MXPA00008631A - Control of gene expression - Google Patents

Abstract

The present invention relates generally to a method of modifying gene expression and to synthetic genes for modifying endogenous gene expression in a cell, tissue or organ of a transgenic organism, in particular a transgenic animal or plant. More particularly, the present invention utilises recombinant DNA technology to post-transcriptionally modify or modulate the expression of a target gene in a cell, tissue, organ or whole organism, thereby producing novel phenotypes. Novel synthetic genes and genetic constructs which are capable or repressing delaying or otherwise reducing the expression of an endogenous gene or a target gene in an organism when introduced thereto are also provided.

Description

EXPRESSION CONTROL OF GENES FIELD OF THE INVENTION The present invention relates generally to a method for modifying the expression of genes and synthetic genes to modify the endogenous expression of genes in a cell, tissue or organ of a transgenic organism, in particular an animal or transgenic plant. More particularly, the present invention uses recombinant DNA technology to modify or post-transcriptionally modulate the expression of a target gene in a whole cell, tissue, organ or organism, whereby novel phenotypes are produced. The novel synthetic genes and the genetic constructs which are capable of repressing, retarding or otherwise reducing the expression of an endogenous gene or a target gene in an organism when introduced therein, are also provided.

GENERALITIES The bibliographic details of the publications referred to in this specification are collected at the end of the description. As used herein, the term "derived from" should be taken to indicate that a specified integer can be obtained from a particular specified source or species, although not necessarily directly from the specified source or species. Through this specification, unless the context requires otherwise, the word "comprises" or variations such as "comprising" or "understood" shall be understood to imply the inclusion of a stage or element or whole or group of Stages or elements or established integers, but not the exclusion of any stage or element or whole or group of elements or integers. Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It should be understood that the invention includes all variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any of two or more steps or features. . The present invention is not limited in scope by the specific embodiments described herein, which are intended for exemplification purposes only. The functionally equivalent products, compositions and methods are clearly within the scope of the invention as described herein.

Sequence identity numbers (SEQ ID NOS) containing information on nucleotide and amino acid sequences included in this specification are collected after the extract and prepared using the Patentln Version 2.0 program. Each nucleotide or amino acid sequence is identified in the sequence list by the numerical indicator < 210 > followed by the sequence identifier (for example <210> 1, <210> 2, etc.). The length, type of sequence (DNA, protein (PRT), etc.), and the source organism for each nucleotide or amino acid sequence is indicated by the information provided in the numerical indicator fields < 211 > , < 212 > and < 213 > , respectively. The nucleotide and amino acid sequences referenced in the specification are defined by the information provided in the numerical indicator field < 400 > followed by the sequence identifier (eg <400> 1, <400> 2, etc. The designation of nucleotide residues referred to herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission , wherein A represents adenine, C represents cytosine, G represents guanine, T represents thymine, Y represents a pyrimidine residue, R represents a purine residue, M represents adenine or cytosine, K represents guanine or thymine, S represents guanine or cytosine, W represents adenine or thymine, H represents a nucleotide different from guanine, B represents a nucleotide different from adenine, V represents a different nucleotide from thymine, D represents a nucleotide different from cytosine and N represents any nucleotide residue. which is referenced herein, recommended by the IUPAC-IUB Biochemical Nomenclature Commission, are included in table 1.

TABLE 1 Amino Acid Three letter code One letter code Alanine Wing A Arginine Arg R Asparagine Asn N Aspartic Acid Asp D Cysteine Cys C Glutamine Gln Q Glutamic Acid Glu E Glycine Gly G Histidine His H Isoleucine He I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr and Valine Val V Aspartate / asparagine Baa B Glutamate / Glutamine Zaa Z Any amino acid Xaa X BACKGROUND OF THE INVENTION The control of metabolic pathways in eukaryotic organisms is desirable in order to produce novel features in them or to introduce novel features into cells, tissues or particular organs of that organism. Although recombinant DNA technology has provided significant progress in understanding the mechanisms that regulate the expression of eukaryotic genes, much less progress has been made in the actual manipulation of gene expression to produce novel features. In tion, there are only limited means by which human invention can lead to a modulation of the level of expression of the eukaryotic gene.

A solution to repress, retard or otherwise reduce the expression of genes uses a mRNA molecule which is transcribed from the complementary strand of a nuclear gene to that which is normally transcribed capable of being translated into a polypeptide. Although the precise mechanism involved in this approach has not been established, it has been postulated that double-stranded mRNA can form base pairing between complementary nucleotide sequences, to produce a complex which is translated with low efficiency and / or is degraded by intracellular ribonuclease enzymes before being translated. Alternatively, the expression of an endogenous gene in a cell, tissue or organ can be suppressed when one or more copies of such a gene, or one or more copies of a substantially similar gene are introduced into the cell. Although the mechanism involved in this phenomenon has not been established and seems to involve mechanistically heterogeneous processes. For example, this approach has been postulated to involve transcriptional repression, in which case somatically-inherited chromatin-repressed states are formed, or alternatively, a transcriptional silencer where the start of transcription normally occurs, but the RNA products in the cosuprimid genes are subsequently eliminated. The efficiency of both approaches in the directing of the expression of specific genes is very low and usually highly variable results are obtained. Inconsistent results are obtained using different regions of the genes, for example 5 'untranslated regions, 3' untranslated regions, coding regions or intron sequences for the expression of the target gene. Consequently, there is currently no consensus regarding the nature of the genetic sequences which provide the most efficient means to repress, retard or otherwise reduce the expression of genes using existing technologies. Furthermore, such a high degree of variation exists between generations so that it is not possible to predict the level of repression of a specific gene in the progeny of an organism in which the expression of the gene is markedly modified. Recently, Dorer and Henikoff (1994) demonstrated the silencing of repeated gene copies in drums in the Drosophila genome and the transcriptional repression of Drosophila Adh genes scattered by Polycomb genes (ie, the Pc-G system, Pal-Bhadra et al. al., 1997). However, such silenced copies of battery-repeated genes are of little use in an attempt to manipulate the expression of genes in an animal cell by recombinant means, wherein sequences capable of directing the expression of a particular gene are introduced into positions scattered in the genome, absent from the combination of this approach with the technology of gene targeting. Although theoretically possible, such combinations are expected to work only at low efficiency, based on the low efficiency of the gene targeting solutions used in the isolation and, in addition, this may require complicated vector systems. In addition, the use of transcriptional repression, such as in the Pc-G system of Drosophila, may seem to require some knowledge of regulatory mechanisms capable of modulating the expression of any specific target gene and, as a consequence, may be difficult to increase in practice as a general technology to repress, retard or reduce the expression of genes in animal cells. A poor understanding of the mechanisms involved in this phenomenon means that there have been few improvements in the technologies to modulate the level of gene expression, in particular technologies to retard, repress or otherwise reduce the expression of specific genes using Recombinant DNA Furthermore, as a consequence of the unpredictability of these approaches, there is currently no commercially viable means to modulate the level of expression of a specific gene in a eukaryotic or prokaryotic organism. Therefore, there is a need for improved methods to modulate gene expression, in particular to repress, retard or otherwise reduce the expression of genes in mammalian cells, for the purpose of introducing novel phenotypic traits thereto. In particular, these methods can provide a general means for phenotypic modification, without the need to conduct concomitant gene targeting approaches.

BRIEF DESCRIPTION OF THE INVENTION The invention is based in part on the surprising discovery by the inventors that cells which display one or more desired traits can be produced and selected from transformed cells comprising a nucleic acid molecule operably linked to a promoter, wherein the transcription product of the nucleic acid molecule comprises a nucleotide sequence which is substantially identical to the nucleotide sequence of a transcript of an endogenous or non-endogenous target gene, the expression of which is intended to be modulated. Transformed cells are regenerated into whole tissues, organs or organisms capable of exhibiting novel traits, in particular resistance to viruses and modified expression of endogenous genes. Accordingly, an aspect of the present invention provides a method for modulating the expression of a target gene in a cell, tissue or animal organ, the method comprising at least the step of introducing to the cell, tissue or organ, one or more dispersed nucleic acid molecules or foreign nucleic acid molecules comprising multiple copies of a nucleotide sequence which is substantially identical to or complementary to the nucleotide sequence of the target gene or a region thereof, for a time and under conditions sufficient to the translation of the mRNA product of the target gene to be modified, subject it to the condition that the transcription of such mRNA product is not repressed or reduced exclusively. In a particularly preferred embodiment, the dispersed nucleic acid molecules or the extraneous nucleic acid molecules comprise a nucleotide sequence which encodes multiple copies of an mRNA molecule which is substantially identical to the nucleotide sequence of the mRNA product of the gene objective. Most preferably, multiple copies of the target molecule are direct repeated sequences in battery. In a more particularly preferred embodiment, the dispersed nucleic acid molecule or the foreign nucleic acid molecule is in a dispersible form so that it is capable of at least being transcribed to produce mRNA. The target gene can be a gene which is endogenous to the animal cell or, alternatively, a foreign gene such as a viral or foreign genetic sequence, among others. Preferably, the target gene is a viral genetic sequence. The invention is particularly useful in the modulation of the expression of eukaryotic genes, in particular the modulation of the expression of human or animal genes, and even more particularly in the modulation of expression of genes derived from vertebrate and invertebrate animals, such as insects, aquatic animals (for example fish, shellfish, molluscs, crustaceans such as crabs, lobsters and shrimps, avian animals and mammals, among others). A variety of traits are selectable with appropriate procedures and with sufficient quantities of transformed cells. Such features include, but are not limited to, visible traits, disease resistance traits and pathogen resistance traits. The modulator effect is applicable to various genes expressed in plants and animals that include, for example, endogenous genes responsible for cell metabolism with cell transformation, including oncogenes, transmission factors and other genes which code for polypeptides involved in cell metabolism . For example, an alteration in pigment production in mice can be engineered by directing the expression of the thyrisinase gene therein. This provides a novel phenotype of albinism in black mice. By targeting genes necessary for virus replication in a plant cell or an animal cell, a genetic construct can be introduced which comprises multiple copies of a nucleotide sequence that codes for a viral replicase, polymerase, coat protein or a protein removal or protease gene, in a cell where it is expressed, to confer immunity against the virus before the cell. In carrying out the present invention, the dispersed nucleic acid molecule or the foreign nucleic acid molecule generally comprises a nucleotide sequence that has more than about 85% identity to the target gene sequence, however, a higher homology can introduce a more effective expression modulation of the target gene sequence. Substantially preferred is greater homology, more than about 90%, and even more preferably about 95% for absolute identity, which is desirable. The dispersed nucleic acid molecule introduced or the foreign nucleic acid sequence, need less than the absolute homology, and neither need to be full length, in relation to either the primary transcription product or the fully processed mRNA of the target gene. A larger homology in a sequence of less than full length compensates for a less long homologous sequence. In addition, the introduced sequence does not need to have the same intron or exon pattern, and the homology of the non-coding segments will be equally effective. Typically, a sequence greater than 20-100 nucleotides can be used, although a sequence of more than about 200-300 nucleotides is preferred, and a sequence of more than 500-1000 nucleotides is especially preferred, depending on the size of the target gene. A second aspect of the present invention provides a synthetic gene which is capable of modifying the expression of a target gene in a cell, tissue or organ of a prokaryotic or eukaryotic organism which is transfected or transformed therewith, wherein the gene The synthetic comprises at least one foreign molecule of nucleic acid dispersed nucleic acid, comprising multiple copies of a nucleotide sequence which is substantially identical to the nucleotide sequence of the target gene or a derivative thereof, or a sequence complementary to the same operably placed under the control of a promoter sequence which is operable in the cell, tissue or organ. A third aspect of the invention provides a synthetic gene which is capable of modifying the expression of a target gene in a cell, tissue or organ of a prokaryotic or eukaryotic organism which is transfected or transformed therewith, wherein the synthetic gene it comprises at least multiple sequences of the structural gene, wherein each of the structural gene sequences comprises a nucleotide sequence which is substantially identical to the nucleotide sequence of the target gene or a derivative thereof, or a sequence complementary thereto, and wherein the multiple structural gene sequences are operably placed under the control of a unique promoter sequence which is operable in the cell, tissue or organ. A fourth aspect of the present invention provides a synthetic gene which is capable of modifying the expression of a target gene in a cell, tissue or organ of a prokaryotic or eukaryotic which is transferred or transformed therewith, wherein the synthetic gene it comprises at least multiple structural genetic sequences, wherein each of the structural genetic sequences is operably placed under the control of a promoter sequence which is operable in the cell, tissue or organ, and wherein each of the gene sequences The structure comprises a nucleotide sequence which is substantially identical to the nucleotide sequence of the target gene or a derivative thereof, or a sequence complementary thereto. A fifth aspect of the invention provides a genetic construct which is capable of modifying the expression of an endogenous gene or target gene in a transformed, transfected cell, tissue or organ., wherein the genetic construct comprises at least one synthetic gene of the invention and one or more origins of replication and / or sequences of selectable marker genes. In order to observe many novel features in multicellular organisms such as plants and animals, in particular those which are tissue-specific or organ-specific or well-regulated by development, the regeneration of a transformed cell representing the synthetic genes will be required. and the genetic constructs described here in a complete organism. Those skilled in the art will realize that this means growing a complete organism from a transformed plant cell or animal cell, or group of cells, a tissue or organ. Standard methods for the regeneration of certain plants and animals from isolated cells and tissues are known to those skilled in the art. Accordingly, a sixth aspect of the invention provides a cell, tissue, organ or organism comprising two synthetic genes and the genetic constructs described herein.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a diagrammatic representation of the plasmid pEGFP-Nl MCS. Figure 2 is a diagrammatic representation of the plasmid pCMV.cass. Figure 3 is a diagrammatic representation of the plasmid pCMV.SV40L.cass. Figure 4 is a diagrammatic representation of the plasmid pCMV.SV40LR.cass.

Figure 5 is a diagrammatic representation of the plasmid pCR.Bgl-GFP-Bam. Figure 6 is a diagrammatic representation of the plasmid pBSII (SK +) .EGFP. Figure 7 is a diagrammatic representation of the plasmid pCMV.EGFP. Figure 8 is a diagrammatic representation of the plasmid pCR.SV40L. Figure 9 is a diagrammatic representation of the plasmid pCR.BEV.l. Figure 10 is a diagrammatic representation of the plasmid pCR.BEV.2. Figure 11 is a diagrammatic representation of the plasmid pCR.BEV.3. Figure 12 is a diagrammatic representation of the plasmid pCMV.EGFP.BEV2. Figure 13 is a diagrammatic representation of the plasmid pCMV.BEV.2. Figure 14 is a diagrammatic representation of the plasmid pCMV.BEV.3. Figure 15 is a diagrammatic representation of the plasmid pCMV.VEB. Figure 16 is a diagrammatic representation of the plasmid pCMV.BEV.GFP.

Figure 17 is a diagrammatic representation of the plasmid pCMV.BEV. SV40L-0. Figure 18 is a diagrammatic representation of the plasmid pCMV.O.SV40L.BEV. Figure 19 is a diagrammatic representation of the plasmid pCMV.0. SV40L.VEB. Figure 20 is a diagrammatic representation of the plasmid pCMV.BEVx2. Figure 21 is a diagrammatic representation of the plasmid pCMV.BEVx3. Figure 22 is a diagrammatic representation of the plasmid pCMV.BEVx4. Figure 23 is a diagrammatic representation of the plasmid pCMV.BEV. SV40L.BEV. Figure 24 is a diagrammatic representation of the plasmid pCMV.BEV.SV40L.VEB. Figure 25 is a diagrammatic representation of the plasmid pCMV.BEV. GFP .VEB. Figure 26 is a diagrammatic representation of the plasmid pCMV.EGFP.BEV2.PFG. Figure 27 is a diagrammatic representation of the plasmid pCMV.BEV. SV40LR Figure 28 is a diagrammatic representation of plasmid pCDNA3. Galt.

