US10064900B2 - Methods of populating a gastrointestinal tract - Google Patents
Methods of populating a gastrointestinal tract Download PDFInfo
- Publication number
- US10064900B2 US10064900B2 US14/765,810 US201414765810A US10064900B2 US 10064900 B2 US10064900 B2 US 10064900B2 US 201414765810 A US201414765810 A US 201414765810A US 10064900 B2 US10064900 B2 US 10064900B2
- Authority
- US
- United States
- Prior art keywords
- bacterial
- spore
- species
- clostridium
- composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/37—Digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/742—Spore-forming bacteria, e.g. Bacillus coagulans, Bacillus subtilis, clostridium or Lactobacillus sporogenes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
- A61K35/745—Bifidobacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
- A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/4816—Wall or shell material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/12—Antidiarrhoeals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- Mammals are colonized by microbes in the gastrointestinal (GI) tract, on the skin, and in other epithelial and tissue niches such as the oral cavity, eye surface and vagina.
- GI gastrointestinal
- the gastrointestinal tract harbors an abundant and diverse microbial community. It is a complex system, providing an environment or niche for a community of many different species or organisms, including diverse strains of bacteria. Hundreds of different species may form a commensal community in the GI tract in a healthy person, and this complement of organisms evolves from the time of birth to ultimately form a functionally mature microbial population by about 3 years of age.
- resources may be food, location and the availability of space to grow or a physical structure to which the microbe may attach.
- host diet is involved in shaping the GI tract flora.
- a healthy microbiota provides the host with multiple benefits, including colonization resistance to a broad spectrum of pathogens, essential nutrient biosynthesis and absorption, and immune stimulation that maintains a healthy gut epithelium and an appropriately controlled systemic immunity.
- microbiota functions can be lost or deranged, resulting in increased susceptibility to pathogens, altered metabolic profiles, or induction of proinflammatory signals that can result in local or systemic inflammation or autoimmunity.
- the intestinal microbiota plays a significant role in the pathogenesis of many diseases and disorders, including a variety of pathogenic infections of the gut. For instance, subjects become more susceptible to pathogenic infections when the normal intestinal microbiota has been disturbed due to use of broad-spectrum antibiotics. Many of these diseases and disorders are chronic conditions that significantly decrease a subject's quality of life and can be ultimately fatal.
- probiotics have asserted that their preparations of bacteria promote mammalian health by preserving the natural microflora in the GI tract and reinforcing the normal controls on aberrant immune responses. See, e.g., U.S. Pat. No. 8,034,601. Probiotics, however, have been limited to a very narrow group of genera and a correspondingly limited number of species; as such, they do not adequately replace the missing natural microflora of the GI tract in many situations.
- a mammalian subject includes the step of orally administering to the mammalian subject an effective amount of a therapeutic composition comprising a purified population of spore-forming bacteria produced by the steps of a) providing a fecal material and b) subjecting the material to a treatment step resulting in purification of spore-forming bacteria, wherein the purified population is present in an amount effective to engraft and/or augment in the gastrointestinal tract in order to treat or prevent a dysbiosis in the mammalian subject.
- Disclosed herein are methods for populating the gastrointestinal tract of a mammalian subject comprising the step of orally administering to the subject an effective amount of a therapeutic composition comprising a purified population of spore-forming bacteria in an amount effective to engraft and/or augment in the gastrointestinal tract in order to treat or prevent a dysbiosis in a mammalian subject.
- compositions comprising a purified population of spore-forming bacteria or bacteria having a substantial activity of spore-forming bacteria in an amount effective to populate the gastrointestinal tract of a mammalian subject to whom the therapeutic composition is administered.
- the population is effective to i) treat a gastrointestinal dysbiosis, and/or ii) engraft at least one type of bacteria present in the therapeutic composition but not present in a mammalian subject prior to treatment; and/or iii) augment at least one type of bacteria not present in the therapeutic composition in a mammalian subject to whom the therapeutic composition is administered.
- compositions comprising a purified population of spore-forming bacteria in an amount effective to populate the gastrointestinal tract of a mammalian subject to whom the therapeutic composition is administered, wherein the purified population is obtained by the steps of a) providing a fecal material comprising spore-forming bacteria and b) subjecting the spore-forming bacteria to a treatment step resulting in purification of the spore-forming bacteria.
- the invention also includes therapeutic compositions comprising a purified bacterial spore population comprising at least about 1 ⁇ 10 3 , 1 ⁇ 10 4 , 1 ⁇ 10 6 , or 1 ⁇ 10 6 spores, wherein the composition does not exceed about 1 gram in weight, formulated for oral administration to populate the gastrointestinal trace in a mammalian subject in need thereof, in order to i) engraft in the mammalian recipient and/or ii) augment a bacterial population in the mammalian recipient and thereby treat or prevent a dysbiosis.
- kits comprising in one or more containers a fecal material collection apparatus and a solvent solution, and instructions for use thereof for generating purified populations of spore-forming bacteria.
- the invention includes methods of populating the gastrointestinal tract of a human subject, comprising the step of administering to the human subject a therapeutic composition comprising a purified population of spore-forming bacteria, under conditions such that a microbial population present in the gastrointestinal tract and/or a microbial population outside the gastrointestinal tract is modulated.
- the invention also includes methods of populating a bacterial population in the gastrointestinal tract of a human subject, comprising the step of administering to the human subject a therapeutic composition comprising a purified population of spore-forming bacteria, under conditions such that at least i) a subset of the spore-forming bacteria sustainably engraft within the gastrointestinal tract, or ii) at least one type of bacteria not present in the therapeutic composition is augmented within the gastrointestinal tract.
- the invention includes methods of populating the gastrointestinal tract of a mammalian subject, comprising the step of orally administering to the subject an effective amount of a bacterial composition comprising at least a first type of isolated bacteria and a second type of isolated bacteria, wherein the first type and the second type are not identical, under conditions such that the first type of isolated bacteria and the second type of isolated bacteria functionally populate the gastrointestinal tract of the subject.
- the invention includes methods of populating the gastrointestinal tract of a mammalian subject, comprising the step of orally administering to the subject an effective amount of a therapeutic composition comprising a purified population of spore-forming bacteria produced by the steps of a) providing a fecal material and b) subjecting the material to a treatment step resulting in purification of spore-forming bacteria, wherein the purified population is present in an amount effective to treat or prevent a dysbiosis in a mammalian recipient subject to whom the therapeutic composition is administered.
- the invention also includes methods of populating the gastrointestinal tract of a mammalian subject, comprising the step of orally administering to the subject an effective amount of a therapeutic composition comprising a purified population of spore-forming bacteria, in an amount effective to treat or prevent a dysbiosis in a mammalian recipient subject to whom the therapeutic composition is administered.
- FIG. 1A provides a schematic of 16S rRNA gene and denotes the coordinates of hypervariable regions 1-9 (V1-V9), according to an embodiment of the invention. Coordinates of V1-V9 are 69-99, 137-242, 433-497, 576-682, 822-879, 986-1043, 1117-1173, 1243-1294, and 1435-1465 respectively, based on numbering using E. coli system of nomenclature defined by Brosius et al., Complete nucleotide sequence of a 16 S ribosomal RNA gene (16 S rRNA ) from Escherichia coli , PNAS 75(10):4801-4805 (1978).
- FIG. 1B highlights in bold the nucleotide sequences for each hypervariable region in the exemplary reference E. coli 16S sequence described by Brosius et al. (SEQ ID NO: 828)
- FIG. 2 shows a photograph of a CsCl gradient demonstrating the spore separation from other residual habitat material, according to an embodiment of the invention.
- FIG. 3 shows three phase contrast images demonstrating the progressive enrichment of spores from a fecal suspension (ethanol treated, CsCl purified spore preparation, and an ethanol treated, CsCl purified, sucrose purified spore preparation).
- FIG. 4 shows a set of survival curves demonstrating efficacy of the spore population in a hamster prophylaxis model of C. difficile .
- Bots are ethanol-treated spores+Vancomycin; Squares are ethanol-treated, gradient purified spores+Vancomycin; X's are vancomycin control; and Diamonds are the vehicle control).
- FIG. 5 provides a set of survival curves demonstrating efficacy of the spore population in a hamster relapse prevention model of C. difficile .
- Opaque diamonds are ethanol-treated spores+Vancomycin; squares are ethanol-treated, gradient purified spores+Vancomycin; X's are vancomycin control; and Clear Diamonds are vehicle control).
- FIG. 6 demonstrates the cell viability under a variety of ethanol and heat treatments for varying lengths of time.
- FIG. 7 shows the strong correlation and linear correspondence between the measurement of DPA concentration by a coupled fluorescence assay and the viable spore colony forming units.
- FIG. 8 demonstrates the effect on various germination treatments on the ability to cultivate vegetative bacteria from a spore population.
- FIG. 9 demonstrates the increase in bacterial diversity from using a germinant treatment to grow vegetative bacteria from spore populations.
- FIG. 10 demonstrates the role of heat activation at various temperatures on spores from three different donor fecal samples.
- FIG. 11 demonstrates that a lysozyme treatment with heat activation improves germination at most temperatures.
- FIG. 12 demonstrates the microbial diversity measured in the ethanol treated spore treatment sample and patient pre- and post-treatment samples.
- Total microbial diversity is defined using the Chao1 Alpha-Diversity Index and is measured at the same genomic sampling depths to confirm adequate sequence coverage to assay the microbiome in the target samples.
- the patient pretreatment (line 1) harbored a microbiome that was significantly reduced in total diversity as compared to the ethanol treated spore treatment (line 2) and patient post treatment at days 5 (line 3), 14 (line 4), and 25 (line 5).
- FIG. 13 demonstrates how the patient microbial ecology is shifted by treatment with an ethanol treated spore treatment from a dysbiotic state to a state of health.
- Principle coordinates analysis based on the total diversity and structure of the microbiome (Bray Curtis Beta Diversity) of the patient pre- and post-treatment delineates that the combination of engraftment of the OTUs from the spore treatment and the augmentation of the patient microbial ecology leads to a microbial ecology that is distinct from both the pretreatment microbiome and the ecology of the ethanol treated spore treatment.
- FIG. 14 demonstrates the augmentation of bacteroides species in patients treated with the spore population. Comparing the number of Bacteroides colonies from fecal suspensions pre-treatment and in week 4 post treatment reveals an increase of 4 logs or greater. Colonies were enumerated by serial dilution and plating on Bacteroides Bile Esculin agar which is highly selective for the B. fragilis group. Species were determined by 16S full-length sequence identification.
- FIG. 15 demonstrates the increase in number of species engrafting and species augmenting in patient's microbiomes after treatment with an ethanol-treated spore population. Relative abundance of species that engrafted or augmented as described were determined based on the number of 16S sequence reads. Each plot is from a different patient treated with the ethanol-treated spore population for recurrent C. difficile.
- Microbiota refers to the community of microorganisms that occur (sustainably or transiently) in and on an animal subject, typically a mammal such as a human, including eukaryotes, archaea, bacteria, and viruses (including bacterial viruses i.e., phage).
- Microbiome refers to the genetic content of the communities of microbes that live in and on the human body, both sustainably and transiently, including eukaryotes, archaea, bacteria, and viruses (including bacterial viruses (i.e., phage)), wherein “genetic content” includes genomic DNA, RNA such as ribosomal RNA, the epigenome, plasmids, and all other types of genetic information.
- “Microbial Carriage” or simply “Carriage” refers to the population of microbes inhabiting a niche within or on humans. Carriage is often defined in terms of relative abundance. For example, OTU1 comprises 60% of the total microbial carriage, meaning that OTU1 has a relative abundance of 60% compared to the other OTUs in the sample from which the measurement was made. Carriage is most often based on genomic sequencing data where the relative abundance or carriage of a single OTU or group of OTUs is defined by the number of sequencing reads that are assigned to that OTU/s relative to the total number of sequencing reads for the sample.
- Microbial Augmentation refers to the establishment or significant increase of a population of microbes that are (i) absent or undetectable (as determined by the use of standard genomic and microbiological techniques) from the administered therapeutic microbial composition, (ii) absent, undetectable, or present at low frequencies in the host niche (for example: gastrointestinal tract, skin, anterior-nares, or vagina) before the delivery of the microbial composition, and (iii) are found after the administration of the microbial composition or significantly increase, for instance 2-fold, 5-fold, 1 ⁇ 10 2 , 1 ⁇ 10 3 , 1 ⁇ 10 4 , 1 ⁇ 10 5 , 1 ⁇ 10 6 , 1 ⁇ 10 7 , or greater than 1 ⁇ 10 8 , in cases where they were present at low frequencies.
- the host niche for example: gastrointestinal tract, skin, anterior-nares, or vagina
- the microbes that comprise an augmented ecology can be derived from exogenous sources such as food and the environment, or grow out from micro-niches within the host where they reside at low frequency.
- the administration of the therapeutic microbial composition induces an environmental shift in the target niche that promotes favorable conditions for the growth of these commensal microbes.
- the host In the absence of treatment with a therapeutic microbial composition, the host can be constantly exposed to these microbes; however, sustained growth and the positive health effects associated with the stable population of increased levels of the microbes comprising the augmented ecology are not observed.
- Microbial Engraftment or simply “engraftment” refers to the establishment of OTUs comprising a therapeutic microbial composition in a target niche that are absent in the treated host prior to treatment.
- the microbes that comprise the engrafted ecology are found in the therapeutic microbial composition and establish as constituents of the host microbial ecology upon treatment.
- Engrafted OTUs can establish for a transient period of time, or demonstrate long-term stability in the microbial ecology that populates the host post treatment with a therapeutic microbial composition.
- the engrafted ecology can induce an environmental shift in the target niche that promotes favorable conditions for the growth of commensal microbes capable of catalyzing a shift from a dysbiotic ecology to one representative of a health state.
- Ecological Niche or simply “Niche” refers to the ecological space in which an organism or group of organisms occupies. Nicohe describes how an organism or population or organisms responds to the distribution of resources, physical parameters (e.g., host tissue space) and competitors (e.g., by growing when resources are abundant, and when predators, parasites and pathogens are scarce) and how it in turn alters those same factors (e.g., limiting access to resources by other organisms, acting as a food source for predators and a consumer of prey).
- physical parameters e.g., host tissue space
- competitors e.g., by growing when resources are abundant, and when predators, parasites and pathogens are scarce
- Dysbiosis refers to a state of the microbiota or microbiome of the gut or other body area, including mucosal or skin surfaces in which the normal diversity and/or function of the ecological network is disrupted. Any disruption from the preferred (e.g., ideal) state of the microbiota can be considered a dysbiosis, even if such dysbiosis does not result in a detectable decrease in health. This state of dysbiosis may be unhealthy, it may be unhealthy under only certain conditions, or it may prevent a subject from becoming healthier.
- Dysbiosis may be due to a decrease in diversity, the overgrowth of one or more pathogens or pathobionts, symbiotic organisms able to cause disease only when certain genetic and/or environmental conditions are present in a patient, or the shift to an ecological network that no longer provides a beneficial function to the host and therefore no longer promotes health.
- pathobiont refers to specific bacterial species found in healthy hosts that may trigger immune-mediated pathology and/or disease in response to certain genetic or environmental factors. Chow et al., (2011) Curr Op Immunol . Pathobionts of the intestinal microbiota and inflammatory disease. 23: 473-80. Thus, a pathobiont is a pathogen that is mechanistically distinct from an acquired infectious organism. Thus, the term “pathogen” includes both acquired infectious organisms and pathobionts.
- pathogen in reference to a bacterium or any other organism or entity includes any such organism or entity that is capable of causing or affecting a disease, disorder or condition of a host organism containing the organism or entity.
- “Phylogenetic tree” refers to a graphical representation of the evolutionary relationships of one genetic sequence to another that is generated using a defined set of phylogenetic reconstruction algorithms (e.g. parsimony, maximum likelihood, or Bayesian). Nodes in the tree represent distinct ancestral sequences and the confidence of any node is provided by a bootstrap or Bayesian posterior probability, which measures branch uncertainty.
- phylogenetic reconstruction algorithms e.g. parsimony, maximum likelihood, or Bayesian
- “Operational taxonomic units,” “OTU” refer to a terminal leaf in a phylogenetic tree and is defined by a nucleic acid sequence, e.g., the entire genome, or a specific genetic sequence, and all sequences that share sequence identity to this nucleic acid sequence at the level of species.
- the specific genetic sequence may be the 16S sequence or a portion of the 16S sequence.
- the entire genomes of two entities are sequenced and compared.
- select regions such as multilocus sequence tags (MLST), specific genes, or sets of genes may be genetically compared.
- OTUs that share ⁇ 97% average nucleotide identity across the entire 16S or some variable region of the 16S are considered the same OTU (see e.g. Claesson M J, Wang Q, O'Sullivan O, Greene-Diniz R, Cole J R, Ross R P, and O'Toole P W. 2010. Comparison of two next-generation sequencing technologies for resolving highly complex microbiota composition using tandem variable 16S rRNA gene regions. Nucleic Acids Res 38: e200. Konstantinidis K T, Ramette A, and Tiedje J M. 2006. The bacterial species definition in the genomic era. Philos Trans R Soc Lond B Biol Sci 361: 1929-1940.).
- OTUs that share ⁇ 95% average nucleotide identity are considered the same OTU (see e.g. Achtman M, and Wagner M. 2008. Microbial diversity and the genetic nature of microbial species. Nat. Rev. Microbiol. 6: 431-440. Konstantinidis K T, Ramette A, and Tiedje J M. 2006. The bacterial species definition in the genomic era. Philos Trans R Soc Lond B Biol Sci 361: 1929-1940.). OTUs are frequently defined by comparing sequences between organisms. Generally, sequences with less than 95% sequence identity are not considered to form part of the same OTU.
- OTUs may also be characterized by any combination of nucleotide markers or genes, in particular highly conserved genes (e.g., “house-keeping” genes), or a combination thereof. Such characterization employs, e.g., WGS data or a whole genome sequence.
- Table 1 below shows a List of Operational Taxonomic Units (OTU) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade.
- Clade membership of bacterial OTUs is based on 16S sequence data.
- Clades are defined based on the topology of a phylogenetic tree that is constructed from full-length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics. Clades are constructed to ensure that all OTUs in a given clade are: (i) within a specified number of bootstrap supported nodes from one another, and (ii) within 5% genetic similarity.
- OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S-V4 sequence data, while OTUs falling within the same clade are closely related. OTUs falling within the same clade are evolutionarily closely related and may or may not be distinguishable from one another using 16S-V4 sequence data. Members of the same clade, due to their evolutionary relatedness, play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention.
- OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont (see Definitions for description of “Pathobiont”).
- NIAID Priority Pathogens are denoted as ‘Category-A’, ‘Category-B’, or ‘Category-C’, and Opportunistic Pathogens are denoted as ‘OP’.
- OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as ‘N’.
- SEQ ID Number denotes the identifier of the OTU in the Sequence Listing File
- Public DB Accession denotes the identifier of the OTU in a public sequence repository.
- Table 2 contains bacterial OTUs identified from the 16s analysis of the ethanol treated spore population before and after a CsCl gradient purification.
- “Residual habitat products” refers to material derived from the habitat for microbiota within or on a human or animal.
- microbiota live in feces in the gastrointestinal tract, on the skin itself, in saliva, mucus of the respiratory tract, or secretions of the genitourinary tract (i.e., biological matter associated with the microbial community).
- Substantially free of residual habitat products means that the bacterial composition no longer contains the biological matter associated with the microbial environment on or in the human or animal subject and is 100% free, 99% free, 98% free, 97% free, 96% free, or 95% free of any contaminating biological matter associated with the microbial community.
- Residual habitat products can include abiotic materials (including undigested food) or it can include unwanted microorganisms. Substantially free of residual habitat products may also mean that the bacterial composition contains no detectable cells from a human or animal and that only microbial cells are detectable. In one embodiment, substantially free of residual habitat products may also mean that the bacterial composition contains no detectable viral (including bacterial viruses (i.e., phage)), fungal, mycoplasmal contaminants.
- bacterial viruses i.e., phage
- it means that fewer than 1 ⁇ 10 ⁇ 2 %, 1 ⁇ 10 ⁇ 3 %, 1 ⁇ 10 ⁇ 4 %, 1 ⁇ 10 ⁇ 5 %, 1 ⁇ 10 ⁇ 6 %, 1 ⁇ 10 ⁇ 7 %, 1 ⁇ 10 ⁇ 8 of the viable cells in the bacterial composition are human or animal, as compared to microbial cells.
- contamination may be reduced by isolating desired constituents through multiple steps of streaking to single colonies on solid media until replicate (such as, but not limited to, two) streaks from serial single colonies have shown only a single colony morphology.
- reduction of contamination can be accomplished by multiple rounds of serial dilutions to single desired cells (e.g., a dilution of 10 ⁇ 8 or 10 ⁇ 9 ), such as through multiple 10-fold serial dilutions. This can further be confirmed by showing that multiple isolated colonies have similar cell shapes and Gram staining behavior.
- Other methods for confirming adequate purity include genetic analysis (e.g. PCR, DNA sequencing), serology and antigen analysis, enzymatic and metabolic analysis, and methods using instrumentation such as flow cytometry with reagents that distinguish desired constituents from contaminants.
- “Clade” refers to the OTUs or members of a phylogenetic tree that are downstream of a statistically valid node in a phylogenetic tree.
- the clade comprises a set of terminal leaves in the phylogenetic tree that is a distinct monophyletic evolutionary unit and that share some extent of sequence similarity.
- 16S sequencing or “16S-rRNA” or “16S” refers to sequence derived by characterizing the nucleotides that comprise the 16S ribosomal RNA gene(s).
- the bacterial 16S rDNA is approximately 1500 nucleotides in length and is used in reconstructing the evolutionary relationships and sequence similarity of one bacterial isolate to another using phylogenetic approaches. 16S sequences are used for phylogenetic reconstruction as they are in general highly conserved, but contain specific hypervariable regions that harbor sufficient nucleotide diversity to differentiate genera and species of most bacteria.
- V1-V9 regions of the 16S rRNA refers to the first through ninth hypervariable regions of the 16S rRNA gene that are used for genetic typing of bacterial samples. These regions in bacteria are defined by nucleotides 69-99, 137-242, 433-497, 576-682, 822-879, 986-1043, 1117-1173, 1243-1294 and 1435-1465 respectively using numbering based on the E. coli system of nomenclature. Brosius et al., Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli , PNAS 75(10):4801-4805 (1978).
- V1, V2, V3, V4, V5, V6, V7, V8, and V9 regions are used to characterize an OTU.
- the V1, V2, and V3 regions are used to characterize an OTU.
- the V3, V4, and V5 regions are used to characterize an OTU.
- the V4 region is used to characterize an OTU.
- a person of ordinary skill in the art can identify the specific hypervariable regions of a candidate 16S rRNA by comparing the candidate sequence in question to a reference sequence and identifying the hypervariable regions based on similarity to the reference hypervariable regions, or alternatively, one can employ Whole Genome Shotgun (WGS) sequence characterization of microbes or a microbial community.
- WGS Whole Genome Shotgun
- subject refers to any animal subject including humans, laboratory animals (e.g., primates, rats, mice), livestock (e.g., cows, sheep, goats, pigs, turkeys, and chickens), and household pets (e.g., dogs, cats, and rodents).
- the subject may be suffering from a dysbiosis, including, but not limited to, an infection due to a gastrointestinal pathogen or may be at risk of developing or transmitting to others an infection due to a gastrointestinal pathogen.
- phenotype refers to a set of observable characteristics of an individual entity.
- an individual subject may have a phenotype of “health” or “disease”.
- Phenotypes describe the state of an entity and all entities within a phenotype share the same set of characteristics that describe the phenotype.
- the phenotype of an individual results in part, or in whole, from the interaction of the entities genome and/or microbiome with the environment.
- Network Ecology refers to a consortium of OTUs that co-occur in some number of subjects.
- a “network” is defined mathematically by a graph delineating how specific nodes (i.e. OTUs) and edges (connections between specific OTUs) relate to one another to define the structural ecology of a consortium of OTUs. Any given Network Ecology will possess inherent phylogenetic diversity and functional properties.
- a Network Ecology can also be defined in terms of function where for example the nodes would be comprised of elements such as, but not limited to, enzymes, clusters of orthologous groups (COGS; www.ncbi.nlm.nih.gov/books/NBK21090/), or KEGG pathways (www.genome.jp/kegg/).
- elements such as, but not limited to, enzymes, clusters of orthologous groups (COGS; www.ncbi.nlm.nih.gov/books/NBK21090/), or KEGG pathways (www.genome.jp/kegg/).
- Network Class, Core Network, Core Network Ecology refers to a group of network ecologies that in general are computationally determined to comprise ecologies with similar phylogenetic and/or functional characteristics.
- a Core Network therefore contains important biological features, defined either phylogenetically or functionally, of a group (i.e., a cluster) of related network ecologies.
- One representation of a Core Network Ecology is a designed consortium of microbes, typically non-pathogenic bacteria, that represents core features of a set of phylogenetically or functionally related network ecologies seen in many different subjects.
- a Core Network while designed as described herein, exists as a Network Ecology observed in one or more subjects.
- Core Network ecologies are useful for reversing or reducing a dysbiosis in subjects where the underlying, related Network Ecology has been disrupted.
- Keystone OTU refers to one or more OTUs that are common to many network ecologies and are members of networks ecologies that occur in many subjects (i.e. are pervasive). Due to the ubiquitous nature of Keystone OTUs, they are central to the function of network ecologies in healthy subjects and are often missing or at reduced levels in subjects with disease. Keystone OTUs may exist in low, moderate, or high abundance in subjects.
- non-Keystone OTU refers to an OTU that is observed in a Network Ecology and is not a keystone OTU.
- Phylogenetic Diversity refers to the biodiversity present in a given Network Ecology or Core Network Ecology based on the OTUs that comprise the network.
- Phylogenetic diversity is a relative term, meaning that a Network Ecology or Core Network that is comparatively more phylogenetically diverse than another network contains a greater number of unique species, genera, and taxonomic families.
- Uniqueness of a species, genera, or taxonomic family is generally defined using a phylogenetic tree that represents the genetic diversity all species, genera, or taxonomic families relative to one another.
- phylogenetic diversity may be measured using the total branch length or average branch length of a phylogenetic tree.
- a “spore” or a population of “spores” includes bacteria (or other single-celled organisms) that are generally viable, more resistant to environmental influences such as heat and bacteriocidal agents than vegetative forms of the same bacteria, and typically capable of germination and out-growth.
- “Spore-formers” or bacteria “capable of forming spores” are those bacteria containing the genes and other necessary abilities to produce spores under suitable environmental conditions.
- a “spore population” refers to a plurality of spores present in a composition. Synonymous terms used herein include spore composition, spore preparation, ethanol treated spore fraction and spore ecology.
- a spore population may be purified from a fecal donation, e.g. via ethanol or heat treatment, or a density gradient separation or any combination of methods described herein to increase the purity, potency and/or concentration of spores in a sample.
- a spore population may be derived through culture methods starting from isolated spore former species or spore former OTUs or from a mixture of such species, either in vegetative or spore form.
- the spore preparation comprises spore forming species wherein residual non-spore forming species have been inactivated by chemical or physical treatments including ethanol, detergent, heat, sonication, and the like; or wherein the non-spore forming species have been removed from the spore preparation by various separations steps including density gradients, centrifugation, filtration and/or chromatography; or wherein inactivation and separation methods are combined to make the spore preparation.
- the spore preparation comprises spore forming species that are enriched over viable non-spore formers or vegetative forms of spore formers.
- spores are enriched by 2-fold, 5-fold, 10-fold, 50-fold, 100-fold, 1000-fold, 10,000-fold or greater than 10,000-fold compared to all vegetative forms of bacteria.
- the spores in the spore preparation undergo partial germination during processing and formulation such that the final composition comprises spores and vegetative bacteria derived from spore forming species.
- isolated encompasses a bacterium or other entity or substance that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature or in an experimental setting), and/or (2) produced, prepared, purified, and/or manufactured by the hand of man.
- Isolated bacteria include those bacteria that are cultured, even if such cultures are not monocultures. Isolated bacteria may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more of the other components with which they were initially associated.
- isolated bacteria are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure.
- a substance is “pure” if it is substantially free of other components.
- the terms “purify,” “purifying” and “purified” refer to a bacterium or other material that has been separated from at least some of the components with which it was associated either when initially produced or generated (e.g., whether in nature or in an experimental setting), or during any time after its initial production.
- a bacterium or a bacterial population may be considered purified if it is isolated at or after production, such as from a material or environment containing the bacterium or bacterial population, or by passage through culture, and a purified bacterium or bacterial population may contain other materials up to about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or above about 90% and still be considered “isolated.”
- purified bacteria and bacterial populations are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure.
- the one or more bacterial types present in the composition can be independently purified from one or more other bacteria produced and/or present in the material or environment containing the bacterial type.
- Bacterial compositions and the bacterial components thereof are generally purified from residual habitat products.
- “Inhibition” of a pathogen encompasses the inhibition of any desired function or activity of the bacterial compositions of the present invention. Demonstrations of pathogen inhibition, such as decrease in the growth of a pathogenic bacterium or reduction in the level of colonization of a pathogenic bacterium are provided herein and otherwise recognized by one of ordinary skill in the art. Inhibition of a pathogenic bacterium's “growth” may include inhibiting the increase in size of the pathogenic bacterium and/or inhibiting the proliferation (or multiplication) of the pathogenic bacterium. Inhibition of colonization of a pathogenic bacterium may be demonstrated by measuring the amount or burden of a pathogen before and after a treatment. An “inhibition” or the act of “inhibiting” includes the total cessation and partial reduction of one or more activities of a pathogen, such as growth, proliferation, colonization, and function.
- a “germinant” is a material or composition or physical-chemical process capable of inducing vegetative growth of a bacterium that is in a dormant spore form, or group of bacteria in the spore form, either directly or indirectly in a host organism and/or in vitro.
- a “sporulation induction agent” is a material or physical-chemical process that is capable of inducing sporulation in a bacterium, either directly or indirectly, in a host organism and/or in vitro.
- To “increase production of bacterial spores” includes an activity or a sporulation induction agent. “Production” includes conversion of vegetative bacterial cells into spores and augmentation of the rate of such conversion, as well as decreasing the germination of bacteria in spore form, decreasing the rate of spore decay in vivo, or ex vivo, or to increasing the total output of spores (e.g. via an increase in volumetric output of fecal material).
- the “colonization” of a host organism includes the non-transitory residence of a bacterium or other microscopic organism.
- “reducing colonization” of a host subject's gastrointestinal tract (or any other microbiotal niche) by a pathogenic bacterium includes a reduction in the residence time of the pathogen in the gastrointestinal tract as well as a reduction in the number (or concentration) of the pathogen in the gastrointestinal tract or adhered to the luminal surface of the gastrointestinal tract. Measuring reductions of adherent pathogens may be demonstrated, e.g., by a biopsy sample, or reductions may be measured indirectly, e.g., by measuring the pathogenic burden in the stool of a mammalian host.
- a “combination” of two or more bacteria includes the physical co-existence of the two bacteria, either in the same material or product or in physically connected products, as well as the temporal co-administration or co-localization of the two bacteria.
- a “cytotoxic” activity or bacterium includes the ability to kill a bacterial cell, such as a pathogenic bacterial cell.
- a “cytostatic” activity or bacterium includes the ability to inhibit, partially or fully, growth, metabolism, and/or proliferation of a bacterial cell, such as a pathogenic bacterial cell.
- Non-comestible products To be free of “non-comestible products” means that a bacterial composition or other material provided herein does not have a substantial amount of a non-comestible product, e.g., a product or material that is inedible, harmful or otherwise undesired in a product suitable for administration, e.g., oral administration, to a human subject. Non-comestible products are often found in preparations of bacteria from the prior art.
- vitamin is understood to include any of various fat-soluble or water-soluble organic substances (non-limiting examples include vitamin A, Vitamin B1 (thiamine), Vitamin B2 (riboflavin), Vitamin B3 (niacin or niacinamide), Vitamin B5 (pantothenic acid), Vitamin B6 (pyridoxine, pyridoxal, or pyridoxamine, or pyridoxine hydrochloride), Vitamin B7 (biotin), Vitamin B9 (folic acid), and Vitamin B12 (various cobalamins; commonly cyanocobalamin in vitamin supplements), vitamin C, vitamin D, vitamin E, vitamin K, K1 and K2 (i.e. MK-4, MK-7), folic acid and biotin) essential in minute amounts for normal growth and activity of the body and obtained naturally from plant and animal foods or synthetically made, pro-vitamins, derivatives, analogs.
- vitamin A vitamin A
- Vitamin B1 thiamine
- Vitamin B2 riboflavin
- Vitamin B3 niacin or n
- the term “minerals” is understood to include boron, calcium, chromium, copper, iodine, iron, magnesium, manganese, molybdenum, nickel, phosphorus, potassium, selenium, silicon, tin, vanadium, zinc, or combinations thereof.
- antioxidant is understood to include any one or more of various substances such as beta-carotene (a vitamin A precursor), vitamin C, vitamin E, and selenium) that inhibit oxidation or reactions promoted by Reactive Oxygen Species (“ROS”) and other radical and non-radical species. Additionally, antioxidants are molecules capable of slowing or preventing the oxidation of other molecules.
- Non-limiting examples of antioxidants include astaxanthin, carotenoids, coenzyme Q10 (“CoQ10”), flavonoids, glutathione, Goji (wolfberry), hesperidin, lactowolfberry, lignan, lutein, lycopene, polyphenols, selenium, vitamin A, vitamin C, vitamin E, zeaxanthin, or combinations thereof.
- bacteria and combinations of bacteria of the human gut microbiota with the capacity to meaningfully provide functions of a healthy microbiota when administered to mammalian hosts. Without being limited to a specific mechanism, it is thought that such compositions inhibit the growth, proliferation, and/or colonization of one or a plurality of pathogenic bacteria in the dysbiotic microbiotal niche, so that a healthy, diverse and protective microbiota colonizes and populates the intestinal lumen to establish or reestablish ecological control over pathogens or potential pathogens (e.g., some bacteria are pathogenic bacteria only when present in a dysbiotic environment).
