WO1999049029A1 - Control of gene expression - Google Patents
Control of gene expression Download PDFInfo
- Publication number
- WO1999049029A1 WO1999049029A1 PCT/AU1999/000195 AU9900195W WO9949029A1 WO 1999049029 A1 WO1999049029 A1 WO 1999049029A1 AU 9900195 W AU9900195 W AU 9900195W WO 9949029 A1 WO9949029 A1 WO 9949029A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- plasmid
- gene
- cell
- pvy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
- C12N15/69—Increasing the copy number of the vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/127—RNA-directed RNA polymerase (2.7.7.48), i.e. RNA replicase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/503—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from viruses
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/30—Production chemically synthesised
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/50—Biochemical production, i.e. in a transformed host cell
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/50—Biochemical production, i.e. in a transformed host cell
- C12N2330/51—Specially adapted vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/108—Plasmid DNA episomal vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
- C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/15—Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/38—Vector systems having a special element relevant for transcription being a stuffer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/55—Vector systems having a special element relevant for transcription from bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/60—Vector systems having a special element relevant for transcription from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
Definitions
- the present invention relates generally to a method of modifying gene expression and to synthetic genes for modifying endogenous gene expression in a cell, tissue or organ of a transgenic organism, in particular a transgenic animal or plant. More particularly, the present invention utilises recombinant DNA technology to post-transcriptionally modify or modulate the expression of a target gene in a cell, tissue, organ or whole organism, thereby producing novel phenotypes. Novel synthetic genes and genetic constructs which are capable of repressing delaying or otherwise reducing the expression of an endogenous gene or a target gene in an organism when introduced thereto are also provided.
- derived from shall be taken to indicate that a specified integer may be obtained from a particular specified source or species, albeit not necessarily directly from that specified source or species.
- Sequence identity numbers (SEQ ID NOS.) containing nucleotide and amino acid sequence information included in this specification are collected after the Abstract and have been prepared using the programme Patentln Version 2.0. Each nucleotide or amino acid sequence is identified in the sequence listing by the numeric indicator ⁇ 210> followed by the sequence identifier (e.g. ⁇ 210>1 , ⁇ 210>2, etc). The length, type of sequence (DNA, protein (PRT), etc) and source organism for each nucleotide or amino acid sequence are indicated by information provided in the numeric indicator fields ⁇ 211 >, ⁇ 212> and ⁇ 213>, respectively. Nucleotide and amino acid sequences referred to in the specification are defined by the information provided in numeric indicator field ⁇ 400> followed by the sequence identifier (eg. ⁇ 400>1 , ⁇ 400>2, etc).
- nucleotide residues referred to herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission, wherein A represents Adenine, C represents Cytosine, G represents Guanine, T represents thymine, Y represents a pyrimidine residue, R represents a purine residue, M represents Adenine or Cytosine, K represents Guanine or Thymine, S represents Guanine or Cytosine, W represents Adenine or Thymine, H represents a nucleotide other than Guanine, B represents a nucleotide other than Adenine, V represents a nucleotide other than Thymine, D represents a nucleotide other than Cytosine and N represents any nucleotide residue.
- amino acid residues referred to herein, as recommended by the IUPAC-IUB Biochemical Nomenclature Commission are listed in Table 1.
- Controlling metabolic pathways in eukaryotic organisms is desirable for the purposes of producing novel traits therein or introducing novel traits into a particular cell, tissue or organ of said organism.
- recombinant DNA technology has provided significant progress in an understanding of the mechanisms regulating eukaryotic gene expression, much less progress has been made in the actual manipulation of gene expression to produce novel traits.
- human intervention may lead to a modulation of the level of eukaryotic gene expression.
- mRNA molecule which is transcribed from the complementary strand of a nuclear gene to that which is normally transcribed and capable of being translated into a polypeptide.
- a double-stranded mRNA may form by base pairing between the complementary nucleotide sequences, to produce a complex which is translated at low efficiency and/or degraded by intracellular ribonuclease enzymes prior to being translated.
- an endogenous gene in a cell, tissue or organ may be suppressed when one or more copies of said gene, or one or more copies of a substantially similar gene are introduced into the cell.
- this approach has not been established and appears to be involve mechanistically heterogeneous processes.
- this approach has been postulated to involve transcriptional repression, in which case somatically-heritable repressed states of chromatin are formed or alternatively, a post-transcriptional silencing wherein transcription initiation occurs normally but the RNA products of the co-suppressed genes are subsequently eliminated.
- transcriptional repression such as the Drosophila Pc-G system
- Drosophila Pc-G system would appear to require some knowledge of the regulatory mechanisms capable of modulating the expression of any specific target gene and, as a consequence, would be difficult to implement in practice as a general technology for repressing, delaying or reducing gene expression in animal cells.
- the invention is based in part on the surprising discovery by the inventors that cells which exhibit one or more desired traits can be produced and selected from transformed cells comprising a nucleic acid molecule operably linked to a promoter, wherein the transcription product of the nucleic acid molecule comprises a nucleotide sequence which is substantially identical to the nucleotide sequence of a transcript of an endogenous or non-endogenous target gene, the expression of which is intended to be modulated.
- the transformed cells are regenerated into whole tissues, organs or organisms capable of exhibiting novel traits, in particular virus resistance and modified expression of endogenous genes.
- one aspect of the present invention provides a method of modulating the expression of a target gene in an animal cell, tissue or organ, said method at least comprising the step of introducing to said cell, tissue or organ one or more dispersed nucleic acid molecules or foreign nucleic acid molecules comprising multiple copies of a nucleotide sequence which is substantially identical to the nucleotide sequence of said target gene or a region thereof or complementary thereto for a time and under conditions sufficient for translation of the mRNA product of said target gene to be modified, subject to the proviso that the transcription of said mRNA product is not exclusively repressed or reduced.
- the dispersed nucleic acid molecules or foreign nucleic acid molecules comprises a nucleotide sequence which encodes multiple copies of an mRNA molecule which is substantially identical to the nucleotide sequence of the mRNA product of the target gene. More preferably, the multiple copies of the target molecule are tandem direct repeat sequences.
- the dispersed nucleic acid molecule or foreign nucleic acid molecule is in an expressible form such that it is at least capable of being transcribed to produce mRNA.
- the target gene may be a gene which is endogenous to the animal cell or alternatively, a foreign gene such as a viral or foreign genetic sequence, amongst others.
- a foreign gene such as a viral or foreign genetic sequence, amongst others.
- the target gene is a viral genetic sequence.
- the invention is particularly useful in the modulation of eukaryotic gene expression, in particular the modulation of human or animal gene expression and even more particularly in the modulation of expression of genes derived from vertebrate and invertebrate animals, such as insects, aquatic animals (eg. fish, shellfish, molluscs, crustaceans such as crabs, lobsters and prawns, avian animals and mammals, amongst others).
- vertebrate and invertebrate animals such as insects, aquatic animals (eg. fish, shellfish, molluscs, crustaceans such as crabs, lobsters and prawns, avian animals and mammals, amongst others).
- a variety of traits are selectable with appropriate procedures and sufficient numbers of transformed cells. Such traits include, but are not limited to, visible traits, disease- resistance traits, and pathogen-resistance traits.
- the modulatory effect is applicable to a variety of genes expressed in plants and animals including, for example, endogenous genes responsible for cellular metabolism or cellular transformation, including oncogenes, transcription factors and other genes which encode polypeptides involved in cellular metabolism.
- an alteration in the pigment production in mice can be engineered by - 8
- tyrosinase gene therein. This provides a novel phenotype of albinism in black mice.
- a genetic construct which comprises multiple copies of nucleotide sequence encoding a viral replicase, polymerase, coat protein or uncoating gene, or protease protein, may be introduced into a cell where it is expressed, to confer immunity against the virus upon the cell.
- the dispersed nucleic acid molecule or foreign nucleic acid molecule will generally comprise a nucleotide sequence having greater than about 85% identity to the target gene sequence, however, a higher homology might produce a more effective modulation of expression of the target gene sequence. Substantially greater homology, or more than about 90% is preferred, and even more preferably about 95% to absolute identity is desirable.
- the introduced dispersed nucleic acid molecule or foreign nucleic acid molecule sequence needing less than absolute homology, also need not be full length, relative to either the primary transcription product or fully processed mRNA of the target gene.
- a higher homology in a shorter than full length sequence compensates for a longer less homologous sequence.
- the introduced sequence need not have the same intron or exon pattern, and homology of non-coding segments will be equally effective. Normally, a sequence of greater than 20-100 nucleotides should be used, though a sequence of greater than about 200-300 nucleotides would be preferred, and a sequence of greater than 500-1000 nucleotides would be especially preferred depending on the size of the target gene.
- a second aspect of the present invention provides a synthetic gene which is capable of modifying target gene expression in a cell, tissue or organ of a prokaryotic or eukaryotic organism which is transfected or transformed therewith, wherein said synthetic gene at least comprises a dispersed nucleic acid molecular foreign nucleic acid molecule comprising multiple copies of a nucleotide sequence which is substantially identical to the nucleotide sequence of said target gene or a derivative thereof or a complementary sequence thereto placed operably under the control of a promoter sequence which is operable in said cell, tissue or organ.
- a third aspect of the invention provides a synthetic gene which is capable of modifying the expression of a target gene in a cell, tissue or organ of a prokaryotic or eukaryotic organism which is transfected or transformed therewith, wherein said synthetic gene at least comprises multiple structural gene sequences, wherein each of said structural gene sequences comprises a nucleotide sequence which is substantially identical to the nucleotide sequence of said target gene or a derivative thereof or a complementary sequence thereto and wherein said multiple structural gene sequences are placed operably under the control of a single promoter sequence which is operable in said cell, tissue or organ.
- a fourth aspect of the present invention provides a synthetic gene which is capable of modifying the expression of a target gene in a cell, tissue or organ of a prokaryote or eukaryote which is transfected or transformed therewith wherein said synthetic gene at least comprises multiple structural gene sequences wherein each of said structural gene sequences is placed operably under the control of a promoter sequence which is operable in said cell, tissue or organ and wherein each of said structural gene sequences comprises a nucleotide sequence which is substantially identical to the nucleotide sequence of said target gene or a derivative thereof or a complementary sequence thereto.
- a fifth aspect of the present invention provides a genetic construct which is capable of modifying the expression of an endogenous gene or target gene in a transformed or transfected cell, tissue or organ wherein said genetic construct at least comprises the synthetic gene of the invention and one or more origins of replication and/or selectable marker gene sequences.
- a sixth aspect of the invention provides a cell, tissue, organ or organism comprising the synthetic genes and genetic constructs described herein.
- Figure 1 is a diagrammatic representation of the plasmid pEGFP-N1 MCS.
- Figure 2 is a diagrammatic representation of the plasmid pCMV.cass.
- Figure 3 is a diagrammatic representation of the plasmid pCMV.SV40L.cass.
- Figure 4 is a diagrammatic representation of the plasmid pCMV.SV40LR.cass.
- Figure 5 is a diagrammatic representation of the plasmid pCR.Bgl-GFP-Bam.
- Figure 6 is a diagrammatic representation of the plasmid pBSII(SK+).EGFP.
- Figure 7 is a diagrammatic representation of the plasmid pCMV.EGFP.
- Figure 8 is a diagrammatic representation of the plasmid pCR.SV40L. - 11
- Figure 9 is a diagrammatic representation of the plasmid pCR.BEVJ .
- Figure 10 is a diagramma ic representation of the plasmid pCR.BEV.2.
- Figure 11 is a diagramma' ic representation of the plasmid pCR.BEV.3.
- Figure 12 is a diagramma ic representation of the plasmid pCMV.EGFP.BEV2.
- Figure 13 is a diagramma ic representation of the plasmid pCMV.BEV.2.
- Figure 14 is a diagramma ic representation of the plasmid pCMV.BEV.3.
- Figure 15 is a diagramma ic representation of the plasmid pCMV.VEB.
- Figure 16 is a diagramma ic representation of the plasmid pCMV.BEV.GFP.
- Figure 17 is a diagramma ic representation of the plasmid pCMV.BEV.SV40L-0.
- Figure 18 is a diagramma ic representation of the plasmid pCMV.0.SV40L.BEV.
- Figure 19 is a diagramma ic representation of the plasmid pCMV.0.SV40L.VEB.
- Figure 20 is a diagramma ic representation of the plasmid pCMV.BEVx2.
- Figure 21 is a diagramma ic representation of the plasmid pCMV.BEVx3.
- Figure 22 is a diagramma ic representation of the plasmid pCMV.BEVx4.
- Figure 23 is a diagramma ic representation of the plasmid pCMV.BEV.SV40L.BEV. - 12 -
- Figure 24 is a diagrammatic representation of the plasmid pCMV.BEV.SV40L.VEB.
- Figure 25 is a diagrammatic representation of the plasmid pCMV.BEV.GFP.VEB.
- Figure 26 is a diagrammatic representation of the plasmid pCMV.EGFP.BEV2.PFG.
- Figure 27 is a diagrammatic representation of the plasmid pCMV.BEV.SV40LR.
- Figure 28 is a diagrammatic representation of the plasmid pCDNA3.Galt.
- Figure 29 is a diagrammatic representation of the plasmid pCMV.Galt.
- Figure 30 is a diagrammatic representation of the plasmid pCMV.EGFP.Galt.
- Figure 31 is a diagrammatic representation of the plasmid pCMV.Galt.GFP.
- Figure 32 is a diagrammatic representation of the plasmid pCMV.Galt.SV40L.0.
- Figure 33 is a diagrammatic representation of the plasmid pCMV.Galt.SV40L.tlaG.
- Figure 34 is a diagrammatic representation of the plasmid pCMV.0.SV40L.Galt.
- Figure 35 is a diagrammatic representation of the plasmid pCMV.Galtx2.
- Figure 36 is a diagrammatic representation of the plasmid pCMV.Galtx4.
- Figure 37 is a diagrammatic representation of the plasmid pCMV. Gait. SV40L. Gait.
- Figure 38 is a diagrammatic representation of the plasmid pCMV.Galt. SV40L.tlaG. 13
- Figure 39 is a diagramma ic representation of the plasmid pCMV.Galt.GFP.tlaG.
- Figure 40 is a diagramma' ic representation of the plasmid pCMV.EGFP.Galt.PFG.
- Figure 41 is a diagramma ic representation of the plasmid pCMV.Galt.SV40LR.
- Figure 42 is a diagramma ic representation of the plasmid pART7.
- Figure 43 is a diagramma c representation of the plasmid pART7.35S.SCBV.cass.
- Figure 44 is a diagramma ic representation of the plasmid pBC.PVY.
- Figure 45 is a diagramma ic representation of the plasmid pSP72.PVY.
- Figure 46 is a diagramma ic representation of the plasmid pClapBC.PVY.
- Figure 47 is a diagramma ic representation of the plasmid pBC.PVYx2.
- Figure 48 is a diagramma ic representation of the plasmid pSP72.PVYx2.
- Figure 49 is a diagramma ic representation of the plasmid pBC.PVYx3.
- Figure 50 is a diagramma ic representation of the plasmid pBC.PVYx4.
- Figure 51 is a diagramma ic representation of the plasmid pBC.PVY.LNYV.
- Figure 52 is a diagramma' ic representation of the plasmid pBC.PVY.LNYV.PVY.
- Figure 53 is a diagramma ic representation of the plasmid pBC.PVY.LNYV. YVP ⁇ . - 14 -
- Figure 54 is a diagrammatic representation of the plasmid pBC.PVY.LNYV.YVP.
- Figure 55 is a diagrammatic representation of the plasmid pART27.PVY
- Figure 56 is a diagrammatic representation of the plasmid pART27.35S.PVY.SCBV.O.
- Figure 57 is a diagrammatic representation of the plasmid pART27.35S.O.SCBV.PVY.
- Figure 58 is a diagrammatic representation of the plasmid pART27.35S.O.SCBV.YVP.
- Figure 59 is a diagrammatic representation of the plasmid pART7.PVYx2.
- Figure 60 is a diagrammatic representation of the plasmid pART7.PVYx3.
- Figure 61 is a diagrammatic representation of the plasmid pART7.PVYx4.
- Figure 62 is a diagrammatic representation of the plasmid pART7.PVY.LNYV.PVY.
- Figure 63 is a diagrammatic representation of the plasmid pART7.PVY.LNYV. YVP ⁇ .
- Figure 64 is a diagrammatic representation of the plasmid pART7.PVY.LNYV.YVP.
- Figure 65 is a diagrammatic representation of pART7.35S.PVY.SCBV.YVP.
- Figure 66 is a diagrammatic representation of pART7.35S.PVYx3.SCBV.YVPx3.
- Figure 67 is a diagrammatic representation of pART7.PVYx3.LNYV.YVPx3.
- Figure 68 is a diagrammatic representation of the plasmid pART7.PVYMULTI. 15
- the present invention provides a method of modulating the expression of a target gene in a cell, tissue or organ, said method at least comprising the step of introducing to said cell, tissue or organ one or more dispersed nucleic acid molecules or foreign nucleic acid molecules comprising multiple copies of a nucleotide sequence which is substantially identical to the nucleotide sequence of said target gene or a region thereof or complementary thereto for a time and under conditions sufficient for translation of the mRNA product of said target gene to be modified, subject to the proviso that the transcription of said mRNA product is not exclusively repressed or reduced.
- multiple copies is meant that two or more copies of the target gene are presented in close physical connection or juxtaposed, in the same or different orientation, on the same nucleic acid molecule, optionally separated by a stuffer fragment or intergenic region to facilitate secondary structure formation between each repeat where this is required.
- the stuffer fragment may comprise any combination of nucleotide or amino acid residues, carbohydrate molecules or oligosaccharide molecules or carbon atoms or a homologue, analogue or derivative thereof which is capable of being linked covalently to a nucleic acid molecule.
- the stuffer fragment comprises a sequence of nucleotides or a homologue, analogue or derivative thereof.
- the stuffer fragment comprises a sequence of nucleotides of at least about 10-50 nucleotides in length, even more preferably at least about 50-100 nucleotides in length and still more preferably at least about 100-500 nucleotides in length.
- dispersed or foreign nucleic acid molecule comprises intron/exon splice 16 -
- the stuffer fragment may serve as an intron sequence placed between the 3'-splice site of the structural gene nearer the 5'-end of the gene and the 5'- splice site of the next downstream unit thereof.
- the stuffer fragment placed there between should not include an in-frame translation stop codon, absent intron/exon splice junction sequences at both ends of the stuffer fragment or the addition of a translation start codon at the 5' end of each unit, as will be obvious to those skilled in the art.
- Preferred stuffer fragments are those which encode detectable marker proteins or biologically-active analogues and derivatives thereof, for example luciferase, ⁇ - galacturonase, ⁇ -galactosidase, chloramphenicol acetyltransferase or green fluorescent protein, amongst others. Additional stuffer fragments are not excluded.
- the detectable marker or an analogue or derivative thereof serves to indicate the expression of the synthetic gene of the invention in a cell, tissue or organ by virtue of its ability to confer a specific detectable phenotype thereon, preferably a visually-detectable phenotype.
- modulating shall be taken to mean that expression of the target gene is reduced in amplitude and/or the timing of gene expression is delayed and/or the developmental or tissue-specific or cell-specific pattern of target gene expression is altered, compared to the expression of said gene in the absence of the inventive method described herein.
- the present invention is directed to a modulation of gene expression which comprises the repression, delay or reduction in amplitude of target gene expression in a specified cell, tissue or organ of a eukaryotic organism, in particular a plant such as a monocotyledonous or dicotyledonous plant, or a human or other animal and even more particularly a 17
- vertebrate and invertebrate animal such as an insect, aquatic animal (eg. fish, shellfish, mollusc, crustacean such as a crab, lobster or prawn, an avian animal or a mammal, amongst others).
- an insect eg. fish, shellfish, mollusc, crustacean such as a crab, lobster or prawn, an avian animal or a mammal, amongst others.
- target gene expression is completely inactivated by the dispersed nucleic acid molecules or foreign nucleic acid molecules which has been introduced to the cell, tissue or organ.
- the reduced or eliminated expression of the target gene which results from the performance of the invention may be attributed to reduced or delayed translation of the mRNA transcription product of the target gene or alternatively, the prevention of translation of said mRNA, as a consequence of sequence-specific degradation of the mRNA transcript of the target gene by an endogenous host cell system.
- sequence-specific degradation of the mRNA transcript of the target gene occurs either prior to the time or stage when the mRNA transcript of the target gene would normally be translated or alternatively, at the same time as the mRNA transcript of the target gene would normally be translated. Accordingly, the selection of an appropriate promoter sequence to regulate expression of the introduced dispersed nucleic acid molecule or foreign nucleic acid molecule is an important consideration to optimum performance of the invention. For this reason, strong constitutive promoters or inducible promoter systems are especially preferred for use in regulating expression of the introduced dispersed nucleic acid molecules or foreign nucleic acid molecules.
- the present invention clearly encompasses reduced expression wherein reduced expression of the target gene is effected by lowered transcription, subject to the proviso that a reduction in transcription is not the sole mechanism by which this occurs and said reduction in transcription is at least accompanied by reduced translation of 18
- the target gene may be a genetic sequence which is endogenous to the animal cell or alternatively, a non-endogenous genetic sequence, such as a genetic sequence which is derived from a virus or other foreign pathogenic organism and is capable of entering a cell and using the cell's machinery following infection.
- the target gene is a non-endogenous genetic sequence to the animal cell, it is desirable that the target gene encodes a function which is essential for replication or reproduction of the viral or other pathogen.
- the present invention is particularly useful in the prophylactic and therapeutic treatment of viral infection of an animal cell or for conferring or stimulating resistance against said pathogen.
- the target gene comprises one or more nucleotide sequences of a viral pathogen of a plant or an animal cell, tissue or organ.
- the viral pathogen may be a retrovirus, for example a lentivirus such as the immunodeficiency viruses, a single- stranded (+) RNA virus such as bovine enterovirus (BEV) or Sinbis alphavirus.
- the target gene can comprise one or more nucleotide sequences of a viral pathogen of an animal cell, tissue or organ, such as but not limited to a double- stranded DNA virus such as bovine herpes virus or herpes simplex virus I (HSV I), amongst others.
- the virus pathogen is preferably a potyvirus, caulimovirus, badnavirus, geminivirus, reovirus, rhabdovirus, bunyavirus, tospovirus, tenuivirus, tombusvirus, luteovirus, sobemovirus, bromovirus, cucomovirus, ilavirus, alfamovirus, tobamovirus, tobravirus, potexvirus and clostrovirus, such as but not limited to CaMV, SCSV, PVX, PVY, PLRV, and TMV, amongst others.
- a potyvirus such as but not limited to CaMV, SCSV, PVX, PVY, PLRV, and TMV, amongst others.
- virus- encoded functions may be complemented in trans by polypeptides encoded by the host cell.
- the replication of the bovine herpes virus genome in the host cell may be facilitated by host cell DNA polymerases which are capable of complementing an inactivated viral DNA polymerase gene.
- a further alternative embodiment of the invention provides for the target gene to encode a viral or foreign polypeptide which is not capable of being complemented by a host cell function, such as a virus-specific genetic sequence.
- exemplary target genes according to this embodiment of the invention include, but are not limited to genes which encode virus coat proteins, uncoating proteins and RNA- dependent DNA polymerases and RNA-dependent RNA polymerases, amongst others.
- the target gene is the BEV RNA-dependent RNA polymerase gene or a homologue, analogue or derivative thereof or PVY Nia protease-encoding sequences.
- the cell in which expression of the target gene is modified may be any cell which is derived from a multicellular plant or animal, including cell and tissue cultures thereof.
- the animal cell is derived from an insect, reptile, amphibian, bird, human or other mammal.
- Exemplary animal cells include embryonic stem cells, cultured skin fibroblasts, neuronal cells, somatic cells, haematopoietic stem cells, T-cells and immortalised cell lines such as COS, VERO, HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, baby hamster kidney (BHK) or MDBK cell lines, amongst others.
- Such cells and cell lines are readily available to those skilled in the art.
- the tissue or organ in which expression of the target gene is modified may be any tissue or organ comprising such animal cells.
- the plant cell is derived from a monocotyledonous or dicotyledonous plant 20
- the term "dispersed nucleic acid molecule” shall be taken to refer to a nucleic acid molecule which comprises one or more multiple copies, preferably tandem direct repeats, of a nucleotide sequence which is substantially identical or complementary to the nucleotide sequence of a gene which originates from the cell, tissue or organ into which said nucleic acid molecule is introduced, wherein said nucleic acid molecule is non-endogenous in the sense that it is introduced to the cell, tissue or organ of an animal via recombinant means and will generally be present as extrachromosomal nucleic acid or alternatively, as integrated chromosomal nucleic acid which is genetically-unlinked to said gene.
- the "dispersed nucleic acid molecule” will comprise chromosomal or extrachromosomal nucleic acid which is unlinked to the target gene against which it is directed in a physical map, by virtue of their not being tandemly-linked or alternatively, occupying a different chromosomal position on the same chromosome or being localised on a different chromosome or present in the cell as an episome, plasmid, cosmid or virus particle.
- foreign nucleic acid molecule an isolated nucleic acid molecule which has one or more multiple copies, preferably tandem direct repeats, of a nucleotide sequence which originates from the genetic sequence of an organism which is different from the organism to which the foreign nucleic acid molecule is introduced.
- This definition encompasses a nucleic acid molecule which originates from a different individual of the same lowest taxonomic grouping (i.e.
- nucleic acid molecule which originates from a different individual of a different taxonomic grouping as the taxonomic grouping to which said nucleic acid molecule is introduced, such as a gene derived from a viral pathogen.
- a target gene against which a foreign nucleic acid molecule acts in the performance of the invention may be a nucleic acid molecule which has been 21
- Exemplary target genes according to this embodiment of the invention include the green fluorescent protein-encoding gene derived from the jellyfish Aequoria victoria (Prasher et a/., 1992; International Patent Publication No. WO 95/07463), tyrosinase genes and in particular the murine tyrosinase gene (Kwon et al., 1988), the Escherichia coli lac ⁇ gene which is capable of encoding a polypeptide repressor of the lacZ gene, the porcine ⁇ -1 ,3-galactosyltransferase gene (NCBI Accession No. L36535) exemplified herein, and the PVY and BEV structural genes exemplified herein or a homologue, analogue or derivative of said genes or a complementary nucleotide sequence thereto.
- green fluorescent protein-encoding gene derived from the jellyfish Aequoria victoria (Prasher et a/., 1992;
- the present invention is further useful for simultaneously targeting the expression of several target genes which are co-expressed in a particular cell, for example by using a dispersed nucleic acid molecule or foreign nucleic acid molecule which comprises nucleotide sequences which are substantially identical to each of said co-expressed target genes.
- substantially identical is meant that the introduced dispersed or foreign nucleic acid molecule of the invention and the target gene sequence are sufficiently identical at the nucleotide sequence level to permit base-pairing there between under standard intracellular conditions.
- the nucleotide sequence of each repeat in the dispersed or foreign nucleic acid molecule of the invention and the nucleotide sequence of a part of the target gene sequence are at least about 80-85% identical at the nucleotide sequence level, more preferably at least about 85-90% identical, even more preferably at least about 90-95% identical and still even more preferably at least about 95-99% or 100% identical at the nucleotide sequence level.
- the present invention requires at least two copies of the target gene sequence to be expressed in the cell.
- the multiple copies of the target gene sequence are presented in the dispersed nucleic acid molecule or the foreign nucleic acid molecule as tandem inverted repeat sequences and/or tandem direct repeat sequences.
- Such configurations are exemplified by the "test plasmids" described herein that comprise Gait, BEV or PVY gene regions.
- the dispersed or foreign nucleic acid molecule which is introduced to the cell, tissue or organ comprises RNA or DNA.
- the dispersed or foreign nucleic acid molecule further comprises a nucleotide sequence or is complementary to a nucleotide sequence which is capable of encoding an amino acid sequence encoded by the target gene.
- the nucleic acid molecule includes one or more ATG or AUG translational start codons.
- Standard methods may be used to introduce the dispersed nucleic acid molecule or foreign nucleic acid molecule into the cell, tissue or organ for the purposes of modulating the expression of the target gene.
- the nucleic acid molecule may be introduced as naked DNA or RNA, optionally encapsulated in a liposome, in a virus particle as attenuated virus or associated with a virus coat or a transport protein or inert carrier such as gold or as a recombinant viral vector or bacterial vector or as a genetic construct, amongst others.
- Administration means include injection and oral ingestion (e.g. in medicated food material), amongst others. - 23
- the subject nucleic acid molecules may also be delivered by a live delivery system such as using a bacterial expression system optimised for their expression in bacteria which can be incorporated into gut flora.
- a viral expression system can be employed.
- one form of viral expression is the administration of a live vector generally by spray, feed or water where an infecting effective amount of the live vector (e.g. virus or bacterium) is provided to the animal.
- Another form of viral expression system is a non-replicating virus vector which is capable of infecting a cell but not replicating therein.
- the non-replicating viral vector provides a means of introducing to the human or animal subject genetic material for transient expression therein.
- the mode of administering such a vector is the same as a live viral vector.
- the carriers, excipients and/or diluents utilised in delivering the subject nucleic acid molecules to a host cell should be acceptable for human or veterinary applications.
- Such carriers, excipients and/or diluents are well-known to those skilled in the art.
- Carriers and/or diluents suitable for veterinary use include any and all solvents, dispersion media, aqueous solutions, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the composition is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
- the invention provides a method of modulating the expression of a target gene in a cell, tissue or organ, said method at least comprising the steps of: (i) selecting one or more dispersed nucleic acid molecules or foreign nucleic acid molecules which comprise multiple copies of a nucleotide sequence which is substantially identical to the nucleotide sequence of said target gene or a region thereof or which is complementary thereto; and
- nucleotide sequences for targeting expression of the target gene may be employed.
- multiple copies of specific regions of characterised genes may be cloned in operable connection with a suitable promoter and assayed for efficacy in reducing target gene expression.
- shotgun libraries comprising multiple copies of genetic sequences may be produced and assayed for their efficacy in reducing target gene expression.
- the advantage associated with the latter approach is that it is not necessary to have any prior knowledge of the significance of any particular target gene in specifying an undesirable phenotype in the cell.
- shotgun libraries comprising virus sub-genomic fragments may be employed and tested directly for their ability to confer virus immunity on the animal host cell, without prior knowledge of the role which any virus genes play in pathogenesis of the host cell.
- shotgun library is a set of diverse nucleotide sequences wherein each member of said set is preferably contained within a suitable plasmid, cosmid, bacteriophage or virus vector molecule which is suitable for maintenance and/or replication in a cellular host.
- shotgun library includes a representative library, in which the extent of diversity between the nucleotide sequences is numerous such that all sequences in the genome of the organism from which said nucleotide sequences is derived are present in the "set” or alternatively, a limited library in which there is a lesser degree of diversity between said sequences.
- shotgun library further encompasses random nucleotide sequences, wherein the nucleotide sequence comprises viral or cellular genome fragments, amongst others obtained for example by shearing or partial digestion of genomic DNA using restriction endonucleases, amongst other approaches.
- a "shotgun library” further includes cells, virus particles and bacteriophage particles comprising the - 25 -
- Preferred shotgun libraries according to this embodiment of the invention are "representative libraries", comprising a set of tandem repeated nucleotide sequences derived from a viral pathogen of a plant or an animal.
- the shotgun library comprises cells, virus particles or bacteriophage particles comprising a diverse set of tandem- repeated nucleotide sequences which encode a diverse set of amino acid sequences, wherein the member of said diverse set of nucleotide sequences are placed operably under the control of a promoter sequence which is capable of directing the expression of said tandem-repeated nucleotide sequence in the cell.
- nucleotide sequence of each unit in the tandem-repeated sequence may comprise at least about 1 to 200 nucleotides in length.
- the introduced nucleic acid molecule is preferably in an expressible form.
- expressible form is meant that the subject nucleic acid molecule is presented in an arrangement such that it may be expressed in the cell, tissue, organ or whole organism, at least at the transcriptional level (i.e. it is expressed in the animal cell to yield at least an mRNA product which is optionally translatable or translated to produce a recombinant peptide, oligopeptide or polypeptide molecule).
- a synthetic gene or a genetic construct comprising said synthetic gene is produced, wherein said synthetic gene comprises a nucleotide sequence as described supra in 26
- the subject nucleic acid molecule will be operably connected to one or more regulatory elements sufficient for eukaryotic transcription to occur.