Figure 29 is a diagrammatic representation of the plasmid pCMV.Galt. Figure 30 is a diagrammatic representation of the plasmid pCMV.EGFP .Galt. Figure 31 is a diagrammatic representation of the plasmid pCMV. Galt .GFP. Figure 32 is a diagrammatic representation of the plasmid pCMV.Galt. SV40L.0. Figure 33 is a diagrammatic representation of the plasmid pCMV.Galt. SV40L. tlaG. Figure 34 is a diagrammatic representation of the plasmid pCMV.0. SV40L. Galt. Figure 35 is a diagrammatic representation of the plasmid pCMV.Galtx2. Figure 36 is a diagrammatic representation of the plasmid pCMV.Galtx4. Figure 37 is a diagrammatic representation of the plasmid pCMV. Galt. SV40L. Galt. Figure 38 is a diagrammatic representation of the plasmid pCMV. Galt. SV40L. tlaG. Figure 39 is a diagrammatic representation of the plasmid pCMV. Galt .GFP. tlaG. Figure 40 is a diagrammatic representation of the plasmid pCMV. EGFP.Galt. PFG.

Figure 41 is a diagrammatic representation of the plasmid pCMV. Galt. SV40LR Figure 42 is a diagrammatic representation of the pART7 plasmid. Figure 43 is a diagrammatic representation of the pART7.35S plasmid. SCBV. cass. Figure 44 is a diagrammatic representation of the plasmid pBC.PVY. Figure 45 is a diagrammatic representation of the plasmid pSP72.PVY. Figure 46 is a diagrammatic representation of the plasmid pClapBC.PVY. Figure 47 is a diagrammatic representation of the plasmid pBC.PVYx2. Figure 48 is a diagrammatic representation of the plasmid pSP72.PVYx2. Figure 49 is a diagrammatic representation of the pBC plasmid. PVYx3. Figure 50 is a diagrammatic representation of the plasmid pBC.PVYx4. Figure 51 is a diagrammatic representation of the pBC plasmid. PVY. LNYV. Figure 52 is a diagrammatic representation of the pBC plasmid. PVY. LNYV. PVY.

Figure 53 is a diagrammatic representation of the pBC plasmid. PVY. LNYV. YVP? . Figure 54 is a diagrammatic representation of the pBC plasmid. PVY. LNYV, YVP. Figure 55 is a diagrammatic representation of the plasmid pART27.PVY. Figure 56 is a diagrammatic representation of plasmid pART27.35S. PVY. SCBV.O. Figure 57 is a diagrammatic representation of the plasmid pART27.35S .0. SCBV. PVY. Figure 58 is a diagrammatic representation of the plasmid pART27.35S.O. SCBV. YVP Figure 59 is a diagrammatic representation of the pART7 plasmid. PVYx2. Figure 60 is a diagrammatic representation of the pART7 plasmid. PVYx3. Figure 61 is a diagrammatic representation of the pART7 plasmid. PVYx4 Figure 62 is a diagrammatic representation of the pART7 plasmid. PVY.LNYV. PVY. Figure 63 is a diagrammatic representation of the pART7 plasmid. PVY.LNYV. YVP? . Figure 64 is a diagrammatic representation of the pART7 plasmid. PVY. LNYV. YVP Figure 65 is a diagrammatic representation of the plasmid pART7.35S. PVY. SCBV. YVP Figure 66 is a diagrammatic representation of the pART.35S plasmid. PVYx3.SCBV.YVPx3. Figure 67 is a diagrammatic representation of the pART7 plasmid. PVYx3. LNYV. YVPx3. Figure 68 is a diagrammatic representation of the pART7 plasmid. PVYMULTI.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides a method for modulating the expression of a target gene in a cell, tissue or organ, the method comprising at least the step of introducing to the cell, tissue or organ, one or more dispersed nucleic acid molecules or molecules. foreign nucleic acid comprising multiple copies of a nucleotide sequence which is substantially identical to the nucleotide sequence of the target gene or a region thereof, or complementary thereto, for a time and under conditions sufficient for translation of the mRNA product of the target gene that is to be modified, subject to the condition that the transcription of the mRNA product is not repressed or reduced exclusively. By the term "multiple copies" is meant that two or more copies of the target gene are presented in close physical connection or are juxtaposed, in the same or different orientation, in the same nucleic acid molecule, optionally separated by a filler fragment or intergenic region to facilitate the formation of a secondary structure between each repeated section where it is required. The filler fragment can comprise any combination of nucleotide or amino acid residues, carbohydrate molecules or oligosaccharide molecules or carbon atoms or a homologue, analog or derivative thereof which is capable of being covalently bound to a nucleic acid molecule. Preferably, in the embodiment, the filler fragment comprises a nucleotide sequence or a homologue, analog or derivative thereof. More preferably, the filler fragment comprises a nucleotide sequence of at least about 10-50 nucleotides in length, even more preferably at least about 50-100 nucleotides in length, and most preferably at least less about 100-500 nucleotides in length. Where the dispersed or stranded nucleic acid molecule comprises intron / exon splicing junction sequences, the fill fragment can serve as an intron sequence placed between the 3 'splice site of the structural gene closest to the 5' end of the gene and the 5 'splice site of the next unit to the 3' end thereof. Alternatively, when it is desirable that more than two units of adjacent nucleotide sequences be translated from the foreign dispersed nucleic acid molecule, the filler fragment placed therebetween must not include a frame translation stop codon, absent binding sequences. splice / exon junction at both ends of the fill fragment or the addition of a translation start codon at the 5 'end of each unit, as will be apparent to those skilled in the art. Preferred filler fragments are those which code for detectable marker proteins or biologically active analogues or derivatives thereof, for example luciferase, β-galacturonase, β-galactosidase, chloramphenicol, acetyltransferase or green fluorescent protein, among others. Additional filler fragments are not excluded. According to this embodiment, the detectable label or an analog or derivative thereof serves to indicate the expression of the synthetic gene of the invention in a cell, tissue or organ by virtue of its ability to confer a specific detectable phenotype therein, preferably a visually detectable phenotype. As used herein, the term "modular" will be taken to indicate that the expression of the target gene is reduced in amplitude and / or the timing of gene expression is delayed and / or the development or specific pattern of tissue is altered or modified. cell-specific expression of the target gene, compared to the expression of the gene in the absence of the method of the invention described herein. Although it is not desired to limit the scope of the invention described herein, the present invention is directed to the modulation of the expression of a gene which comprises the repression, retardation or reduction in amplitude of the target expression gene in a cell, tissue or organ. of a eukaryotic organism, in particular a plant such as a monocotyledonous or dicotyledonous plant, or a human or other animal, and even more particularly a vertebrate and invertebrate animal, such as an insect, an aquatic animal (eg fish, shellfish, mollusk, crustacean such as crab, lobster or shrimp, an avian animal or a mammal, among others). More preferably, the expression of the target gene is completely inactivated by dispersed nucleic acid molecules or foreign nucleic acid molecules which have been introduced into the cell, tissue or organ. Although not wishing to be bound by any theory or mode of action, the reduced or deleted expression of the target gene which results from the operation of the invention can be attributed to a reduced or delayed translation of the mRNA transcription product of the target gene, or alternatively , the prevention of translation of such mRNA, as a consequence of the sequence specific degradation of the mRNA transcript of the target gene by the endogenous host cell system.

It is particularly preferred that, for optimal results, the sequence specific degradation of the mRNA transcript of the target gene occurs either before the time or step when the mRNA transcript of the target gene is normally translated, or alternatively at the same time as the transcript mRNA of the target gene would normally be translated. Accordingly, the selection of an appropriate promoter sequence to regulate the expression of the introduced dispersed nucleic acid molecule or the foreign nucleic acid molecule is an important consideration of the optimal functioning of the invention. For this reason, strong constitutive promoters or inducible promoter systems are especially preferred for use in regulating the expression and introduced dispersed molecules of nucleic acid with foreign nucleic acid molecules. The present invention clearly encompasses reduced expression, wherein reduced expression of the target gene is carried out by decreasing transcription, subject to the condition that a reduction in transcription is not the only mechanism by which this occurs and that such a reduction in transcription is accompanied by at least a reduced translation of the accumulated stable-state mRNA. The target gene may be a genetic sequence which is endogenous to the animal cell or alternatively, a non-endogenous genetic sequence, such as a genetic sequence which is derived from a virus or other foreign pathogenic organism and which is capable of entering a cell and use the machinery of the cell after infection. When the target gene is a non-endogenous genetic sequence for the animal cell, it is desirable for the target gene to code for a function which is essential for the replication or reproduction of the viral pathogen or other pathogen. In such embodiments, the present invention is particularly useful in the prophylactic and therapeutic treatment of viral infection or an animal cell or to confer or stimulate resistance against the pathogen. Preferably, the target gene comprises one or more nucleotide sequences of a viral pathogen or a cell, tissue or plant or animal organ. For example, in the case of animals and humans, the viral pathogen can be a retrovirus, for example a lentivirus such as the immunodeficiency virus, a single chain (+) RNA virus such as bovine enterovisus (BEV) or the alpha virus Sinbis. Alternatively, the target gene may comprise one or more nucleotide sequences of a viral pathogen or a cell, tissue or animal organ such as, but not limited to, double-stranded DNA virus such as herpes virus or herpes simplex virus. I (HSV I), among others.

In the case of plants, the viral pathogen is preferably a potyvirus, caulimovirus, badnavirus, geminovirus, reovirus, rhabdovirus, bunyavirus, tospovirus, tenuivirus, tombusvirus, luteovirus, sobemovirus, bromovirus, cucomovirus, ilavirus, alphaamovirus, tobamovirus, tobravirus, potexvirus and clostroviruses, such as, but not limited to, CaMV, SCSV, PVX, PVY, PLRV and TMV, among others. With particular regard to viral pathogens, those skilled in the art know that virus-encoded functions can be complemented in trans by polypeptides encoded by the host cell. For example, replication of the genome of bovine herpes virus in the host cell can be facilitated by host cell DNA polymerases which are capable of complementing an inactivated viral DNA polymerase gene. Accordingly, wherein the target gene is a non-endogenous genetic sequence for the animal cell, a further alternative embodiment of the invention provides an objective gene for coding for a viral or foreign polypeptide which is not capable of being supplemented by a function of the host cell, such as a virus-specific genetic sequence. Exemplary target genes according to this embodiment of the invention include, but are not limited to genes which code for virus coat protein, coat removal proteins and RNA-dependent DNA polymerases and mRNA-dependent RNA polymerases among others. In a particularly preferred embodiment of the present invention, the target gene is RNA-dependent RNA polymerase of BEV, or a homologue, analogue or derivative thereof or sequences encoding PVY Nia protease. The cell in which the expression of the target gene is modified by any cell which is derived from a multicellular plant or animal, includes cell cultures and tissues thereof. Preferably, the animal cell is derived from an insect, reptile, amphibian, bird, human or other mammal. Exemplary animal cells include embryonic fluripotent cells, cultured skin fibroblasts, neuronal cells, somatic cells, hematopoietic pluripotent cells, T cells and immortalized cell lines such as COS, VERO, HeLa, C127 mouse, Chinese Hamster ovary cells (CHO), WI-38 cells, baby hamster kidney cell lines (BHK) or MDBK, among others. Such cells and cell lines are readily available to those skilled in the art. Accordingly, the tissue or organ in which the expression of the target gene is modified can be any tissue or organ comprising such animal cells. Preferably, the plant cell is derived from a monocotyledonous or dicotyledonous plant species or a cell line derived therefrom.

As used herein, the term "dispersed nucleic acid molecule" will be taken to refer to a nucleic acid molecule which comprises one or more multiple copies, preferably to direct tandem repeats, of a nucleotide sequence which is substantially identical or complementary to the nucleotide sequence of a gene which originates from the cell, tissue or organ in which the nucleic acid molecule is introduced, wherein the nucleic acid molecule is non-endogenous in the sense that it is introduced into the nucleic acid molecule. the cell, tissue or organs of an animal via a recombinant means and will generally be present as an extrachromosomal nucleic acid or alternatively, as an integrated chromosomal nucleic acid which is not genetically linked to such a gene. More particularly, the "dispersed nucleic acid molecule" will comprise a chromosomal or extrachromosomal nucleic acid which is not bound to the target gene against which it is directed on a physical map, by virtue of not being connected in battery, or alternatively, occupying a different chromosomal position on the same chromosome or that is located on a different chromosome or that is present in the cell as an episome, plasmid, cosmid or virus particle. By the term "foreign nucleic acid molecule" is meant an isolated nucleic acid molecule which has one or more multiple copies, preferably direct repeated sequences in battery, of a nucleotide sequence which originates from the genetic sequence of an organism which is different from the organism to which the foreign nucleic acid molecule is introduced. This definition encompasses a nucleic acid molecule which originates from a different individual from the same lower taxonomic grouping (ie, from the same population) as the taxonomic grouping to which the nucleic acid molecule has been introduced, as well as a molecule of nucleic acid which originates from a single or different taxonomic grouping as the taxonomic grouping to which the nucleic acid molecule has been introduced, such as a gene derived from a viral pathogen. Accordingly, an objective gene against which a nucleic acid molecule acts in the operation of the invention, can be a nucleic acid molecule which has been introduced from one organism to another organism using transformation or introgression technologies. Exemplary target genes according to this embodiment of the invention include the gene encoding the green fluorescent protein derived from the jellyfish Aequoria victoria (Prasher et al., 1992; International Patent Publication number WO 95/07463), tyrosinase genes. and in particular the murine tyrosinase gene (Kwon et al., 1988), the lacl gene of Escherichia coli which is capable of coding for a repressor polypeptide of the lacZ gene, the a-1, 3-galactosyltransferase porcine gene (NCBI). , accession number L36535) exemplified herein, and the PVY and BEV structural genes exemplified herein, or a homologue, analog or derivative of such genes or a complementary nucleotide sequence therefor. The present invention is also useful for simultaneous targeting of the expression of several target genes which are coexpressed in a particular cell, for example by the use of a dispersed nucleic acid molecule. or a foreign nucleic acid molecule which comprises nucleotide sequences which are substantially identical to each of the co-expressed target genes. By "substantially identical" is meant that the dispersed or foreign introduced nucleic acid molecule of the invention and the sequence of the target gene are sufficiently identical at the nucleotide sequence level to allow base matching between them under standard intracellular conditions. Preferably, the nucleotide sequence of each repeated sequence in the dispersed or foreign nucleic acid molecule of the invention and the nucleotide sequence of a part of the target gene sequence are at least about 80-85% identical at the level of the nucleotide sequence, more preferably at least about 85-90% identical, even more preferably at least about 90-95% identical and even more preferably at least 95-99% or 100% identical at the nucleotide sequence level .