- bacterial composition engraft in the host gut are detectable 1, 2, 3, 4, 5, or 6 days, 1 or 2 weeks, 1, 3 or 6 months, 1 year or greater than 1 year after the administration of composition when the bacteria compositions were not present before treatment.
- the bacteria compositions delivered shift the gut environment to a state allowing other healthy commensal bacteria to augment the delivered population. In this manner, augmentation of the commensal bacteria not directly delivered increases the overall diversity of the subsequent microbiome with healthy commensal bacteria and improves host health.
- pathogens include those pathogens such as C. difficile, Salmonella spp., enteropathogenic E coli , multi-drug resistant bacteria such as Klebsiella , and E. coli , Carbapenem-resistent Enterobacteriaceae (CRE), extended spectrum beta-lactam resistant Enterococci (ESBL), and vancomycin-resistant Enterococci (VRE).
- CRE Carbapenem-resistent Enterobacteriaceae
- ESBL extended spectrum beta-lactam resistant Enterococci
- VRE vancomycin-resistant Enterococci
- a “type” or more than one “types” of bacteria may be differentiated at the genus level, the species, level, the sub-species level, the strain level or by any other taxonomic method, as described herein and otherwise known in the art.
- Bacterial compositions may comprise two types of bacteria (termed “binary combinations” or “binary pairs”) or greater than two types of bacteria.
- a bacterial composition may comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21, 22, 23, 24, 25, 26, 27, 28, 29 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or at least 40, at least 50 or greater than 50 types of bacteria, as defined by species or operational taxonomic unit (OTU), or otherwise as provided herein.
- OTU operational taxonomic unit
- the number of types of bacteria present in a bacterial composition is at or below a known value.
- the bacterial composition comprises 50 or fewer types of bacteria, such as 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 or fewer, or 9 or fewer types of bacteria, 8 or fewer types of bacteria, 7 or fewer types of bacteria, 6 or fewer types of bacteria, 5 or fewer types of bacteria, 4 or fewer types of bacteria, or 3 or fewer types of bacteria.
- a bacterial composition comprises from 2 to no more than 40, from 2 to no more than 30, from 2 to no more than 20, from 2 to no more than 15, from 2 to no more than 10, or from 2 to no more than 5 types of bacteria.
- bacterial compositions are provided with the ability to exclude pathogenic bacteria. Exemplary bacterial compositions are demonstrated to reduce the growth rate of one pathogen, C. difficile , as provided in the Examples, wherein the ability of the bacterial compositions is demonstrated by assessing the antagonism activity of a combination of OTUs or strains towards a given pathogen using in vitro assays.
- Bacterial compositions may be prepared comprising at least two types of isolated bacteria, chosen from the species in Table 1.
- the bacterial composition comprises at least one and preferably more than one of the following: Enterococcus faecalis (previously known as Streptococcus faecalis ), Clostridium innocuum, Clostridium ramosum, Bacteroides ovatus, Bacteroides vulgatus, Bacteroides thetaoiotaomicron, Escherichia coli (1109 and 1108-1), Clostridium bifermentans , and Blautia producta (previously known as Peptostreptococcus productus).
- Enterococcus faecalis previously known as Streptococcus faecalis
- Clostridium innocuum Clostridium ramosum
- Bacteroides ovatus Bacteroides vulgatus
- Bacteroides thetaoiotaomicron Escherichia coli (1109 and 1108-1
- Clostridium bifermentans
- the bacterial composition comprises at least one and preferably more than one of the following: Enterococcus faecalis (previously known as Streptococcus faecalis ), Clostridium innocuum, Clostridium ramosum, Bacteroides ovatus, Bacteroides vulgatus, Bacteroides thetaoiotaomicron, Escherichia coli (1109 and 1108-1), Clostridium bifermentans , and Blautia producta (previously known as Peptostreptococcus productus ).
- Enterococcus faecalis previously known as Streptococcus faecalis
- Clostridium innocuum Clostridium ramosum
- Bacteroides ovatus Bacteroides vulgatus
- Bacteroides thetaoiotaomicron Escherichia coli (1109 and 1108-1
- the bacterial composition comprises at least one and preferably more than one of the following: Acidaminococcus intestinalis, Bacteroides ovatus , two strains of Bifidobacterium adolescentis , two strains of Bifidobacterium longum, Blautia producta, Clostridium cocleatum, Collinsella aerofaciens , two strains of Dorea longicatena, Escherichia coli, Eubacterium desmolans, Eubacterium eligens, Eubacterium limosum , four strains of Eubacterium rectale, Eubacterium ventriosumi, Faecalibacterium prausnitzii, Lachnospira pectinoshiza, Lactobacillus casei, Lactobacillus casei/paracasei, Paracateroides distasonis, Raoultella sp., one strain of Roseburia (chosen from Roseburia faecalis or Roseburia f
- the bacterial composition comprises at least one and preferably more than one of the following: Bamesiella intestinihominis; Lactobacillus reuteri ; a species characterized as one of Enterococcus hirae, Enterococus faecium , or Enterococcus durans ; a species characterized as one of Anaerostipes caccae or Clostridium indolis ; a species characterized as one of Staphylococcus warneri or Staphylococcus pasteuri ; and Adlercreutzia equolifaciens .
- at least one of the preceding species is not substantially present in the bacterial composition.
- the bacterial composition comprises at least one and preferably more than one of the following: Clostridium absonum, Clostridium argentinense, Clostridium baratii, Clostridium bartlettii, Clostridium bifermentans, Clostridium botulinum, Clostridium butyricum, Clostridium cadaveris, Clostridium camis, Clostridium celatum, Clostridium chauvoei, Clostridium clostridioforme, Clostridium cochlearium, Clostridium difficile, Clostridium fallax, Clostridium felsineum, Clostridium ghonii, Clostridium glycolicum, Clostridium haemolyticum, Clostridium hastiforme, Clostridium histolyticum, Clostridium indolis, Clostridium innocuum, Clostridium irregulare, Clostridium limosum, Clostridium malenomin
- the bacterial composition comprises at least one and preferably more than one of the following: Clostridium innocuum, Clostridium bifermentans, Clostridium butyricum, Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides uniformis , three strains of Escherichia coli , and Lactobacillus sp. In an alternative embodiment, at least one of the preceding species is not substantially present in the bacterial composition.
- the bacterial composition comprises at least one and preferably more than one of the following: Clostridium bifermentans, Clostridium innocuum, Clostridium butyricum , three strains of Escherichia coli , three strains of Bacteroides , and Blautia producta .
- at least one of the preceding species is not substantially present in the bacterial composition.
- the bacterial composition comprises at least one and preferably more than one of the following: Bacteroides sp., Escherichia coli , and non pathogenic Clostridia , including Clostridium innocuum, Clostridium bifermentans and Clostridium ramosum .
- Bacteroides sp. Escherichia coli
- non pathogenic Clostridia including Clostridium innocuum, Clostridium bifermentans and Clostridium ramosum .
- at least one of the preceding species is not substantially present in the bacterial composition.
- the bacterial composition comprises at least one and preferably more than one of the following: Bacteroides species, Escherichia coli and non-pathogenic Clostridia , such as Clostridium butyricum, Clostridium bifermentans and Clostridium innocuum .
- Bacteroides species Escherichia coli and non-pathogenic Clostridia , such as Clostridium butyricum, Clostridium bifermentans and Clostridium innocuum .
- at least one of the preceding species is not substantially present in the bacterial composition.
- the bacterial composition comprises at least one and preferably more than one of the following: Bacteroides caccae, Bacteroides capillosus, Bacteroides coagulans, Bacteroides distasonis, Bacteroides eggerthii, Bacteroides forsythus, Bacteroides fragilis, Bacteroides fragilis - ryhm, Bacteroides gracilis, Bacteroides levii, Bacteroides macacae, Bacteroides merdae, Bacteroides ovatus, Bacteroides pneumosintes, Bacteroides putredinis, Bacteroides pyogenes, Bacteroides splanchnicus, Bacteroides stercoris, Bacteroides tectum, Bacteroides thetaiotaomicron, Bacteroides uniformis, Bacteroides ureolyticus , and Bacteroides vulgatus . In an alternative embodiment, at least one of the preceding species
- the bacterial composition comprises at least one and preferably more than one of the following: Bacteroides, Eubacteria, Fusobacteria, Propionibacteria, Lactobacilli, anaerobic cocci, Ruminococcus, Escherichia coli, Gemmiger, Desulfomonas , and Peptostreptococcus .
- Bacteroides Eubacteria, Fusobacteria, Propionibacteria, Lactobacilli, anaerobic cocci, Ruminococcus, Escherichia coli, Gemmiger, Desulfomonas , and Peptostreptococcus .
- at least one of the preceding species is not substantially present in the bacterial composition.
- the bacterial composition comprises at least one and preferably more than one of the following: Bacteroides fragilis ss. Vulgatus, Eubacterium aerofaciens, Bacteroides fragilis ss. Thetaiotaomicron, Blautia producta (previously known as Peptostreptococcus productus II), Bacteroides fragilis ss.
- Distasonis Fusobacterium prausnitzii, Coprococcus eutactus, Eubacterium aerofaciens III, Blautia producta (previously known as Peptostreptococcus productus I), Ruminococcus bronii, Bifidobacterium adolescentis, Gemmiger formicilis, Bifidobacterium longum, Eubacterium siraeum, Ruminococcus torques, Eubacterium rectale III-H, Eubacterium rectale IV, Eubacterium eligens, Bacteroides eggerthii, Clostridium leptum, Bacteroides fragilis ss.
- A Eubacterium biforme, Bifidobacterium infantis, Eubacterium rectale III-F, Coprococcus comes, Bacteroides capillosus, Ruminococcus albus, Eubacterium formicigenerans, Eubacterium hallii, Eubacterium ventriosum I, Fusobacterium russii, Ruminococcus obeum, Eubacterium rectale II, Clostridium ramosum I, Lactobacillus leichmanii, Ruminococcus cailidus, Butyrivibrio crossotus, Acidaminococcus fermentans, Eubacterium ventriosum, Bacteroides fragilis ss.
- Bacterial compositions may be prepared comprising at least two types of isolated bacteria, chosen from Table 1.
- the OTUs can be characterized by one or more of the variable regions of the 16S sequence (V1-V9). These regions in bacteria are defined by nucleotides 69-99, 137-242, 433-497, 576-682, 822-879, 986-1043, 1117-1173, 1243-1294 and 1435-1465 respectively using numbering based on the E. coli system of nomenclature. (See, e.g., Brosius et al., Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli , PNAS 75(10):4801-4805 (1978)).
- At least one of the V1, V2, V3, V4, V5, V6, V7, V8, and V9 regions are used to characterize an OTU.
- the V1, V2, and V3 regions are used to characterize an OTU.
- the V3, V4, and V5 regions are used to characterize an OTU.
- the V4 region is used to characterize an OTU.
- the bacterial composition does not comprise at least one of Enterococcus faecalis (previously known as Streptococcus faecalis ), Clostridium innocuum, Clostridium ramosum, Bacteroides ovatus, Bacteroides vulgatus, Bacteroides thetaoiotaomicron, Escherichia coli (1109 and 1108-1), Clostridium bifermentans , and Blautia producta (previously known as Peptostreptococcus productus).
- Enterococcus faecalis previously known as Streptococcus faecalis
- Clostridium innocuum Clostridium ramosum
- Bacteroides ovatus Bacteroides vulgatus
- Bacteroides thetaoiotaomicron Escherichia coli (1109 and 1108-1
- Clostridium bifermentans Clostridium biferment
- the bacterial composition does not comprise at least one of Acidaminococcus intestinalis, Bacteroides ovatus , two species of Bifidobacterium adolescentis , two species of Bifidobacterium longum, Collinsella aerofaciens , two species of Dorea longicatena, Escherichia coli, Eubacterium eligens, Eubacterium limosum , four species of Eubacterium rectale, Eubacterium ventriosumi, Faecalibacterium prausnitzii, Lactobacillus casei, Lactobacillus paracasei, Paracateroides distasonis, Raoultella sp., one species of Roseburia (chosen from Roseburia faecalis or Roseburia faecis ), Roseburia intestinalis , two species of Ruminococcus torques , and Streptococcus mitis.
- Roseburia chosen from Roseburia fa
- the bacterial composition does not comprise at least one of Barnesiella intestinihominis; Lactobacillus reuteri ; a species characterized as one of Enterococcus hirae, Enterococus faecium , or Enterococcus durans ; a species characterized as one of Anaerostipes caccae or Clostridium indolis ; a species characterized as one of Staphylococcus warneri or Staphylococcus pasteuri ; and Adlercreutzia equolifaciens.
- the bacterial composition does not comprise at least one of Clostridium absonum, Clostridium argentinense, Clostridium baratii, Clostridium bifermentans, Clostridium botulinum, Clostridium butyricum, Clostridium cadaveric, Clostridium camis, Clostridium celatum, Clostridium chauvoei, Clostridium clostridioforme, Clostridium cochlearium, Clostridium difficile, Clostridium fallax, Clostridium felsineum, Clostridium ghonii, Clostridium glycolicum, Clostridium haemolyticum, Clostridium hastiforme, Clostridium histolyticum, Clostridium indolis, Clostridium innocuum, Clostridium irregulare, Clostridium limosum, Clostridium malenominatum, Clostridium novyi, Clostridium or
- the bacterial composition does not comprise at least one of Clostridium innocuum, Clostridium bifermentans, Clostridium butyricum, Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides uniformis , three strains of Escherichia coli , and Lactobacillus sp.
- the bacterial composition does not comprise at least one of Clostridium bifermentans, Clostridium innocuum, Clostridium butyricum , three strains of Escherichia coli , three strains of Bacteroides , and Blautia producta (previously known as Peptostreptococcus productus ).
- the bacterial composition does not comprise at least one of Bacteroides sp., Escherichia coli , and non pathogenic Clostridia , including Clostridium innocuum, Clostridium bifermentans and Clostridium ramosum.
- the bacterial composition does not comprise at least one of more than one Bacteroides species, Escherichia coli and non-pathogenic Clostridia , such as Clostridium butyricum, Clostridium bifermentans and Clostridium innocuum.
- the bacterial composition does not comprise at least one of Bacteroides caccae, Bacteroides capillosus, Bacteroides coagulans, Bacteroides distasonis, Bacteroides eggerthii, Bacteroides forsythus, Bacteroides fragilis, Bacteroides fragilis - ryhm, Bacteroides gracilis, Bacteroides levii, Bacteroides macacae, Bacteroides merdae, Bacteroides ovatus, Bacteroides pneumosintes, Bacteroides putredinis, Bacteroides pyogenes, Bacteroides splanchnicus, Bacteroides stercoris, Bacteroides tectum, Bacteroides thetaiotaomicron, Bacteroides uniformis, Bacteroides ureolyticus , and Bacteroides vulgatus.
- the bacterial composition does not comprise at least one of Bacteroides, Eubacteria, Fusobacteria, Propionibacteria, Lactobacilli, anaerobic cocci, Ruminococcus, Escherichia coli, Gemmiger, Desulfomonas , and Peptostreptococcus.
- the bacterial composition does not comprise at least one of Bacteroides fragilis ss. Vulgatus, Eubacterium aerofaciens, Bacteroides fragilis ss. Thetaiotaomicron, Blautia producta (previously known as Peptostreptococcus productus II), Bacteroides fragilis ss.
- Distasonis Fusobacterium prausnitzii, Coprococcus eutactus, Eubacterium aerofaciens III, Blautia producta (previously known as Peptostreptococcus productus I), Ruminococcus bromii, Bifidobacterium adolescentis, Gemmiger formicilis, Bifidobacterium longum, Eubacterium siraeum, Ruminococcus torques, Eubacterium rectale III-H, Eubacterium rectale IV, Eubacterium eligens, Bacteroides eggerthii, Clostridium leptum, Bacteroides fragilis ss.
- A Eubacterium biforme, Bifidobacterium infantis, Eubacterium rectale III-F, Coprococcus comes, Bacteroides capillosus, Ruminococcus albus, Eubacterium formicigenerans, Eubacterium hallii, Eubacterium ventriosum I, Fusobacterium russii, Ruminococcus obeum, Eubacterium rectale II, Clostridium ramosum I, Lactobacillus leichmanii, Ruminococcus cailidus, Butyrivibrio crossotus, Acidaminococcus fermentans, Eubacterium ventriosum, Bacteroides fragilis ss.
- the bacterial composition provides a protective or therapeutic effect against infection by one or more GI pathogens of interest.
- a list of exemplary bacterial pathogens is provided in Table 1, demarcated by the pathogen status column.
- the pathogenic bacterium or pathobiont is selected from the group categorized as pathogens or pathobionts in Table 1.
- the pathogenic bacterium is selected from the group consisting of Yersinia, Vibrio, Treponema, Streptococcus, Staphylococcus, Shigella, Salmonella, Rickettsia, Orientia, Pseudomonas, Neisseria, Mycoplasma, Mycobacterium, Listeria, Leptospira, Legionella, Klebsiella, Helicobacter, Haemophilus, Francisella, Escherichia, Ehrlichia, Enterococcus, Coxiella, Corynebacterium, Clostridium, Chlamydia, Chlamydophila, Campylobacter, Burkholderia, Brucella, Borrelia, Bordetella, Bifidobacterium, Bacillus , multi-drug resistant bacteria, extended spectrum beta-
- these pathogens include, but are not limited to, Aeromonas hydrophila, Campylobacter fetus, Plesiomonas shigelloides, Bacillus cereus, Campylobacter jejuni, Clostridium botulinum, Clostridium difficile, Clostridium perfringens , enteroaggregative Escherichia coli , enterohemorrhagic Escherichia coli , enteroinvasive Escherichia coli , enterotoxigenic Escherichia coli (such as, but not limited to, LT and/or ST), Escherichia coli O157:H7, Helicobacter pylori, Klebsiellia pneumonia, Lysteria monocytogenes, Plesiomonas shigelloides, Salmonella spp., Salmonella typhi, Salmonella paratyphi, Shigella spp., Staphylococcus spp., Sta
- the pathogen of interest is at least one pathogen chosen from Clostridium difficile, Salmonella spp., pathogenic Escherichia coli , vancomycin-resistant Enterococcus spp., and extended spectrum beta-lactam resistant Enterococci (ESBL).
- the bacterial compositions comprise purified spore populations.
- Purified spore populations contain combinations of commensal bacteria of the human gut microbiota with the capacity to meaningfully provide functions of a healthy microbiota when administered to a mammalian subject. Without being limited to a specific mechanism, it is thought that such compositions inhibit the growth of a pathogen such as C. difficile, Salmonella spp., enteropathogenic E. coli , and vancomycin-resistant Enterococcus spp., so that a healthy, diverse and protective microbiota can be maintained or, in the case of pathogenic bacterial infections such as C. difficile infection, repopulate the intestinal lumen to reestablish ecological control over potential pathogens.
- a pathogen such as C. difficile, Salmonella spp., enteropathogenic E. coli , and vancomycin-resistant Enterococcus spp.
- Spore forming bacteria often exist in both a spore form and a vegetative form in a given population of cells.
- the biological activity and resistance to environmental stress can vary in each form and as a result both forms might be advantageous for different purposes.
- Bacterial compositions and methods described allow one to purify compositions containing spores to produce bacterial compositions that are resistant to environmental stresses such as but not limited to aerobic conditions, lack of nutrients, low pH, and temperature variations to populate the gut. In vegatitative form, the proper bacterial compositions disclosed herein can produce beneficial health effects.
- compositions containing non-pathogenic, germination-competent bacterial spores for the prevention, control, and treatment of gastrointestinal diseases, disorders and conditions and for general nutritional health. These compositions are advantageous in being suitable for safe administration to humans and other mammalian subjects and are efficacious in numerous gastrointestinal diseases, disorders and conditions and in general nutritional health. While spore-based compositions are known, these are generally prepared according to various techniques such as lyophilization or spray-drying of liquid bacterial cultures, resulting in poor efficacy, instability, substantial variability and lack of adequate safety.
- populations of bacterial spores can be obtained from biological materials obtained from mammalian subjects, including humans. These populations are formulated into compositions as provided herein, and administered to mammalian subjects using the methods as provided herein.
- compositions containing a purified population of bacterial spores are provided herein.
- purify refers to the state of a population (e.g., a plurality of known or unknown amount and/or concentration) of desired bacterial spores, that have undergone one or more processes of purification, e.g., a selection or an enrichment of the desired bacterial spore, or alternatively a removal or reduction of residual habitat products as described herein.
- a purified population has no detectable undesired activity or, alternatively, the level or amount of the undesired activity is at or below an acceptable level or amount.
- a purified population has an amount and/or concentration of desired bacterial spores at or above an acceptable amount and/or concentration.
- the purified population of bacterial spores is enriched as compared to the starting material (e.g., a fecal material) from which the population is obtained. This enrichment may be by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, 99.9999%, or greater than 99.9999% as compared to the starting material.
- the purified populations of bacterial spores have reduced or undetectable levels of one or more pathogenic activities, such as toxicity, an infection of the mammalian recipient subject, an immunomodulatory activity, an autoimmune response, a metabolic response, or an inflammatory response or a neurological response.
- pathogenic activities such as toxicity, an infection of the mammalian recipient subject, an immunomodulatory activity, an autoimmune response, a metabolic response, or an inflammatory response or a neurological response.
- pathogenic activities such as toxicity, an infection of the mammalian recipient subject, an immunomodulatory activity, an autoimmune response, a metabolic response, or an inflammatory response or a neurological response.
- pathogenic activities such as toxicity, an infection of the mammalian recipient subject, an immunomodulatory activity, an autoimmune response, a metabolic response, or an inflammatory response or a neurological response.
- Such a reduction in a pathogenic activity may be by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 9
- purified populations of bacterial spores that are substantially free of residual habitat products.
- Substantially free of residual habitat products may also mean that the bacterial spore composition contains no detectable cells from a human or animal, and that only microbial cells are detectable, in particular, only desired microbial cells are detectable.
- the residual habitat product present in the purified population is reduced at least a certain level from the fecal material obtained from the mammalian donor subject, e.g., reduced by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, 99.9999%, or greater than 99.9999%.
- substantially free of residual habitat products or substantially free of a detectable level of a pathogenic material means that the bacterial composition contains no detectable viral (including bacterial viruses (i.e., phage)), fungal, or mycoplasmal or toxoplasmal contaminants, or a eukaryotic parasite such as a helminth.
- the purified spore populations are substantially free of an acellular material, e.g., DNA, viral coat material, or non-viable bacterial material.
- purified spore populations can be demonstrated by genetic analysis (e.g., PCR, DNA sequencing), serology and antigen analysis, and methods using instrumentation such as flow cytometry with reagents that distinguish desired bacterial spores from non-desired, contaminating materials.
- Exemplary biological materials include fecal materials such as feces or materials isolated from the various segments of the small and large intestines.
- Fecal materials are obtained from a mammalian donor subject, or can be obtained from more than one donor subject, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 200, 300, 400, 500, 750, 1000 or from greater than 1000 donors, where such materials are then pooled prior to purification of the desired bacterial spores.
- the desired bacterial spores are purified from a single fecal material sample obtained from a single donor, and after such purification are combined with purified spore populations from other purifications, either from the same donor at a different time, or from one or more different donors, or both.
- Preferred bacterial genera include Acetonema, Alkaliphilus, Alicyclobacillus, Amphibacillus, Ammonifex, Anaerobacter, Anaerofustis, Anaerostipes, Anaerotruncus, Anoxybacillus, Bacillus, Blautia, Brevibacillus, Bryantella, Caldicellulosiruptor, Caloramator, Candidatus, Carboxydibrachium, Carboxydothermus, Clostridium, Cohnella, Coprococcus, Dendrosporobacter Desulfitobacterium, Desulfosporosinus, Desulfotomaculum, Dorea, Eubacterium, Faecalibacterium, Filifactor, Geobacillus, Halobacteroides, Heliobacillus, Heliobacterium, Heliophilum, Heliorestis, Lachnoanaerobaculum, Lysinibacillus, Moorella, Oceanobacillus, Orenia (S.), Oxalophagus, Oxobacter
- Preferred bacterial species are provided at Table 1, demarcated as spore former or non-spore former. Where specific strains of a species are provided, one of skill in the art will recognize that other strains of the species or species in the same clade can be substituted for the named strain.
- spore-forming bacteria are identified by the presence of nucleic acid sequences that modulate sporulation.
- signature sporulation genes are highly conserved across members of distantly related genera including Clostridium and Bacillus .
- Traditional approaches of forward genetics have identified many, if not all, genes that are essential for sporulation (spo).
- the developmental program of sporulation is governed in part by the successive action of four compartment-specific sigma factors (appearing in the order ⁇ F, ⁇ E, ⁇ G and ⁇ K), whose activities are confined to the forespore ( ⁇ F and ⁇ G) or the mother cell ( ⁇ E and ⁇ K).
- spore populations containing more than one type of bacterium are provided.
- a “type” or more than one “types” of bacteria may be differentiated at the genus level, the species, level, the sub-species level, the strain level or by any other taxonomic method, as described herein and otherwise known in the art.
- all or essentially all of the bacterial spores present in a purified population are obtained from a fecal material treated as described herein or otherwise known in the art.
- one or more than one bacterial spores or types of bacterial spores are generated in culture and combined to form a purified spore population.
- one or more of these culture-generated spore populations are combined with a fecal material-derived spore population to generate a hybrid spore population.
- Bacterial compositions may contain at least two types of these preferred bacteria, including strains of the same species.
- a bacterial composition may comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 or more than 20 types of bacteria, as defined by species or operational taxonomic unit (OTU) encompassing such species.
- OTU operational taxonomic unit
- compositions containing a population of bacterial spores suitable for therapeutic administration to a mammalian subject in need thereof are produced by generally following the steps of: (a) providing a fecal material obtained from a mammalian donor subject; and (b) subjecting the fecal material to at least one purification treatment or step under conditions such that a population of bacterial spores is produced from the fecal material.
- composition is formulated such that a single oral dose contains at least about 1 ⁇ 10 4 colony forming units of the bacterial spores, and a single oral dose will typically contain about 1 ⁇ 10 4 , 1 ⁇ 10 5 , 1 ⁇ 10 6 , 1 ⁇ 10 7 , 1 ⁇ 10 8 , 1 ⁇ 10 9 , 1 ⁇ 10 10 , 1 ⁇ 10 11 , 1 ⁇ 10 12 , 1 ⁇ 10 13 , 1 ⁇ 10 14 , 1 ⁇ 10 15 , or greater than 1 ⁇ 10 15 CFUs of the bacterial spores.
- the presence and/or concentration of a given type of bacteria spore may be known or unknown in a given purified spore population.
- the concentration of spores of a given strain, or the aggregate of all strains is e.g., 1 ⁇ 10 4 , 1 ⁇ 10 5 , 1 ⁇ 10 6 , 1 ⁇ 10 7 , 1 ⁇ 10 8 , 1 ⁇ 10 9 , 1 ⁇ 10 10 , 1 ⁇ 10 11 , 1 ⁇ 10 12 , 1 ⁇ 10 13 , 1 ⁇ 10 14 , 1 ⁇ 10 15 , or greater than 1 ⁇ 10 15 viable bacterial spores per gram of composition or per administered dose.
- the composition contains at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than 90% spores on a mass basis.
- the administered dose does not exceed 200, 300, 400, 500, 600, 700, 800, 900 milligrams or 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, or 1.9 grams in mass.
- the bacterial spore compositions are generally formulated for oral or gastric administration, typically to a mammalian subject.
- the composition is formulated for oral administration as a solid, semi-solid, gel, or liquid form, such as in the form of a pill, tablet, capsule, or lozenge.
- such formulations contain or are coated by an enteric coating to protect the bacteria through the stomach and small intestine, although spores are generally resistant to the stomach and small intestines.
- the bacterial spore compositions may be formulated to be effective in a given mammalian subject in a single administration or over multiple administrations.
- a single administration is substantially effective to reduce Cl. difficile and/or Cl. difficile toxin content in a mammalian subject to whom the composition is administered.
- substantially effective means that Cl. difficile and/or Cl. difficile toxin content in the subject is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or greater than 99% following administration of the composition.
- an In Vitro Assay utilizing competition between the bacterial compositions or subsets thereof and C. difficile .
- Exemplary embodiments of this Assay are provided herein and in the Examples.
- an In Vitro Assay utilizing 10% (wt/vol) Sterile-Filtered Feces.
- an in vitro assay to test for the protective effect of the bacterial compositions and to screen in vitro for combinations of microbes that inhibit the growth of a pathogen.
- the assay can operate in automated high-throughput or manual modes. Under either system, human or animal feces may be re-suspended in an anaerobic buffer solution, such as pre-reduced PBS or other suitable buffer, the particulate removed by centrifugation, and filter sterilized. This 10% sterile-filtered feces material serves as the base media for the in vitro assay.
- an investigator may add it to the sterile-filtered feces material for a first incubation period and then may inoculate the incubated microbial solution with the pathogen of interest for a second incubation period.
- the resulting titer of the pathogen may be quantified by any number of methods such as those described below, and the change in the amount of pathogen is compared to standard controls including the pathogen cultivated in the absence of the bacterial composition.
- the assay is conducted using at least one control. Feces from a healthy subject may be used as a positive control. As a negative control, antibiotic-treated feces or heat-treated feces may be used.
- Various bacterial compositions may be tested in this material and the bacterial compositions optionally compared to the positive and/or negative controls.
- the ability to inhibit the growth of the pathogen may be measured by plating the incubated material on C. difficile selective media and counting colonies. After competition between the bacterial composition and C. difficile , each well of the in vitro assay plate is serially diluted ten-fold six times, and plated on selective media, such as but not limited to cycloserine cefoxitin mannitol agar (CCMA) or cycloserine cefoxitin fructose agar (CCFA), and incubated. Colonies of C. difficile are then counted to calculate the concentration of viable cells in each well at the end of the competition. Colonies of C. difficile are confirmed by their characteristic diffuse colony edge morphology as well as fluorescence under UV light.
- CCMA cycloserine cefoxitin mannitol agar
- CCFA cycloserine ce
- the in vitro assay utilizes Antibiotic-Treated Feces.
- human or animal feces may be resuspended in an anaerobic buffer solution, such as pre-reduced PBS or other suitable buffer.
- the resuspended feces is treated with an antibiotic, such as clindamycin, or a cocktail of several antibiotics in order to reduce the ability of feces from a healthy subject to inhibit the growth of C. difficile ; this material is termed the antibiotic-treated matrix. While not being bound by any mechanism, it is believed that beneficial bacteria in healthy subjects protects them from infection by competing out C. difficile .
- Antibiotics in addition to clindamycin that inhibit the normal flora include ceftriaxone and piperacillin-tazobactam and may be substituted for the clindamycin.
- the antibiotic-treated matrix is centrifuged, the supernatant removed, and the pelleted material resuspended in filter-sterilized, diluted feces in order to remove any residual antibiotic. This washed antibiotic-treated matrix may be used in the in vitro assay described above in lieu of the 10% sterile-filtered feces.
- the ability to inhibit the growth of the pathogen may be measured by quantitative PCR (qPCR). Standard techniques may be followed to generate a standard curve for the pathogen of interest.
- Genomic DNA may be extracted from samples using commercially-available kits, such as the Mo Bio Powersoil®-htp 96 Well Soil DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.), the Mo Bio Powersoil® DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.), or the QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, Calif.) according to the manufacturer's instructions.
- the qPCR may be conducted using HotMasterMix (5PRIME, Gaithersburg, Md.) and primers specific for the pathogen of interest, and may be conducted on a MicroAmp® Fast Optical 96-well Reaction Plate with Barcode (0.1 mL) (Life Technologies, Grand Island, N.Y.) and performed on a BioRad C1000TM Thermal Cycler equipped with a CFX96TM Real-Time System (BioRad, Hercules, Calif.), with fluorescent readings of the FAM and ROX channels. The Cq value for each well on the FAM channel is determined by the CFX ManagerTM software version 2.1.
- the log 10 (cfu/ml) of each experimental sample is calculated by inputting a given sample's Cq value into linear regression model generated from the standard curve comparing the Cq values of the standard curve wells to the known log 10 (cfu/ml) of those samples.
- the skilled artisan may employ alternative qPCR modes.
- mice are made susceptible to C.
- Bacterial compositions may be given either before (prophylactic treatment) or after (therapeutic treatment) C. difficile gavage.
- bacterial compositions may be given after (optional) vancomycin treatment (see below) to assess their ability to prevent recurrence and thus suppress the pathogen in vivo.
- the outcomes assessed each day from day ⁇ 1 to day 6 (or beyond, for prevention of recurrence) are weight, clinical signs, mortality and shedding of C. difficile in the feces. Weight loss, clinical signs of disease, and C. difficile shedding are typically observed without treatment.
- Vancomycin provided by oral gavage on days ⁇ 1 to 4 protects against these outcomes and serves as a positive control.
- Clinical signs are subjective, and scored each day by the same experienced observer. Animals that lose greater than or equal to 25% of their body weight are euthanized and counted as infection-related mortalities.
- Feces are gathered from mouse cages (5 mice per cage) each day, and the shedding of C. difficile spores is detected in the feces using a selective plating assay as described for the in vitro assay above, or via qPCR for the toxin gene as described herein.
- the effects of test materials including 10% suspension of human feces (as a positive control), bacterial compositions, or PBS (as a negative vehicle control), are determined by introducing the test article in a 0.2 mL volume into the mice via oral gavage on day ⁇ 1, one day prior to C. difficile challenge, on day 1, 2 and 3 as treatment or post-vancomycin treatment on days 5, 6, 7 and 8. Vancomycin, as discussed above, is given on days 1 to 4 as another positive control.
- Alternative dosing schedules and routes of administration may be employed, including multiple doses of test article, and 10 3 to 10 10 of a given organism or composition may be delivered.
- OTUs can be defined either by full 16S sequencing of the rRNA gene, by sequencing of a specific hypervariable region of this gene (i.e. V1, V2, V3, V4, V5, V6, V7, V8, or V9), or by sequencing of any combination of hypervariable regions from this gene (e.g. V1-3 or V3-5).
- the bacterial 16S rDNA is approximately 1500 nucleotides in length and is used in reconstructing the evolutionary relationships and sequence similarity of one bacterial isolate to another using phylogenetic approaches. 16S sequences are used for phylogenetic reconstruction as they are in general highly conserved, but contain specific hypervariable regions that harbor sufficient nucleotide diversity to differentiate genera and species of most microbes.