- a further alternative embodiment of the invention provides a method of modulating the expression of a target gene in an animal cell, tissue or organ, said method at least comprising the steps of:
- a classical genomic gene consisting of transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (i.e. introns, 5'- and 3'- untranslated sequences); and/or
- a structural region corresponding to the coding regions optionally further comprising untranslated sequences and/or a heterologous promoter sequence which consists of transcriptional and/or translational regulatory regions capable of 27
- gene is also used to describe synthetic or fusion molecules encoding all or part of a functional product, in particular a sense or antisense mRNA product or a peptide, oligopeptide or polypeptide or a biologically-active protein.
- synthetic gene refers to a non-naturally occurring gene as hereinbefore defined which preferably comprises at least one or more transcriptional and/or translational regulatory sequences operably linked to a structural gene sequence.
- structural gene shall be taken to refer to a nucleotide sequence which is capable of being transmitted to produce mRNA and optionally, encodes a peptide, oligopeptide, polypeptide or biologically active protein molecule.
- Those skilled in the art will be aware that not all mRNA is capable of being translated into a peptide, oligopeptide, polypeptide or protein, for example if the mRNA lacks a functional translation start signal or alternatively, if the mRNA is antisense mRNA.
- the present invention clearly encompasses synthetic genes comprising nucleotide sequences which are not capable of encoding peptides, oligopeptides, polypeptides or biologically-active proteins. In particular, the present inventors have found that such synthetic genes may be advantageous in modifying target gene expression in cells, tissues or organs of a prokaryotic or eukaryotic organism.
- structural gene region refers to that part of a synthetic gene which comprises a dispersed nucleic acid molecule or foreign nucleic acid molecule as described herein which is expressed in a cell, tissue or organ under the control of a promoter sequence to which it is operably connected.
- a structural gene region may comprise one or more dispersed nucleic acid molecules and/or foreign nucleic acid molecules operably under the control of a single promoter sequence or multiple promoter sequences.
- the structural gene region of a synthetic gene may comprise a nucleotide sequence which is capable of encoding an amino acid 28 -
- a structural gene region which is used in the performance of the instant invention may also comprise a nucleotide sequence which encodes an animo acid sequence yet lacks a functional translation initiation codon and/or a functional translation stop codon and, as a consequence, does not comprise a complete open reading frame.
- the term "structural gene region" also extends to a non-coding nucleotide sequences, such as 5'- upstream or 3'-downstream sequences of a gene which would not normally be translated in a eukaryotic cell which expresses said gene.
- a structural gene region may also comprise a fusion between two or more open reading frames of the same or different genes.
- the invention may be used to modulate the expression of one gene, by targeting different non-contiguous regions thereof or alternatively, to simultaneously modulate the expression of several different genes, including different genes of a multigene family.
- the fusion may provide the added advantage of conferring simultaneous immunity or protection against several pathogens, by targeting the expression of genes in said several pathogens.
- the fusion may provide more effective immunity against any pathogen by targeting the expression of more than one gene of that pathogen.
- Particularly preferred structural gene regions according to this aspect of the invention are those which include at least one translatable open reading frame, more preferably further including a translational start codon located at the 5'-end of said open reading frame, albeit not necessarily at the 5'-terminus of said structural gene region.
- the structural gene region may comprise at least one translatable open reading frame and/or AUG or ATG translational start codon, the inclusion of such sequences in no way suggests that the present invention requires translation of the introduced nucleic acid molecule to occur in order to modulate the - 29 -
- the inclusion of at least one translatable open reading frame and/or translational start codon in the subject nucleic acid molecule may serve to increase stability of the mRNA transcription product thereof, thereby improving the efficiency of the invention.
- the optimum number of structural gene sequences to be included in the synthetic genes of the present invention may be determined empirically by those skilled in the art, without any undue experimentation and by following standard procedures such as the construction of the synthetic gene of the invention using recombinase-deficient cell lines, reducing the number of repeated sequences to a level which eliminates or minimises recombination events and by keeping the total length of the multiple structural gene sequence to an acceptable limit, preferably no more than 5-1 Okb, more preferably no more than 2-5kb and even more preferably no more than 0.5-2. Okb in length.
- the structural gene region comprises more than one dispersed nucleic acid molecule or foreign nucleic acid molecule it shall be referred to herein as a "multiple structural gene region" or similar term.
- the present invention clearly extends to the use of multiple structural gene regions which preferably comprise a direct repeat sequence, inverted repeat sequence or interrupted palindrome sequence of a particular structural gene, dispersed nucleic acid molecule or foreign nucleic acid molecule, or a fragment thereof.
- Each dispersed or foreign nucleic acid molecule contained within the multiple structural gene unit of the subject synthetic gene may comprise a nucleotide sequence which is substantially identical to a different target gene in the same organism.
- Such an arrangement may be of particular utility when the synthetic gene is intended to provide protection against a pathogen in a cell, tissue or organ, in particular a viral pathogen, by modifying the expression of viral target genes.
- the multiple structural gene may comprise nucleotide sequences (i.e. two or more dispersed or foreign nucleic acid molecules) which are substantially identical to two or more target genes selected from the list comprising DNA polymerase, RNA polymerase, Nia protease, and coat protein or other target gene which is essential for viral infectivity, replication or reproduction.
- the structural gene units are selected such that the target genes to which they are substantially identical are normally expressed at approximately the same time (or later) in an infected cell, tissue or organ as (than) the multiple structural gene of the subject synthetic gene is expressed under control of the promoter sequence.
- the promoter controlling expression of the multiple structural gene will usually be selected to confer expression in the cell, tissue or organ over the entire life cycle of the virus when the viral target genes are expressed at different stages of infection.
- the individual units of the multiple structural gene may be spatially connected in any orientation relative to each other, for example head-to-head, head-to-tail or tail-to-tail and all such configurations are within the scope of the invention.
- the synthetic gene For expression in eukaryotic cells, the synthetic gene generally comprises, in addition to the nucleic acid molecule of the invention, a promoter and optionally other regulatory sequences designed to facilitate expression of the dispersed nucleic acid molecule or foreign nucleic acid molecule.
- transcriptional regulatory sequences of a classical genomic gene including the TATA box which is required for accurate transcription initiation, with or without a CCAAT box sequence and additional regulatory elements (i.e. upstream activating sequences, enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue-specific manner.
- a promoter is usually, but not necessarily, positioned upstream or 5', of a structural gene region, the expression of which it regulates.
- the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene.
- promoter is also used to describe a synthetic or fusion molecule, or derivative which confers, activates or enhances expression of a nucleic acid molecule in a cell.
- Preferred promoters may contain additional copies of one or more specific regulatory elements, to further enhance expression of the sense molecule and/or to alter the spatial expression and/or temporal expression of said sense molecule.
- regulatory elements which confer copper inducibility may be placed adjacent to a heterologous promoter sequence driving expression of a sense molecule, thereby conferring copper inducibility on the expression of said molecule.
- Placing a dispersed or foreign nucleic acid molecule under the regulatory control of a promoter sequence means positioning the said molecule such that expression is controlled by the promoter sequence. Promoters are generally positioned 5' (upstream) to the genes that they control. In the construction of heterologous promoter/structural gene combinations it is generally preferred to position the promoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, i.e., the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of promoter function. Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous - 32
- gene to be placed under its control is defined by the positioning of the element in its natural setting, i.e., the genes from which it is derived. Again, as is known in the art, some variation in this distance can also occur.
- promoters suitable for use in the synthetic genes of the present invention include viral, fungal, bacterial, animal and plant derived promoters capable of functioning in plant, animal, insect, fungal, yeast or bacterial cells.
- the promoter may regulate the expression of the structural gene component constitutively, or differentially with respect to cell, the tissue or organ in which expression occurs or, with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, or pathogens, or metal ions, amongst others.
- the promoter is capable of regulating expression of a nucleic acid molecule in a eukaryotic cell, tissue or organ, at least during the period of time over which the target gene is expressed therein and more preferably also immediately preceding the commencement of detectable expression of the target gene in said cell, tissue or organ.
- promoters are particularly preferred for the purposes of the present invention or promoters which may be induced by virus infection or the commencement of target gene expression.
- Plant-operable and animal-operable promoters are particularly preferred for use in the synthetic genes of the present invention.
- preferred promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator- promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, CaMV 35S promoter, SCSV promoter, SCBV promoter and the like.
- the promoter sequence is a constitutive strong promoter such as the CMV-IE promoter or the SV40 early promoter sequence, the SV40 late promoter sequence, the CaMV 35S promoter, or the SCBV promoter, amongst others.
- a constitutive strong promoter such as the CMV-IE promoter or the SV40 early promoter sequence, the SV40 late promoter sequence, the CaMV 35S promoter, or the SCBV promoter, amongst others.
- the terms "in operable connection with” or “operably under the control” or similar shall be taken to indicate that expression of the structural gene region or multiple structural gene region is under the control of the promoter sequence with which it is spatially connected; in a cell, tissue, organ or whole organism.
- a structural gene region i.e. dispersed nucleic acid molecule or foreign nucleic acid molecule
- multiple structural gene region is placed operably in connection with a promoter orientation relative to the promoter sequence, such that when it is transcribed an mRNA product is synthesized which, if translated, is capable of encoding a polypeptide product of the target gene or a fragment thereof.
- the present invention is not to be limited to the use of such an arrangement and the invention clearly extends to the use of synthetic genes and genetic constructs wherein the a structural gene region or multiple structural gene region is placed in the "antisense" orientation relative to the promoter sequence, such that at least a part of the mRNA transcription product thereof is complementary to the mRNA encoded by the target gene or a fragment thereof.
- dispersed nucleic acid molecule foreign nucleic acid molecule or multiple structural gene region comprises tandem direct and/or inverted repeat sequences of the target gene, all combinations of the above-mentioned configurations are encompassed by the invention.
- the structural gene region or multiple structural gene region is operably connected to both a first promoter sequence and a second promoter sequence, wherein said promoters are located at the distal and proximal ends thereof such that at least one unit of said a structural gene region or multiple structural gene region is placed in the "sense" orientation relative to the first promoter sequence and in the "antisense” orientation relative to the second promoter sequence.
- the first and second promoters be different, to prevent competition there between for cellular transcription factors which bind thereto. The advantage of this arrangement is that the effects of transcription from the first and second promoters in reducing target gene expression in the cell may be compared to determine the optimum orientation for each nucleotide sequence tested.
- the synthetic gene preferably contains additional regulatory elements for efficient transcription, for example a transcription termination sequence.
- Terminator refers to a DNA sequence at the end of a transcriptional unit which signals termination of transcription. Terminators are 3'-non-translated DNA sequences containing a polyadenylation signal, which facilitates the addition of polyadenylate sequences to the 3'-end of a primary transcript. Terminators active in plant cells are known and described in the literature. They may be isolated from bacteria, fungi, viruses, animals and/or plants or synthesized de novo.
- the terminator may be any terminator sequence which is operable in the cells, tissues or organs in which it is intended to be used.
- terminators particularly suitable for use in the synthetic genes of the present invention include the SV40 polyadenylation signal, the HSV TK polyadenylation signal, the CYC1 terminator, ADH terminator, SPA terminator, nopaline synthase (NOS) gene terminator of Agrobactehum tumefaciens, the - 35 -
- Cauliflower mosaic virus (CaMV) 35S gene the Cauliflower mosaic virus (CaMV) 35S gene
- the zein gene terminator from Zea mays the Rubisco small subunit gene (SSU) gene terminator sequences
- SCSV subclover stunt virus
- any t ?o-independent E.coli terminator or the lacZ alpha terminator, amongst others.
- the terminator is the SV40 polyadenylation signal or the HSVTK polyadenylation signal which are operable in animal cells, tissues and organs, octopine synthase (OCS) or nopaline synthase (NOS) terminator active in plant cells, tissues or organs, or the lacZ alpha terminator which is active in prokaryotic cells.
- OCS octopine synthase
- NOS nopaline synthase
- a genetic construct which comprises two or more structural gene regions or multiple structural gene regions wherein each of said structural gene regions is placed operably under the control of its own promoter sequence.
- the orientation of each structural gene region may be varied to maximise its modulatory effect on target gene expression.
- the promoters controlling expression of the structural gene unit are preferably different promoter sequences, to reduce competition there between for cellular transcription factors and RNA polymerases.
- Preferred promoters are selected from those referred to supra. - 36 -
- the synthetic genes described supra are capable of being modified further, for example by the inclusion of marker nucleotide sequences encoding a detectable marker enzyme or a functional analogue or derivative thereof, to facilitate detection of the synthetic gene in a cell, tissue or organ in which it is expressed.
- the marker nucleotide sequences will be present in a translatable format and expressed, for example as a fusion polypeptide with the translation product(s) of any one or more of the structural genes or alternatively as a non-fusion polypeptide.
- the synthetic genes of the present invention may be introduced to a suitable cell, tissue or organ without modification as linear DNA in the form of a genetic construct, optionally contained within a suitable carrier, such as a cell, virus particle or liposome, amongst others.
- a suitable carrier such as a cell, virus particle or liposome, amongst others.
- the synthetic gene of the invention is inserted into a suitable vector or episome molecule, such as a bacteriophage vector, viral vector or a plasmid, cosmid or artificial chromosome vector which is capable of being maintained and/or replicated and/or expressed in the host cell, tissue or organ into which it is subsequently introduced.
- a further aspect of the invention provides a genetic construct which at 37 -
- Genetic constructs are particularly suitable for the transformation of a eukaryotic cell to introduce novel genetic traits thereto, in addition to the provision of resistance characteristics to viral pathogens.
- additional novel traits may be introduced in a separate genetic construct or, alternatively on the same genetic construct which comprises the synthetic genes described herein.
- an origin of replication or a selectable marker gene suitable for use in bacteria is physically-separated from those genetic sequences contained in the genetic construct which are intended to be expressed or transferred to a eukaryotic cell, or integrated into the genome of a eukaryotic cell.
- the origin of replication is functional in a bacterial cell and comprises the pUC or the ColE1 origin or alternatively the origin of replication is operable in a eukaryotic cell, tissue and more preferably comprises the 2 micron (2 ⁇ xn) origin of replication or the SV40 origin of replication.
- selectable marker gene includes any gene which confers a phenotype on a cell in which it is expressed to facilitate the identification and/or selection of cells which are transfected or transformed with a genetic construct of the invention or a derivative thereof.
- Suitable selectable marker genes contemplated herein include the ampiciliin-resistance 38
- tetracycline-resistance gene Tc r
- bacterial kanamycin-resistance gene Kan r
- Zeocin is a drug of bleomycin family which is trademark of InVitrogen Corporation
- AURI-C zeocin resistance gene
- nptW neomycin phosphotransferase gene
- hygromycin-resistance gene ⁇ -glucuronidase (GUS) gene
- chloramphenicol acetyltransferase (CAT) gene green fluorescent protein- encoding gene or the luciferase gene, amongst others.
- the selectable marker gene is the npfll gene or Kan r gene or green fluorescent protein (GFP)-encoding gene.
- selectable marker genes useful in the performance of the present invention and the subject invention is not limited by the nature of the selectable marker gene.
- the present invention extends to all genetic constructs essentially as described herein, which include further genetic sequences intended for the maintenance and/or replication of said genetic construct in prokaryotes or eukaryotes and/or the integration of said genetic construct or a part thereof into the genome of a eukaryotic cell or organism.
- Additional means for introducing recombinant DNA into plant tissue or cells include, but are not limited to, transformation using CaCI 2 and variations thereof, in particular - 39 -
- a microparticle is propelled into a cell to produce a transformed cell.
- Any suitable ballistic cell transformation methodology and apparatus can be used in performing the present invention. Exemplary apparatus and procedures are disclosed by Stomp etal. (U.S. Patent No. 5,122,466) and Sanford and Wolf (U.S. Patent No. 4,945,050).
- the genetic construct may incorporate a plasmid capable of replicating in the cell to be transformed.
- microparticles suitable for use in such systems include 1 to 5 ⁇ m gold spheres.
- the DNA construct may be deposited on the microparticle by any suitable technique, such as by precipitation.
- the synthetic genes and genetic constructs described herein are adapted for integration into the genome of a cell in which it is expressed.
- Those skilled in the art will be aware that, in order to achieve integration of a genetic sequence or genetic construct into the genome of a host cell, certain additional genetic sequences may be required. In the case of plants, left and right border sequences from the T-DNA of the Agrobactehum tumefaciens Ti plasmid will generally be required.
- the present invention further extends to an isolated cell, tissue or organ comprising 40
- the present invention extends further to regenerated tissues, organs and whole organisms derived from said cells, tissues and organs and to propagules and progeny thereof.
- plants may be regenerated from transformed plant cells or tissues or organs on hormone-containing media and the regenerated plants may take a variety of forms, such as chimeras of transformed cells and non-transformed cells; clonal transformants (e.g., all cells transformed to contain the expression cassette); grafts of transformed and untransformed tissues (e.g., a transformed root stock grafted to an untransformed scion in citrus species).
- Transformed plants may be propagated by a variety of means, such as by clonal propagation or classical breeding techniques. For example, a first generation (or T1) transformed plants may be selfed to give homozygous second generation (or T2) transformed plants, and the T2 plants further propagated through classical breeding techniques.
- Plasmid pBluescript II (SK+) is commercially available from Stratagene and comprises the LacZ promoter sequence and /acZ-alpha transcription terminator, with a multiple cloning site for the insertion of structural gene sequences therein.
- the plasmid further comprises the ColE1 and fl origins of replication and ampiciliin-resistance gene.
- Plasmid pSVL is commercially-obtainable from Pharmacia and serves as a source of the SV40 late promoter sequence.
- the nucleotide sequence of pSVL is also publicly available as GenBank Accession Number U13868.
- Plasmid pCR2.1 is commercially available from Invitrogen and comprises the LacZ promoter sequence and lacZ- ⁇ transcription terminator, with a cloning site for the insertion of structural gene sequences there between. Plasmid pCR2.1 is designed to clone nucleic acid fragments by virtue of the A-overhang frequently synthesized by Taq polymerase during the polymerase chain reaction. PCR fragments cloned in this fashion are flanked by two EcoRI sites. The plasmid further comprises the ColE1 and fl origins of replication and kanamycin-resistance and ampiciliin-resistance genes.
- Plasmid pEGFP-N1 MCS ( Figure 1; Clontech) contains the CMV IE promoter operably connected to an open reading frame encoding a red-shifted variant of wild-type green fluorescent protein (GFP; Prasher et al., 1992; Chalfie et al., 1994; Inouye and Tsuji, - 42 -
- Plasmid pEGFP-N1 MCS contains a multiple cloning site comprising BglW and Bam ⁇ sites and many other restriction endonuclease cleavage sites, located between the CMV IE promoter and the GFP open reading frame. Structural genes cloned into the multiple cloning site will be expressed at the transcriptional level if they lack a functional translation start site, however such structural gene sequences will not be expressed at the protein level (i.e. translated).
- Structural gene sequences inserted into the multiple cloning site which comprise a functional translation start site will be expressed as GFP fusion polypeptides if they are cloned in-frame with the GFP-encoding sequence.
- the plasmid further comprises an SV40 polyadenylation signal downstream of the GFP open reading frame to direct proper processing of the 3'-end of mRNA transcribed from the CMV-IE promoter sequence.
- the plasmid further comprises the SV40 origin of replication functional in animal cells; the neomycin-resistance gene comprising SV40 early promoter (SV40 EP in Figure 1) operably connected to the neomycin/kanamycin-resistance gene derived from Tn5 (Kan/neo in Figure 1) and the HSV thymidine kinase polyadenylation signal (HSV TK poly (A) in Figure 1), for selection of transformed cells on kamanycin, neomycin or G418; the pUC19 origin of replication which is functional in bacterial cells (pUC Ori in Figure 1); and the f1 origin of replication for single-stranded DNA production (fl Ori in Figure 1).
- SV40 EP SV40 early promoter
- HSV TK poly (A) HSV thymidine kinase polyadenylation signal
- Plasmid pCMV.cass ( Figure 2) is an expression cassette for driving expression of a structural gene sequence under control of the CMV-IE promoter sequence.
- Plasmid pCMV.cass was derived from pEGFP-N1 MCS by deletion of the GFP open reading frame as follows: Plasmid pEGFP-N1 MCS was digested with PinA and Not I, blunt- ended using Pfu ⁇ polymerase and then re-ligated. Structural gene sequences are cloned into pCMV.cass using the multiple cloning site, which is identical to the multiple cloning site of pEGFP-N1 MCS, except it lacks the P/ ' nAI site. 43
- Plasmid pCMV.SV40L.cass ( Figure 3) comprises the synthetic poly A site and the SV40 late promoter sequence from plasmid pCR.SV40L ( Figure 4), sub-cloned as a Sal I fragment, into the Sal I site of plasmid pCMV.cass ( Figure 2), such that the CMV- IE promoter and SV40 late promoter sequences are capable of directing transcription in the same direction.
- the synthetic poly(A) site at the 5' end of the SV40 promoter sequence is used as a transcription terminator for structural genes expressed from the CMV IE promoter in this plasmid, which also provides for the insertion of said structural gene via the multiple cloning site present between the SV40 late promoter and the synthetic poly(A) site ( Figure 5).
- the multiple cloning sites are located behind the CMV-IE and SV40 late promoters, including Bam ⁇ and BglW sites.
- Plasmid pCMV.SV40LR.cass ( Figure 4) comprises the SV40 late promoter sequence derived from plasmid pCR.SV40L, sub-cloned as a Sail fragment into the Sa/I site of the plasmid pCMV.cass ( Figure 2), such that the CMV-IE or the SV40 late promoter may drive transcription of a structural gene or a multiple structural gene unit, in the sense or antisense orientation, as desired.
- a multiple cloning site is positioned between the opposing CMV- IE and SV40 late promoter sequences in this plasmid to facilitate the introduction of a structural gene sequence.
- the structural gene sequence or multiple structural gene unit which is to be introduced into pCMV.SV40LR.cass will comprise both a 5' and a 3' polyadenylation signal as follows:
- the structural gene sequence or multiple structural gene unit is to be expressed in the sense orientation from the CMV IE promoter sequence and/or in the antisense orientation from the SV40 late promoter, the 5' polyadenylation signal will be in the antisense orientation and the 3' 44
- polyadenylation signal will be in the sense orientation; and (ii) where the structural gene sequence or multiple structural gene unit is to be expressed in the antisense orientation from the CMV IE promoter sequence and/or in the sense orientation from the SV40 late promoter, the 5' polyadenylation signal will be in the sense orientation and the 3' polyadenylation signal will be in the antisense orientation.
- suitably-oriented terminator sequences may be placed at the 5'-end of the CMV and SV40L promoters, as shown in Figure 4.
- plasmid pCMV.SV40LR.cass is further modified to produce a derivative plasmid which comprises two polyadenylation signals located between the CMV IE and SV40 late promoter sequences, in approriate orientations to facilitate expression of any structural gene located therebetween in the sense or antisense orientation from either the CMV IE promoter or the SV40 promoter sequence.
- the present invention clearly encompasses such derivatives.
- appropriately oriented terminators could be placed upstream of the CMV and SV40L promoters such that transcriptional termination could occur after readthrough of each of the two promoters in the antisense orientation.
- Plasmid pCR.Bgl-GFP-Bam ( Figure 5) comprises an internal region of the GFP open reading frame derived from plasmid pEGFP-N1 MCS ( Figure 1) placed operably under the control of the lacZ promoter. To produce this plasmid, a region of the GFP open reading frame was amplified from pEGFP-N1 MCS using the amplification primers Bgl- GFP and GFP-Bam and cloned into plasmid pCR2.1. The internal GFP-encoding region in plasmid pCR.Bgl-GFP-Bam lacks functional translational start and stop codons. - 45 -
- EGFP ( Figure 6) comprises the EGFP open reading frame derived from plasmid pEGFP-N1 MCS ( Figure 1) placed operably under the control of the lacZ promoter. To produce this plasmid, the EGFP encoding region of pEGFP-N1 MCS was excised as a NotMXho ⁇ fragment and cloned into the NotMXho cloning sites of plasmid pBluescript II (SK+).
- Plasmid pCMV.EGFP ( Figure 7) is capable of expressing the EGFP structural gene under the control of the CMV-IE promoter sequence.
- the EGFP sequence from plasmid pBSII(SK+).EGFP was excised as BamHUSacl fragment and cloned into the BglU/Sacl sites of plasmid pCMV.cass ( Figure 2).
- Plasmid pCR.SV40L ( Figure 8) comprises the SV40 late promoter derived from plasmid pSVL (GenBank Accession No. U 13868; Pharmacia), cloned into pCR2.1 (Stratagene). To produce this plasmid, the SV40 late promoter was amplified using the primers SV40-1 and SV40-2 which comprise Sal I cloning sites to facilitate sub- cloning of the amplified DNA fragment into pCMV.cass. The primer also contains a synthetic poly (A) site at the 5' end, such that the amplicification product comprises the synthetic poly(A) site at the 5' end of the SV40 promoter sequence.
- the BEV RNA-dependent RNA polymerase coding region was amplified as a 1 ,385 bp DNA fragment from a full-length cDNA clone encoding same, using primers designated BEV-1 and BEV-2, under standard amplification conditions.
- the amplified DNA contained a 5'-Bgl II restriction enzyme site, derived from the BEV-1 primer sequence and a 3' ⁇ amHI restriction enzyme site, derived from the BEV-2 primer sequence.
- the BEV-1 primer sequence contains a translation start signal 5'-ATG-3' engineered at positions 15-17, the amplified BEV polymerase 46 -
- the amplified BEV polymerase structural gene comprises the start site in-frame with BEV polymerase-encoding nucleotide sequences,
- the amplified BEV polymerase structural gene comprises the ATG start codon immediately upstream (ie. juxtaposed) to the BEV polymerase- encoding sequence.
- This plasmid is present as Figure 9.
- the complete BEV polymerase coding region was amplified from a full-length cDNA clone encoding same, using primers BEV-1 and BEV-3.
- Primer BEV-3 comprises a BamHl restriction enzyme site at positions 5 to 10 inclusive and the complement of a translation stop signal at positions 11 to 13.
- an open reading frame comprising a translation start signal and translation stop signal, contained between the Bgl II and BamHl restriction sites.
- the amplified fragment was cloned into pCR2J (Stratagene) to produce plasmid pCR2.BEV.2 ( Figure 10).
- a non-translatable BEV polymerase structural gene was amplified from a full-length BEV polymerase cDNA clone using the amplification primers BEV-3 and BEV-4.
- Primer BEV-4 comprises a Bglll cloning site at positions 5-10 and sequences downstream of this Bglll site are homologous to nucleotide sequences of the BEV polymerase gene.
- the BEV polymerase is expressed as part of a polyprotein and, as a consequence, there is no ATG translation start site in this gene.
- the amplified DNA was cloned into plasmid pCR2.1 (Stratagene) to yield plasmid pCR.BEV.3 ( Figure 11).
- Plasmid pCMV.EGFP.BEV2 ( Figure 12) was produced by cloning the BEV polymerase sequence from pCR.BEV.2 as a Bglll/BamHI fragment into the BamHl site of pCMV.EGFP. 47
- Plasmid pCMV.BEV.2 ( Figure 13) is capable of expressing the entire BEV polymerase open reading frame under the control of CMV-IE promoter sequence.
- the BEV polymerase sequence from pCR.BEV.2 was sub-cloned in the sense orientation as a Bg/ll-to-SamHI fragment into Sg/ll/SamHI-digested pCMV.cass ( Figure 2).
- Plasmid pCMV.BEV.3 ( Figure 14) expresses a non-translatable BEV polymerase structural gene in the sense orientation under the control of the CMV-IE promoter sequence.
- the BEV polymerase sequence from pCR.BEV.3 was sub-cloned in the sense orientation as a Sg/ll-to-SamHI fragment into Bg/ll/ ⁇ amHI-digested pCMV.cass ( Figure 2).
- Plasmid pCMV.VEB ( Figure 15) expresses an antisense BEV polymerase mRNA under the control of the CMV-IE promoter sequence.
- the BEV polymerase sequence from pCR.BEV.2 was sub-cloned in the antisense orientation as a Sg/ll-to-SamHI fragment into ⁇ g/ll/SamHI-digested pCMV.cass ( Figure 2).
- Plasmid pCMV.BEV.GFP ( Figure 16) was constructed by cloning the GFP fragment from pCR.Bgl-GFP-Bam as a Bglll/BamHI fragment into BamHI-digested pCMV.BEV.2. This plasmid serves as a control in some experiments and also as an intermediate construct.
- Plasmid pCMV.BEV.SV40-L ( Figure 17) comprises a translatable BEV polymerase 48 -
- the BEV polymerase structural gene was sub-cloned as a Bg/ll-to-BamHI fragment into Bg/ll-digested pCMV.SV40L.cass DNA.
- Plasmid pCMV.O.SV40L.BEV ( Figure 18) comprises a translatable BEV polymerase structural gene derived from plasmid pCR.BEV.2 cloned downstream of tandem CMV- IE promoter and SV40 late promoter sequences present in plasmid pCMV.SV40L.cass.
- the BEV polymerase structural gene was sub-cloned in the sense orientation as a Bg/ll-to-BamHI fragment into BamHI-digested pCMV.SV40L.cass DNA.
- Plasmid pCMV.O.SV40L.VEB ( Figure 19) comprises an antisense BEV polymerase structural gene derived from plasmid pCR.BEV.2 cloned downstream of tandem CMV- IE promoter and SV40 late promoter sequences present in plasmid pCMV.SV40L.cass.
- the BEV polymerase structural gene was sub-cloned in the antisense orientation as a Bg/ll-to-BamHI fragment into BamHI-digested pCMV.SV40L.cass DNA.
- Plasmid pCMV.BEVx2 ( Figure 20) comprises a direct repeat of a complete BEV polymerase open reading frame under the control of the CMV-IE promoter sequence. In eukaryotic cells at least, the open reading frame located nearer the CMV-IE promoter is translatable.
- the BEV polymerase structural gene from plasmid pCR.BEV.2 was sub-cloned in the sense orientation as a Bg/ll-to- BamHl fragment into BamHI-digested pCMV.BEV.2, immediately downstream of the 49 -
- Plasmid pCMV.BEVx3 ( Figure 21) comprises a direct repeat of three complete BEV polymerase open reading frames under the control of the CMV-1E promoter.
- the BEV polymerase fragment from pCR.BEV.2 was cloned in the sense orientation as a Bglll/BamHI fragment into the BamHl site of pCMV.BEVx2, immediately downstream of the BEV polymerase sequences already present therein.
- Plasmid pCMV.BEVx4 ( Figure 22) comprises a direct repeat of four complete BEV polymerase open reading frames under the control of the CMV-1 E promoter.
- the BEV polymerase fragment from pCR.BEV.2 was cloned in the sense orientation as a Bglll/BamHI fragment into the BamHl site of pCMV.BEVx3, immediately downstream of the BEV polymerase sequences already present therein.
- Plasmid pCMV.BEV.SV40L.BEV comprises a multiple structural gene unit comprising two BEV polymerase structural genes placed operably and separately under control of the CMV-IE promoter and SV40 late promoter sequences.
- the translatable BEV polymerase structural gene present in pCR.BEV.2 was sub-cloned in the sense orientation as a Bg/ll-to- BamHl fragment behind the SV40 late promoter sequence present in BamHI-digested pCMV.BEV.SV40L-O.
- Plasmid pCMV.BEV.SV40L.VEB ( Figure 24) comprises a multiple structural gene unit comprising two BEV polymerase structural genes placed operably and separately - 50 -
- the translatable BEV polymerase structural gene present in pCR.BEV.2 was sub-cloned in the antisense orientation as a Bg/ll-to- BamHI fragment behind the SV40 late promoter sequence present in BamHI-digested pCMV.BEV.SV40L-O.
- the BEV polymerase structural gene is expressed in the sense orientation under control of the CMV-IE promoter to produce a translatable mRNA, whilst the BEV polymerase structural gene is also expressed under control of the SV40 promoter to produce an antisense mRNA species.
- Plasmid pCMV.BEV.GFP.VEB ( Figure 25) comprises a BEV structural gene inverted repeat or palindrome, interrupted by the insertion of a GFP open reading frame (stuffer fragment) between each BEV structural gene sequence in the inverted repeat.
- the GFP stuffer fragment from pCR.Bgl-GFP- Bam was first sub-cloned in the sense orientation as a Bg/ll-to-BamHI fragment into BamHI-digested pCMV.BEV.2 to produce an intermediate plasmid pCMV.BEV.GFP wherein the BEV polymerase-encoding and GFP-encoding sequences are contained within the same 5'-Bg/ll-to-BamHI-3' fragment.
- the BEV polymerase structural gene from pCMV.BEV.2 was then cloned in the antisense orientation as a Bg/ll-to-BamHI fragment into BamHI-digested pCMV.BEV.GFP.
