12 | Larimar Therapeutics, Inc. | Tat peptide binding proteins and uses thereof |
| WO2021158938A1 (en) | 2020-02-06 | 2021-08-12 | Bristol-Myers Squibb Company | Il-10 and uses thereof |
| WO2021167908A1 (en) | 2020-02-17 | 2021-08-26 | Board Of Regents, The University Of Texas System | Methods for expansion of tumor infiltrating lymphocytes and use thereof |
| WO2021170750A1 (en) | 2020-02-28 | 2021-09-02 | Orega Biotech | Combination therapies based on ctla4 and il-17b inhibitors |
| WO2022074464A2 (en) | 2020-03-05 | 2022-04-14 | Neotx Therapeutics Ltd. | Methods and compositions for treating cancer with immune cells |
| WO2021183428A1 (en) | 2020-03-09 | 2021-09-16 | Bristol-Myers Squibb Company | Antibodies to cd40 with enhanced agonist activity |
| US12091681B2 (en) | 2020-03-27 | 2024-09-17 | Mendus B.V. | Ex vivo use of modified cells of leukemic origin for enhancing the efficacy of adoptive cell therapy |
| WO2021203131A1 (en) | 2020-03-31 | 2021-10-07 | Theravance Biopharma R&D Ip, Llc | Substituted pyrimidines and methods of use |
| WO2021207449A1 (en) | 2020-04-09 | 2021-10-14 | Merck Sharp & Dohme Corp. | Affinity matured anti-lap antibodies and uses thereof |
| WO2021211331A1 (en) | 2020-04-13 | 2021-10-21 | Abbott Point Of Care Inc. | METHODS, COMPLEXES AND KITS FOR DETECTING OR DETERMINING AN AMOUNT OF A ß-CORONAVIRUS ANTIBODY IN A SAMPLE |
| WO2021216670A1 (en) | 2020-04-21 | 2021-10-28 | University Of Rochester | Inhibitors of human epididymus protein 4 |
| WO2021216920A1 (en) | 2020-04-22 | 2021-10-28 | Iovance Biotherapeutics, Inc. | Systems and methods for coordinating manufacturing of cells for patient-specific immunotherapy |
| US12497452B2 (en) | 2020-05-13 | 2025-12-16 | Disc Medicine, Inc. | Anti-hemojuvelin (HJV) antibodies for treating myelofibrosis |
| EP4559477A2 (en) | 2020-05-13 | 2025-05-28 | Adagene AG | Compositions and methods for treating cancer |
| US12365729B2 (en) | 2020-05-13 | 2025-07-22 | Disc Medicine, Inc. | Anti-hemojuvelin (HJV) antibodies for treating myelofibrosis |
| WO2021231732A1 (en) | 2020-05-15 | 2021-11-18 | Bristol-Myers Squibb Company | Antibodies to garp |
| WO2021237068A2 (en) | 2020-05-21 | 2021-11-25 | Board Of Regents, The University Of Texas System | T cell receptors with vgll1 specificity and uses thereof |
| WO2021247836A1 (en) | 2020-06-03 | 2021-12-09 | Board Of Regents, The University Of Texas System | Methods for targeting shp-2 to overcome resistance |
| WO2021245071A1 (en) | 2020-06-03 | 2021-12-09 | Mv Biotherapeutics Sa | Combination of an atp-hydrolyzing enzyme and an immune checkpoint modulator and uses thereof |
| WO2021247908A1 (en) | 2020-06-03 | 2021-12-09 | Bionecure Therapeutics, Inc. | Trophoblast cell-surface antigen-2 (trop-2) antibodies |
| WO2021253041A1 (en) | 2020-06-10 | 2021-12-16 | Theravance Biopharma R&D Ip, Llc | Naphthyridine derivatives useful as alk5 inhibitors |
| WO2021260675A1 (en) | 2020-06-24 | 2021-12-30 | Yeda Research And Development Co. Ltd. | Agents for sensitizing solid tumors to treatment |
| WO2022003568A1 (en) | 2020-06-30 | 2022-01-06 | Dcprime B.V. | Use of leukemia-derived cells in ovarian cancer vaccines |
| US12364758B2 (en) | 2020-06-30 | 2025-07-22 | Mendus B.V. | Use of leukemia-derived cells in ovarian cancer vaccines |
| WO2022003156A1 (en) | 2020-07-02 | 2022-01-06 | Oncurious Nv | Ccr8 non-blocking binders |