- genomic DNA is extracted from a bacterial sample, the 16S rDNA (full region or specific hypervariable regions) amplified using polymerase chain reaction (PCR), the PCR products cleaned, and nucleotide sequences delineated to determine the genetic composition of 16S gene or subdomain of the gene.
- PCR polymerase chain reaction
- the sequencing method used may be, but is not limited to, Sanger sequencing.
- the sequencing can be, but is not limited to being, performed using the Sanger method or using a next-generation sequencing method, such as an Illumina (sequencing by synthesis) method using barcoded primers allowing for multiplex reactions.
- a next-generation sequencing method such as an Illumina (sequencing by synthesis) method using barcoded primers allowing for multiplex reactions.
- OTUs can be defined by a combination of nucleotide markers or genes, in particular highly conserved genes (e.g., “house-keeping” genes), or a combination thereof, full-genome sequence, or partial genome sequence generated using amplified genetic products, or whole genome sequence (WGS).
- WGS whole genome sequence
- DNA extracted from a bacterial sample will have specific genomic regions amplified using PCR and sequenced to determine the nucleotide sequence of the amplified products.
- WGS whole genome shotgun
- Sequence data can be generated using any sequencing technology including, but not limited to Sanger, Illumina, 454 Life Sciences, Ion Torrent, ABI, Pacific Biosciences, and/or Oxford Nanopore.
- Methods for producing bacterial compositions can include three main processing steps, combined with one or more mixing steps.
- the steps include organism banking, organism production, and preservation.
- the strains included in the bacterial composition may be (1) isolated directly from a specimen or taken from a banked stock, (2) optionally cultured on a nutrient agar or broth that supports growth to generate viable biomass, and (3) the biomass optionally preserved in multiple aliquots in long-term storage.
- the agar or broth can contain nutrients that provide essential elements and specific factors that enable growth.
- An example would be a medium composed of 20 g/L glucose, 10 g/L yeast extract, 10 g/L soy peptone, 2 g/L citric acid, 1.5 g/L sodium phosphate monobasic, 100 mg/L ferric ammonium citrate, 80 mg/L magnesium sulfate, 10 mg/L hemin chloride, 2 mg/L calcium chloride, 1 mg/L menadione.
- a variety of microbiological media and variations are well known in the art (e.g. R. M. Atlas, Handbook of Microbiological Media (2010) CRC Press).
- Medium can be added to the culture at the start, may be added during the culture, or may be intermittently/continuously flowed through the culture.
- the strains in the bacterial composition may be cultivated alone, as a subset of the bacterial composition, or as an entire collection comprising the bacterial composition.
- a first strain may be cultivated together with a second strain in a mixed continuous culture, at a dilution rate lower than the maximum growth rate of either cell to prevent the culture from washing out of the cultivation.
- the inoculated culture is incubated under favorable conditions for a time sufficient to build biomass.
- bacterial compositions for human use this is often at 37° C. temperature, pH, and other parameter with values similar to the normal human niche.
- the environment can be actively controlled, passively controlled (e.g., via buffers), or allowed to drift.
- anaerobic bacterial compositions e.g., gut microbiota
- anoxic/reducing environment can be employed. This can be accomplished by addition of reducing agents such as cysteine to the broth, and/or stripping it of oxygen.
- a culture of a bacterial composition can be grown at 37° C., pH 7, in the medium above, pre-reduced with 1 g/L cysteine ⁇ HCl.
- the organisms can be placed into a chemical milieu that protects from freezing (adding ‘cryoprotectants’), drying (‘lyoprotectants’), and/or osmotic shock (‘osmoprotectants’), dispensing into multiple (optionally identical) containers to create a uniform bank, and then treating the culture for preservation.
- Containers are generally impermeable and have closures that assure isolation from the environment. Cryopreservation treatment is accomplished by freezing a liquid at ultra-low temperatures (e.g., at or below ⁇ 80° C.).
- Dried preservation removes water from the culture by evaporation (in the case of spray drying or ‘cool drying’) or by sublimation (e.g., for freeze drying, spray freeze drying). Removal of water improves long-term bacterial composition storage stability at temperatures elevated above cryogenic. If the bacterial composition comprises spore forming species and results in the production of spores, the final composition can be purified by additional means, such as density gradient centrifugation preserved using the techniques described above. Bacterial composition banking can be done by culturing and preserving the strains individually, or by mixing the strains together to create a combined bank.
- a bacterial composition culture can be harvested by centrifugation to pellet the cells from the culture medium, the supernate decanted and replaced with fresh culture broth containing 15% glycerol. The culture can then be aliquoted into 1 mL cryotubes, sealed, and placed at ⁇ 80° C. for long-term viability retention. This procedure achieves acceptable viability upon recovery from frozen storage.
- Organism production can be conducted using similar culture steps to banking, including medium composition and culture conditions. It can be conducted at larger scales of operation, especially for clinical development or commercial production. At larger scales, there can be several subcultivations of the bacterial composition prior to the final cultivation. At the end of cultivation, the culture is harvested to enable further formulation into a dosage form for administration. This can involve concentration, removal of undesirable medium components, and/or introduction into a chemical milieu that preserves the bacterial composition and renders it acceptable for administration via the chosen route.
- a bacterial composition can be cultivated to a concentration of 10 10 CFU/mL, then concentrated 20-fold by tangential flow microfiltration; the spent medium can be exchanged by diafiltering with a preservative medium consisting of 2% gelatin, 100 mM trehalose, and 10 mM sodium phosphate buffer. The suspension can then be freeze-dried to a powder and titrated.
- the powder After drying, the powder can be blended to an appropriate potency, and mixed with other cultures and/or a filler such as microcrystalline cellulose for consistency and ease of handling, and the bacterial composition formulated as provided herein.
- a filler such as microcrystalline cellulose for consistency and ease of handling, and the bacterial composition formulated as provided herein.
- compositions disclosed herein are administered to a patient or a user (sometimes collectively referred to as a “subject”).
- a patient sometimes collectively referred to as a “subject”.
- administer and “administration” encompasses embodiments in which one person directs another to consume a bacterial composition in a certain manner and/or for a certain purpose, and also situations in which a user uses a bacteria composition in a certain manner and/or for a certain purpose independently of or in variance to any instructions received from a second person.
- Non-limiting examples of embodiments in which one person directs another to consume a bacterial composition in a certain manner and/or for a certain purpose include when a physician prescribes a course of conduct and/or treatment to a patient, when a parent commands a minor user (such as a child) to consume a bacterial composition, when a trainer advises a user (such as an athlete) to follow a particular course of conduct and/or treatment, and when a manufacturer, distributer, or marketer recommends conditions of use to an end user, for example through advertisements or labeling on packaging or on other materials provided in association with the sale or marketing of a product.
- the bacterial compositions offer a protective and/or therapeutic effect against infection by one or more GI pathogens of interest and can be administered after an acute case of infection has been resolved in order to prevent relapse, during an acute case of infection as a complement to antibiotic therapy if the bacterial composition is not sensitive to the same antibiotics as the GI pathogen, or to prevent infection or reduce transmission from disease carriers.
- a bacterial compositions administered to the gut are used to treat disorders that are not gut-related. Altering the gut microbiome can have effects on the skin and vagina of mammalian hosts (Levkovich et al, Probiotic bacteria induce a ‘glow of health’, PlosOne, Vol 8, Issue 1, e53867.
- mastitis can be used to treat non-GI related health problems.
- the present bacterial compositions can be useful in a variety of clinical situations.
- the bacterial compositions can be administered as a complementary treatment to antibiotics when a patient is suffering from an acute infection, to reduce the risk of recurrence after an acute infection has subsided, or when a patient will be in close proximity to others with or at risk of serious gastrointestinal infections (physicians, nurses, hospital workers, family members of those who are ill or hospitalized).
- the present bacterial compositions can be administered to animals, including humans, laboratory animals (e.g., primates, rats, mice), livestock (e.g., cows, sheep, goats, pigs, turkeys, chickens), and household pets (e.g., dogs, cats, rodents).
- laboratory animals e.g., primates, rats, mice
- livestock e.g., cows, sheep, goats, pigs, turkeys, chickens
- household pets e.g., dogs, cats, rodents.
- the bacterial composition can be administered enterically, in other words, by a route of access to the gastrointestinal tract.
- the patient Prior to administration of the bacterial composition, the patient can optionally have a pretreatment protocol to prepare the gastrointestinal tract to receive the bacterial composition.
- the pretreatment protocol is advisable, such as when a patient has an acute infection with a highly resilient pathogen.
- the pretreatment protocol is entirely optional, such as when the pathogen causing the infection is not resilient, or the patient has had an acute infection that has been successfully treated but where the physician is concerned that the infection may recur.
- the pretreatment protocol can enhance the ability of the bacterial composition to affect the patient's microbiome.
- At least one antibiotic can be administered to alter the bacteria in the patient.
- a standard colon-cleansing preparation can be administered to the patient to substantially empty the contents of the colon, such as used to prepare a patient for a colonoscopy.
- substantially emptying the contents of the colon this application means removing at least 75%, at least 80%, at least 90%, at least 95%, or about 100% of the contents of the ordinary volume of colon contents.
- Antibiotic treatment can precede the colon-cleansing protocol.
- the antibiotic can be stopped in sufficient time to allow the antibiotic to be substantially reduced in concentration in the gut before the bacterial composition is administered.
- the antibiotic can be discontinued 1, 2, or 3 days before the administration of the bacterial composition.
- the antibiotic can be discontinued 3, 4, 5, 6, or 7 antibiotic half-lives before administration of the bacterial composition.
- the antibiotic can be chosen so the constituents in the bacterial composition have an MIC50 that is higher than the concentration of the antibiotic in the gut.
- the bacterial compositions of the invention are suitable for administration to mammals and non-mammalian animals in need thereof.
- the mammalian subject is a human subject who has one or more symptoms of a dysbiosis.
- the bacterial compositions described herein are suitable for treatment thereof.
- the mammalian subject has not received antibiotics in advance of treatment with the bacterial compositions.
- the mammalian subject has not been administered at least two doses of vancomycin, metronidazole and/or or similar antibiotic compound within one week prior to administration of the therapeutic composition.
- the mammalian subject has not previously received an antibiotic compound in the one month prior to administration of the therapeutic composition.
- the mammalian subject has received one or more treatments with one or more different antibiotic compounds and such treatment(s) resulted in no improvement or a worsening of symptoms.
- the gastrointestinal disease, disorder or condition is diarrhea caused by C. difficile including recurrent C. difficile infection, ulcerative colitis, colitis, Crohn's disease, or irritable bowel disease.
- the therapeutic composition is administered only once prior to improvement of the disease, disorder or condition.
- the therapeutic composition is administered at intervals greater than two days, such as once every three, four, five or six days, or every week or less frequently than every week.
- the preparation can be administered intermittently according to a set schedule, e.g., once a day, once weekly, or once monthly, or when the subject relapses from the primary illness.
- the preparation may be administered on a long-term basis to subjects who are at risk for infection with or who may be carriers of these pathogens, including subjects who will have an invasive medical procedure (such as surgery), who will be hospitalized, who live in a long-term care or rehabilitation facility, who are exposed to pathogens by virtue of their profession (livestock and animal processing workers), or who could be carriers of pathogens (including hospital workers such as physicians, nurses, and other health care professionals).
- an invasive medical procedure such as surgery
- who will be hospitalized who live in a long-term care or rehabilitation facility, who are exposed to pathogens by virtue of their profession (livestock and animal processing workers), or who could be carriers of pathogens (including hospital workers such as physicians, nurses, and other health care professionals).
- the bacterial composition is administered enterically. This preferentially includes oral administration, or by an oral or nasal tube (including nasogastric, nasojejunal, oral gastric, or oral jejunal). In other embodiments, administration includes rectal administration (including enema, suppository, or colonoscopy).
- the bacterial composition can be administered to at least one region of the gastrointestinal tract, including the mouth, esophagus, stomach, small intestine, large intestine, and rectum. In some embodiments, it is administered to all regions of the gastrointestinal tract.
- the bacterial compositions can be administered orally in the form of medicaments such as powders, capsules, tablets, gels or liquids.
- the bacterial compositions can also be administered in gel or liquid form by the oral route or through a nasogastric tube, or by the rectal route in a gel or liquid form, by enema or instillation through a colonoscope or by a suppository.
- the composition is administered colonoscopically and, optionally, if the bacterial composition is administered by other rectal routes (such as an enema or suppository) or even if the subject has an oral administration, the subject can have a colon-cleansing preparation.
- the colon-cleansing preparation can facilitate proper use of the colonoscope or other administration devices, but even when it does not serve a mechanical purpose, it can also maximize the proportion of the bacterial composition relative to the other organisms previously residing in the gastrointestinal tract of the subject. Any ordinarily acceptable colon-cleansing preparation may be used such as those typically provided when a subject undergoes a colonoscopy.
- the bacteria and bacterial compositions are provided in a dosage form.
- the dosage form is designed for administration of at least one OTU or combination thereof disclosed herein, wherein the total amount of bacterial composition administered is selected from 0.1 ng to 10 g, 10 ng to 1 g, 100 ng to 0.1 g, 0.1 mg to 500 mg, 1 mg to 100 mg, or from 10-15 mg.
- the bacterial composition is consumed at a rate of from 0.1 ng to 10 g a day, 10 ng to 1 g a day, 100 ng to 0.1 g a day, 0.1 mg to 500 mg a day, 1 mg to 100 mg a day, or from 10-15 mg a day, or more.
- the treatment period is at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, or at least 1 year.
- the treatment period is from 1 day to 1 week, from 1 week to 4 weeks, from 1 month, to 3 months, from 3 months to 6 months, from 6 months to 1 year, or for over a year.
- 10 5 and 10 12 microorganisms total can be administered to the patient in a given dosage form.
- an effective amount can be provided in from 1 to 500 ml or from 1 to 500 grams of the bacterial composition having from 10 7 to 10 11 bacteria per ml or per gram, or a capsule, tablet or suppository having from 1 mg to 1000 mg lyophilized powder having from 10 7 to 10 11 bacteria.
- Those receiving acute treatment can receive higher doses than those who are receiving chronic administration (such as hospital workers or those admitted into long-term care facilities).
- any of the preparations described herein can be administered once on a single occasion or on multiple occasions, such as once a day for several days or more than once a day on the day of administration (including twice daily, three times daily, or up to five times daily).
- the preparation can be administered intermittently according to a set schedule, e.g., once weekly, once monthly, or when the patient relapses from the primary illness.
- the preparation can be administered on a long-term basis to individuals who are at risk for infection with or who may be carriers of these pathogens, including individuals who will have an invasive medical procedure (such as surgery), who will be hospitalized, who live in a long-term care or rehabilitation facility, who are exposed to pathogens by virtue of their profession (livestock and animal processing workers), or who could be carriers of pathogens (including hospital workers such as physicians, nurses, and other health care professionals).
- individuals who will have an invasive medical procedure such as surgery
- who will be hospitalized who live in a long-term care or rehabilitation facility, who are exposed to pathogens by virtue of their profession (livestock and animal processing workers), or who could be carriers of pathogens (including hospital workers such as physicians, nurses, and other health care professionals).
- Particular bacterial compositions can be selected for individual patients or for patients with particular profiles.
- 16S sequencing can be performed for a given patient to identify the bacteria present in his or her microbiota.
- the sequencing can either profile the patient's entire microbiome using 16S sequencing (to the family, genera, or species level), a portion of the patient's microbiome using 16S sequencing, or it can be used to detect the presence or absence of specific candidate bacteria that are biomarkers for health or a particular disease state, such as markers of multi-drug resistant organisms or specific genera of concern such as Escherichia .
- a particular composition can be selected for administration to a patient to supplement or complement a patient's microbiota in order to restore health or treat or prevent disease.
- patients can be screened to determine the composition of their microbiota to determine the likelihood of successful treatment.
- the bacterial compositions can be administered with other agents in a combination therapy mode, including anti-microbial agents and prebiotics. Administration can be sequential, over a period of hours or days, or simultaneous.
- the bacterial compositions are included in combination therapy with one or more anti-microbial agents, which include anti-bacterial agents, anti-fungal agents, anti-viral agents and anti-parasitic agents.
- Anti-bacterial agents can include cephalosporin antibiotics (cephalexin, cefuroxime, cefadroxil, cefazolin, cephalothin, cefaclor, cefamandole, cefoxitin, cefprozil, and ceftobiprole); fluoroquinolone antibiotics (cipro, Levaquin, floxin, tequin, avelox, and norflox); tetracycline antibiotics (tetracycline, minocycline, oxytetracycline, and doxycycline); penicillin antibiotics (amoxicillin, ampicillin, penicillin V, dicloxacillin, carbenicillin, vancomycin, and methicillin); and carbapenem antibiotics (ertapenem, doripenem, imipenem/cilastatin, and meropenem).
- cephalosporin antibiotics cephalexin, cefuroxime, cefadroxil, cefazolin, cephalothin
- Anti-viral agents can include Abacavir, Acyclovir, Adefovir, Amprenavir, Atazanavir, Cidofovir, Darunavir, Delavirdine, Didanosine, Docosanol, Efavirenz, Elvitegravir, Emtricitabine, Enfuvirtide, Etravirine, Famciclovir, Foscarnet, Fomivirsen, Ganciclovir, Indinavir, Idoxuridine, Lamivudine, Lopinavir Maraviroc, MK-2048, Nelfinavir, Nevirapine, Penciclovir, Raltegravir, Rilpivirine, Ritonavir, Saquinavir, Stavudine, Tenofovir Trifluridine, Valaciclovir, Valganciclovir, Vidarabine, Ibacitabine, Amantadine, Oseltamivir, Rimantidine, Tipranavir, Zalcitabine,
- antifungal compounds include, but are not limited to polyene antifungals such as natamycin, rimocidin, filipin, nystatin, amphotericin B, candicin, and hamycin; imidazole antifungals such as miconazole, ketoconazole, clotrimazole, econazole, omoconazole, bifonazole, butoconazole, fenticonazole, isoconazole, oxiconazole, sertaconazole, sulconazole, and tioconazole; triazole antifungals such as fluconazole, itraconazole, isavuconazole, ravuconazole, posaconazole, voriconazole, terconazole, and albaconazole; thiazole antifungals such as abafungin; allylamine antifungals such as terbinafine, naftifine, and butena
- Other compounds that have antifungal properties include, but are not limited to polygodial, benzoic acid, ciclopirox, tolnaftate, undecylenic acid, flucytosine or 5-fluorocytosine, griseofulvin, and haloprogin.
- the bacterial compositions are included in combination therapy with one or more corticosteroids, mesalazine, mesalamine, sulfasalazine, sulfasalazine derivatives, immunosuppressive drugs, cyclosporin A, mercaptopurine, azathiopurine, prednisone, methotrexate, antihistamines, glucocorticoids, epinephrine, theophylline, cromolyn sodium, anti-leukotrienes, anti-cholinergic drugs for rhinitis, anti-cholinergic decongestants, mast-cell stabilizers, monoclonal anti-IgE antibodies, vaccines, and combinations thereof.
- corticosteroids mesalazine, mesalamine, sulfasalazine, sulfasalazine derivatives
- immunosuppressive drugs cyclosporin A, mercaptopurine, azathio
- a prebiotic is a selectively fermented ingredient that allows specific changes, both in the composition and/or activity in the gastrointestinal microbiota that confers benefits upon host well-being and health.
- Prebiotics can include complex carbohydrates, amino acids, peptides, or other essential nutritional components for the survival of the bacterial composition.
- Prebiotics include, but are not limited to, amino acids, biotin, fructooligosaccharide, galactooligosaccharides, inulin, lactulose, mannan oligosaccharides, oligofructose-enriched inulin, oligofructose, oligodextrose, tagatose, trans-galactooligosaccharide, and xylooligosaccharides.
- an animal model such as a mouse model
- the model can begin by evaluating the microbiota of the mice.
- Qualitative assessments can be accomplished using 16S profiling of the microbial community in the feces of normal mice. It can also be accomplished by full genome sequencing, whole genome shotgun sequencing (WGS), or traditional microbiological techniques. Quantitative assessments can be conducted using quantitative PCR (qPCR), described below, or by using traditional microbiological techniques and counting colony formation.
- the mice can receive an antibiotic treatment to mimic the condition of dysbiosis.
- Antibiotic treatment can decrease the taxonomic richness, diversity, and evenness of the community, including a reduction of abundance of a significant number of bacterial taxa. Dethlefsen et al., The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing, PLoS Biology 6(11):3280 (2008). At least one antibiotic can be used, and antibiotics are well known.
- Antibiotics can include aminoglycoside antibiotic (amikacin, arbekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, rhodostreptomycin, streptomycin, tobramycin, and apramycin), amoxicillin, ampicillin, Augmentin (an amoxicillin/clavulanate potassium combination), cephalosporin (cefaclor, defadroxil, cefazolin, cefixime, fefoxitin, cefprozil, ceftazimdime, cefuroxime, cephalexin), clavulanate potassium, clindamycin, colistin, gentamycin, kanamycin, metronidazole, or vancomycin.
- aminoglycoside antibiotic amikacin, arbekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, rhodost
- mice can be provided with drinking water containing a mixture of the antibiotics kanamycin, colistin, gentamycin, metronidazole and vancomycin at 40 mg/kg, 4.2 mg/kg, 3.5 mg/kg, 21.5 mg/kg, and 4.5 mg/kg (mg per average mouse body weight), respectively, for 7 days.
- mice can be administered ciprofloxacin at a dose of 15-20 mg/kg (mg per average mouse body weight), for 7 days.
- mice are provided with an antibiotic, a wash out period of from one day to three days may be provided with no antibiotic treatment and no bacterial composition treatment.
- test bacterial composition is administered to the mice by oral gavage.
- the test bacterial composition may be administered in a volume of 0.2 ml containing 10 4 CFUs of each type of bacteria in the bacterial composition.
- Dose-response may be assessed by using a range of doses, including, but not limited to 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , and/or 10 10 .
- mice can be evaluated using 16S sequencing, full genome sequencing, whole genome shotgun sequencing (WGS), or traditional microbiological techniques to determine whether the test bacterial composition has populated the gastrointestinal tract of the mice. For example only, one day, three days, one week, two weeks, and one month after administration of the bacterial composition to the mice, 16S profiling is conducted to determine whether the test bacterial composition has populated the gastrointestinal tract of the mice. Quantitative assessments, including qPCR and traditional microbiological techniques such as colony counting, can additionally or alternatively be performed, at the same time intervals.
- the number of sequence counts that correspond exactly to those in the bacterial composition over time can be assessed to determine specifically which components of the bacterial composition reside in the gastrointestinal tract over a particular period of time.
- the strains of the bacterial composition persist for a desired period of time.
- the components of the bacterial composition persist for a desired period of time, while also increasing the ability of other microbes (such as those present in the environment, food, etc.) to populate the gastrointestinal tract, further increasing overall diversity, as discussed below.
- a bacterial composition can also be assessed for their ability to populate different regions on the gastrointestinal tract.
- a bacterial composition can be chosen for its ability to populate one or more than one region of the gastrointestinal tract, including, but not limited to the stomach, the small intestine (duodenum, jejunum, and ileum), the large intestine (the cecum, the colon (the ascending, transverse, descending, and sigmoid colon), and the rectum).
- An in vivo study can be conducted to determine which regions of the gastrointestinal tract a given bacterial composition will populate.
- a mouse model similar to the one described above can be conducted, except instead of assessing the feces produced by the mice, particular regions of the gastrointestinal tract can be removed and studied individually. For example, at least one particular region of the gastrointestinal tract can be removed and a qualitative or quantitative determination can be performed on the contents of that region of the gastrointestinal tract. In another embodiment, the contents can optionally be removed and the qualitative or quantitative determination may be conducted on the tissue removed from the mouse.
- Genomic DNA can be extracted from samples using commercially-available kits, such as the Mo Bio Powersoil®-htp 96 Well Soil DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.), the Mo Bio Powersoil® DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.), or the QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, Calif.) according to the manufacturer's instructions.
- kits such as the Mo Bio Powersoil®-htp 96 Well Soil DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.), the Mo Bio Powersoil® DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.), or the QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, Calif.) according to the manufacturer's instructions.
- qPCR can be conducted using HotMasterMix (5PRIME, Gaithersburg, Md.) and primers specific for the bacterial composition of interest, and may be conducted on a MicroAmp® Fast Optical 96-well Reaction Plate with Barcode (0.1 mL) (Life Technologies, Grand Island, N.Y.) and performed on a BioRad C1000TM Thermal Cycler equipped with a CFX96TM Real-Time System (BioRad, Hercules, Calif.), with fluorescent readings of the FAM and ROX channels. The Cq value for each well on the FAM channel is determined by the CFX ManagerTM software version 2.1.
- the log 10 (cfu/ml) of each experimental sample is calculated by inputting a given sample's Cq value into linear regression model generated from the standard curve comparing the Cq values of the standard curve wells to the known log 10 (cfu/ml) of those samples.
- the skilled artisan may employ alternative qPCR modes.
- bacterial compositions for testing certain characteristics of bacterial compositions. For example, the sensitivity of bacterial compositions to certain environmental variables is determined, e.g., in order to select for particular desirable characteristics in a given composition, formulation and/or use.
- the constituents in the bacterial composition can be tested for pH resistance, bile acid resistance, and/or antibiotic sensitivity, either individually on a constituent-by-constituent basis or collectively as a bacterial composition comprised of multiple bacterial constituents (collectively referred to in this section as bacterial composition).
- a bacterial composition will be administered other than to the colon or rectum (i.e., for example, an oral route)
- optionally testing for pH resistance enhances the selection of bacterial compositions that will survive at the highest yield possible through the varying pH environments of the distinct regions of the GI tract.
- Understanding how the bacterial compositions react to the pH of the GI tract also assists in formulation, so that the number of bacteria in a dosage form can be increased if beneficial and/or so that the composition may be administered in an enteric-coated capsule or tablet or with a buffering or protective composition.
- bacterial compositions can be prepared that survive these varying pH ranges (specifically wherein at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or as much as 100% of the bacteria can survive gut transit times through various pH ranges). This can be tested by exposing the bacterial composition to varying pH ranges for the expected gut transit times through those pH ranges.
- GMM gut microbiota medium
- PNAS 108(15):6252-6257 (2011) or another animal-products-free medium
- pH adjusting agents for a pH of 1 to 2 for 30 minutes, a pH of 3 to 4 for 1 hour, a pH of 4 to 5 for 1 to 2 hours, and a pH of 6 to 7.4 for 2.5 to 3 hours.
- An alternative method for testing stability to acid is described in U.S. Pat. No. 4,839,281. Survival of bacteria may be determined by culturing the bacteria and counting colonies on appropriate selective or non-selective media.
- testing for bile-acid resistance enhances the selection of bacterial compositions that will survive exposures to bile acid during transit through the GI tract.
- Bile acids are secreted into the small intestine and can, like pH, affect the survival of bacterial compositions. This can be tested by exposing the bacterial compositions to bile acids for the expected gut exposure time to bile acids.
- bile acid solutions can be prepared at desired concentrations using 0.05 mM Tris at pH 9 as the solvent. After the bile acid is dissolved, the pH of the solution may be adjusted to 7.2 with 10% HCl.
- Bacterial compositions can be cultured in 2.2 ml of a bile acid composition mimicking the concentration and type of bile acids in the patient, 1.0 ml of 10% sterile-filtered feces media and 0.1 ml of an 18-hour culture of the given strain of bacteria. Incubations may be conducted for from 2.5 to 3 hours or longer.
- An alternative method for testing stability to bile acid is described in U.S. Pat. No. 4,839,281. Survival of bacteria may be determined by culturing the bacteria and counting colonies on appropriate selective or non-selective media.
- bacterial compositions can be tested for sensitivity to antibiotics.
- bacterial compositions can be chosen so that the bacterial constituents are sensitive to antibiotics such that if necessary they can be eliminated or substantially reduced from the patient's gastrointestinal tract by at least one antibiotic targeting the bacterial composition.
- the bacterial compositions may optionally be tested for the ability to adhere to gastrointestinal cells.
- a method for testing adherence to gastrointestinal cells is described in U.S. Pat. No. 4,839,281.
- a solvent treatment is a miscible solvent treatment (either partially miscible or fully miscible) or an immiscible solvent treatment.
- Miscibility is the ability of two liquids to mix with each to form a homogeneous solution. Water and ethanol, for example, are fully miscible such that a mixture containing water and ethanol in any ratio will show only one phase. Miscibility is provided as a wt/wt %, or weight of one solvent in 100 g of final solution. If two solvents are fully miscible in all proportions, their miscibility is 100%.
- alcohols e.g., methanol, ethanol, isopropanol, butanol, etc.
- the alcohols can be provided already combined with water; e.g., a solution containing 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 89%, 85%, 90%, 95% or greater than 95%
- Other solvents are only partially miscible, meaning that only some portion will dissolve in water.
- Diethyl ether for example, is partially miscible with water. Up to 7 grams of diethyl ether will dissolve in 93 g of water to give a 7% (wt/wt %) solution.
- miscible materials include ethers, dimethoxyethane, or tetrahydrofuran
- an oil such as an alkane and water are immiscible and form two phases.
- immiscible treatments are optionally combined with a detergent, either an ionic detergent or a non-ionic detergent.
- exemplary detergents include Triton X-100, Tween 20, Tween 80, Nonidet P40, a pluronic, or a polyol.
- the fecal materials are subjected to one or more chromatographic treatments, either sequentially or in parallel.
- a chromatographic treatment a solution containing the fecal material is contacted with a solid medium containing a hydrophobic interaction chromatographic (HIC) medium or an affinity chromatographic medium.
- HIC hydrophobic interaction chromatographic
- a solid medium capable of absorbing a residual habitat product present in the fecal material is contacted with a solid medium that adsorbs a residual habitat product.
- the HIC medium contains sepharose or a derivatized sepharose such as butyl sepharose, octyl sepharose, phenyl sepharose, or butyl-s sepharose.
- the affinity chromatographic medium contains material derivatized with mucin type I, II, III, IV, V, or VI, or oligosaccharides derived from or similar to those of mucins type I, II, III, IV, V, or VI.
- the affinity chromatographic medium contains material derivatized with antibodies that recognize spore-forming bacteria.
- the mechanical disrupting treatment substantially disrupts a non-spore material present in the fecal material and does not substantially disrupt a spore present in the fecal material.
- Mechanical treatments optionally include filtration treatments, where the desired spore populations are retained on a filter while the undesirable (non-spore) fecal components to pass through, and the spore fraction is then recovered from the filter medium.
- undesirable particulates and eukaryotic cells may be retained on a filter while bacterial cells including spores pass through.
- the spore fraction retained on the filter medium is subjected to a diafiltration step, wherein the retained spores are contacted with a wash liquid, typically a sterile saline-containing solution or other diluent, in order to further reduce or remove the undesirable fecal components.
- a wash liquid typically a sterile saline-containing solution or other diluent
- the thermal disruption of the fecal material is provided herein.
- the fecal material is mixed in a saline-containing solution such as phosphate-buffered saline (PBS) and subjected to a heated environment, such as a warm room, incubator, water-bath, or the like, such that efficient heat transfer occurs between the heated environment and the fecal material.
- PBS phosphate-buffered saline
- the fecal material solution is mixed during the incubation to enhance thermal conductivity and disrupt particulate aggregates.
- Thermal treatments can be modulated by the temperature of the environment and/or the duration of the thermal treatment.
- the fecal material or a liquid comprising the fecal material is subjected to a heated environment, e.g., a hot water bath of at least about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or greater than 100 degrees Celsius, for at least about 1, 5, 10, 15, 20, 30, 45 seconds, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50 minutes, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 hours.
- the thermal treatment occurs at two different temperatures, such as 30 seconds in a 100 degree Celsius environment followed by 10 minutes in a 50 degree Celsius environment.
- the temperature and duration of the thermal treatment are sufficient to kill or remove pathogenic materials while not substantially damaging or reducing the germination-competency of the spores.
- ionizing radiation typically gamma irradiation, ultraviolet irradiation or electron beam irradiation provided at an energy level sufficient to kill pathogenic materials while not substantially damaging the desired spore populations.
- ionizing radiation typically gamma irradiation, ultraviolet irradiation or electron beam irradiation provided at an energy level sufficient to kill pathogenic materials while not substantially damaging the desired spore populations.
- ultraviolet radiation at 254 nm provided at an energy level below about 22,000 microwatt seconds per cm 2 will not generally destroy desired spores.
- a solution containing the fecal material is subjected to one or more centrifugation treatments, e.g., at about 1000 ⁇ g, 2000 ⁇ g, 3000 ⁇ g, 4000 ⁇ g, 5000 ⁇ g, 6000 ⁇ g, 7000 ⁇ g, 8000 ⁇ g or greater than 8000 ⁇ g.
- Differential centrifugation separates desired spores from undesired non-spore material; at low forces the spores are retained in solution, while at higher forces the spores are pelleted while smaller impurities (e.g., virus particles, phage) are retained in solution.
- a first low force centrifugation pellet fibrous materials
- a second, higher force centrifugation pellets undesired eukaryotic cells and a third, still higher force centrifugation pellets the desired spores while small contaminants remain in suspension.
- density or mobility gradients or cushions e.g., step cushions
- Percoll, Ficoll, Nycodenz, Histodenz or sucrose gradients are used to separate desired spore populations from other materials in the fecal material.
- formulations for administration to humans and other subjects in need thereof are combined with additional active and/or inactive materials in order to produce a final product, which may be in single dosage unit or in a multi-dose format.
- the composition comprises at least one carbohydrate.
- a “carbohydrate” refers to a sugar or polymer of sugars.
- saccharide polysaccharide
- carbohydrate oligosaccharide
- Most carbohydrates are aldehydes or ketones with many hydroxyl groups, usually one on each carbon atom of the molecule.
- Carbohydrates generally have the molecular formula C n H 2n O n .
- a carbohydrate can be a monosaccharide, a disaccharide, trisaccharide, oligosaccharide, or polysaccharide.
- the most basic carbohydrate is a monosaccharide, such as glucose, sucrose, galactose, mannose, ribose, arabinose, xylose, and fructose.
- Disaccharides are two joined monosaccharides. Exemplary disaccharides include sucrose, maltose, cellobiose, and lactose.