Regardless of whether the present invention is not limited by the precise number of repeated sequences in the dispersed nucleic acid molecule or the foreign nucleic acid molecule of the invention, it is to be understood that the present invention requires at least two copies of the sequence of the target gene that is going to be expressed in the cell. Preferably, multiple copies of the target gene sequence are presented in the dispersed nucleic acid molecule or the foreign nucleic acid molecule as repeated sequences inverted in battery and / or direct repeated sequences in battery. Such configurations are exemplified by the "test plasmids" described herein that comprise the regions of the Galt, BEV or PVY genes. Preferably, the dispersed or foreign molecule of nucleic acid which is introduced into the cell, tissue or organ comprises RNA or DNA. Preferably, the dispersed or foreign nucleic acid molecule further comprises a nucleotide sequence or its sequence complementary to a nucleotide, which is capable of coding for an amino acid sequence encoded by the target gene. Even more preferably, the nucleic acid molecule includes one or more ATG or AUG translational start codons. The standard methods can be used to introduce the dispersed nucleic acid molecule or the foreign nucleic acid molecule into the cell, tissue or organ for purposes of modulating the expression of the target gene. For example, the nucleic acid molecule can be introduced as naked DNA or RNA, optionally encapsulated in a liposome, in a virus particle as a virus attenuated or associated with a virus coat or a transport protein or an inert carrier such as gold, or as a recombinant viral vector or as a bacterial vector, or as a genetic construct, among others. The administration means includes injection and oral ingestion (e.g., medicated food material) among others. The nucleic acid subject molecules can also be delivered by a live delivery system for example by using a bacterial expression system optimized for expression in bacteria, which can be incorporated into the gut flora. Alternatively, a viral expression system can be used. In this regard, a form of viral expression is the administration of a live vector generally by spraying, feeding or water wherein the infecting effective amount of the living vector (eg, a virus or bacteria) is provided to the animal. Another form of viral expression system is a non-replicating virus vector which is capable of infecting a cell but not replicating therein. The non-replicating viral vector provides a means to enter the genetic material of the human or animal subject for expression * ^^^^^ fi ^ transient in it. The mode of administration of such vector is the same as that of the live viral vector. The carriers, excipients and / or diluents used to deliver the subject molecules of nucleic acid to a host cell must be acceptable for human or veterinary applications. Such carriers, excipients or diluents are well known to those skilled in the art. Suitable carriers or diluents for veterinary use include any and all solvents, dispersion media, aqueous solutions, coatings, antibacterial and antifungal agents, isotonic and absorption delay agents, and the like. Except insofar as any conventional medium or agent is incompatible with the active ingredient, the use thereof in the composition is contemplated. Supplementary active ingredients can also be incorporated into the compositions. In an alternative embodiment, the invention provides a method for modulating the expression of a target gene in a cell, tissue or organ, the method comprises at least the steps of: (i) selecting one or more dispersed nucleic acid molecules or molecules strangers of nucleic acid which comprise multiple copies of a nucleotide sequence which is substantially identical to the nucleotide sequence of the target gene or a region thereof or which is complementary thereto; Y «U * ßA.MH * £ ia« MlUk? LMiaMbBfc i? IlI ??? (ii) introducing the dispersed nucleic acid molecules or foreign nucleic acid molecules into the cell tissue or organ for a time and under conditions sufficient for the translation of the mRNA product of the target gene to be modified, subject to the condition of that the transcription of such an mRNA product is not repressed or reduced exclusively. To select appropriate nucleotide frequencies to direct the expression of the target gene, various approaches can be used. In one embodiment, multiple copies of specific regions of genes characterized in operable connection with a suitable promoter can be cloned and assayed for efficacy in reducing expression of the target gene. Alternatively, shotgun libraries comprising multiple copies of genetic sequences can be produced and tested to determine their efficacy and reduce the expression of the target gene. The advantage associated with this latter solution is that it is not necessary to have any prior knowledge of the importance of any particular target gene to specify an undesirable phenotype in the cell. For example, shotgun libraries comprise subgenomic fragments of viruses which can be used and tested slowly to determine their ability to confer viral immunity in the host cell of the animal, without prior knowledge of the role which any virus gene plays in the pathogenesis. of the host cell. As used herein, the term "shotgun library" is a set of various nucleotide sequences wherein each member of the set is preferably contained within a suitable plasmid, cosmid, bacteriophage or virus vector molecule, which is suitable for maintenance and / or replication in a cellular host. The term "shotgun library" includes a representative library, which the extent of diversity between the nucleotide sequences is numerous so that all sequences in the genome of the organism from which the nucleotide sequences are derived are present in the "set" or alternatively, a limited library in which there is a lesser degree of diversity between such sequences. The term "shotgun library" further encompasses random nucleotide sequences, wherein the nucleotide sequence comprises fragments of viral or cellular genome, among others obtained, for example, by cutting or partial digestion of genomic DNA using restriction endonucleases, among other approaches. A "shotgun library" further includes cells, viral particles and bacteriophage particles comprising the individual nucleotide sequences of the diverse set. Preferred shotgun libraries according to this embodiment of the invention are "representative libraries" comprising a set of tandem repeated nucleotide sequences derived from a viral pathogen of a plant or an animal. In a particularly preferred embodiment of the invention, the shotgun library comprises cells, viral particles or bacteriophage particles comprising a diverse set of battery-repeated nucleotide sequences which code for a diverse set of amino acid sequences wherein the set member Various of nucleotide sequences are operably placed under the control of a promoter sequence which is capable of directing the expression of the nucleotide sequence repeated in battery in the cell. Accordingly, the nucleotide sequence of each unit in the battery repeated sequence may comprise at least about 1 to 200 nucleotides in length. The use of larger fragments, particularly using randomly cut nucleic acid derived from viral, plant or animal genomes, is not excluded. The introduced nucleic acid molecule is preferably in an expressible form. By the term "expressible form" is meant that the subject nucleic acid molecule is present in an array so that it can be expressed in the cell, tissue, organ or throughout the organism, at least at the transcriptional level (ie, it is present in the animal cell to provide at least one mRNA product which is optionally translatable or is translated to produce a peptide, oligopeptide molecule or recombinant polypeptide). By way of exemplification, in order to obtain the expression of the dispersed nucleic acid molecule or the foreign nucleic acid molecule in the cell, tissue or organ of interest, a synthetic gene or a genetic construct comprising such a synthetic gene is produced , wherein the synthetic gene comprises a nucleotide sequence as described above in operable connection with a promoter sequence which is capable of regulating expression therein. Therefore, the subject nucleic acid molecule will be operably linked to one or more regulatory segments sufficient for eukaryotic transcription to occur. Accordingly, a further alternative embodiment of the invention provides a method for modulating the expression of a target gene in a cell, tissue or animal organ, the method comprising at least the steps of: (i) selecting one or more dispersed molecules of nucleic acid or foreign nucleic acid molecules which comprise multiple copies, preferably sequences repeated in battery, of a nucleotide sequence which is substantially identical to the nucleotide sequence of the target gene or a region thereof or which is complementary to it; (ii) producing a synthetic gene comprising dispersed nucleic acid molecules or foreign nucleic acid molecules; (iii) introducing the synthetic gene into the cell, tissue or organ, and (iv) expressing the synthetic gene in the cell, tissue or organ for a time and under conditions sufficient for the translation of the mRNA product of the target gene that is leaving to be modified, subsumed to the condition that the transcription of such mRNA product is not expressed or reduced exclusively. The reference herein to "gene" or "genes" is taken in its broader context and includes: (i) a classical genomic gene consisting of transcriptional or translational regulatory sequences, or a coding region or untranslated sequences (i.e. , introns, untranslated sequences 5 'and 3') or all of the above; or (ii) mRNA or cDNA corresponding to the coding regions, i.e., exons, and 5 'and 3' untranslated sequences of the gene; or (iii) a structural region corresponding to the coding regions (ie, exons), which optionally further comprise untranslated sequences or a heterologous promoter sequence which consists of transcriptional or translational regulatory regions capable of conferring expression characteristics on the region structural, or all of the above. The term "gene" is also used to describe synthetic or fusion molecules that code for all or part of a functional product, in particular a product of Direct or antisense mRNA, or a peptide, oligopeptide or polypeptide, or a biologically active protein. The term "synthetic gene" refers to a gene that does not occur naturally as defined above, which preferably comprises at least one or more transcriptional or translational regulatory sequences or both, operably linked to a gene sequence. structural The term "structural gene" should be considered to refer to a nucleotide sequence which is capable of being transmitted to produce mRNA, and optionally encodes a peptide, oligopeptide, polypeptide or a biologically active protein molecule. Those skilled in the art will realize that not all mRNA is capable of being translated into a peptide, oligopeptide, polypeptide or protein, for example if the mRNA lacks a functional translation start signal, or alternatively, if the mRNA is Antisense mRNA. The present invention clearly encompasses synthetic genes comprising nucleotide sequences which are not capable of coding for biologically active peptides, oligopeptides, polypeptides or proteins. In particular, the present inventors have found that such synthetic genes can be advantageous for modifying the expression of the target gene in cells, tissues or organs of a prokaryotic or eukaryotic organism. The term "structural gene region" refers to that part of the synthetic gene which comprises a dispersed nucleic acid molecule or foreign nucleic acid molecule as described herein, which is expressed in a cell, tissue or organ under the control of a promoter sequence to which it is connected operably. A structural gene region may comprise one or more dispersed nucleic acid molecules and / or foreign nucleic acid molecules operably under the control of a single promoter sequence or multiple promoter sequences. Accordingly, the structural gene region of a synthetic gene may comprise a nucleotide sequence which is capable of encoding an amino acid sequence, or which is complementary thereto. In this regard, a structural gene region which is used in the operation of the present invention may also comprise a nucleotide sequence which codes for an amino acid sequence that still lacks a functional translation start codon or codon functional translation stop, or both, and as a consequence, does not include a complete open reading frame. In the present context, the term "structural gene region" also extends to non-coding nucleotide sequences, such as sequences 5 'upstream or 3' downstream of a gene, which would normally translate into a eukaryotic cell which expresses such a gene Accordingly, in the context of the present invention, a structural gene region may also comprise a fusion between two or more open reading frames of the same or different genes. In such embodiments, the invention can be used to modulate the expression of a gene, by targeting different non-contiguous regions thereof, or alternatively, to simultaneously modulate the expression of several different genes, which include genes different from a multiple gene family. In the case of a nucleic acid fusion molecule which is non-endogenous to the animal cell, and which in particular comprises two or more nucleotide sequences derived from a viral pathogen, the fusion may provide the additional advantage of conferring simultaneous immunity or protection against several pathogens, by directing the expression of genes in several pathogens. Alternatively, or additionally, the fusion can provide more effective immunity against any pathogen by directing the expression of more than one gene of that pathogen. Particularly preferred structural gene regions according to this aspect of the invention are those which include at least one translatable open reading frame, more preferably including further a translational start codon located at the 5 'end of the framework of open reading, although not necessarily in the terminal 5 'part of such structural gene region. In this regard, regardless of whether the structural gene region can comprise at least one translatable open reading frame or a translational start codon AUG or ATG or both, the inclusion of such sequences in no way suggests that the present invention requires that the translation of the introduced nucleic acid molecule is carried out in order to modulate the expression of the target gene. Although not wishing to be bound by any theory or mode of action, the inclusion of at least one translatable open reading frame or a translational start codon, or both, in the nucleic acid subject molecule, can serve to increase stability of the mRNA transcription product thereof, whereby the efficiency of the invention is improved. The optimal number of structural gene sequences which can be involved in the synthesis gene of the present invention will vary considerably depending on the length of each of the structural gene sequences, their orientation and degree of identity to each other. For example, those skilled in the art will be aware of the inherent instability of palindromic nucleotide sequences in vivo and the difficulties associated with the construction of long synthetic genes comprising inverted repeat nucleotide sequences, due to the tendency of such sequences to recombine in vivo. . Regardless of such difficulties, the optimal number of structural gene sequences that are included in the synthetic genes of the present invention can be determined empirically by those skilled in the art without undue experimentation and by following standard procedures such as gene construction. of the invention using recombinase-deficient cell lines, reducing the number of repeat sequences to a level which eliminates or minimizes recombination phenomena and by maintaining the total length of the multiple structural gene sequence within an acceptable limit, preferably not greater than 5-10 kb, more preferably no greater than 2-5 kb, and even more preferably no greater than 0.5-2.0 kb in length. When the structural gene region comprises more than one dispersed nucleic acid molecule or foreign nucleic acid molecule, will be referred to herein as a "multiple structural gene region" or a similar term. The present invention clearly extends to the use of multiple structural gene regions which preferably comprise a direct repeat sequence, an inverted repeat sequence or an interrupted palindromic sequence of a particular structural gene, a dispersed nucleic acid molecule or a foreign acid molecule nucleic, or a fragment of it. Each dispersed or foreign molecule of nucleic acid contained within the multiple structural gene unit of the synthetic target gene can comprise a nucleotide sequence which is substantially identical to a different target gene in the same organism. Such an arrangement may be of particular utility when the synthetic gene is designed to provide protection against a pathogen in a cell, tissue or organ, in particular a viral pathogen, by modifying the expression of the viral target genes. For example, the multiple structural gene may comprise nucleotide sequences (i.e., two or more dispersed or extraneous nucleic acid molecules) which are substantially identical to two or more target genes selected from the list comprising DNA polymerase, RNA polymerase, Nia. Protease and coating protein or another target gene which is essential for viral infectivity, replication or reproduction. However, it is preferred within this arrangement that the structural gene units be selected so that the target genes to which they are substantially identical, are normally expressed approximately at the same time (or later) in an infected cell, tissue or organ in instead of the multiple structural gene of the synthetic gene subject that is expressed under the control of the promoter sequence. This means that the expression controlling the promoter of the multiple structure gene is usually selected to confer expression in the cell, tissue or organ over the entire life cycle of the virus, when the viral target genes are expressed in different stages of infection.

As the individual sequence units of a dispersed or foreign nucleic acid molecule, the individual units of the multiple structural gene can be spatially connected in any one orientation relative to the other, eg head to head, head to tail or tail to tail, and all configurations are within the scope of the invention. For expression in eukaryotic cells the synthetic gene generally comprises in addition to the nucleic acid molecule of the invention, a promoter and optionally other regulatory sequences designed to facilitate the expression of the dispersed nucleic acid molecule or the foreign nucleic acid molecule. The reference herein to a "promoter" should be taken in its broader context and includes the transcriptional regulatory sequences of a classical genomic gene, which include the TATA box which is necessary for an accurate start of transcription, with or without the sequence of the CCAAT box and any additional regulatory element (ie, activating sequences towards the 5 'end of extenders and silencers), which may alter gene expression in response to developmental or external stimuli or both, or in a specific manner of tissue. A promoter is usually, but not necessarily, positioned towards the 5 'end of a structural gene region, the expression of which it regulates. In addition, regulatory elements that comprise a promoter are usually placed within the next 2 kb of the transcription start site of the gene. In the present context, the term "promoter" is also used to describe a synthetic or fusion molecule, or a derivative which confers, activates or enhances the expression of a nucleic acid molecule in a cell. The preferred promoters may contain additional copies of one or more specific regulatory elements, to further lengthen the expression of the direct molecule or to alter spatial expression, or to alter the temporal expression of the direct molecule, or all of the foregoing, for example, Regulatory elements which confer copper induction capacity can be placed adjacent to a heterologous promoter sequence that activates the expression of a target molecule, thereby conferring copper induction capacity on the expression of such a molecule. The placement of a dispersed or foreign molecule of nucleic acid under the regulatory control of a promoter sequence means placing the molecule so that the expression is controlled by the promoter sequence. The promoters are usually placed towards the 5 'end (upstream) of the genes they control. In the construction of heterologous promoter / structural gene constructs, it is generally preferred to place the promoter at a distance from the transcription start site of the gene that is approximately the same as the distance between the promoter and the gene it controls in its natural placement, that is, the gene from which the promoter is derived. As is known in the art, some variation in the distance can be adapted without loss of the promoter function. Similarly, the preferred placement of the regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the placement of the element in its natural domain, i.e., the genes from which it is derived. Again, it is known in the art that some variation in this distance may also occur. Examples of suitable promoters for use in the synthetic genes of the present invention include promoters derived from viruses, fungi, bacteria, animals and plants capable of functioning in plant, animal, insect, mycotic, yeast or bacterial cells. The promoter can regulate the expression of the structural gene component constitutively, or differentially with respect to the cell, tissue or organ in which the expression is produced or, with respect to the stage of development in which the expression occurs, or in response to external stimuli such as physiological stresses, or pathogens, or metal ions, among others. Preferably, the promoter is capable of regulating the expression of a nucleic acid molecule in a eukaryotic cell, tissue or organ, for at least the period of time over which the target gene is expressed therein, and more preferably also immediately preceding the start of the detectable expression of the target gene in the cell, tissue or organ. Accordingly, strong constitutive promoters are particularly preferred for purposes of the present invention or promoters which may be induced by viral infection or the onset of an expression of the target gene. Promoters operable by plants and operable by animals are particularly preferred for use in the synthetic genes of the present invention. Examples of preferred promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, CaMV 35S promoter, SCSV promoter, SCBV promoter and the like. In consideration of the preferred requirement for high level expression which matches the expression of the target gene or that precedes the expression of the target gene, it is highly desirable that the promoter sequence be a strong constitutive promoter such as the CMV-IE promoter of the early promoter sequence of SV40, the late promoter sequence of SV40, the 35S promoter of CaMV or the SCBV promoter among others. Those skilled in the art will readily realize the additional promoter sequences other than those specifically described. In the present context the terms "in operable connection with" or "operably under the control of" or the like should be taken to indicate that the ession of the region of the structural gene or the region of the multiple structural gene is under the control of the sequence promoter with which it connects spatially; in a cell, tissue, organ or complete organism. In a preferred embodiment of the invention, a region of the structural gene (i.e., a dispersed nucleic acid molecule or a foreign nucleic acid molecule) or a multiple structural gene region is operably placed in connection with an orientation promoter in relation to to the promoter sequence so that when a mRNA product is transcribed it is synthesized which, if translated, is capable of encoding a polypeptide product of the target gene or a fragment thereof. However, the present invention is not limited to the use of such an arrangement and the invention clearly extends to the use of synthetic genes and genetic constructs wherein the structural gene region or the multiple structural gene region is placed in the "antisense" orientation. in relation to the promoter sequence, so that at least part of the mRNA transcription product thereof is complementary to the mRNA encoded by the target gene or a fragment thereof. Clearly, as the dispersed nucleic acid molecule, the foreign nucleic acid molecule or the multiple structural gene region comprises direct or inverted repeat sequences or both, in battery of the target gene, all combinations of the configurations mentioned above are encompassed by the invention. In an alternative embodiment of the invention, the structural gene region or the multiple structural gene region is operably linked to both the first promoter sequence and a second promoter sequence, wherein the promoters are located at the distal and proximal ends of the promoter sequence. same, so that at least one unit of the structural gene or the multiple structural gene region is placed in the "direct" orientation relative to the first promoter sequence and in the "antisense" orientation relative to the second promoter sequence. In accordance with this embodiment, it is also preferred that the first and second promoters be different, to avoid competition between them for cellular transcription factors which bind to them. The advantage of this arrangement is that the effects of the transmission of the first and second promoters to reduce the ession of the target gene in the cell can be compared to determine the optimal orientation for each nucleotide sequence tested.