| WO2022008519A1 (en) | 2020-07-07 | 2022-01-13 | BioNTech SE | Therapeutic rna for hpv-positive cancer |
| WO2022010847A1 (en) | 2020-07-07 | 2022-01-13 | Cancure, Llc | Mic antibodies and binding agents and methods of using the same |
| WO2022020636A2 (en) | 2020-07-24 | 2022-01-27 | Amgen Inc. | Immunogens derived from sars-cov2 spike protein |
| WO2022020661A1 (en) | 2020-07-24 | 2022-01-27 | The University Of Rochester | Inhibitors of interleukin-1 receptor-associated kinases 1 and 4 |
| WO2022031804A1 (en) | 2020-08-04 | 2022-02-10 | Abbott Laboratories | Improved methods and kits for detecting sars-cov-2 protein in a sample |
| WO2022047189A1 (en) | 2020-08-28 | 2022-03-03 | Bristol-Myers Squibb Company | Lag-3 antagonist therapy for hepatocellular carcinoma |
| WO2022047412A1 (en) | 2020-08-31 | 2022-03-03 | Bristol-Myers Squibb Company | Cell localization signature and immunotherapy |
| US12553029B2 (en) | 2020-10-06 | 2026-02-17 | Iovance Biotherapeutics, Inc. | Treatment of NSCLC patients with tumor infiltrating lymphocyte therapies |
| US12565528B2 (en) | 2020-10-23 | 2026-03-03 | Bristol-Myers Squibb Company | LAG-3 antagonist therapy for lung cancer |
| WO2022087402A1 (en) | 2020-10-23 | 2022-04-28 | Bristol-Myers Squibb Company | Lag-3 antagonist therapy for lung cancer |
| EP4570256A2 (en) | 2020-11-05 | 2025-06-18 | Board of Regents, The University of Texas System | Engineered t cell receptors targeting egfr antigens and methods of use |
| WO2022104109A1 (en) | 2020-11-13 | 2022-05-19 | Catamaran Bio, Inc. | Genetically modified natural killer cells and methods of use thereof |
| WO2022115611A1 (en) | 2020-11-25 | 2022-06-02 | Catamaran Bio, Inc. | Cellular therapeutics engineered with signal modulators and methods of use thereof |
| WO2022119841A1 (en) | 2020-12-01 | 2022-06-09 | Abbott Laboratories | Use of one or more biomarkers to determine traumatic brain injury (tbi) in a subject having received a head computerized tomography scan that is negative for a tbi |
| WO2022120179A1 (en) | 2020-12-03 | 2022-06-09 | Bristol-Myers Squibb Company | Multi-tumor gene signatures and uses thereof |
| WO2022120388A2 (en) | 2020-12-04 | 2022-06-09 | Tidal Therapeutics, Inc. | Ionizable cationic lipids and lipid nanoparticles, and methods of synthesis and use thereof |
| WO2022130206A1 (en) | 2020-12-16 | 2022-06-23 | Pfizer Inc. | TGFβr1 INHIBITOR COMBINATION THERAPIES |
| WO2022135667A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Therapeutic rna for treating cancer |
| WO2022136266A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Therapeutic rna for treating cancer |
| WO2022136255A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Treatment schedule for cytokine proteins |
| WO2022135666A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Treatment schedule for cytokine proteins |
| WO2022136257A1 (en) | 2020-12-21 | 2022-06-30 | BioNTech SE | Therapeutic rna for treating cancer |
| WO2022136647A1 (en) | 2020-12-24 | 2022-06-30 | Oncurious Nv | Human ccr8 binders |
| WO2022136650A1 (en) | 2020-12-24 | 2022-06-30 | Oncurious Nv | Murine cross-reactive human ccr8 binders |
| WO2022136649A1 (en) | 2020-12-24 | 2022-06-30 | Oncurious Nv | Non-blocking human ccr8 binders |
| WO2022146948A1 (en) | 2020-12-28 | 2022-07-07 | Bristol-Myers Squibb Company | Subcutaneous administration of pd1/pd-l1 antibodies |