- an oligosaccharide includes between three and six monosaccharide units (e.g., raffinose, stachyose), and polysaccharides include six or more monosaccharide units.
- Exemplary polysaccharides include starch, glycogen, and cellulose.
- Carbohydrates can contain modified saccharide units, such as 2′-deoxyribose wherein a hydroxyl group is removed, 2′-fluororibose wherein a hydroxyl group is replace with a fluorine, or N-acetylglucosamine, a nitrogen-containing form of glucose (e.g., 2′-fluororibose, deoxyribose, and hexose).
- Carbohydrates can exist in many different forms, for example, conformers, cyclic forms, acyclic forms, stereoisomers, tautomers, anomers, and isomers.
- the composition comprises at least one lipid.
- a “lipid” includes fats, oils, triglycerides, cholesterol, phospholipids, fatty acids in any form including free fatty acids. Fats, oils and fatty acids can be saturated, unsaturated (cis or trans) or partially unsaturated (cis or trans).
- the lipid comprises at least one fatty acid selected from lauric acid (12:0), myristic acid (14:0), palmitic acid (16:0), palmitoleic acid (16:1), margaric acid (17:0), heptadecenoic acid (17:1), stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2), linolenic acid (18:3), octadecatetraenoic acid (18:4), arachidic acid (20:0), eicosenoic acid (20:1), eicosadienoic acid (20:2), eicosatetraenoic acid (20:4), eicosapentaenoic acid (20:5) (EPA), docosanoic acid (22:0), docosenoic acid (22:1), docosapentaenoic acid (22:5), docosahexaenoic acid (22:6) (DHA), and
- the composition comprises at least one supplemental mineral or mineral source.
- supplemental mineral or mineral source examples include, without limitation: chloride, sodium, calcium, iron, chromium, copper, iodine, zinc, magnesium, manganese, molybdenum, phosphorus, potassium, and selenium.
- Suitable forms of any of the foregoing minerals include soluble mineral salts, slightly soluble mineral salts, insoluble mineral salts, chelated minerals, mineral complexes, non-reactive minerals such as carbonyl minerals, and reduced minerals, and combinations thereof.
- the composition comprises at least one supplemental vitamin.
- the at least one vitamin can be fat-soluble or water soluble vitamins.
- Suitable vitamins include but are not limited to vitamin C, vitamin A, vitamin E, vitamin B12, vitamin K, riboflavin, niacin, vitamin D, vitamin B6, folic acid, pyridoxine, thiamine, pantothenic acid, and biotin.
- Suitable forms of any of the foregoing are salts of the vitamin, derivatives of the vitamin, compounds having the same or similar activity of the vitamin, and metabolites of the vitamin.
- the composition comprises an excipient.
- suitable excipients include a buffering agent, a preservative, a stabilizer, a binder, a compaction agent, a lubricant, a dispersion enhancer, a disintegration agent, a flavoring agent, a sweetener, and a coloring agent.
- the excipient is a buffering agent.
- suitable buffering agents include sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, and calcium bicarbonate.
- the excipient comprises a preservative.
- suitable preservatives include antioxidants, such as alpha-tocopherol and ascorbate, and antimicrobials, such as parabens, chlorobutanol, and phenol.
- the composition comprises a binder as an excipient.
- suitable binders include starches, pregelatinized starches, gelatin, polyvinylpyrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamides, polyvinyloxoazolidone, polyvinylalcohols, C 12 -C 18 fatty acid alcohol, polyethylene glycol, polyols, saccharides, oligosaccharides, and combinations thereof.
- the composition comprises a lubricant as an excipient.
- suitable lubricants include magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oils, sterotex, polyoxyethylene monostearate, talc, polyethyleneglycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, and light mineral oil.
- the composition comprises a dispersion enhancer as an excipient.
- suitable dispersants include starch, alginic acid, polyvinylpyrrolidones, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isoamorphous silicate, and microcrystalline cellulose as high HLB emulsifier surfactants.
- the composition comprises a disintegrant as an excipient.
- the disintegrant is a non-effervescent disintegrant.
- suitable non-effervescent disintegrants include starches such as corn starch, potato starch, pregelatinized and modified starches thereof, sweeteners, clays, such as bentonite, micro-crystalline cellulose, alginates, sodium starch glycolate, gums such as agar, guar, locust bean, karaya, pecitin, and tragacanth.
- the disintegrant is an effervescent disintegrant.
- suitable effervescent disintegrants include sodium bicarbonate in combination with citric acid, and sodium bicarbonate in combination with tartaric acid.
- the excipient comprises a flavoring agent.
- Flavoring agents can be chosen from synthetic flavor oils and flavoring aromatics; natural oils; extracts from plants, leaves, flowers, and fruits; and combinations thereof.
- the flavoring agent is selected from cinnamon oils; oil of wintergreen; peppermint oils; clover oil; hay oil; anise oil; eucalyptus ; vanilla; citrus oil such as lemon oil, orange oil, grape and grapefruit oil; and fruit essences including apple, peach, pear, strawberry, raspberry, cherry, plum, pineapple, and apricot.
- the excipient comprises a sweetener.
- suitable sweeteners include glucose (corn syrup), dextrose, invert sugar, fructose, and mixtures thereof (when not used as a carrier); saccharin and its various salts such as the sodium salt; dipeptide sweeteners such as aspartame; dihydrochalcone compounds, glycyrrhizin; Stevia Rebaudiana (Stevioside); chloro derivatives of sucrose such as sucralose; and sugar alcohols such as sorbitol, mannitol, sylitol, and the like.
- hydrogenated starch hydrolysates and the synthetic sweetener 3,6-dihydro-6-methyl-1,2,3-oxathiazin-4-one-2,2-dioxide particularly the potassium salt (acesulfame-K), and sodium and calcium salts thereof.
- the composition comprises a coloring agent.
- suitable color agents include food, drug and cosmetic colors (FD&C), drug and cosmetic colors (D&C), and external drug and cosmetic colors (Ext. D&C).
- the coloring agents can be used as dyes or their corresponding lakes.
- the weight fraction of the excipient or combination of excipients in the formulation is usually about 99% or less, such as about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 2% or less, or about 1% or less of the total weight of the composition.
- compositions disclosed herein can be formulated into a variety of forms and administered by a number of different means.
- the compositions can be administered orally, rectally, or parenterally, in formulations containing conventionally acceptable carriers, adjuvants, and vehicles as desired.
- parenteral as used herein includes subcutaneous, intravenous, intramuscular, or intrasternal injection and infusion techniques.
- the bacterial composition is administered orally.
- Solid dosage forms for oral administration include capsules, tablets, caplets, pills, troches, lozenges, powders, and granules.
- a capsule typically comprises a core material comprising a bacterial composition and a shell wall that encapsulates the core material.
- the core material comprises at least one of a solid, a liquid, and an emulsion.
- the shell wall material comprises at least one of a soft gelatin, a hard gelatin, and a polymer.
- Suitable polymers include, but are not limited to: cellulosic polymers such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose (HPMC), methyl cellulose, ethyl cellulose, cellulose acetate, cellulose acetate phthalate, cellulose acetate trimellitate, hydroxypropylmethyl cellulose phthalate, hydroxypropylmethyl cellulose succinate and carboxymethylcellulose sodium; acrylic acid polymers and copolymers, such as those formed from acrylic acid, methacrylic acid, methyl acrylate, ammonio methylacrylate, ethyl acrylate, methyl methacrylate and/or ethyl methacrylate (e.g., those copolymers sold under the trade name “Eudragit”); vinyl polymers and copolymers such as polyvinyl pyrrolidone, polyvinyl acetate, polyvinylacetate phthalate, vinylacetate crotonic acid copoly
- Tablets, pills, and the like can be compressed, multiply compressed, multiply layered, and/or coated.
- the coating can be single or multiple.
- the coating material comprises at least one of a saccharide, a polysaccharide, and glycoproteins extracted from at least one of a plant, a fungus, and a microbe.
- Non-limiting examples include corn starch, wheat starch, potato starch, tapioca starch, cellulose, hemicellulose, dextrans, maltodextrin, cyclodextrins, inulins, pectin, mannans, gum arabic, locust bean gum, mesquite gum, guar gum, gum karaya, gum ghatti, tragacanth gum, funori, carrageenans, agar, alginates, chitosans, or gellan gum.
- the coating material comprises a protein.
- the coating material comprises at least one of a fat and an oil.
- the at least one of a fat and an oil is high temperature melting.
- the at least one of a fat and an oil is hydrogenated or partially hydrogenated.
- the at least one of a fat and an oil is derived from a plant.
- the at least one of a fat and an oil comprises at least one of glycerides, free fatty acids, and fatty acid esters.
- the coating material comprises at least one edible wax.
- the edible wax can be derived from animals, insects, or plants. Non-limiting examples include beeswax, lanolin, bayberry wax, carnauba wax, and rice bran wax. Tablets and pills can additionally be prepared with enteric coatings.
- powders or granules embodying the bacterial compositions disclosed herein can be incorporated into a food product.
- the food product is a drink for oral administration.
- suitable drink include fruit juice, a fruit drink, an artificially flavored drink, an artificially sweetened drink, a carbonated beverage, a sports drink, a liquid diary product, a shake, an alcoholic beverage, a caffeinated beverage, infant formula and so forth.
- suitable means for oral administration include aqueous and nonaqueous solutions, emulsions, suspensions and solutions and/or suspensions reconstituted from non-effervescent granules, containing at least one of suitable solvents, preservatives, emulsifying agents, suspending agents, diluents, sweeteners, coloring agents, and flavoring agents.
- the food product can be a solid foodstuff.
- a solid foodstuff include without limitation a food bar, a snack bar, a cookie, a brownie, a muffin, a cracker, an ice cream bar, a frozen yogurt bar, and the like.
- the compositions disclosed herein are incorporated into a therapeutic food.
- the therapeutic food is a ready-to-use food that optionally contains some or all essential macronutrients and micronutrients.
- the compositions disclosed herein are incorporated into a supplementary food that is designed to be blended into an existing meal.
- the supplemental food contains some or all essential macronutrients and micronutrients.
- the bacterial compositions disclosed herein are blended with or added to an existing food to fortify the food's protein nutrition. Examples include food staples (grain, salt, sugar, cooking oil, margarine), beverages (coffee, tea, soda, beer, liquor, sports drinks), snacks, sweets and other foods.
- the formulations are filled into gelatin capsules for oral administration.
- An example of an appropriate capsule is a 250 mg gelatin capsule containing from 10 (up to 100 mg) of lyophilized powder (10 8 to 10 11 bacteria), 160 mg microcrystalline cellulose, 77.5 mg gelatin, and 2.5 mg magnesium stearate.
- from 10 5 to 10 12 bacteria may be used, 10 5 to 10 7 , 10 6 to 10 7 , or 10 8 to 10 10 , with attendant adjustments of the excipients if necessary.
- an enteric-coated capsule or tablet or with a buffering or protective composition can be used.
- the identity of the bacterial species which grew up from a complex fraction can be determined in multiple ways. First, individual colonies can be picked into liquid media in a 96 well format, grown up and saved as 15% glycerol stocks at ⁇ 80° C. Aliquots of the cultures can be placed into cell lysis buffer and colony PCR methods can be used to amplify and sequence the 16S rDNA gene (Example 2 and described above). Alternatively, colonies may be streaked to purity in several passages on solid media. Well separated colonies are streaked onto the fresh plates of the same kind and incubated for 48-72 hours at 37° C. The process is repeated multiple times in order to ensure purity.
- Pure cultures can be analyzed by phenotypic- or sequence-based methods, including 16S rDNA amplification and sequencing as described in Examples 2 and 3. Sequence characterization of pure isolates or mixed communities e.g. plate scrapes and spore fractions can also include whole genome shotgun sequencing. The latter is valuable to determine the presence of genes associated with sporulation, antibiotic resistance, pathogenicity, and virulence. Colonies can also be scraped from plates en masse and sequenced using a massively parallel sequencing method as described in Examples 2 and 3, such that individual 16S signatures can be identified in a complex mixture.
- the sample can be sequenced prior to germination (if appropriate DNA isolation procedures are used to lsye and release the DNA from spores) in order to compare the diversity of germinable species with the total number of species in a spore sample.
- MALDI-TOF-mass spec can also be used for species identification (as reviewed in Anaerobe 22:123).
- OTUs can be defined either by full 16S sequencing of the rRNA gene, by sequencing of a specific hypervariable region of this gene (i.e. V1, V2, V3, V4, V5, V6, V7, V8, or V9), or by sequencing of any combination of hypervariable regions from this gene (e.g. V1-3 or V3-5).
- the bacterial 16S rDNA is approximately 1500 nucleotides in length and is used in reconstructing the evolutionary relationships and sequence similarity of one bacterial isolate to another using phylogenetic approaches. 16S sequences are used for phylogenetic reconstruction as they are in general highly conserved, but contain specific hypervariable regions that harbor sufficient nucleotide diversity to differentiate genera and species of most microbes.
- genomic DNA is extracted from a bacterial sample, the 16S rDNA (full region or specific hypervariable regions) amplified using polymerase chain reaction (PCR), the PCR products cleaned, and nucleotide sequences delineated to determine the genetic composition of 16S gene or subdomain of the gene.
- PCR polymerase chain reaction
- the sequencing method used may be, but is not limited to, Sanger sequencing.
- the sequencing may be, but is not limited to being, performed using the Sanger method or using a next-generation sequencing method, such as an Illumina (sequencing by synthesis) method using barcoded primers allowing for multiplex reactions.
- a next-generation sequencing method such as an Illumina (sequencing by synthesis) method using barcoded primers allowing for multiplex reactions.
- various strains of pathogenic Escherichia coli can be distinguished using DNAs from the genes that encode heat-labile (LTI, LTIIa, and LTIIb) and heat-stable (STI and STII) toxins, verotoxin types 1, 2, and 2e (VT1, VT2, and VT2e, respectively), cytotoxic necrotizing factors (CNF1 and CNF2), attaching and effacing mechanisms (eaeA), enteroaggregative mechanisms (Eagg), and enteroinvasive mechanisms (Einv).
- the optimal genes to utilize for taxonomic assignment of OTUs by use of marker genes will be familiar to one with ordinary skill of the art of sequence based taxonomic identification.
- Genomic DNA is extracted from pure microbial cultures using a hot alkaline lysis method. 1 ⁇ l of microbial culture is added to 9 ⁇ l of Lysis Buffer (25 mM NaOH, 0.2 mM EDTA) and the mixture is incubated at 95° C. for 30 minutes. Subsequently, the samples are cooled to 4° C. and neutralized by the addition of 10 ⁇ l of Neutralization Buffer (40 mM Tris-HCl) and then diluted 10-fold in Elution Buffer (10 mM Tris-HCl). Alternatively, genomic DNA is extracted from pure microbial cultures using commercially available kits such as the Mo Bio Ultraclean® Microbial DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.) or by standard methods known to those skilled in the art.
- Lysis Buffer 25 mM NaOH, 0.2 mM EDTA
- V1-V9 regions refer to the first through ninth hypervariable regions of the 16S rRNA gene that are used for genetic typing of bacterial samples.
- regions in bacteria are defined by nucleotides 69-99, 137-242, 433-497, 576-682, 822-879, 986-1043, 1117-1173, 1243-1294 and 1435-1465 respectively using numbering based on the E. coli system of nomenclature.
- V1, V2, V3, V4, V5, V6, V7, V8, and V9 regions are used to characterize an OTU.
- the V1, V2, and V3 regions are used to characterize an OTU.
- the V3, V4, and V5 regions are used to characterize an OTU.
- the V4 region is used to characterize an OTU.
- the PCR can be performed on commercially available thermocyclers such as a BioRad MyCyclerTM Thermal Cycler (BioRad, Hercules, Calif.).
- the reactions are run at 94° C. for 2 minutes followed by 30 cycles of 94° C. for 30 seconds, 51° C. for 30 seconds, and 68° C. for 1 minute 30 seconds, followed by a 7 minute extension at 72° C. and an indefinite hold at 4° C.
- gel electrophoresis of a portion of the reaction products is used to confirm successful amplification of a ⁇ 1.5 kb product.
- HT ExoSap-IT Affymetrix, Santa Clara, Calif.
- Amplification performed for downstream sequencing by short read technologies such as Illumina require amplification using primers known to those skilled in the art that additionally include a sequence-based barcoded tag.
- primers known to those skilled in the art that additionally include a sequence-based barcoded tag.
- 2 ⁇ l of extracted gDNA is added to a 20 ⁇ l final volume PCR reaction.
- the PCR reaction also contains 1 ⁇ HotMasterMix (5PRIME, Gaithersburg, Md.), 200 nM of V4_515f_adapt (AATGATACGGCGACCACCGAGATCTACACTATGGTAATTGTGTGCCAGCMGCCGC GGTAA (SEQ ID NO: 2035) IDT, Coralville, Iowa), and 200 nM of barcoded 806rbc (CAAGCAGAAGACGGCATACGAGAT_12bpGolayBarcode_AGTCAGTCAGCCGGACT ACHVGGGTWTCTAAT (SEQ ID NOS 2036 and 2037, respectively) IDT, Coralville, Iowa), with PCR Water (Mo Bio Laboratories, Carlsbad, Calif.) for the balance of the volume.
- V4_515f_adapt AATGATACGGCGACCACCACCGAGATCTACACTATGGTAATTGTGTGCCAGCMGCCGC GGTAA (SEQ ID NO: 2035) IDT, Coralville, Iowa
- barcoded 806rbc CA
- primers incorporate barcoded adapters for Illumina sequencing by synthesis.
- identical replicate, triplicate, or quadruplicate reactions may be performed.
- other universal bacterial primers or thermostable polymerases known to those skilled in the art are used to obtain different amplification and sequencing error rates as well as results on alternative sequencing technologies.
- the PCR amplification is performed on commercially available thermocyclers such as a BioRad MyCyclerTM Thermal Cycler (BioRad, Hercules, Calif.). The reactions are run at 94° C. for 3 minutes followed by 25 cycles of 94° C. for 45 seconds, 50° C. for 1 minute, and 72° C. for 1 minute 30 seconds, followed by a 10 minute extension at 72° C. and a indefinite hold at 4° C. Following PCR, gel electrophoresis of a portion of the reaction products is used to confirm successful amplification of a ⁇ 1.5 kb product. PCR cleanup is performed as specified in the previous example.
- the cleaned PCR amplification products are quantified using the Quant-iTTM PicoGreen® dsDNA Assay Kit (Life Technologies, Grand Island, N.Y.) according to the manufacturer's instructions. Following quantification, the barcoded cleaned PCR products are combined such that each distinct PCR product is at an equimolar ratio to create a prepared Illumina library.
- the prepared library can be sequenced on Illumina HiSeq or MiSeq sequencers (Illumina, San Diego, Calif.) with cluster generation, template hybridization, iso-thermal amplification, linearization, blocking and denaturization and hybridization of the sequencing primers performed according to the manufacturer's instructions.
- 16SV4SeqFw (TATGGTAATTGTGTGCCAGCMGCCGCGGTAA) (SEQ ID NO: 2038)
- 16SV4SeqRev AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT) (SEQ ID NO: 2037) and 16SV4Index (ATTAGAWACCCBDGTAGTCCGGCTGACTGACT) (SEQ ID NO: 2039) (IDT, Coralville, Iowa)
- Other sequencing technologies can be used such as but not limited to 454, Pacific Biosciences, Helicos, Ion Torrent, and Nanopore using protocols that are standard to someone skilled in the art of genomic sequencing.
- Nucleic acid sequences can be analyzed and annotated to define taxonomic assignments using sequence similarity and phylogenetic placement methods or a combination of the two strategies.
- a similar approach can be used to annotate protein names, transcription factor names, and any other classification schema for nucleic acid sequences.
- Sequence similarity based methods include those familiar to individuals skilled in the art including, but not limited to BLAST, BLASTx, tBLASTn, tBLASTx, RDP-classifier, DNAclust, and various implementations of these algorithms such as Qiime or Mothur. These methods rely on mapping a sequence read to a reference database and selecting the match with the best score and e-value.
- Common databases include, but are not limited to the Human Microbiome Project, NCBI non-redundant database, Greengenes, RDP, and Silva.
- Phylogenetic methods can be used in combination with sequence similarity methods to improve the calling accuracy of an annotation or taxonomic assignment.
- tree topologies and nodal structure are used to refine the resolution of the analysis.
- phylogenetic methods we analyze nucleic acid sequences using one of numerous sequence similarity approaches and leverage phylogenetic methods that are well known to those skilled in the art, including but not limited to maximum likelihood phylogenetic reconstruction (see e.g. Liu K, Linder C R, and Warnow T. 2011.
- the certainty or significance of the OTU annotation is defined based on the OTU's sequence similarity to a reference nucleic acid sequence and the proximity of the OTU sequence relative to one or more reference sequences in the phylogeny.
- the specificity of a taxonomic assignment is defined with confidence at the the level of Family, Genus, Species, or Strain with the confidence determined based on the position of bootstrap supported branches in the reference phylogenetic tree relative to the placement of the OTU sequence being interrogated.
- 16S-V4 OTU identification to assign an OTU as a specific species depends in part on the resolving power of the 16S-V4 region of the 16S gene for a particular species or group of species. Both the density of available reference 16S sequences for different regions of the tree as well as the inherent variability in the 16S gene between different species will determine the definitiveness of a taxonomic annotation. Given the topological nature of a phylogenetic tree and the fact that tree represents hierarchical relationships of OTUs to one another based on their sequence similarity and an underlying evolutionary model, taxonomic annotations of a read can be rolled up to a higher level using a clade-based assignment procedure (Table 1).
- clades are defined based on the topology of a phylogenetic tree that is constructed from full-length 16S sequences using maximum likelihood or other phylogenetic models familiar to individuals with ordinary skill in the art of phylogenetics. Clades are constructed to ensure that all OTUs in a given clade are: (i) within a specified number of bootstrap supported nodes from one another (generally, 1-5 bootstraps), and (ii) within a 5% genetic similarity. OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S-V4 sequence data.
- OTUs falling within the same clade are evolutionarily closely related and may or may not be distinguishable from one another using 16S-V4 sequence data.
- the power of clade based analysis is that members of the same clade, due to their evolutionary relatedness, are likely to play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention.
- 16S sequences of isolates of a given OTU are phylogenetically placed within their respective clades, sometimes in conflict with the microbiological-based assignment of species and genus that may have preceded 16S-based assignment.
- Discrepancies between taxonomic assignment based on microbiological characteristics versus genetic sequencing are known to exist from the literature.
- Mixtures of bacteria can include species that are in spore form. Germinating a spore fraction increases the number of viable bacteria that will grow on various media types. To germinate a population of spores, the sample is moved to the anaerobic chamber, resuspended in prereduced PBS, mixed and incubated for 1 hour at 37 C to allow for germination.
- Germinants can include amino-acids (e.g., alanine, glycine), sugars (e.g., fructose), nucleosides (e.g., inosine), bile salts (e.g., cholate and taurocholate), metal cations (e.g., Mg2+, Ca2+), fatty acids, and long-chain alkyl amines (e.g., dodecylamine, Germination of bacterial spores with alkyl primary amines” J. Bacteriology, 1961.). Mixtures of these or more complex natural mixtures, such as rumen fluid or Oxgall, can be used to induce germination.
- amino-acids e.g., alanine, glycine
- sugars e.g., fructose
- nucleosides e.g., inosine
- bile salts e.g., cholate and taurocholate
- Oxgall is dehydrated bovine bile composed of fatty acids, bile acids, inorganic salts, sulfates, bile pigments, cholesterol, mucin, lecithin, glycuronic acids, porphyrins, and urea.
- the germination can also be performed in a growth medium like prereduced BHIS/oxgall germination medium, in which BHIS (Brain heart infusion powder (37 g/L), yeast extract (5 g/L), L-cysteine HCl (1 g/L)) provides peptides, amino acids, inorganic ions and sugars in the complex BHI and yeast extract mixtures and Oxgall provides additional bile acid germinants.
- BHIS Brain heart infusion powder (37 g/L), yeast extract (5 g/L), L-cysteine HCl (1 g/L)
- pressure may be used to germinate spores.
- the selection of germinants can vary with the microbe being sought. Different species require different germinants and different isolates of the same species can require different germinants for optimal germination.
- it is important to dilute the mixture prior to plating because some germinants are inhibitory to growth of the vegetative-state microorganisms. For instance, it has been shown that alkyl amines must be neutralized with anionic lipophiles in order to promote optimal growth. Bile acids can also inhibit growth of some organisms despite promoting their germination, and must be diluted away prior to plating for viable cells.
- BHIS/oxgall solution is used as a germinant and contains 0.5 ⁇ BHIS medium with 0.25% oxgall (dehydrated bovine bile) where 1 ⁇ BHIS medium contains the following per L of solution: 6 g Brain Heart Infusion from solids, 7 g peptic digest of animal tissue, 14.5 g of pancreatic digest of casein, 5 g of yeast extract, 5 g sodium chloride, 2 g glucose, 2.5 g disodium phosphate, and 1 g cysteine.
- Ca-DPA is a germinant and contains 40 mM CaCl2, and 40 mM dipicolinic acid (DPA). Rumen fluid (Bar Diamond, Inc.) is also a germinant.
- Simulated gastric fluid (Ricca Chemical) is a germinant and is 0.2% (w/v) Sodium Chloride in 0.7% (v/v) Hydrochloric Acid.
- Mucin medium is a germinant and prepared by adding the following items to 1 L of distilled sterile water: 0.4 g KH 2 PO 4 , 0.53 g Na 2 HPO 4 , 0.3 g NH 4 Cl, 0.3 g NaCl, 0.1 g MgCl 2 ⁇ 6H 2 O, 0.11 g CaCl 2 , 1 ml alkaline trace element solution, 1 ml acid trace element solution, 1 ml vitamin solution, 0.5 mg resazurin, 4 g NaHCO 3 , 0.25 g Na 2 S ⁇ 9H 2 O.
- the trace element and vitamin solutions prepared as described previously (Stams et al., 1993). All compounds were autoclaved, except the vitamins, which were filter-sterilized.
- the basal medium was supplemented with 0.7% (v/v) clarified, sterile rumen fluid and 0.25% (v/v) commercial hog gastric mucin (Type III; Sigma), purified by ethanol precipitation as described previously (Miller & Hoskins, 1981). This medium is referred herein as mucin medium.
- Fetal Bovine Serum can be used as a germinant and contains 5% FBS heat inactivated, in Phosphate Buffered Saline (PBS, Fisher Scientific) containing 0.137M Sodium Chloride, 0.0027M Potassium Chloride, 0.0119M Phosphate Buffer.
- PBS Phosphate Buffered Saline
- Thioglycollate is a germinant as described previously (Kamiya et al Journal of Medical Microbiology 1989) and contains 0.25M (pH10) sodium thioglycollate.
- Dodecylamine solution containing 1 mM dodecylamine in PBS is a germinant.
- a sugar solution can be used as a germinant and contains 0.2% fructose, 0.2% glucose, and 0.2% mannitol.
- Amino acid solution can also be used as a germinant and contains 5 mM alanine, 1 mM arginine, 1 mM histidine, 1 mM lysine, 1 mM proline, 1 mM asparagine, 1 mM aspartic acid, 1 mM phenylalanine.
- a germinant mixture referred to herein as Germix 3 can be a germinant and contains 5 mM alanine, 1 mM arginine, 1 mM histidine, 1 mM lysine, 1 mM proline, 1 mM asparagine, 1 mM aspartic acid, 1 mM phenylalanine, 0.2% taurocholate, 0.2% fructose, 0.2% mannitol, 0.2% glucose, 1 mM inosine, 2.5 mM Ca-DPA, and 5 mM KCl.
- BHIS medium+DPA is a germinant mixture and contains BHIS medium and 2 mM Ca-DPA.
- EcSN Escherichia coli spent medium supernatant referred to herein as EcSN is a germinant and is prepared by growing E. coli MG1655 in SweetB/Fos inulin medium anaerobically for 48 hr, spinning down cells at 20,000 rcf for 20 minutes, collecting the supernatant and heating to 60 C for 40 min. Finally, the solution is filter sterilized and used as a germinant solution.
- media to support growth including preferred carbon sources.
- preferred carbon sources include complex sugars such as cellobiose over simple sugars.
- media used in the isolation of sporulating organisms include EYA, BHI, BHIS, and GAM (see below for complete names and references). Multiple dilutions are plated out to ensure that some plates will have well isolated colonies on them for analysis, or alternatively plates with dense colonies may scraped and suspended in PBS to generate a mixed diverse community.
- Plates are incubated anaerobically or aerobically at 37 C for 48-72 or more hours, targeting anaerobic or aerobic spore formers, respectively.
- Solid plate media include:
- Gifu Anaerobic Medium without dextrose supplemented with fructooligosaccharides/inulin (0.4%), mannitol (0.4%), inulin (0.4%), or fructose (0.4%), or a combination thereof.
- Sweet GAM Gifu Anaerobic Medium (GAM, Nissui) modified, supplemented with glucose, cellobiose, maltose, L-arabinose, fructose, fructooligosaccharides/inulin, mannitol and sodium lactate
- PEA sheep blood (Anaerobe Systems; 5% Sheep Blood Agar with Phenylethyl Alcohol)
- EYA Egg Yolk Agar
- Sweet B Brain Heart Infusion agar (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) supplemented with yeast extract (0.5%), hemin, cysteine (0.1%), maltose (0.1%), cellobiose (0.1%), soluble starch (sigma, 1%), MOPS (50 mM, pH 7).
- PY-salicin peptone-yeast extract agar supplemented with salicin
- Modified Brain Heart Infusion [[sweet and sour]] contains the following per L: 37.5 g Brain Heart Infusion powder (Remel), 5 g yeast extract, 2.2 g meat extract, 1.2 g liver extract, 1 g cystein HCl, 0.3 g sodium thioglycolate, 10 mg hemin, 2 g soluble starch, 2 g FOS/Inulin, 1 g cellobiose, 1 g L-arabinose, 1 g mannitol, 1 Na-lactate, 1 mL Tween 80, 0.6 g MgSO4 ⁇ 7H2O, 0.6 g CaCl2, 6 g (NH4)2SO4, 3 g KH2PO4, 0.5 g K2HPO4, 33 mM Acetic acid, 9 mM propionic acid, 1 mM Isobutyric acid, 1 mM isovaleric acid, 15 g agar, and after autoclaving add 50 mL of 8%
- BHIS az1/ge2 BHIS az/ge agar (Reeves et. al. Infect. Immun. 80:3786-3794 (2012)) [Brain Heart Infusion agar (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) supplemented with yeast extract 0.5%, cysteine 0.1%, 0.1% cellobiose, 0.1% inulin, 0.1% maltose, aztreonam 1 mg/L, gentamycin 2 mg/L]
- BHIS CInM az1/ge2 BHIS CInM [Brain Heart Infusion agar (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) supplemented with yeast extract 0.5%, cysteine 0.1%, 0.1% cellobiose, 0.1% inulin, 0.1% maltose, aztreonam 1 mg/L, gentamycin 2 mg/L]
- a donation is first blended with saline using a homogenization device (e.g., laboratory blender) to produce a 20% slurry (w/v). 100% ethanol is added for an inactivation treatment that lasts 10 seconds to 1 hour. The final alcohol concentration can range from 30-90%, preferably 50-70%. High speed centrifugation (3200 rcf for 10 min) is performed to remove solvent and the pellet is retained and washed.
- a homogenization device e.g., laboratory blender
- 100% ethanol is added for an inactivation treatment that lasts 10 seconds to 1 hour.
- the final alcohol concentration can range from 30-90%, preferably 50-70%.
- High speed centrifugation (3200 rcf for 10 min) is performed to remove solvent and the pellet is retained and washed.
- a low speed centrifugation step (200 rcf for 4 min) is performed to remove large particulate vegetative matter and the supernatant containing the spores is retained.
- High speed centrifugation (3200 rcf for 10 min) is performed on the supernatant to concentrate the spore material.
- the pellet is then washed and resuspended to generate a 20% slurry. This is the ethanol treated spore preparation.
- the concentrated slurry is then separated with a density based gradient e.g. a CsCl gradient, sucrose gradient or combination of the two generating a ethanol treated, gradient-purified spore preparation.
- a CsCl gradient is performed by loading a 20% volume of spore suspension on top a 80% volume of a stepwise CsCl gradient (w/v) containing the steps of 64%, 50%, 40% CsCl (w/v) and centrifuging for 20 min at 3200 rcf.
- the spore fraction is then run on a sucrose step gradient with steps of 67%, 50%, 40%, and 30% (w/v).
- the spores run roughly in the 30% and 40% sucrose fractions.
- the lower spore fraction ( FIG. 2 ) is then removed and washed to produce a concentrated ethanol treated, gradient-purified spore preparation.
- spores after treatment with a germinant can also be used to quantify a viable spore population. Briefly, samples were incubated with a germinant (Oxgall, 0.25% for up to 1 hour), diluted and plated anaerobically on BBA ( Brucella Blood Agar) or similar media (e.g. see Examples 4 and 5). Individual colonies were picked and DNA isolated for full-length 16S sequencing to identify the species composition (e.g. see Examples 2 and 3). Analysis revealed that 22 species were observed in total (Table 2) with a vast majority present in both the material purified with the gradient and without the gradient, indicating no or inconsequential shift in the ecology as a result of gradient purification. Spore yield calculations demonstrate an efficient recovery of 38% of the spores from the initial fecal material as measured by germination and plating of spores on BBA or measuring DPA count in the sample.
- a germinant Oxgall, 0.25% for up to 1 hour
- BBA Brucella Blood A
- Example 7 Bacterial Compositions Prevent C. difficile Infection in a Mouse Model
- a prophylactic mouse model of C. difficile infection (model based on Chen, et al., A mouse model of Clostridium difficile associated disease, Gastroenterology 135(6):1984-1992) was used. Two cages of five mice each were tested for each arm of the experiment.
- antibiotic cocktail consisting of 10% glucose, kanamycin (0.5 mg/ml), gentamicin (0.044 mg/ml), colistin (1062.5 U/ml), metronidazole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml
- a positive control group received vancomycin from day ⁇ 1 through day 3 in addition to the antibiotic protocol and C. difficile challenge specified above. Feces were collected from the cages for analysis of bacterial carriage, mortality was assessed every day from day 0 to day 6 and the weight and subsequent weight change of the animal was assessed with weight loss being associated with C. difficile infection. Mortality and reduced weight loss of the test article compared to the vehicle were used to assess the success of the test article. Additionally, a C. difficile symptom scoring was performed each day from day ⁇ 1 through day 6.