The synthetic gene preferably contains additional regulatory elements for efficient transcription, for example, a transcription termination sequence. The term "terminator" refers to a DNA sequence at the end of a transcriptional unit which indicates the termination of transcription. The terminators are 3 'untranslated DNA sequences containing a polyadenylation signal, which facilitates the addition of polyadenylated sequences towards the 3' end of a primary transcript. Active terminators in plant cells are known and described in the literature. They can be isolated from bacteria, fungi, viruses, animals or plants, or they are synthesized de novo. As with the promoter sequences, the terminator can be any terminator sequence which is operable in the cells, tissues or organs in which it is intended to be used. Examples of terminators particularly suitable for use in the synthetic genes in the present invention include the SV40 polyadenylation signal, the HSV polyadenylation signal TK, the CYCl terminator, the ADH terminator, the SPA terminator, the nopaline synthase gene terminator (US), of Agrobacterium tumefaciens, the terminator of the 35S gene of the cauliflower mosaic virus (CaMV), the terminator of the zein gene of Zea mays, the gene of the small subunit of Rubisco of the terminator sequences of the gene (SSU), the terminators of the sequence of the blunt clover virus gene (SCSV), and the terminator of rho-independent E. coli, or the alpha terminator of lacZ, among others. In a particularly preferred embodiment, the terminator is the SV40 polyadenylation signal or the HSV TK polyadenylation signal which are operable in cells, tissues and animal organs, the octopine synthase terminator (OCS) or nopaline synthase (NOS) active in cells, tissues or plant organs, or the alpha terminator of lacZ which is active in prokaryotic cells. Those skilled in the art will recognize that the additional terminator sequences which are suitable for use in the embodiment of the invention. Such sequences can be easily used without undue experimentation. The means for introducing (i.e., transfecting or transforming) cells with the synthetic genes described herein or a genetic construct comprising the same are well known to those skilled in the art. In a further alternative embodiment, a genetic construct is used which comprises two or more regions of structural genes or regions of multiple structural genes wherein each of the structural gene regions is operably placed under the control of its own promoter sequence. As with the other embodiments described herein, the orientation of each structural gene region can vary to maximize its modulating effect on the expression of the target gene. According to this embodiment, promoters that control the expression of the structural gene unit are preferably different promoter sequences, to reduce competition between them for cellular transcription factors and RNA polymerases. The preferred promoters are selected from those mentioned above. Those skilled in the art will know how to modify the arrangement or configuration of the individual structural genes as described supra to regulate their expression from separate promoter sequences. The synthetic genes described supra are capable of being further modified, for example by the inclusion of marker nucleotide sequences that encode a detectable marker enzyme or a functional analogue or derivative thereof, to facilitate the detection of the synthetic gene in a cell, tissue or organ in which it is expressed. According to this embodiment, the marker nucleotide sequences will be present in a translatable format and are expressed, for example, as a fusion polypeptide with the translation of product or products of any one or more structural genes, or alternatively as a polypeptide that does not It is fusion. Those skilled in the art will be able to know how to produce the synthetic genes described herein and the requirements to obtain expression thereof, when desired, in a specific cell or cell type under the desired conditions. In particular, it will be known to those skilled in the art that the genetic manipulations necessary to carry out the present invention may require the propagation of a genetic construct described herein or a derivative thereof in a prokaryotic cell such as an E. coli cell. or a plant cell or an animal cell. The synthetic genes of the present invention can be introduced into a suitable cell, tissue or organ without modification as linear DNA in the form of a genetic construct, optionally contained within a suitable carrier, such as a cell, viral particle or liposome, among others. . To produce a genetic construct, the synthetic gene of the invention is inserted into a suitable episome vector or molecule, such as a bacteriophage vector, viral vector or a plasmid, cosmid or artificial chromosome vector which is capable of being maintained , replicated or expressed, or all of the above, in the host cell, tissue or organ in which it is subsequently introduced. Accordingly, a further aspect of the invention provides a genetic construct which comprises at least the synthetic gene according to any of one or more of the embodiments described herein, and one or more origins of replication or selectable marker gene sequences, or both.

Genetic constructs are particularly suitable for the transformation of a eukaryotic cell to introduce novel genetic traits to it, in addition to providing characteristics of resistance to viral pathogens. Such additional novel features can be introduced into a separate genetic construct or alternatively into the same genetic construct which comprises the synthetic genes described herein. Those of skill in the art will recognize the important advantages, in particular in terms of reduced genetic manipulations and targeted culture requirements and improved cost effectiveness, of including genetic sequences which encode for such additional traits and the synthetic genes described herein in a unique genetic construct. Usually, an origin of replication or a selectable marker gene, suitable for use in bacteria, is physically separated from those genetic sequences contained in the genetic construct which are intended to be expressed or transferred to a eukaryotic cell, or which are integrated into the genome of a eukaryotic cell. In a particularly preferred embodiment, the origin of replication is functional in a bacterial cell, and comprises the pUC or the ColEl origin, or alternatively the origin of replication is operable in a eukaryotic cell, a tissue and more preferably comprises the origin of replication of 2 microns (2 μm) from the SV40 origin of replication. As used herein, the term "selectable marker gene" includes any gene that confers a phenotype on a cell in which it is expressed to facilitate the expression or selection, or both, of the cells which are transfected or transformed with a genetic construct of the invention or a derivative thereof. Suitable selectable marker genes contemplated herein include the ampicillin resistance gene (Ampr), tetracycline resistance gene (Tcr), kanamycin bacterial resistance gene (Kanr) and the Zeocin resistance gene (Zeocin is a drug from the bleomycin family which is a trademark of Invitrogen Corporation), the AURI-C gene which confers resistance to the antibiotic aureobasidin A, the phosphinothricin resistance gene, the neomycin phosphotransferase (nptll) gene, the hygromycin resistance gene, the β-glucuronidase (GUS) gene, the chloramphenicol acetyltransferase (CAT) gene, the gene encoding the green fluorescent protein or the gene for luciferase, among others. Preferably, the selectable marker gene is the nptll gene or the Kanr gene, or the gene encoding the green fluorescent protein (GFP). Those skilled in the art will recognize other selectable marker genes useful in the operation of the present invention, and the present invention is not limited by the nature of the selectable marker gene. The present invention extends to all genetic constructs essentially as described herein, which include additional genetic sequences designed for the maintenance or replication, or both, of the genetic construct in prokaryotes or eukaryotes, or the integration of the genetic construct or a part of it in the genome of a eukaryotic cell or organism, or all of the above. As with dispersed or foreign nucleic acid molecules, the standard methods described above can be used to introduce synthetic genes and genetic constructs into the cell, tissue or organ for the purpose of modulating the expression of the target gene, for example, transfection or liposome-mediated transformation, transformation of cells with attenuated virus particles or bacterial cells, cell matching, transformation or transfection procedures known to those skilled in the art or described by Ausubel et al., (1992). An additional means for introducing recombinant DNA into a plant tissue or cells includes, but is not limited to transformation using CaCl2 and variations thereof, in particular the method described by Hananan (1983), direct uptake of DNA into protoplasts (Krens et al. ., 1982; Paszkowski et al., 1984), PEG-mediated uptake to protoplasts (Amstrong et al. (1990), bombardment of microparticles, electroporation (Fromm et al., 1985), microinjection of DNA (Crossway et al., 1986), bombardment by tissue microparticles of explants or cells (Christou et al., 1988; Stanford, 1988), vacuum infiltration of tissue with nucleic acid, or in the case of plants, transference mediated by Agrobacterium T DNA to plant tissue, as described essentially by An et al., (1985). Herrera-Estrella et al., (1983a, 1983b, 1985). For the microparticle bombardment of cells, a microparticle is driven inside a cell to produce a transformed cell. Any suitable ballistic cell transformation methodology and apparatus can be used to carry out the present invention. Exemplary apparatuses and methods are described by Stomp et al., (U.S. Patent No. 5,122,466) and Sanford and Wolf (U.S. Patent No. 4,945,050). When ballistic transformation procedures are used, the genetic construct can incorporate a plasmid capable of replicating in the cell to be transformed. Examples of microparticles suitable for use in such systems include gold spheres of 1 to 5 μm. The DNA construct can be deposited on the microparticle by any suitable technique, such as by precipitation. In a further embodiment of the present invention, the synthetic genes and genetic constructs described herein are adapted for integration into the genome of a cell in which ^ ÉMttMaamitÉ are expressed. Those skilled in the art will recognize that, in order to obtain integration of a genetic sequence or a genetic construct into the genome of a host cell, certain additional genetic sequences may be required. In the case of plants, the sequences on the left and right boundary of the T DNA of the Ti plasmid of Agrobacterium tumefaciens are generally those that are required. The present invention extends further to a cell, tissue or isolated organ comprising the synthetic gene described herein or a genetic construct comprising the same. The present invention extends further to regenerated whole tissues, organs and organisms derived from such cells, tissues and organs and to propagules and progeny thereof. For example, plants can be regenerated from cells or tissues or organs of transformed plants in a medium containing hormones, and regenerated plants can take various forms, such as transformed cell chimeras and untransformed cells.; clonal transformants (e.g. all cells transformed to contain the expression cassette); grafts from transformed and untransformed tissues (for example, a root concentrate transformed grafted to an untransformed sapling of citrus species). Transformed plants can be propagated by various means, such as clonal propagation or classical seeding techniques. For example, a first generation (or TI) of transformed plants can be self-pollinated to provide a second homozygous (or T2) generation of transformed plants, and the T2 plants are further propagated through classical breeding techniques. The present invention is further described with reference to the following non-limiting examples.

EXAMPLE 1 Genetic constructs comprising sequences of the BEV polymerase gene linked to the CMV promoter sequence or the SV40L promoter sequence, or both 1. Commercial Plasmids Plasmid pBluescript II (SK +) Plasmid pBluescript II (SK +) is commercially available from Stratagene and comprises the lacZ promoter sequence and the lacZ-alpha transcription terminator, with a multiple cloning site for the insertion of the structural gene sequences at that site. The plasmid further comprises the ColEl and fl origins of replication and the ampicillin resistance gene. "" * - "- * - pSVL Plasmid Plasmid pSVL is commercially available from pharmacy and serves as a source of the SV40 late promoter sequence. The nucleotide sequence of pSVL is also publicly available as GenBank access number U13868.

Plasmid pCR2.1 Plasmid pCR2.1 is commercially available from Invitrogen and comprises the lacZ promoter sequence and the lacZ-a transcription terminator, with a cloning site for the insertion of structural gene sequences therebetween. The plasmid pCR2.1 is designed to clone nucleic acid fragments by virtue of the excess part A that is frequently synthesized by Taq polymerase during the polymerase chain reaction. The PCR fragments cloned in this way are flanked by two EcoRI sites. The plasmid also comprises the origins of ColEl and fl replication, and the kanamycin resistance and ampicillin resistance genes.

Plasmid pEGFP-Nl MCS Plasmid pEGFP-Nl MCS (Figure 1; Clontech) contains the CMV IE promoter operably linked to an open reading frame that codes for a red-shifted variant of a green wild type fluorescent protein (GFP; Prasher et al., 1992; Chalfie et al., 1994; Inouye and Tsuji, 1994), which has been optimized for a brighter fluorescence. The specific GFP variant encoded by pEGFP-Nl MCS has been described by Cormack et al. (nineteen ninety six) . Plasmid pEGFP-Nl MCS contains a multiple cloning site comprising BglII and BamHI sites, and many other restriction endonuclease separation sites, located between the CMV IE promoter and the GFP open reading frame. Structural genes cloned within the multiple cloning site will be expressed at the transcriptional level if they lack a functional translation start site, however, such structural gene sequences will not be expressed at the protein level (ie they will translate). The sequences of structural genes inserted within the multiple cloning site which comprise a functional translation initiation site will be expressed as GFP fusion polypeptides, if they are cloned in frame with the sequence coding for GFP. The plasmid further comprises a SV40 polyadenylation signal downstream of the GFP open reading frame to direct proper processing of the 3 'end of the mRNA transcribed from the CMV-IE promoter sequence. The plasmid further comprises the SV40 origin of functional replication in animal cells; the neomycin resistance gene comprising the SV40 early promoter (SV40 EP in Figure 1) operably linked to the neomycin / kanamycin resistance gene derived from Tn5 (Kan / neo in Figure 1) and the HSV thymidine polyadenylation signal kinase (HSV TK poly (A) in Figure 1), for the selection of transformed cells in kanamycin, neomycin or G418; the origin of replication pUC19, which is functional in bacterial cells (pUC Ori in figure 1); and the origin of replication fl for the production of single-stranded DNA (fl Ori in Figure 1). 2. Expression Cassettes Plasmid pCMV.cass The plasmid pMCV.cass (Figure 2) is an expression cassette for activating the expression of a structural gene sequence under the control of the CMV-IE promoter sequence. The plasmid pCMV.cass is derived from pEGFP-NQ MCS by deletion of the GFP open reading frame as follows: it is digested to the plasmid pEGFP-Nl MCS with PinAI and NotI, blunt ends are formed using Pful polymerase and then religated. The structural gene sequences are cloned into pCMV.cass using the multiple cloning site, which is identical to the multiple cloning site of pEGFP-Nl MCS, except that it lacks the PinAI site.

Plasmid pCMV.SV40L.cass The plasmid pCMV. SV40. cass (FIG. 3) comprises the synthetic site Poly A and the late promoter sequence SV40 from the plasmid pCR.SV40L (FIG. 4) is subcloned as a SalI fragment, into the SalI site of the plasmid pCMV.cass (FIG. 2). that the CMV-IE promoter and SV40 late promoter sequences are capable of directing transcription in the same direction. Accordingly, the synthetic poly (A) site at the 5 'end of the SV40 promoter sequence is used as a transcription terminator for structural genes expressed from the CMV IE promoter in this plasmid, which also provides the structural gene insertion via the multiple cloning site present between the late promoter SV40 and the synthetic site poly (A) (Figure 5). The multiple cloning sites are located behind CMV-IE and the SV40 late promoters, including the BamHl and Bglll sites.