- the BEV polymerase structural gene nearer the CMV-IE promoter sequence in plasmid pCMV.BEV.GFP.VEB is capable of being translated, at least in eukaryotic cells.
- Plasmid pCMV.EGFP.BEV2.PFG ( Figure 26) comprise a GFP palindrome, interrupted by the insertion of a BEV polymerase sequence between each GFP structural gene in the inverted repeat. To produce this plasmid the GFP fragment from pCR.Bgl-GFP- Bam was cloned as a Bglll/BamHI fragment into the BamHl site of pCMV.EGFP.BEV2 in the antisense orientation relative to the CMV promoter. - 51 -
- Plasmid pCMV.BEV.SV40LR ( Figure 27) comprises a structural gene comprising the entire BEV polymerase open reading frame placed operably and separately under control of opposing CMV-IE promoter and SV40 late promoter sequences, thereby potentially producing BEV polymerase transcripts at least from both strands of the full- length BEV polymerase structural gene.
- the translatable BEV polymerase structural gene present in pCR.BEV.2 was sub-cloned, as a Bg/ll-to-BamHI fragment, into the unique Bglll site of plasmid pCMV.SV40LR.cass, such that the BEV open reading frame is present in the sense orientation relative to the CMV-IE promoter sequence.
- EXAMPLE 2 Genetic constructs comprising the porcine ⁇ -1,3-galactosyltransferase (Gait) structural gene sequence or sequences operably connected to the CMV promoter sequence and/or the SV40L promoter sequence
- Plasmid pcDNA3 is commercially available from Invitrogen and comprises the CMV-IE promoter and BGHpA transcription terminator, with multiple cloning sites for the insertion of structural gene sequences there between.
- the plasmid further comprises the ColE1 and fl origins of replication and neomycin-resistance and ampiciliin- resistance genes.
- Plasmid pcDNA3.Galt (BresaGen Limited, South Australia, Australia; Figure 28) is plasmid pcDNA3 (Invitrogen) and comprises the cDNA sequence encoding porcine gene alpha-1,3-galactosyltransferase (Gait) operably under the control of the CMV-IE promoter sequence such that it is capable of being expressed therefrom.
- porcine gene alpha-1 ,3-galactosyltransferase cDNA was cloned as an EcoRI fragment into the EcoRI cloning site of pcDNA3.
- the plasmid further comprises the ColE1 and fl origins of replication and the neomycin and ampiciliin-resistance genes.
- Plasmid pCMV.Galt ( Figure 29) is capable of expressing the Gait structural gene under the control of the CMV-IE promoter sequence.
- Gait sequence from plasmid pcDNA3.Galt was excised as an EcoRI fragment and cloned in the sense orientation into the EcoRI site of plasmid pCMV.cass ( Figure 2).
- Plasmid pCMV.EGFP.Galt ( Figure 30) is capable of expressing the Gait structural gene as a Gait fusion polypeptide under the control of the CMV-IE promoter sequence.
- the Gait sequence from pCMV.Galt ( Figure 29) was excised as a Bglll/BamHI fragment and cloned into the BamHl site of pCMV.EGFP.
- Plasmid pCMV.Galt.GFP ( Figure 31) was produced by cloning the Gait cDNA as an EcORI fragment from pCDNA3 into EcoRI-digested pCMV.EGFP in the sense orientation. This plasmid serves as both a control and construct intermediate. 53
- the plasmid pCMV.Galt.SV40L.0 ( Figure 32) comprises a Gait structural gene cloned downstream of the CMV promoter present in pCMV.SV40L.cass.
- the Gait cDNA fragment from pCMV.Galt was cloned as a Bglll/BamHI into Bglll-digested pCMV.SV40L.cass in the sense orientation.
- the plasmid pCMV.O.SV40L.tlaG ( Figure 33) comprises a Gait structural gene clones in an antisense orientation downstream of the SV40L promoter present in pCMV.SV40L.cass.
- the Gait cDNA fragment from pCMV.Galt was cloned as a Bglll/BamHI into BamHI-digested pCMV.SV40L.cass in the antisense orientation.
- Plasmid pCMV.O.SV40L.Galt ( Figure 34) comprises a Gait structural gene cloned downstream of the SV40L promoter present in pCMV.SV40L.cass. To produce the plasmid the Gait cDNA fragment from pCMV.Galt was cloned as a Bglll/BamHI into BamHI-digested pCMV.SV40L.cass in the sense orientation.
- Plasmid pCMV.Galtx2 ( Figure 35) comprises a direct repeat of a Gait open reading frame under the control of the CMV-IE promoter sequence. In eukaryotes cells at least, the open reading frame located nearer the CMV-IE promoter is translatable.
- the Gait structural gene from pCMV.Galt was excised as a Bglll/BamHI fragment and cloned in the sense orientation into the BamHl cloning site of pCMV.Galt.
- Plasmid pCMV.Galtx4 ( Figure 36) comprises a quadruple direct repeat of a Gait open - 54 -
- the Galtx2 sequence from pCMV.Galtx2 was excised as a Bglll/BamHI fragment and cloned in the sense orientation into the BamHl cloning site of pCMV.Galtx2.
- the plasmid pCMV.Galt.SV40L.Galt ( Figure 37) is designed to express two sense transcripts of Gait, one driven by the CMV promoter, the other by the SV40L promoter.
- a Gait cDNA fragment from pCMV.Galt was cloned as a
- the plasmid pCMV.Galt.SV40.tlaG ( Figure 38) is designed to express a sense transcript of Gait driven by the CMV promoter and an antisense transcript driven by the SV40L promoter.
- a Gait cDNA fragment from pCMV.Galt was cloned as a Bglll/BamHI fragment into Bglll-digested pCMV.O.SV40.talG in the sense orientation.
- Plasmid pCMV.Galt.GFP.tlaG ( Figure 39) comprise a Gait palindrome, interrupted by the insertion of a GFP sequence between each Gait structural gene in the inverted repeat.
- the Bglll/BamHI Gait cDNA fragment from pCMV.Galt was cloned into the BamHl site of pCMV.Galt.GFP in the antisense relative to the CMV promoter.
- the plasmid pCMV.EGFP.Galt.PFG ( Figure 40) comprises a GFP palindrome, interrupted by the insertion of a Gait sequence between each GFP structural gene of the inverted repeat, expression of which is driven by the CMV promoter.
- this plasmid the Gait sequences from pCMV.Galt were cloned as a Bglll/BamHI fragment into BamHI-digested pCMV.EGFP in the sense orientation to produce the intermediate pCMV.EGFP.Galt (not shown); following this further GFP sequences from pCR.Bgl-pCMV.EGFP.Galt in the antisense orientation.
- the plasmid pCMV.Galt.SV40LR ( Figure 41) is designed to express GalT cDNA sequences cloned between the opposing CMV and SV40L promoters in the expression cassette pCMV.SV40LR.cass.
- To produce this plasmid Gait sequences from pCMV.Galt were cloned as a Bglll/BamHI fragment in Bg Ill-digested pCMV.SV40LR.cass in the sense orientation relative to the 35S promoter.
- EXAMPLE 3 Genetic constructs comprising PVY Nia sequences operably linked to the35S promoter sequence and/or the SCBV promoter sequence
- Plasmid pART27 is a binary vector, specifically designed to be compatible with the pART7 expression cassette. It contains bacterial origins of replication for both E. coli and Agrobacterium tumefaciens, a spectinomycin resistance gene for bacterial selection, left and right T-DNA borders for transfer of DNA from Agrobacterium to plant cells and a kanamycin resistance cassette to permit selection of transformed plant cells.
- the kanamycin resistance cassette is located between the T-DNA borders
- pART27 also contains a unique NotI restriction site which permits cloning of constructs prepared in vectors such as pART7 to be cloned between the T-DNA borders. Construction of pART27 is described in Gleave, AP (1992).
- 35S promoter in the described pART7 constructs was chosen; this was done to minimise any experimental artefacts that may arise from comparing different constructs with different insert orientations.
- Plasmid pBC Plasmid pBC (KS-)
- Plasmid pBC (KS-) is commercially available from Stratagene and comprises the LacZ promoter sequence and lacZ-alpha transcription terminator, with a multiple cloning site for the insertion of structural gene sequences therein.
- the plasmid further comprises the ColE1 and fl origins of replication and a chloroamphenicol-resistance gene.
- Plasmid pSP72 is commercially available from Promega and contains a multiple cloning site for the insertion of structural gene sequences therein.
- the plasmid further comprises the ColE1 origin of replication and an ampiciliin-resistance gene.
- Plasmid pART7 is an expression cassette designed to drive expression of sequences cloned behind the 35S promoter. It contains a polylinkerto assist cloning and a region of the octipine synthase terminator.
- the 35S expression cassette is flanked by two Not I restriction sites which permits cloning into binary expression vectors, such as pART27 which contains a unique NotI site. Its construction as described in Gleave, AP (1992), a map is shown in Figure 43.
- Plasmid p35S.CMV.cass was designed to express two separate gene sequences cloned into a single plasmid. To create this plasmid, sequences corresponding to the nos terminator and the SCBV promoter were amplified by PCR then cloned in the polylinker of pART7 between the 35S promoter and OCS. - 57 -
- the resulting plasmid has the following arrangement of elements:
- sequences cloned into polylinker 1 is controlled by the 35S promoter
- expression of sequences cloned into polylinker 2 is controlled by the SCBV promoter.
- NOS terminator sequences were amplified from the plasmid pAHC27 (Christensen and Quail, 1996) using the two oligonucleotides;
- Nucleotide residues 1 to 17 for NOS 5' and 1 to 15 for NOS 3' represent additional nucleotides designed to assist in construct preparation by adding additional restriction sites.
- Nucleotide residues 1 to 17 for NOS 5' and 1 to 15 for NOS 3' represent additional nucleotides designed to assist in construct preparation by adding additional restriction sites.
- For NOS 5' these are BamHl, Smal, Aatll and the first 4 bases of an Nrul site, for NOS 3' these are Ncol and Sfil sites.
- the remaining sequences for each oligonucleotide are homologous to the 5' and 3' ends respectively of NOS sequences in pAHC 27.
- SCBV promoter sequences were amplified from the plasmid pScBV-20 (Tzafir et al, 1998) using the two oligonucleotides:
- SCBV 5' 5'-CCATGGCCTATATGGCCATTCCCCACATTCAAG-3';
- SCBV 3' 5'-AACGTTAACTTCTACCCAGTTCCAGAG-3' 58
- Nucleotide residues 1 to 17 of SCBV 5' encode Ncol and Sfil restriction sites designed to assist in construct preparation, the remaining sequences are homologous to upstream sequences of the SCMV promoter region.
- Nucleotide residues 1 to 9 of SCBV 3' encode Psp10461 and Hpal restriction sites designed to assist in construct preparation, the remaining sequences are homologous to the reverse and complement of sequences near the transcription initiation site of SCBV.
- a region of the PVY genome was amplified by PCR using reverse-transcribed RNA isolated from PVY-infected tobacco as a template using standard protocols and cloned into a plasmid pGEM 3 (Stratagene), to create pGEM.PVY.
- pGEM 3 (Stratagene)
- a Sall/Hindlll fragment from pGEM.PVY, corresponding to a Sall/Hindlll fragment positions 1536-2270 of the PVY strain O sequence was then subcloned into the plasmid pBC (Stratagene Inc.) to create pBC.PVY ( Figure 44).
- Plasmid pSP72.PVY was prepared by inserting an EcoRI/Sall fragment from pBC.PVY into EcoRI/Sall cut ⁇ SP72 (Promega). This construct contains additional restriction sites flanking the PVY insert which were used to assist subsequent manipulations. A map of this construct is shown in Figure 45.
- Plasmid ClapBC.PVY Plasmid Cla pBC.PVY was prepared by inserting a Clal/Sall fragment from pSP72.PVY - 59 -
- Plasmid pBC.PVYx2 contains two direct head-to-tail repeats of the PVY sequences derived from pBC.PVY.
- the plasmid was generated by cloning an Accl/Clal PVY fragment from pSP72.PVY into Accl cut pBC.PVY and is shown in Figure 47.
- Plasmid pSP72.PVYx2 contains two direct head-to-tail repeats of the PVY sequences derived from pBC.PVY.
- the plasmid was generated by cloning an Accl/Clal PVY fragment from pBc.PVY into Accl cut pSP72.PVY and is shown in Figure 48.
- Plasmid pBC.PVYx3 contains three direct head-to-tail repeats of the PVY sequences derived from pBC.PVY.
- the plasmid was prepared by cloning an Accl/Clal PVY fragment from pSP72.PVY into Accl cut pBC.PVYx2 and is shown in Figure 49.
- Plasmid pBC.PVYx4 contains four direct head-to-tail repeats of the PVY sequences derived from pBC.PVY.
- the plasmid was prepared by cloning the direct repeat of PVY sequences from pSP72.PVYx2 as an Accl/Clal fragment into Accl cut pBC.PVYx2 and is shown in Figure 50.
- the first 9 nucleotide of these primers encode a BamHl site, the remaining nucleotides are homologous to sequences of the LNYV 4b gene.
- the plasmid pBC.PVY. LNYV. YVP contains an interrupted direct repeat of PVY sequences, to create this plasmid a Hpal/Hincll fragment from pSP72 was cloned into Smal-digested pBC.PVY.LNYV and a plasmid containing the sense orientation isolated, a map of this construct is shown in Figure 52.
- the plasmid PBV.PVY.LNYV.YVP ⁇ contains a partial interrupted palindrome of PVY sequences.
- One arm of the palindrome contains all the PVY sequences from pBC.PVY, the other arm contains part of the sequences from PVY, corresponding to sequences between the EcoRV and Hindi sites of pSP72.PVY.
- Plasmid pBC.PVY.LNYV. YVP contains an interrupted palindrome of PVY sequences.
- a Hpal/Hincll fragment from pSP72. was cloned into Sma-digested pBC.PVY.LNYV and a plasmid containing the antisense orientation isolated, a map of this construct is shown in Figure 54.
- Plasmid pART7.PVY ( Figure 55) was designed to express PVY sequences driven by the 35S promoter. This plasmid serves as a control construct in these experiments, against which all other constructs was compared. To generate this plasmid a Clal/Accl fragment from ClapBC.PVY was cloned into Clal-digested pART7 and a plasmid with expected to express a sense PVY sequence with respect to the PVY genome, was selected.
- Plasmid pART7.35S.PVY.SCBV.O ( Figure 56) was designed to act as a control for co- expression of multiple constructs from a single plasmid in transgenic plants.
- the 35S promoter was designed to express PVY sense sequences, whilst the SCBV promoter was empty.
- the PVY fragment from Cla pBC.PVY was cloned as a Xhol/EcoRI fragment into Xhol/EcoRI-digested pART7.35S.SCBV.cass to create p35S.PVY.SCBV>O.
- Plasmid pART27.35S.O.SCBV.PVY ( Figure 57) was designed to act as an additional control for co-expression of multiple constructs from a single plasmid in transgenic plants. No expressible sequences were cloned behind the 35S promoter, whilst the SCBV promoter drove expression of a PVY sense fragment. To generate this plasmid, the PVY fragment from Cla pBC.PVY was cloned as a Clal fragment into Clal-digested pART7.35S.SCBV.cass, a plasmid containing PVY sequences in a sense orientation was isolated and designated p35S.O.SCBV.PVY.
- Plasmids pART7.35S.O.SCBV.YVP & pART7.35S.O.SCBV.YVP Plasmid pART7.35S.O.SCBV.YVP ( Figure 58) was designed to act as an additional control for co-expression of multiple constructs from a single plasmid in transgenic plants. No expressible sequences were cloned behind the 35S promoter, whilst the SCBV promoter drove expression of a PVY antisense fragment.
- the PVY fragment from Cla pBC.PVY was cloned as a Clal fragment into Clal- digested p35S.SCBV.cass, a plasmid containing PCY sequences in an antisense orientation was isolated and designated p35S.O.SCBV.YVP.
- Sequences, consisting of the 35S promoter and NOS terminator, the SCBV promoter driving sense PVY sequences and the OCS terminator were excised as a NotI fragment and cloned into pART27, a plasmid with the desired insert orientation was isolated and designated pART27.35S.O.SCBV.YVP.
- Plasmid pART7.PVYx2 ( Figure 59) was designed to express a direct repeat of PVY sequences driven by the 35S promoter in transgenic plants. To generate this plasmid, direct repeats from pBC.PVYx2 were cloned as a Xhol/BamHI fragment into Xhol/BamHI cut pART7. Sequences consisting of the 35 S promoter, direct repeats of PVY and the OCS terminator were excised as a NotI fragment from pART7.PVYx2 and cloned into Notl-digested pART27, a plasmid with the desired insert orientation was selected and designated pART27.PVYx2.
- Plasmid pART7.PVYx3 & pART27.PVYx3 Plasmid pART7.PVYx3 ( Figure 60) was designed to express a direct repeat of three PVY sequences driven by the 35S promoter in transgenic plants. To generate this plasmid, direct repeats from pBC.PVYx3 were cloned as a Xhol/BamHI fragment into Xhol/BamHI cut pART7.
- Plasmid pART7.PVYx4 ( Figure 61) was designed to express a direct repeat of four PVY sequences driven by the 35S promoter in transgenic plants. To generate this plasmid, direct repeats from pBC.PVYx4 were cloned as a Xhol/BamHI fragment into xhol/BamHI cut pART7. Sequences consisting of the 35S promoter, direct repeats of PVY and the OCS terminator were excised as a NotI fragment from pART7.PVYx3 and cloned into Notl-digested pART27, a plasmid with the desired insert orientation was selected and designated pART27.PVYx3.
- Plasmid pART7. PVY. LNYV. PVY ( Figure 62) was designed to express the interrupted direct repeat of PVY sequences driven by the 35S promoter in transgenic plants. This construct was prepared by cloning the interrupted direct repeat of PVY from 64 -
- Plasmid pART7. PVY. LNYV. YVP ⁇ ( Figure 63) was designed to express the partial interrupted palindrome of PVY sequences driven by the 35S promoter in transgenic plants. This construct was prepared by cloning the partial interrupted palindrome of PVY sequences from pBC.PVY. LNYV. YVP ⁇ as a Xhol/Xbal fragment into pART7 digested with Xhol/Xbal. Sequences consisting of the 35S promoter, the partial interrupted palindrome of PVY sequences and the OCS terminator were excised from pART7. PVY. LNYV. YVP ⁇ as a NotI fragment and cloned into Notl-digested pART27, a plasmid with the desired insert orientation was selected and designated pART27. PVY. LNYV. YVP.
- Plasmid pART7. PVY. LNYV. YVP ( Figure 64) was designed to express the interrupted palindrome of PVY sequences driven by the 35S promoter in transgenic plants. This construct was prepared by cloning the interrupted palindrome of PVY sequences from PBC.PVY.LNYV.YVP ⁇ as a Xhol/Xbal fragment into pART7 digested with Xhol/Xbal. Sequences consisting of the 35S promoter, the interrupted palindrome of PVY sequences and the OCS terminator were excised from pART7.PVY.LNYV. YVP as a NotI fragment and cloned into ⁇ ART27, a plasmid with the desired insert orientation was selected and designated pART27. PVY. LNYV. YVP.
- Plasmid pART7.35S. PVY. SCBV. YVP ( Figure 65) was designed to co-express sense and antisense constructs in transgenic plants. To generate this plasmid the PVY 65
- Plasmid pART7.35S.PVYx3.SCBV.YVPx3 ( Figure 66) was designed to co-express sense and antisense repeats of PVY in transgenic plants, to generate this plasmid, the intermediate pART7.35S.O.SCBV.YVPx3 was constructed by cloning the triple direct PVY repeat from ClapBC.PVYx3 as a Clal/Accl fragment into Cla-digested p35S.SCBV.cass and isolating a plasmid with an antisense orientation, for p35S.PVYx3.SCBV.YVPx3 the triple direct PVY repeat from Cla pBC.PVYx3 was cloned as a KpnI/Smal fragment into KpnI/Smal-digested p35S.O.SCBV.YVPx3 to create p35S.PVYx3.SCBV.YVPx3.
- Plasmids pART7.PVYx3.LNYV.YVPx3 & pART27.PVYx3.LNYV.YVPx3 Plasmid pART7.PVYx3.LNYV.YVPx3 ( Figure 67) was designed to express triple repeats of PVY sequences as an interrupted palindrome. To generate this plasmid an intermediate, pART7x3. PVY. LNYV. YV was constructed by cloning a PVY.LNYV.YVP fragment from pBC.PVY. LNYV. YVP as an Accl/Clal fragment into the plasmid pART7.PVYx2.
- pART7.35S.PVYx3.LNYV.YVPx3 was made by cloning an additional PVY direct repeat from pBC.PVYx2 as an Accl/Clal fragment into Clal digested pART7x3.PVY.LNYV.YVP. Sequences from pART7.35S.PVYx3.LNYV.YVPx3, including the 35S promoter, all PVY sequences and the OCS terminator were excised as a NotI fragment and cloned into Notl-digested pART27, a plasmid with an - 66 -
- Plasmid pART7.35S.PVY multi ( Figure 68) was designed to express higher order direct repeats of regions of PVY sequences in transgenic plants. Higher order direct repeats of a 72 bp of the PVY Nia region from PVY were prepared by annealing two partially complementary oligonucleotides as follows:
- PVY1 5'-TAATGAGGATGATGTCCCTACCTTTAATTGGCAGAAATTTCTGTGGAAAGACAG GGAAATCTTTCGGCATTT-3';
- PVY2 ⁇ '-TTCTGCCAATTAAAGGTAGGGACATCATCCTCATTAAAATGCCGAAAGATT TCCCTGTCTTTCCACAGAAAT-3'
- oligonucleotides were phosphorylated with T4 polynucleotide kinase, heated and cooled slowly to permit self-annealing, ligated with T4 DNA ligase, end-filled with Klenow polymerase and cloned into pCR2.1 (Invitrogen). Plasmids containing multiple repeats were isolated and sequences were cloned as EcoRI fragments in a sense orientation into EcoRI-digested pART7, to create the intermediate pART7.PVY multi. to create pART27.PVY multi, the 35S promoter, PVY sequences and the OCS terminator were excised as a NotI fragment and cloned into Notl-digested pART27. A plasmid with an appropriate insert orientation was isolated and designated pART27. PVY multi. - 67 -
- Viral immune lines are created by expressing viral sequences in stably transformed cell lines.
- lytic viruses are used for this approach since cell lysis provides very simple screens and also offer the ability to directly select for potentially rare transformation events which might create viral immunity.
- Sub-genomic fragments derived from a simple single stranded RNA virus (Bovine enterovirus - BEV) or a complex double stranded DNA virus, Herpes Simplex Virus I (HSV I) are cloned into a suitable vector and expressed in transformed cells.
- Mammalian cell lines are transformed with genetic constructs designed to express viral sequences driven by the strong cytomegalovirus (CMV-IE) promoter. Sequences utilised include specific viral replicase genes. Random "shotgun" libraries comprising representative viral gene sequences, may also be used and the introduced dispersed nucleic acid molecule, to target the expression of virus sequences.
- CMV-IE cytomegalovirus
- Exemplary genetic constructs for use in this procedure comprising nucleotide sequences derived from the BEV RNA-dependent RNA polymerase gene, are presented herein.
- Resistant cell lines are supportive of the ability of the introduced nucleotide sequences to inactivate viral gene expression in a mammalian system. - 68 -
- resistant lines obtained from such experiments are used to more precisely define molecular and biochemical characteristics of the modulation which is observed.
- PVYx3.SCBV.YPVx3, pART27.PVYx3.LNYV.YVPx3 and pART27.PVYx10 using tri-parental matings. DNA mini-preps from these strains were prepared and examined by restriction with NotI to ensure they contained the appropriate binary vectors.
- Nicotiana tabaccum (cultivar W38) were transformed with these Agrobactehum strains using standard procedures. Putative transformed shoots were excised and rooted on media containing kanamycin. Under these conditions we have consistently observed that only transgenic shoots will root on kanamycin plates. Rooted shoots were transferred to soil and allowed to establish. After two to three weeks, vigorous plants with at least three sets of leaves were chosen and infected with PVY.
- Viral inoculum was prepared from W38 tobacco previously infected with the virus, approximately 2 g of leaf material, showing obvious viral symptoms were ground with carbarundum in 10 ml of 100mM Na phosphate buffer (pH 7.5). the inoculum was diluted to 200 ml with additional Na phosphate buffer. Two leaves from each transgenic plant were sprinkled with carbarundum, then 0.4 ml of inoculum was applied to each leaf and leaves rubbed fairly vigorously with fingers. Using this procedure 100% of non-transgenic control plants were infected with PVY. 69
- PVY-D an Australian PVY isolate
- Transgenic lines were described as resistant if they showed reduced viral symptoms, which manifests as a reduction in the leaf are showing chlorotic lesions. Resistance ranges from very strong resistance where only a few viral lesions are observed on a plant to weak resistance which manifects as reduced symptoms on leaves that develop late in plant growth.
- Transgenic plants which showed absolutely no evidence of viral symptoms were classified as immune. To ensure these plants were immune they were re-inoculated with virus, most plants remained immune, the few that showed symptoms were re- classified as resistant.
- inverted and/or direct repeat sequences modulate expression of the virus target gene in the transgenic plant.
- porcine PK2 cells were transformed with the relevant constructs.
- PK2 cells constitutively express Gait enzyme, the activity of which results in the addition of a variety of ⁇ -1 ,3-galactosyl groups to a range of proteins expressed on the cell surface of these cells.
- Cells were transformed using lipofectin and stably transformed lines were selected using genetecin.
- HBSS/Hepes Hank's buffered saline solution with 20 mM Hepes, pH7.4
- IB4-biotin 10 ug/ml IB4-biotin (Sigma) in HBSS/Hepes for 45 mins at 4°C.
- Cells were washed in HBSS/Hepes, probed with a 1:200 dilution of ExtrAvidin-FITC (Sigma) in HBSS/Hepes for 45 mins at 4°C at and rinsed in cold HBSS/Hepes prior to FACS - 71 -
- transformed cell lines are assayed for Gait inactivation and quantitative assessment of construct effectiveness is determined.