- Clinical Score was based on a 0-4 scale by combining scores for Appearance (0-2 pts based on normal, hunched, piloerection, or lethargic), and Clinical Signs (0-2 points based on normal, wet tail, cold-to-the-touch, or isolation from other animals).
- a naive control arm animals were challenged with C. difficile .
- vancomycin positive control arm animals were dosed with C. difficile and treated with vancomycin from day ⁇ 1 through day 3.
- the negative control was gavaged with PBS alone and no bacteria.
- the test arms of the experiment tested 1 ⁇ , 0.1 ⁇ , 0.01 ⁇ dilutions derived from a single donor preparation of ethanol treated spores (e.g. see example AAAF) or the heat treated feces prepared by treating a 20% slurry for 30 min at 80 C.
- Dosing for CFU counts was determined from the final ethanol treated spores and dilutions of total spores were administered at 1 ⁇ , 0.1 ⁇ , 0.01 ⁇ of the spore mixture for the ethanol treated fraction and a 1 ⁇ dose for the heat treated fraction.
- Clindamycin (10 mg/kg s.c.) is given on day ⁇ 5, the bacterial composition or control is administered on day ⁇ 3, and C. difficile challenge occurs on day 0.
- vancomycin is then administered on day 1-5 (and vehicle control is delivered on day ⁇ 3).
- Feces are collected on day ⁇ 5, ⁇ 4, -1, 1, 3, 5, 7, 9 and fecal samples are assessed for pathogen carriage and reduction by microbiological methods, 16S sequencing approaches or other methods utilized by one skilled in the art. Mortality is assessed throughout the experiment through 21 days post C. difficile challenge.
- the percentage survival curves show that ethanol treated spores and ethanol treated, gradient-purified spores better protect the hamsters compared to the Vancomycin control, and vehicle control.
- FIG. 4 shows a prophylaxis model with the ethanol treated spore preparation and the ethanol treated, gradient-purified spore preparation.
- hamsters are challenged with toxigenic C. difficile strains on day 0, and treated with clindamycin by oral gavage on day 1, and vancomycin dosing day 2-6. Test or control treatment was then administered on day 7, 8, and 9.
- the groups of hamsters for each arm consist of 8 hamsters per group. Fecal material is collected on day ⁇ 1, 1, 3, 5, 7, 10 and 13 and hamster mortality is assessed throughout. Survival curves are used to assess the success of the test article e.g. ethanol treated or ethanol treated, gradient purified spores versus the control treatment in preventing hamster death.
- the survival curves demonstrate maximum efficacy for the ethanol treated, gradient-purified spores followed by the ethanol treated spores. Both treatments improved survival percentage over vancomycin treatment alone.
- FIG. 5 shows the relapse prevention model with ethanol treated spores and ethanol treated, gradient purified spores
- test articles like bacterial composition including but not limited to a ethanol treated spore preparations (e.g. see Example 6) to treat recurrent C. difficile in human patients
- the following procedure was performed to take feces from a healthy donor, inactivate via the ethanol treated spore preparation protocol described below, and treat recurrent C. difficile in patients presenting with this indication.
- Non-related donors were screened for general health history for absence of chronic medical conditions (including inflammatory bowel disease; irritable bowel syndrome; Celiac disease; or any history of gastrointestinal malignancy or polyposis), absence of risk factors for transmissible infections, antibiotic non-use in the previous 6 months, and negative results in laboratory assays for blood-borne pathogens (HIV, HTLV, HCV, HBV, CMV, HAV and Treponema pallidum ) and fecal bacterial pathogens ( Salmonella, Shigella, Yersinia, Campylobacter, E. coli 0157), ova and parasites, and other infectious agents (Giardia, Cryptosporidium Cyclospora, Isospora ) prior to stool donation.
- blood-borne pathogens HBV, HBV, CMV, HAV and Treponema pallidum
- fecal bacterial pathogens Salmonella, Shigella, Yersinia, Campylobacter, E.
- Donor stool was frozen shortly after donation and sampled for testing. At the time of use, approximately 75 g of donor stool was thawed and resuspended in 500 mL of non-bacteriostatic normal saline and mixed in a single use glass or plastic blender. The resulting slurry was sequentially passed through sterile, disposable mesh screens that remove particles of size 600, 300 and 200 microns. The slurry was then centrifuged briefly (200 rcf for 4 min) to separate fibrous and particulate materials, and the supernatant (containing bacterial cells and spores) was transferred to a fresh container.
- Ethanol was added to a final concentration of 50% and the resulting ⁇ 1500 ml slurry was incubated at room temperature for 1 hr with continuous mixing to inactivate vegetative bacterial cells. Midway through inactivation the slurry was transferred to a new bottle to ensure complete contact with the ethanol. The solid matter was pelleted in a centrifuge and washed 3 times with normal saline to remove residual ethanol. The final pellet was resuspended in 100% sterile, USP glycerol at a minimum volume, and filled into approximately 30 size 0 delayed release capsules (hypromellose DRcaps, Capsugel, Inc.) at 0.65 mL suspension each.
- the capsules were immediately capped and placed onto an aluminum freezing block held at ⁇ 80° C. via dry ice to freeze.
- the frozen capsules were in turn over-capsulated with size 00 DRcaps to enhance capsule stability, labeled, and placed into ⁇ 65° C. storage immediately.
- the final product was stored at ⁇ 65° C. until the day and time of use. Encapsulated product may be stored for indefinitely at ⁇ 65° C.
- On the day of dosing capsules were warmed on wet ice for 1 to 2 hours to improve tolerability, and were then dosed with water ad libitium.
- Patient 1 is a 45-year old woman with a history of C. difficile infection and diarrhea for at least 1 year prior to treatment. She has been previously treated with multiple courses of antibiotics followed each time by recurrence of C. difficile -associated diarrhea.
- Patient 2 is an 81-year old female who has experienced recurrent C. difficile infection for 6 months prior to treatment despite adequate antibiotic therapy following each recurrence.
- CDAD antibiotic therapy was discontinued.
- Each patient received a colon preparation procedure intended to reduce the competing microbial burden in the gastrointestinal tract and to facilitate repopulation by the spore forming organisms in the investigational product.
- the patients received a dose of delayed release capsules containing the investigational product with water ad libitum. Patients were requested to avoid food for 1 hour thereafter. The next day, the patient returned to the clinic to receive an additional dose. Patients were asked to avoid food for 4 hours prior to receiving their second dose and for 1 hour following dosing.
- the above protocol could be modified to deliver other bacterial compositions e.g. vegetative cells, spore preparations, and combinations thereof.
- dilution plates were selected in which the density enables distinct separation of single colonies. Colonies were picked with a sterile implement (either a sterile loop or toothpick) and re-streaked to BBA or other solid media. Plates were incubated at 37° C. for 3-7 days. One or more well-isolated single colonies of the major morphology type were re-streaked. This process was repeated at least three times until a single, stable colony morphology is observed. The isolated microbe was then cultured anaerobically in liquid media for 24 hours or longer to obtain a pure culture of 10 6 -10 10 cfu/ml.
- Liquid growth medium might include Brain Heart Infusion-based medium (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) supplemented with yeast extract, hem in, cysteine, and carbohydrates (for example, maltose, cellobiose, soluble starch) or other media described previously (e.g. see example AAAE).
- the culture was centrifuged at 10,000 ⁇ g for 5 min to pellet the bacteria, the spent culture media was removed, and the bacteria were resuspended in sterile PBS. Sterile 75% glycerol was added to a final concentration of 20%. An aliquot of glycerol stock was titered by serial dilution and plating. The remainder of the stock was frozen on dry ice for 10-15 min and then placed at ⁇ 80 C for long term storage.
- Cell banks (RCBs) of bacterial strains were prepared as follows. Bacterial strains were struck from ⁇ 80° C. frozen glycerol stocks to Brucella blood agar with Hemin or Vitamin K (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010), M2GSC (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) or other solid growth media and incubated for 24 to 48 h at 37° C. in an anaerobic chamber with a gas mixture of H 2 :CO 2 :N 2 of 10:10:80.
- Single colonies were then picked and used to inoculate 250 ml to 1 L of Wilkins-Chalgren broth, Brain-Heart Infusion broth, M2GSC broth or other growth media, and grown to mid to late exponential phase or into the stationary phase of growth.
- the single colonies may be used to inoculate a pilot culture of 10 ml, which were then used to inoculate a large volume culture.
- the growth media and the growth phase at harvest were selected to enhance cell titer, sporulation (if desired) and phenotypes that might be associated desired in vitro or in vivo.
- Cultures were grown static or shaking, depending which yielded maximal cell titer.
- the cultures were then concentrated 10 fold or more by centrifugation at 5000 rpm for 20 min, and resuspended in sterile phosphate buffered saline (PBS) plus 15% glycerol. 1 ml aliquots were transferred into 1.8 ml cryovials which were then frozen on dry ice and stored at ⁇ 80 C.
- the identity of a given cell bank was confirmed by PCR amplification of the 16S rDNA gene, followed by Sanger direct cycle sequencing, and comparison to a curated rDNA database to determine a taxonomic ID. Each bank was confirmed to yield colonies of a single morphology upon streaking to Brucella blood agar or M2GSC agar.
- colonies were confirmed to be the expected species by PCR and sequencing analysis of the 16S rDNA gene.
- Variant colony morphologies can be observed within pure cultures, and in a variety of bacteria the mechanisms of varying colony morphologies have been well described (van der Woude, Clinical Microbiology Reviews, 17:518, 2004), including in Clostridium species (Wadsworth-KTL Anaerobic Bacteriology Manual, 6th Ed, Jousimie-Somer, et al 2002).
- RCBs were confirmed to lack aerobic colony forming units at a limit of detection of 10 cfu/ml.
- the number of viable cells per ml was determined on the freshly harvested, washed and concentrated culture by plating serial dilutions of the RCB to Brucella blood agar or other solid media, and varied from 10 6 to 10 10 cfu/ml.
- the impact of freezing on viability was determined by titering the banks after one or two freeze-thaw cycles on dry ice or at ⁇ 80° C., followed by thawing in an anaerobic chamber at room temperature. Some strains displayed a 1-3 log drop in viable cfu/ml after the 1st and/or 2nd freeze thaw, while the viability of others were unaffected.
- strains were typically thawed on ice and combined in an anaerobic chamber to create mixtures, followed by a second freeze at ⁇ 80° C. to preserve the mixed samples.
- the cfu in the final mixture was estimated based on the second freeze-thaw titer of the individual strains.
- strains may be combined at equal counts in order to deliver between 1e4 and 1e10 per strain. Additionally, some bacteria may not grow to sufficient titer to yield cell banks that allowed the production of compositions where all bacteria were present at 1e10.
- Fresh gut microbiome samples e.g. fecal samples were obtained from healthy human donors who have been screened for general good health and for the absence of infectious diseases, and meet inclusion and exclusion criteria, inclusion criteria include being in good general health, without significant medical history, physical examination findings, or clinical laboratory abnormalities, regular bowel movements with stool appearance typically Type 2, 3, 4, 5 or 6 on the Bristol Stool Scale, and having a BMI ⁇ 18 kg/m 2 and ⁇ 25 kg/m 2 .
- Exclusion criteria generally included significant chronic or acute medical conditions including renal, hepatic, pulmonary, gastrointestinal, cardiovascular, genitourinary, endocrine, immunologic, metabolic, neurologic or hematological disease, a family history of, inflammatory bowel disease including Crohn's disease and ulcerative colitis, Irritable bowel syndrome, colon, stomach or other gastrointestinal malignancies, or gastrointestinal polyposis syndromes, or recent use of yogurt or commercial probiotic materials in which an organism(s) is a primary component. Samples were collected directly using a commode specimen collection system, which contains a plastic support placed on the toilet seat and a collection container that rests on the support. Gut microbiome samples e.g.
- feces were deposited into the container, and the lid was then placed on the container and sealed tightly. The sample was then delivered on ice within 1-4 hours for processing. Samples were mixed with a sterile disposable tool, and 2-4 g aliquots were weighed and placed into tubes and flash frozen in a dry ice/ethanol bath. Aliquots are frozen at ⁇ 80 degrees Celsius until use.
- the microbiome sample was suspended in a solution, and/or fibrous and/or particulate materials were removed.
- a frozen aliquot containing a known weight of sample was removed from storage at ⁇ 80 degrees Celsius and allowed to thaw at room temperature.
- Sterile 1 ⁇ PBS was added to create a 10% w/v suspension, and vigorous vortexing was performed to suspend the sample until the material appeared homogeneous.
- the sample was then left to sit for 10 minutes at room temperature to sediment fibrous and particulate matter.
- the suspension above the sediment was then carefully removed into a new tube and contains a purified spore population.
- the suspension was then centrifuged at a low speed, e.g., 1000 ⁇ g, for 5 minutes to pellet particulate matter including fibers.
- the pellet was discarded and the supernatant, which contained vegetative organisms and spores, was removed into a new tube. The supernatant was then centrifuged at 6000 ⁇ g for 10 minutes to pellet the vegetative organisms and spores. The pellet was then resuspended in 1 ⁇ PBS with vigorous vortexing until the sample material appears homogenous.
- Example 15 Bacterial Compositions Populating the Gut in a Mouse Model
- compositions Two bacterial compositions were evaluated in a mouse model to demonstrate the ability to populate the gastrointestinal tract. Bacteria were grown as described in Example 13. Compositions were pre-made under anaerobic conditions and suspended in PBS+15% glycerol and stored at ⁇ 70° C. prior to use.
- mice 10 females/group; 5 per cage were pre-treated on Days ⁇ 14 to ⁇ 5 with an antibiotic cocktail consisting of 10% glucose, kanamycin (0.5 mg/ml), gentamicin (0.044 mg/ml), colistin (1062.5 U/ml), metronidazole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), ampicillin (0.1 mg/ml) and vancomycin (0.056 mg/ml) in their drinking water.
- an antibiotic cocktail consisting of 10% glucose, kanamycin (0.5 mg/ml), gentamicin (0.044 mg/ml), colistin (1062.5 U/ml), metronidazole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), ampicillin (0.1 mg/ml) and vancomycin (0.056 mg/ml) in their drinking water.
- an antibiotic cocktail consisting of 10% glucose, kanamycin (0.5 mg/ml), gentamicin (0.044 mg/
- Microbial compositions comprised approximately equal numbers of each OTU and were dosed at approximately 1 ⁇ 10 9 , 1 ⁇ 10 8 and 1 ⁇ 10 7 per OTU for each composition (e.g. microbial composition 1, comprising 15 strains, was dosed at approximately 1.5 ⁇ 10 10 , 1.5 ⁇ 10 9 , and 1.5 ⁇ 10 8 total CFU).
- microbial composition 1 comprising 15 strains
- Fecal samples were collected from each cage on Day ⁇ 1 (approximately 1 hour before dosing) and on Days 2, 3 and 4 post-dosing. Feces were stored frozen prior to processing and sequencing. Weight gain of mice treated with either microbial compositions was similar to that of naive, control mice.
- Fecal samples were processed by isolating and sequencing DNA according to Examples 2 and 3.
- the OTU assignment of fecal samples from Days ⁇ 1, 2, 3 and 4 was determined by analyzing 16S-V4 sequence reads and assigning OTUs as described in Example 2. Clades were assigned as described in Example 2. Total read counts were determined for each OTU or each clade by summing the results from cages of the same experimental group. Samples with 10 or fewer sequence reads for a given OTU or clade were considered to be below background and were not included in the summation process. Results are shown by OTU (Table 7) and by clade (Table 8).
- composition 2 Co. aerofaciens is detected transiently on Day 2 in the 1 ⁇ 10 8 and 1 ⁇ 10 7 dose groups; E. rectale in the same experimental groups is detected on Day 3, suggesting a possible relationship between transient population by Co. aerofaciens followed by E. rectale in these groups of mice.
- a striking observation is that the observed population of OTU sequence reads is not highly dose dependent. Overall, the data is consistent with a model whereby OTUs populate rapidly following oral administration.
- the clade-based analysis in Table 8 was performed to more thoroughly evaluate the population of the GI tract. Clade-based analysis obscures some of the details afforded by an OTU analysis. For instance, Cl. tertium and Cl. butyricum are members of the same clade and thus a clade-based analysis cannot distinguish the dynamics of these individual OTUs. However, clade-based analysis has the compensatory benefit that it is sensitive to measuring population changes that can be missed by an OTU-based analysis.
- the ability of 16S-V4 OTU identification to assign an OTU as a specific species depends in part on the resolving power of the 16S-V4 region for a particular species or group of species.
- mice challenged in parallel with C. difficile were significantly protected as shown in Table 9.
- mice gavaged with vehicle experienced 100% mortality while microbial compositions 1 and 2 protected at all dose levels with between 0 and 10% mortality by Day 6, the last day of the experiment.
- weight loss in animals treated with microbial compositions 1 and 2 was minimal compared to animals receiving the vehicle gavage.
- spore concentration in complex mixtures typically require the separation and selection of spores and subsequent growth of individual species to determine the colony forming units.
- the art does not teach how to quantitatively germinate all the spores in a complex mixture as there are many species for which appropriate germinants have not been identified.
- sporulation is thought to be a stochastic process as a result of evolutionary selection, meaning that not all spores from a single species germinate with same response to germinant concentration, time and other environmental conditions.
- DPA dipicolinic acid
- the assay utilizes the fact that DPA chelates Terbium 3+ to form a luminescent complex (Fichtel et al, FEMS Microbiology Ecology, 2007; Kort et al, Applied and Environmental Microbiology, 2005; Shafaat and Ponce, Applied and Environmental Microbiology, 2006; Yang and Ponce, International Journal of Food Microbiology, 2009; Hindle and Hall, Analyst, 1999).
- a time-resolved fluorescence assay detects terbium luminescence in the presence of DPA giving a quantitative measurement of DPA concentration in a solution.
- Purified spores are produced as described previously (e.g. see www.epa.gov/pesticides/methods/MB-28-00.pdf). Serial dilutions of purified spores from C. bifermentans, C. sporogenes , and C. butyricum cultures were prepared and measured by plating on BBA media and incubating overnight at 37° C. to determine CFU/ml.
- FIG. 7 shows the linear correspondence across different spore producing bacteria across several logs demonstrating the DPA assay as means to assess spore content (linear range of DPA assay compared to CFU counts/ml).
- spore content varies greatly per 30 capsules. As measured by germinable SCFU, spore content varies by greater than 10,000-fold. As measured by DPA, spore content varies by greater than 100-fold. In the absence of the DPA assay, it would be difficult to set a minimum dose for administration to a patient. For instance, without data from the DPA assay, one would conclude that a minimum effective dose of spores is 4 ⁇ 10 5 or less using the SCFU assay (e.g. Preparation 1, See Table 10 below). If that SCFU dose was used to normalize dosing in a clinical setting, however, then the actual spore doses given to patients would be much lower for other ethanol treated spore preparations as measured as by the DPA assay (See Table 11 below).
- spores from three different donors were germinated by various treatments and plated on various media. Germination with BHIS/oxgall (BHIS ox), Ca-DPA, rumen fluid (RF), simulated gastric fluid (SGF), mucin medium (Muc), fetal bovine serum (FBS), or thioglycollate (Thi) for 1 hour at 37 C in anaerobic conditions was performed as described previously (e.g. see Examples 4 and 5) with samples derived from two independent donors ( FIG. 8 ).
- BHIS/oxgall BHIS ox
- Ca-DPA rumen fluid
- RF rumen fluid
- SGF simulated gastric fluid
- Muc mucin medium
- FBS fetal bovine serum
- Thi thioglycollate
- the spore-germinant mixture was serially diluted and plated on different plate media including BBA, Sweet B, Sweet B+lysozyme (2 ug/ml), M2GSC and M2GSC+lysozyme (2 ug/ml) as previously described (e.g. see Examples 4 and 5) to determine spore germination.
- Colony forming units were tallied and titers were determined using standard techniques by one skilled in the art. As FIG. 8 shows, maximum colony forming units are derived from BHI-oxgall treatment. This germination treatment also greatly increases the diversity as measured by the number of OTUs identified when samples were submitted for 16S sequencing (e.g. see Examples 2 and 3) compared to plating without a germination step ( FIG. 9 ).
- FIG. 8 shows different germinant treatments have variable effects on CFU counts from donor A (upper left) and donor B (lower right).
- the Y-Axes are spore CFU per ml.
- FIG. 9 shows germinates greatly increase the diversity of cultured spore forming OTUs.
- ethanol treated fecal samples were treated for 15 min at room temperature, 55° C., 65° C., 75° C. or 85° C. from three different donors and germinated subsequently with BHIS+Oxgall for 1 hr at 37° C. then plated on BBA media ( FIG. 10 ) as previously described (e.g. see Examples 4 and 5).
- Pretreatment at room temperature produced equal if not more spores than the elevated temperatures in all three donors.
- the temperature of germinating was also examined by incubating samples at room temperature or 37° C. for 1 hr in anaerobic conditions before plating on BBA. No difference in the number of CFUs was observed between the two conditions.
- Lysozyme addition to the plates (2 ug/ml) was also tested on a single donor sample by the testing of various activation temperature followed by an incubation in the presence or absence of lysozyme.
- the addition of lysozyme had a small effect when plated on Sweet B or M2GSC media but less so than treatment with BHIS oxgall without lysozyme for 1 hr ( FIG. 11 ).
- FIG. 10 shows heat activation as a germination treatment with BHIS+oxgall.
- FIG. 11 shows the effect of lysozyme slightly enhances germination
- Germination time was also tested by treating a 10% suspension of a single donor ethanol treated feces (e.g. see Example AAAF) incubated in either BHIS, taurocholate, oxgall, or germix for 0, 15, 30, or 60 minutes and subsequently plated on BHIS, EYA, or BBA media (e.g. see Examples AAAD and AAAE). 60 minutes resulted in the most CFU units across all various combinations germinates and plate media tested. Furthermore, this protocol and germination treatment can be applied to mixtures of bacteria and spore forming species to enrich the population of spore-forming bacterial growth. In this manner, spore formers growth can be enhanced in a mixed population by addition of a germinate or germination treatment step as described above.
- Example 18 Construction of an In Vitro Assay to Screen for Combinations of Microbes Inhibitory to the Growth of Clostridium Difficile
- the in vitro assay is a high-throughput assay designed to screen for combinations of microbes that inhibit the growth of a pathogen or pathobiont. Feces from a human donor is resuspended 10% w/v in pre-reduced PBS under anaerobic conditions and then is pelleted in an Eppendorf Centrifuge 5810R, Rotor F34-6-38 at 8,500 rpm (9289 rcf) for 5 min to remove cells and particulates. The supernatant is then filter-sterilized using a 0.22 ⁇ m filter to produce the background media for in vitro competitions.
- the 10% sterile-filtered feces media is then added in 178 ⁇ L aliquots to wells of a 96-well plate. 20 ⁇ L of candidate bacterial strains or combinations of strains are added to each well.
- the in vitro assay plate is then incubated anaerobically at 37° C. for 3 hr. before inoculation of Clostridium difficile ATCC 9689.
- the C. difficile inoculum is prepared by inoculating 5 mL BHI (Brain Heart Infusion Broth) and incubating 37° C. for 18 hr. The overnight culture is then diluted 100 fold in PBS before inoculating 2 ⁇ L into each well to produce a final dilution of 10,000 fold from the overnight culture.
- In vitro assay plates are then incubated anaerobically for 24 hr. before assaying for viable counts of C. difficile by plating serial dilutions on C. difficile selective agar plates with cycloserine cefoxitin mannitol agar (CCMA).
- CCMA cycloserine cefoxitin mannitol agar
- Colonies of C. difficile are confirmed by their characteristic diffuse colony edge morphology as well as fluorescence under UV light.
- the standard curve is generated from wells containing pathogenic C. difficile grown in 10% sterile-filtered feces media from Example 2 by selective spot plating. Serial dilutions of duplicate cultures are performed in sterile phosphate-buffered saline. Genomic DNA is then extracted from the standard curve samples along with the other wells.
- Genomic DNA can be extracted from 50 ⁇ l of each sample using the Mo Bio Powersoil®-htp 96 Well Soil DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.) according to the manufacturer's instructions with two exceptions: the bead beating is performed for 2 ⁇ 4:40 minutes using a BioSpec Mini-Beadbeater-96 (BioSpec Products, Bartlesville, Okla.) and the DNA is eluted in 50 ⁇ l of Solution C6.
- the genomic DNA could be isolated using the Mo Bio Powersoil® DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.) or the QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, Calif.) according to the manufacturer's instructions.
- the qPCR contains 1 ⁇ HotMasterMix (5PRIME, Gaithersburg, Md.), 900 nM of Wr-tcdB-F (AGCAGTTGAATATAGTGGTTTAGTTAGAGTTG (SEQ ID NO: 2040) IDT, Coralville, Iowa), 900 nM of Wr-tcdB-R (CATGCTTTTTTAGTTTCTGGATTGAA (SEQ ID NO: 2041) IDT, Coralville, Iowa), 250 nM of We-tcdB-P (6FAM-CATCCAGTCTCAATTGTATATGTTTCTCCA-MGB (SEQ ID NO: 2042) Life Technologies, Grand Island, N.Y.), and PCR Water (Mo Bio Laboratories, Carlsbad, Calif.) to 18 ⁇ l (Primers adapted from: Wroblewski, D.
- This reaction mixture is aliquoted to wells of a MicroAmp® Fast Optical 96-well Reaction Plate with Barcode (0.1 mL) (Life Technologies, Grand Island, N.Y.). To this reaction mixture, 2 ⁇ l of extracted genomic DNA is added. The qPCR is performed on a BioRad C1000TM Thermal Cycler equipped with a CFX96TM Real-Time System (BioRad, Hercules, Calif.). The thermocycling conditions are 95° C. for 2 minutes followed by 45 cycles of 95° C. for 3 seconds, 60° C. for 30 seconds, and fluorescent readings of the FAM and ROX channels.
- the Cq value for each well on the FAM channel is determined by the CFX ManagerTM software version 2.1.
- the log 10 (cfu/ml) of each experimental sample is calculated by inputting a given sample's Cq value into linear regression model generated from the standard curve comparing the Cq values of the standard curve wells to the known log 10 (cfu/ml) of those samples.
- Example 20 Construction of an In Vitro Assay to Screen for Combinations of Microbes Inhibitory to the Growth of Pathogenic E. coli
- the in vitro assay is used to screen for combinations of bacteria inhibitory to the growth of E. coli by modifying the media used for growth of the pathogen inoculum.
- One of several choices of media is used for growth of the pathogen such as Reinforced Clostridial Media (RCM), Brain Heart Infusion Broth (BHI) or Luria Bertani Broth (LB) (also known as Lysogeny Broth).
- E. coli is quantified by using alternative selective media specific for E. coli or using qPCR probes specific for the pathogen. For example, aerobic growth on MacConkey lactose medium selects for enteric Gram negatives, including E. coli . qPCR is conducted using probes specific for the shiga toxin of pathogenic E. coli.
- Example 21 Construction of an In Vitro Assay to Screen for Combinations of Microbes Inhibitory to the Growth of Vancomycin-Resistant Enterococcus (VRE)
- the in vitro assay is used to screen for combinations of bacteria inhibitory to the growth of Vancomycin-Resistant Enterococcus spp. (VRE) by modifying the media used for growth of the pathogen inoculum.
- VRE Vancomycin-Resistant Enterococcus spp.
- Several choices of media are used for growth of the pathogen such as Reinforced Clostridial Media (RCM), Brain Heart Infusion Broth (BHI) or Luria Bertani Broth (LB).
- RCM Reinforced Clostridial Media
- BHI Brain Heart Infusion Broth
- LB Luria Bertani Broth
- VRE is quantified by using alternative selective media specific for VRE or using qPCR probes specific for the pathogen.
- m- Enterococcus agar containing sodium azide is selective for Enterococcus spp. and a small number of other species. Probes specific to the van genes conferring vancomycin resistance are used in the qPCR.
- Example 22 Prophylactic Use and Treatment in a Mouse Model of Vancomycin Resistant Enterococcus (VRE) Colonization
- VRE infection mouse model is used as previously described (Ubeda et al, Infectious Immunity 2013, Ubeda et al, Journal of clinical investigation, 2010). Briefly, experiments are done with 7-week-old C57BL/6J female mice purchased from Jackson Laboratory, housed with irradiated food, and provided with acidified water. Mice are individually housed to avoid contamination between mice due to coprophagia. For experimental infections with VRE, mice are treated with ampicillin (0.5 g/liter) in their drinking water, which is changed every 3 days.
- mice are infected by means of oral gavage with 10 8 CFU of the vancomycin-resistant Enterococcus faecium strain purchased from ATCC (ATCC 700221).
- CFU vancomycin-resistant Enterococcus faecium strain purchased from ATCC (ATCC 700221).
- antibiotic treatment is stopped and VRE levels are determined at different time points by plating serial dilutions of fecal pellets on Enterococcosel agar plates (Difco) with vancomycin (8 ug/ml; Sigma). VRE colonies are identified by appearance and confirmed by Gram staining or other methods previously described (e.g. see Examples 1-3).
- PCR of the vanA gene which confers resistance to vancomycin, confirms the presence of VRE in infected mice.
- the bacterial composition test article such as but not limited to an ethanol treated, gradient purified spore preparation (as described herein), fecal suspension, or antibiotic treatment is delivered in PBS on days 1-3 while the negative control contains only PBS and is also delivered on days 1-3 by oral gavage.
- Fresh fecal stool pellets are obtained daily for the duration of the experiment from days ⁇ 7 to day 10. The samples are immediately frozen and stored at ⁇ 80° C. DNA was extracted using standard techniques and analyzed with 16S or comparable methods (e.g. see Examples 2 and 3).
- ampicillin is administered as described above for day ⁇ 7 to day 1
- treatment with the test article or vehicle control is administered on day 0-2
- the VRE resistant bacteria at 10 8 CFU are administered on day 14.
- Fecal samples are taken throughout the experiment daily from ⁇ 7 to day 21 and submitted for 16S sequencing as previously described (e.g. see Examples 2 and 3).
- titers of VRE in feces are used to evaluate the success of the test article versus the negative control. Furthermore, microbiota composition is assessed for the ability of the bacterial composition test article to induce a healthy microbiome.
- KPC K. pneumoniae carbapenemase
- KPC-Kp KPC-Kp
- MDR multidrug-resistant organisms
- a treatment protocol in a mouse model as previously described is used to evaluate the bacterial composition (test article) for treating carbapenem resistant Klebsiella and reducing carriage in the GI tract.
- Female CF1 mice (Harlan Sprague-Dawley, Indianapolis, Ind.) are used and are individually housed and weighed between 25 and 30 g.
- K. pneumoniae , VA-367 8, 9, 25
- This clinical isolate is genetically related to the KPC-Kp strain circulating in the Eastern United States.
- Characterization of the resistance mechanisms in K. pneumoniae VA-367 with PCR and DNA sequence analysis revealed the presence of bla KPC-3 , bla TEM-1 , bla SHV-11 , and bla SHV-12 as well as qnrB19 and aac(6′)-Ib.
- PCR and DNA sequencing revealed disruptions in the coding sequences of the following outer membrane protein genes: ompK35, ompK36, and ompK37.
- AST Antibiotic susceptibility testing
- CCSI Clinical and Laboratory Standards Institute
- mice (10 per group) are assigned to either a bacterial composition (test article), ethanol treated, spore preparation (e.g. see Example 6), antibiotic clindamycin, piperacillin-tazobactam, tigecycline, ertapenem, cefepime, ciprofloxacin, or combination thereof or control group receiving only the vehicle. They are administered the test article daily from day ⁇ 10 to day 0, On day 0, 10 3 CFU of KPC-Kp VA-367 diluted in 0.5 ml phosphate-buffered saline (PBS) was administered by oral gavage using a stainless-steel feeding tube (Per Stammum; Popper & Sons, New Hyde Park, N.Y.).
- PBS phosphate-buffered saline
- Stool samples were collected 1, 4, 6, and 11 days after the administration of KPC-Kp in order to measure the concentration of carbapenem-resistant K. pneumoniae .
- Stool samples (100 mg diluted in 800 ml of PBS) are plated onto MacConkey agar with and without 0.5 ug/ml of imipenem, and the number of CFU per gram of stool was determined.
- other methods may be used to measure the levels of carbapenem-resistant K. pneumoniae e.g. per, antigen testing, as one who's skilled in the art could perform.
- mice are treated with subcutaneous clindamycin to reduce the normal intestinal flora 1 day before receiving 10 4 CFU of KPC-Kp VA-367 by oral gavage, and the mice continued to receive subcutaneous clindamycin every other day for 7 days. Concurrently, for 7 days after oral gavage with KPC-Kp, mice received oral gavage of normal saline (control group), or the bacterial composition as specified. An additional dose of subcutaneous clindamycin was administered 20 days after the administration of KPC-Kp VA-367 to assess whether low levels of carbapenem-resistant K. pneumoniae were present that could be augmented by the elimination of the anaerobic microflora. Stool samples were collected at baseline and at 3, 6, 8, 11, 16, and 21 days after KPC-Kp VA-367 was given by gavage. The bacterial composition will be examined by the reduction of CRKB in feces.
- the human body is an ecosystem in which the microbiota, and the microbiome, play a significant role in the basic healthy function of human systems (e.g. metabolic, immunological, and neurological).
- the microbiota and resulting microbiome comprise an ecology of microorganisms that co-exist within single subjects interacting with one another and their host (i.e., the mammalian subject) to form a dynamic unit with inherent biodiversity and functional characteristics.
- these networks of interacting microbes i.e. ecologies
- particular members can contribute more significantly than others; as such these members are also found in many different ecologies, and the loss of these microbes from the ecology can have a significant impact on the functional capabilities of the specific ecology.
- Keystone OTUs and/or Functions are computationally-derived by analysis of network ecologies elucidated from a defined set of samples that share a specific phenotype.