Plasmid pCMV.SV40LR.cass The plasmid pCMV. SV40LR cass (Figure 4) comprises the SV40 late promoter sequence derived from the plasmid pCR.SV40L, subcloned as a SalI fragment within the SalI site of the plasmid pCMV.cass (Figure 2), so that the CMV-IE or the late promoter of SV40 can activate the transcription of a structural gene or a multiple structural gene unit, in direct or antisense orientation, as desired. A multiple cloning site is placed between the opposing CMV-IE sequences and the SV40 late promoter in this plasmid, to facilitate the introduction of a structural gene sequence. In order for the expression of a structural gene sequence from this plasmid to occur, it must be introduced with its own transcription termination sequence located at the 3 'end, because there are no localized transcription termination sequences. between the opposite sequences of CMV-IE and the SV40 late promoter in this plasmid. Preferably, the structural gene sequence or the multiple structural gene unit which is to be introduced into pCMV. SV40LR cass will comprise both 5 'and 3' polyadenylation signals, as follows: (i) when the structural gene sequence or the multiple structural gene unit is to be expressed in direct orientation from the promoter sequence of CMV IE or in the antisense orientation from the SV40 late promoter, the 5 'polyadenylation signal will be in the antisense orientation and the 3' polyadenylation signal will be in the direct orientation; and (ii) when the sequence of the structural gene or the multiple structural gene unit is to be expressed in the direct orientation from the CMV IE promoter sequence or in the direct orientation from the SV40 late promoter, or vice versa, the signal 5 'polyadenylation will be in the direct orientation and the 3' polyadenylation signal will be in the antisense orientation. Alternatively, or in addition, appropriately oriented terminator sequences can be placed at the 5 'end of the CMV and SV40L promoters, as shown in Figure 4. Alternatively, the plasmid pCMV. SV40LR cass is further modified to produce a derived plasmid which comprises two polyadenylation signals located between the CMV-IE and SV40 late promoter sequences, in appropriate orientations to facilitate the expression of any structural gene located therein in direct or antisense orientation either from the CMV IE promoter or the SV40 promoter sequence. The present invention clearly encompasses such derivatives. Alternatively, appropriately oriented terminators can be placed towards the 5 'end of the CMV and SV40L promoters, such that the transcriptional termination can occur after full reading of each of the two promoters in the antisense orientation. 3. Intermediate Constructions J "" i ^ '' - "- - iin"? Í ?? r? - iifflrr Plasmid pCR-Bgl-GFP-Bam The plasmid pCR-Bgl-GFP-Bam (Figure 5) comprises an internal region of the open reading frame of GFP derived from the plasmid pEGFP-Nl MCS (Figure 1) operably placed under the control of the lacZ promoter. To produce this plasmid, a region of the GFP open reading frame is amplified from pEGFP-Nl MCS using the amplification primers Bgl-GFP and GFP-Bam, and cloned into the plasmid pCR2.1. The coding region of internal GFP in the pCR plasmid. Bgl-GFP. Bam lacks functional translational start and stop codons.

Plasmid pBSII (SK +) .EGFP The plasmid pBSII) SK +) .EGFP (Figure 6) comprises the open reading frame of EGFP derived from the plasmid pEGFP-Nl MCS (Figure 1) operably placed under the control of the lacZ promoter. To produce this plasmid, the EGFP coding region of pEGFP-Nl MCS is excised as a Notl / XhoI fragment and cloned into the NotI / XhoI cloning sites of the plasmid pBluescript II (SK +).

Plasmid pCMV.EGFP The plasmid (figure 7) is capable of expressing the EGFP structural gene under the control of the promoter sequence CMV-IE. To produce this plasmid, the EGFP sequence of plasmid pBSII (SK +) -EGFP is cut as a BamHI / SacI fragment and cloned into the BglII / SacI sites of the plasmid pCMV.cass (figure 2).

Plasmid pCR.SV40L The plasmid pCR.SV40L (figure 8) comprises the SV40 late promoter derived from the plasmid pSVL (GenBank accession number U13868; Pharmacia), cloned in pCR2.1 (Stratagene). To produce this plasmid, the SV40 late promoter is amplified using primers SV40-1 and SV40-2, which comprise SalI cloning sites to facilitate subcloning of the amplified DNA fragment within pCMV.cass. The primer also contains a synthetic poly (A) site at the 5 'end, such that the amplification product comprises the synthetic poly (A) site at the 5' end of the SV40 promoter sequence.

Plasmid pCR.BEV.l The coding region of RNA polymerase dependent on RNA, BEV, is amplified as a 1385 bp DNA fragment from a full-length cDNA clone encoding it, using primers termed BEV-1 and BEV-2, under standard amplification conditions. The amplified DNA containing a 5'-BglII restriction enzyme site, derived from the BEV-1 primer sequence and a 3'-BamHI restriction enzyme site, derived from the BEV-2 primer sequence. Additionally, since the BEV-1 primer sequence contains a translation initiation signal 5'-ATG-3 'engineered at positions 15-17, the amplified BEV polymerase structural gene comprises the initiation site in frame with the nucleotide sequences that code for BEV polymerase. Therefore, the amplified BEV polymer structural gene comprises the ATG start codon immediately towards the 5 'end (i.e., juxtaposed) to the sequence encoding BEV polymerase. There is no stop codon for translation in the amplified DNA. This plasmid is presented as figure 9.

Plasmid pCR.BEV.2 The complete BEV polymerase coding region is amplified from the full-length cDNA clone encoding it, using the primers BEV-1 and BEV-3. The BEV-3 primer comprises a restriction enzyme site BamHl in positions 5 to 10 inclusive, and the complement of a translation stop signal in positions 11 to 13. As a consequence, an open reading frame comprises a signal of translation initiation and a stop signal for translation, contained between the restriction sites BglII and BamHI. The amplified fragment is cloned into PCR2.1 (Stratagene) to produce plasmid pCR2-BEV.2 (Figure 10).

Plasmid pCR.BEV.3 A non-translatable BEV polymerase structural gene is amplified from a full-length BEV polymerase cDNA clone using the amplification primers BEV-3 and BEV-4. The BEV-4 primer comprises a BglII cloning site at positions 5-10, and sequences towards the 3 'end of this BglII site are homologous to the nucleotide sequences of the BEV polymerase gene. There is no functional ATG start codon in the amplified DNA product of the BEV-3 and BEV-4 primers. The BEV polymerase is expressed as part of a polyprotein and, as a consequence, there is no ATG translation start site in this gene. The amplified DNA is cloned into the plasmid pCR2.1 (Stratagene) to provide the plasmid pCR.BEV.3 (Figure 11).

Plasmid pCMV. EGFP .BEV2 The plasmid pCMV.EGFP.BEV2 (FIG. 12) is produced by cloning the BEV polymerase sequence from pCR.BEV.2 as a BglII / BamHI fragment into the BamHl site of pCMV.EGFP. 4. Control of plasmids Plasmid pCMV.BEV.2 The plasmid pCMV.BEV.2 (FIG. 13) is capable of expressing the entire open reading frame of BEV polymerase under the control of the promoter sequence CMV-IE. To produce pCMV.BEV.2 the BEV polymerase sequence from pCR.BEV.2 was subcloned in direct orientation as a BglII to BamHI fragment into pCMV.cass digested with BglII / BamHI (Figure 2).

Plasmid pCMV.BEV.3 The plasmid pCMV.BEV.3 (FIG. 14) expresses a non-translatable BEV polymerase structural gene in the direct orientation under the control of the promoter sequence CMV.IE. To produce pCMV.BEVnt, the BEV polymerase sequence from pCR.BEV.3 is subcloned in direct targeting as a BglII to BamHI fragment within pCMV.cass digested with BglII / BamHI (Figure 2).

Plasmid pCMV.VEB The plasmid pCMV.VEB (FIG. 15) expresses an antisense BEV polymerase mRNA under the control of the CMV-IE promoter sequence. To produce the plasmid pCMV.VEB, the BEV polymerase sequence is subcloned from pCR.BEV.2 in the antisense orientation as a BglII to BamHI fragment into PCMV.cass digested with BglII / BamHI (Figure 2).

Plasmid pCMV.BEV. GFP The plasmid pCMV.BEV is constructed. GFP (FIG. 16) by cloning the GFP fragment from pCR.Bgl-GFP-Bam as a BglH / BamHI fragment into pCMV.BEV.2. This plasmid serves as a control in some experiments and also as an intermediate construct.

Plasmid pCMV. BEV. SV40 -L The plasmid pCMV.BEV. SV40-L (Figure 17) comprises a structural gene of translatable BEV polymerase derived from plasmid pCR.BEV.2 inserted in the direct orientation between the CMV-IE promoter and the SV40 late promoter sequences of the plasmid pCMVS.SV40L.cass. To produce the plasmid pCMV.BEV. SV40L-O, the structural gene of BEV polymerase is subcloned as a BglII to BamHI fragment into pCMV DNA. SV40L. cass digested with Bglll.

Plasmid pCMV.O.SV40L.BEV The plasmid pCMV.O. SV40L.BEV (Figure 18) comprises a structural gene of translatable BEV polymerase, derived from the plasmid pCR.BEV.2 cloned towards the 3 'end of the CMV-IE promoter in battery in the SV40 late promoter sequences present in the plasmid pCMV. SV40L. cass. To produce the plasmid pCMV.O.SV40L.BEV, the structural gene of BEV polymerase is subcloned in direct orientation as a BglII to BamHI fragment within the pCMV DNA. SV40L. cass digested with BamHl.

Plasmid pCMV.O.SV40L.VEB The plasmid pCMV.O. SV40.VEB (Figure 19) comprises a structural gene of BEV antisense polymerase derived from the plasmid pCR.BEV.2 cloned towards the 3 'end of the CMV-IE promoter in battery and the late promoter sequences of SV40 present in the plasmid pCMV. SV40L. cass. To produce the plasmid pCMV.O. SV40L.VEB, the structural gene of BEV polymerase is subcloned in the antisense orientation as a BglII to BamHI fragment within the pCMV DNA. SV40L. cass digested with BamHl.

. Test plasmids Plasmid pCMV.BEVx2 The plasmid pCMV.BEV.x2 (FIG. 20) comprises a direct repeat sequence of an open BEV polymerase open reading frame under the control of the CMV-IE promoter sequence. In eukaryotic cells at least, the open reading frame that is located closest to the CMV-IE promoter is translatable. To produce pCMV.BEVx2, the BEV polymerase structural gene is subcloned from the plasmid pCR.BEV.2 in the direct orientation as a BglII to BamHI fragment into pCMV.BEV.2 digested with BamHI, immediately towards the 3 'end of the structural gene of BEV polymerase that is already present in it.

Plasmid pCMV.BEVx3 The plasmid pCMV.BEVx3 (FIG. 21) comprises a direct repeat sequence of three complete open reading frames of BEV polymerase under the control of the CMV-1E promoter. To produce pCMV.BEVx3, the BEV polymerase fragment is cloned from pCR.BEV.2 in direct orientation as a BglII / Ba Hl fragment within the BamH1 site of pCMV.BEVx2, immediately towards the 3 'end of the sequences of BEV polymerase that are already present in it.

Plasmid pCMV.BEVx4 The plasmid pCMV.BEVx4 (FIG. 22) comprises a direct repeat sequence of four complete open reading frames of BEV polymerase under the control of the CMV-1E promoter. To produce pCMV.BEVx4, the BEV polymerase fragment is cloned from pCR.BEV.2 in the direct orientation as a BglII / BamHI fragment within the BamH1 site of pCMV.BEVx3, immediately towards the 3 'end of the sequences of BEV polymerase that are already present in it.

Plasmid pCMV.BEV.SV40L.BEV The plasmid pCMV.BEV. SV40L. BEV (FIG. 23) comprises a multiple structural gene unit comprising two structural genes of BEV polymerase placed operably and separately under the control of the CMV-IE promoter and the late promoter sequences of SV40. To produce the plasmid pCMV.BEV.SV40L.BEV, the translatable BEV polymerase structural gene present in pCR.BEV.2 is subcloned in direct targeting as a BglII to BamHI fragment behind the SV40 late promoter sequence present in pCMV. BEV. SV40L-O digested with BamHl.

Plasmid pCMV.BEV.SV40L.VEB The plasmid pCMV.BEV. SV40L. EBV (FIG. 24) comprises a multiple structural gene unit comprising two structural BEV polymerase genes operably and separately under the control of the CMV-IE promoter and the late promoter sequences of SV40. To produce the plasmid pCMV.BEV.SV40L.VEB, the translatable BEV polymerase structural gene present in pCR.BEV.2 is subcloned in the antisense orientation as a BglII to BamHI fragment behind the SV40 late promoter sequence present in pCMV.BEV . SV40L-0 digested with BamHl. In this plasmid, the structural gene of BEV polymerase is expressed in direct orientation under the CMV-IE promoter to produce translatable mRNA, while the BEV polymerase structural gene is also expressed under the control of the SV40 promoter to produce antisense mRNA species .

Plasmid pCMV. BEV. GFP .VEB The plasmid pCMV.BEV. GFP. EBV (Figure 25) comprises an inverted repeated sequence of the BEV structural gene or palindrome, interrupted by the insertion of a reading frame The open GFP (filler fragment) in each BEV structural gene sequence in the inverted repeated sequence. To produce the plasmid pCMV.BEV. GFP.VEB, the GFP filler fragment from pCR.Bgl-GFP-Bam is first subcloned in direct targeting as a BglII fragment within pCMV.BEV.2 digested with BamHI to produce an intermediate plasmid pCMV.BEV. GFP wherein the sequences coding for BEV polymerase and coding for GFP are contained within the same 5'-BglII to BamHI-3 'fragment. The structural gene of BEV polymerase from pCMV.BEV.2 is then cloned in the antisense orientation as a BglII to BamHI fragment within pCMV.BEV. GFP digested with BamHl. The structural gene of BEV polymerase closest to the CMV-IE promoter sequence in the plasmid pCMV.BEV. GFP. EBV is capable of being translated, at least in eukaryotic cells.

Plasmid pCMV. EGFP .BEV2. PFG The plasmid pCMV. EGFP .BEV2. PFG (Figure 26) comprises a palindrome of GFP, interrupted by the insertion of a BEV polymerase sequence between each structural GFP gene in the inverted repeat sequence. To produce this plasmid, the fragment of "GFP from pCR.Bgl-GFP-Bam is cloned as a fragment BglII / BamHI within the BamHl site of pCMV. EGFP. BEV2 in the antisense orientation in relation to the CMV promoter.

Plasmid pCMV.BEV-SV40LR The plasmid pCMV.BEV. SV40LR (Figure 27) comprises a structural gene comprising the entire open reading frame of BEV polymerase placed operably and separately under the control of the opposite CMV-IE promoter and the SV40 late promoter sequences, thereby potentially producing transcripts of BEV polymerase at least from both chains of the full-length BEV polymerase structural gene. To produce the plasmid pCMV.BEV. SV40LR, the translatable BEV polymerase structural gene present in pCR.BEV.2 is subcloned as a BglII to BamHI fragment into the unique BglII site of the pCMV plasmid. SV40LR cass, so that the BEV open reading frame is present in the direct orientation in relation to the promoter sequence CMV-IE. Those skilled in the art will recognize that it is possible to generate a plasmid wherein the BEV polymerase fragment from pCR.BEV.2 is inserted in the antisense orientation, relative to the CMV IE promoter sequence, using this cloning strategy. The present invention also encompasses such a genetic construct.

EXAMPLE 2 Genetic constructs comprising the structural gene sequence of porcine α-1,3-galactosyltransferase (Galt) or sequences operably linked to the CMV promoter sequence or the SV40 promoter sequence or both 1. Commercial plasmids Plasmid pcDNA3 The pcDNA3 plasmid is commercially available from invitrogen and comprises the CMV-IE promoter and the transcription terminator BGHpA, with multiple cloning sites for the insertion of structural gene sequence therebetween. The plasmid also comprises the origins of ColEl and fl replication and genes of neomycin resistance and ampicillin resistance. 2. Intermediate plasmids Plasmid pcDNA3.Galt Plasmid pcDNA3.Galt (BresaGen Limited, South Australia, Australia; figure 28) is a pcDNA3 plasmid (Invitrogen) and comprises the cDNA sequence encoding the α-1,3-galactosyltransferase (Galt) gene operably linked under the control of the CMV-IE promoter so that it is capable of being expressed therefrom. To produce the plasmid pcDNA3.Galt, the cDNA of porcine gene α-1,3-galactosyltransferase is cloned as an EcoRI fragment within the EcoRI cloning site of pcDNA3. The plasmid also comprises the origins of replication ColEl and fl, and the genes of resistance to neomycin and ampicillin. 3. Control plasmids Plasmid pCMV.Galt The plasmid pCMV.Galt (FIG. 29) is capable of expressing the Galt structural gene under the control of a CMV-IE promoter sequence. To produce the plasmid pcDNA3.Galt, the Galt sequence of the plasmid pcDNA3.Galt is cut as an EcoRI fragment and cloned in the direct orientation into the EcoRI site of the plasmid pCMV.cass (Figure 2).