- cell lines showing Gait inactivation are isolated and subject to further molecular analyses to determine the mechanism of gene inactivation.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Cell Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Saccharide Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Priority Applications (22)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020067005341A KR101085210B1 (ko) | 1998-03-20 | 1999-03-19 | 유전자 발현 조절방법 |
| EP07008204.5A EP1857549B1 (en) | 1998-03-20 | 1999-03-19 | Control of gene expression |
| SG200205122A SG115493A1 (en) | 1998-03-20 | 1999-03-19 | Control of gene expression |
| AU29163/99A AU743316C (en) | 1998-03-20 | 1999-03-19 | Control of gene expression |
| CA002323726A CA2323726C (en) | 1998-03-20 | 1999-03-19 | Control of gene expression |
| HU0101225A HU230353B1 (hu) | 1998-03-20 | 1999-03-19 | A génexpresszió szabályozása |
| KR1020107006892A KR101054060B1 (ko) | 1998-03-20 | 1999-03-19 | 유전자 발현 조절방법 |
| SK1372-2000A SK287538B6 (sk) | 1998-03-20 | 1999-03-19 | Syntetický gén obsahujúci dispergovanú alebo cudzorodú deoxyribonukleovú molekulu, génový konštrukt obsahujúci tento syntetický gén a prípravok obsahujúci tento syntetický gén |
| EP10183258.2A EP2302057B1 (en) | 1998-03-20 | 1999-03-19 | Control of gene expression |
| JP2000537990A JP4187413B2 (ja) | 1998-03-20 | 1999-03-19 | 遺伝子発現の制御 |
| EP99910039A EP1071762A4 (en) | 1998-03-20 | 1999-03-19 | CONTROL OF GENE EXPRESSION |
| PL99343064A PL343064A1 (en) | 1998-03-20 | 1999-03-19 | Control of gene expression |
| KR1020007010419A KR20010042069A (ko) | 1998-03-20 | 1999-03-19 | 유전자 발현 조절방법 |
| HK01105904.3A HK1035742B (en) | 1998-03-20 | 1999-03-19 | Control of gene expression |
| GB0024727A GB2353282C (en) | 1998-03-20 | 1999-03-19 | Control of gene expression |
| BRPI9908967A BRPI9908967B1 (pt) | 1998-03-20 | 1999-03-19 | processos para reprimir, retardar ou de outro modo reduzir a expressão de um gene alvo em uma célula de planta |
| SG200503921-9A SG141233A1 (en) | 1998-03-20 | 1999-03-19 | Control of gene expression |
| NZ506648A NZ506648A (en) | 1998-03-20 | 1999-03-19 | Control of gene expression through introduction of synthetic tandem repeats to reduce translation of mRNA |
| US10/646,070 US7754697B2 (en) | 1998-03-20 | 2003-08-22 | Control of gene expression |
| US11/218,999 US8168774B2 (en) | 1998-03-20 | 2005-09-02 | Control of gene expression |
| US13/458,704 US20120277285A1 (en) | 1998-03-20 | 2012-04-27 | Control of gene expression |
| US14/137,737 US9963698B2 (en) | 1998-03-20 | 2013-12-20 | Control of gene expression |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AUPP2492A AUPP249298A0 (en) | 1998-03-20 | 1998-03-20 | Synthetic genes and genetic constructs comprising same I |
| AUPP2492 | 1998-03-20 | ||
| AUPP2499 | 1998-03-20 | ||
| AUPP2499A AUPP249998A0 (en) | 1998-03-20 | 1998-03-20 | Gene expression I |
| US10081398A | 1998-06-19 | 1998-06-19 | |
| US09/100,812 US6573099B2 (en) | 1998-03-20 | 1998-06-19 | Genetic constructs for delaying or repressing the expression of a target gene |
Related Parent Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09/100,812 Continuation-In-Part US6573099B2 (en) | 1998-03-20 | 1998-06-19 | Genetic constructs for delaying or repressing the expression of a target gene |
| US10081398A Continuation-In-Part | 1998-03-20 | 1998-06-19 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09646807 A-371-Of-International | 2000-12-05 | ||
| US10/646,070 Continuation US7754697B2 (en) | 1998-03-20 | 2003-08-22 | Control of gene expression |
| US11/218,999 Division US8168774B2 (en) | 1998-03-20 | 2005-09-02 | Control of gene expression |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1999049029A1 true WO1999049029A1 (en) | 1999-09-30 |
Family
ID=25645735
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU1999/000195 Ceased WO1999049029A1 (en) | 1998-03-20 | 1999-03-19 | Control of gene expression |
Country Status (20)
| Country | Link |
|---|---|
| US (6) | US20030074684A1 (https=) |
| EP (5) | EP2302057B1 (https=) |
| JP (4) | JP4187413B2 (https=) |
| KR (3) | KR20010042069A (https=) |
| CN (3) | CN101818145A (https=) |
| AT (2) | ATE526406T1 (https=) |
| AU (6) | AU743316C (https=) |
| BR (1) | BRPI9908967B1 (https=) |
| CA (3) | CA2487328A1 (https=) |
| CZ (1) | CZ295108B6 (https=) |
| DK (1) | DK1624060T3 (https=) |
| ES (2) | ES2374290T3 (https=) |
| GB (1) | GB2353282C (https=) |
| HU (1) | HU230353B1 (https=) |
| NZ (2) | NZ506648A (https=) |
| PL (1) | PL343064A1 (https=) |
| SG (2) | SG141233A1 (https=) |
| SK (1) | SK287538B6 (https=) |
| WO (1) | WO1999049029A1 (https=) |
| ZA (1) | ZA200004507B (https=) |
Cited By (237)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000068374A1 (en) * | 1999-05-10 | 2000-11-16 | Syngenta Participations Ag | Regulation of viral gene expression |
| WO2003070918A2 (en) | 2002-02-20 | 2003-08-28 | Ribozyme Pharmaceuticals, Incorporated | Rna interference by modified short interfering nucleic acid |
| WO2003076620A1 (en) | 2002-03-14 | 2003-09-18 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for monitoring and modulating gene silencing |
| WO2003070914A3 (en) * | 2002-02-20 | 2003-12-24 | Sirna Therapeutics Inc | RNA INTERFERENCE MEDIATED INHIBITION OF FOS GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| WO2003070966A3 (en) * | 2002-02-20 | 2004-03-11 | Sirna Therapeutics Inc | RNA INTERFERENCE MEDIATED TARGET DISCOVERY AND TARGET VALIDATION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| WO2004041838A1 (en) * | 2002-11-01 | 2004-05-21 | University Of Massachusetts | Regulation of transcription elongation factors |
| WO2003070972A3 (en) * | 2002-02-20 | 2004-06-03 | Ribozyme Pharm Inc | RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| EP1445321A1 (en) | 2002-12-18 | 2004-08-11 | Monsanto Technology LLC | Maize embryo-specific promoter compositions and methods for use thereof |
| US6777588B2 (en) | 2000-10-31 | 2004-08-17 | Peter Waterhouse | Methods and means for producing barley yellow dwarf virus resistant cereal plants |
| EP1516931A2 (en) | 1998-05-26 | 2005-03-23 | Syngenta Participations AG | DSRNA-mediated regulation of gene expression in plants |
| WO2005028649A1 (en) | 2002-02-20 | 2005-03-31 | Sirna Therapeutics, Inc. | RNA INTERFERENCE MEDIATED INHIBITION OF VASCULAR ENDOTHELIAL GROWTH FACTOR AND VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| AU781598B2 (en) * | 1999-04-21 | 2005-06-02 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for inhibiting the function of polynucleotide sequences |
| US6907887B2 (en) | 2001-06-08 | 2005-06-21 | Vector Tobacco Ltd. | Modifying nicotine and nitrosamine levels in tobacco |
| US6911541B2 (en) | 2000-08-30 | 2005-06-28 | North Carolina State University | Promoter fragment that is recognized by the product of the tobacco Nic gene |
| EP1550719A1 (de) * | 1999-01-30 | 2005-07-06 | Alnylam Europe AG | Verfahren und Medikament zur Hemmung der Expression eines vorgegebenen Gens |
| WO2005060739A1 (en) | 2003-12-24 | 2005-07-07 | G2 Inflammation Pty Ltd | Transgenic non-human mammal comprising a polynucleotide encoding human or humanized c5ar |
| US6933146B2 (en) | 2001-01-26 | 2005-08-23 | Commonwealth Scientific And Industrial Research Corporation | Methods and means for producing efficient silencing construct using recombinational cloning |
| WO2005077116A2 (en) | 2004-02-10 | 2005-08-25 | Mosanto Technology, Llc | Recombinant dna for gene suppression |
| WO2005081714A2 (en) | 2003-11-21 | 2005-09-09 | Revivicor, Inc. | Use of interfering rna in the production of transgenic animals |
| WO2005110068A2 (en) | 2004-04-09 | 2005-11-24 | Monsanto Technology Llc | Compositions and methods for control of insect infestations in plants |
| EP1621632A1 (en) | 2004-07-31 | 2006-02-01 | Monsanto Technology, LLC | Genes and uses for plant improvement |
| WO2005087926A3 (en) * | 2004-03-05 | 2006-03-16 | Benitec Inc | Multiple promoter expression cassettes for simultaneous delivery of rnai agents |
| US7022828B2 (en) | 2001-04-05 | 2006-04-04 | Sirna Theraputics, Inc. | siRNA treatment of diseases or conditions related to levels of IKK-gamma |
| WO2006046148A2 (en) | 2004-10-25 | 2006-05-04 | Devgen Nv | Rna constructs |
| US7056704B2 (en) | 2000-12-01 | 2006-06-06 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | RNA interference mediating small RNA molecules |
| US7067722B2 (en) | 1999-08-26 | 2006-06-27 | Monsanto Technology Llc | Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids |
| WO2003070193A3 (en) * | 2002-02-20 | 2006-08-24 | James Mcswiggen | RNA interference mediated inhibition of HIV gene expression using short interfering nucleic acid (siNA) |
| WO2006099249A2 (en) | 2005-03-10 | 2006-09-21 | Monsanto Technology Llc | Maize seed with synergistically enhanced lysine content |
| US7148336B2 (en) | 1999-08-26 | 2006-12-12 | Calgene Llc | Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acid levels |
| WO2006133983A1 (en) | 2005-04-19 | 2006-12-21 | Basf Plant Science Gmbh | Starchy-endosperm and/or germinating embryo-specific expression in mono-cotyledonous plants |
| US7166771B2 (en) | 2002-06-21 | 2007-01-23 | Monsanto Technology Llc | Coordinated decrease and increase of gene expression of more than one gene using transgenic constructs |
| US7189570B2 (en) | 2000-11-07 | 2007-03-13 | North Carolina State University | Putrescine-n-methyltransferase promoter |
| WO2007095469A2 (en) | 2006-02-10 | 2007-08-23 | Monsanto Technology Llc | Identification and use of target genes for control of plant parasitic nematodes |
| US7304220B2 (en) | 1997-06-12 | 2007-12-04 | North Carolina State University | Regulation of quinolate phosphoribosyl transferase expression |
| US7351578B2 (en) | 1999-12-10 | 2008-04-01 | Invitrogen Corp. | Use of multiple recombination sites with unique specificity in recombinational cloning |
| WO2008116094A2 (en) | 2007-03-21 | 2008-09-25 | Brookhaven Science Associates, Llc | Combined hairpin-antisense compositions and methods for modulating expression |
| US7452987B2 (en) | 2002-08-05 | 2008-11-18 | Silence Therapeutics Aktiengesellschaft (Ag) | Interfering RNA molecules |
| EP2003205A2 (en) | 2004-12-28 | 2008-12-17 | Pioneer Hi-Bred International, Inc. | Improved grain quality through altered expression of seed proteins |
| WO2008157263A2 (en) | 2007-06-15 | 2008-12-24 | Arkansas State University | Methods of delivery of molecules to cells using a ricin subunit and compositions relating to same |
| US7473525B2 (en) | 2001-01-09 | 2009-01-06 | Alnylam Europe Ag | Compositions and methods for inhibiting expression of anti-apoptotic genes |
| US7491805B2 (en) | 2001-05-18 | 2009-02-17 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| WO2009021285A1 (en) | 2007-08-13 | 2009-02-19 | Commonwealth Scientific And Industrial Research Organisation | Barley with low levels of hordein |
| WO2009026660A1 (en) | 2007-08-30 | 2009-03-05 | Walter And Eliza Hall Institute Of Medical Research | Dendritic cell marker and uses thereof |
| US7517864B2 (en) | 2001-05-18 | 2009-04-14 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA) |
| US7531718B2 (en) | 1999-08-26 | 2009-05-12 | Monsanto Technology, L.L.C. | Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids |
| US7538095B2 (en) | 1997-12-23 | 2009-05-26 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded RNA |
| WO2009067580A2 (en) | 2007-11-20 | 2009-05-28 | Pioneer Hi-Bred International, Inc. | Maize ethylene signaling genes and modulation of same for improved stress tolerance in plants |
| WO2009067751A1 (en) | 2007-11-27 | 2009-06-04 | Commonwealth Scientific And Industrial Research Organisation | Plants with modified starch metabolism |
| US7560538B2 (en) | 2003-11-05 | 2009-07-14 | University Of Pittsburgh | Porcine isogloboside 3 synthase protein, cDNA, genomic organization, and regulatory region |
| US7566813B2 (en) | 2002-03-21 | 2009-07-28 | Monsanto Technology, L.L.C. | Nucleic acid constructs and methods for producing altered seed oil compositions |
| US7601888B2 (en) | 2002-03-21 | 2009-10-13 | Monsanto Technology L.L.C. | Nucleic acid constructs and methods for producing altered seed oil compositions |
| WO2009129558A1 (en) | 2008-04-24 | 2009-10-29 | Newsouth Innovations Pty Limited | Cyanobacteria saxitoxin gene cluster and detection of cyanotoxic organisms |
| US7612194B2 (en) | 2001-07-24 | 2009-11-03 | Monsanto Technology Llc | Nucleic acid sequences from Diabrotica virgifera virgifera LeConte and uses thereof |
| EP2116607A1 (en) | 2003-03-28 | 2009-11-11 | Monsanto Technology, LLC | Novel plant promoters for use in early seed development |
| WO2010005527A1 (en) | 2008-06-30 | 2010-01-14 | Angioblast Systems, Inc. | Treatment of eye diseases and excessive neovascularization using a combined therapy |
| WO2010009499A1 (en) | 2008-07-21 | 2010-01-28 | Commonwealth Scientific And Industrial Research Organisation | Improved cottonseed oil and uses |
| US7659390B2 (en) | 2002-02-20 | 2010-02-09 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of muscarinic colinergic receptor gene expression using short interfering nucleic acid (siNA) |
| US7659389B2 (en) | 2001-05-18 | 2010-02-09 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of MYC and/or MYB gene expression using short interfering nucleic acid (siNA) |
| US7662952B2 (en) | 2002-02-20 | 2010-02-16 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acid (siNA) |
| US7662951B2 (en) | 2000-08-30 | 2010-02-16 | Sirna Therapeutics, Inc. | RNA interference mediated treatment of Alzheimer's disease using short interfering nucleic acid (siNA) |
| US7667030B2 (en) | 2002-02-20 | 2010-02-23 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of matrix metalloproteinase 13 (MMP13) gene expression using short interfering nucleic acid (siNA) |
| US7667029B2 (en) | 2002-02-20 | 2010-02-23 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of checkpoint kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA) |
| US7678897B2 (en) | 2002-02-20 | 2010-03-16 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA) |
| US7691995B2 (en) | 2001-07-12 | 2010-04-06 | University Of Massachusetts | In vivo production of small interfering RNAS that mediate gene silencing |
| US7691999B2 (en) | 2002-02-20 | 2010-04-06 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of NOGO and NOGO receptor gene expression using short interfering nucleic acid (siNA) |
| US7695426B2 (en) | 2003-08-20 | 2010-04-13 | Biological Resources Pty Ltd | Methods for enhancing viability |
| US7700760B2 (en) | 2002-02-20 | 2010-04-20 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of vascular cell adhesion molecule (VCAM) gene expression using short interfering nucleic acid (siNA) |
| US7732417B2 (en) | 2000-03-16 | 2010-06-08 | Cold Spring Harbor Laboratory | Methods and compositions for RNA interference using recombinant Dicer and Argonaut |
| WO2010065867A1 (en) | 2008-12-04 | 2010-06-10 | Pioneer Hi-Bred International, Inc. | Methods and compositions for enhanced yield by targeted expression of knotted1 |
| US20100145015A1 (en) * | 2007-03-26 | 2010-06-10 | Uri Galili | Compositions and methods for increasing immunogenicity of glycoprotein vaccines |
| WO2010066689A2 (en) | 2008-12-09 | 2010-06-17 | Novartis Ag | Organic compounds |
| US7767802B2 (en) | 2001-01-09 | 2010-08-03 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of anti-apoptotic genes |
| WO2010101818A1 (en) | 2009-03-02 | 2010-09-10 | Pioneer Hi-Bred International, Inc. | Nac transcriptional activators involved in abiotic stress tolerance |
| US7795422B2 (en) | 2002-02-20 | 2010-09-14 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of hypoxia inducible factor 1 (HIF1) gene expression using short interfering nucleic acid (siNA) |
| US7795493B2 (en) | 2002-08-21 | 2010-09-14 | Revivicor, Inc. | Porcine animals lacking any expression of functional alpha 1, 3 galactosyltransferase |
| WO2010120862A1 (en) | 2009-04-14 | 2010-10-21 | Pioneer Hi-Bred International, Inc. | Modulation of acc synthase improves plant yield under low nitrogen conditions |
| WO2010118477A1 (en) | 2009-04-17 | 2010-10-21 | Molecular Plant Breeding Nominees Ltd | Plant promoter operable in endosperm and uses thereof |
| WO2010123904A1 (en) | 2009-04-20 | 2010-10-28 | Monsanto Technology Llc | Multiple virus resistance in plants |
| US7829693B2 (en) | 1999-11-24 | 2010-11-09 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of a target gene |
| US7833992B2 (en) | 2001-05-18 | 2010-11-16 | Merck Sharpe & Dohme | Conjugates and compositions for cellular delivery |
| EP2251349A1 (en) | 2006-04-19 | 2010-11-17 | Pioneer Hi-Bred International, Inc. | Isolated polynucleotide molecules corresponding to mutant and wild-type alleles of the maize D9 gene and methods of use |
| WO2010139026A1 (en) | 2009-06-05 | 2010-12-09 | Centenary Institute Of Cancer Medicine And Cell Biology | Therapeutic and diagnostic molecules |
| EP2261362A2 (en) | 2005-05-25 | 2010-12-15 | Pioneer Hi-Bred International Inc. | Methods for improving crop plant architecture and yield |
| US7855323B2 (en) | 2004-02-10 | 2010-12-21 | Monsanto Technology Llc | Recombinant DNA for gene suppression |
| US7858625B2 (en) | 2001-05-18 | 2010-12-28 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| US7858769B2 (en) | 2004-02-10 | 2010-12-28 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA) |
| US7868160B2 (en) | 2001-01-09 | 2011-01-11 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of anti-apoptotic genes |
| EP2275563A2 (en) | 2005-09-16 | 2011-01-19 | deVGen N.V. | Transgenic plant-based methods for plant insect pests using RNAi |
| WO2011011273A1 (en) | 2009-07-24 | 2011-01-27 | Pioneer Hi-Bred International, Inc. | The use of dimerization domain component stacks to modulate plant architecture |
| US7884264B2 (en) | 2006-01-17 | 2011-02-08 | Biolex Therapeutics, Inc. | Compositions and methods for inhibition of fucosyltransferase and xylosyltransferase expression in duckweed plants |
| US7893248B2 (en) | 2002-02-20 | 2011-02-22 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of Myc and/or Myb gene expression using short interfering nucleic acid (siNA) |
| US7897752B2 (en) | 2002-02-20 | 2011-03-01 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of telomerase gene expression using short interfering nucleic acid (siNA) |
| US7897757B2 (en) | 2002-02-20 | 2011-03-01 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of protein tyrosine phosphatase-1B (PTP-1B) gene expression using short interfering nucleic acid (siNA) |
| US7897753B2 (en) | 2002-02-20 | 2011-03-01 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of XIAP gene expression using short interfering nucleic acid (siNA) |
| EP2292739A1 (fr) | 2006-03-24 | 2011-03-09 | Institut National De La Recherche Agronomique | Procédé de préparation de cellules aviaires differenciées et gènes impliqués dans le maintien de la pluripotence |
| EP2292773A1 (en) | 2004-03-25 | 2011-03-09 | Monsanto Technology LLC | Genes and uses for plant improvement |
| US7910724B2 (en) | 2002-02-20 | 2011-03-22 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of Fos gene expression using short interfering nucleic acid (siNA) |
| US7910725B2 (en) | 2002-02-20 | 2011-03-22 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA) |
| US7915400B2 (en) | 2002-02-20 | 2011-03-29 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of hepatitis C virus (HCV) gene expression using short interfering nucleic acid (siNA) |
| WO2011041796A1 (en) | 2009-10-02 | 2011-04-07 | Pioneer Hi-Bred International, Inc. | Down-regulation of acc synthase for improved plant performance |
| US7923547B2 (en) | 2002-09-05 | 2011-04-12 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| US7923549B2 (en) | 2002-02-20 | 2011-04-12 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA) |
| US7928218B2 (en) | 2002-02-20 | 2011-04-19 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA) |
| US7928220B2 (en) | 2002-02-20 | 2011-04-19 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of stromal cell-derived factor-1 (SDF-1) gene expression using short interfering nucleic acid (siNA) |
| US7928219B2 (en) | 2002-02-20 | 2011-04-19 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (SINA) |
| US7935812B2 (en) | 2002-02-20 | 2011-05-03 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of hepatitis C virus (HCV) expression using short interfering nucleic acid (siNA) |
| US7943757B2 (en) | 2002-02-20 | 2011-05-17 | Mcswiggen James | RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA) |
| US7943819B2 (en) | 2005-09-16 | 2011-05-17 | Monsanto Technology Llc | Methods for genetic control of insect infestations in plants and compositions thereof |
| EP2267139A3 (en) * | 1998-04-08 | 2011-05-25 | Commonwealth Scientific and Industrial Research Organization | Methods and means for obtaining modified phenotypes |
| US7960614B2 (en) | 2003-06-06 | 2011-06-14 | Arborgen, Llc | Plant transformation and selection |
| EP2333061A1 (en) | 2001-07-06 | 2011-06-15 | Commonwealth Scientific and Industrial Research Organization | Delivery of dsRNA to arthropods |
| WO2011073326A2 (en) | 2009-12-18 | 2011-06-23 | Novartis Ag | Organic compositions to treat hsf1-related diseases |
| EP2338905A2 (en) | 2005-02-23 | 2011-06-29 | North Carolina State University | Alteration of tobacco alkaloid content through modification of specific cytochrome p450 genes |
| US7977472B2 (en) | 2002-02-20 | 2011-07-12 | Leonid Beigelman | RNA interference mediated inhibition of myostatin gene expression using short interfering nucleic acid (siNA) |
| WO2011085062A1 (en) | 2010-01-06 | 2011-07-14 | Pioneer Hi-Bred International, Inc. | Identification of diurnal rhythms in photosynthetic and non-photosynthetic tissues from zea mays and use in improving crop plants |
| US7985853B2 (en) | 2002-02-20 | 2011-07-26 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of platelet derived growth factor (PDGF) and platelet derived growth factor receptor (PDGFR) gene expression using short interfering nucleic acid (siNA) |
| US7989612B2 (en) | 2002-02-20 | 2011-08-02 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| EP2357244A2 (en) | 2004-04-22 | 2011-08-17 | Commonwealth Scientific and Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells. |
| WO2011098449A1 (en) | 2010-02-10 | 2011-08-18 | Novartis Ag | Methods and compounds for muscle growth |
| US8008473B2 (en) | 2002-02-20 | 2011-08-30 | Mcswiggen James | RNA interference mediated inhibition of TNF and TNF receptor gene expression using short interfering nucleic acid (siNA) |
| US8008472B2 (en) | 2001-05-29 | 2011-08-30 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of human immunodeficiency virus (HIV) gene expression using short interfering nucleic acid (siNA) |
| US8013143B2 (en) | 2002-02-20 | 2011-09-06 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of CXCR4 gene expression using short interfering nucleic acid (siNA) |
| US8017761B2 (en) | 2001-05-18 | 2011-09-13 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of Stearoyl-CoA desaturase (SCD) gene expression using short interfering nucelic acid (siNA) |
| US8049069B2 (en) | 2004-03-31 | 2011-11-01 | Commonwealth Scientific And Industrial Research Organisation | Genes involved in plant fibre development |
| US8067575B2 (en) | 2002-02-20 | 2011-11-29 | Merck, Sharp & Dohme Corp. | RNA interference mediated inhibition of cyclin D1 gene expression using short interfering nucleic acid (siNA) |
| US8093369B2 (en) | 2005-10-11 | 2012-01-10 | Ben Gurion University Of The Negev Research And Development Authority Ltd. | Compositions for silencing the expression of VDAC1 and uses thereof |
| US8093043B2 (en) | 2008-06-04 | 2012-01-10 | New York University | β-TrCP1, β-TrCP2 and RSK1 or RSK2 inhibitors and methods for sensitizing target cells to apoptosis |
| WO2012007945A2 (en) | 2010-07-12 | 2012-01-19 | The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization, (A.R.O.), Volcani Center | Isolated polynucleotides and methods and plants using same for regulating plant acidity |
| US8106251B2 (en) | 2002-08-21 | 2012-01-31 | Revivicor, Inc. | Tissue products derived from porcine animals lacking any expression of functional alpha 1,3 galactosyltransferase |
| EP2426206A2 (en) | 2006-02-13 | 2012-03-07 | Monsanto Technology LLC | Selecting and stablizing dsRNA constructs |
| US8153776B2 (en) | 2000-03-16 | 2012-04-10 | Cold Spring Harbor Laboratory | Methods and compositions for RNA interference |
| WO2012055362A1 (en) | 2010-10-28 | 2012-05-03 | Benitec Biopharma Limited | Hbv treatment |
| WO2012058726A1 (en) | 2010-11-05 | 2012-05-10 | Transbio Ltd | Markers of endothelial progenitor cells and uses thereof |
| WO2012058730A1 (en) | 2010-11-04 | 2012-05-10 | Arista Cereal Technologies Pty Ltd | High amylose wheat |
| JP2012085641A (ja) * | 1999-11-19 | 2012-05-10 | Cancer Research Technology Ltd | Dsrnaによる遺伝子発現の阻害 |
| EP2489726A2 (en) | 2005-01-12 | 2012-08-22 | Monsanto Technology LLC | Genes and uses for plant improvement |
| WO2012112586A1 (en) | 2011-02-14 | 2012-08-23 | Revivicor, Inc. | Genetically modified pigs for xenotransplantation of vascularized xenografts and derivatives thereof |
| US8258288B2 (en) | 2002-02-20 | 2012-09-04 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of respiratory syncytial virus (RSV) expression using short interfering nucleic acid (siNA) |
| US8269082B2 (en) | 2005-10-20 | 2012-09-18 | Commonwealth Scientific And Industrial Research Organisation | Cereals with altered dormancy |
| US8273866B2 (en) | 2002-02-20 | 2012-09-25 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SINA) |
| WO2012129373A2 (en) | 2011-03-23 | 2012-09-27 | Pioneer Hi-Bred International, Inc. | Methods for producing a complex transgenic trait locus |
| US8299042B2 (en) | 2002-04-26 | 2012-10-30 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for silencing genes without inducing toxicity |
| WO2012148835A1 (en) | 2011-04-29 | 2012-11-01 | Pioneer Hi-Bred International, Inc. | Down-regulation of a homeodomain-leucine zipper i-class homeobox gene for improved plant performance |
| US8329989B2 (en) | 2008-09-29 | 2012-12-11 | Monsanto Technology Llc | Soybean transgenic event MON87705 and methods for detection thereof |
| US8329890B2 (en) | 2002-08-05 | 2012-12-11 | University Of Iowa Research Foundation | SiRNA-mediated gene silencing |
| US8329667B2 (en) | 2004-04-23 | 2012-12-11 | The Trustees Of Columbia University In The City Of New York | Inhibition of hairless protein mRNA |
| WO2012174139A2 (en) | 2011-06-14 | 2012-12-20 | Synthon Biopharmaceuticals B.V. | Compositions and methods for making and b ioc ont aining auxotrophic transgenic plants |
| US8394628B2 (en) | 2000-03-30 | 2013-03-12 | University Of Massachusetts | RNA sequence-specific mediators of RNA interference |
| WO2013063653A1 (en) | 2011-11-04 | 2013-05-10 | Arista Cereal Technologies Pty Limited | High amylose wheat - ii |
| WO2013066805A1 (en) | 2011-10-31 | 2013-05-10 | Pioneer Hi-Bred International, Inc. | Improving plant drought tolerance, nitrogen use efficiency and yield |
| WO2013066423A2 (en) | 2011-06-21 | 2013-05-10 | Pioneer Hi-Bred International, Inc. | Methods and compositions for producing male sterile plants |
| US8461418B2 (en) | 2004-08-11 | 2013-06-11 | Monsanto Technology Llc | Enhanced zein reduction in transgenic corn seed |
| WO2013088438A1 (en) | 2011-12-11 | 2013-06-20 | The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization, (A.R.O.), Volcani Center | Methods of modulating stomata conductance and plant expression constructs for executing same |
| WO2013096992A1 (en) | 2011-12-27 | 2013-07-04 | Commonwealth Scientific And Industrial Reserach Organisation | Simultaneous gene silencing and supressing gene silencing in the same cell |
| WO2013096991A1 (en) | 2011-12-27 | 2013-07-04 | Commonwealth Scientific And Industrial Research Organisation | Production of dihydrosterculic acid and derivatives thereof |
| WO2013096993A1 (en) | 2011-12-27 | 2013-07-04 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing lipids |
| US8481710B2 (en) | 2002-08-05 | 2013-07-09 | University Of Iowa Research Foundation | RNA interference suppression of neurodegenerative diseases and methods of use thereof |
| WO2013105022A2 (en) | 2012-01-09 | 2013-07-18 | Novartis Ag | Organic compositions to treat beta-catenin-related diseases |
| WO2013104026A1 (en) | 2012-01-11 | 2013-07-18 | The Australian National University | Method for modulating plant root architecture |
| US8524879B2 (en) | 2002-08-05 | 2013-09-03 | University Of Iowa Research Foundation | RNA interference suppresion of neurodegenerative diseases and methods of use thereof |
| US8536429B2 (en) | 2006-07-12 | 2013-09-17 | Commonwealth Scientific And Industrial Research Organisation | Polynucleotides encoding a NAX2 polypeptide and methods for enhancing salinity tolerance in plants |
| WO2013138309A1 (en) | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
| WO2013138358A1 (en) | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
| WO2013159149A1 (en) | 2012-04-25 | 2013-10-31 | Commonwealth Scientific And Industrial Research Organisation | High oleic acid oils |
| US8598332B1 (en) | 1998-04-08 | 2013-12-03 | Bayer Cropscience N.V. | Methods and means for obtaining modified phenotypes |
| US8633028B2 (en) * | 2003-07-02 | 2014-01-21 | Musc Foundation For Research Development | dsRNA induced specific and non-specific immunity in crustaceans and other invertebrates and biodelivery vehicles for use therein |
| WO2014027021A1 (en) | 2012-08-16 | 2014-02-20 | Vib Vzw | Means and methods for altering the lignin pathway in plants |
| US8716554B2 (en) | 2003-08-21 | 2014-05-06 | Rahan Meristem (1998) Ltd. Plant Propagation & Biotechnology | Plants resistant to cytoplasm-feeding parasites |
| EP2730587A2 (en) | 2006-02-09 | 2014-05-14 | Pioneer Hi-Bred International, Inc. | Genes for enhancing nitrogen utilization efficiency in crop plants |
| WO2014118123A1 (en) | 2013-01-29 | 2014-08-07 | The University Court Of The University Of Glasgow | Methods and means for increasing stress tolerance and biomass in plants |
| WO2014143996A2 (en) | 2013-03-15 | 2014-09-18 | Pioneer Hi-Bred International, Inc. | Compositions and methods of use of acc oxidase polynucleotides and polypeptides |
| WO2014147249A1 (en) | 2013-03-21 | 2014-09-25 | Vib Vzw | Means and methods for the reduction of photorespiration in crops |
| WO2014160122A1 (en) | 2013-03-14 | 2014-10-02 | Pioneer Hi-Bred International, Inc. | Maize stress related transcription factor 18 and uses thereof |