| US12582713B2 (en) | 2020-12-28 | 2026-03-24 | Bristol-Myers Squibb Company | Methods of treating tumors |
| EP4566674A2 (en) | 2020-12-28 | 2025-06-11 | Bristol-Myers Squibb Company | Antibody compositions and methods of use thereof |
| WO2022146947A1 (en) | 2020-12-28 | 2022-07-07 | Bristol-Myers Squibb Company | Antibody compositions and methods of use thereof |
| WO2022147147A1 (en) | 2020-12-30 | 2022-07-07 | Abbott Laboratories | Methods for determining sars-cov-2 antigen and anti-sars-cov-2 antibody in a sample |
| WO2022159492A1 (en) | 2021-01-19 | 2022-07-28 | William Marsh Rice University | Bone-specific delivery of polypeptides |
| US12397055B2 (en) | 2021-01-22 | 2025-08-26 | Mendus B.V. | Methods of tumor vaccination |
| WO2022157715A1 (en) | 2021-01-22 | 2022-07-28 | Dcprime B.V. | Methods of tumor vaccination |
| WO2022165214A1 (en) | 2021-01-29 | 2022-08-04 | Board Of Regents, The University Of Texas System | Methods of treating cancer with kinase inhibitors |
| WO2022190058A1 (en) | 2021-03-12 | 2022-09-15 | Dcprime B.V. | Methods of vaccination and use of cd47 blockade |
| US12570961B2 (en) | 2021-03-25 | 2026-03-10 | Iovance Biotherapeutics, Inc. | Methods and compositions for T-cell coculture potency assays and use with cell therapy products |
| US12553031B2 (en) | 2021-03-25 | 2026-02-17 | Iovance Biotherapeutics, Inc. | Methods and compositions for T-cell coculture potency assays and use with cell therapy products |
| WO2022212876A1 (en) | 2021-04-02 | 2022-10-06 | The Regents Of The University Of California | Antibodies against cleaved cdcp1 and uses thereof |
| EP4319755A1 (en) | 2021-04-08 | 2024-02-14 | Board of Regents, The University of Texas System | Compounds and methods for theranostic targeting of parp activity |
| EP4070799A1 (en) | 2021-04-08 | 2022-10-12 | Nuvamid SA | Compositions for the improvement of sport performance |
| WO2022214455A1 (en) | 2021-04-08 | 2022-10-13 | Nuvamid Sa | Compositions for the improvement of sport performance |
| WO2022217022A1 (en) | 2021-04-10 | 2022-10-13 | Profoundbio Us Co. | Folr1 binding agents, conjugates thereof and methods of using the same |
| EP4079310A1 (en) | 2021-04-20 | 2022-10-26 | Nuvamid SA | Nmn and derivatives for its use in the treatment of alpha-synucleinopathies |
| WO2022223622A1 (en) | 2021-04-20 | 2022-10-27 | Institut Curie | Compositions and methods for use in immunotherapy |
| WO2022223613A1 (en) | 2021-04-20 | 2022-10-27 | Nuvamid Sa | Nmn and derivatives for its use in the treatment of depression and/or anxiety in patients having a form of parkinsonism |
| WO2022223612A1 (en) | 2021-04-20 | 2022-10-27 | Nuvamid Sa | Nmn and derivatives for its use in the treatment of alpha-synucleinopathies |
| EP4079311A1 (en) | 2021-04-20 | 2022-10-26 | Nuvamid SA | Nmn and derivatives for its use in the treatment of depression and/or anxiety in patients having a form of parkinsonism |
| WO2022226317A1 (en) | 2021-04-23 | 2022-10-27 | Profoundbio Us Co. | Anti-cd70 antibodies, conjugates thereof and methods of using the same |
| WO2022245920A1 (en) | 2021-05-18 | 2022-11-24 | Abbott Laboratories | Methods of evaluating brain injury in a pediatric subject |
| WO2022251359A1 (en) | 2021-05-26 | 2022-12-01 | Theravance Biopharma R&D Ip, Llc | Bicyclic inhibitors of alk5 and methods of use |