- Keystone OTUs and/or Functions are defined as all Nodes within a defined set of networks that meet two or more of the following criteria. Using Criterion 1, the node is frequently observed in networks, and the networks in which the node is observed are found in a large number of individual subjects; the frequency of occurrence of these Nodes in networks and the pervasiveness of the networks in individuals indicates these Nodes perform an important biological function in many individuals.
- Criterion 2 the node is frequently observed in networks, and each the networks in which the node is observed contain a large number of Nodes—these Nodes are thus “super-connectors”, meaning that they form a nucleus of a majority of networks and as such have high biological significance with respect to their functional contributions to a given ecology.
- Criterion 3 the node is found in networks containing a large number of Nodes (i.e. they are large networks), and the networks in which the node is found occur in a large number of subjects; these networks are potentially of high interest as it is unlikely that large networks occurring in many individuals would occur by chance alone strongly suggesting biological relevance.
- the required thresholds for the frequency at which a node is observed in network ecologies, the frequency at which a given network is observed across subject samples, and the size of a given network to be considered a Keystone node are defined by the 50th, 70th, 80th, or 90th percentiles of the distribution of these variables.
- the required thresholds are defined by the value for a given variable that is significantly different from the mean or median value for a given variable using standard parametric or non-parametric measures of statistical significance.
- a Keystone node is defined as one that occurs in a sample phenotype of interest such as but not limited to “health” and simultaneously does not occur in a sample phenotype that is not of interest such as but not limited to “disease.”
- a Keystone Node is defined as one that is shown to be significantly different from what is observed using permuted test datasets to measure significance.
- Example 25 Microbial Population (Engraftment and Augmentation) and Reduction of Pathogen Carriage in Patients Treated with Spore Compositions
- Complementary genomic and microbiological methods were used to characterize the composition of the microbiota from Patient 1, 2, 3, 4, and 5, 6, 7, 8, 9, and 10 at pretreatment (pretreatment) and on up to 4 weeks post-treatment.
- the microbiome was characterized by 16S-V4 sequencing prior to treatment (pretreatment) with an ethanol treated spore preparation and up to 25 days after receiving treatment.
- pretreatment an ethanol treated spore preparation
- a bacterial composition in the vegetative state or a mixture of vegetative bacteria and bacterial spores.
- the treatment of patient 1 with an ethanol treated spore preparation led to microbial population via the engraftment of OTUs from the spore treatment and augmentation in the microbiome of the patient ( FIG. 12 and FIG. 13 ).
- Table 12 shows bacterial OTUs associated with engraftment and ecological augmentation and establishment of a more diverse microbial ecology in patients treated with an ethanol treated spore preparation.
- OTUs that comprise an augmented ecology are not present in the patient prior to treatment and/or exist at extremely low frequencies such that they do not comprise a significant fraction of the total microbial carriage and are not detectable by genomic and/or microbiological assay methods.
- OTUs that are members of the engrafting and augmented ecologies were identified by characterizing the OTUs that increase in their relative abundance post treatment and that respectively are: (i) present in the ethanol treated spore preparation and absent in the patient pretreatment (engrafting OTUs), or (ii) absent in the ethanol treated spore preparation, but increase in their relative abundance through time post treatment with the preparation due to the formation of favorable growth conditions by the treatment (augmenting OTUs).
- the latter OTUs can grow from low frequency reservoirs in the patient, or be introduced from exogenous sources such as diet.
- OTUs that comprise a “core” augmented or engrafted ecology can be defined by the percentage of total patients in which they are observed to engraft and/or augment; the greater this percentage the more likely they are to be part of a core ecology responsible for catalyzing a shift away from a dysbiotic ecology.
- the dominant OTUs in an ecology can be identified using several methods including but not limited to defining the OTUs that have the greatest relative abundance in either the augmented or engrafted ecologies and defining a total relative abundance threshold.
- the dominant OTUs in the augmented ecology of Patient-1 were identified by defining the OTUs with the greatest relative abundance, which together comprise 60% of the microbial carriage in this patient's augmented ecology.
- FIG. 12 shows the microbial diversity measured in the ethanol treated spore treatment sample and patient pre- and post-treatment samples.
- Total microbial diversity is defined using the Chao1 Alpha-Diversity Index and is measured at different genomic sampling depths to confirm adequate sequence coverage to assay the microbiome in the target samples.
- the patient pretreatment harbored a microbiome that was significantly reduced in total diversity as compared to the ethanol treated spore treatment (red) and patient post treatment at days 5 (blue), 14 (orange), and 25 (green).
- FIG. 13 shows patient microbial ecology is shifted by treatment with an ethanol treated spore treatment from a dysbiotic state to a state of health.
- Principle Coordinates Analysis based on the total diversity and structure of the microbiome (Bray-Curtis Beta-Diversity) of the patient pre- and post-treatment delineates that the engraftment of OTUs from the spore treatment and the augmentation of the patient microbial ecology leads to a microbial ecology that is distinct from both the pretreatment microbiome and the ecology of the ethanol treated spore treatment (Table 12).
- FIG. 14 shows the augmentation of Bacteroides species in patients. Comparing the number of Bacteroides fragilis groups species per cfu/g of feces pre-treatment and in week 4 post treatment reveals an increase of 4 logs or greater.
- the ability of 165-V4 OTU identification to assign an OTU as a specific species depends in part on the resolution of the 16S-V4 region of the 16S gene for a particular species or group of species. Both the density of available reference 16S sequences for different regions of the tree as well as the inherent variability in the 16S gene between different species will determine the definitiveness of a taxonomic annotation to a given sequence read.
- taxonomic annotations of a read can be rolled up to a higher level using a clade-based assignment procedure (Table 1).
- Table 1 taxonomic annotations of a read can be rolled up to a higher level using a clade-based assignment procedure (Table 1).
- clades are defined based on the topology of a phylogenetic tree that is constructed from full-length 16S sequences using maximum likelihood or other phylogenetic models familiar to individuals with ordinary skill in the art of phylogenetics.
- Clades are constructed to ensure that all OTUs in a given clade are: (i) within a specified number of bootstrap supported nodes from one another (generally, 1-5 bootstraps), and (ii) within a 5% genetic similarity.
- OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S-V4 sequence data.
- OTUs falling within the same clade are evolutionarily closely related and may or may not be distinguishable from one another using 16S-V4 sequence data.
- the power of clade based analysis is that members of the same clade, due to their evolutionary relatedness, play similar functional roles in a microbial ecology such as that found in the human gut. Compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention.
- 16S sequences of isolates of a given OTU are phylogenetically placed within their respective clades despite that the actual taxonomic assignment of species and genus may suggest they are taxonomically distinct from other members of the clades in which they fall.
- Discrepancies between taxonomic names given to an OTU is based on microbiological characteristics versus genetic sequencing are known to exist from the literature. The OTUs footnoted in this table are known to be discrepant between the different methods for assigning a taxonomic name.
- Klebsiella is a resident of the human microbiome in only about 2% of subjects based on an analysis of HMP database (www.hmpdacc.org), and the mean relative abundance of Klebsiella is only about 0.09% in the stool of these people. Its surprising presence at 20% relative abundance in Patient 1 before treatment is an indicator of a proinflammatory gut environment enabling a “pathobiont” to overgrow and outcompete the commensal organisms normally found in the gut. Similarly, the dramatic overgrowth of Fusobacterium indicates a profoundly dysbiotic gut microbiota.
- Fusobacterium F. nucleatum (an OTU phylogenetically indistinguishable from Fusobacterium sp.
- Klebsiella spp. carriage is consistent across multiple patients.
- Four separate patients were evaluated for the presence of Klebsiella spp. pre treatment and 4 weeks post treatment.
- Klebsiella spp. were detected by growth on selective Simmons Citrate Inositol media as previously described. Serial dilution and plating, followed by determining cfu/mL titers of morphologically distinct species and 16S full length sequence identification of representatives of those distinct morphological classes, allowed calculation of titers of specific species.
- the genus Bacteroides is an important member of the gastrointestinal microbiota; 100% of stool samples from the Human Microbiome Project contain at least one species of Bacteroides with total relative abundance in these samples ranging from 0.96% to 93.92% with a median relative abundance of 52.67% (www.hmpdacc.org reference data set HMSMCP). Bacteroides in the gut has been associated with amino acid fermentation and degradation of complex polysaccharides. Its presence in the gut is enhanced by diets rich in animal-derived products as found in the typical western diet [David, L. A. et al, Nature (2013) doi:10.1038/nature12820].
- the highly selective BBE agar had a limit of detection of ⁇ 2 ⁇ 10 3 cfu/g, while the limit of detection for Bacteroides on PFA agar was approximately 2 ⁇ 10 7 cfu/g due to the growth of multiple non- Bacteroides species in the pretreatment sample on that medium. Colony counts of Bacteroides species on Day 25 were up to 2 ⁇ 10 10 cfu/g, consistent with the 16S-V4 sequencing, demonstrating a profound reconstitution of the gut microbiota in Patient 1 (Table 15 below).
- FIG. 15 shows species engrafting versus species augmenting in patients microbiomes after treatment with a bacterial composition such as but not limited to an ethanol-treated spore population. Relative abundance of species that engrafted or augmented as described were determined based on the number of 16S sequence reads. Each plot is from a different patient treated with the bacterial composition such as but not limited to an ethanol-treated spore population for recurrent C. difficile.
- the impact of the bacterial composition such as but not limited to an ethanol treated spore population treatment on carriage of imipenem resistant Enterobacteriaceae was assessed by plating pretreatment and Day 28 clinical samples from Patients 2, 4 and 5 on MacConkey lactose plus 1 ug/mL of imipenem. Resistant organisms were scored by morphology, enumerated and DNA was submitted for full length 16S rDNA sequencing as described above. Isolates were identified as Morganella morganii, Providencia rettgeri and Proteus pennerii .
- bacterial composition such as but not limited to an ethanol treated spore preparation resulted in greater than 100-fold reduction in 4 of 5 cases of Enterobacteriaceae carriage with multiple imipenem resistant organisms (See Table 17 which shows titers (in cfu/g) of imipenem-resistant M. morganii, P. rettgeri and P. pennerii from Patients 2, 4 & 5).
- the bacterial composition such as but not limited to, an ethanol treated spores administered to Patient 4 caused the clearance of 2 imipenem resistant organisms (Table 12). While this example specifically uses a spore preparation, the methods herein describe how one skilled in the art would use a more general bacterial composition to achieve the same effects. The specific example should not be viewed as a limitation of the scope of this disclosure.
- Example 6 Ten different bacterial compositions were made by the ethanol treated spore preparation methods from 6 different donors (as described in Example 6). The spore preparations were used to treat 10 patients, each suffering from recurrent C. difficile infection. Patients were identified using the inclusion/exclusion criteria described in Example 9, and donors were identified using the criteria described in Example 10. None of the patients experienced a relapse of C. difficile in the 4 weeks of follow up after treatment, whereas the literature would predict that 70-80% of subjects would experience a relapse following cessation of antibiotic [Van Nood, et al, NEJM (2013)]. Thus, the ethanol treated spore preparations derived from multiple different donors and donations showed remarkable clinical efficacy. These ethanol treated spore preparations are a subset of the bacterial compositions described herein and the results should not be viewed as a limitation on the scope of the broader set of bacterial compositions.
- the OTU composition of the spore preparation was determined by 16S-V4 rDNA sequencing and computational assignment of OTUs per Example 2.
- a requirement to detect at least ten sequence reads in the ethanol treated spore preparation was set as a conservative threshold to define only OTUs that were highly unlikely to arise from errors during amplification or sequencing.
- Methods routinely employed by those familiar to the art of genomic-based microbiome characterization use a read relative abundance threshold of 0.005% (see e.g. Bokulich, A. et al. 2013. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing.
- OTU OTU
- Engraftment is important for two reasons. First, engraftment is a sine qua non of the mechanism to reshape the microbiome and eliminate C. difficile colonization. OTUs that engraft with higher frequency are highly likely to be a component of the Core Ecology of the spore preparation or broadly speaking a set bacterial composition. Second, OTUs detected by sequencing a bacterial composition (as in Table 18 may include non-viable cells or other contaminant DNA molecules not associated with the composition.
- OTUs that represent non-viable cells or contaminating sequences eliminates OTUs that represent non-viable cells or contaminating sequences.
- Table 18 also identifies all OTUs detected in the bacterial composition that also were shown to engraft in at least one patient post-treatment. OTUs that are present in a large percentage of the bacterial composition e.g. ethanol spore preparations analyzed and that engraft in a large number of patients represent a subset of the Core Ecology that are highly likely to catalyze the shift from a dysbiotic disease ecology to a healthy microbiome.
- a third lens was applied to further refine insights into the Core Ecology of the bacterial composition e.g. spore preparation.
- Computational-based, network analysis has enabled the description of microbial ecologies that are present in the microbiota of a broad population of healthy individuals. These network ecologies are comprised of multiple OTUs, some of which are defined as Keystone OTUs. Keystone OTUs are computationally defined as described in Example 24. Keystone OTUs form a foundation to the microbially ecologies in that they are found and as such are central to the function of network ecologies in healthy subjects. Keystone OTUs associated with microbial ecologies associated with healthy subjects are often are missing or exist at reduced levels in subjects with disease. Keystone OTUs may exist in low, moderate, or high abundance in subjects. Table 18 further notes which of the OTUs in the bacterial composition e.g. spore preparation are Keystone OTUs exclusively associated with individuals that are healthy and do not harbor disease.
- Lutispora thermophila a spore former found in all ten spore preparations, did not engraft in any of the patients.
- Bilophila wadsworthia a gram negative anaerobe, is present in 9 of 10 donations, yet it does not engraft in any patient, indicating that it is likely a non-viable contaminant in the ethanol treated spore preparation.
- CES Core Ecology Score
- the CES has a maximum possible score of 5 and a minimum possible score of 0.8.
- Table 19 ranks the top 20 OTUs by CES with the further requirement that an OTU must be shown to engraft to be a considered an element of a core ecology.
- This redundancy makes it highly likely that subsets of the Core Ecology describe therapeutically beneficial components of the bacterial composition such as but not limited to an ethanol treated spore preparation and that such subsets may themselves be useful compositions for populating the GI tract and for the treatment of C. difficile infection given the ecologies functional characteristics.
- individual OTUs can be prioritized for evaluation as an efficacious subset of the Core Ecology.
- Another aspect of functional redundancy is that evolutionarily related organisms (i.e. those close to one another on the phylogenetic tree, e.g. those grouped into a single clade) will also be effective substitutes in the Core Ecology or a subset thereof for treating C. difficile.
- OTU subsets for testing in vitro (e.g. see Example 28 below) or in vivo (e.g. see Examples 7 or 8) is straightforward. Subsets may be selected by picking any 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 OTUs from Table 18, with a particular emphasis on those with higher CES, such as the OTUs described Table 19. In addition, using the clade relationships defined in Example 2 and Table 1 above, related OTUs can be selected as substitutes for OTUs with acceptable CES values. These organisms can be cultured anaerobically in vitro using the appropriate media (selected from those described in Example 5 above), and then combined in a desired ratio. A typical experiment in the mouse C.
- each strain be provided in a minimum amount so that the strain's contribution to the efficacy of the Core Ecology subset can be measured.
- Table 18 describes the clades for each OTU detected in a spore preparation and Table 1 describes the OTUs that can be used for substitutions based on clade relationships.
- mice Two cages of five mice each were tested for each arm of the experiment. All mice received an antibiotic cocktail consisting of 10% glucose, kanamycin (0.5 mg/ml), gentamicin (0.044 mg/ml), colistin (1062.5 U/ml), metronidazole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), ampicillin (0.1 mg/ml) and Vancomycin (0.056 mg/ml) in their drinking water on days ⁇ 14 through ⁇ 5 and a dose of 10 mg/kg Clindamycin by oral gavage on day ⁇ 3. On day ⁇ 1, they received either the test articles or control articles via oral gavage. On day 0, they were challenged by administration of approximately 4.5 log 10 cfu of C.
- C. difficile (ATCC 43255) via oral gavage. Mortality was assessed every day from day 0 to day 6 and the weight and subsequent weight change of the animal was assessed with weight loss being associated with C. difficile infection. Mortality and reduced weight loss of the test article compared to the empty vehicle was used to assess the success of the test article. Additionally, a C. difficile symptom scoring was performed each day from day ⁇ 1 through day 6. Symptom scoring was based on Appearance (0-2 pts based on normal, hunched, piloerection, or lethargic), Respiration (0-2 pts based on normal, rapid or shallow, with abdominal breathing), Clinical Signs (0-2 points based on normal, wet tail, cold-to-the-touch, or isolation from other animals).
- the average minimum relative weight is calculated as the mean of each mouse's minimum weight relative to Day ⁇ 1 and the average maximum clinical score is calculated as the mean of each mouse's maximum combined clinical score with a score of 4 assigned in the case of death.
- the results are reported in Table 21 below (Results of bacterial compositions tested in a C. difficile mouse model).
- Example 29 Defining Subsets of the Core Ecology in the In Vitro C. Difficile Inhibition Assay
- Vials of ⁇ 80° C. glycerol stock banks were thawed and diluted to 1e8 CFU/mL. Selected strains and their clade assignment are given in Table 22. Each strain was then diluted 10 ⁇ (to a final concentration of 1e7 CFU/mL of each strain) into 200 uL of PBS+15% glycerol in the wells of a 96-well plate. Plates were then frozen at ⁇ 80° C. When needed for the assay, plates were removed from ⁇ 80° C. and thawed at room temperature under anaerobic conditions when testing in a in vitro C. difficile inhibition assay (CivSim).
- SweetB-FosIn is a complex media composed of brain heart infusion, yeast extract, cysteine, cellobiose, maltose, soluble starch, and fructooligosaccharides/inulin, and hem in, and is buffered with MOPs. After 24 hr of growth the culture is diluted 100,000 fold into a complex media such as SweetB-FosIn which is suitable for the growth of a wide variety of anaerobic bacterial species. The diluted C. difficile mixture is then aliquoted to wells of a 96-well plate (180 uL to each well).
- One example of a positive control that inhibits growth is a combination of Blautia producta, Clostridium bifermentans and Escherichia coli .
- One example of a control that shows reduced inhibition of C. difficile growth is a combination of Bacteroides thetaiotaomicron, Bacteroides ovatus and Bacteroides vulgatus. Plates are wrapped with parafilm and incubated for 24 hr at 37° C. under anaerobic conditions. After 24 hr the wells containing C. difficile alone are serially diluted and plated to determine titer. The 96-well plate is then frozen at ⁇ 80 C before quantifying C. difficile by qPCR assay.
- a standard curve is generated from a well on each assay plate containing only pathogenic C. difficile grown in SweetB+FosIn media and quantified by selective spot plating. Serial dilutions of the culture are performed in sterile phosphate-buffered saline. Genomic DNA is extracted from the standard curve samples along with the other wells.
- Genomic DNA is extracted from 5 ⁇ l of each sample using a dilution, freeze/thaw, and heat lysis protocol. 5 ⁇ L of thawed samples is added to 45 ⁇ L of UltraPure water (Life Technologies, Carlsbad, Calif.) and mixed by pipetting. The plates with diluted samples are frozen at ⁇ 20° C. until use for qPCR which includes a heated lysis step prior to amplification.
- genomic DNA is isolated using the Mo Bio Powersoil®-htp 96 Well Soil DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.), Mo Bio Powersoil® DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.), or the QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, Calif.) according to the manufacturer's instructions.
- the qPCR reaction mixture contains 1 ⁇ SsoAdvanced Universal Probes Supermix, 900 nM of Wr-tcdB-F primer (AGCAGTTGAATATAGTGGTTTAGTTAGAGTTG (SEQ ID NO: 2040), IDT, Coralville, Iowa), 900 nM of Wr-tcdB-R primer (CATGCTTTTTTAGTTTCTGGATTGAA (SEQ ID NO: 2041) IDT, Coralville, Iowa), 250 nM of Wr-tcdB-P probe (6FAM-CATCCAGTCTCAATTGTATATGTTTCTCCA-MGB (SEQ ID NO: 2042) Life Technologies, Grand Island, N.Y.), and Molecular Biology Grade Water (Mo Bio Laboratories, Carlsbad, Calif.) to 18 ⁇ l (Primers adapted from: Wroblewski, D.
- This reaction mixture is aliquoted to wells of a Hard-shell Low-Profile Thin Wall 96-well Skirted PCR Plate (BioRad, Hercules, Calif.). To this reaction mixture, 2 ⁇ l of diluted, frozen, and thawed samples are added and the plate sealed with a Microseal ‘B’ Adhesive Seal (BioRad, Hercules, Calif.).
- the qPCR is performed on a BioRad C1000TM Thermal Cycler equipped with a CFX96TM Real-Time System (BioRad, Hercules, Calif.).
- the thermocycling conditions are 95° C. for 15 minutes followed by 45 cycles of 95° C. for 5 seconds, 60° C. for 30 seconds, and fluorescent readings of the FAM channel.
- the qPCR is performed with other standard methods known to those skilled in the art.
- the Cq value for each well on the FAM channel is determined by the CFX ManagerTM 3.0 software.
- the log 10 (cfu/mL) of C. difficile each experimental sample is calculated by inputting a given sample's Cq value into a linear regression model generated from the standard curve comparing the Cq values of the standard curve wells to the known log 10 (cfu/mL) of those samples.
- the log inhibition is calculated for each sample by subtracting the log 10 (cfu/mL) of C. difficile in the sample from the log 10 (cfu/mL) of C. difficile in the sample on each assay plate used for the generation of the standard curve that has no additional bacteria added.
- the mean log inhibition is calculated for all replicates for each composition.
- a histogram of the range and standard deviation of each composition is plotted. Ranges or standard deviations of the log inhibitions that are distinct from the overall distribution are examined as possible outliers. If the removal of a single log inhibition datum from one of the binary pairs that is identified in the histograms would bring the range or standard deviation in line with those from the majority of the samples, that datum is removed as an outlier, and the mean log inhibition is recalculated.
- the pooled variance of all samples evaluated in the assay is estimated as the average of the sample variances weighted by the sample's degrees of freedom.
- the pooled standard error is then calculated as the square root of the pooled variance divided by the square root of the number of samples. Confidence intervals for the null hypothesis are determined by multiplying the pooled standard error to the z score corresponding to a given percentage threshold. Mean log inhibitions outside the confidence interval are considered to be inhibitory if positive or stimulatory if negative with the percent confidence corresponding to the interval used.
- Table 22 below shows OTUs and their clade assignments tested in ternary combinations with results in the in vitro inhibition assay
- the CivSim shows that many ternary combinations inhibit C. difficile. 39 of 56 combinations show inhibition with a confidence interval >80%; 36 of 56 with a C.I. >90%; 36 of 56 with a C.I. >95%; 29 of 56 with a C.I. of >99%.
- Non-limiting but exemplary ternary combinations include those with mean log reduction greater than 0.171, e.g. any combination shown in Table 22 with a score of ++++, such as Colinsella aerofaciens, Coprococcus comes , and Blautia producta .
- CivSim assay describes ternary combinations that do not effectively inhibit C. difficile. 5 of 56 combinations promote growth with >80% confidence; 2 of 56 promote growth with >90% confidence; 1 of 56, Coprococcus comes, Clostridium symbiosum and Eubacterium rectale, promote growth with >95% confidence. 12 of 56 combinations are neutral in the assay, meaning they neither promote nor inhibit C. difficile growth to the limit of measurement.
- An in vitro assay is performed to test the ability of a chosen species or combination of species to inhibit the growth of a pathogen such as Clostridium difficile in media that is otherwise suitable for growth of the pathogen.
- a liquid media suitable for growth of the pathogen is chosen, such as Brain Heart Infusion Broth (BHI) for C. difficile (see Example 5).
- BHI Brain Heart Infusion Broth
- the potential competitor species or a combination of competitor species are inoculated into 3 mL of the media and incubated anaerobically for 24 hr at 37° C. After incubation the cells are pelleted in a centrifuge at 10,000 rcf for 5 min. Supernatant is removed and filtered through a 0.22 ⁇ m filter to remove all cells. C.
- C. difficile or another pathogen of interest is then inoculated into the filtered spent supernatant and grown anaerobically at 37° C. for 24 hr.
- a control culture in fresh media is incubated in parallel.
- the titer of C. difficile is determined by serially diluting and plating to Brucella Blood Agar (BBA) plates and incubated anaerobically for 24 hr at 37° C. Colonies are counted to determine the final titer of the pathogen after incubation in competitor conditioned media and control media. The percent reduction in final titer is calculated and considered inhibitory if a statistically significant reduction in growth is measured. Alternatively, the inhibition of pathogen growth is monitored by OD 600 measurement of the test and control cultures.
- Example 30 Testing of Bacterial Composition Against Salmonella
- the in vitro assay is used to screen for combinations of bacteria inhibitory to the growth of Salmonella spp. by modifying the media used for growth of the pathogen inoculum.
- media such as Reinforced Clostridial Media (RCM), Brain Heart Infusion Broth (BHI) or Luria Bertani Broth (LB).
- Salmonella spp. are quantified by using alternative selective media specific for Salmonella spp. or using qPCR probes specific for the pathogen.
- MacConkey agar is used to select for Salmonella spp. and the invA gene is targeted with qPCR probes; this gene encodes an invasion protein carried by many pathogenic Salmonella spp. and is used in invading eukaryotic cells.
- Example 31 Method of Preparing the Bacterial Composition for Administration to a Patient
- Two strains for the bacterial composition are independently cultured and mixed together before administration. Both strains are independently be grown at 37° C., pH 7, in a GMM or other animal-products-free medium, pre-reduced with 1 g/L cysteine ⁇ HCl. After each strain reaches a sufficient biomass, it is preserved for banking by adding 15% glycerol and then frozen at ⁇ 80° C. in 1 ml cryotubes.
- Each strain is then be cultivated to a concentration of 10 10 CFU/mL, then concentrated 20-fold by tangential flow microfiltration; the spent medium is exchanged by diafiltering with a preservative medium consisting of 2% gelatin, 100 mM trehalose, and 10 mM sodium phosphate buffer, or other suitable preservative medium.
- the suspension is freeze-dried to a powder and titrated.
- the powder After drying, the powder is blended with microcrystalline cellulose and magnesium stearate and formulated into a 250 mg gelatin capsule containing 10 mg of lyophilized powder (10 8 to 10 11 bacteria), 160 mg microcrystalline cellulose, 77.5 mg gelatin, and 2.5 mg magnesium stearate.
- Example 32 Method of Treating a Subject with a Bacterial Composition
- a patient has suffered from recurrent bouts of C. difficile .
- the patient is treated with an antibiotic sufficient to ameliorate the symptoms of the illness.
- the patient is administered one of the present bacterial compositions.
- Bacillus circulans and Roseburia inulinivorans at a dose of 10 8 bacteria total in a lyophilized form, specifically in a 250 mg gelatin capsule containing 10 mg of lyophilized bacteria, 160 mg microcrystalline cellulose, 77.5 mg gelatin, and 2.5 mg magnesium stearate.
- the patient takes the capsule by mouth and resumes a normal diet after 4, 8, 12, or 24 hours.
- the patient may take the capsule by mouth before, during, or immediately after a meal.
- Feces is collected before and at 1 day, 3 days, 1 week, and 1 month after administration.
- the presence of C. difficile is found in the feces before administration of the bacterial composition, but feces collections after administration show reducing (such as at least 50% less, 60%, 70%, 80%, 90%, or 95%) to no detectable levels of C. difficile , as measured by qPCR, as described above.
- ELISA for toxin protein or traditional microbiological identification techniques may also be used.
- a positive response may be defined as absence of diarrhea, which itself is defined as 3 or more loose or watery stools per day for at least 2 consecutive days or 8 or more loose or watery stools in 48 hours, or persisting diarrhea (due to other causes) with repeating (three times) negative stool tests for toxins of C. difficile.
- Treatment failure is defined as persisting diarrhea with a positive C. difficile toxin stool test or no reduction in levels of C. difficile , as measured by qPCR sequencing. ELISA or traditional microbiological identification techniques may also be used.
- Example 33 Method of Treating a Subject with a Bacterial Composition
- a patient has suffered from recurrent bouts of C. difficile .
- the patient is treated with an antibiotic sufficient to ameliorate the symptoms of the illness.
- the patient is administered one of the present bacterial compositions.
- the patient is administered a bacterial composition containing two bacterial types from Table 1, at a dose of 10 8 bacteria total in a lyophilized form formulated in an enteric coated capsule.
- Example of the patient or samples derived from the patient is expected to demonstrate at least one measure of success as described herein (reducing levels of C. difficile as measured by qPCR, ELISA, or traditional microbiological identification; absence of diarrhea; persisting diarrhea with repeating (three times) negative stool tests for toxins of C. difficile.
- HGF5 1402 AEXS01000095 clade_270 Y N Paenibacillus sp. HGF7 1403 AFDH01000147 clade_270 Y N Eubacterium sp. oral clone JI012 868 AY349379 clade_298 Y N Alicyclobacillus contaminans 124 NR_041475 clade_301 Y N Alicyclobacillus herbarius 126 NR_024753 clade_301 Y N Alicyclobacillus pomorum 127 NR_024801 clade_301 Y N Blautia coccoides 373 AB571656 clade_309 Y N Blautia glucerasea 374 AB588023 clade_309 Y N Blautia glucerasei 375 AB439724 clade_309 Y N Blautia hansenii 376 ABYU02000037 clade_309
- HPB_46 629 AY862516 clade_430 Y N Clostridium tyrobutyricum 656 NR_044718 clade_430 Y N Sutterella parvirubra 1899 AB300989 clade_432 Y N Acetanaerobacterium elongatum 4 NR_042930 clade_439 Y N Clostridium cellulosi 567 NR_044624 clade_439 Y N Ethanoligenens harbinense 832 AY675965 clade_439 Y N Eubacterium rectale 856 FP929042 clade_444 Y N Eubacterium sp.
- NSP5 668 AB076850 clade_245 N N Delftia acidovorans 748 CP000884 clade_245 N N Xenophilus aerolatus 2018 JN585329 clade_245 N N Oribacterium sp. oral taxon 078 1380 ACIQ02000009 clade_246 N N Oribacterium sp.
- oral taxon 302 1550 ACZK01000043 clade_280 N N
- Prevotella sp. oral taxon F68 1556 HM099652 clade_280 N N
- KLDS 1.0719 1134 EU600923 clade_320 N N Lactobacillus buchneri 1073 ACGH01000101 clade_321 N N Lactobacillus genomosp. C1 1086 AY278619 clade_321 N N Lactobacillus genomosp.
- NS31_3 1422 JN029805 clade_420 N N
- 6_1_58FAA_CT1 1914 ACWX01000068 clade_420 N N Mycoplasma amphoriforme 1311 AY531656 clade_421 N N Mycoplasma genitalium 1317 L43967 clade_421 N N Mycoplasma pneumoniae 1322 NC_000912 clade_421 N N Mycoplasma penetrans 1321 NC_004432 clade_422 N N Ureaplasma parvum 1966 AE002127 clade_422 N N Ureaplasma urealyticum 1967 AAYN01000002 clade_422 N N Treponema genomosp.
- YIT 12072 1901 AB491210 clade_432 N N Sutterella stercoricanis 1902 NR_025600 clade_432 N N Sutterella wadsworthensis 1903 ADMF01000048 clade_432 N N Propionibacterium freudenreichii 1572 NR_036972 clade_433 N N Propionibacterium sp. oral taxon 192 1580 GQ422728 clade_433 N N Tessaracoccus sp. oral taxon F04 1917 HM099640 clade_433 N N Peptoniphilus ivorii 1445 Y07840 clade_434 N N Peptoniphilus sp.
- BBDP51 770 DQ337512 clade_462 N N Dietzia sp.
- CA149 771 GQ870422 clade_462 N N Dietzia timorensis 772
- GQ870424 clade_462 N N Gordonia bronchialis 951 NR_027594 clade_463 N N Gordonia polyisoprenivorans 952 DQ385609 clade_463 N N Gordonia sp.
- OB7196 140 AB425070 clade_475 N N Bifidobacterium urinalis 366 AJ278695 clade_475 N N Prevotella loescheii 1503 JN867231 clade_48 N N Prevotella sp. oral clone ASCG12 1530 DQ272511 clade_48 N N Prevotella sp. oral clone GU027 1540 AY349398 clade_48 N N Prevotella sp.
- BV2CASA2 813 JN809766 clade_497 N N Enterococcus sp. CCRI_16620 814 GU457263 clade_497 N N Enterococcus sp. F95 815 FJ463817 clade_497 N N Enterococcus sp. RfL6 816 AJ133478 clade_497 N N Enterococcus thailandicus 817 AY321376 clade_497 N N Fusobacterium canifelinum 893 AY162222 clade_497 N N Fusobacterium genomosp.
- type_1 1202 ADGP01000010 clade_506 N N Megasphaera sp.
- UPII 199_6 1205 AFIJ01000040 clade_506 N N Chromobacterium violaceum 513 NC_005085 clade_507 N N Laribacter hongkongensis 1148 CP001154 clade_507 N N Methylophilus sp.
- BS2 186 HQ616367 clade_539 N N Atopobium sp.
- F0209 187 EU592966 clade_539 N N Atopobium sp.
- ICM42b10 188 HQ616393 clade_539 N N Atopobium sp.
- ChDC B197 72 AF543275 clade_54 N N Actinomyces sp. GEJ15 73 GU561313 clade_54 N N Actinomyces sp. M2231_94_1 79 AJ234063 clade_54 N N Actinomyces sp. oral clone GU067 83 AY349362 clade_54 N N Actinomyces sp. oral clone IO077 85 AY349364 clade_54 N N Actinomyces sp. oral clone IP073 86 AY349365 clade_54 N N Actinomyces sp.
- NATTS 1738 AB505075 clade_566 N N Chlamydiales bacterium NS13 506 JN606075 clade_567 N N Victivallaceae bacterium NML 080035 2003 FJ394915 clade_567 N N Victivallis vadensis 2004 ABDE02000010 clade_567 N N Streptomyces griseus 1889 NR_074787 clade_573 N N Streptomyces sp. SD 511 1891 EU544231 clade_573 N N Streptomyces sp.