| WO2014164116A1 (en) | 2013-03-13 | 2014-10-09 | Pioneer Hi-Bred International, Inc. | Functional expression of bacterial major facilitator superfamily (sfm) gene in maize to improve agronomic traits and grain yield |
| WO2014164014A1 (en) | 2013-03-11 | 2014-10-09 | Pioneer Hi-Bred International, Inc. | Genes for improving nutrient uptake and abiotic stress tolerance in plants |
| WO2014164074A1 (en) | 2013-03-13 | 2014-10-09 | Pioneer Hi-Bred International, Inc. | Enhanced nitrate uptake and nitrate translocation by over-expressing maize functional low-affinity nitrate transporters in transgenic maize |
| US8895805B2 (en) | 2006-12-04 | 2014-11-25 | Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences | Method for modifying insect resistance of plants by utilizing RNAi technique |
| EP2810952A1 (en) | 2013-06-03 | 2014-12-10 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Novel pest control methods |
| WO2014197943A1 (en) | 2013-06-13 | 2014-12-18 | Commonwealth Scientific And Industrial Research Organisation | Barley with very low levels of hordeins |
| WO2014200842A2 (en) | 2013-06-11 | 2014-12-18 | Syngenta Participations Ag | Methods for generating transgenic plants |
| WO2014205516A1 (en) | 2013-06-25 | 2014-12-31 | The Walter And Eliza Hall Institute Of Medical Research | Method of treating intracellular infection |
| EP2821490A2 (en) | 2008-10-30 | 2015-01-07 | Pioneer Hi-Bred International Inc. | Manipulation of glutamine synthetases (GS) to improve nitrogen use efficiency and grain yield in higher plants |
| US8945884B2 (en) | 2000-12-11 | 2015-02-03 | Life Technologies Corporation | Methods and compositions for synthesis of nucleic acid molecules using multiplerecognition sites |
| US9018179B2 (en) | 2001-07-23 | 2015-04-28 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for RNAi mediated inhibition of gene expression in mammals |
| US9029527B2 (en) | 1998-03-20 | 2015-05-12 | Commonwealth Scientific And Industrial Research Organisation | Synthetic genes and genetic constructs |
| WO2015069459A1 (en) | 2013-11-05 | 2015-05-14 | Novartis Ag | Organic compounds |
| US9051566B2 (en) | 2001-01-31 | 2015-06-09 | Alnylam Pharmaceuticals, Inc. | Post-transcriptional gene silencing using expressed double stranded RNA |
| WO2015089585A1 (en) | 2013-12-18 | 2015-06-25 | Csl Limited | Method of treating wounds |
| US9074213B2 (en) | 2001-01-09 | 2015-07-07 | Alnylam Pharmacuticals, Inc. | Compositions and methods for inhibiting expression of a target gene |
| WO2015116680A1 (en) | 2014-01-30 | 2015-08-06 | Two Blades Foundation | Plants with enhanced resistance to phytophthora |
| US9181551B2 (en) | 2002-02-20 | 2015-11-10 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| WO2015171603A1 (en) | 2014-05-06 | 2015-11-12 | Two Blades Foundation | Methods for producing plants with enhanced resistance to oomycete pathogens |
| EP2966157A1 (en) | 2014-07-07 | 2016-01-13 | Commonwealth Scientific and Industrial Research Organisation | Processes for producing industrial products from plant lipids |
| WO2016005449A1 (en) | 2014-07-08 | 2016-01-14 | Vib Vzw | Means and methods to increase plant yield |
| EP2980220A1 (en) | 2005-09-20 | 2016-02-03 | BASF Plant Science GmbH | Improved methods controlling gene expression |
| US9260471B2 (en) | 2010-10-29 | 2016-02-16 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA) |
| US9267145B2 (en) | 2002-05-03 | 2016-02-23 | Duke University | Method of regulating gene expression |
| US9290777B2 (en) | 2007-02-05 | 2016-03-22 | National University Of Singapore | Putative cytokinin receptor and methods for use thereof |
| US9309512B2 (en) | 2006-08-31 | 2016-04-12 | Monsanto Technology Llc | Phased small RNAs |
| WO2016079527A1 (en) | 2014-11-19 | 2016-05-26 | Tetralogic Birinapant Uk Ltd | Combination therapy |
| WO2016097773A1 (en) | 2014-12-19 | 2016-06-23 | Children's Cancer Institute | Therapeutic iap antagonists for treating proliferative disorders |
| US9441239B2 (en) | 1998-04-08 | 2016-09-13 | Commonwealth Scientific & Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| WO2016196489A1 (en) | 2015-05-29 | 2016-12-08 | Arcadia Biosciences | Reduced gluten grains and compositions thereof |
| WO2016205644A2 (en) | 2015-06-19 | 2016-12-22 | Arcadia Biosciences, Inc. | Wheat with reduced lipoxygenase activity |
| US9534252B2 (en) | 2003-12-01 | 2017-01-03 | Life Technologies Corporation | Nucleic acid molecules containing recombination sites and methods of using the same |
| US9592250B2 (en) | 2002-02-01 | 2017-03-14 | Life Technologies Corporation | Double-stranded oligonucleotides |
| WO2017062790A1 (en) | 2015-10-09 | 2017-04-13 | Two Blades Foundation | Cold shock protein receptors and methods of use |
| US9657294B2 (en) | 2002-02-20 | 2017-05-23 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| WO2017083920A1 (en) | 2015-11-18 | 2017-05-26 | Commonwealth Scientific And Industrial Research Organisation | Rice grain with thickened aleurone |
| WO2017091952A1 (zh) | 2015-11-30 | 2017-06-08 | 谢彦晖 | Akt2在诊断和治疗肿瘤中的用途 |
| US9708621B2 (en) | 1999-08-13 | 2017-07-18 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| US9765351B2 (en) | 2006-02-13 | 2017-09-19 | Monsanto Technology Llc | Modified gene silencing |
| WO2017161264A1 (en) | 2016-03-18 | 2017-09-21 | Pioneer Hi-Bred International, Inc. | Methods and compositions for producing clonal, non-reduced, non-recombined gametes |
| US9777275B2 (en) | 2002-02-01 | 2017-10-03 | Life Technologies Corporation | Oligonucleotide compositions with enhanced efficiency |
| US9803008B2 (en) | 2013-11-28 | 2017-10-31 | Csl Limited | Method of treating diabetic nephropathy by administering antibodies to vascular endothelial growth factor B (VEGF-B) |
| US9885038B2 (en) | 2007-08-14 | 2018-02-06 | Commonwealth Scientific & Industrial Research Organisation | Gene silencing methods |
| EP3293257A1 (en) | 2009-03-20 | 2018-03-14 | Mesoblast, Inc. | Production of reprogrammed pluripotent cells |
| CN107841510A (zh) * | 2016-09-20 | 2018-03-27 | 中国科学院青岛生物能源与过程研究所 | 一种原核细胞转录后水平控制不同基因表达比例的方法 |
| US9963698B2 (en) | 1998-03-20 | 2018-05-08 | Commonwealth Scientific And Industrial Research Organisation | Control of gene expression |
| US9994853B2 (en) | 2001-05-18 | 2018-06-12 | Sirna Therapeutics, Inc. | Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference |
| US10428336B2 (en) | 2013-10-16 | 2019-10-01 | The Australian National University | Method for modulating plant growth |
| US10508277B2 (en) | 2004-05-24 | 2019-12-17 | Sirna Therapeutics, Inc. | Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference |
| US10517887B2 (en) | 2001-07-23 | 2019-12-31 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for RNAi mediated inhibition of gene expression in mammals |
| WO2020078865A1 (en) | 2018-10-16 | 2020-04-23 | F. Hoffmann-La Roche Ag | Use of akt inhibitors in ophthalmology |
| WO2020148310A1 (en) | 2019-01-17 | 2020-07-23 | F. Hoffmann-La Roche Ag | E3 ubiquitin ligase (ube3a) protein targets |
| WO2021019536A1 (en) | 2019-07-30 | 2021-02-04 | The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) | Methods of controlling cannabinoid synthesis in plants or cells and plants and cells produced thereby |
| EP3825408A1 (en) | 2019-11-19 | 2021-05-26 | FRAUNHOFER-GESELLSCHAFT zur Förderung der angewandten Forschung e.V. | Methods of multi-species insect pest control |
| WO2022162015A1 (en) | 2021-01-26 | 2022-08-04 | Universite Brest Bretagne Occidentale | Novel stim1 splicing variants and uses thereof |
| WO2023012342A1 (en) | 2021-08-06 | 2023-02-09 | Kws Vegetables B.V. | Durable downy mildew resistance in spinach |
| WO2023020980A1 (en) | 2021-08-16 | 2023-02-23 | F. Hoffmann-La Roche Ag | E3 ubiquitin ligase (ube3a) protein targets |
| US12071484B2 (en) | 2011-06-13 | 2024-08-27 | Csl Limited | Nucleic acids encoding antibodies against human granulocyte-colony stimulating factor receptor (G-CSFR) and method of expressing encoded protein |
| EP4477069A1 (en) | 2023-06-16 | 2024-12-18 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Unreduced clonal gamete formation and polyploid genome design in the solanaceae |
| US12264202B2 (en) | 2017-11-29 | 2025-04-01 | Csl Limited | Methods of reducing or hindering development of ischemia-reperfusion injury due to kidney transplantation with an antibody that inhibits granulocyte-colony stimulating factor (G-CSF) signaling |
| US12281160B2 (en) | 2018-03-23 | 2025-04-22 | Csl Limited | Method of treating asthma |
| US12357689B2 (en) | 2023-07-05 | 2025-07-15 | CSL Innovation Pty Ltd | Methods of treating or preventing a cardiovascular system complication of sickle cell disease with an anti-G-CSFR antibody |
| US12428641B2 (en) | 2017-09-15 | 2025-09-30 | Commonwealth Scientific And Industrial Research Organisation | RNA molecules |
| US12583929B2 (en) | 2020-06-04 | 2026-03-24 | CSL Innovation Pty Ltd | Method of treating acute respiratory distress syndrome |
Families Citing this family (65)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6939712B1 (en) * | 1998-12-29 | 2005-09-06 | Impedagen, Llc | Muting gene activity using a transgenic nucleic acid |
| CA2361201A1 (en) * | 1999-01-28 | 2000-08-03 | Medical College Of Georgia Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna |
| AU2008202208C1 (en) * | 1999-01-30 | 2014-04-24 | Alnylam Pharmaceuticals, Inc. | Method and medicament for inhibiting the expression of a defined gene |
| US20040138168A1 (en) * | 1999-04-21 | 2004-07-15 | Wyeth | Methods and compositions for inhibiting the function of polynucleotide sequences |
| KR20020097198A (ko) * | 2000-03-17 | 2002-12-31 | 베니텍 오스트레일리아 리미티드 | 유전자 사일런싱 |
| US20050037989A1 (en) * | 2001-08-27 | 2005-02-17 | Lewis David L. | Inhibition of gene function by delivery of polynucleotide-based gene expression inhibitors to mammalian cells in vivo |
| WO2004015062A2 (en) | 2002-08-12 | 2004-02-19 | New England Biolabs, Inc. | Methods and compositions relating to gene silencing |
| US20040242518A1 (en) * | 2002-09-28 | 2004-12-02 | Massachusetts Institute Of Technology | Influenza therapeutic |
| JP2006526394A (ja) * | 2003-06-03 | 2006-11-24 | ベニテック オーストラリア リミテッド | 二本鎖核酸 |
| WO2005009346A2 (en) * | 2003-06-24 | 2005-02-03 | Mirus Corporation | Inhibition of gene function by delivery of polynucleotide-based gene expression inhibitors to mammalian cells in vivo |
| CA2533259C (en) * | 2003-07-21 | 2014-01-28 | Lifecell Corporation | Acellular tissue matrices made from galactose .alpha.-1,3-galactose-deficient tissue |
| WO2005026356A1 (en) * | 2003-09-12 | 2005-03-24 | Commonwealth Scientific And Industrial Research Organisation | Modified gene-silencing nucleic acid molecules and uses thereof |
| EP1799029B1 (en) | 2004-10-13 | 2012-05-16 | University Of Georgia Research Foundation, Inc. | Nematode resistant transgenic plants |
| ATE556126T1 (de) * | 2004-10-29 | 2012-05-15 | Life Technologies Corp | Funktionalisierte fluoreszierende nanokristalle und verfahren zu deren herstellung und verwendung |
| US8404927B2 (en) * | 2004-12-21 | 2013-03-26 | Monsanto Technology Llc | Double-stranded RNA stabilized in planta |
| DE202005004135U1 (de) * | 2005-03-11 | 2005-05-19 | Klocke Verpackungs-Service Gmbh | Mehrkomponentenverpackung mit Applikator |
| CA2605068A1 (en) * | 2005-04-15 | 2006-10-26 | The Board Of Regents Of The University Of Texas System | Delivery of sirna by neutral lipid compositions |
| WO2006113743A2 (en) * | 2005-04-18 | 2006-10-26 | Massachusetts Institute Of Technology | Compositions and methods for rna interference with sialidase expression and uses thereof |
| BRPI0806321A2 (pt) | 2007-01-10 | 2011-09-06 | Sanofi Aventis | métodos para identificação da estabilidade de metilenoaminas orgánicas na presença de amina oxidase sensìvel à semicarbazida e para determinação do perfil da mesma |
| WO2008109432A2 (en) * | 2007-03-02 | 2008-09-12 | The Board Of Regents Of The University Of Texas System | Therapeutic targeting of interleukins using sirna in neutral liposomes |
| WO2009082208A2 (en) | 2007-12-21 | 2009-07-02 | Keygene N.V. | Trichome specific promoters |
| MX2010010867A (es) * | 2008-04-04 | 2011-05-25 | Robert Shorr | Composicion farmaceutica. |
| WO2009132351A2 (en) * | 2008-04-25 | 2009-10-29 | University Of Medicine And Dentistry Of New Jersey | Anti-sense microrna expression vectors |
| EP2350131B1 (en) | 2008-11-07 | 2017-06-07 | Research Development Foundation | Compositions and methods for the inhibition of cripto/grp78 complex formation and signaling |
| US8734853B2 (en) | 2008-11-17 | 2014-05-27 | University Of North Texas Health Science Center At Fort Worth | HDL particles for delivery of nucleic acids |
| WO2010065437A1 (en) | 2008-12-03 | 2010-06-10 | Research Development Foundation | Modulation of olfml-3 mediated angiogenesis |
| US20110045080A1 (en) * | 2009-03-24 | 2011-02-24 | William Marsh Rice University | Single-Walled Carbon Nanotube/Bioactive Substance Complexes and Methods Related Thereto |
| MX336182B (es) | 2009-06-08 | 2016-01-11 | Nunhems Bv | Plantas tolerantes a la sequia. |
| CN101760555B (zh) * | 2009-09-30 | 2012-06-27 | 西南大学 | 一种基于pcr技术鉴定单拷贝转基因烟草的方法 |
| BR112012028848A2 (pt) * | 2010-05-10 | 2018-05-15 | Texas A & M Univ Sys | composições, organismos, sistemas e métodos para expressar um produto de gene em plantas |
| EP2575430A1 (en) | 2010-05-28 | 2013-04-10 | Nunhems B.V. | Plants with increased fruit size |
| EP3192880B1 (en) | 2010-08-18 | 2019-10-09 | Fred Hutchinson Cancer Research Center | Nucleic acid agents for use in treating facioscapulohumeral dystrophy (fshd) |
| WO2012027467A1 (en) * | 2010-08-26 | 2012-03-01 | Merck Sharp & Dohme Corp. | RNA INTERFERENCE MEDIATED INHIBITION OF PROLYL HYDROXYLASE DOMAIN 2 (PHD2) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| EP2633049B1 (en) | 2010-10-27 | 2018-10-10 | Harrisvaccines Inc | Methods and compositions to protect aquatic invertebrates from disease |
| CN102719454B (zh) * | 2012-06-15 | 2014-07-30 | 华南农业大学 | 一种优化的硫化物醌氧化还原酶基因及其表达载体 |
| WO2014045126A2 (en) | 2012-09-18 | 2014-03-27 | Uti Limited Partnership | Treatment of pain by inhibition of usp5 de-ubiquitinase |
| WO2014134179A1 (en) | 2013-02-28 | 2014-09-04 | The Board Of Regents Of The University Of Texas System | Methods for classifying a cancer as susceptible to tmepai-directed therapies and treating such cancers |
| WO2015066668A1 (en) | 2013-11-04 | 2015-05-07 | Lifecell Corporation | Methods of removing alpha-galactose |
| WO2015089338A2 (en) | 2013-12-11 | 2015-06-18 | Sloan-Kettering Institute For Cancer Research | Glucocorticoid inhibitors for treatment of prostate cancer |
| WO2015171723A1 (en) | 2014-05-06 | 2015-11-12 | Research Development Foundation | Methods for treating insulin resistance and for sensitizing patients to glp1 agonist therapy |
| WO2016094342A1 (en) | 2014-12-08 | 2016-06-16 | The Board Of Regents Of The University Of Texas System | Lipocationic polymers and uses thereof |
| US10000766B2 (en) * | 2015-07-17 | 2018-06-19 | National Chung Hsing University | Recombinant construct, recombinant microorganism, recombinant plant cell and method of providing plant with resistance against DNA virus and RNA virus |
| IL257831B2 (en) | 2015-09-04 | 2025-11-01 | Keygene Nv | Diplosporic garden |
| WO2017048789A1 (en) | 2015-09-14 | 2017-03-23 | The Board Of Regents Of The University Of Texas System | Lipocationic dendrimers and uses thereof |
| WO2017162265A1 (en) * | 2016-03-21 | 2017-09-28 | Biontech Rna Pharmaceuticals Gmbh | Trans-replicating rna |
| US12185424B2 (en) | 2016-04-20 | 2024-12-31 | Tm Ip Holdings, Llc | Secure routing of data packets including with use with transpositional modulation fortified communications |
| US12133287B1 (en) | 2016-04-20 | 2024-10-29 | Tm Ip Holdings, Llc | Transpositional modulation fortified communications traffic management |
| CN109414408B (zh) | 2016-05-16 | 2022-03-29 | 得克萨斯州大学系统董事会 | 阳离子磺酰胺氨基脂质和两亲性两性离子氨基脂质 |
| EP3500279A4 (en) * | 2016-08-19 | 2020-04-22 | Calimmune, Inc. | METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANINE CONDITIONS USING A RECOMBINANT SELF-COMPLEMENTARY ADENO-ASSOCIATED VIRUS. |
| JP7165410B2 (ja) | 2016-08-19 | 2022-11-04 | ユニバーシティ オブ フロリダ リサーチ ファウンデーション,インコーポレイティド | 組換え自己相補的アデノ随伴ウイルスを使用して疾患を治療するための方法及び組成物 |
| KR20190088561A (ko) | 2016-12-07 | 2019-07-26 | 유니버시티 오브 플로리다 리서치 파운데이션, 인코포레이티드 | 인터류킨-1 수용체 길항제(IL-1RA) cDNA |
| EP3775258A4 (en) | 2018-03-28 | 2022-01-26 | Board of Regents, The University of Texas System | IDENTIFICATION OF EPIGENETIC ALTERATIONS IN DNA ISOLATED FROM EXOSOMES |
| US11649455B2 (en) | 2018-03-30 | 2023-05-16 | University Of Geneva | Micro RNA expression constructs and uses thereof |
| US20220136011A1 (en) | 2019-02-08 | 2022-05-05 | Board Of Regents, The University Of Texas System | Telomerase-containing exosomes for treatment of diseases associated with aging and age-related organ dysfunction |
| CN115996707A (zh) | 2020-04-20 | 2023-04-21 | 德克萨斯大学系统董事会 | 生物活性干粉组合物及其制造和使用方法 |
| CN115715295A (zh) | 2020-05-27 | 2023-02-24 | 安逊生物科学股份有限公司 | 将car t细胞重新定向到感兴趣的抗原的衔接分子 |
| US20230266325A1 (en) | 2020-06-30 | 2023-08-24 | Lunglife Ai, Inc. | Methods for detecting lung cancer |
| CN116145266B (zh) * | 2021-11-19 | 2025-08-29 | 广东少和生物科技有限公司 | 蛹虫草Ptrpc重叠启动子文库及其应用 |
| GB202206507D0 (en) | 2022-05-04 | 2022-06-15 | Antion Biosciences Sa | Expression construct |
| EP4532772A1 (en) | 2022-05-24 | 2025-04-09 | Lunglife Ai, Inc. | Methods for detecting circulating genetically abnormal cells |
| WO2024028794A1 (en) | 2022-08-02 | 2024-02-08 | Temple Therapeutics BV | Methods for treating endometrial and ovarian hyperproliferative disorders |
| US12587352B2 (en) | 2023-02-03 | 2026-03-24 | Tm Ip Holdings, Llc | Full duplex adaptive array |
| GB202306619D0 (en) | 2023-05-04 | 2023-06-21 | Antion Biosciences Sa | Cell |
| GB202402745D0 (en) | 2024-02-27 | 2024-04-10 | Antion Biosciences Sa | Cell |
| WO2025248505A1 (en) | 2024-05-31 | 2025-12-04 | Wayne State University | Methods for treating endometrial and ovarian hyperproliferative disorders |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998053083A1 (en) * | 1997-05-21 | 1998-11-26 | Zeneca Limited | Gene silencing |
Family Cites Families (228)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US86356A (en) * | 1869-02-02 | Improvement in the construction of fire-proof safes | ||
| US114784A (en) * | 1871-05-16 | Improvement in compounds for cure of chills and fever | ||
| US165894A (en) * | 1875-07-20 | Improvement in vessels for removing foul water from docks | ||
| US27783A (en) * | 1860-04-10 | Improvement in apparatus for evaporating sugar-juices | ||
| US36197A (en) * | 1862-08-12 | Improvement in compound bullets for small-arms | ||
| US266005A (en) * | 1882-10-17 | William allen | ||
| US74684A (en) * | 1868-02-18 | of wallingford | ||
| US56235A (en) * | 1866-07-10 | Improvement in paring-knives | ||
| US3931397A (en) | 1971-11-05 | 1976-01-06 | Beecham Group Limited | Biologically active material |
| US4024222A (en) | 1973-10-30 | 1977-05-17 | The Johns Hopkins University | Nucleic acid complexes |
| US4034323A (en) * | 1975-03-24 | 1977-07-05 | Oki Electric Industry Company, Ltd. | Magnetic relay |
| US4283393A (en) | 1979-03-13 | 1981-08-11 | Merck & Co., Inc. | Topical application of interferon inducers |
| US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
| US4605394A (en) | 1982-12-03 | 1986-08-12 | Simon V. Skurkovich | Methods for the treatment of pathological conditions by removing interferon from the organism |
| DE3208247A1 (de) | 1982-03-08 | 1983-09-22 | Philips Patentverwaltung Gmbh, 2000 Hamburg | Cuvette fuer die atom-absorptions-spektrometrie |
| JPS5936698A (ja) | 1982-08-20 | 1984-02-28 | Science & Tech Agency | B型肝炎ウイルス遺伝子を組込んだ組換えdnaおよび形質転換動物細胞 |
| NZ209840A (en) * | 1983-10-17 | 1988-11-29 | Kaji Akira | A method of inhibiting viral propagation by hybridising dna with the viral rna thus blocking its action |
| US5272065A (en) | 1983-10-20 | 1993-12-21 | Research Foundation Of State University Of New York | Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA |
| US5190931A (en) * | 1983-10-20 | 1993-03-02 | The Research Foundation Of State University Of New York | Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA |
| US5208149A (en) * | 1983-10-20 | 1993-05-04 | The Research Foundation Of State University Of New York | Nucleic acid constructs containing stable stem and loop structures |
| DE3486053T3 (de) | 1983-10-20 | 2004-01-08 | The Research Foundation Of State University Of New York | Regulierung von Gen-Expression durch Translationshemmung unter Verwendung von m-RNS hinderndem Komplementär-RNS. |
| US5173410A (en) | 1984-02-15 | 1992-12-22 | Lubrizol Genetics Inc. | Transfer vector |
| US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US4766072A (en) | 1985-07-17 | 1988-08-23 | Promega Corporation | Vectors for in vitro production of RNA copies of either strand of a cloned DNA sequence |
| GB8521646D0 (en) | 1985-08-30 | 1985-10-02 | English Clays Lovering Pochin | Inorganic fillers |
| CA1326450C (en) | 1985-08-26 | 1994-01-25 | William A. Carter | Modulation of aids virus-related events by double stranded rnas (dsrnas) |
| US6617496B1 (en) | 1985-10-16 | 2003-09-09 | Monsanto Company | Effecting virus resistance in plants through the use of negative strand RNAs |
| GB8601680D0 (en) | 1986-01-23 | 1986-02-26 | Agricultural Genetics Co | Modification of plant viruses |
| US5453566A (en) | 1986-03-28 | 1995-09-26 | Calgene, Inc. | Antisense regulation of gene expression in plant/cells |
| NZ219472A (en) | 1986-03-28 | 1990-08-28 | Calgene Inc | Regulation of phenotype in plant cells using dsdna constructs |
| US5107065A (en) | 1986-03-28 | 1992-04-21 | Calgene, Inc. | Anti-sense regulation of gene expression in plant cells |
| US5017488A (en) * | 1986-04-01 | 1991-05-21 | University Of Medicine And Dentistry Of New Jersey | Highly efficient dual T7/T3 promoter vector PJKF16 and dual SP6/T3 promoter vector PJFK15 |
| DE3850683T2 (de) * | 1987-02-09 | 1994-10-27 | Lubrizol Genetics Inc | Hybrides RNS-Virus. |
| PH24467A (en) | 1987-03-03 | 1990-07-18 | Hem Res Inc | Synergistics interplay of lymphokines and dsrnas |
| US4950652A (en) | 1987-03-23 | 1990-08-21 | Hem Research, Inc. | dsRNAs for combination therapy in the treatment of viral diseases |
| AU1820588A (en) | 1987-07-17 | 1989-01-19 | Hem Research, Inc. | Double-stranded rna correction of abnormalities in circulating immune complexes and monocyte function |
| IE66830B1 (en) | 1987-08-12 | 1996-02-07 | Hem Res Inc | Topically active compositions of double-stranded RNAs |
| IE72103B1 (en) | 1987-08-12 | 1997-03-12 | Hem Res Inc | Promotion of host defense by systemic dsRNA treatment |
| EP0306347B1 (en) | 1987-09-04 | 1995-05-10 | Hem Pharmaceuticals Corp. | Diagnosis of double-stranded RNA deficiency states |
| US5874555A (en) | 1987-10-30 | 1999-02-23 | California Institute Of Technology | Triple helices and processes for making same |
| US4963532A (en) | 1987-11-25 | 1990-10-16 | Hem Research, Inc. | dsRNA-based prevention of viral escape |
| US5254678A (en) * | 1987-12-15 | 1993-10-19 | Gene Shears Pty. Limited | Ribozymes |
| MC2115A1 (fr) | 1987-12-15 | 1991-07-05 | Gene Shears Pty Ltd | Ribozynes |
| PH25365A (en) | 1987-12-23 | 1991-05-13 | Hem Research | Rhase l inhibitor as a marker for virus infections |
| US5922602A (en) | 1988-02-26 | 1999-07-13 | Biosource Technologies, Inc. | Cytoplasmic inhibition of gene expression |
| GB8810120D0 (en) | 1988-04-28 | 1988-06-02 | Plant Genetic Systems Nv | Transgenic nuclear male sterile plants |
| CA1320446C (en) | 1988-06-20 | 1993-07-20 | William A. Carter | Modulation of lymphokine-resistant cellular states by dsrnas |
| ES2066847T3 (es) | 1988-07-07 | 1995-03-16 | Hem Pharma Corp | Diagnostico y tratamiento del sindrome de fatiga cronica. |
| US5597718A (en) * | 1988-10-04 | 1997-01-28 | Agracetus | Genetically engineering cotton plants for altered fiber |
| US5198346A (en) * | 1989-01-06 | 1993-03-30 | Protein Engineering Corp. | Generation and selection of novel DNA-binding proteins and polypeptides |
| US5780269A (en) * | 1989-02-24 | 1998-07-14 | The University Of Medicine And Denistry Of New Jersey | Hybrid molecules |
| US5434070A (en) * | 1989-02-24 | 1995-07-18 | The University Of Medicine And Dentistry Of New Jersey | Reverse transcriptases from Escherichia coli and Myxococcus xanthus |
| US5405775A (en) * | 1989-02-24 | 1995-04-11 | The University Of Medicine And Dentistry Of New Jersey | Retrons coding for hybrid DNA/RNA molecules |
| US5436141A (en) | 1989-02-24 | 1995-07-25 | University Of Medicine And Dentistry Of New Jersey | Method for synthesizing stable single-stranded CDNA in eukaryotes by means of a bacterial retron and products |
| DE59010432D1 (de) | 1989-03-16 | 1996-09-05 | Boehringer Ingelheim Int | Genetische Einheiten zur Inhibierung der Funktion von RNA |
| US5231020A (en) | 1989-03-30 | 1993-07-27 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| US5034323A (en) | 1989-03-30 | 1991-07-23 | Dna Plant Technology Corporation | Genetic engineering of novel plant phenotypes |
| WO1990012488A2 (en) | 1989-04-05 | 1990-11-01 | The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce | A clone of double-stranded rna virus applied to antibody production, study of retrovirus-like frameshifting and production of proteins in yeast |
| AU5421090A (en) | 1989-04-05 | 1990-11-05 | United States of America, as represented by the Secretary, U.S. Department of Commerce, The | A clone of double-stranded rna virus and applications thereof |
| EP0473576A4 (en) | 1989-05-19 | 1993-03-10 | Hem Research, Inc. | Short therapeutic dsrna of defined structure |
| US5122466A (en) | 1989-06-13 | 1992-06-16 | North Carolina State University | Ballistic transformation of conifers |
| GB8916213D0 (en) | 1989-07-14 | 1989-08-31 | Ici Plc | Dna constructs,cells and plants derived therefrom |
| WO1991002069A1 (en) | 1989-08-10 | 1991-02-21 | Plant Genetic Systems N.V. | Plants with modified flowers |
| US5747308A (en) | 1989-10-25 | 1998-05-05 | Celltech Therapeutics Limited | Recombinant DNA method |
| US5939600A (en) * | 1989-11-03 | 1999-08-17 | Goldbach; Robert Willem | Nucleic acids encoding tospovirus genome and expression thereof |
| HUT57265A (en) * | 1989-11-03 | 1991-11-28 | Zaadunie Bv | Process for producing plants of diminished infection-sensitivity |
| US5457189A (en) * | 1989-12-04 | 1995-10-10 | Isis Pharmaceuticals | Antisense oligonucleotide inhibition of papillomavirus |
| US5578718A (en) * | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
| AU642959B2 (en) * | 1990-01-18 | 1993-11-04 | United States of America, as represented by the Secretary, U.S. Department of Commerce, The | Vector with multiple target response elements affecting gene expression |
| US6245560B1 (en) * | 1990-01-18 | 2001-06-12 | The United States Of America As Represented By The Department Of Health And Human Services | Vector with multiple target response elements affecting gene expression |
| US5168064A (en) | 1990-04-20 | 1992-12-01 | The Regents Of The University Of California | Endo-1,4-β-glucanase gene and its use in plants |
| GB9009307D0 (en) | 1990-04-25 | 1990-06-20 | Ici Plc | Dna,constructs,cells and plant derived therefrom |
| WO1991018088A1 (en) * | 1990-05-23 | 1991-11-28 | The United States Of America, Represented By The Secretary, United States Department Of Commerce | Adeno-associated virus (aav)-based eucaryotic vectors |
| US5270163A (en) * | 1990-06-11 | 1993-12-14 | University Research Corporation | Methods for identifying nucleic acid ligands |
| AU8059891A (en) | 1990-06-13 | 1992-01-07 | Trustees Of Princeton University, The | A (lac) repressor-hsv vp16 chimeric transcriptional activator protein system functioning in transfected mammalian cells |
| HUT69956A (en) | 1990-08-14 | 1995-09-28 | Isis Pharmaceuticals Inc | Methode for inhibition of influenza virus by antiseuse oligonucleotides |
| DE4027616A1 (de) * | 1990-08-31 | 1992-03-05 | Boehringer Mannheim Gmbh | Verfahren zur bestimmung von polymerase-aktivitaet |
| MX9100993A (es) | 1990-09-10 | 1992-05-04 | Us Agriculture | Secuencia de adn aislado y enzima acido 1-aminociclopropan-1-carboxilico sintasa,recombinante |
| US5306862A (en) * | 1990-10-12 | 1994-04-26 | Amoco Corporation | Method and composition for increasing sterol accumulation in higher plants |
| SE9004095L (sv) | 1990-12-21 | 1992-06-01 | Amylogene Hb | Genetisk foeraendring av potatis foer bildning av staerkelse av amylostyp |
| SE467358B (sv) | 1990-12-21 | 1992-07-06 | Amylogene Hb | Genteknisk foeraendring av potatis foer bildning av staerkelse av amylopektintyp |
| EP0568641A4 (en) | 1991-01-25 | 1994-09-14 | Us Biochemical Corp | Regulation of nucleic acid translation |
| GB9105383D0 (en) * | 1991-03-14 | 1991-05-01 | Immunology Ltd | An immunotherapeutic for cervical cancer |
| GB9106713D0 (en) | 1991-03-28 | 1991-05-15 | Ici Plc | Dna,dna constructs,cells and plants derived therefrom |
| IE921206A1 (en) | 1991-04-16 | 1992-10-21 | Mogen Int | Male-sterile plants, method for obtaining male-sterile¹plants and recombinant dna for use therein |
| CA2106386A1 (en) | 1991-04-18 | 1992-10-19 | Barbara C. F. Chu | Oligodeoxynucleotides and oligonucleotides useful as decoys for proteins which selectively bind to defined dna sequences |
| FR2675803B1 (fr) | 1991-04-25 | 1996-09-06 | Genset Sa | Oligonucleotides fermes, antisens et sens et leurs applications. |
| GB9109063D0 (en) | 1991-04-26 | 1991-06-12 | Ici Plc | Modification of lignin synthesis in plants |
| CA2110169A1 (en) | 1991-05-30 | 1992-12-10 | Walter Van Der Eycken | Nematode-responsive plant promoters |
| PL170326B1 (pl) | 1991-07-11 | 1996-11-29 | Int Flower Dev Pty Ltd | S posób wytwarzania rosliny transgenicznej PL |
| US6010908A (en) | 1992-08-21 | 2000-01-04 | The Regents Of The University Of California | Gene therapy by small fragment homologous replacement |
| CA2073630C (en) | 1991-08-30 | 2007-12-11 | Atsushi Ohshima | Method for synthesizing single-stranded stem-loop dnas, the products and uses therefor |
| US5714323A (en) | 1991-08-30 | 1998-02-03 | The University Of Medecine And Dentistry Of New Jersey | Over expression of single-stranded molecules |
| WO1993010251A1 (en) | 1991-11-20 | 1993-05-27 | Mogen International N.V. | A method for obtaining plants with reduced susceptibility to plant-parasitic nematodes |