| WO2022261018A1 (en) | 2021-06-07 | 2022-12-15 | Providence Health & Services - Oregon | Cxcr5, pd-1, and icos expressing tumor reactive cd4 t cells and their use |
| EP4528280A2 (en) | 2021-06-14 | 2025-03-26 | Abbott Laboratories | Methods of diagnosing or aiding in diagnosis of brain injury caused by acoustic energy, electromagnetic energy, an over pressurization wave, and/or blast wind |
| WO2022266034A1 (en) | 2021-06-14 | 2022-12-22 | Abbott Laboratories | Methods of diagnosing or aiding in diagnosis of brain injury caused by acoustic energy, electromagnetic energy, an over pressurization wave, and/or blast wind |
| US12415857B2 (en) | 2021-06-25 | 2025-09-16 | Chugai Seiyaku Kabushiki Kaisha | Anti-CTLA-4 antibody and use thereof |
| KR20240024255A (ko) | 2021-06-25 | 2024-02-23 | 추가이 세이야쿠 가부시키가이샤 | 항ctla-4 항체의 사용 |
| KR20240024213A (ko) | 2021-06-25 | 2024-02-23 | 추가이 세이야쿠 가부시키가이샤 | 항ctla-4 항체 |
| US12448451B2 (en) | 2021-06-25 | 2025-10-21 | Chugai Seiyaku Kabushiki Kaisha | Anti-CTLA-4 antibody and use thereof |
| WO2023280790A1 (en) | 2021-07-05 | 2023-01-12 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Gene signatures for predicting survival time in patients suffering from renal cell carcinoma |
| WO2023285552A1 (en) | 2021-07-13 | 2023-01-19 | BioNTech SE | Multispecific binding agents against cd40 and cd137 in combination therapy for cancer |
| WO2023014922A1 (en) | 2021-08-04 | 2023-02-09 | The Regents Of The University Of Colorado, A Body Corporate | Lat activating chimeric antigen receptor t cells and methods of use thereof |
| WO2023028501A1 (en) | 2021-08-23 | 2023-03-02 | Immunitas Therapeutics, Inc. | Anti-cd161 antibodies and uses thereof |
| WO2023034777A1 (en) | 2021-08-31 | 2023-03-09 | Abbott Laboratories | Methods and systems of diagnosing brain injury |
| WO2023056361A1 (en) | 2021-09-29 | 2023-04-06 | Board Of Regents, The University Of Texas System | Anti-hsp70 antibodies and therapeutic uses thereof |
| WO2023056268A1 (en) | 2021-09-30 | 2023-04-06 | Abbott Laboratories | Methods and systems of diagnosing brain injury |
| WO2023060136A1 (en) | 2021-10-05 | 2023-04-13 | Cytovia Therapeutics, Llc | Natural killer cells and methods of use thereof |
| WO2023061930A1 (en) | 2021-10-11 | 2023-04-20 | BioNTech SE | Therapeutic rna for lung cancer |
| WO2023068382A2 (en) | 2021-10-20 | 2023-04-27 | Takeda Pharmaceutical Company Limited | Compositions targeting bcma and methods of use thereof |
| WO2023076880A1 (en) | 2021-10-25 | 2023-05-04 | Board Of Regents, The University Of Texas System | Foxo1-targeted therapy for the treatment of cancer |
| WO2023077090A1 (en) | 2021-10-29 | 2023-05-04 | Bristol-Myers Squibb Company | Lag-3 antagonist therapy for hematological cancer |
| WO2023092099A1 (en) | 2021-11-19 | 2023-05-25 | Ardeagen Corporation | Gpc3 binding agents, conjugates thereof and methods of using the same |
| WO2023102384A1 (en) | 2021-11-30 | 2023-06-08 | Abbott Laboratories | Use of one or more biomarkers to determine traumatic brain injury (tbi) in a subject having received a head computerized tomography scan that is negative for a tbi |
| WO2023114978A1 (en) | 2021-12-17 | 2023-06-22 | Abbott Laboratories | Systems and methods for determining uch-l1, gfap, and other biomarkers in blood samples |
| WO2023118411A1 (en) | 2021-12-23 | 2023-06-29 | Etherna Immunotherapies Nv | Immunostimulatory mrna compositions and uses thereof |