Plasmid pCMV. EGFP.Galt The plasmid pCMV. EGFP. Galt (FIG. 30) is capable of expressing the Galt structural gene as a Galt fusion polypeptide under the control of the CMV-IE promoter sequence. To produce the plasmid pCMV. EGFP. Galt, the Galt sequence of pCMV.Galt is cut (Figure 29) as a BglH / BamHI fragment and cloned into the BamHl site of pCMV-EGFP.

Plasmid pCMV. Galt .EGFP The plasmid pCMV is produced. Galt .GFP (figure 31) by cloning Galt cDNA as an EcoRI fragment from pCDNA3 into pCMV.EGFP digested with EcoRI in direct orientation. This plasmid serves as a control and as an intermediate construct.

Plasmid pCMV.Galt .SV40L.0 The plasmid pCMV.Galt. SV40L.0 (Figure 32) comprises a Galt structural gene cloned towards the 3 'end of the CMV promoter present in pCMV. SV40L. cass. To produce the Galt cDNA fragment from pCMV.Galt, it is cloned as BglII / BamHI within pCMV. SV40L. cass digested with Bglll in direct orientation.

Plasmid pCMV.O. SV40L. tlaG The plasmid pCMV.O. SV40L. tlaG (Figure 33) comprises clones of Galt structural genes in an antisense orientation towards the 3 'end of the SV40L promoter present in pCMV. SV40L. cass. To produce this plasmid, the Galt cDNA fragment from pCMV.Galt is cloned as BglII / BamHI within pCMV. SV40L.cass digested in BamHl in the antisense orientation.

- -. * .. Plasmid pCMV.O.SV40L.Galt The plasmid pCMV.O. SV40L. Galt (Figure 34) comprises a Galt structural gene cloned downstream of the SV40L promoter present in pCMV. SV40L. cass. To produce the plasmid, the Galt cDNA fragment from pCMV.Galt is cloned as a BglII / BamHI fragment into pCMV. SV40L. cass digested with BamHl in direct orientation. 4. Test plasmids Plasmid pCMV.Galtx2 Plasmid pCMV.Galtx2 (FIG. 35) comprises a direct repeat sequence of an open Galt reading frame under the control of the CMV-IE promoter sequence. In at least eukaryotic cells, the open reading frame located closest to the CMV-IE promoter is translatable. To produce pCMV.Galtx2, the Galt structural gene of pCMV.Galt is cut as a BglII / BamHI fragment in the direct orientation within the BamHl cloning site of pCMV.Galt.

Plasmid pCMV.Galtx4 The plasmid pCMV.Galtx4 (figure 36) comprises a direct quadruple repeat sequence of an open reading frame Galt under the control of the promoter sequence CMV-IE. In eukaryotic cells at least, the open reading frame is located near the CMV-IE promoter which is translatable. To produce pCMV.Galtx4, the Galtx2 sequence of pCMV.Galtx2 is cut as a BglII / BamHI fragment and cloned in a direct orientation within the BamHl cloning site of pCMV.Galtx2.

Plasmid pCMV.Galt.SV40.Galt The plasmid pCMV is designed. Galt. SV40L. Galt (figure 37) to express two direct transcripts of Galt, one activated by the CMV promoter, the other by the SV40L promoter. To produce the plasmid, a Galt cDNA fragment is cloned from pCMV.Galt as a BglII / BamHI fragment into pCMV.O.SV40.Galt digested with BglII in the direct orientation.

Plasmid pCMV.Galt .SV40L. tlaG The plasmid pCMV is designed. Galt. SV40.GFP tlaG (Figure 38) to express the direct transcript of Galt activated by the CMV promoter and an antisense transcript activated by the SV40L promoter. To produce the plasmid, a Galt cDNA fragment is cloned from pCMV.Galt as a BglII / BamHI fragment into pCMV.O. SV40. TalG in direct guidance.

Plasmid pCMV.Galt .GFP. tlaG 5 The plasmid pCMV. Galt .GFP. tlaG (Figure 39) comprises a Galt palindrome, interrupted by the insertion of a GFP sequence between each Galt structural gene in the inverted repeat sequence. To produce this plasmid, the Galt cDNA fragment treated by BglII / BamHI of pCMV.Galt is cloned into the BamHI site of pCMV. Galt .GFP antisense in relation to the CMV promoter.

Plasmid pCMV.EGFP. Galt .PFG 15 The plasmid pCMV. EGFP.Galt. PFG (Figure 40) comprises a palindrome of GFP, interrupted by the insertion of a Galt sequence between each structural GFP gene of the inverted repeat sequence, the expression of which is activated by the promoter CMV. To produce this plasmid, the Galt sequences of pCMV.Galt are cloned as a BglII / BamHI fragment into pCMV.EGFP digested with BamHI in the direct orientation to produce the pCMV intermediate. EGF .Galt (not shown); Subsequent to this, additional GFP sequences follow from pCR.Bgl-25 pCMV.EGFP. Galt in the antisense orientation. t * a Mß nim * ií Plasmid pCMV.Galt .SV40LR The plasmid pCMV.Galt is designed. SV40LR (Figure 41) to express cloned GalT cDNA sequences between the opposing CMV and SV40L promoters in the expression cassette pCMV. SV40LR cass. To produce this plasmid, the plasmid Galt sequences are cloned from pCMV.Galt as a BglIl / BamHI fragment in pCMV. SV40LR cass digested with BglII in direct orientation in relation to the 35S promoter.

Example 3 Genetic constructs comprising PVY Nia sequences operably linked to the 35S promoter sequence or the SCBV promoter sequence, or both 1: Binary vector Plasmid pART27 Plasmid pART27 is a binary vector, specifically designed to be compatible with the expression cassette pART7. It contains the bacterial origins of replication of both E. coli and Agrobacterium tumefaciens, a gene for resistance to spectinomycin for bacterial selection, limits of left and right T DNA for transfer of DNA from Agrobacterium to plant cells and a cassette of kanamycin resistance for allow the selection of transformed plant cells. The kanamycin resistance cassette is located between the T DNA boundaries, pART27 also contains a unique Notl restriction site which allows the cloning of the constructs prepared in vectors such as pART7, cloned between the T DNA boundaries. Construction of pART27 is described in Gleave, AP (1992). When Notl insects are cloned into this vector, two insert orientations can be obtained. In all the following examples, the same orientation is chosen, in relation to the address of the 35S promoter in the described pART7 drivers; this is done to minimize any experimental artifact that may arise when comparing different constructs with different insert orientations. 2. Commercial plasmids Plasmid pCB (KS-) Plasmid pBC (KS-) is commercially available from Stratagene and comprises the lacZ promoter sequence and the lacZ-a transcription terminator, with a multiple cloning site for the insertion of structural gene sequences therein. The plasmid further comprises the ColEl and fl origins of replication, and a chloramphenicol resistance gene.

Plasmid pSP72 Plasmid pSP72 is commercially available from It promises and contains a multiple cloning site for the insertion of structural gene sequences in it. The plasmid also comprises the origin of replication of ColEl and an ampicillin resistance gene. 3. Expression cassettes Plasmid pART7 Plasmid pART7 is an expression cassette designed to activate the expression of cloned sequences behind the 35S promoter. It contains a polylinker to aid cloning, and a region of the octipin synthase terminator. The 35S expression cassette is flanked by two Notl restriction sites which allow cloning in binary expression vectors, so that pART27 continues as a single Notl site. Its construction is as described in Gleave, AP (1992), and a map is shown in Figure 43.

Plasmid pART7.35S. SCBV. cass The plasmid p35S. CMV. cass is designed to express two separate gene sequences cloned into a single plasmid. To create this plasmid, the sequences corresponding to the terminators nos and the SCBV promoter are amplified by PCR and then cloned in the polylinker of pART7 between the 35S promoter and OCS. The resulting plasmid has the following array of elements: promoter 35S-polylinker 1-terminator NOS-promoter SCVB-polylinker 2 -terminer OCS. The expression of the sequences cloned within polylinker 1 are controlled by the 35S promoter, the expression of the cloned sequences in polylinker 2 are controlled by the SCBV promoter. The NOS terminator sequences are amplified from plasmid pAHC27 (Christensen and Quail, 1996) using the two oligonucleotides; US 5 '(direct primer; SEQ ID NO: 5) -GGATTCCCGGGACGTCGCGAATTTCCCCCGATCGTTC-3'; Y US 3 '(reverse primer; SEQ ID NO: 5) -CCATGGCCATATAGGCCCGATCTAGTAACATAG-3' Nucleotide residues 1 to 17 for 5 'NOS, and 1 to 15 for 3' NOS represent additional nucleotides designed to aid in the preparation of a construct by adding additional restriction sites. For NOS 5 ', these are BamHl, Smal, AatH and the first 4 bases of a Nril site, for NOS 3', these are Ncol and Sfil sites. The remanent sequences for each oligonucleotide are homologous to the 5 'and 3' ends respectively of the NOS sequences in pAHC 27. The SCBV promoter sequences are amplified from the plasmid pScBV-20 (Tzafir et al, 1998) using the two oligonucleotides: SCBV 5 ': 5' -CCATGGCCTATATGGCCATTCCCCACATTCAAG-3 '; Y SCBV 3 ': 5' -AACGTTAACTTCTACCCAGTTCCAGAG-3 '.

The nucleotide residues 1 to 17 of SCBV 5 'encode the Ncol and Sfil restriction sites designed to aid in the preparation of constructs, the remaining sequences are homologous to the sequences towards the 5' end of the promoter region of SCMV. The nucleotide residues 1 to 9 of SCBV 3 'code for Pspl0461 and the Hpal restriction sites designed to aid in the preparation of the construct, the remaining sequences are homologous to the inverse or to the complement of the sequences near the transcription start site of SCBV. The sequences amplified from pScVB-20 using PCR and cloned into pCR2.1 (Invitrogen) to produce pCR.NOS and pCR.SCBV, respectively. Binding pCR.NOS cut with Small / Sfil and pCR.SCBV cut with Sfil / Hpal are ligated into pART7 cut with Smal, and a plasmid with a suitable orientation is chosen and named pART7.35S. SCBV. cass, and a map of that construct is shown in figure 43. 4. Intermediary constructions Plasmid pBC.PVY A region of the PVY genome is amplified by PCR using reverse transcribed RNA isolated from tobacco infected with PVY as a template using standard protocols and cloned into a pGEM 3 plasmid (Stratagene) to create pGEM.PVY. A SalI / HindIII fragment of pGEM.PVY, corresponding to the SalII / HindIII 1536-2270 fragment positions of the O sequence of the PVY strain (access number D12539, GenBank), was then subcloned into the pBC plasmid (Stratagene Inc. ) to create pBC.PVY (figure 44).

Plasmid pSP72.PVY Plasmid pSP72.PVY is prepared by inserting an EcoRI / SalI fragment from pBC.PVY into pSP72 cut with Ecol / Sall (Promega). This construct contains additional restriction sites that flank the PVY insert which is used to aid subsequent manipulations. In figure 45 a map of this construct is shown.

Plasmid ClapBC.PVY Plasmid pBC.PVY is prepared by inserting a fragment Clal / Sall from pSP72.PVY within pBC cut with Clal / Sall (Stratagene). This construct contains additional restriction sites that flank the PVY insert which they use to aid in subsequent manipulations. In figure 46 a map of this construct is shown.

Plasmid pBC.PVYx2 The plasmid pBC.PVYx2 contains two direct repeated sequences, head to tail, of the pBC.PVY sequences. The plasmid is generated by cloning an Accl / Clal fragment of PVY from pSP72.PVY in pBC.PVY cut with Accl, and is shown in Figure 47.

Plasmid pSP72-PVYx2 Plasmid pSP72.PVY.x2 contains two direct repeated head-to-tail sequences of the PVY sequences derived from pCB.PVY. The plasmid is generated by cloning a PVY fragment of Accl / Clal from pBc. PVY within pSP72.PVY cut with Accl, and shown in figure 48.

Plasmid pSP72-PVYx3 The plasmid pBC.PVYx3 contains three direct repeated head-to-tail sequences of the PVY sequences derived from pCB.PVY. The plasmid is prepared by cloning a PVY fragment of Accl / Clal from pSP72. PVY inside pBC.PVYx2 cut with Accl, and shown in figure 49.

Plasmid pSP72-PVYx4 The plasmid pBC.PVYx4 contains four direct repeated head-to-tail sequences of the PVY sequences derived from pBC.PVY. The plasmid is prepared by cloning the direct repeated sequence of PVY sequences from pSP72.PVYx2 as an Accl / Clal fragment into pBC.PVYx2 cut with Accl, and shown in Figure 50.

Plasmid pBC.PVY.LNYV All attempts to create direct palidromes of the PVY sequences failed, probably because such sequence arrays are unstable in cloned hosts of E. coli commonly used. However, the interrupted palindromes proved to be stable. To create interrupted palindromes of the sequences PVY, a "filler" fragment of approximately 360 bp within pW.PVY treated with Cía towards the 3 'end of the PVY sequences. The filler fragment is made as follows: A clone obtained initially from a cDNA library prepared from the genomic RNA of the lettuce necrotic yellowing virus (LNYV) (Deitzgen et al., 1989), which is known to contain the virus 4b gene, is amplified by PCR using the primers: LNYV 1: 5 '-ATGGGATCCGTTATGCCAAGAAGAAGGA-3'; Y LNVY 2: 5 '-TGTGGATCCCTAACGGACCCGATG-3' The first nine nucleotides of these primers encode for a BamH1 site, the remaining nucleotides are homologous to the sequences of the 4b gene of LNYV. After amplification, the fragment is cloned into the EcoRI site of pCR2.1 (Stratagene). This EcoRI fragment is cloned into the EcoRI site of pBC.PVY treated with Cía, to create the intermediate plasmid pBC.PVY. LNYV which is shown in figure 51.

Plasmid pBC. PVY. LNYV. PVY The pBC plasmid. PVY.LNYV. YVP contains an interrupted direct repeated sequence of PVY sequences. To create this plasmid, a Hpal / HincII fragment is cloned from pSP72 into pbc.pvy.lnyv digested with Smal, and a plasmid containing the isolated direct orientation, a map of this construct is shown in Figure 52.

Plasmid pBC.PVY.LNYV.YVP? The plasmid pBV. PVY. LNYV. YVP? contains a partially interrupted palindrome of PVY sequences. One arm of the palindrome contains all the PVY sequences from pBC.PVY, the other arm contains part of the PVY sequences, which correspond to the sequences between the EcoRV and HincII sites of pSP72.PVY. To create this plasmid, an EcoRV / HincII fragment is cloned from pSP72.PVY in pBC.PVY. LNYV digested with Smal, and a plasmid containing the desired orientation isolated, and a map of this construct is shown in Figure 53.

Plasmid pBC.PVY. NYV.YVP The plasmid contains an interrupted palindrome of PVY sequences, to create this plasmid, a Hpal / HincII fragment of pSP72 is cloned into pBC. PVY.LNYV digested with Sma and a plasmid containing the isolated antisense orientation, a map of this construct is shown in Figure 54.

. Control plasmids Plasmids pART7.PVY and pART7.PVY The pART7 plasmid. PVY (Figure 55) is designed to express PVY sequences activated by the 35S promoter. This plasmid serves as a control construct in these experiments, against which all other constructs are compared. To generate this plasmid, a Clal / Accl fragment is cloned from ClapBC.PVY into pART7 digested with Clal, and a plasmid is selected that is expected to express a direct PVY sequence with respect to the PVY genome. The sequences consisting of the 35S promoter, the PVY sequences and the OCS terminator are cut as a NotI fragment and cloned in pART27 digested with NotI, a plasmid with the desired orientation of the insert is selected and named pART27.

Plasmids pART7.35S. PVY. SCBV.0 and pART27.35S. VY SCBV.0 The plasmid pART7.35S is digested. PVY. SCBV.0 (Figure 56) to act as a control for the coexpression of multiple constructs from a single plasmid in transgenic plants. The 35S promoter is designed to express direct PVY sequences, while the SCBV promoter is empty. To generate this plasmid, the PVY fragment from Cía pBC.PVY is cloned as an Xhol / EcoRI fragment within pART7.35SCBV. cass digested with Xhol / EcoRI to create p35SC. PVY. SCBV > 0. The sequences consisting of the 35S promoter that activates the direct PVY sequences and the NOS terminator and the SCBV promoter, and the OCS terminator are cut as a NotI fragment and cloned into pART27, a plasmid with the desired orientation of the insert is isolated and it is called pART27.35S.PVY.SCBV.O.