| FR2685346B1 (fr) * | 1991-12-18 | 1994-02-11 | Cis Bio International | Procede de preparation d'arn double-brin, et ses applications. |
| CA2130454C (en) | 1992-02-19 | 2008-04-08 | William G. Dougherty | Production of viral resistant plants via introduction of untranslatable plus sense viral rna |
| DE4208107A1 (de) | 1992-03-13 | 1993-09-16 | Bayer Ag | Pseudorabies-virus (prv)-polynukleotide und ihre verwendung zur herstellung von virusresistenten eukaryotischen zellen |
| US5593874A (en) * | 1992-03-19 | 1997-01-14 | Monsanto Company | Enhanced expression in plants |
| US5496698A (en) * | 1992-08-26 | 1996-03-05 | Ribozyme Pharmaceuticals, Inc. | Method of isolating ribozyme targets |
| GB9210273D0 (en) | 1992-05-13 | 1992-07-01 | Ici Plc | Dna |
| US5693535A (en) | 1992-05-14 | 1997-12-02 | Ribozyme Pharmaceuticals, Inc. | HIV targeted ribozymes |
| US6451603B1 (en) * | 1992-06-29 | 2002-09-17 | Gene Shears Pty. Limited | Ribozyme nucleic acids and methods of use thereof for controlling viral pathogens |
| PL172710B1 (pl) | 1992-07-02 | 1997-11-28 | Hybridon Inc | Samostabilizujacy sie oligonukleotyd PL PL |
| WO1994003607A1 (en) | 1992-07-30 | 1994-02-17 | Keygene N.V. | Dna constructs, cells and plants derived therefrom |
| CA2106260A1 (en) * | 1992-09-17 | 1994-03-18 | Robert M. Kotin | Human adeno-associated virus integration site dna and uses thereof |
| WO1994007367A1 (en) | 1992-09-29 | 1994-04-14 | Apollon, Inc. | Anti-viral oligomers that bind polypurine tracts of single-stranded rna or rna-dna hybrids |
| CA2146113A1 (en) | 1992-10-15 | 1994-10-15 | Adrianus Johannes Van Tunen | Genetic moderation of restoration or plant phenotypes |
| US6872872B1 (en) * | 1992-11-17 | 2005-03-29 | E. I. Du Pont De Nemours And Company | Genes for microsomal delta-12 fatty acid desaturases and related enzymes from plants |
| US6372965B1 (en) | 1992-11-17 | 2002-04-16 | E.I. Du Pont De Nemours And Company | Genes for microsomal delta-12 fatty acid desaturases and hydroxylases from plants |
| ZA939767B (en) | 1993-01-21 | 1994-09-14 | Univ North Carolina State | Nematode-resistant transgenic plants |
| US6069298A (en) | 1993-02-05 | 2000-05-30 | Regents Of The University Of Minnesota | Methods and an acetyl CoA carboxylase gene for conferring herbicide tolerance and an alteration in oil content of plants |
| JPH08506490A (ja) | 1993-02-05 | 1996-07-16 | モンサント・カンパニー | 植物中の改変リノレン酸及びリノール酸含量 |
| EP0620281A3 (en) * | 1993-03-31 | 1995-05-03 | Mitsubishi Corp | Oilseed-producing oilseeds with modified amino and fatty acid compositions. |
| EP0701619A1 (en) | 1993-06-08 | 1996-03-20 | Nunhems Zaden Bv | Process for generating male sterile plants |
| US5739309A (en) | 1993-07-19 | 1998-04-14 | Gen-Probe Incorporated | Enhancement of oligonucleotide inhibition of protein production, cell proliferation and / or multiplication of infectious disease pathogens |
| JPH09500787A (ja) | 1993-07-19 | 1997-01-28 | ジェン−プローブ・インコーポレイテッド | 蛋白生産、細胞増殖および/または感染症病原体の増殖に対するオリゴヌクレオチド阻害の促進 |
| CA2105364A1 (en) | 1993-09-01 | 1995-03-02 | Eric T. Kool | Stem-loop oligonucleotides containing parallel and antiparallel binding domains |
| US5808036A (en) | 1993-09-01 | 1998-09-15 | Research Corporation Technologies Inc. | Stem-loop oligonucleotides containing parallel and antiparallel binding domains |
| EP0759170B1 (en) | 1993-09-10 | 2008-07-09 | The Trustees Of Columbia University In The City Of New York | Uses of green fluorescent protein |
| GB9318927D0 (en) | 1993-09-13 | 1993-10-27 | Zeneca Ltd | Regulation of senescence |
| JP2001505401A (ja) | 1993-09-20 | 2001-04-24 | シー. リード,ジョン | bc1−2遺伝子発現の調節 |
| US5858981A (en) | 1993-09-30 | 1999-01-12 | University Of Pennsylvania | Method of inhibiting phagocytosis |
| GB9320548D0 (en) | 1993-10-06 | 1993-11-24 | Sandoz Ltd | Improvements in or relating to organic compounds |
| US5624803A (en) | 1993-10-14 | 1997-04-29 | The Regents Of The University Of California | In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom |
| US5801154A (en) * | 1993-10-18 | 1998-09-01 | Isis Pharmaceuticals, Inc. | Antisense oligonucleotide modulation of multidrug resistance-associated protein |
| US5578716A (en) | 1993-12-01 | 1996-11-26 | Mcgill University | DNA methyltransferase antisense oligonucleotides |
| US5908779A (en) | 1993-12-01 | 1999-06-01 | University Of Connecticut | Targeted RNA degradation using nuclear antisense RNA |
| FR2714383B1 (fr) | 1993-12-29 | 1996-02-09 | Centre Nat Rech Scient | Contrôle de l'expression de gènes. |
| ATE320487T1 (de) | 1994-01-05 | 2006-04-15 | Gene Shears Pty Ltd | Ribozyme gegen eine hiv tat sequenz |
| US5849991A (en) * | 1994-01-27 | 1998-12-15 | Bresatch Limited | Mice homozygous for an inactivated α 1,3-galactosyl transferase gene |
| EP0746614A1 (en) | 1994-02-23 | 1996-12-11 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting the expression of disease related genes |
| US5686649A (en) | 1994-03-22 | 1997-11-11 | The Rockefeller University | Suppression of plant gene expression using processing-defective RNA constructs |
| US5631148A (en) | 1994-04-22 | 1997-05-20 | Chiron Corporation | Ribozymes with product ejection by strand displacement |
| US6054299A (en) * | 1994-04-29 | 2000-04-25 | Conrad; Charles A. | Stem-loop cloning vector and method |
| US6146886A (en) | 1994-08-19 | 2000-11-14 | Ribozyme Pharmaceuticals, Inc. | RNA polymerase III-based expression of therapeutic RNAs |
| AU7954794A (en) | 1994-09-12 | 1996-03-29 | City Of Hope | Modulation of drug radiation resistant genes |
| US5576716A (en) * | 1994-12-07 | 1996-11-19 | Sadler; Kermit M. | Owner oriented system for locating lost or stolen property |
| WO1996035706A1 (en) | 1995-05-11 | 1996-11-14 | Hybridon, Inc. | Pyrimidine targeting hairpin triplex-forming oligonucleotides |
| US5691140A (en) | 1995-05-18 | 1997-11-25 | New England Biolabs, Inc. | Bidirectional in vitro transcription vectors utilizing a single RNA polymerase for both directions |
| US5693773A (en) | 1995-06-07 | 1997-12-02 | Hybridon Incorporated | Triplex-forming antisense oligonucleotides having abasic linkers targeting nucleic acids comprising mixed sequences of purines and pyrimidines |
| AU710874B2 (en) | 1995-06-30 | 1999-09-30 | Dna Plant Technology Corporation | Delayed ripening tomato plants |
| FR2737501B1 (fr) * | 1995-07-31 | 1997-10-24 | Transgene Sa | Nouveaux virus auxiliaires pour la preparation de vecteurs viraux recombinants |
| EP0850318A1 (en) | 1995-09-13 | 1998-07-01 | Chiron Corporation | Method and construct for screening for inhibitors of transcriptional activation |
| CA2239976A1 (en) | 1995-09-20 | 1997-03-27 | Paul A. Zamecnik | Antisense oligonucleotide chemotherapy for benign hyperplasia or cancer of the prostate |
| JPH11513256A (ja) | 1995-10-06 | 1999-11-16 | プラント ジエネテイツク システムズ エヌ.ブイ | 種子粉砕 |
| JPH09110894A (ja) | 1995-10-17 | 1997-04-28 | Soyaku Gijutsu Kenkyusho:Kk | ハイブリッドdna/rnaオリゴヌクレオチド及び抗ウイルス剤 |
| EP0771878A1 (en) | 1995-10-31 | 1997-05-07 | Plant Genetic Systems N.V. | Plants with reduced glucosinolate content |
| US5773692A (en) | 1995-12-12 | 1998-06-30 | Her Majesty The Queen In Right Of Canada, As Represented By Agriculture And Agri-Food Canada | Anti-sense RNA for CAB transcript to reduce chlorophyll content in plants |
| CA2279673A1 (en) | 1995-12-15 | 1997-06-16 | Enzo Therapeutics, Inc. | Property effecting and/or property exhibiting constructs for the expression of non-native nucleic acids for therapeutic and diagnostic uses |
| IT1283876B1 (it) | 1996-01-12 | 1998-05-07 | Univ Roma | Molecole chimeriche ribozima-snrna ad attivita' catalitica per rna a localizzazione nucleare |
| EP0880598A4 (en) * | 1996-01-23 | 2005-02-23 | Affymetrix Inc | RAPID EVALUATION OF NUCLEIC ACID ABUNDANCE DIFFERENCE, WITH A HIGH-DENSITY OLIGONUCLEOTIDE SYSTEM |
| US5891855A (en) * | 1996-02-12 | 1999-04-06 | The Scripps Research Institute | Inhibitors of leaderless protein export |
| JP3847366B2 (ja) | 1996-02-22 | 2006-11-22 | アンジェスMg株式会社 | アンチセンスオリゴヌクレオチドを用いた固定性分裂終了細胞増殖剤 |
| US5989864A (en) * | 1996-10-29 | 1999-11-23 | Smithkline Beecham Corporation | DNA encoding spo-rel polypeptides |
| US6153815A (en) | 1996-03-13 | 2000-11-28 | National Research Council Of Canada | DNA sequences from brassicaceae encoding squalene epoxidase and process of raising squalene levels in plants therewith |
| US6413735B1 (en) * | 1996-03-15 | 2002-07-02 | Munin Corporation | Method of screening for a modulator of angiogenesis |
| US6022863A (en) | 1996-05-21 | 2000-02-08 | Yale University | Regulation of gene expression |
| ES2258793T5 (es) | 1996-05-24 | 2010-01-25 | Biogen Idec Ma Inc. | Moduladores de la regeneracion tisular. |
| AU725002B2 (en) | 1996-06-21 | 2000-10-05 | Plant Genetic Systems N.V. | Gene expression in plants |
| US5994526A (en) | 1996-06-21 | 1999-11-30 | Plant Genetic Systems | Gene expression in plants |
| US5952546A (en) * | 1996-06-27 | 1999-09-14 | Dna Plant Technology Corporation | Delayed ripening tomato plants with T-DNA bearing a truncated ACC2 synthase gene |
| US5850026A (en) | 1996-07-03 | 1998-12-15 | Cargill, Incorporated | Canola oil having increased oleic acid and decreased linolenic acid content |
| CA2259179C (en) | 1996-07-03 | 2008-09-23 | University Of Pittsburgh | Emulsion formulations for hydrophilic active agents |
| NZ333802A (en) * | 1996-08-02 | 2001-09-28 | Genesense Technologies Inc | Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase |
| DE19631919C2 (de) | 1996-08-07 | 1998-07-16 | Deutsches Krebsforsch | Anti-Sinn-RNA mit Sekundärstruktur |
| US5747338A (en) | 1996-08-15 | 1998-05-05 | Chiron Corporation | Method and construct for screening for inhibitors of transcriptional activation |
| US6225290B1 (en) | 1996-09-19 | 2001-05-01 | The Regents Of The University Of California | Systemic gene therapy by intestinal cell transformation |
| US5814500A (en) | 1996-10-31 | 1998-09-29 | The Johns Hopkins University School Of Medicine | Delivery construct for antisense nucleic acids and methods of use |
| GB9703146D0 (en) | 1997-02-14 | 1997-04-02 | Innes John Centre Innov Ltd | Methods and means for gene silencing in transgenic plants |
| CN1248292A (zh) | 1997-02-21 | 2000-03-22 | 丹尼斯科有限公司 | 淀粉分支酶表达的反义内含子的抑制作用 |
| EP0921195A1 (en) * | 1997-03-10 | 1999-06-09 | Japan Tobacco Inc. | Antisense base sequences |
| GB9706381D0 (en) | 1997-03-27 | 1997-05-14 | Cambridge Advanced Tech | Improvements relating to the specificity of gene expression |
| US7589253B2 (en) | 1997-04-15 | 2009-09-15 | Commonwealth Scientific And Industrial Research Organisation | Fatty acid epoxygenase genes from plants and uses therefor in modifying fatty acid metabolism |
| US5942395A (en) | 1997-05-09 | 1999-08-24 | Universite De Montreal | Hybrid ribozymes and methods of use |
| EP1019429A4 (en) * | 1997-08-20 | 2001-08-08 | Somagenics Inc | ANTISENSE THERAPEUTIC PRODUCTS WITH IMPROVED BINDING PROPERTIES AND METHODS OF USE |
| GB9720148D0 (en) | 1997-09-22 | 1997-11-26 | Innes John Centre Innov Ltd | Gene silencing materials and methods |
| CA2309719A1 (en) | 1997-11-18 | 1999-05-27 | Pioneer Hi-Bred International, Inc. | Targeted manipulation of genes in plants |
| DE19754622A1 (de) | 1997-12-09 | 1999-06-10 | Antje Von Dr Schaewen | Pflanzliche GntI-Sequenzen und Verwendung derselben zur Gewinnung von Pflanzen mit verminderter oder fehlender N-Acetylglucosaminyltransferase I (GnTI)-Aktivität |
| US6506559B1 (en) | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
| AUPP249298A0 (en) | 1998-03-20 | 1998-04-23 | Ag-Gene Australia Limited | Synthetic genes and genetic constructs comprising same I |
| CN101818145A (zh) | 1998-03-20 | 2010-09-01 | 联邦科学和工业研究组织 | 控制基因表达 |
| CN1202246C (zh) | 1998-04-08 | 2005-05-18 | 联邦科学和工业研究组织 | 获得修饰表型的方法和措施 |
| US8598332B1 (en) | 1998-04-08 | 2013-12-03 | Bayer Cropscience N.V. | Methods and means for obtaining modified phenotypes |
| US20040214330A1 (en) | 1999-04-07 | 2004-10-28 | Waterhouse Peter Michael | Methods and means for obtaining modified phenotypes |
| EP0959133A1 (en) | 1998-05-22 | 1999-11-24 | Centrum Voor Plantenveredelings- En Reproduktieonderzoek (Cpro-Dlo) | A process for inhibiting expression of genes |
| AR020078A1 (es) | 1998-05-26 | 2002-04-10 | Syngenta Participations Ag | Metodo para alterar la expresion de un gen objetivo en una celula de planta |
| GB9827152D0 (en) | 1998-07-03 | 1999-02-03 | Devgen Nv | Characterisation of gene function using double stranded rna inhibition |
| US6040908A (en) * | 1998-07-28 | 2000-03-21 | Litton Systems, Inc. | Method for stress tuning fiber optic sensor coils |
| CA2361201A1 (en) | 1999-01-28 | 2000-08-03 | Medical College Of Georgia Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna |
| DE19956568A1 (de) | 1999-01-30 | 2000-08-17 | Roland Kreutzer | Verfahren und Medikament zur Hemmung der Expression eines vorgegebenen Gens |
| ES2316363T3 (es) | 1999-04-20 | 2009-04-16 | Bayer Bioscience N.V. | Metodos para administracion de rna inhibidor a las plantas y aplicaciones de los mismos. |
| US20040138168A1 (en) | 1999-04-21 | 2004-07-15 | Wyeth | Methods and compositions for inhibiting the function of polynucleotide sequences |
| KR20070118315A (ko) | 1999-04-21 | 2007-12-14 | 와이어쓰 | 폴리뉴클레오티드 서열의 기능을 억제하기 위한 조성물 |
| CA2373628A1 (en) | 1999-06-14 | 2000-12-21 | Michael A. Costa | Animal models and methods for analysis of lipid metabolism and screening of pharmaceutical and pesticidal agents that modulate lipid metabolism |
| BR0012325A (pt) | 1999-07-09 | 2002-05-21 | American Home Prod | Métodos e composições para prevenção da formação de rna anormal durante a transcrição de uma sequência de plasmìdeo |
| US6423885B1 (en) | 1999-08-13 | 2002-07-23 | Commonwealth Scientific And Industrial Research Organization (Csiro) | Methods for obtaining modified phenotypes in plant cells |
| AU7487300A (en) | 1999-09-16 | 2001-04-17 | Genoptera, Llc | Lethal insectidice targets |
| HK1047109A1 (zh) | 1999-10-15 | 2003-02-07 | University Of Massachusetts | 作为指定基因干预工具的rna干预轨迹基因 |
| US6291504B1 (en) | 1999-10-20 | 2001-09-18 | Dupont Pharmaceuticals Company | Acylsemicarbazides and their uses |
| GB9925459D0 (en) | 1999-10-27 | 1999-12-29 | Plant Bioscience Ltd | Gene silencing |
| GB9927444D0 (en) | 1999-11-19 | 2000-01-19 | Cancer Res Campaign Tech | Inhibiting gene expression |
| AU2047001A (en) | 1999-11-24 | 2001-06-04 | Dna Plant Technology Corporation | Methods of inhibiting plant parasitic nematodes and insect pests by expression of nematode and insect specific double-stranded rna in plants |
| WO2001038359A2 (en) | 1999-11-29 | 2001-05-31 | Genoptera, Llc | Drosophila nicotinic acetylcholine receptor |
| GB9930691D0 (en) | 1999-12-24 | 2000-02-16 | Devgen Nv | Improvements relating to double-stranded RNA inhibition |
| KR20020097198A (ko) | 2000-03-17 | 2002-12-31 | 베니텍 오스트레일리아 리미티드 | 유전자 사일런싱 |
| ES2336887T5 (es) | 2000-03-30 | 2019-03-06 | Whitehead Inst Biomedical Res | Mediadores de interferencia por ARN específicos de secuencias de ARN |
| GB2362383B (en) | 2000-05-19 | 2003-12-31 | Devgen Nv | Gene expression system |
| US6995258B1 (en) * | 2000-05-25 | 2006-02-07 | City Of Hope | Nucleolar targeting of therapeutics against HIV |
| JP2004512020A (ja) | 2000-06-23 | 2004-04-22 | イー・アイ・デュポン・ドウ・ヌムール・アンド・カンパニー | 組換え構築物ならびにこれを遺伝子発現を減少させる際に用いる方法 |
| US7109393B2 (en) | 2000-08-15 | 2006-09-19 | Mendel Biotechnology, Inc. | Methods of gene silencing using inverted repeat sequences |
| CA2429814C (en) | 2000-12-01 | 2014-02-18 | Thomas Tuschl | Rna interference mediating small rna molecules |
| US20020150968A1 (en) * | 2001-01-10 | 2002-10-17 | Wang Peng G. | Glycoconjugate and sugar nucleotide synthesis using solid supports |
| CA2369944A1 (en) | 2001-01-31 | 2002-07-31 | Nucleonics Inc. | Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell |
| AUPR621501A0 (en) | 2001-07-06 | 2001-08-02 | Commonwealth Scientific And Industrial Research Organisation | Delivery of ds rna |
| IL159756A0 (en) | 2001-07-12 | 2004-06-20 | Univ Massachusetts | IN VIVO PRODUCTION OF SMALL INTERFERING RNAs THAT MEDIATE GENE SILENCING |
| JP4344858B2 (ja) | 2001-09-13 | 2009-10-14 | カリフォルニア インスティチュート オブ テクノロジー | 細胞内で抗ウイルス性小rna分子を発現させる方法 |
| JP2005502383A (ja) | 2001-09-27 | 2005-01-27 | ティモシー アルバート ホルトン | 核酸ライブラリーを作製する方法 |
| US20030148519A1 (en) * | 2001-11-14 | 2003-08-07 | Engelke David R. | Intracellular expression and delivery of siRNAs in mammalian cells |
| GB0130955D0 (en) | 2001-12-24 | 2002-02-13 | Cancer Res Ventures | Expression system |
| US20040022748A1 (en) | 2002-03-12 | 2004-02-05 | Unilever Home & Personal Care Usa, Division Of Conopco, Inc. | Method of enhancing skin lightening |
| CA2478904A1 (en) | 2002-03-14 | 2003-09-18 | Commonwealth Scientific And Industrial Research Organisation | Modified gene-silencing rna and uses thereof |
| ITRM20020253A1 (it) | 2002-05-08 | 2003-11-10 | Univ Roma | Molecole chimeriche di snrna con sequenze antisenso per le giunzioni di splicing del gene della distrofina e applicazioni terapeutiche. |
| US20040106566A1 (en) * | 2002-05-17 | 2004-06-03 | Shi-Lung Lin | RNA-splicing and processing-directed gene silencing and the relative applications thereof |
| AU2003297474A1 (en) * | 2002-12-18 | 2004-07-14 | Salk Institute For Biological Studies | Methods of inhibiting gene expression by rna interference |
| CN1750752A (zh) | 2003-02-19 | 2006-03-22 | 联邦科学和工业研究组织 | 使用短dsRNA序列在植物中进行有效的基因沉默 |
| WO2005026356A1 (en) | 2003-09-12 | 2005-03-24 | Commonwealth Scientific And Industrial Research Organisation | Modified gene-silencing nucleic acid molecules and uses thereof |
| CA2650861A1 (en) | 2006-05-03 | 2007-11-15 | Commonwealth Scientific And Industrial Research Organisation | Improved gene silencing methods |
| WO2009109937A1 (en) * | 2008-03-05 | 2009-09-11 | Nxp B.V. | Dynamic mbsfn area configuration method in consideration of radio resource efficiency and system thereof |
-
1999
- 1999-03-19 CN CN200910206175A patent/CN101818145A/zh active Pending
- 1999-03-19 EP EP10183258.2A patent/EP2302057B1/en not_active Expired - Lifetime
- 1999-03-19 ES ES04015041T patent/ES2374290T3/es not_active Expired - Lifetime
- 1999-03-19 AT AT05013010T patent/ATE526406T1/de not_active IP Right Cessation
- 1999-03-19 SK SK1372-2000A patent/SK287538B6/sk not_active IP Right Cessation
- 1999-03-19 HU HU0101225A patent/HU230353B1/hu unknown
- 1999-03-19 SG SG200503921-9A patent/SG141233A1/en unknown
- 1999-03-19 GB GB0024727A patent/GB2353282C/en not_active Expired - Lifetime
- 1999-03-19 CA CA002487328A patent/CA2487328A1/en not_active Abandoned
- 1999-03-19 JP JP2000537990A patent/JP4187413B2/ja not_active Expired - Lifetime
- 1999-03-19 KR KR1020007010419A patent/KR20010042069A/ko not_active Ceased
- 1999-03-19 KR KR1020107006892A patent/KR101054060B1/ko not_active Expired - Lifetime
- 1999-03-19 ES ES05013010T patent/ES2374534T3/es not_active Expired - Lifetime
- 1999-03-19 KR KR1020067005341A patent/KR101085210B1/ko not_active Expired - Lifetime
- 1999-03-19 CA CA002323726A patent/CA2323726C/en not_active Expired - Lifetime
- 1999-03-19 EP EP04015041A patent/EP1555317B1/en not_active Revoked
- 1999-03-19 PL PL99343064A patent/PL343064A1/xx not_active IP Right Cessation
- 1999-03-19 EP EP07008204.5A patent/EP1857549B1/en not_active Expired - Lifetime
- 1999-03-19 WO PCT/AU1999/000195 patent/WO1999049029A1/en not_active Ceased
- 1999-03-19 EP EP99910039A patent/EP1071762A4/en not_active Ceased
- 1999-03-19 BR BRPI9908967A patent/BRPI9908967B1/pt active IP Right Grant
- 1999-03-19 NZ NZ506648A patent/NZ506648A/en not_active IP Right Cessation
- 1999-03-19 SG SG200205122A patent/SG115493A1/en unknown
- 1999-03-19 CA CA002513336A patent/CA2513336A1/en not_active Abandoned
- 1999-03-19 CN CNA2005100833251A patent/CN1796556A/zh active Pending
- 1999-03-19 CN CN99804255A patent/CN1294631A/zh active Pending
- 1999-03-19 AU AU29163/99A patent/AU743316C/en not_active Revoked
- 1999-03-19 EP EP05013010A patent/EP1624060B1/en not_active Revoked
- 1999-03-19 NZ NZ547283A patent/NZ547283A/en not_active IP Right Cessation
- 1999-03-19 AT AT04015041T patent/ATE526405T1/de not_active IP Right Cessation
- 1999-03-19 CZ CZ20003346A patent/CZ295108B6/cs not_active IP Right Cessation
- 1999-03-19 DK DK05013010.3T patent/DK1624060T3/da active
-
2000
- 2000-08-30 ZA ZA200004507A patent/ZA200004507B/xx unknown
-
2001
- 2001-11-30 US US09/997,905 patent/US20030074684A1/en not_active Abandoned
-
2002
- 2002-04-24 AU AU35647/02A patent/AU3564702A/en not_active Abandoned
-
2003
- 2003-08-22 US US10/646,070 patent/US7754697B2/en not_active Expired - Fee Related
-
2004
- 2004-04-08 US US10/821,710 patent/US20040237145A1/en not_active Abandoned
-
2005
- 2005-06-17 AU AU2005202658A patent/AU2005202658B2/en not_active Expired
- 2005-08-02 JP JP2005223953A patent/JP4187737B2/ja not_active Expired - Lifetime
- 2005-09-02 US US11/218,999 patent/US8168774B2/en not_active Expired - Fee Related
- 2005-09-09 AU AU2005209648A patent/AU2005209648B2/en not_active Expired
- 2005-09-15 AU AU2005211538A patent/AU2005211538C1/en not_active Expired
-
2007
- 2007-11-21 JP JP2007302237A patent/JP4460600B2/ja not_active Expired - Lifetime
-
2008
- 2008-11-21 AU AU2008249157A patent/AU2008249157B2/en not_active Ceased
-
2009
- 2009-07-08 JP JP2009161847A patent/JP4981103B2/ja not_active Expired - Lifetime
-
2012
- 2012-04-27 US US13/458,704 patent/US20120277285A1/en not_active Abandoned
-
2013
- 2013-12-20 US US14/137,737 patent/US9963698B2/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998053083A1 (en) * | 1997-05-21 | 1998-11-26 | Zeneca Limited | Gene silencing |
Non-Patent Citations (8)
| Title |
|---|
| ASSAAD F F, TUCKER K L, SIGNER E R: "EPIGENETIC REPEAT-INDUCED GENE SILENCING (RIGS) IN ARABIDOPSIS", PLANT MOLECULAR BIOLOGY, SPRINGER, DORDRECHT., NL, vol. 22, no. 06, 1 January 1993 (1993-01-01), NL, pages 1067 - 1085, XP000982135, ISSN: 0167-4412, DOI: 10.1007/BF00028978 * |
| DORER D R, HENIKHOFF S: "TRANSGENE REPEAT ARRAYS INTERACT WITH DISTANT HETEROCHROMATIN AND CAUSE SILENCING IN CIS AND TRANS", GENETICS, GENETICS SOCIETY OF AMERICA, AUSTIN, TX, US, vol. 147, no. 03, 1 November 1997 (1997-11-01), US, pages 1181 - 1190, XP000987071, ISSN: 0016-6731 * |
| DORER D R, HENIKOFF S: "EXPANSIONS OF TRANSGENE REPEATS CAUSE HETEROCHROMATIN FORMATION ANDGENE SILENCING IN DROSOPHILA", CELL, CELL PRESS, US, vol. 77, no. 07, 1 July 1994 (1994-07-01), US, pages 993 - 1002, XP000982138, ISSN: 0092-8674, DOI: 10.1016/0092-8674(94)90439-1 * |
| GRANT S R: "DISSECTING THE MECHANISMS OF POSTTRANSCRIPTIONAL GENE SILENCING: DIVIDE AND CONQUER", CELL, CELL PRESS, US, vol. 96, no. 03, 5 February 1999 (1999-02-05), US, pages 303 - 306, XP000982139, ISSN: 0092-8674, DOI: 10.1016/S0092-8674(00)80541-3 * |
| HAMILTON ANDREW J ET AL: "A transgene with repeated DNA causes high frequency, post-transcriptional suppression of ACC-oxidase gene expression in tomato.", THE PLANT JOURNAL, BLACKWELL SCIENTIFIC PUBLICATIONS, OXFORD., GB, vol. 15, no. 6, 1 January 1998 (1998-01-01), GB, pages 737 - 746, XP002146504, ISSN: 0960-7412, DOI: 10.1046/j.1365-313X.1998.00251.x * |
| QUE Q, JORGENSEN R A: "HOMOLOGY-BASED CONTROL OF GENE EXPRESSION PATTERNS IN TRANSGENIC PETUNIA FLOWERS", DEVELOPMENTAL GENETICS, NEW-YORK, NY., US, vol. 22, no. 01, 1 January 1998 (1998-01-01), US, pages 100 - 109, XP000987329, ISSN: 0192-253X, DOI: 10.1002/(SICI)1520-6408(1998)22:1<100::AID-DVG10>3.0.CO;2-D * |
| SIJEN T, ET AL.: "RNA-MEDIATED VIRUS RESISTANCE: ROLE OF REPEATED TRANSGENES AND DELINEATION OF TARGETED REGIONS", THE PLANT CELL, AMERICAN SOCIETY OF PLANT BIOLOGISTS, US, vol. 08, 1 December 1996 (1996-12-01), US, pages 2277 - 2294, XP000982134, ISSN: 1040-4651, DOI: 10.1105/tpc.8.12.2277 * |
| STAM M, MOL J N M, KOOTER J M: "THE SILENCE OF GENES IN TRANSGENIC PLANTS", ANNALS OF BOTANY., ACADEMIC PRESS, LONDON., GB, vol. 79, no. 01, 1 January 1997 (1997-01-01), GB, pages 03 - 12, XP000987302, ISSN: 0305-7364, DOI: 10.1006/anbo.1996.0295 * |
Cited By (465)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7304220B2 (en) | 1997-06-12 | 2007-12-04 | North Carolina State University | Regulation of quinolate phosphoribosyl transferase expression |
| US7425670B2 (en) | 1997-06-12 | 2008-09-16 | North Carolina State University | Methods and compositions for protein production in tobacco plants with reduced nicotine |
| US7605308B2 (en) | 1997-06-12 | 2009-10-20 | North Carolina State University | Regulation of quinolate phosphoribosyl transferase expression |
| US7408098B2 (en) | 1997-06-12 | 2008-08-05 | North Carolina State University | Regulation of quinolate phosphoribosyl transferase expression |
| US7560438B2 (en) | 1997-12-23 | 2009-07-14 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded RNA |
| US7538095B2 (en) | 1997-12-23 | 2009-05-26 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded RNA |
| US7622633B2 (en) | 1997-12-23 | 2009-11-24 | Carnegie Institution Of Washington | Genetic inhibition by double-stranded RNA |
| US9102939B2 (en) | 1997-12-23 | 2015-08-11 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded RNA |
| US9029527B2 (en) | 1998-03-20 | 2015-05-12 | Commonwealth Scientific And Industrial Research Organisation | Synthetic genes and genetic constructs |
| US9963698B2 (en) | 1998-03-20 | 2018-05-08 | Commonwealth Scientific And Industrial Research Organisation | Control of gene expression |
| EP1068311B2 (en) † | 1998-04-08 | 2020-12-09 | Commonwealth Scientific and Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| EP3214177A3 (en) * | 1998-04-08 | 2017-11-22 | Commonwealth Scientific and Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| US8598332B1 (en) | 1998-04-08 | 2013-12-03 | Bayer Cropscience N.V. | Methods and means for obtaining modified phenotypes |
| EP2267139A3 (en) * | 1998-04-08 | 2011-05-25 | Commonwealth Scientific and Industrial Research Organization | Methods and means for obtaining modified phenotypes |
| US9441239B2 (en) | 1998-04-08 | 2016-09-13 | Commonwealth Scientific & Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| JP2009261403A (ja) * | 1998-05-26 | 2009-11-12 | Syngenta Participations Ag | 植物内の遺伝子発現のdsrna介在調節 |
| EP1516931A2 (en) | 1998-05-26 | 2005-03-23 | Syngenta Participations AG | DSRNA-mediated regulation of gene expression in plants |
| EP1516931A3 (en) * | 1998-05-26 | 2007-10-31 | Syngenta Participations AG | DSRNA-mediated regulation of gene expression in plants |
| AU2005201044B2 (en) * | 1999-01-30 | 2008-05-29 | Alnylam Pharmaceuticals, Inc. | Method and medicament for inhibiting the expression of a defined gene |
| DE10066235C5 (de) | 1999-01-30 | 2014-08-21 | Alnylam Europe Ag | Verfahren und Medikament zur Hemmung der Expression eines vorgegebenen Gens |
| EP1550719A1 (de) * | 1999-01-30 | 2005-07-06 | Alnylam Europe AG | Verfahren und Medikament zur Hemmung der Expression eines vorgegebenen Gens |
| EP1798285A1 (de) * | 1999-01-30 | 2007-06-20 | Alnylam Europe AG | Verfahren und Medikament zur Hemmung der Expression eines vorgegebenen Gens |
| EP3018207A1 (de) * | 1999-01-30 | 2016-05-11 | Alnylam Europe AG | Oligoribonukleotid zur hemmung der expression eines vorgegebenen gens |
| US9133454B2 (en) | 1999-01-30 | 2015-09-15 | Alnylam Pharmaceuticals, Inc. | Method and medicament for inhibiting the expression of a given gene |
| US9902955B2 (en) | 1999-01-30 | 2018-02-27 | Alnylam Pharmaceuticals, Inc. | Method and medicament for inhibiting the expression of a given gene |
| AU781598B2 (en) * | 1999-04-21 | 2005-06-02 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for inhibiting the function of polynucleotide sequences |
| CN100420748C (zh) * | 1999-05-10 | 2008-09-24 | 辛根塔参与股份公司 | 病毒基因表达的调节 |
| JP2002543783A (ja) * | 1999-05-10 | 2002-12-24 | シンジェンタ・パティシペーションズ・アクチェンゲゼルシャフト | ウイルス遺伝子発現の調節 |
| WO2000068374A1 (en) * | 1999-05-10 | 2000-11-16 | Syngenta Participations Ag | Regulation of viral gene expression |
| EP1801215A3 (en) * | 1999-05-10 | 2008-12-17 | Syngeta Participations AG | Regulation of viral gene expression |
| US10190127B2 (en) | 1999-08-13 | 2019-01-29 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| US9708621B2 (en) | 1999-08-13 | 2017-07-18 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
| US7563949B2 (en) | 1999-08-26 | 2009-07-21 | Monsanto Technology Llc | Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids |
| US7256329B2 (en) | 1999-08-26 | 2007-08-14 | Calgene Llc | Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids |
| US7148336B2 (en) | 1999-08-26 | 2006-12-12 | Calgene Llc | Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acid levels |
| US7067722B2 (en) | 1999-08-26 | 2006-06-27 | Monsanto Technology Llc | Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids |
| US8097778B2 (en) | 1999-08-26 | 2012-01-17 | Monsanto Company | Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids |
| US7531718B2 (en) | 1999-08-26 | 2009-05-12 | Monsanto Technology, L.L.C. | Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids |
| JP2012085641A (ja) * | 1999-11-19 | 2012-05-10 | Cancer Research Technology Ltd | Dsrnaによる遺伝子発現の阻害 |
| JP2015109847A (ja) * | 1999-11-19 | 2015-06-18 | キャンサー・リサーチ・テクノロジー・リミテッドCan | Dsrnaによる遺伝子発現の阻害 |
| US7829693B2 (en) | 1999-11-24 | 2010-11-09 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of a target gene |
| US7351578B2 (en) | 1999-12-10 | 2008-04-01 | Invitrogen Corp. | Use of multiple recombination sites with unique specificity in recombinational cloning |
| US8202846B2 (en) | 2000-03-16 | 2012-06-19 | Cold Spring Harbor Laboratory | Methods and compositions for RNA interference |
| US8383599B2 (en) | 2000-03-16 | 2013-02-26 | Cold Spring Harbor Laboratory | Methods and compositions for RNA interference |
| US7732417B2 (en) | 2000-03-16 | 2010-06-08 | Cold Spring Harbor Laboratory | Methods and compositions for RNA interference using recombinant Dicer and Argonaut |
| US8153776B2 (en) | 2000-03-16 | 2012-04-10 | Cold Spring Harbor Laboratory | Methods and compositions for RNA interference |
| US8790922B2 (en) | 2000-03-30 | 2014-07-29 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA sequence-specific mediators of RNA interference |
| US9012621B2 (en) | 2000-03-30 | 2015-04-21 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA sequence-specific mediators of RNA interference |
| US8394628B2 (en) | 2000-03-30 | 2013-03-12 | University Of Massachusetts | RNA sequence-specific mediators of RNA interference |
| US8420391B2 (en) | 2000-03-30 | 2013-04-16 | University Of Massachusetts | RNA sequence-specific mediators of RNA interference |
| US8552171B2 (en) | 2000-03-30 | 2013-10-08 | University Of Massachusetts | RNA sequence-specific mediators of RNA interference |