| WO2023129942A1 (en) | 2021-12-28 | 2023-07-06 | Abbott Laboratories | Use of biomarkers to determine sub-acute traumatic brain injury (tbi) in a subject having received a head computerized tomography (ct) scan that is negative for a tbi or no head ct scan |
| WO2023147371A1 (en) | 2022-01-26 | 2023-08-03 | Bristol-Myers Squibb Company | Combination therapy for hepatocellular carcinoma |
| WO2023150652A1 (en) | 2022-02-04 | 2023-08-10 | Abbott Laboratories | Lateral flow methods, assays, and devices for detecting the presence or measuring the amount of ubiquitin carboxy-terminal hydrolase l1 and/or glial fibrillary acidic protein in a sample |
| WO2023164638A1 (en) | 2022-02-25 | 2023-08-31 | Bristol-Myers Squibb Company | Combination therapy for colorectal carcinoma |
| WO2023168404A1 (en) | 2022-03-04 | 2023-09-07 | Bristol-Myers Squibb Company | Methods of treating a tumor |
| WO2023170606A1 (en) | 2022-03-08 | 2023-09-14 | Alentis Therapeutics Ag | Use of anti-claudin-1 antibodies to increase t cell availability |
| WO2023178192A1 (en) | 2022-03-15 | 2023-09-21 | Compugen Ltd. | Il-18bp antagonist antibodies and their use in monotherapy and combination therapy in the treatment of cancer |
| KR20240161968A (ko) | 2022-03-16 | 2024-11-13 | 다이이찌 산쿄 가부시키가이샤 | 다중 특이적 분자와 면역 체크 포인트 저해제의 조합 |
| WO2023176881A1 (ja) | 2022-03-16 | 2023-09-21 | 第一三共株式会社 | 多重特異的分子と免疫チェックポイント阻害剤の組み合わせ |
| WO2023178329A1 (en) | 2022-03-18 | 2023-09-21 | Bristol-Myers Squibb Company | Methods of isolating polypeptides |
| WO2023196987A1 (en) | 2022-04-07 | 2023-10-12 | Bristol-Myers Squibb Company | Methods of treating tumor |
| US11981921B2 (en) | 2022-04-15 | 2024-05-14 | Iovance Biotherapeutics, Inc. | TIL expansion processes using specific cytokine combinations and/or AKTi treatment |
| WO2023211972A1 (en) | 2022-04-28 | 2023-11-02 | Medical University Of South Carolina | Chimeric antigen receptor modified regulatory t cells for treating cancer |
| WO2023213763A1 (en) | 2022-05-02 | 2023-11-09 | Transgene | Poxvirus encoding a binding agent comprising an anti- pd-l1 sdab |
| WO2023213764A1 (en) | 2022-05-02 | 2023-11-09 | Transgene | Fusion polypeptide comprising an anti-pd-l1 sdab and a member of the tnfsf |
| WO2023228095A1 (en) | 2022-05-24 | 2023-11-30 | Daiichi Sankyo Company, Limited | Dosage regimen of an anti-cdh6 antibody-drug conjugate |
| WO2023235847A1 (en) | 2022-06-02 | 2023-12-07 | Bristol-Myers Squibb Company | Antibody compositions and methods of use thereof |
| WO2023240156A1 (en) | 2022-06-08 | 2023-12-14 | Tidal Therapeutics, Inc. | Ionizable cationic lipids and lipid nanoparticles, and methods of synthesis and use thereof |
| WO2024006876A1 (en) | 2022-06-29 | 2024-01-04 | Abbott Laboratories | Magnetic point-of-care systems and assays for determining gfap in biological samples |
| US12076375B2 (en) | 2022-06-29 | 2024-09-03 | Snipr Biome Aps | Treating and preventing E coli infections |
| WO2024003353A1 (en) | 2022-07-01 | 2024-01-04 | Transgene | Fusion protein comprising a surfactant-protein-d and a member of the tnfsf |
| WO2024023750A1 (en) | 2022-07-28 | 2024-02-01 | Astrazeneca Uk Limited | Combination of antibody-drug conjugate and bispecific checkpoint inhibitor |
| WO2024028794A1 (en) | 2022-08-02 | 2024-02-08 | Temple Therapeutics BV | Methods for treating endometrial and ovarian hyperproliferative disorders |