- OBRC6 1847 HQ616352 clade_60 N N Burkholderia ambifaria 442 AAUZ01000009 clade_61 N OP Burkholderia cenocepacia 443 AAHI01000060 clade_61 N OP Burkholderia cepacia 444 NR_041719 clade_61 N OP Burkholderia mallei 445 CP000547 clade_61 N Category-B Burkholderia multivorans 446 NC_010086 clade_61 N OP Burkholderia oklahomensis 447 DQ108388 clade_61 N OP Burkholderia pseudomallei 448 CP001408 clade_61 N Category-B Burkholderia rhizoxinica 449 HQ005410 clade_61 N OP Burkholderia sp.
- oral clone FW035 1536 AY349394 clade_62 N N Prevotella bivia 1486 ADFO01000096 clade_63 N N
- OTUs associated with engraftment and ecological augmentation and establishment of a more diverse microbial ecology in patients treated with an ethanol treated spore preparation are not present in the patient prior to treatment and/or exist at extremely low frequencies such that they do not comprise a significant fraction of the total microbial carriage and are not detectable by genomic and/or microbiological assay methods.
- OTUs that are members of the engrafting and augmented ecologies were identified by characterizing the OTUs that increase in their relative abundance post treatment and that respectively are: (i) present in the ethanol treated spore preparation and absent in the patient pretreatment, or (ii) absent in the ethanol treated spore preparation, but increase in their relative abundance through time post treatment with the preparation due to the formation of favorable growth conditions by the treatment.
- the latter OTUs can grow from low frequency reservoirs in the patient, or be introduced from exogenous sources such as diet.
- OTUs that comprise a “core” augmented or engrafted ecology can be defined by the percentage of total patients in which they are observed to engraft and/or augment; the greater this percentage the more likely they are to be part of a core ecology responsible for catalyzing a shift away from a dysbiotic ecology.
- the dominant OTUs in an ecology can be identified using several methods including but not limited to defining the OTUs that have the greatest relative abundance in either the augmented or engrafted ecologies and defining a total relative abundance threshold.
- the dominant OTUs in the augmented ecology of Patient-1 were identified by defining the OTUs with the greatest relative abundance, which together comprise 60% of the microbial carriage in this patient's augmented ecology.
- ACB7 clade90 N Prevotella salivae clade104 N Bacteroides intestinalis clade171 N Y Bifidobacterium dentium clade172 N Alcaligenes faecalis clade183 N Rothia dentocariosa clade194 N Peptoniphilus lacrimalis clade291 N Anaerococcus sp. gpac155 clade294 N Sutterella stercoricanis clade302 N Y Bacteroides sp.
- HGF2 clade351 Y Clostridium bartlettii clade354 Y Clostridium bifermentans clade354 Y Clostridium glycolicum clade354 Y Eubacterium um clade354 Y Dorea formicigenerans clade360 Y Dorea longicatena clade360 Y Lachnospiraceae bacterium clade360 Y 2_1_46FAA Lachnospiraceae bacterium clade360 Y Y 9_1_43BFAA Ruminococcus gnavus clade360 Y Clostridium hathewayi clade362 Y Blautia hydrogenotrophica clade368 Y Clostridiaceae bacterium clade368 Y END-2 Roseburia faecis clade369 Y Roseburia hominis clade370 Y Roseburia intestinalis clade370 Y Eubacterium s
- OTUs detected by a minimum of ten 16S-V4 sequence reads in at least a one ethanol treated spore preparation (pan-microbiome).
- Starred OTUs occur in ⁇ 80% of the ethanol preps and engraft in ⁇ 50% of the treated patients.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Mycology (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Physiology (AREA)
- Nutrition Science (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Developmental Biology & Embryology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Coloring Foods And Improving Nutritive Qualities (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/765,810 US10064900B2 (en) | 2013-02-04 | 2014-02-04 | Methods of populating a gastrointestinal tract |
Applications Claiming Priority (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361760584P | 2013-02-04 | 2013-02-04 | |
| US201361760606P | 2013-02-04 | 2013-02-04 | |
| US201361760585P | 2013-02-04 | 2013-02-04 | |
| US201361760574P | 2013-02-04 | 2013-02-04 | |
| US201461926918P | 2014-01-13 | 2014-01-13 | |
| PCT/US2014/014738 WO2014121298A2 (en) | 2013-02-04 | 2014-02-04 | Methods of populating a gastrointestinal tract |
| US14/765,810 US10064900B2 (en) | 2013-02-04 | 2014-02-04 | Methods of populating a gastrointestinal tract |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/014738 A-371-Of-International WO2014121298A2 (en) | 2013-02-04 | 2014-02-04 | Methods of populating a gastrointestinal tract |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/051,747 Division US20190192581A1 (en) | 2013-02-04 | 2018-08-01 | Methods of Populating a Gastrointestinal Tract |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| US20160158294A1 US20160158294A1 (en) | 2016-06-09 |
| US10064900B2 true US10064900B2 (en) | 2018-09-04 |
Family
ID=51263061
Family Applications (14)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/765,810 Active US10064900B2 (en) | 2013-02-04 | 2014-02-04 | Methods of populating a gastrointestinal tract |
| US14/765,814 Active 2034-12-25 US11185562B2 (en) | 2013-02-04 | 2014-02-04 | Compositions and methods for inhibition of pathogenic bacterial growth |
| US14/197,044 Active US9011834B1 (en) | 2013-02-04 | 2014-03-04 | Compositions and methods |
| US14/313,828 Active US9180147B2 (en) | 2013-02-04 | 2014-06-24 | Compositions and methods |
| US14/884,655 Active US9585921B2 (en) | 2013-02-04 | 2015-10-15 | Compositions and methods |
| US15/068,438 Active US9446080B2 (en) | 2013-02-04 | 2016-03-11 | Compositions and methods |
| US15/415,745 Active US9855303B2 (en) | 2013-02-04 | 2017-01-25 | Compositions and methods |
| US15/847,623 Active US10064901B2 (en) | 2013-02-04 | 2017-12-19 | Compositions and methods |
| US16/051,747 Abandoned US20190192581A1 (en) | 2013-02-04 | 2018-08-01 | Methods of Populating a Gastrointestinal Tract |
| US16/054,864 Active US10967011B2 (en) | 2013-02-04 | 2018-08-03 | Compositions and methods |
| US17/222,778 Active 2034-05-18 US11730775B2 (en) | 2013-02-04 | 2021-04-05 | Methods for treatment of Clostridium difficile infection or recurrence or symptoms thereof |
| US17/534,361 Abandoned US20220249578A1 (en) | 2013-02-04 | 2021-11-23 | Compositions and methods for inhibition of pathogenic bacterial growth |
| US18/350,081 Active US12605415B2 (en) | 2013-02-04 | 2023-07-11 | Compositions and methods |
| US18/431,885 Abandoned US20250000915A1 (en) | 2013-02-04 | 2024-02-02 | Methods of populating a gastrointestinal tract |
Family Applications After (13)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/765,814 Active 2034-12-25 US11185562B2 (en) | 2013-02-04 | 2014-02-04 | Compositions and methods for inhibition of pathogenic bacterial growth |
| US14/197,044 Active US9011834B1 (en) | 2013-02-04 | 2014-03-04 | Compositions and methods |
| US14/313,828 Active US9180147B2 (en) | 2013-02-04 | 2014-06-24 | Compositions and methods |
| US14/884,655 Active US9585921B2 (en) | 2013-02-04 | 2015-10-15 | Compositions and methods |
| US15/068,438 Active US9446080B2 (en) | 2013-02-04 | 2016-03-11 | Compositions and methods |
| US15/415,745 Active US9855303B2 (en) | 2013-02-04 | 2017-01-25 | Compositions and methods |
| US15/847,623 Active US10064901B2 (en) | 2013-02-04 | 2017-12-19 | Compositions and methods |
| US16/051,747 Abandoned US20190192581A1 (en) | 2013-02-04 | 2018-08-01 | Methods of Populating a Gastrointestinal Tract |
| US16/054,864 Active US10967011B2 (en) | 2013-02-04 | 2018-08-03 | Compositions and methods |
| US17/222,778 Active 2034-05-18 US11730775B2 (en) | 2013-02-04 | 2021-04-05 | Methods for treatment of Clostridium difficile infection or recurrence or symptoms thereof |
| US17/534,361 Abandoned US20220249578A1 (en) | 2013-02-04 | 2021-11-23 | Compositions and methods for inhibition of pathogenic bacterial growth |
| US18/350,081 Active US12605415B2 (en) | 2013-02-04 | 2023-07-11 | Compositions and methods |
| US18/431,885 Abandoned US20250000915A1 (en) | 2013-02-04 | 2024-02-02 | Methods of populating a gastrointestinal tract |
Country Status (13)
| Country | Link |
|---|---|
| US (14) | US10064900B2 (cg-RX-API-DMAC7.html) |
| EP (5) | EP2951285A4 (cg-RX-API-DMAC7.html) |
| JP (6) | JP2016509003A (cg-RX-API-DMAC7.html) |
| KR (3) | KR102553134B1 (cg-RX-API-DMAC7.html) |
| CN (2) | CN110917220A (cg-RX-API-DMAC7.html) |
| AU (7) | AU2014212004B2 (cg-RX-API-DMAC7.html) |
| BR (2) | BR122021010444B1 (cg-RX-API-DMAC7.html) |
| CA (3) | CA2899925A1 (cg-RX-API-DMAC7.html) |
| HK (3) | HK1218837A1 (cg-RX-API-DMAC7.html) |
| MX (2) | MX369877B (cg-RX-API-DMAC7.html) |
| NZ (1) | NZ711771A (cg-RX-API-DMAC7.html) |
| RU (1) | RU2664479C2 (cg-RX-API-DMAC7.html) |
| WO (3) | WO2014121298A2 (cg-RX-API-DMAC7.html) |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10555978B2 (en) | 2010-06-04 | 2020-02-11 | The University Of Tokyo | Composition for inducing proliferation or accumulation of regulatory T cells |
| US10624933B2 (en) * | 2011-12-01 | 2020-04-21 | The University Of Tokyo | Human-derived bacteria that induce proliferation or accumulation of regulatory T cells |
| US20220000943A1 (en) * | 2018-10-08 | 2022-01-06 | Ajou University Industry-Academic Cooperation Foundation | Composition comprising tetragenococcus halophilus for prevetion or treatment of behcet's disease or herpes simplex virus infection |
| WO2022036225A1 (en) | 2020-08-14 | 2022-02-17 | Prolacta Bioscience, Inc. | Human milk oligosaccharide compositions for use with bacteriotherapies |
| US11376285B2 (en) * | 2020-05-19 | 2022-07-05 | Microbiotica Limited | Bacterial biomarker |
| US20220256823A1 (en) * | 2019-09-12 | 2022-08-18 | MarvelBiome, Inc. | Compositions and methods for characterizing a microbiome |
| US20220265754A1 (en) * | 2021-02-19 | 2022-08-25 | Multistars Biotechnology Company Limited | Method of improving diseases using traditional chinese medicine polysaccharides and bacterial composition thereof |
| US11458174B2 (en) | 2012-11-23 | 2022-10-04 | Seres Therapeutics, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| US11666612B2 (en) | 2013-03-15 | 2023-06-06 | Seres Therapeutics, Inc | Network-based microbial compositions and methods |
| US20230172996A1 (en) * | 2020-02-21 | 2023-06-08 | Yoshikazu NAKAOKA | Composition for alleviating pulmonary hypertension, method for predicting prognosis of pulmonary hypertension, method for assisting in determining severity of pulmonary hypertension, and method for assisting in diagnosing pulmonary hypertension |
| US11701394B2 (en) | 2017-08-14 | 2023-07-18 | Seres Therapeutics, Inc. | Compositions and methods for treating cholestatic disease |
| US11786562B2 (en) * | 2016-04-19 | 2023-10-17 | Genome Research Limited | Bacteriotherapy |
| US12083151B2 (en) | 2012-11-23 | 2024-09-10 | Seres Therapeutics, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| US12214002B2 (en) | 2017-10-30 | 2025-02-04 | Seres Therapeutics, Inc. | Compositions and methods for treating antibiotic resistance |
| US12364721B2 (en) | 2019-09-24 | 2025-07-22 | Prolacta Bioscience, Inc. | Compositions and methods for treatment of inflammatory and immune diseases |
Families Citing this family (345)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AUPQ899700A0 (en) | 2000-07-25 | 2000-08-17 | Borody, Thomas Julius | Probiotic recolonisation therapy |
| US9457077B2 (en) | 2009-11-18 | 2016-10-04 | Katherine Rose Kovarik | Method and system for targeting the microbiome to promote health and treat allergic and inflammatory diseases |
| US9585920B2 (en) | 2011-02-04 | 2017-03-07 | Katherine Rose Kovarik | Method and system for treating cancer cachexia |
| DK3564357T3 (da) | 2010-02-01 | 2022-06-20 | Rebiotix Inc | Bakterieterapi mod clostridium difficile colitis |
| EP3040425B1 (en) | 2010-02-17 | 2019-08-28 | Gen-Probe Incorporated | Compostions and methods to detect atopobium vaginae nucleic acid |
| EP3424515A3 (en) | 2010-08-04 | 2019-06-19 | Thomas Julius Borody | Stool collection devices and methods for using them |
| US10687975B2 (en) | 2011-02-04 | 2020-06-23 | Joseph E. Kovarik | Method and system to facilitate the growth of desired bacteria in a human's mouth |
| US10512661B2 (en) | 2011-02-04 | 2019-12-24 | Joseph E. Kovarik | Method and system for reducing the likelihood of developing liver cancer in an individual diagnosed with non-alcoholic fatty liver disease |
| US10245288B2 (en) | 2011-02-04 | 2019-04-02 | Joseph E. Kovarik | Method and system for reducing the likelihood of developing NASH in an individual diagnosed with non-alcoholic fatty liver disease |
| US9987224B2 (en) | 2011-02-04 | 2018-06-05 | Joseph E. Kovarik | Method and system for preventing migraine headaches, cluster headaches and dizziness |
| US11844720B2 (en) | 2011-02-04 | 2023-12-19 | Seed Health, Inc. | Method and system to reduce the likelihood of dental caries and halitosis |
| US11419903B2 (en) | 2015-11-30 | 2022-08-23 | Seed Health, Inc. | Method and system for reducing the likelihood of osteoporosis |
| US10086018B2 (en) | 2011-02-04 | 2018-10-02 | Joseph E. Kovarik | Method and system for reducing the likelihood of colorectal cancer in a human being |
| US11523934B2 (en) | 2011-02-04 | 2022-12-13 | Seed Health, Inc. | Method and system to facilitate the growth of desired bacteria in a human's mouth |
| US11998479B2 (en) | 2011-02-04 | 2024-06-04 | Seed Health, Inc. | Method and system for addressing adverse effects on the oral microbiome and restoring gingival health caused by sodium lauryl sulphate exposure |
| US9730967B2 (en) | 2011-02-04 | 2017-08-15 | Katherine Rose Kovarik | Method and system for treating cancer cachexia |
| US10314865B2 (en) | 2011-02-04 | 2019-06-11 | Katherine Rose Kovarik | Method and system for treating cancer and other age-related diseases by extending the healthspan of a human |
| US11951139B2 (en) | 2015-11-30 | 2024-04-09 | Seed Health, Inc. | Method and system for reducing the likelihood of osteoporosis |
| US11951140B2 (en) | 2011-02-04 | 2024-04-09 | Seed Health, Inc. | Modulation of an individual's gut microbiome to address osteoporosis and bone disease |
| US12279989B2 (en) | 2011-02-04 | 2025-04-22 | Seed Health, Inc. | Method and system for increasing beneficial bacteria and decreasing pathogenic bacteria in the oral cavity |
| US10085938B2 (en) | 2011-02-04 | 2018-10-02 | Joseph E. Kovarik | Method and system for preventing sore throat in humans |
| US12533312B2 (en) | 2011-02-04 | 2026-01-27 | Seed Health, Inc. | Method and system for preventing sore throat in humans |
| US12257272B2 (en) | 2015-12-24 | 2025-03-25 | Seed Health, Inc. | Method and system for reducing the likelihood of developing depression in an individual |
| US10583033B2 (en) | 2011-02-04 | 2020-03-10 | Katherine Rose Kovarik | Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being |
| US10111913B2 (en) | 2011-02-04 | 2018-10-30 | Joseph E. Kovarik | Method of reducing the likelihood of skin cancer in an individual human being |
| US10548761B2 (en) | 2011-02-04 | 2020-02-04 | Joseph E. Kovarik | Method and system for reducing the likelihood of colorectal cancer in a human being |
| US10835560B2 (en) | 2013-12-20 | 2020-11-17 | Joseph E. Kovarik | Reducing the likelihood of skin cancer in an individual human being |
| US10842834B2 (en) | 2016-01-06 | 2020-11-24 | Joseph E. Kovarik | Method and system for reducing the likelihood of developing liver cancer in an individual diagnosed with non-alcoholic fatty liver disease |
| US10940169B2 (en) | 2015-11-30 | 2021-03-09 | Joseph E. Kovarik | Method for reducing the likelihood of developing cancer in an individual human being |
| US11273187B2 (en) | 2015-11-30 | 2022-03-15 | Joseph E. Kovarik | Method and system for reducing the likelihood of developing depression in an individual |
| US10010568B2 (en) | 2011-02-04 | 2018-07-03 | Katherine Rose Kovarik | Method and system for reducing the likelihood of a spirochetes infection in a human being |
| US11357722B2 (en) | 2011-02-04 | 2022-06-14 | Seed Health, Inc. | Method and system for preventing sore throat in humans |
| US11191665B2 (en) | 2011-02-04 | 2021-12-07 | Joseph E. Kovarik | Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being |
| US9968638B2 (en) | 2011-03-09 | 2018-05-15 | Regents Of The University Of Minnesota | Compositions and methods for transplantation of colon microbiota |
| GB201112091D0 (en) | 2011-07-14 | 2011-08-31 | Gt Biolog Ltd | Bacterial strains isolated from pigs |
| GB201117313D0 (en) | 2011-10-07 | 2011-11-16 | Gt Biolog Ltd | Bacterium for use in medicine |
| EP2836224A4 (en) | 2012-02-29 | 2015-12-16 | Ethicon Endo Surgery Inc | COMPOSITIONS OF BIOZOOSE AND RELATED METHODS |
| EP2825676B1 (en) | 2012-03-17 | 2017-12-20 | The Regents of The University of California | Fast diagnosis and personalized treatments for acne |
| WO2013139861A1 (en) | 2012-03-20 | 2013-09-26 | Luc Montagnier | Methods and pharmaceutical compositions of the treatment of autistic syndrome disorders |
| CA3008794C (en) | 2012-03-29 | 2021-03-16 | Therabiome, Llc | Gastrointestinal site-specific oral vaccination formulations active on the ileum and appendix |
| US9719144B2 (en) | 2012-05-25 | 2017-08-01 | Arizona Board Of Regents | Microbiome markers and therapies for autism spectrum disorders |
| AU2012381990B2 (en) | 2012-06-04 | 2017-02-23 | Nutrien Ag Solutions (Canada) Inc. | Formulations containing paraffinic oil and anti-settling agent |
| WO2014036182A2 (en) | 2012-08-29 | 2014-03-06 | California Institute Of Technology | Diagnosis and treatment of autism spectrum disorder |
| JP2016509003A (ja) | 2013-02-04 | 2016-03-24 | セレス セラピューティクス インコーポレイテッド | 組成物および方法 |
| US10973861B2 (en) | 2013-02-04 | 2021-04-13 | Seres Therapeutics, Inc. | Compositions and methods |
| AU2014239883B2 (en) | 2013-03-14 | 2019-01-17 | Therabiome, Llc | Targeted gastrointestinal tract delivery of probiotic organisms and/or therapeutic agents |
| ES2664411T3 (es) | 2013-03-15 | 2018-04-19 | Suncor Energy Inc. | Composiciones herbicidas |
| GB201306536D0 (en) | 2013-04-10 | 2013-05-22 | Gt Biolog Ltd | Polypeptide and immune modulation |
| US9511100B2 (en) | 2013-06-05 | 2016-12-06 | Rebiotix, Inc. | Microbiota restoration therapy (MRT), compositions and methods of manufacture |
| US9511099B2 (en) | 2013-06-05 | 2016-12-06 | Rebiotix, Inc. | Microbiota restoration therapy (MRT), compositions and methods of manufacture |
| US9694039B2 (en) | 2013-06-05 | 2017-07-04 | Rebiotix, Inc. | Microbiota restoration therapy (MRT), compositions and methods of manufacture |
| US9782445B2 (en) | 2013-06-05 | 2017-10-10 | Rebiotix, Inc. | Microbiota restoration therapy (MRT), compositions and methods of manufacture |
| US10383901B2 (en) | 2013-06-05 | 2019-08-20 | Rebiotix, Inc. | Microbiota restoration therapy (MRT), compositions and methods of manufacture |
| KR102099503B1 (ko) | 2013-06-05 | 2020-04-09 | 리바이오틱스, 인코퍼레이티드 | 미생물상 복원 요법(mrt) 조성물 |
| US11274144B2 (en) | 2013-06-13 | 2022-03-15 | Research Institute At Nationwide Children's Hospital | Compositions and methods for the removal of biofilms |
| JP6637885B2 (ja) | 2013-07-21 | 2020-01-29 | ペンデュラム セラピューティクス, インコーポレイテッド | マイクロバイオームの特性解明、モニタリング、および処置のための方法およびシステム |
| CN105979952B (zh) | 2013-11-25 | 2022-04-08 | 赛里斯治疗公司 | 协同细菌组合物以及其制造方法和用途 |
| US9956282B2 (en) | 2013-12-16 | 2018-05-01 | Seres Therapeutics, Inc. | Bacterial compositions and methods of use thereof for treatment of immune system disorders |
| US11833177B2 (en) | 2013-12-20 | 2023-12-05 | Seed Health, Inc. | Probiotic to enhance an individual's skin microbiome |
| US11969445B2 (en) | 2013-12-20 | 2024-04-30 | Seed Health, Inc. | Probiotic composition and method for controlling excess weight, obesity, NAFLD and NASH |
| US11826388B2 (en) | 2013-12-20 | 2023-11-28 | Seed Health, Inc. | Topical application of Lactobacillus crispatus to ameliorate barrier damage and inflammation |
| US11529379B2 (en) | 2013-12-20 | 2022-12-20 | Seed Health, Inc. | Method and system for reducing the likelihood of developing colorectal cancer in an individual human being |
| US12246043B2 (en) | 2013-12-20 | 2025-03-11 | Seed Health, Inc. | Topical application to treat acne vulgaris |
| US11672835B2 (en) | 2013-12-20 | 2023-06-13 | Seed Health, Inc. | Method for treating individuals having cancer and who are receiving cancer immunotherapy |
| US11026982B2 (en) | 2015-11-30 | 2021-06-08 | Joseph E. Kovarik | Method for reducing the likelihood of developing bladder or colorectal cancer in an individual human being |
| US11213552B2 (en) | 2015-11-30 | 2022-01-04 | Joseph E. Kovarik | Method for treating an individual suffering from a chronic infectious disease and cancer |
| US11839632B2 (en) | 2013-12-20 | 2023-12-12 | Seed Health, Inc. | Topical application of CRISPR-modified bacteria to treat acne vulgaris |
| US12329783B2 (en) | 2013-12-20 | 2025-06-17 | Seed Health, Inc. | Method and system to improve the health of a person's skin microbiome |
| US12005085B2 (en) | 2013-12-20 | 2024-06-11 | Seed Health, Inc. | Probiotic method and composition for maintaining a healthy vaginal microbiome |
| US12318377B2 (en) | 2013-12-20 | 2025-06-03 | Seed Health, Inc. | Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being |
| US11998574B2 (en) | 2013-12-20 | 2024-06-04 | Seed Health, Inc. | Method and system for modulating an individual's skin microbiome |
| US11642382B2 (en) | 2013-12-20 | 2023-05-09 | Seed Health, Inc. | Method for treating an individual suffering from bladder cancer |
| US11980643B2 (en) | 2013-12-20 | 2024-05-14 | Seed Health, Inc. | Method and system to modify an individual's gut-brain axis to provide neurocognitive protection |
| US10624934B2 (en) | 2014-03-06 | 2020-04-21 | Research Institute At Nationwide Children's Hospital | Prebiotic formulations |
| JP6754694B2 (ja) * | 2014-03-06 | 2020-09-16 | リサーチ インスティチュート アット ネイションワイド チルドレンズ ホスピタル | プロバイオティクス製剤および使用のための方法 |
| US9783858B2 (en) * | 2014-04-02 | 2017-10-10 | Northwestern University | Altered microbiome of chronic pelvic pain |
| US10766799B2 (en) | 2014-05-23 | 2020-09-08 | Nch Corporation | Method for improving quality of aquaculture pond water using a nutrient germinant composition and spore incubation method |
| FI127671B (en) | 2014-05-28 | 2018-11-30 | Filip Scheperjans | Method for diagnostics of Parkinson’s disease |
| US20160016002A1 (en) * | 2014-07-17 | 2016-01-21 | John Todd Kuenstner | Treatment of Diseases Using Combination of Ultraviolet Blood Irradiation and Probiotics |
| SG11201700089QA (en) * | 2014-07-25 | 2017-02-27 | Biosynth Srl | Glycoconjugate vaccines comprising basic units of a molecular construct expressing built-in multiple epitopes for the formulation of a broad-spectrum vaccine against infections due to enteropathogenic bacteria |
| PT3194566T (pt) | 2014-08-04 | 2019-07-08 | Basf Se | Estirpes de paenibacillus antifúngicas, compostos tipo fusaridicina e seu uso |
| US10900043B2 (en) | 2014-09-02 | 2021-01-26 | Arizona Board Of Regents On Behalf Of The University Of Arizona | Compositions and methods for treating bacterial disease |
| US10286016B2 (en) | 2014-09-02 | 2019-05-14 | Arizona Board Of Regents On Behalf Of The University Of Arizona | Compositions and methods for treating gonorrhea |
| KR20170052626A (ko) | 2014-09-05 | 2017-05-12 | 심바이오믹스 세러퓨틱스 엘엘씨 | 세균질증 치료에 사용하기 위한 세크니다졸 |
| WO2016057671A1 (en) * | 2014-10-07 | 2016-04-14 | University Of Virginia Patent Foundation | Compositions and methods for preventing and treating infection |
| US9760676B2 (en) | 2014-10-21 | 2017-09-12 | uBiome, Inc. | Method and system for microbiome-derived diagnostics and therapeutics for endocrine system conditions |
| US9758839B2 (en) | 2014-10-21 | 2017-09-12 | uBiome, Inc. | Method and system for microbiome-derived diagnostics and therapeutics for conditions associated with microbiome functional features |
| US9754080B2 (en) | 2014-10-21 | 2017-09-05 | uBiome, Inc. | Method and system for microbiome-derived characterization, diagnostics and therapeutics for cardiovascular disease conditions |
| US10073952B2 (en) | 2014-10-21 | 2018-09-11 | uBiome, Inc. | Method and system for microbiome-derived diagnostics and therapeutics for autoimmune system conditions |
| US10409955B2 (en) | 2014-10-21 | 2019-09-10 | uBiome, Inc. | Method and system for microbiome-derived diagnostics and therapeutics for locomotor system conditions |
| US10325685B2 (en) | 2014-10-21 | 2019-06-18 | uBiome, Inc. | Method and system for characterizing diet-related conditions |
| US10410749B2 (en) | 2014-10-21 | 2019-09-10 | uBiome, Inc. | Method and system for microbiome-derived characterization, diagnostics and therapeutics for cutaneous conditions |
| US10169541B2 (en) | 2014-10-21 | 2019-01-01 | uBiome, Inc. | Method and systems for characterizing skin related conditions |
| WO2016065075A1 (en) | 2014-10-21 | 2016-04-28 | uBiome, Inc. | Method and system for microbiome-derived diagnostics and therapeutics |
| US10265009B2 (en) | 2014-10-21 | 2019-04-23 | uBiome, Inc. | Method and system for microbiome-derived diagnostics and therapeutics for conditions associated with microbiome taxonomic features |
| US10395777B2 (en) | 2014-10-21 | 2019-08-27 | uBiome, Inc. | Method and system for characterizing microorganism-associated sleep-related conditions |
| US10357157B2 (en) | 2014-10-21 | 2019-07-23 | uBiome, Inc. | Method and system for microbiome-derived characterization, diagnostics and therapeutics for conditions associated with functional features |
| US10793907B2 (en) | 2014-10-21 | 2020-10-06 | Psomagen, Inc. | Method and system for microbiome-derived diagnostics and therapeutics for endocrine system conditions |
| US10346592B2 (en) | 2014-10-21 | 2019-07-09 | uBiome, Inc. | Method and system for microbiome-derived diagnostics and therapeutics for neurological health issues |
| US10777320B2 (en) | 2014-10-21 | 2020-09-15 | Psomagen, Inc. | Method and system for microbiome-derived diagnostics and therapeutics for mental health associated conditions |
| US9710606B2 (en) | 2014-10-21 | 2017-07-18 | uBiome, Inc. | Method and system for microbiome-derived diagnostics and therapeutics for neurological health issues |
| US10311973B2 (en) | 2014-10-21 | 2019-06-04 | uBiome, Inc. | Method and system for microbiome-derived diagnostics and therapeutics for autoimmune system conditions |
| CA2966360C (en) | 2014-10-30 | 2023-09-05 | California Institute Of Technology | Compositions and methods comprising bacteria for improving behavior in neurodevelopmental disorders |
| WO2016069801A1 (en) * | 2014-10-30 | 2016-05-06 | California Institute Of Technology | Compositions and methods comprising bacteria for improving behavior in neurodecelopmental disorders |
| CA2964480A1 (en) | 2014-10-31 | 2016-05-06 | Whole Biome Inc. | Methods and compositions relating to microbial treatment and diagnosis of disorders |
| WO2016086161A1 (en) * | 2014-11-25 | 2016-06-02 | Memorial Sloan-Kettering Cancer Center | Intestinal microbiota and gvhd |
| MA41020A (fr) | 2014-11-25 | 2017-10-03 | Evelo Biosciences Inc | Compositions probiotiques et prébiotiques, et leurs procédés d'utilisation pour la modulation du microbiome |
| EP3400953A1 (en) | 2014-12-23 | 2018-11-14 | 4D Pharma Research Limited | Pirin polypeptide and immune modulation |
| AR103260A1 (es) | 2014-12-23 | 2017-04-26 | 4D Pharma Res Ltd | Modulación inmunitaria |
| EP3236993B1 (en) | 2014-12-23 | 2023-09-13 | Theriva Biologics, Inc. | Methods and compositions for inhibiting or preventing adverse effects of oral antibiotics |
| WO2016103005A1 (en) | 2014-12-23 | 2016-06-30 | Institut Pasteur | Method of culturing segmented filamentous bacteria in vitro |
| CA2973894A1 (en) * | 2015-02-06 | 2016-08-11 | Western University Of Health Sciences | Probiotic compositions and methods of use |
| EP3265119B1 (en) | 2015-03-06 | 2023-10-11 | Theriva Biologics, Inc. | Safe and effective beta-lactamase dosing for microbiome protection |
| CA2979086A1 (en) * | 2015-03-12 | 2016-09-15 | The University Of British Columbia | Bacterial compositions and methods of use thereof |
| HK1246599A1 (zh) * | 2015-03-16 | 2018-09-14 | Ecole polytechnique fédérale de Lausanne (EPFL) | 生物活性动物饲料中的古细菌,制造组合物的方法和使用该组合物的方法 |
| WO2016161412A2 (en) * | 2015-04-03 | 2016-10-06 | Quest Diagnostics Investments Incorporated | Assay for detection of pathogenic leptospira strains |