| US8742092B2 (en) | 2000-03-30 | 2014-06-03 | University Of Massachusetts | RNA sequence-specific mediators of RNA interference |
| US10472625B2 (en) | 2000-03-30 | 2019-11-12 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA sequence-specific mediators of RNA interference |
| US8632997B2 (en) | 2000-03-30 | 2014-01-21 | University Of Massachusetts | RNA sequence-specific mediators of RNA interference |
| US9193753B2 (en) | 2000-03-30 | 2015-11-24 | University Of Massachusetts | RNA sequence-specific mediators of RNA interference |
| US9012138B2 (en) | 2000-03-30 | 2015-04-21 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA sequence-specific mediators of RNA interference |
| US9309520B2 (en) | 2000-08-21 | 2016-04-12 | Life Technologies Corporation | Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites |
| US6911541B2 (en) | 2000-08-30 | 2005-06-28 | North Carolina State University | Promoter fragment that is recognized by the product of the tobacco Nic gene |
| US7662951B2 (en) | 2000-08-30 | 2010-02-16 | Sirna Therapeutics, Inc. | RNA interference mediated treatment of Alzheimer's disease using short interfering nucleic acid (siNA) |
| US8017765B2 (en) | 2000-08-30 | 2011-09-13 | Merck Sharp & Dohme Corp. | RNA interference mediated treatment of alzheimer's disease using short interfering nucleic acid (siNA) |
| US7192771B2 (en) | 2000-08-30 | 2007-03-20 | North Carolina State University | Plant promoter sequence |
| US6777588B2 (en) | 2000-10-31 | 2004-08-17 | Peter Waterhouse | Methods and means for producing barley yellow dwarf virus resistant cereal plants |
| US7189570B2 (en) | 2000-11-07 | 2007-03-13 | North Carolina State University | Putrescine-n-methyltransferase promoter |
| US7078196B2 (en) | 2000-12-01 | 2006-07-18 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften, E.V. | RNA interference mediating small RNA molecules |
| US8372968B2 (en) | 2000-12-01 | 2013-02-12 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA interference mediating small RNA molecules |
| US8853384B2 (en) | 2000-12-01 | 2014-10-07 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA interference mediating small RNA molecules |
| US8362231B2 (en) | 2000-12-01 | 2013-01-29 | Max-Planck-Gesellschaft zur Föderung der Wissenschaften E.V. | RNA interference mediating small RNA molecules |
| US8445237B2 (en) | 2000-12-01 | 2013-05-21 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA interference mediating small RNA molecules |
| US8895721B2 (en) | 2000-12-01 | 2014-11-25 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA interference mediating small RNA molecules |
| US8329463B2 (en) | 2000-12-01 | 2012-12-11 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA interference mediating small RNA molecules |
| US7056704B2 (en) | 2000-12-01 | 2006-06-06 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | RNA interference mediating small RNA molecules |
| US8796016B2 (en) | 2000-12-01 | 2014-08-05 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA interference mediating small RNA molecules |
| US8895718B2 (en) | 2000-12-01 | 2014-11-25 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA interference mediating small RNA molecules |
| US8933044B2 (en) | 2000-12-01 | 2015-01-13 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA interference mediating small RNA molecules |
| US8778902B2 (en) | 2000-12-01 | 2014-07-15 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA interference mediating small RNA molecules |
| US10633656B2 (en) | 2000-12-01 | 2020-04-28 | Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. | RNA interference mediating small RNA molecules |
| US8765930B2 (en) | 2000-12-01 | 2014-07-01 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA interference mediating small RNA molecules |
| US8993745B2 (en) | 2000-12-01 | 2015-03-31 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA interference mediating small RNA molecules |
| US8945884B2 (en) | 2000-12-11 | 2015-02-03 | Life Technologies Corporation | Methods and compositions for synthesis of nucleic acid molecules using multiplerecognition sites |
| US9074213B2 (en) | 2001-01-09 | 2015-07-07 | Alnylam Pharmacuticals, Inc. | Compositions and methods for inhibiting expression of a target gene |
| US7473525B2 (en) | 2001-01-09 | 2009-01-06 | Alnylam Europe Ag | Compositions and methods for inhibiting expression of anti-apoptotic genes |
| US7767802B2 (en) | 2001-01-09 | 2010-08-03 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of anti-apoptotic genes |
| US7868160B2 (en) | 2001-01-09 | 2011-01-11 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of anti-apoptotic genes |
| US9587240B2 (en) | 2001-01-09 | 2017-03-07 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of a target gene |
| US7846718B2 (en) | 2001-01-26 | 2010-12-07 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for producing efficient silencing construct using recombinational cloning |
| US8877435B2 (en) | 2001-01-26 | 2014-11-04 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for producing efficient silencing construct using recombinational cloning |
| US6933146B2 (en) | 2001-01-26 | 2005-08-23 | Commonwealth Scientific And Industrial Research Corporation | Methods and means for producing efficient silencing construct using recombinational cloning |
| US7732660B2 (en) | 2001-01-26 | 2010-06-08 | Commonwealth Scientific And Industrial Research Corporation | Methods and means for producing efficient silencing construct using recombinational cloning |
| US9051566B2 (en) | 2001-01-31 | 2015-06-09 | Alnylam Pharmaceuticals, Inc. | Post-transcriptional gene silencing using expressed double stranded RNA |
| US7022828B2 (en) | 2001-04-05 | 2006-04-04 | Sirna Theraputics, Inc. | siRNA treatment of diseases or conditions related to levels of IKK-gamma |
| US8017761B2 (en) | 2001-05-18 | 2011-09-13 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of Stearoyl-CoA desaturase (SCD) gene expression using short interfering nucelic acid (siNA) |
| US7491805B2 (en) | 2001-05-18 | 2009-02-17 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| US7517864B2 (en) | 2001-05-18 | 2009-04-14 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA) |
| US7858625B2 (en) | 2001-05-18 | 2010-12-28 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| US7659389B2 (en) | 2001-05-18 | 2010-02-09 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of MYC and/or MYB gene expression using short interfering nucleic acid (siNA) |
| US7964578B2 (en) | 2001-05-18 | 2011-06-21 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| US7833992B2 (en) | 2001-05-18 | 2010-11-16 | Merck Sharpe & Dohme | Conjugates and compositions for cellular delivery |
| US9994853B2 (en) | 2001-05-18 | 2018-06-12 | Sirna Therapeutics, Inc. | Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference |
| US8008472B2 (en) | 2001-05-29 | 2011-08-30 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of human immunodeficiency virus (HIV) gene expression using short interfering nucleic acid (siNA) |
| US6907887B2 (en) | 2001-06-08 | 2005-06-21 | Vector Tobacco Ltd. | Modifying nicotine and nitrosamine levels in tobacco |
| US8263573B2 (en) | 2001-07-06 | 2012-09-11 | Commonwealth Scientific And Industrial Research Organisation | Delivery of dsRNA to arthropods |
| US8101343B2 (en) | 2001-07-06 | 2012-01-24 | Commonwealth Scientific And Industrial Research Organisation | Delivery of dsRNA to arthropods |
| EP2333061A1 (en) | 2001-07-06 | 2011-06-15 | Commonwealth Scientific and Industrial Research Organization | Delivery of dsRNA to arthropods |
| US8877727B2 (en) | 2001-07-06 | 2014-11-04 | Commonwealth Scientific And Industrial Research Organisation | Delivery of dsRNA to arthropods |
| US10323245B2 (en) | 2001-07-06 | 2019-06-18 | Commonwealth Scientific And Industrial Research Organisation | Delivery of dsRNA to arthropods |
| US9085770B2 (en) | 2001-07-06 | 2015-07-21 | Commonwealth Scientific And Industrial Research Organisation | Delivery of dsRNA to arthropods |
| US8415320B2 (en) | 2001-07-06 | 2013-04-09 | Commonwealth Scientific And Industrial Research Organisation | Delivery of dsRNA to arthropods |
| US9663786B2 (en) | 2001-07-06 | 2017-05-30 | Commonwealth Scientific And Industrial Research Organisation | Delivery of dsRNA to arthropods |
| US8232260B2 (en) | 2001-07-12 | 2012-07-31 | University Of Massachusetts | In vivo production of small interfering RNAs that mediate gene silencing |
| US10731155B2 (en) | 2001-07-12 | 2020-08-04 | University Of Massachusetts | In vivo production of small interfering RNAs that mediate gene silencing |
| US8530438B2 (en) * | 2001-07-12 | 2013-09-10 | University Of Massachusetts | Vivo production of small interfering RNAs that mediate gene silencing |
| US7893036B2 (en) | 2001-07-12 | 2011-02-22 | University Of Massachusetts | In vivo production of small interfering RNAs that mediate gene silencing |
| US20180163206A1 (en) * | 2001-07-12 | 2018-06-14 | University Of Massachusetts | In vivo production of small interfering rnas that mediate gene silencing |
| US9175287B2 (en) | 2001-07-12 | 2015-11-03 | University Of Massachusetts | In vivo production of small interfering RNAs that mediate gene silencing |
| US8557785B2 (en) * | 2001-07-12 | 2013-10-15 | University Of Massachusetts | In vivo production of small interfering RNAS that mediate gene silencing |
| US9850487B2 (en) | 2001-07-12 | 2017-12-26 | University Of Massachusetts | In vivo production of small interfering RNAs that mediate gene silencing |
| US7691995B2 (en) | 2001-07-12 | 2010-04-06 | University Of Massachusetts | In vivo production of small interfering RNAS that mediate gene silencing |
| US10590418B2 (en) | 2001-07-23 | 2020-03-17 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for RNAi mediated inhibition of gene expression in mammals |
| US9018179B2 (en) | 2001-07-23 | 2015-04-28 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for RNAi mediated inhibition of gene expression in mammals |
| US10517887B2 (en) | 2001-07-23 | 2019-12-31 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for RNAi mediated inhibition of gene expression in mammals |
| US7612194B2 (en) | 2001-07-24 | 2009-11-03 | Monsanto Technology Llc | Nucleic acid sequences from Diabrotica virgifera virgifera LeConte and uses thereof |
| US8614370B2 (en) | 2001-07-24 | 2013-12-24 | Monsanto Technology Llc | Nucleic acid sequences from Diabrotica virgifera virgifera leconte and uses thereof |
| US8829264B2 (en) | 2002-01-22 | 2014-09-09 | Cold Spring Harbor Laboratory | Methods and compositions for RNA interference |
| US10106793B2 (en) | 2002-02-01 | 2018-10-23 | Life Technologies Corporation | Double-stranded oligonucleotides |
| US10196640B1 (en) | 2002-02-01 | 2019-02-05 | Life Technologies Corporation | Oligonucleotide compositions with enhanced efficiency |
| US9592250B2 (en) | 2002-02-01 | 2017-03-14 | Life Technologies Corporation | Double-stranded oligonucleotides |
| US10036025B2 (en) | 2002-02-01 | 2018-07-31 | Life Technologies Corporation | Oligonucleotide compositions with enhanced efficiency |
| US9777275B2 (en) | 2002-02-01 | 2017-10-03 | Life Technologies Corporation | Oligonucleotide compositions with enhanced efficiency |
| US10626398B2 (en) | 2002-02-01 | 2020-04-21 | Life Technologies Corporation | Oligonucleotide compositions with enhanced efficiency |
| US9796978B1 (en) | 2002-02-01 | 2017-10-24 | Life Technologies Corporation | Oligonucleotide compositions with enhanced efficiency |
| US9732344B2 (en) | 2002-02-20 | 2017-08-15 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| EP3354656A1 (en) | 2002-02-20 | 2018-08-01 | Sirna Therapeutics, Inc. | Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina) |
| US7897755B2 (en) | 2002-02-20 | 2011-03-01 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA) |
| US7897753B2 (en) | 2002-02-20 | 2011-03-01 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of XIAP gene expression using short interfering nucleic acid (siNA) |
| US7700760B2 (en) | 2002-02-20 | 2010-04-20 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of vascular cell adhesion molecule (VCAM) gene expression using short interfering nucleic acid (siNA) |
| EP3926046A2 (en) | 2002-02-20 | 2021-12-22 | Sirna Therapeutics, Inc. | Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina) |
| US7795422B2 (en) | 2002-02-20 | 2010-09-14 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of hypoxia inducible factor 1 (HIF1) gene expression using short interfering nucleic acid (siNA) |
| US7691999B2 (en) | 2002-02-20 | 2010-04-06 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of NOGO and NOGO receptor gene expression using short interfering nucleic acid (siNA) |
| US7910724B2 (en) | 2002-02-20 | 2011-03-22 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of Fos gene expression using short interfering nucleic acid (siNA) |
| US7910725B2 (en) | 2002-02-20 | 2011-03-22 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA) |
| US7915400B2 (en) | 2002-02-20 | 2011-03-29 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of hepatitis C virus (HCV) gene expression using short interfering nucleic acid (siNA) |
| US10889815B2 (en) | 2002-02-20 | 2021-01-12 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| US8846894B2 (en) | 2002-02-20 | 2014-09-30 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| US7923549B2 (en) | 2002-02-20 | 2011-04-12 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA) |
| WO2003070918A2 (en) | 2002-02-20 | 2003-08-28 | Ribozyme Pharmaceuticals, Incorporated | Rna interference by modified short interfering nucleic acid |
| US7928218B2 (en) | 2002-02-20 | 2011-04-19 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA) |
| US7928220B2 (en) | 2002-02-20 | 2011-04-19 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of stromal cell-derived factor-1 (SDF-1) gene expression using short interfering nucleic acid (siNA) |
| US7928219B2 (en) | 2002-02-20 | 2011-04-19 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (SINA) |
| US7935812B2 (en) | 2002-02-20 | 2011-05-03 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of hepatitis C virus (HCV) expression using short interfering nucleic acid (siNA) |
| US7943757B2 (en) | 2002-02-20 | 2011-05-17 | Mcswiggen James | RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA) |
| US7678897B2 (en) | 2002-02-20 | 2010-03-16 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA) |
| US7667029B2 (en) | 2002-02-20 | 2010-02-23 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of checkpoint kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA) |
| US7897752B2 (en) | 2002-02-20 | 2011-03-01 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of telomerase gene expression using short interfering nucleic acid (siNA) |
| US7667030B2 (en) | 2002-02-20 | 2010-02-23 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of matrix metalloproteinase 13 (MMP13) gene expression using short interfering nucleic acid (siNA) |
| US7956178B2 (en) | 2002-02-20 | 2011-06-07 | Mcswiggen James | RNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acid (siNA) |
| US7662952B2 (en) | 2002-02-20 | 2010-02-16 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acid (siNA) |
| US7659390B2 (en) | 2002-02-20 | 2010-02-09 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of muscarinic colinergic receptor gene expression using short interfering nucleic acid (siNA) |
| EP2902406A1 (en) | 2002-02-20 | 2015-08-05 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA) |
| US7897756B2 (en) | 2002-02-20 | 2011-03-01 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of NOGO and NOGO receptor gene expression using short interfering nucleic acid (siNA) |
| EP2287305A1 (en) | 2002-02-20 | 2011-02-23 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA) |
| US10662428B2 (en) | 2002-02-20 | 2020-05-26 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| WO2003070914A3 (en) * | 2002-02-20 | 2003-12-24 | Sirna Therapeutics Inc | RNA INTERFERENCE MEDIATED INHIBITION OF FOS GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| US7977472B2 (en) | 2002-02-20 | 2011-07-12 | Leonid Beigelman | RNA interference mediated inhibition of myostatin gene expression using short interfering nucleic acid (siNA) |
| WO2003074654A3 (en) * | 2002-02-20 | 2004-02-05 | Sirna Therapeurics Inc | Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina) |
| US7985853B2 (en) | 2002-02-20 | 2011-07-26 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of platelet derived growth factor (PDGF) and platelet derived growth factor receptor (PDGFR) gene expression using short interfering nucleic acid (siNA) |
| US7989612B2 (en) | 2002-02-20 | 2011-08-02 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| WO2003070966A3 (en) * | 2002-02-20 | 2004-03-11 | Sirna Therapeutics Inc | RNA INTERFERENCE MEDIATED TARGET DISCOVERY AND TARGET VALIDATION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| EP2042510A2 (en) | 2002-02-20 | 2009-04-01 | Sirna Therapeutics Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleid acid (siNA) |
| WO2003070972A3 (en) * | 2002-02-20 | 2004-06-03 | Ribozyme Pharm Inc | RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| US8008473B2 (en) | 2002-02-20 | 2011-08-30 | Mcswiggen James | RNA interference mediated inhibition of TNF and TNF receptor gene expression using short interfering nucleic acid (siNA) |
| EP2287306A1 (en) | 2002-02-20 | 2011-02-23 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA) |
| US8013146B2 (en) | 2002-02-20 | 2011-09-06 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of matrix metalloproteinase 13 (MMP13) gene expression using short interfering nucleic acid (siNA) |
| US8013143B2 (en) | 2002-02-20 | 2011-09-06 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of CXCR4 gene expression using short interfering nucleic acid (siNA) |
| US10351852B2 (en) | 2002-02-20 | 2019-07-16 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| US7893248B2 (en) | 2002-02-20 | 2011-02-22 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of Myc and/or Myb gene expression using short interfering nucleic acid (siNA) |
| US9181551B2 (en) | 2002-02-20 | 2015-11-10 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| US7176304B2 (en) | 2002-02-20 | 2007-02-13 | Mcswiggen James | RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA) |
| US7855284B2 (en) | 2002-02-20 | 2010-12-21 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of checkpoint kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA) |
| GB2396616A (en) * | 2002-02-20 | 2004-06-30 | Sirna Therapeutics Inc | RNA interference mediated inhibition of gene expression using short interfering nucleic acid (SINA) |
| US8067575B2 (en) | 2002-02-20 | 2011-11-29 | Merck, Sharp & Dohme Corp. | RNA interference mediated inhibition of cyclin D1 gene expression using short interfering nucleic acid (siNA) |
| US8076472B2 (en) | 2002-02-20 | 2011-12-13 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of muscarinic colinergic receptor gene expression using short interfering nucleic acid (siNA) |
| US9657294B2 (en) | 2002-02-20 | 2017-05-23 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| US7897757B2 (en) | 2002-02-20 | 2011-03-01 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of protein tyrosine phosphatase-1B (PTP-1B) gene expression using short interfering nucleic acid (siNA) |
| EP3459963A1 (en) | 2002-02-20 | 2019-03-27 | Sirna Therapeutics, Inc. | Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina) |
| US9738899B2 (en) | 2002-02-20 | 2017-08-22 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| US9771588B2 (en) | 2002-02-20 | 2017-09-26 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| WO2005028649A1 (en) | 2002-02-20 | 2005-03-31 | Sirna Therapeutics, Inc. | RNA INTERFERENCE MEDIATED INHIBITION OF VASCULAR ENDOTHELIAL GROWTH FACTOR AND VASCULAR ENDOTHELIAL GROWTH FACTOR RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| US8273866B2 (en) | 2002-02-20 | 2012-09-25 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SINA) |
| US7858771B2 (en) | 2002-02-20 | 2010-12-28 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of muscarinic colinergic receptor gene expression using short interfering nucleic acid (siNA) |
| US8258288B2 (en) | 2002-02-20 | 2012-09-04 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of respiratory syncytial virus (RSV) expression using short interfering nucleic acid (siNA) |
| WO2003070193A3 (en) * | 2002-02-20 | 2006-08-24 | James Mcswiggen | RNA interference mediated inhibition of HIV gene expression using short interfering nucleic acid (siNA) |
| US8153778B2 (en) | 2002-02-20 | 2012-04-10 | Merck Sharp & Dohme Corp. | RNA interference mediated inhibition of vascular cell adhesion molecule (VCAM) gene expression using short interfering nucleic acid (siNA) |
| US8202979B2 (en) | 2002-02-20 | 2012-06-19 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid |
| US10000754B2 (en) | 2002-02-20 | 2018-06-19 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| EP2278004A1 (en) | 2002-02-20 | 2011-01-26 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA) |
| GB2396616B (en) * | 2002-02-20 | 2005-09-21 | Sirna Therapeutics Inc | RNA interference mediated inhibition of gene expression using double stranded short interfering nucleic acid (SINA) |
| US9957517B2 (en) | 2002-02-20 | 2018-05-01 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| WO2003076620A1 (en) | 2002-03-14 | 2003-09-18 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for monitoring and modulating gene silencing |
| US8802922B2 (en) | 2002-03-21 | 2014-08-12 | Monsanto Technology Llc | Nucleic acid constructs and methods for producing altered seed oil compositions |
| US7601888B2 (en) | 2002-03-21 | 2009-10-13 | Monsanto Technology L.L.C. | Nucleic acid constructs and methods for producing altered seed oil compositions |
| US7566813B2 (en) | 2002-03-21 | 2009-07-28 | Monsanto Technology, L.L.C. | Nucleic acid constructs and methods for producing altered seed oil compositions |
| US10280430B2 (en) | 2002-03-21 | 2019-05-07 | Monsanto Technology Llc | Nucleic acid constructs and methods for producing altered seed oil compositions |
| US8299042B2 (en) | 2002-04-26 | 2012-10-30 | Alnylam Pharmaceuticals, Inc. | Methods and compositions for silencing genes without inducing toxicity |
| US9850485B2 (en) | 2002-05-03 | 2017-12-26 | Duke University | Method of regulating gene expression |
| US9267145B2 (en) | 2002-05-03 | 2016-02-23 | Duke University | Method of regulating gene expression |
| US9856476B2 (en) | 2002-05-03 | 2018-01-02 | Duke University | Method of regulating gene expression |
| US10233451B2 (en) | 2002-05-03 | 2019-03-19 | Duke University | Method of regulating gene expression |
| US7166771B2 (en) | 2002-06-21 | 2007-01-23 | Monsanto Technology Llc | Coordinated decrease and increase of gene expression of more than one gene using transgenic constructs |
| US7452987B2 (en) | 2002-08-05 | 2008-11-18 | Silence Therapeutics Aktiengesellschaft (Ag) | Interfering RNA molecules |
| US9487779B2 (en) | 2002-08-05 | 2016-11-08 | University Of Iowa Research Foundation | siRNA-mediated gene silencing |
| US8779116B2 (en) | 2002-08-05 | 2014-07-15 | University Of Iowa Research Foundation | SiRNA-mediated gene silencing |
| US8481710B2 (en) | 2002-08-05 | 2013-07-09 | University Of Iowa Research Foundation | RNA interference suppression of neurodegenerative diseases and methods of use thereof |
| US8324370B2 (en) | 2002-08-05 | 2012-12-04 | Silence Therapeutics Aktiengesellschaft (Ag) | Interfering RNA molecules |
| US9695423B2 (en) | 2002-08-05 | 2017-07-04 | Silence Therapeutics Gmbh | Interfering RNA molecules |
| US8329890B2 (en) | 2002-08-05 | 2012-12-11 | University Of Iowa Research Foundation | SiRNA-mediated gene silencing |
| US10266829B2 (en) | 2002-08-05 | 2019-04-23 | Silence Therapeutics Gmbh | Interfering RNA molecules |
| US9783802B2 (en) | 2002-08-05 | 2017-10-10 | Silence Therapeutics Gmbh | Interfering RNA molecules |
| US8524879B2 (en) | 2002-08-05 | 2013-09-03 | University Of Iowa Research Foundation | RNA interference suppresion of neurodegenerative diseases and methods of use thereof |
| US10323246B2 (en) | 2002-08-05 | 2019-06-18 | Silence Therapeutics Gmbh | Interfering RNA molecules |
| US10329568B2 (en) | 2002-08-05 | 2019-06-25 | Silence Therapeutics Gmbh | Interfering RNA molecules |
| US11578328B2 (en) | 2002-08-05 | 2023-02-14 | Silence Therapeutics Gmbh | Interfering RNA molecules |
| US8933215B2 (en) | 2002-08-05 | 2015-01-13 | Silence Therapeutics Aktiengesellschaft (Ag) | Interfering RNA molecules |
| US10774332B2 (en) | 2002-08-05 | 2020-09-15 | Silence Therapeutics Gmbh | Interfering RNA molecules |
| US9790505B2 (en) | 2002-08-05 | 2017-10-17 | Silence Therapeutics Gmbh | Interfering RNA molecules |
| US9260716B2 (en) | 2002-08-05 | 2016-02-16 | University Of Iowa Research Foundation | RNA interference suppression of neurodegenerative diseases and methods of use thereof |
| US9222092B2 (en) | 2002-08-05 | 2015-12-29 | Silence Therapeutics Gmbh | Interfering RNA molecules |
| US7893245B2 (en) | 2002-08-05 | 2011-02-22 | Silence Therapeutics Aktiengesellschaft (Ag) | Interfering RNA molecules |
| US10072264B2 (en) | 2002-08-05 | 2018-09-11 | University Of Iowa Research Foundation | RNA interference suppression of neurodegenerative diseases and methods of use |
| US9790501B2 (en) | 2002-08-05 | 2017-10-17 | Silence Therapeutics Gmbh | Interfering RNA molecules |
| US9758784B1 (en) | 2002-08-05 | 2017-09-12 | Silence Therapeutics Gmbh | Interfering RNA molecules |
| US7795493B2 (en) | 2002-08-21 | 2010-09-14 | Revivicor, Inc. | Porcine animals lacking any expression of functional alpha 1, 3 galactosyltransferase |
| US10912863B2 (en) | 2002-08-21 | 2021-02-09 | Revivicor, Inc. | Tissue products derived from animals lacking any expression of functional alpha 1, 3 galactosyltransferase |
| US11172658B2 (en) | 2002-08-21 | 2021-11-16 | Revivicor, Inc. | Porcine animals lacking expression of functional alpha 1, 3 galactosyltransferase |
| US10130737B2 (en) | 2002-08-21 | 2018-11-20 | Revivicor, Inc. | Tissue products derived from animals lacking any expression of functional alpha 1, 3 galactosyltransferase |
| US8106251B2 (en) | 2002-08-21 | 2012-01-31 | Revivicor, Inc. | Tissue products derived from porcine animals lacking any expression of functional alpha 1,3 galactosyltransferase |
| US7956176B2 (en) | 2002-09-05 | 2011-06-07 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| US7923547B2 (en) | 2002-09-05 | 2011-04-12 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| WO2004041838A1 (en) * | 2002-11-01 | 2004-05-21 | University Of Massachusetts | Regulation of transcription elongation factors |
| EP1445321A1 (en) | 2002-12-18 | 2004-08-11 | Monsanto Technology LLC | Maize embryo-specific promoter compositions and methods for use thereof |
| EP2116606A1 (en) | 2003-03-28 | 2009-11-11 | Monsanto Technology, LLC | Novel plant promoters for use in early seed development |
| EP2116607A1 (en) | 2003-03-28 | 2009-11-11 | Monsanto Technology, LLC | Novel plant promoters for use in early seed development |
| US7960614B2 (en) | 2003-06-06 | 2011-06-14 | Arborgen, Llc | Plant transformation and selection |
| US8633028B2 (en) * | 2003-07-02 | 2014-01-21 | Musc Foundation For Research Development | dsRNA induced specific and non-specific immunity in crustaceans and other invertebrates and biodelivery vehicles for use therein |
| US7695426B2 (en) | 2003-08-20 | 2010-04-13 | Biological Resources Pty Ltd | Methods for enhancing viability |
| US8716554B2 (en) | 2003-08-21 | 2014-05-06 | Rahan Meristem (1998) Ltd. Plant Propagation & Biotechnology | Plants resistant to cytoplasm-feeding parasites |
| US7795504B2 (en) | 2003-09-24 | 2010-09-14 | Monsanto Technology Llc | Coordinated decrease and increase of gene expression of more than one gene using transgenic constructs |
| US7560538B2 (en) | 2003-11-05 | 2009-07-14 | University Of Pittsburgh | Porcine isogloboside 3 synthase protein, cDNA, genomic organization, and regulatory region |
| US10793873B2 (en) | 2003-11-21 | 2020-10-06 | Revivicor, Inc. | Use of interfering RNA in the production of transgenic animals |
| WO2005081714A2 (en) | 2003-11-21 | 2005-09-09 | Revivicor, Inc. | Use of interfering rna in the production of transgenic animals |
| US9534252B2 (en) | 2003-12-01 | 2017-01-03 | Life Technologies Corporation | Nucleic acid molecules containing recombination sites and methods of using the same |
| EP2322637A1 (en) | 2003-12-24 | 2011-05-18 | G2 Inflammation Pty Ltd | Transgenic non-human mammal comprising a polynucleotide encoding human or humanized C5AR |
| WO2005060739A1 (en) | 2003-12-24 | 2005-07-07 | G2 Inflammation Pty Ltd | Transgenic non-human mammal comprising a polynucleotide encoding human or humanized c5ar |
| US7858769B2 (en) | 2004-02-10 | 2010-12-28 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA) |
| WO2005077116A2 (en) | 2004-02-10 | 2005-08-25 | Mosanto Technology, Llc | Recombinant dna for gene suppression |
| US7855323B2 (en) | 2004-02-10 | 2010-12-21 | Monsanto Technology Llc | Recombinant DNA for gene suppression |
| US7683237B2 (en) | 2004-02-10 | 2010-03-23 | Monsanto Technology Llc | Maize seed with synergistically enhanced lysine content |
| US10772276B2 (en) | 2004-02-10 | 2020-09-15 | Monsanto Technology Llc | Enhanced zein reduction in transgenic corn seed |
| EP3290516A1 (en) | 2004-02-10 | 2018-03-07 | Monsanto Technology LLC | Recombinant dna for gene suppression |
| US9913487B2 (en) | 2004-02-10 | 2018-03-13 | Monsanto Technology Llc | Enhanced zein reduction in transgenic corn seed |
| US9006414B2 (en) | 2004-02-10 | 2015-04-14 | Monsanto Technology Llc | Recombinant DNA for gene suppression |
| US9976139B2 (en) | 2004-02-10 | 2018-05-22 | Monsanto Technology Llc | Recombinant DNA for gene suppression |
| EP2365072A1 (en) | 2004-02-10 | 2011-09-14 | Monsanto Technology LLC | Recombinant dna for gene suppression |
| US8283461B2 (en) | 2004-03-05 | 2012-10-09 | Benitec, Inc. | Multiple promoter expression cassettes for simultaneous delivery of RNAi agents |
| US7727970B2 (en) | 2004-03-05 | 2010-06-01 | Benitec, Inc. | Multiple promoter expression cassettes for simultaneous delivery of RNAi agents targeted to Hepatitis C virus |
| US8691967B2 (en) | 2004-03-05 | 2014-04-08 | Benitec, Inc. | Multiple promoter expression cassettes for simultaneous delivery of RNAi agents |