| WO2024052356A1 (en) | 2022-09-06 | 2024-03-14 | Institut National de la Santé et de la Recherche Médicale | Inhibitors of the ceramide metabolic pathway for overcoming immunotherapy resistance in cancer |
| WO2024059708A1 (en) | 2022-09-15 | 2024-03-21 | Abbott Laboratories | Biomarkers and methods for differentiating between mild and supermild traumatic brain injury |
| WO2024086827A2 (en) | 2022-10-20 | 2024-04-25 | Repertoire Immune Medicines, Inc. | Cd8 t cell targeted il2 |
| WO2024112571A2 (en) | 2022-11-21 | 2024-05-30 | Iovance Biotherapeutics, Inc. | Two-dimensional processes for the expansion of tumor infiltrating lymphocytes and therapies therefrom |
| WO2024126457A1 (en) | 2022-12-14 | 2024-06-20 | Astellas Pharma Europe Bv | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and immune checkpoint inhibitors |
| WO2024137776A1 (en) | 2022-12-21 | 2024-06-27 | Bristol-Myers Squibb Company | Combination therapy for lung cancer |
| WO2024163477A1 (en) | 2023-01-31 | 2024-08-08 | University Of Rochester | Immune checkpoint blockade therapy for treating staphylococcus aureus infections |
| WO2024196952A1 (en) | 2023-03-20 | 2024-09-26 | Bristol-Myers Squibb Company | Tumor subtype assessment for cancer therapy |
| WO2024204629A1 (ja) | 2023-03-29 | 2024-10-03 | 第一三共株式会社 | 抗cd25抗体及び抗cd25抗体-薬物コンジュゲート |
| WO2024211475A1 (en) | 2023-04-04 | 2024-10-10 | Abbott Laboratories | Use of biomarkers to determine whether a subject has sustained, may have sustained or is suspected of sustaining a subacute acquired brain injury (abi) |
| WO2024213767A1 (en) | 2023-04-14 | 2024-10-17 | Institut National de la Santé et de la Recherche Médicale | Engraftment of mesenchymal stromal cells engineered to stimulate immune infiltration in tumors |
| WO2024226971A1 (en) | 2023-04-28 | 2024-10-31 | Abbott Point Of Care Inc. | Improved assays, cartridges, and kits for detection of biomarkers, including brain injury biomarkers |
| WO2024226969A1 (en) | 2023-04-28 | 2024-10-31 | Abbott Point Of Care Inc. | Improved assays, cartridges, and kits for detection of biomarkers, including brain injury biomarkers |
| WO2024261302A1 (en) | 2023-06-22 | 2024-12-26 | Institut National de la Santé et de la Recherche Médicale | Nlrp3 inhibitors, pak1/2 inhibitors and/or caspase 1 inhibitors for use in the treatment of rac2 monogenic disorders |
| EP4484445A1 (en) | 2023-06-26 | 2025-01-01 | Universität zu Köln | Hcmv neutralizing antibodies |
| WO2025003275A2 (en) | 2023-06-26 | 2025-01-02 | Universität Zu Köln | Hcmv neutralizing antibodies |
| WO2025003753A1 (en) | 2023-06-26 | 2025-01-02 | Compugen Ltd. | Il-18bp antagonist antibodies and their use in monotherapy and combination therapy in the treatment of cancer |
| WO2025003193A1 (en) | 2023-06-26 | 2025-01-02 | Institut National de la Santé et de la Recherche Médicale | Sertraline and indatraline for disrupting intracellular cholesterol trafficking and subsequently inducing lysosomal damage and anti-tumor immunity |
| WO2025012417A1 (en) | 2023-07-13 | 2025-01-16 | Institut National de la Santé et de la Recherche Médicale | Anti-neurotensin long fragment and anti-neuromedin n long fragment antibodies and uses thereof |
| WO2025038763A1 (en) | 2023-08-15 | 2025-02-20 | Bristol-Myers Squibb Company | Ceramic hydroxyapatite chromatography flow through method |