Plasmids pART7.35S .O. SCBV. PVY and pART27.35S .0. SCBV. PVY The plasmid pART27.35S .0. SCBV. PVY (Figure 57) is designed to act as an additional control for the coexpression of multiple constructs from a single plasmid in transgenic plants. Non-expressible sequences are cloned behind the 35S promoter, while the SCBV promoter activates the expression of a direct PVY fragment. To generate this plasmid, the PVY fragment from Cía pBC.PVY is cloned as a Clal fragment within pART7.35S.SCBV. cass, digested with Clal, a plasmid containing the PVY sequences in a direct orientation, is isolated and designated p35S .0. SCBV. PVY. The sequences consisting of the 35S promoter and the NOS terminator, the SCBV promoter that activates the direct PVY sequences and the OSC terminator are cut as a NotI fragment and cloned into pART27, a plasmid with the desired insert orientation is isolated and named pART27.35S .0. SCBV. PVY.

Plasmids pART7.35S .O. SCBV.YVP and pART7.35S .0. SCBV.YVP The plasmid pART7.35S .O.SCBV is digested. YVP (figure 58) to act as an additional control for the coexpression of multiple constructs from a single plasmid in transgenic plants. The non-expressible sequences are cloned behind the 35S promoter, while the SCBV promoter activates the expression of an antisense PVY fragment. To generate this plasmid, the PVY fragment from Cía pBC.PVY is cloned as a Clal fragment within p35S .0. SCBV. cass, digested with Clal, a plasmid containing PCY sequences in an antisense orientation, and is isolated and designated p35S .0. SCBV. YVP The sequences consisting of the 35S promoter and the NOS terminator are cut, the SCBV promoter activates the PVY direct sequences and the OSC terminator, as a NotI fragment and cloned into pART27, a plasmid with the desired insert orientation is isolated and isolated. denominates pART27.35S. O SCBV. YVP 6. Test plasmids Plasmids pART7.PVYx2 and pART27.PVYx2 The pART7 plasmid. PVYx2 (Figure 59) is designed to express a direct repeated sequence of active PVY sequences by the 35S promoter in transgenic plants. To generate this plasmid, direct repeated sequences of pBC.PVYx2 are cloned as an XhoI / BamHI fragment into pART7 cut with XhoI / BamHI. The sequences consisting of the 35S promoter, the PVY direct repeats and the OSC terminator are cut as a NotI fragment from pAR 7. PVYx2 and cloned into pART27, digested with NotI, a plasmid is selected with the desired insert orientation and it is called pART27. PVYx2.

Plasmids pART7.PVYx3 and pART27.PVYx3 The pART7 plasmid is designed. PVYx3 (figure 60) to express a direct repeat sequence of three PVY sequences activated by the 35S promoter in transgenic plants. To generate this plasmid, the direct repeated sequences of pBC.PVYx3 are cloned as an XhoI / BamHI fragment into pART7 cut with XhoI / BamHI. The sequences consisting of the 35S promoter, direct repeat sequences of PVY and the OSC terminator are cut as a NotI fragment from pART.PVYx3 and cloned into pLN27 digested with NotI, a plasmid is selected with the desired insert orientation, and it is called pART27.PVYx3.

Plasmids pART7.PVYx4 and pART27.PVYx4 The pART7 plasmid is designed. PVYx4 (Figure 61) to express a direct repeat sequence of four PVY sequences activated by the 35S promoter in transgenic plants. To generate this plasmid, direct repeat sequences of pBC.PVYx4 are cloned as an XhoI / BamHI fragment into pART7 cut with XhoI / BamHI. The sequences consisting of the 35S promoter, the direct repeat sequences of PVY and the OCS terminator, are cut as a Notl fragment from pART7. PVYx3 and are cloned into pART27, digested with NotI, and a plasmid with the desired insert orientation is selected and named pART27.PVYx3.

Plasmids pART7. PVY. LNYV. PVY and pART27. PVY. LNYV. PVY The pART7 plasmid is designed. PVY.LNYV. PVY (Figure 62) to express the interrupted direct repeated sequence of the PVY sequences activated by the 35S promoter in transgenic plants. This construct is prepared by cloning the interrupted direct repeated sequence of PVY from pBC.PVY. LNYV. PVY as an XhoI / Xbal fragment within pART7 digested with XhoI / XbaI. The sequences consisting of the 35S promoter, the interrupted direct repeat sequence of the PVY sequences and the OSC terminator, are cut from pART7. PVY.LNYV. PVY as a NotI fragment and cloned into pART27 digested with NotI, a plasmid is selected with the desired insert orientation, and is referred to as pART27. PVY. LNYV. PVY.

Plasmids pART7.PVY.LNYV.YVP? and pART27.PVY.LNYV.YVP? The pART7 plasmid is designed. PVY. LNYV. YPV? (Figure 63) to express the partial interrupted palindrome of the PVY sequences activated by the 35S promoter in transgenic plants. This construct is prepared by cloning the partial interrupted palindrome of the PVY sequences from pBC.PVY. LNYV. YVP? as an XhoI / Xbal fragment within pART7 digested with XhoI / XbaI. The sequences that consist of the promoter 35S, the partial interrupted palindrome of the PVY sequences and the OSC terminator are cut off from pART7. PVY.LNYV. YVP? As a NotI fragment and cloned into pART27, digested with NotI, a plasmid with the desired insert orientation is selected and named pART27. PVY. LNYV. YVP Plasmid pART7. PVY. LNYV.YVP and pART27. PVY.LNYV.YVP The pART7 plasmid is designed. PVY.LNYV. YVP (figure 64) to express the interrupted palindrome of the PVY sequences activated by the 35S promoter in transgenic plants. This construct is prepared by cloning the interrupted palindrome of PVY sequences from pBC. PVY.LNYV. YVP? as an XhoI / Xbal fragment within pART7 digested with XhoI / XbaI. The sequences consisting of the 35S promoter, the interrupted palindrome of the PVY sequences and the OCS terminator are cut from pART7. PVY. LNYV. YVP as a NotI fragment and cloned into pART27, the plasmid is selected with the desired insert orientation and is referred to as pART27. PVY. LNYV. YVP Plasmid pART7.35S. VY.SCBV. VP and pART27.35S. PVY. SCBV.YVP Plasmid pART7.35S is designed. PVY. SCBV. YVP (figure 65) to express direct and antisense constructs in transgenic plants. To generate this plasmid, the PVY fragment from Cía pBC.PVY is cloned as an Xhol / EcoRI fragment into Xhol / EcoRI digested with p35S. SCBV. O. SCBV. YVP The sequences, consisting of the 35S promoter that activates the direct PVY sequences and the NOS terminator as well as the SCBV promoter that activates the antisense PVY and the OSC terminator, are cut as a NotI fragment and cloned into pART27, a plasmid is isolated with the pART27.35S. PVY. SCBV. YVP P S a m e s pART 7. 35 S. PVYx 3, S CBV. YVPx 3 and pART27.35S.PVYx3, SCBV.YVPx3 Plasmid pART7.35S is designed. VYx3, SCBV. YVPx3 (figure 66) to co-express direct and antisense PVY antisense sequences in transgenic plants. To generate this plasmid, the intermediary pART7.35S.O is constructed. SCBV. YVPx3 by cloning a triple direct PVY repeat sequence from ClapBC.PVYx3 as a Clal / Accl fragment within p35S. SCBV. cass digested with Cia and isolation of a plasmid with an antisense orientation. For 35S. PVYx3, SCBV. YVPx3 the triple direct PVY repeat sequence of Co. pBC.PVYx3 is cloned as a Kpnl / Smal fragment within Kpnl / Smal digested with Kpnl / Smal within p35S .0. SCBV. YVPx3 to create p35S. PVYx3. SCBV. YVPx3. Sequences including both promoters, terminators and direct PVY repeat sequences are isolated as a NotI fragment and cloned into pART27. A plasmid with an appropriate orientation is chosen and is called pART27.35S. PVYx3. SCBV.

Plasmids pART7. PVYx3. LNYV. VPx3 and pART27.PVYx3.LNYV.YVPx3 Plasmid pART7 is designed. PVYx3. LNYV. YVPx3 (FIG. 67) to express repeated triple sequences of PVY sequences as an interrupted palindrome. To generate this plasmid, a pART7x3 intermediate is constructed. PVYx3. LNYV. YV by cloning a PVY fragment. LNYV. YVP from pBC. PVY.LNYV. YVP as an AccI / Clal fragment within the plasmid pART7.PVYx2.pART7.35S.PVYx3.LNYV.YVPX3, which is made by cloning an additional direct repeat sequence of PVY from pBC.PVYx2 as an Accl / Call fragment within from pART7x3.PVYx3.LNYV. YVP, digested with Clal. The sequences of pART7.35S.PVYx3.LNYV.YVPx3, including the 35S promoter, all the PVY sequences and the OSC terminator are cut as a NotI fragment and cloned into pART27, digested with NotI, a plasmid with an orientation is chosen appropriate and is called pART27.35S.PVYx3.LNYV.

Plasmids pART7.PVY multi and pART27.PVY multi.

The multi plasmid pART7.35S is designed. PVY multi (figure 68) to express higher order direct repeated sequences of regions of the PVY sequences in transgenic plants. The higher order direct repeated sequences of 72 bp of the PVY Nia region of PVY are prepared by reassociating two partially complementary oligonucleotides, as follows: PVY1: 5 '-TAATGAGGATGATGTCCCTACCTTTAATTGGCAGAAATTTCTGTGGAAAGACAG GGAAATCTTTCGGCATTT-3'; Y PVY2: 5 '-TTCTGCCAATTAAAGGTAGGGACATCATCCTCATTAAAATGCCGAAAGATT TCCCTGTCTTTCCACAGAAAT-3' The oligonucleotides are phosphorylated with T4 polynucleotide kinase, heated and slowly cooled to allow self-reoccurrence, ligated with T4 DNA ligase, filled at the ends with Klenow polymerase and cloned into pCR2.1 (Invitrogen). Plasmids containing multiple repeat sequences are isolated and the sequences cloned as EcoRI fragments in a direct orientation within pART7 digested with EcoRI, to create pART7. PVY multi intermediary, to create pART27.PVY multi, the 35S promoter, the PVY sequences and the OSC terminator are cut as a NotI fragment and cloned into pART27 digested with NotI. A plasmid is isolated with the proper insert orientation and is referred to as pART27.PVY multi.

EXAMPLE 6 Inactivation of the expression of a virus gene in a mammal Viral immune lines are generated by expressing viral sequences in stably transformed cell lines. In particular, lytic viruses are used for this approach, since the lysis of the cells provides a very simple analysis and also provides the ability to directly select for the potentially rare transformation events which can create viral immunity. Subgenomic fragments derived from a simple, single-chain virus RNA (bovine enterovirus-BEV) or a double-stranded DNA virus, complex, herpes simplex virus I (HSV I) are cloned into a suitable vector and expressed in transformed cells . Mammalian cell lines are transformed with genetic constructs designed to express viral sequences activated by the strong cytomegalovirus promoter (CMV-IE). The sequences used include specific viral replicase genes. Libraries of random "shotguns" comprising sequences of representative viral genes can also be used and the introduced dispersed nucleic acid molecule, towards the target of the expression of the virus sequences. Exemplary genetic constructs for use in this method comprise nucleotide sequences derived from the RNA-dependent RNA polymerase gene of BEV and are presented herein.

For the viral polymerase constructs, large amounts (about 100) of transformed cell lines are generated and infected with the respective virus. For the cells transformed with the shotgun libraries very large numbers (hundreds) of transformed lines are generated and analyzed in volume to determine viral immunity. After exposure to the virus, the resistant cell lines are selected and analyzed further to determine the sequences that confer immunity to it. The resistant cell lines are supportive of the ability of the introduced nucleotide sequences to inactivate the expression of viral genes in a mammalian system. Additionally, the resistant lines obtained from such experiments are used to define more precisely the molecular and biochemical characteristics of the modulation which is observed.

EXAMPLE 8 Induction of virus resistance in transgenic plants Agrrojbacterium tumefaciens is transformed, strain LBA4404, independently, with the pART27 constructs. PVY, pART27. PVYx2, pART2 7. PVYx3, pART2 7. PVYx4, pART2 7. PVY. LNYV. PVY, pART27.PVY.LNYV, YVP ?, pART27. PVY. LNYV. YVP, pART27.35S. PVY. SCBV. Or, pART27.35S.O.SCBV.PVY, pART27.35S. O SCBV. YVP, pART27.435S. PVY. SCBV. YVP, pART27.35S. PVYx3. SCBV. YPVx3, pART27. PVYx3. LNYV. YVPx3 and pART27. PVYxlO, using triparentales pairing. DNA mini-preparations of these strains are prepared and examined by restriction with Notl to ensure that they contain the appropriate binary vectors. Nicotiana tabaccum (culture W38) is transformed with these strains of Agrobacterium using standard procedures. The transformed putative shoots are cut and planted in medium containing kanamycin. Under these conditions, we have consistently observed that only transgenic shoots generate roots on kanamycin plates. The shoots with roots are transferred to the soil and allowed to settle. After two to three weeks, vigorous plants with at least three sets of leaves are selected and infected with PVY. The viral inoculum is prepared from W38 tobacco previously infected with the virus, approximately 2 g of leaf material, which shows obvious viral symptoms and is grown with carbarundum in 10 ml of 100 mM Na phosphate buffer (pH 7.5) . The inoculum is diluted to 200 ml with additional Na phosphate buffer. Two leaves of each transgenic plant are splashed with carbarundum, and then apply 0.4 ml of inoculum to each leaf, and the leaves are rubbed very vigorously with the fingers. Using this procedure, 100% of non-transgenic control plants are infected with PVY. To perform an assay regarding viral resistance and immunity, transgenic plants are monitored to determine the development of symptoms. The PVY strain (PVY-D, an Australian isolate of PVY) provides obvious symptoms in tobacco W38, a symptom of vein clearance is observed quickly on both leaves above the inoculated leaves, and the subsequent leaves show uniform chlorotic lesions . The development of symptoms is monitored over a period of six weeks. The transgenic lines are described as resistant if they show reduced viral symptoms which manifest as a reduction in the leaves showing chlorotic lesions. The resistance intervalsFrom a very strong resistance, there were only some viral lesions that are observed in a plant, up to a weak resistance, which manifests itself with reduced symptoms in the leaves that develop later in the growth of the plants. Transgenic plants which show absolutely no evidence of viral symptoms are classified as immune. To ensure that these plants are immune, they are re-inoculated with virus, most of the plants remain immune, and some of them show symptoms and are classified as resistant.

For lines of plants generated, the Southern blot test is performed, and the resistance is monitored in subsequent generations to determine if the resistance / immunity is transmissible. Additionally, the viral resistance space is monitored by exposing lines with other PVY strains, to determine if the susceptibility of the host range has been modified. The results of these experiments are described in the Table 2. These data indicate that constructs comprising repeated sequences in sequence of the target gene, either in the configuration of palindromes, interrupted palindromes as direct repeated sequences, are capable of conferring viral resistance and / or immunity in transgenic plants . Consequently, such inverted or direct repeated sequences, or both, modulate the expression of the target gene of the virus in the transgenic plant. The constructs that combine the use of direct and inverse repeated sequences, specifically pART27.35S.PVYx3.SCBV.YVPx3 and pART27. PVYx3. LNYV. YVPx3, are also useful for modulating gene expression.