| WO2005087926A3 (en) * | 2004-03-05 | 2006-03-16 | Benitec Inc | Multiple promoter expression cassettes for simultaneous delivery of rnai agents |
| EP2292773A1 (en) | 2004-03-25 | 2011-03-09 | Monsanto Technology LLC | Genes and uses for plant improvement |
| US8049069B2 (en) | 2004-03-31 | 2011-11-01 | Commonwealth Scientific And Industrial Research Organisation | Genes involved in plant fibre development |
| US9340797B2 (en) | 2004-04-09 | 2016-05-17 | Monsanto Technology Llc | Compositions and methods for control of insect infestations in plants |
| US10167484B2 (en) | 2004-04-09 | 2019-01-01 | Monsanto Technology Llc | Compositions and methods for control of insect infestations in plants |
| US11685930B2 (en) | 2004-04-09 | 2023-06-27 | Monsanto Technology, Llc | Compositions and methods for control of insect infestations in plants |
| EP2402441A1 (en) | 2004-04-09 | 2012-01-04 | Monsanto Technology, LLC | Compositions and methods for control of insect infestations in plants |
| US8946510B2 (en) | 2004-04-09 | 2015-02-03 | Monsanto Technology Llc | Compositions and methods for control of insect infestations in plants |
| US12077770B2 (en) | 2004-04-09 | 2024-09-03 | Monsanto Technology Llc | Compositions and methods for control of insect infestations in plants |
| EP2308971A1 (en) | 2004-04-09 | 2011-04-13 | Monsanto Technology LLC | Compositions and methods for control of insect infestations in plants |
| WO2005110068A2 (en) | 2004-04-09 | 2005-11-24 | Monsanto Technology Llc | Compositions and methods for control of insect infestations in plants |
| US10787680B2 (en) | 2004-04-09 | 2020-09-29 | Monsanto Technology Llc | Compositions and methods for control of insect infestations in plants |
| US11492638B2 (en) | 2004-04-09 | 2022-11-08 | Monsanto Technology, Llc | Compositions and methods for control of insect infestations in plants |
| US9238822B2 (en) | 2004-04-09 | 2016-01-19 | Monsanto Technology Llc | Compositions and methods for control of insect infestations in plants |
| EP2363492A2 (en) | 2004-04-22 | 2011-09-07 | Commonwealth Scientific and Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells. |
| EP2357244A2 (en) | 2004-04-22 | 2011-08-17 | Commonwealth Scientific and Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells. |
| EP2357243A2 (en) | 2004-04-22 | 2011-08-17 | Commonwealth Scientific and Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells. |
| US8946402B2 (en) | 2004-04-23 | 2015-02-03 | The Trustees Of Columbia University In The City Of New York | Inhibition of hairless protein mRNA |
| US8329667B2 (en) | 2004-04-23 | 2012-12-11 | The Trustees Of Columbia University In The City Of New York | Inhibition of hairless protein mRNA |
| US10508277B2 (en) | 2004-05-24 | 2019-12-17 | Sirna Therapeutics, Inc. | Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference |
| EP1621632A1 (en) | 2004-07-31 | 2006-02-01 | Monsanto Technology, LLC | Genes and uses for plant improvement |
| EP2295582A2 (en) | 2004-07-31 | 2011-03-16 | Monsanto Technology LLC | Genes and uses for plant improvement |
| US8461418B2 (en) | 2004-08-11 | 2013-06-11 | Monsanto Technology Llc | Enhanced zein reduction in transgenic corn seed |
| EP2330203A3 (en) * | 2004-10-25 | 2011-10-05 | Devgen NV | Rna constructs |
| WO2006046148A3 (en) * | 2004-10-25 | 2006-11-30 | Devgen Nv | Rna constructs |
| EP2330203A2 (en) | 2004-10-25 | 2011-06-08 | Devgen NV | Rna constructs |
| WO2006046148A2 (en) | 2004-10-25 | 2006-05-04 | Devgen Nv | Rna constructs |
| EP2003205A2 (en) | 2004-12-28 | 2008-12-17 | Pioneer Hi-Bred International, Inc. | Improved grain quality through altered expression of seed proteins |
| EP2584033A1 (en) | 2005-01-12 | 2013-04-24 | Monsanto Technology LLC | Genes and uses for plant improvement |
| EP3059306A1 (en) | 2005-01-12 | 2016-08-24 | Monsanto Technology LLC | Genes and uses for plant improvement |
| EP2489726A2 (en) | 2005-01-12 | 2012-08-22 | Monsanto Technology LLC | Genes and uses for plant improvement |
| EP2338905A2 (en) | 2005-02-23 | 2011-06-29 | North Carolina State University | Alteration of tobacco alkaloid content through modification of specific cytochrome p450 genes |
| WO2006099249A2 (en) | 2005-03-10 | 2006-09-21 | Monsanto Technology Llc | Maize seed with synergistically enhanced lysine content |
| WO2006133983A1 (en) | 2005-04-19 | 2006-12-21 | Basf Plant Science Gmbh | Starchy-endosperm and/or germinating embryo-specific expression in mono-cotyledonous plants |
| EP2261361A2 (en) | 2005-05-25 | 2010-12-15 | Pioneer Hi-Bred International Inc. | Methods for improving crop plant architecture and yield |
| EP2261362A2 (en) | 2005-05-25 | 2010-12-15 | Pioneer Hi-Bred International Inc. | Methods for improving crop plant architecture and yield |
| EP2431473A1 (en) | 2005-09-16 | 2012-03-21 | Monsanto Technology LLC | Methods for genetic control of insect infestations in plants and compositions thereof |
| EP2439279A1 (en) | 2005-09-16 | 2012-04-11 | Monsanto Technology LLC | Methods for genetic control of insect infestations in plants and compositions thereof |
| US9695439B2 (en) | 2005-09-16 | 2017-07-04 | Monsanto Technology Llc | Methods for genetic control of insect infestations in plants and compositions thereof |
| US10538783B2 (en) | 2005-09-16 | 2020-01-21 | Monsanto Technology Llc | Methods for genetic control of insect infestations in plants and compositions thereof |
| EP2426208A1 (en) | 2005-09-16 | 2012-03-07 | Monsanto Technology, LLC | Methods for genetic control of insect infestations in plants and compositions thereof |
| EP2275563A2 (en) | 2005-09-16 | 2011-01-19 | deVGen N.V. | Transgenic plant-based methods for plant insect pests using RNAi |
| EP2281896A2 (en) | 2005-09-16 | 2011-02-09 | deVGen N.V. | Transgenic plant-based methods for plant insect pests using RNAi |
| EP3173486A1 (en) | 2005-09-16 | 2017-05-31 | Monsanto Technology LLC | Methods for genetic control of insect infestations in plants and compositions thereof |
| EP2275562A2 (en) | 2005-09-16 | 2011-01-19 | deVGen N.V. | Transgenic plant-based methods for plant insect pests using RNAi |
| US11312975B2 (en) | 2005-09-16 | 2022-04-26 | Monsanto Technology Llc | Methods for genetic control of insect infestations in plants and compositions thereof |
| EP2330207A2 (en) | 2005-09-16 | 2011-06-08 | deVGen N.V. | Transgenic plant-based methods for plant pests using RNAi |
| US11939589B2 (en) | 2005-09-16 | 2024-03-26 | Monsanto Technology Llc | Methods for genetic control of insect infestations in plants and compositions thereof |
| EP2439278A1 (en) | 2005-09-16 | 2012-04-11 | Monsanto Technology LLC | Methods for genetic control of insect infestations in plants and compositions thereof |
| EP3508582A1 (en) | 2005-09-16 | 2019-07-10 | Monsanto Technology LLC | Methods for genetic control of insect infestations in plants and compositions thereof |
| US8759611B2 (en) | 2005-09-16 | 2014-06-24 | Monsanto Technology Llc | Methods for genetic control of insect infestation in plants and compositions thereof |
| EP2295584A2 (en) | 2005-09-16 | 2011-03-16 | deVGen N.V. | Transgenic plant-based methods for plant pests using RNAi |
| US7943819B2 (en) | 2005-09-16 | 2011-05-17 | Monsanto Technology Llc | Methods for genetic control of insect infestations in plants and compositions thereof |
| EP2980220A1 (en) | 2005-09-20 | 2016-02-03 | BASF Plant Science GmbH | Improved methods controlling gene expression |
| US8093369B2 (en) | 2005-10-11 | 2012-01-10 | Ben Gurion University Of The Negev Research And Development Authority Ltd. | Compositions for silencing the expression of VDAC1 and uses thereof |
| US8269082B2 (en) | 2005-10-20 | 2012-09-18 | Commonwealth Scientific And Industrial Research Organisation | Cereals with altered dormancy |
| US7884264B2 (en) | 2006-01-17 | 2011-02-08 | Biolex Therapeutics, Inc. | Compositions and methods for inhibition of fucosyltransferase and xylosyltransferase expression in duckweed plants |
| US8716557B2 (en) | 2006-01-17 | 2014-05-06 | Synthon Biopharmaceuticals B.V. | Compositions and methods for inhibition of fucosyltransferase and xylosyltransferase expression in plants |
| EP2730587A2 (en) | 2006-02-09 | 2014-05-14 | Pioneer Hi-Bred International, Inc. | Genes for enhancing nitrogen utilization efficiency in crop plants |
| WO2007095469A2 (en) | 2006-02-10 | 2007-08-23 | Monsanto Technology Llc | Identification and use of target genes for control of plant parasitic nematodes |
| EP2426206A2 (en) | 2006-02-13 | 2012-03-07 | Monsanto Technology LLC | Selecting and stablizing dsRNA constructs |
| US11708577B2 (en) | 2006-02-13 | 2023-07-25 | Monsanto Technology Llc | Modified gene silencing |
| US9765351B2 (en) | 2006-02-13 | 2017-09-19 | Monsanto Technology Llc | Modified gene silencing |
| US10941398B2 (en) | 2006-02-13 | 2021-03-09 | Monsanto Technology Llc | Selecting and stabilizing dsRNA constructs |
| EP2292739A1 (fr) | 2006-03-24 | 2011-03-09 | Institut National De La Recherche Agronomique | Procédé de préparation de cellules aviaires differenciées et gènes impliqués dans le maintien de la pluripotence |
| EP2251349A1 (en) | 2006-04-19 | 2010-11-17 | Pioneer Hi-Bred International, Inc. | Isolated polynucleotide molecules corresponding to mutant and wild-type alleles of the maize D9 gene and methods of use |
| US8536429B2 (en) | 2006-07-12 | 2013-09-17 | Commonwealth Scientific And Industrial Research Organisation | Polynucleotides encoding a NAX2 polypeptide and methods for enhancing salinity tolerance in plants |
| EP2059596B1 (en) * | 2006-08-31 | 2017-10-04 | Monsanto Technology, LLC | Phased small rnas |
| US9309512B2 (en) | 2006-08-31 | 2016-04-12 | Monsanto Technology Llc | Phased small RNAs |
| US10301623B2 (en) | 2006-08-31 | 2019-05-28 | Monsanto Technology Llc | Phased small RNAs |
| US8895805B2 (en) | 2006-12-04 | 2014-11-25 | Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences | Method for modifying insect resistance of plants by utilizing RNAi technique |
| US9290777B2 (en) | 2007-02-05 | 2016-03-22 | National University Of Singapore | Putative cytokinin receptor and methods for use thereof |
| US8796442B2 (en) | 2007-03-21 | 2014-08-05 | Brookhaven Science Associates, Llc. | Combined hairpin-antisense compositions and methods for modulating expression |
| WO2008116094A2 (en) | 2007-03-21 | 2008-09-25 | Brookhaven Science Associates, Llc | Combined hairpin-antisense compositions and methods for modulating expression |
| US9193972B2 (en) | 2007-03-21 | 2015-11-24 | Brookhaven Science Associates, Llc | Combined hairpin-antisense compositions and methods for modulating expression |
| US20100145015A1 (en) * | 2007-03-26 | 2010-06-10 | Uri Galili | Compositions and methods for increasing immunogenicity of glycoprotein vaccines |
| US9662383B2 (en) * | 2007-03-26 | 2017-05-30 | University Of Massachusetts | Compositions and methods for increasing immunogenicity of glycoprotein vaccines |
| US10201601B2 (en) | 2007-03-26 | 2019-02-12 | University Of Massachusetts | Compositions and methods for increasing immunogenicity of glycoprotein vaccines |
| WO2008157263A2 (en) | 2007-06-15 | 2008-12-24 | Arkansas State University | Methods of delivery of molecules to cells using a ricin subunit and compositions relating to same |
| WO2009021285A1 (en) | 2007-08-13 | 2009-02-19 | Commonwealth Scientific And Industrial Research Organisation | Barley with low levels of hordein |
| US9133427B2 (en) | 2007-08-13 | 2015-09-15 | Commonwealth Scientific And Industrial Research Organisation | Barley with low levels of hordeins |
| US8642846B2 (en) | 2007-08-13 | 2014-02-04 | Commonwealth Scientific And Industrial Research Organisation | Barley with low levels of hordeins |
| US10501712B2 (en) | 2007-08-13 | 2019-12-10 | Commonwealth Scientific And Industrial Research Organisation | Barley with low levels of hordeins |
| US11326134B2 (en) | 2007-08-13 | 2022-05-10 | Commonwealth Scientific And Industrial Research Organisation | Barley with low levels of hordeins |
| US9885038B2 (en) | 2007-08-14 | 2018-02-06 | Commonwealth Scientific & Industrial Research Organisation | Gene silencing methods |
| WO2009026660A1 (en) | 2007-08-30 | 2009-03-05 | Walter And Eliza Hall Institute Of Medical Research | Dendritic cell marker and uses thereof |
| WO2009067580A2 (en) | 2007-11-20 | 2009-05-28 | Pioneer Hi-Bred International, Inc. | Maize ethylene signaling genes and modulation of same for improved stress tolerance in plants |
| WO2009067751A1 (en) | 2007-11-27 | 2009-06-04 | Commonwealth Scientific And Industrial Research Organisation | Plants with modified starch metabolism |
| WO2009129558A1 (en) | 2008-04-24 | 2009-10-29 | Newsouth Innovations Pty Limited | Cyanobacteria saxitoxin gene cluster and detection of cyanotoxic organisms |
| US8093043B2 (en) | 2008-06-04 | 2012-01-10 | New York University | β-TrCP1, β-TrCP2 and RSK1 or RSK2 inhibitors and methods for sensitizing target cells to apoptosis |
| WO2010005527A1 (en) | 2008-06-30 | 2010-01-14 | Angioblast Systems, Inc. | Treatment of eye diseases and excessive neovascularization using a combined therapy |
| WO2010009499A1 (en) | 2008-07-21 | 2010-01-28 | Commonwealth Scientific And Industrial Research Organisation | Improved cottonseed oil and uses |
| US8692080B2 (en) | 2008-09-29 | 2014-04-08 | Monsanto Technology Llc | Soybean transgenic event MON87705 and methods for detection thereof |
| US10344292B2 (en) | 2008-09-29 | 2019-07-09 | Monsanto Technology Llc | Soybean transgenic event MON87705 and methods for detection thereof |
| US9572311B2 (en) | 2008-09-29 | 2017-02-21 | Monsanto Technology Llc | Soybean transgenic event MON87705 and methods for detection thereof |
| US8329989B2 (en) | 2008-09-29 | 2012-12-11 | Monsanto Technology Llc | Soybean transgenic event MON87705 and methods for detection thereof |
| EP2821490A2 (en) | 2008-10-30 | 2015-01-07 | Pioneer Hi-Bred International Inc. | Manipulation of glutamine synthetases (GS) to improve nitrogen use efficiency and grain yield in higher plants |
| WO2010065867A1 (en) | 2008-12-04 | 2010-06-10 | Pioneer Hi-Bred International, Inc. | Methods and compositions for enhanced yield by targeted expression of knotted1 |
| WO2010066689A2 (en) | 2008-12-09 | 2010-06-17 | Novartis Ag | Organic compounds |
| WO2010101818A1 (en) | 2009-03-02 | 2010-09-10 | Pioneer Hi-Bred International, Inc. | Nac transcriptional activators involved in abiotic stress tolerance |
| EP3293257A1 (en) | 2009-03-20 | 2018-03-14 | Mesoblast, Inc. | Production of reprogrammed pluripotent cells |
| WO2010120862A1 (en) | 2009-04-14 | 2010-10-21 | Pioneer Hi-Bred International, Inc. | Modulation of acc synthase improves plant yield under low nitrogen conditions |
| WO2010118477A1 (en) | 2009-04-17 | 2010-10-21 | Molecular Plant Breeding Nominees Ltd | Plant promoter operable in endosperm and uses thereof |
| EP3260545A1 (en) | 2009-04-20 | 2017-12-27 | Monsanto Technology LLC | Multiple virus resistance in plants |
| WO2010123904A1 (en) | 2009-04-20 | 2010-10-28 | Monsanto Technology Llc | Multiple virus resistance in plants |
| WO2010139026A1 (en) | 2009-06-05 | 2010-12-09 | Centenary Institute Of Cancer Medicine And Cell Biology | Therapeutic and diagnostic molecules |
| WO2011011273A1 (en) | 2009-07-24 | 2011-01-27 | Pioneer Hi-Bred International, Inc. | The use of dimerization domain component stacks to modulate plant architecture |
| WO2011041796A1 (en) | 2009-10-02 | 2011-04-07 | Pioneer Hi-Bred International, Inc. | Down-regulation of acc synthase for improved plant performance |
| EP3766976A1 (en) | 2009-12-18 | 2021-01-20 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat hsf1-related diseases |
| EP3000885A2 (en) | 2009-12-18 | 2016-03-30 | Arrowhead Research Corporation | Organic compositions to treat hsf1-related diseases |
| EP3406720A1 (en) | 2009-12-18 | 2018-11-28 | Arrowhead Pharmaceuticals, Inc. | Organic compositions to treat hsf1-related diseases |
| WO2011073326A2 (en) | 2009-12-18 | 2011-06-23 | Novartis Ag | Organic compositions to treat hsf1-related diseases |
| WO2011085062A1 (en) | 2010-01-06 | 2011-07-14 | Pioneer Hi-Bred International, Inc. | Identification of diurnal rhythms in photosynthetic and non-photosynthetic tissues from zea mays and use in improving crop plants |
| WO2011098449A1 (en) | 2010-02-10 | 2011-08-18 | Novartis Ag | Methods and compounds for muscle growth |
| WO2012007945A2 (en) | 2010-07-12 | 2012-01-19 | The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization, (A.R.O.), Volcani Center | Isolated polynucleotides and methods and plants using same for regulating plant acidity |
| WO2012055362A1 (en) | 2010-10-28 | 2012-05-03 | Benitec Biopharma Limited | Hbv treatment |
| EP3124610A1 (en) | 2010-10-28 | 2017-02-01 | Benitec Biopharma Limited | Hbv treatment |
| US9970005B2 (en) | 2010-10-29 | 2018-05-15 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA) |
| US9260471B2 (en) | 2010-10-29 | 2016-02-16 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA) |
| US12516321B2 (en) | 2010-10-29 | 2026-01-06 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA) |
| US11932854B2 (en) | 2010-10-29 | 2024-03-19 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA) |
| US11193126B2 (en) | 2010-10-29 | 2021-12-07 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA) |
| WO2012058730A1 (en) | 2010-11-04 | 2012-05-10 | Arista Cereal Technologies Pty Ltd | High amylose wheat |
| WO2012058726A1 (en) | 2010-11-05 | 2012-05-10 | Transbio Ltd | Markers of endothelial progenitor cells and uses thereof |
| US12569592B2 (en) | 2011-02-14 | 2026-03-10 | Revivicor, Inc. | Genetically modified pigs for xenotransplantation of vascularized xenografts and derivatives thereof |
| US11179496B2 (en) | 2011-02-14 | 2021-11-23 | Revivicor, Inc. | Genetically modified pigs for xenotransplantation of vascularized xenografts and derivatives thereof |
| WO2012112586A1 (en) | 2011-02-14 | 2012-08-23 | Revivicor, Inc. | Genetically modified pigs for xenotransplantation of vascularized xenografts and derivatives thereof |
| WO2012129373A2 (en) | 2011-03-23 | 2012-09-27 | Pioneer Hi-Bred International, Inc. | Methods for producing a complex transgenic trait locus |
| WO2012148835A1 (en) | 2011-04-29 | 2012-11-01 | Pioneer Hi-Bred International, Inc. | Down-regulation of a homeodomain-leucine zipper i-class homeobox gene for improved plant performance |
| US12071484B2 (en) | 2011-06-13 | 2024-08-27 | Csl Limited | Nucleic acids encoding antibodies against human granulocyte-colony stimulating factor receptor (G-CSFR) and method of expressing encoded protein |
| WO2012174139A2 (en) | 2011-06-14 | 2012-12-20 | Synthon Biopharmaceuticals B.V. | Compositions and methods for making and b ioc ont aining auxotrophic transgenic plants |
| WO2013066423A2 (en) | 2011-06-21 | 2013-05-10 | Pioneer Hi-Bred International, Inc. | Methods and compositions for producing male sterile plants |
| WO2013066805A1 (en) | 2011-10-31 | 2013-05-10 | Pioneer Hi-Bred International, Inc. | Improving plant drought tolerance, nitrogen use efficiency and yield |
| WO2013063653A1 (en) | 2011-11-04 | 2013-05-10 | Arista Cereal Technologies Pty Limited | High amylose wheat - ii |
| WO2013088438A1 (en) | 2011-12-11 | 2013-06-20 | The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization, (A.R.O.), Volcani Center | Methods of modulating stomata conductance and plant expression constructs for executing same |
| WO2013096993A1 (en) | 2011-12-27 | 2013-07-04 | Commonwealth Scientific And Industrial Research Organisation | Processes for producing lipids |
| WO2013096991A1 (en) | 2011-12-27 | 2013-07-04 | Commonwealth Scientific And Industrial Research Organisation | Production of dihydrosterculic acid and derivatives thereof |
| WO2013096992A1 (en) | 2011-12-27 | 2013-07-04 | Commonwealth Scientific And Industrial Reserach Organisation | Simultaneous gene silencing and supressing gene silencing in the same cell |
| US10822615B2 (en) | 2011-12-27 | 2020-11-03 | Commonwealth Scientific And Industrial Research Organisation | Simultaneous gene silencing and suppressing gene silencing in the same cell |
| US11560571B2 (en) | 2011-12-27 | 2023-01-24 | Commonwealth Scientific And Industrial Research Organisation | Simultaneous gene silencing and suppressing gene silencing in ihe same cell |
| WO2013105022A2 (en) | 2012-01-09 | 2013-07-18 | Novartis Ag | Organic compositions to treat beta-catenin-related diseases |
| WO2013104026A1 (en) | 2012-01-11 | 2013-07-18 | The Australian National University | Method for modulating plant root architecture |
| WO2013138309A1 (en) | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
| WO2013138358A1 (en) | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
| WO2013159149A1 (en) | 2012-04-25 | 2013-10-31 | Commonwealth Scientific And Industrial Research Organisation | High oleic acid oils |
| WO2014027021A1 (en) | 2012-08-16 | 2014-02-20 | Vib Vzw | Means and methods for altering the lignin pathway in plants |
| US10006041B2 (en) | 2012-08-16 | 2018-06-26 | Vib Vzw | Means and methods for altering the lignin pathway in plants |
| WO2014118123A1 (en) | 2013-01-29 | 2014-08-07 | The University Court Of The University Of Glasgow | Methods and means for increasing stress tolerance and biomass in plants |
| WO2014164014A1 (en) | 2013-03-11 | 2014-10-09 | Pioneer Hi-Bred International, Inc. | Genes for improving nutrient uptake and abiotic stress tolerance in plants |
| WO2014164074A1 (en) | 2013-03-13 | 2014-10-09 | Pioneer Hi-Bred International, Inc. | Enhanced nitrate uptake and nitrate translocation by over-expressing maize functional low-affinity nitrate transporters in transgenic maize |
| WO2014164116A1 (en) | 2013-03-13 | 2014-10-09 | Pioneer Hi-Bred International, Inc. | Functional expression of bacterial major facilitator superfamily (sfm) gene in maize to improve agronomic traits and grain yield |
| WO2014160122A1 (en) | 2013-03-14 | 2014-10-02 | Pioneer Hi-Bred International, Inc. | Maize stress related transcription factor 18 and uses thereof |
| WO2014143996A2 (en) | 2013-03-15 | 2014-09-18 | Pioneer Hi-Bred International, Inc. | Compositions and methods of use of acc oxidase polynucleotides and polypeptides |
| US10017778B2 (en) | 2013-03-21 | 2018-07-10 | Vib Vzw | Means and methods for the reduction of photorespiration in crops |
| WO2014147249A1 (en) | 2013-03-21 | 2014-09-25 | Vib Vzw | Means and methods for the reduction of photorespiration in crops |
| EP2810952A1 (en) | 2013-06-03 | 2014-12-10 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Novel pest control methods |
| WO2014200842A2 (en) | 2013-06-11 | 2014-12-18 | Syngenta Participations Ag | Methods for generating transgenic plants |
| US10849345B2 (en) | 2013-06-13 | 2020-12-01 | Commonwealth Scientific And Industrial Research Organisation | Barley with very low levels of hordeins |
| WO2014197943A1 (en) | 2013-06-13 | 2014-12-18 | Commonwealth Scientific And Industrial Research Organisation | Barley with very low levels of hordeins |
| EP3682873A1 (en) | 2013-06-25 | 2020-07-22 | The Walter and Eliza Hall Institute of Medical Research | Smac mimetics for use in the treatment of persistent hiv infection |
| WO2014205516A1 (en) | 2013-06-25 | 2014-12-31 | The Walter And Eliza Hall Institute Of Medical Research | Method of treating intracellular infection |
| US10500252B2 (en) | 2013-06-25 | 2019-12-10 | Walter And Eliza Hall Institute Of Medical Research | Method of treating intracellular infection |
| US10428336B2 (en) | 2013-10-16 | 2019-10-01 | The Australian National University | Method for modulating plant growth |
| WO2015069459A1 (en) | 2013-11-05 | 2015-05-14 | Novartis Ag | Organic compounds |
| US10407498B2 (en) | 2013-11-28 | 2019-09-10 | Csl Limited | Method of treating diabetic nephropathy in a subject suffering from type 2 diabetes by administering an antibody which inhibits VEGF-B signaling |
| US11261243B2 (en) | 2013-11-28 | 2022-03-01 | Csl Limited | Methods of treating diabetic nephropathy by administering an anti-vegf-b (vascular endothelial growth factor-b) antibody |
| US9803008B2 (en) | 2013-11-28 | 2017-10-31 | Csl Limited | Method of treating diabetic nephropathy by administering antibodies to vascular endothelial growth factor B (VEGF-B) |
| WO2015089585A1 (en) | 2013-12-18 | 2015-06-25 | Csl Limited | Method of treating wounds |
| WO2015116680A1 (en) | 2014-01-30 | 2015-08-06 | Two Blades Foundation | Plants with enhanced resistance to phytophthora |
| WO2015171603A1 (en) | 2014-05-06 | 2015-11-12 | Two Blades Foundation | Methods for producing plants with enhanced resistance to oomycete pathogens |
| EP2966157A1 (en) | 2014-07-07 | 2016-01-13 | Commonwealth Scientific and Industrial Research Organisation | Processes for producing industrial products from plant lipids |
| EP4303288A2 (en) | 2014-07-07 | 2024-01-10 | Nuseed Global Innovation Ltd | Processes for producing industrial products from plant lipids |
| WO2016005449A1 (en) | 2014-07-08 | 2016-01-14 | Vib Vzw | Means and methods to increase plant yield |
| WO2016079527A1 (en) | 2014-11-19 | 2016-05-26 | Tetralogic Birinapant Uk Ltd | Combination therapy |
| WO2016097773A1 (en) | 2014-12-19 | 2016-06-23 | Children's Cancer Institute | Therapeutic iap antagonists for treating proliferative disorders |
| WO2016196489A1 (en) | 2015-05-29 | 2016-12-08 | Arcadia Biosciences | Reduced gluten grains and compositions thereof |
| EP4282875A2 (en) | 2015-05-29 | 2023-11-29 | Arcadia Biosciences, Inc. | Reduced gluten grains and compositions thereof |
| WO2016205644A2 (en) | 2015-06-19 | 2016-12-22 | Arcadia Biosciences, Inc. | Wheat with reduced lipoxygenase activity |
| WO2017062790A1 (en) | 2015-10-09 | 2017-04-13 | Two Blades Foundation | Cold shock protein receptors and methods of use |
| WO2017083920A1 (en) | 2015-11-18 | 2017-05-26 | Commonwealth Scientific And Industrial Research Organisation | Rice grain with thickened aleurone |
| WO2017091952A1 (zh) | 2015-11-30 | 2017-06-08 | 谢彦晖 | Akt2在诊断和治疗肿瘤中的用途 |
| WO2017161264A1 (en) | 2016-03-18 | 2017-09-21 | Pioneer Hi-Bred International, Inc. | Methods and compositions for producing clonal, non-reduced, non-recombined gametes |
| CN107841510A (zh) * | 2016-09-20 | 2018-03-27 | 中国科学院青岛生物能源与过程研究所 | 一种原核细胞转录后水平控制不同基因表达比例的方法 |
| CN107841510B (zh) * | 2016-09-20 | 2021-02-09 | 中国科学院青岛生物能源与过程研究所 | 一种原核细胞转录后水平控制不同基因表达比例的方法 |
| US12428641B2 (en) | 2017-09-15 | 2025-09-30 | Commonwealth Scientific And Industrial Research Organisation | RNA molecules |
| US12264202B2 (en) | 2017-11-29 | 2025-04-01 | Csl Limited | Methods of reducing or hindering development of ischemia-reperfusion injury due to kidney transplantation with an antibody that inhibits granulocyte-colony stimulating factor (G-CSF) signaling |
| US12281160B2 (en) | 2018-03-23 | 2025-04-22 | Csl Limited | Method of treating asthma |
| WO2020078865A1 (en) | 2018-10-16 | 2020-04-23 | F. Hoffmann-La Roche Ag | Use of akt inhibitors in ophthalmology |
| WO2020148310A1 (en) | 2019-01-17 | 2020-07-23 | F. Hoffmann-La Roche Ag | E3 ubiquitin ligase (ube3a) protein targets |
| US12360123B2 (en) | 2019-01-17 | 2025-07-15 | Hoffmann-La Roche Inc. | E3 ubiquitin ligase (UBE3A) protein targets |
| WO2021019536A1 (en) | 2019-07-30 | 2021-02-04 | The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) | Methods of controlling cannabinoid synthesis in plants or cells and plants and cells produced thereby |
| EP3825408A1 (en) | 2019-11-19 | 2021-05-26 | FRAUNHOFER-GESELLSCHAFT zur Förderung der angewandten Forschung e.V. | Methods of multi-species insect pest control |
| WO2021099377A1 (en) | 2019-11-19 | 2021-05-27 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Methods of multi-species insect pest control |
| US12583929B2 (en) | 2020-06-04 | 2026-03-24 | CSL Innovation Pty Ltd | Method of treating acute respiratory distress syndrome |
| WO2022162015A1 (en) | 2021-01-26 | 2022-08-04 | Universite Brest Bretagne Occidentale | Novel stim1 splicing variants and uses thereof |
| WO2023012342A1 (en) | 2021-08-06 | 2023-02-09 | Kws Vegetables B.V. | Durable downy mildew resistance in spinach |
| WO2023020980A1 (en) | 2021-08-16 | 2023-02-23 | F. Hoffmann-La Roche Ag | E3 ubiquitin ligase (ube3a) protein targets |
| WO2024256682A1 (en) | 2023-06-16 | 2024-12-19 | Max-Planck-Gessellschaft zur förderung der Wissenschaften e.V. | Unreduced clonal gamete formation and polyploid genome design in the solanaceae |
| EP4477069A1 (en) | 2023-06-16 | 2024-12-18 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Unreduced clonal gamete formation and polyploid genome design in the solanaceae |
| US12357689B2 (en) | 2023-07-05 | 2025-07-15 | CSL Innovation Pty Ltd | Methods of treating or preventing a cardiovascular system complication of sickle cell disease with an anti-G-CSFR antibody |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU743316B2 (en) | Control of gene expression | |
| MXPA00008631A (en) | Control of gene expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 99804255.2 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 29163/99 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 506648 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2000/008631 Country of ref document: MX Ref document number: IN/PCT/2000/00169/DE Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PV2000-3346 Country of ref document: CZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13722000 Country of ref document: SK |
|
| ENP | Entry into the national phase |
Ref document number: 2323726 Country of ref document: CA Ref document number: 2323726 Country of ref document: CA Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020007010419 Country of ref document: KR |
|
| ENP | Entry into the national phase |
Ref document number: 200024727 Country of ref document: GB Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1999910039 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 09646807 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: 1999910039 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: PV2000-3346 Country of ref document: CZ |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020007010419 Country of ref document: KR |
|
| WWG | Wipo information: grant in national office |
Ref document number: 29163/99 Country of ref document: AU |
|
| WWG | Wipo information: grant in national office |
Ref document number: PV2000-3346 Country of ref document: CZ |
|
| WWR | Wipo information: refused in national office |
Ref document number: 1999910039 Country of ref document: EP |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 1999910039 Country of ref document: EP |