| WO2025050009A2 (en) | 2023-09-01 | 2025-03-06 | Children's Hospital Medical Center | Identification of targets for immunotherapy in melanoma using splicing-derived neoantigens |
| WO2025061994A1 (en) | 2023-09-21 | 2025-03-27 | Domain Therapeutics | Anti-ccr8 monoclonal antibodies and their therapeutic use |
| WO2025061993A1 (en) | 2023-09-21 | 2025-03-27 | Domain Therapeutics | Anti-ccr8 monoclonal antibodies and their therapeutic use |
| WO2025120866A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| WO2025120867A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and anti-vegfr2 antibodies |
| WO2025121444A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and anti-vegfr2 antibodies |
| WO2025121445A1 (en) | 2023-12-08 | 2025-06-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| WO2025133175A1 (en) | 2023-12-21 | 2025-06-26 | Egle Therapeutics | Immunocytokine for cancer treatment |
| EP4574165A1 (en) | 2023-12-21 | 2025-06-25 | Egle Therapeutics | Immunocytokine for cancer treatment |
| WO2025145207A1 (en) | 2023-12-29 | 2025-07-03 | Bristol-Myers Squibb Company | Combination therapy of kras inhibitor and treg-depleting agent |
| WO2025174825A2 (en) | 2024-02-12 | 2025-08-21 | Aera Therapeutics, Inc. | Delivery compositions |
| WO2025184208A1 (en) | 2024-02-27 | 2025-09-04 | Bristol-Myers Squibb Company | Anti-ceacam5 antibodies and uses thereof |
| WO2025184211A1 (en) | 2024-02-27 | 2025-09-04 | Bristol-Myers Squibb Company | Anti-ceacam5 antibody drug conjugates |
| WO2025202222A1 (en) | 2024-03-25 | 2025-10-02 | Institut National de la Santé et de la Recherche Médicale | Therapeutic use of sting and tlrs agonists to induce p16 expression in immune cells |
| WO2025210175A1 (en) | 2024-04-04 | 2025-10-09 | Centre National De La Recherche Scientifique | Mutant csf-1r extracellular domain fusion molecules and therapeutic uses thereof |
| WO2025217096A1 (en) | 2024-04-08 | 2025-10-16 | University Of Rochester | Inhibitors of leucine-rich repeat kinase 2 (lrrk2) and medical uses thereof |
| WO2025217094A1 (en) | 2024-04-08 | 2025-10-16 | University Of Rochester | Interleukin receptor-associated kinase (irak) protac degraders and medical use thereof |
| WO2025245489A1 (en) | 2024-05-24 | 2025-11-27 | Bristol-Myers Squibb Company | Treatment of tumors in subjects having fgl-1 positive samples |
| WO2025248505A1 (en) | 2024-05-31 | 2025-12-04 | Wayne State University | Methods for treating endometrial and ovarian hyperproliferative disorders |
| WO2026012976A1 (en) | 2024-07-08 | 2026-01-15 | Institut National de la Santé et de la Recherche Médicale | Use of inhibitor of gasdermind for treatment of rac2 monogenic disorders |
| WO2026033885A1 (en) | 2024-08-08 | 2026-02-12 | Astellas Pharma Inc. | Combination therapy involving bispecific binding agents binding to cldn18.2 and cd3 and agents stabilizing or increasing expression of cldn18.2 |
| WO2026039642A1 (en) | 2024-08-16 | 2026-02-19 | Ardeagen Corporation | Anti-mesothelin antibody conjugates and methods of use thereof |
| WO2026052851A2 (en) | 2024-09-09 | 2026-03-12 | Institut National de la Santé et de la Recherche Médicale | Inhibitor of ciliogenesis for use in a method of preventing therapeutic resistance in cancer |