EXAMPLE 9 Inactivation of Galt in animal cells To test the inactivation of Galt, porcine PK2 cells are transformed with the relevant constructs. PK2 cells constitutively express the Galt enzyme, whose activity results in the addition of a variety of α-1,3-galactosyl groups to a variety of proteins expressed on the cell surface of these cells. Cells are transformed using lipofectin and stably transformed lines are selected using genetecin. As an initial assay, cell lines are probed to determine the presence of the epitope encoded by Galt, ie, the a-1,3-galactosyl portions that decorate the cell surface proteins, using lectin IB4. The IB4 binding test is carried out either in itself or by FACS classification. For binding in, the cells are fixed to solid supports with cold methanol for 5 minutes, the cells are rinsed in PBS (phosphate buffered saline) and the non-specific IB4 binding is blocked with 1% BSA in PBS for 10 minutes. minutes Fixed cells are probed using 20 μg / ml IB4-biotin (Sigma) in 1% BSA, PBS for 30 minutes at room temperature, the cells are washed in PBS and then probed with a 1: 200 dilution of ExtrAvidin-FITC (Sigma) in PBS for 30 minutes, followed by additional rinsings in PBS. The cells are then examined using fluorescence microscopy, under these conditions, the outer surface of the control PK2 cells stains uniformly green. For FACS analysis, the cells are suspended after treatment with trypsin, washed in HBSS / Hepes (Hank's buffered saline with 20 mM Hepes, pH 7.4) and probed with 10 μg / ml of IB4-biotin (Sigma) in HBSS / Hepes for 45 minutes at 4 ° C. The cells are washed in HBSS / Hepes, probed with a 1: 200 dilution of ExtrAvidin-FITC (Sigma) in HBSS / Hepes for 45 minutes at 4 ° C and rinsed in HBSS / Hepes before sorting by FACS. Using this approach, transformed cell lines are assayed for Galt inactivation and the quantitative assignment of construct effectiveness is determined. In addition, cell lines that are inactivated by Galt are isolated and subjected to additional molecular analysis to determine the mechanism of inactivation of the gene.

REFERENCES 1. An et al. (1985) EMBO J 4: 277-284. 2. Armostrong, et al. Plant Cell Reports 9: 335-339, 1990. 3. Ausubel, F.M. et al. (1987) In: Current Protocols in Molecular Biology, Wliey Interscience (ISBN 047140338). 4. Chalfie, M. et al (1994) Science 263: 802-805. 5. Christensen, A.H. and Quail, P.H. (1996) Transgenic Research 5: 213-218. 6. Christou, P., et al. Plant Physiol 81: 671-674, 1988. 7. Cormack, B. et al. (1996) Gene 173: 33-38. 8. Crossway et al., Mol. Gen. Genet. 202: 179-185, 1986. 9. Dorer, D.R., and Henikoff, S. (1994) Cell 7: 993-1002.

. Fromm et al. Proc. Natl. Acad. Sci. (USA) 82: 5824-5828, 1985. 11. Cleave, A.P. (1992) Plant Molecular Bioloby 20: 1203-1207. 12. Hanahan, D. (1983) J. "Mol. Biol. 166: 557-560 13. Herrera-Estella et al., Nature 303: 209-213, 1983a 14. Herrera-Estella et al., EMBO J. 2: 987-995, 1983b.

. Herrera-Estella et al. In: Plant Genetic Engineering, Cambridge University Press, N.Y. , pp. 63-93, 1985. 16. Inouye, S. and Tsuji, F.l. (1994) FEBS Letts. 341: 277-280. 17. Jackson, I.J. (1995) Ann Rev. Genet. 28: 189-217.

Krens, F.A. et al., Nature 296: 72-74, 1982. Kwon, B.S. et al., (1988) Biochem. Biophys. Res. Comm. 153: 1301-1309. Pal-Bhadra, M. et al., (1997) Cell 90: 479-490. Paszkowski et al., EMBO J. 3: 2717-2722, 1984 Prasher, D.C. et al., (1992) Gene 111: 229-233. Sanford, J.C. et al., Particulate Science and Technology 5: 27-37, 1987.

SEQUENCE LIST (I) GENERAL INFORMATION: (i) APPLICANT: AgGene Australia Pty. Ltd and The Government of Queensland as represented by Queensland Department of Primary Industries ii) TITLE OF THE INVENTION: Synthetic genes and genetic constructs that comprise them. iii) NUMBER OF SEQUENCES: 16 (iv) ADDRESS OF CORRESPONDENCE: (A) RECIPIENT: DAVIES COLLISON CAVE (B) STREET: 1 LITTLE COLLINS STREET (C) CITY: MELBOURNE (D) STATE: VICTORIA (E) COUNTRY: AUSTRALIA (F) POSTAL CODE: 3000 (V) LEGIBLE FORM IN COMPUTER (A) TYPE OF MEDIUM: Flexible disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM; PC-DOS / MS-DOS (D) SOFTWARE: Patentln Relay # 1.0, Version # 1.25 (vi) CURRENT REQUEST DATA: (A) NUMBER OF APPLICATION: Provisional AU (B) DATE OF SUBMISSION: (VIII) INFORMATION ATTORNEY / AGENT (A) NAME: HUGHES EL, JOHN E L (IX) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: +61 3 9254 2777 (B) TELEFAX: +61 3 9254 2770 (C) TELEX: AA 31787 (2) INFORMATION FOR SEC. FROM IDENT. NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 1 CGGCAGATCT AACAATGGCA GGACAAATCG AGTACATC 38 (2) INFORMATION FOR SEC. FROM IDENT. NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 2: CCCGGGATCC TCGAAAGAAT CGTACCACTT C 31 (2) INFORMATION FOR SEC. FROM IDENT. NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 3 GGGCGGATCC TTAGAAAGAA TCGTACCAC 29 (2) INFORMATION FOR SEC. FROM IDENT. NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 4: CGGCAGATCT GGACAAATCG AGTACATC 28 (2) INFORMATION FOR SEC. FROM IDENT. NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 5 AGATCTGTAA ACGGCCACAA GTTCAG 26 (2) INFORMATION FOR SEC. FROM IDENT. NO 6 : (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO 6 : GGATCCTTGT ACAGCTCGTC CATGCC 26 (2) INFORMATION FOR SEC. FROM IDENT. NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 74 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 7: GTCGACAATA AAATATCTTT ATTTTCATTA CATCTGTGTG TTGGTTTTTT GTGTGATTTT 60 TGCAAAAGCC TAGG 74 (2) INFORMATION FOR SEC. FROM IDENT. NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) LOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 8 GTCGACGTTT AGAGCAGAAG TAACACTTCC G 31 (2) INFORMATION FOR SEC. FROM IDENT. NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) LOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 9 CCCGGGGCTT AGTGTAAAAC AGGCTGAGAG 30 (2) INFORMATION FOR SEC. FROM IDENT. NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) LOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 10 CCCGGGCAAA TCCCAGTCAT TTCTTAGAAA C 31 (2) INFORMATION FOR SEC. FROM IDENT. NO: 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) LOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: ll: CGGCAGATCT AACAATGGCA GGACAAATCG AGTACATC 38 (2) INFORMATION FOR SEC. FROM IDENT. NO: 12: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) LOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 12 CCCGGGATCC TCGAAAGAAT CGTACCACTT C 31 (2) INFORMATION FOR SEC. FROM IDENT. NO: 13: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) LOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 13 GGGCGGATCC TTAGAAAGAA TCGTACCAC 29 (2) INFORMATION FOR SEC. FROM IDENT. NO: 14: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) LOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 14 CGGCAGATCT GGACAAATCG AGTACATC 28 (2) INFORMATION FOR SEC. FROM IDENT. NO: 15: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) LOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 15: CCCGGGGCTT AGTGTAAAAC AGGCTGAGAG 30 (2) INFORMATION FOR SEC. FROM IDENT. NO: 16: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) LOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 16 CCCGGGCAAA TCCCAGTCAT TTCTTAGAAA C 31

Claims (43)

1. A method of repressing, retarding or otherwise reducing the expression of a target gene in a cell, tissue or animal organ, the method comprises introducing the cell, tissue or animal organ to one or more dispersed nucleic acid molecules or foreign molecules of nucleic acid comprising battery copies of a nucleotide sequence which is substantially identical to the nucleotide sequence of the target gene or to a region thereof or complementary thereto for a time and under conditions sufficient for the translation of the mRNA product of the target gene which it will be modified, subject to the condition that the transcription of the mRNA product is not repressed or reduced exclusively.

The method as described in claim 1, wherein the dispersed nucleic acid molecules or the extraneous nucleic acid molecules comprise inverted repeat sequences of the target gene sequence or a region thereof, or complementary thereto.

The method as described in claim 1, wherein the dispersed nucleic acid molecules or the extraneous nucleic acid molecules comprise direct repeat sequences of the target gene sequence or a region thereof, or complementary thereto.

4. The method as described in claim 1, wherein the dispersed nucleic acid molecules or the extraneous nucleic acid molecules comprise both direct and inverted repeat sequences of the target gene sequence or a region thereof, or complementary thereto.

The method as described in any of claims 1 to 4, wherein the copy number of the target gene sequence or a region thereof or complementary thereto in the dispersed nucleic acid molecule or the foreign molecule of nucleic acid, is two.

The method as described in any of claims 1 to 4, wherein the copy number of the target gene sequence or a region thereof or complementary thereto in the dispersed nucleic acid molecule or the foreign molecule of nucleic acid, is three.

The method as described in any of claims 1 to 4, wherein the copy number of the target gene sequence or a region thereof or complementary thereto in the dispersed nucleic acid molecule or the foreign molecule of nucleic acid, is four.

The method as described in any one of claims 1 to 4, wherein the copy number of the target gene sequence or a region thereof or complementary thereto in the dispersed nucleic acid molecule or the foreign molecule of nucleic acid, is six.

The method as described in any one of claims 1 to 4, wherein the copy number of the target gene sequence or a region thereof or complementary thereto in the dispersed nucleic acid molecule or the foreign molecule of nucleic acid, is ten.

The method as described in any one of claims 1 to 9, wherein the dispersed nucleic acid molecule or the foreign nucleic acid molecule comprises repeated sequences in sequence of the target gene, and wherein one or more of the repeated units of the repeated sequences in battery that is separated from the other unit is a filler fragment containing nucleic acid.

The method as described in claim 1, wherein the animal is a mouse.

The method as described in any of claims 1 to 11, wherein the target gene is a gene which is contained within the genome of the cell, tissue or animal organ.

The method as described in claim 12, wherein the target gene is α-1,3-galactosyltransferase.

The method as described in any of claims 1 to 13, wherein the target gene is derived from the genome of a cell pathogen, tissue or animal organ, or an organism comprising the cell, tissue or organ.

15. The method as described in claim 14, wherein the pathogen is virus.

16. The method as described in claim 15, wherein the virus is BEV.

The method as described in any of claims 1 to 16, further comprising selecting the dispersed nucleic acid molecules or the foreign nucleic acid molecules according to their ability to effectively modulate the expression of the target gene.

18. A method for repressing, retarding or otherwise reducing the expression of a target gene in a cell, tissue or animal organ, the method comprising: (i) selecting one or more dispersed nucleic acid molecules or foreign acid molecules nucleic which comprise repeated sequences in battery or a nucleotide sequence which is substantially identical to the nucleotide sequence of the target gene or a region thereof or which is complementary to it; (ii) producing a synthetic gene comprising dispersed nucleic acid molecules or foreign nucleic acid molecules operably linked to a promoter sequence operable in the cell, tissue or animal organ; (iii) introducing the synthetic gene into the cell, tissue or organ, and (iv) expressing the synthetic gene in the cell, tissue or organ for a time and under conditions sufficient for the translation of the mRNA product of the target gene that is leaving to be modified, subject to the condition that the transcription of such mRNA product is not expressed or reduced exclusively.

19. A method for conferring resistance or immunity against a viral pathogen in a cell, tissue, organ or animal whole organism, comprising introducing one or more of the dispersed nucleic acid molecules or foreign nucleic acid molecules which comprise repeated sequences in tandem of a nucleotide sequence derived from the viral pathogen or a sequence complementary thereto for a time and under conditions sufficient for translation of the mRNA product of a virus gene to be retarded or reduced in some other way, subject to the condition that transcription of the mRNA product is not repressed or reduced exclusively.

The method as described in claim 19, wherein the virus is an animal pathogen.

21. The method as described in claim 20, wherein the virus is BEV.

22. The method as described in any of claims 19 to 21, further comprising selecting the dispersed nucleic acid molecules or the foreign nucleic acid molecules, according to their ability to confer resistance or immunity in the cell, tissue, animal organ or organism.

23. A method for conferring resistance or immunity against a viral pathogen to a whole animal cell, tissue, organ or organism, comprising: (i) selecting one or more dispersed nucleic acid molecules or foreign nucleic acid molecules which comprise sequences repeated in battery or a nucleotide sequence derived from the viral pathogen or a sequence complementary thereto; (ii) producing a synthetic gene comprising the dispersed nucleic acid molecules or the extraneous nucleic acid molecules operably connected to a promoter sequence operable in the whole cell, tissue, organ or organism; (iii) introducing the synthetic gene into the whole cell, tissue, organ or organism; and (iv) expressing the synthetic gene in the cell, tissue or organ for a time and under conditions sufficient for translation of the mRNA product of a gene of the virus to be modified, subject to the condition that the transcription of the product from MRNA is not repressed or reduced exclusively.

The method as described in one of claims 19 to 23, wherein the dispersed nucleic acid molecules or the extraneous nucleic acid molecules comprise battery copies of the nucleotide sequence encoding a replicase, polymerase, coat protein or viral cover elimination gene.

25. The method as described in claim 24, wherein the dispersed nucleic acid molecules or the extraneous nucleic acid molecules comprise battery copies of the nucleotide sequence encoding a viral polymerase.

26. The method as recited in claim 25, wherein the dispersed nucleic acid molecules or foreign nucleic acid molecules comprise battery copies of nucleotide sequence encoding a viral coat protein.

27. A synthetic gene, when used according to the method of claim 1 to repress, retard or otherwise reduce the expression of a target gene in a cell, tissue, organ or animal whole organism, wherein the gene Synthetic comprises a dispersed nucleic acid molecule or a foreign nucleic acid molecule comprising battery copies of a nucleotide sequence which is substantially identical to the nucleotide sequence of the target gene or a derivative thereof, or a sequence complementary thereto operably placed under the control of a promoter sequence which is operable in the cell, tissue, organ or complete animal organism.

The synthetic gene as described in claim 27, wherein the dispersed nucleic acid molecule or a foreign nucleic acid molecule comprises repeated sequences in battery, inverted or direct or both, of a genetic sequence that is endogenous to the genome of the cell, tissue, organ or animal organism or which is derived from a non-endogenous gene of the animal cell, tissue, organ or organism.

29. The synthetic gene as described in claim 28, wherein the non-endogenous gene is derived from a viral pathogen of the animal cell, tissue, organ or organism.

30. The synthetic gene as described in claim 29, wherein the non-endogenous gene is derived from an animal virus.

31. The synthetic gene as described in claim 30, wherein the animal virus is BEV.

32. The synthetic gene as described in claim 30, wherein the non-endogenous gene is derived from the BEV polymerase gene.

33. The synthetic gene as described in claim 32, wherein the promoter is the CMV-IE promoter or the SV40 promoter sequence.

34. The synthetic gene as described in claims 27 or 28, wherein the dispersed nucleic acid molecule or a foreign nucleic acid molecule comprises repeat, inverted or direct, battery sequences, or both, of the a-1, 3 porcine gene. -galactosyltransferase.

35. The synthetic gene as described in claim 24, wherein the porcine gene of a-1,3-galactosyltransferase is operably placed in connection with the promoter sequence of CMV.

36. The synthetic gene as described in any of claims 27 to 35, wherein the battery copies of the nucleotide sequence of the target gene are operably linked to two or more promoter sequences.

37. The synthetic gene as described in claim 36, wherein each of the battery copies of the nucleotide sequence of the target gene are operably linked to spatially separated promoter sequences.

38. A genetic construct comprising the synthetic gene as described in any of claims 27 to 37.

39. The genetic construct, as described in claim 38, which is selected from the list comprising the plasmid pCMV.BEVx2; pCMV plasmid. BEV. GFP .VEB; plasmid pCMV.BEV.SV40L.BEV; and the pCMV plasmid. BEV. SV40L .VEB.

40. The genetic construct, as described in claim 38, which is selected from the plasmid pCMV.Galtx2; and pCMV.Galtx4.

41. The use of the genetic construct, as described in claim 39, to confer immunity or resistance against BEV to a cell, tissue or animal organ, or to a whole animal.

42. The use of the genetic construct, as described in claim 40, to retard, repress or otherwise reduce the expression of a-1,3-galactosyltransferase in a cell, tissue, organ or animal whole organism that otherwise way I would express to it.

43. A cell, tissue, organ or complete animal organism, comprising the synthetic gene as described in any of claims 27 to 37, or the genetic construct according to any of claims 38 to 40.