| WO2026072557A2 (en) | 2024-09-24 | 2026-04-02 | Genzyme Corporation | Ionizable cationic lipids and lipid nanoparticles, and methods of synthesis and use thereof |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9963508B2 (en) | Human monoclonal antibodies to CTLA-4 | |
| AU772676B2 (en) | Human monoclonal antibodies to CTLA-4 | |
| US7824679B2 (en) | Human monoclonal antibodies to CTLA-4 | |
| CA2619682A1 (en) | Human monoclonal antibodies to ctla-4 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: P-455/01 Country of ref document: YU Ref document number: 99813642.5 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| AK | Designated states |
Kind code of ref document: C2 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: C2 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| COP | Corrected version of pamphlet |
Free format text: PAGES 1/47-47/47, DRAWINGS, REPLACED BY NEW PAGES 1/48-48/48; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 143797 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2356215 Country of ref document: CA Ref document number: 2356215 Country of ref document: CA Kind code of ref document: A Ref document number: 2000 589573 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 9142001 Country of ref document: SK Ref document number: 22149/00 Country of ref document: AU Ref document number: 2001/01831 Country of ref document: TR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PV2001-2349 Country of ref document: CZ Ref document number: PA/a/2001/006422 Country of ref document: MX Ref document number: 512553 Country of ref document: NZ Ref document number: 1020017007965 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2001/05742 Country of ref document: ZA Ref document number: 200105742 Country of ref document: ZA Ref document number: 1200100662 Country of ref document: VN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: IN/PCT/2001/730/KOL Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1999966644 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 1999 105722 Country of ref document: BG Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: P20010551A Country of ref document: HR Ref document number: 200100698 Country of ref document: EA |
|
| ENP | Entry into the national phase |
Ref document number: 20010579 Country of ref document: UZ Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 6011 Country of ref document: GE |
|
| WWP | Wipo information: published in national office |
Ref document number: 1999966644 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: PV2001-2349 Country of ref document: CZ |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020017007965 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002/00735 Country of ref document: TR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004/02063 Country of ref document: TR |
|
| WWG | Wipo information: grant in national office |
Ref document number: 22149/00 Country of ref document: AU |
|
| WWR | Wipo information: refused in national office |
Ref document number: 1020017007965 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PV2011-342 Country of ref document: CZ |
|
| ENP | Entry into the national phase |
Ref document number: 50352011 Country of ref document: SK Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PV2012-807 Country of ref document: CZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: P20130077A Country of ref document: HR |