| US10246753B2 (en) | 2015-04-13 | 2019-04-02 | uBiome, Inc. | Method and system for characterizing mouth-associated conditions |
| EP3283086A4 (en) * | 2015-04-13 | 2019-04-24 | Ubiome Inc. | METHOD AND SYSTEM FOR MICROBIOMY-DERIVED DIAGNOSTICS AND THERAPEUTIC FOR DISEASES RELATED TO MICROBIOMIC FUNCTIONAL PROPERTIES |
| CN107708716B (zh) * | 2015-04-13 | 2022-12-06 | 普梭梅根公司 | 用于微生物组分类学特征相关的状况的微生物组来源的诊断和治疗的方法及系统 |
| AU2016250100A1 (en) * | 2015-04-13 | 2017-11-09 | Psomagen, Inc. | Method and system for microbiome-derived characterization, diagnostics and therapeutics for cutaneous conditions |
| EP3283087A4 (en) * | 2015-04-14 | 2019-03-13 | Ubiome Inc. | METHOD AND SYSTEM FOR MICROBIOMEDIVED DIAGNOSTICS AND THERAPEUTICS FOR DISEASES OF THE ENDOCRINE SYSTEM |
| FR3035328B1 (fr) | 2015-04-24 | 2019-08-23 | Maat Pharma | Procede de preparation d'un echantillon de microbiote fecal |
| US12050161B2 (en) | 2015-04-24 | 2024-07-30 | Maat Pharma | Microorganism sampling method, microorganism sampling device and sampling kit comprising such a sampling device |
| FR3035317B1 (fr) | 2015-04-24 | 2019-06-14 | Maat Pharma | Dispositif de prelevement de micro-organismes, kit de prelevement comprenant un tel dispositif et procede de prelevement mettant en œuvre un tel dispositif |
| BR112017024264B1 (pt) * | 2015-05-14 | 2022-07-12 | Crestovo Holdings Llc | Composições para transplante de flora fecal e métodos de preparação e utilização das mesmas, e dispositivos para sua administração |
| KR102534545B1 (ko) * | 2015-05-22 | 2023-05-18 | 아리조나 보드 오브 리젠츠 온 비하프 오브 아리조나 스테이트 유니버시티 | 자폐 스펙트럼 장애 및 관련된 증상을 치료하는 방법 |
| US11253501B2 (en) | 2015-06-01 | 2022-02-22 | Lupin Inc. | Secnidazole formulations and use in treating bacterial vaginosis |
| CN105067731B (zh) * | 2015-06-05 | 2017-06-16 | 中国农业科学院兰州兽医研究所 | 一种弓形虫感染后血清中生物标记物的筛选方法及筛选出的生物标记物的应用 |
| US10828340B2 (en) | 2015-06-09 | 2020-11-10 | Rebiotix, Inc. | Microbiota restoration therapy (MRT) compositions and methods of manufacture |
| US10905726B2 (en) | 2015-06-09 | 2021-02-02 | Rebiotix, Inc. | Microbiota restoration therapy (MRT) compositions and methods of manufacture |
| US10799539B2 (en) | 2015-06-09 | 2020-10-13 | Rebiotix, Inc. | Microbiota restoration therapy (MRT) compositions and methods of manufacture |
| ES2889902T3 (es) * | 2015-06-09 | 2022-01-14 | Rebiotix Inc | Métodos de fabricación de composiciones para terapia de restauración de la microbiota (TRM) |
| MA41010B1 (fr) | 2015-06-15 | 2020-01-31 | 4D Pharma Res Ltd | Compositions comprenant des souches bactériennes |
| MA41060B1 (fr) | 2015-06-15 | 2019-11-29 | 4D Pharma Res Ltd | Compositions comprenant des souches bactériennes |
| NZ737752A (en) | 2015-06-15 | 2022-02-25 | 4D Pharma Res Ltd | Compositions comprising bacterial strains |
| SMT201900588T1 (it) | 2015-06-15 | 2019-11-13 | 4D Pharma Res Limited | Blautia stercoris e wexlerae per uso nel trattamento di malattie infiammatorie ed autoimmuni |
| WO2016203221A1 (en) | 2015-06-15 | 2016-12-22 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| PY1639434A (es) | 2015-06-25 | 2018-08-01 | Ascus Biosciences Inc | Procedimientos, aparatos y sistemas para el analisis de cepas de microorganismos provinientes de comunidades complejas y heterogenas. prediccion e identificacion de relaciones..//. |
| US9938558B2 (en) | 2015-06-25 | 2018-04-10 | Ascus Biosciences, Inc. | Methods, apparatuses, and systems for analyzing microorganism strains from complex heterogeneous communities, predicting and identifying functional relationships and interactions thereof, and selecting and synthesizing microbial ensembles based thereon |
| US10632157B2 (en) | 2016-04-15 | 2020-04-28 | Ascus Biosciences, Inc. | Microbial compositions and methods of use for improving fowl production |
| US10851399B2 (en) | 2015-06-25 | 2020-12-01 | Native Microbials, Inc. | Methods, apparatuses, and systems for microorganism strain analysis of complex heterogeneous communities, predicting and identifying functional relationships and interactions thereof, and selecting and synthesizing microbial ensembles based thereon |
| EP3319619A4 (en) * | 2015-07-08 | 2019-01-02 | Seres Therapeutics, Inc. | Methods of treating colitis |
| WO2017023863A1 (en) | 2015-07-31 | 2017-02-09 | Research Institute At Nationwide Children's Hospital | Peptides and antibodies for the removal of biofilms |
| EP3341000A4 (en) * | 2015-08-24 | 2019-02-20 | Nubyiota LLC | SYSTEMS AND METHOD FOR TREATING DYSBIOSIS WITH BACTERIAL POPULATIONS FROM FECALIA |
| AU2016318112B2 (en) | 2015-09-04 | 2021-11-04 | Memorial Sloan-Kettering Cancer Center | Methods and compositions for detecting risk of cancer relapse |
| WO2017044885A1 (en) * | 2015-09-09 | 2017-03-16 | uBiome, Inc. | Method and system for microbiome-derived diagnostics and therapeutics for conditions associated with cerebro-craniofacial health |
| WO2017053544A1 (en) * | 2015-09-22 | 2017-03-30 | Mayo Foundation For Medical Education And Research | Methods and materials for using biomarkers which predict susceptibility to clostridium difficile infection |
| AU2016327450B2 (en) | 2015-09-24 | 2022-01-27 | Agriculture Victoria Services Pty Ltd | Brachiaria endophytes and related methods |
| CN108235682A (zh) | 2015-09-29 | 2018-06-29 | 金伯利-克拉克环球有限公司 | 用于维护微生物群落的健康平衡的协同组合物 |
| EP3365027B1 (en) | 2015-10-14 | 2022-03-30 | Research Institute at Nationwide Children's Hospital | Hu specific antibodies and their use in inhibiting biofilm |
| CN115252650A (zh) * | 2015-11-03 | 2022-11-01 | 布里格姆及妇女医院股份有限公司 | 用于治疗和/或预防食物变态反应的治疗性微生物群 |
| CN108513545B (zh) | 2015-11-20 | 2020-11-03 | 4D制药研究有限公司 | 包含细菌菌株的组合物 |
| GB201520497D0 (en) | 2015-11-20 | 2016-01-06 | 4D Pharma Res Ltd | Compositions comprising bacterial strains |
| GB201520631D0 (en) | 2015-11-23 | 2016-01-06 | 4D Pharma Res Ltd | Compositions comprising bacterial strains |
| GB201520638D0 (en) | 2015-11-23 | 2016-01-06 | 4D Pharma Res Ltd | Compositions comprising bacterial strains |
| PL3380108T3 (pl) * | 2015-11-24 | 2023-03-27 | Seres Therapeutics, Inc. | Zaprojektowane kompozycje bakteryjne |
| US10086024B2 (en) | 2015-11-30 | 2018-10-02 | Joseph E. Kovarik | Method and system for protecting honey bees, bats and butterflies from neonicotinoid pesticides |
| US10568916B2 (en) | 2015-11-30 | 2020-02-25 | Joseph E. Kovarik | Method and system for protecting honey bees, bats and butterflies from neonicotinoid pesticides |
| US10675347B2 (en) | 2015-11-30 | 2020-06-09 | Joseph E. Kovarik | Method and system for protecting honey bees from fipronil pesticides |
| US12239706B2 (en) | 2015-11-30 | 2025-03-04 | Seed Health, Inc. | Method and system for protecting monarch butterflies from pesticides |
| US10933128B2 (en) | 2015-11-30 | 2021-03-02 | Joseph E. Kovarik | Method and system for protecting honey bees from pesticides |
| US11529412B2 (en) | 2015-11-30 | 2022-12-20 | Seed Health, Inc. | Method and system for protecting honey bees from pesticides |
| WO2017100420A1 (en) * | 2015-12-08 | 2017-06-15 | Mayo Foundation For Medical Education And Research | Biomarkers for predicting clostridium difficile infection treatment outcome |
| FR3045383B1 (fr) | 2015-12-18 | 2019-06-14 | Maat Pharma | Procede de lyophilisation d'un echantillon de microbiote fecal |
| MX392304B (es) | 2016-01-07 | 2025-03-24 | Native Microbials Inc | Métodos para mejorar la producción de leche mediante la administración de consorcios microbianos. |
| CN106974940B (zh) * | 2016-01-15 | 2020-08-25 | 深圳华大生命科学研究院 | 厚壁菌类益生菌在治疗和预防肥胖及其相关疾病中的应用 |
| IL243707A0 (en) | 2016-01-20 | 2016-05-01 | Galmed Res And Dev Ltd | Treatment to regulate the microbiota in the intestine |
| EP3639834B1 (en) * | 2016-02-04 | 2023-07-12 | Universiteit Gent | Use of microbial communities for human and animal health |
| WO2017137834A1 (en) * | 2016-02-08 | 2017-08-17 | University Of Oslo | Bacterial growth media |
| EP3205209A1 (en) | 2016-02-09 | 2017-08-16 | Basf Se | Mixtures and compositions comprising paenibacillus strains or metabolites thereof and other biopesticides |
| CN115887508A (zh) | 2016-03-04 | 2023-04-04 | 加利福尼亚大学董事会 | 微生物聚生体及其用途 |
| ME03487B (me) | 2016-03-04 | 2020-01-20 | 4D Pharma Plc | Kompozicije koje sadrže blautia bakterijske sojeve za liječenje visceralne hipersenzitivnosti |
| GB201612191D0 (en) | 2016-07-13 | 2016-08-24 | 4D Pharma Plc | Compositions comprising bacterial strains |
| EP3429604A1 (en) | 2016-03-14 | 2019-01-23 | Holobiome, Inc. | Modulation of the gut microbiome to treat mental disorders or diseases of the central nervous system |
| WO2017165729A1 (en) * | 2016-03-24 | 2017-09-28 | Paratek Pharmaceuticals, Inc. | Methods for treating and preventing c. difficile infection |
| US12097226B2 (en) | 2016-04-05 | 2024-09-24 | Nch Corporation | System and method for using a single-serve nutrient spore composition for small scale farm applications |
| US10897922B2 (en) | 2016-04-05 | 2021-01-26 | Nch Corporation | Composition and method for germinative compounds in probiotic food and beverage products for human consumption |
| CA3019732A1 (en) | 2016-04-05 | 2017-10-12 | Nch Corporation | Nutrient rich germinant composition and spore incubation method |
| MX391417B (es) | 2016-04-15 | 2025-03-21 | Native Microbials Inc | Métodos para mejorar la producción agrícola de aves de corral mediante la administración de consorcios microbianos o cepas purificadas de los mismos. |
| US9889165B2 (en) | 2016-04-21 | 2018-02-13 | Naked Biome, Inc. | Compositions and methods for treatment of skin disorders |
| US10252145B2 (en) | 2016-05-02 | 2019-04-09 | Bao Tran | Smart device |
| CN121534089A (zh) | 2016-05-23 | 2026-02-17 | 加州理工学院 | 调节肠微生物群来治疗神经退行性病症 |
| WO2017210428A1 (en) * | 2016-06-01 | 2017-12-07 | Crestovo Llc | Compositions and methods for treating inflammatory bowel diseases (ibds) and other disorders |
| CA3226196A1 (en) * | 2016-06-14 | 2017-12-21 | Vedanta Biosciences, Inc. | Treatment of clostridium difficile infection |
| US9999641B2 (en) | 2016-06-14 | 2018-06-19 | Vedanta Biosciences, Inc. | Treatment of clostridium difficile infection |
| US20170360848A1 (en) | 2016-06-15 | 2017-12-21 | Arizona Board Of Regents On Behalf Of Arizona State University | Methods for treating autism spectrum disorder and associated symptoms |
| WO2017218889A1 (en) * | 2016-06-16 | 2017-12-21 | Ohio State Innovation Foundation | Eubacterium probiotics and methods of treating or preventing heart disease |
| US10849936B2 (en) | 2016-07-01 | 2020-12-01 | Regents Of The University Of Minnesota | Compositions and methods for C. difficile treatment |
| GB201703548D0 (en) * | 2017-03-06 | 2017-04-19 | 4D Pharma Plc | Compositions comprising bacterial strains |
| CN109475305B (zh) * | 2016-07-13 | 2022-01-25 | 普梭梅根公司 | 用于微生物药物基因组学的方法和系统 |
| TWI802545B (zh) * | 2016-07-13 | 2023-05-21 | 英商4D製藥有限公司 | 包含細菌菌株之組合物 |
| GB201703552D0 (en) * | 2017-03-06 | 2017-04-19 | 4D Pharma Plc | Compositions comprising bacterial strains |
| KR101815692B1 (ko) * | 2016-07-25 | 2018-01-16 | 주식회사 고바이오랩 | 구강 세균의 군집을 이용한 대사성 질환 진단용 바이오 마커 |
| US20180036352A1 (en) | 2016-08-03 | 2018-02-08 | Crestovo Holdings Llc | Methods for treating ulcerative colitis |
| WO2018031545A1 (en) * | 2016-08-11 | 2018-02-15 | The Trustees Of The University Of Pennsylvania | Compositions and methods for detecting oral squamous cell carcinomas |
| WO2018046485A1 (en) | 2016-09-09 | 2018-03-15 | Swecure Ab | Use of butyricimonas and/or oxalobacter for treating irritable bowel syndrome |
| WO2018071536A1 (en) | 2016-10-11 | 2018-04-19 | Crestovo Holdings Llc | Compositions and methods for treating primary sclerosing cholangitis and related disorders |
| US10092601B2 (en) | 2016-10-11 | 2018-10-09 | Crestovo Holdings Llc | Compositions and methods for treating multiple sclerosis and related disorders |
| WO2018071537A1 (en) | 2016-10-11 | 2018-04-19 | Crestovo Holdings Llc | Compositions and methods for treating multiple sclerosis and related disorders |
| JP6927512B2 (ja) * | 2016-10-26 | 2021-09-01 | 地方独立行政法人神奈川県立産業技術総合研究所 | 物体表面の抗菌性試験用菌液媒体 |
| CA3045026A1 (en) * | 2016-12-06 | 2018-06-14 | Whole Biome Inc. | Methods and compositions relating to isolated and purified microbes |
| GB201621123D0 (en) | 2016-12-12 | 2017-01-25 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US11566238B2 (en) | 2016-12-15 | 2023-01-31 | The Board Of Trustees Of The Leland Stanford Junior University | Compositions and methods for modulating growth of a genetically modified gut bacterial cell |
| WO2018112371A1 (en) * | 2016-12-16 | 2018-06-21 | Vedanta Biosciences, Inc. | Methods and compositions for determining bacterial integrity |
| JOP20190146A1 (ar) | 2016-12-19 | 2019-06-18 | Axcella Health Inc | تركيبات حمض أميني وطرق لمعالجة أمراض الكبد |
| RU2761873C2 (ru) * | 2016-12-23 | 2021-12-13 | Кэйо Юниверсити | Композиции и способы для индукции cd8+ t-клеток |
| CA3048246A1 (en) | 2016-12-28 | 2018-07-05 | Ascus Biosciences, Inc. | Methods, apparatuses, and systems for analyzing complete microorganism strains in complex heterogeneous communities, determining functional relationships and interactions thereof, and identifying and synthesizing bioreactive modificators based thereon |
| AU2017388535A1 (en) | 2016-12-28 | 2019-07-25 | Native Microbials, Inc. | Methods, apparatuses, and systems for microorganism strain analysis of complex heterogeneous communities with tracer analytics, determination of functional relationships and interactions thereof, and synthesis of microbial ensembles including dosed microbial ensembles and inoculative microbial ensembles |
| WO2018129249A1 (en) * | 2017-01-05 | 2018-07-12 | The University Of Chicago | Inhibition of enteric infection through the modulation of microbiota |
| CN107058490B (zh) * | 2017-01-12 | 2018-03-06 | 杨俊杰 | 肠道及口腔菌群多样性及差异性的分析方法 |
| US10381105B1 (en) | 2017-01-24 | 2019-08-13 | Bao | Personalized beauty system |
| KR102769558B1 (ko) * | 2017-02-28 | 2025-02-19 | 킴벌리-클라크 월드와이드, 인크. | 미생물총의 건강한 균형을 유지하기 위한 상승적 조성물 |
| US10052026B1 (en) | 2017-03-06 | 2018-08-21 | Bao Tran | Smart mirror |
| EP3606325B1 (en) | 2017-04-03 | 2024-09-04 | Gusto Global, LLC | Rational design of microbial-based biotherapeutics |
| EP3606541A1 (en) | 2017-04-05 | 2020-02-12 | Crestovo Holdings LLC | Compositions and methods for treating parkinson's disease (pd) and related disorders |
| US11040073B2 (en) | 2017-04-05 | 2021-06-22 | Finch Therapeutics Holdings Llc | Compositions and methods for treating diverticulitis and related disorders |
| EP3388069B1 (en) | 2017-04-12 | 2019-05-01 | ETH Zurich | Consortia of living bacteria useful for treatment of microbiome dysbiosis |
| UY37708A (es) | 2017-04-28 | 2018-10-31 | Ascus Biosciences Inc | Métodos para complementar dietas con alto consumo de granos y/o alto valor energético en rumiantes, mediante la administración de un bioensamble sintético de microbios, o cepas purificadas de los mismos |
| WO2018213204A1 (en) | 2017-05-15 | 2018-11-22 | Axial Biotherapeutics, Inc. | Inhibitors of microbially induced amyloid |
| DK3630136T3 (da) | 2017-05-22 | 2021-05-25 | 4D Pharma Res Ltd | Sammensætninger, der omfatter bakteriestammer |
| EP3630942B1 (en) | 2017-05-24 | 2022-11-30 | 4D Pharma Research Limited | Compositions comprising bacterial strain |
| JP2020521760A (ja) | 2017-05-26 | 2020-07-27 | クレストヴォ・ホールディングス・エルエルシー | 糞便微生物ベースの治療剤を含む凍結乾燥組成物ならびにそれを製造および使用する方法 |
| SMT202000555T1 (it) | 2017-06-14 | 2020-11-10 | 4D Pharma Res Limited | Composizioni comprendenti un ceppo batterico del genere megaspaera e loro usi |
| SMT202000695T1 (it) | 2017-06-14 | 2021-01-05 | 4D Pharma Res Limited | Composizioni comprendenti ceppi batterici |
| CA3066189A1 (en) | 2017-06-14 | 2018-12-20 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| WO2018236979A1 (en) * | 2017-06-20 | 2018-12-27 | Cornell University | Probiotic compositions and methods |
| AU2018309153A1 (en) * | 2017-08-04 | 2020-03-19 | Tarunmeet GUJRAL | Roseburia hominis, Eubacterium eligens, and combinations thereof as biotherapeutics |
| CN107854495B (zh) * | 2017-08-04 | 2021-04-13 | 青岛东海药业有限公司 | 凝结芽孢杆菌在制备降低血尿酸制剂中的应用 |
| EP3662087B1 (en) * | 2017-08-06 | 2022-10-05 | Second Genome, Inc. | Streptococcus australis as a biotherapeutics |
| WO2019032575A1 (en) * | 2017-08-07 | 2019-02-14 | Finch Therapeutics, Inc. | TREATMENT OF LIVER DISEASE BY MODULATION OF MICROBIOMA |
| JP2020530494A (ja) | 2017-08-07 | 2020-10-22 | フィンチ セラピューティクス、インコーポレイテッド. | 健康な腸バリアを維持及び回復するための組成物及び方法 |
| MX2020001765A (es) | 2017-08-14 | 2020-07-29 | Axcella Health Inc | Composiciones de aminoacidos para el tratamiento de enfermedad hepatica. |
| TWI640314B (zh) * | 2017-08-22 | 2018-11-11 | 長庚生物科技股份有限公司 | 戈氏副擬桿菌用於降低胰島素抗性及提升葡萄糖耐受性之用途 |
| TW201920648A (zh) * | 2017-08-29 | 2019-06-01 | 美商艾弗洛生物科技股份有限公司 | 使用布勞特氏(blautia)菌株治療癌症 |
| US20200188310A1 (en) | 2017-08-29 | 2020-06-18 | Chr. Hansen A/S | Stable capsules with fecal microbiota or a culture of microorganisms |
| JP2020532515A (ja) | 2017-08-30 | 2020-11-12 | ペンデュラム セラピューティクス, インコーポレイテッド | マイクロバイオーム関連障害の処置のための方法および組成物 |
| EP3678693A1 (en) | 2017-09-08 | 2020-07-15 | Evelo Biosciences, Inc. | Bacterial extracellular vesicles |
| EP3453395B1 (en) | 2017-09-08 | 2023-10-18 | Deutsches Rheuma-Forschungszentrum Berlin | Anaeroplasmatales for use in the treatment or prevention of an inflammatory disorder of the digestive system |
| EP3688196A4 (en) * | 2017-09-26 | 2021-07-14 | Second Genome, Inc. | GEMELLA SANGUINIS AS BIOTHERAPEUTICS |
| UY37939A (es) | 2017-10-18 | 2019-04-30 | Ascus Biosciences Inc | Aumento de la producción de aves de corral mediante la administración de un bioensamblaje sintético de microbios o cepas purificadas de los mismos |
| FI128395B (en) * | 2017-11-09 | 2020-04-30 | Kemira Oyj | Method for making a fibrous web |
| CN107653243B (zh) * | 2017-11-15 | 2021-06-15 | 中国农业科学院农业基因组研究所 | 一种从肠道内容物中提取微生物宏基因组dna的方法 |
| AU2018379996A1 (en) | 2017-12-05 | 2020-06-25 | BioPlx, Inc. | Methods and compositions to prevent microbial infection |
| CN107828705A (zh) * | 2017-12-31 | 2018-03-23 | 佛山市艳晖生物科技有限公司 | 一株解淀粉芽孢杆菌及其在防治孤独症上的应用 |
| GB2585291B (en) | 2018-02-02 | 2023-07-19 | Univ Hong Kong Chinese | Fecal fungome and therapeutic efficacy of fecal microbiota transplantation |
| JP7325106B2 (ja) * | 2018-02-09 | 2023-08-14 | Noster株式会社 | リポ多糖制御性腸内細菌及びその用途 |
| AU2019217041B2 (en) * | 2018-02-09 | 2022-09-15 | Keio University | Compositions and methods for the induction of CD8+ T-cells |
| CN110211629A (zh) * | 2018-02-11 | 2019-09-06 | 中国科学院昆明动物研究所 | 一种评估微生物群落宏基因(或普通生物群落宏遗传)多样性和相似性的概念和方法 |
| ES3032290T3 (en) | 2018-03-20 | 2025-07-16 | Theriva Biologics Inc | Intestinal alkaline phosphatase formulations |
| MX2020010177A (es) * | 2018-03-29 | 2021-01-15 | Seres Therapeutics Inc | Composiciones y métodos para tratar enfermedades inflamatorias intestinales. |
| EP3773645A4 (en) | 2018-04-10 | 2021-11-24 | Siolta Therapeutics, Inc. | MICROBIAL CONSORTIA |
| WO2019200271A1 (en) | 2018-04-13 | 2019-10-17 | White Dog Labs, Inc. | An improved method for selecting probiotics |
| KR102225939B1 (ko) * | 2018-04-19 | 2021-03-10 | 주식회사 고바이오랩 | 신규한 Bacteroides vulgatus 균주 및 이를 유효 성분으로 하는 면역 및 대사성 질환 예방 또는 치료용 조성물 |
| JP7351853B2 (ja) * | 2018-04-30 | 2023-09-27 | サンコー・エナジー・インコーポレイテッド | 植物の非生物的ストレス抵抗力を増加させるための大環状テトラピロール化合物、組成物及び方法 |
| CN113151036B (zh) | 2018-05-11 | 2024-08-23 | 韩国亿诺生物有限公司 | 具有预防或治疗癌症的效果的新型菌株 |
| CN112469426B (zh) | 2018-05-23 | 2025-07-11 | 布莱阿姆青年大学 | 噬菌体组合物和试剂盒及相关方法 |
| US11986502B2 (en) | 2018-05-23 | 2024-05-21 | Optium, LLC | Bacteriophage compositions and kits and related methods |
| BR112020023933A2 (pt) * | 2018-05-24 | 2021-04-27 | Seres Therapeutics, Inc. | composições bacterianas projetadas e usos destas |
| US20210121511A1 (en) * | 2018-05-29 | 2021-04-29 | Unm Rainforest Innovations | Virus-like particle compositions and methods of using same |
| CN112805367B (zh) * | 2018-06-07 | 2024-08-09 | 阿尔图根治疗有限公司 | 用于治疗艰难梭菌的方法和组合物 |
| KR20240091008A (ko) * | 2018-06-14 | 2024-06-21 | 리바이오틱스, 인코퍼레이티드 | 미생물총 회복 요법 조성물 및 제조 방법 |
| SG11202012621VA (en) * | 2018-06-19 | 2021-01-28 | 4D Pharma Res Ltd | Dosage form comprising a live biotherapeutic product |
| CN112839643A (zh) | 2018-06-20 | 2021-05-25 | 胺细拉健康公司 | 用于治疗肌肉中脂肪浸润的组合物及方法 |
| EP3594321A1 (en) * | 2018-07-10 | 2020-01-15 | Université catholique de Louvain | Dusodibacter, a novel bacterial genus of the gastroinstestinal microbiota and uses thereof |
| US11166990B2 (en) | 2018-07-13 | 2021-11-09 | Finch Therapeutics Holdings Llc | Methods and compositions for treating ulcerative colitis |
| EP3823651A4 (en) | 2018-07-19 | 2022-04-27 | Pendulum Therapeutics, Inc. | METHODS AND COMPOSITIONS FOR MICROBIAL TRANSPLANTATION |
| US12226433B2 (en) | 2018-08-06 | 2025-02-18 | The Johns Hopkins University | Treatment of irritable bowel syndrome with molybdenum |
| AU2019321681A1 (en) | 2018-08-17 | 2021-02-25 | Vedanta Biosciences, Inc. | Methods of decreasing dysbiosis and restoring a microbiome |
| WO2020055547A2 (en) | 2018-08-18 | 2020-03-19 | Seed Health, Inc. | Methods and compositions for honey bee health |
| WO2020041581A1 (en) * | 2018-08-23 | 2020-02-27 | Cornell University | Methods and compositions for preventing and treating inflammatory bowel disease and nonalcoholic fatty liver disease |
| US11401500B2 (en) | 2018-08-29 | 2022-08-02 | Nch Corporation | System, method, and composition for incubating spores for use in aquaculture, agriculture, wastewater, and environmental remediation applications |
| US12144834B2 (en) | 2018-09-13 | 2024-11-19 | Xbiome Inc. | Methods and compositions for treating gastrointestinal and inflammatory disorders |
| US12509714B2 (en) | 2018-09-21 | 2025-12-30 | Emory University | Multiple heteroresistance to guide combination antibiotic regimens |
| EP3856212A1 (en) | 2018-09-27 | 2021-08-04 | Finch Therapeutics Holdings LLC | Compositions and methods for treating epilepsy and related disorders |
| CN109234195A (zh) * | 2018-09-28 | 2019-01-18 | 邓州市汇海农业科技有限公司 | 一种稻田微生物复合菌剂 |
| EA202190876A1 (ru) * | 2018-10-09 | 2021-07-02 | 4Д Фарма Рисерч Лимитед | Композиции, содержащие бактериальные штаммы |
| WO2020079026A1 (en) * | 2018-10-15 | 2020-04-23 | Pharmabiome Ag | A method of manufacturing a consortium of bacterial strains |
| EP3870154A4 (en) | 2018-10-22 | 2022-07-27 | Research Institute at Nationwide Children's Hospital | COMPOSITIONS AND METHODS FOR THE PREVENTION AND TREATMENT OF ANTIBIOTIC-INDUCED PATHOLOGIES USING PROBIOTICS IN BIOFILM STATE |
| BR112021008917A2 (pt) * | 2018-11-09 | 2021-08-17 | The Brigham And Women's Hospital, Inc. | microbiota terapêutica para o tratamento e/ou prevenção da disbiose |
| US12421518B2 (en) | 2018-12-10 | 2025-09-23 | Tenza, Inc. | Methods and compositions for treating hyperoxaluria |
| WO2020139852A1 (en) * | 2018-12-28 | 2020-07-02 | General Probiotics, Inc. | Combinations of engineered antimicrobial probiotics for treatment of gastrointestinal tract pathogens |
| WO2020150831A1 (en) | 2019-01-25 | 2020-07-30 | Suncor Energy Inc. | Photosensitizer compounds, methods of manufacture and application to plants |
| WO2020166708A1 (ja) * | 2019-02-15 | 2020-08-20 | コンビ株式会社 | 新規乳酸菌およびそれを含有する組成物 |
| CN113677204B (zh) | 2019-02-15 | 2024-03-05 | 桑科能源股份有限公司 | 原卟啉ix衍生物改善植物健康的用途 |
| WO2020176564A1 (en) | 2019-02-26 | 2020-09-03 | The Regents Of The University Of Colorado, A Body Corporate | Method and composition for treating gastrointestinal inflammatory disorders |
| CN110195027B (zh) * | 2019-03-08 | 2022-03-01 | 大连理工大学 | 烟草节杆菌zl-1及其堆肥低温发酵菌剂的制备方法与应用 |
| WO2020194298A1 (en) * | 2019-03-25 | 2020-10-01 | The State Of Israel, Ministry Of Agriculture & Rural Development, Agricultural Research Organization (Aro) (Volcani Center) | Method of treating bovine mastitis |
| WO2020198503A1 (en) * | 2019-03-26 | 2020-10-01 | The Children's Medical Center Corporation | Therapeutic microbiota for the treatment and/or prevention of dysbiosis |
| MX2021013776A (es) * | 2019-05-10 | 2021-12-10 | 4D Pharma Res Limited | Composiciones que comprenden cepas bacterianas. |
| AU2020280107A1 (en) * | 2019-05-23 | 2021-12-23 | American Molecular Laboratories, Inc. | Methods for detecting a level of H. pylori in a fecal sample |
| US20220233612A1 (en) * | 2019-05-31 | 2022-07-28 | South Dakota Board Of Regents Technology Transfer Office | Probiotics to inhibit enteric pathogens |
| EP3979830B1 (en) | 2019-06-03 | 2025-11-26 | Research Institute at Nationwide Children's Hospital | Formulations for the treatment of neurodevelopmental deficiencies induced by necrotizing enterocolitis |
| CA3142240A1 (en) | 2019-06-03 | 2020-12-10 | Synthetic Biologics, Inc. | Alkaline phosphatase formulations and uses thereof |
| EP3999029A4 (en) * | 2019-07-17 | 2023-07-26 | University of Utah Research Foundation | CLOSTRIDIA CONSORTIA COMPOSITIONS AND METHODS OF TREATMENT OF OBESITY, METABOLIC SYNDROME AND IRRITABLE BOWEL |
| PH12021553137A1 (en) * | 2019-07-19 | 2022-07-25 | Finch Therapeutics Holdings Llc | Methods and products for treatment of gastrointestinal disorders |
| CN110358849A (zh) * | 2019-07-30 | 2019-10-22 | 中国医学科学院北京协和医院 | 源于肠道的诊断胰腺炎的生物标志物、筛选方法及其用途 |
| US20220287995A1 (en) * | 2019-07-30 | 2022-09-15 | The Regents Of The University Of California | Compositions and methods for inhibiting bacterial virulence and flim-based device and method for antibiotic susceptibility testing |
| CN112438995A (zh) | 2019-09-04 | 2021-03-05 | 台达电子工业股份有限公司 | 抑制具万古霉素抗药性肠球菌的益生菌及其组合与其用途 |
| CN120732903A (zh) | 2019-10-07 | 2025-10-03 | 谢尔塔治疗公司 | 治疗性药物组合物 |
| EP4054609A1 (en) * | 2019-11-04 | 2022-09-14 | Vedanta Biosciences, Inc. | Compositions and methods for enhancing immune checkpoint inhibitor therapy |
| BR112022010411A2 (pt) * | 2019-11-27 | 2022-08-23 | Seres Therapeutics Inc | Composições bacterianas projetadas e usos das mesmas |
| KR102215592B1 (ko) * | 2019-12-11 | 2021-02-15 | 주식회사 에이치이엠 | 신규한 락토바실러스 퍼멘텀 hem 1036 균주, 및 상기 균주 또는 이의 배양물을 포함하는 장내 환경 개선용 조성물 |
| CN114760976A (zh) | 2019-12-16 | 2022-07-15 | 高露洁-棕榄公司 | 含有菊粉的口腔护理组合物 |
| EP3838276A1 (en) * | 2019-12-17 | 2021-06-23 | Exeliom Biosciences | Association of faecalibacterium prausnitzii strain cncm i-4573 with pentasa® for the treatment and prevention of gastrointestinal inflammation |
| TWI854077B (zh) * | 2019-12-20 | 2024-09-01 | 瑞士商葛德瑪控股公司 | 生產肉毒桿菌毒素的方法 |
| WO2021154872A1 (en) | 2020-01-27 | 2021-08-05 | General Probiotics, Inc. | Compositions including probiotic bacteria for the expression and secretion of enterocins to control clostridia perfringens-induced necrotic enteritis in livestock and related methods |
| WO2021159068A1 (en) | 2020-02-06 | 2021-08-12 | Nch Corportion | Composition and method of using germinative compounds in probiotics for inflammation reduction in humans |
| WO2021163212A1 (en) * | 2020-02-10 | 2021-08-19 | Native Microbials, Inc. | Microbial compositions and methods of use for canine enteropathy and dysbiosis |
| WO2021168119A2 (en) * | 2020-02-18 | 2021-08-26 | Memorial Sloan-Kettering Cancer Center | Methods and compositions for identifying and treating subjects at risk of poor cancer survival |
| EP4110269A4 (en) * | 2020-02-28 | 2024-01-17 | Emory University | PENTAGALLOYL GLUCOSE FROM SCHINUS PLANTS AND METHOD OF USE |
| TW202146036A (zh) * | 2020-04-28 | 2021-12-16 | 香港中文大學 | 針對covid-19的微生物的治療和診斷用途 |
| WO2021221110A1 (ja) * | 2020-04-29 | 2021-11-04 | 学校法人慶應義塾 | Th1細胞及び/又はTh17細胞の増殖又は活性化を誘導する小腸内細菌 |
| EP4161541A4 (en) * | 2020-06-09 | 2024-09-11 | Flagship Pioneering Innovations VI, LLC | PHYSIOLOGICALLY ACCEPTABLE COMPOSITIONS CONTAINING MICROORGANISMS OR MICROBIAL PRODUCTS |
| NL2025863B1 (en) | 2020-06-19 | 2022-02-17 | Acad Medisch Ct | Fecal matter for treatment of cachexia |
| WO2022027040A2 (en) | 2020-07-28 | 2022-02-03 | Icahn School Of Medicine At Mount Sinai | Compositions and methods for treating infections of the gastrointestinal tract |
| CN112040091B (zh) | 2020-09-01 | 2023-07-21 | 先临三维科技股份有限公司 | 相机增益的调整方法和装置、扫描系统 |
| CN116847859A (zh) * | 2020-09-11 | 2023-10-03 | 奇迹生物公司 | 微生物组组合物的方法和用途 |
| US12280037B2 (en) | 2020-09-22 | 2025-04-22 | Evofem Biosciences, Inc. | Method and pharmaceutical composition for treating or preventing trichomoniasis and uses thereof |
| KR102470808B1 (ko) * | 2020-11-02 | 2022-11-28 | 주식회사 바이오미 | 염증성 장질환 예방 또는 치료용 조성물 |
| WO2022115646A1 (en) * | 2020-11-25 | 2022-06-02 | Seres Therapeutics, Inc. | Designed bacterial compositions for treating graft-versus-host-disease |
| US20240127925A1 (en) * | 2021-02-03 | 2024-04-18 | Tata Consultancy Services Limited | Method and system for designing personalized therapeutics and diet based on functions of microbiome |
| KR102373886B1 (ko) * | 2021-03-26 | 2022-03-15 | 주식회사 에이치이엠파마 | 머신러닝 모델을 이용하여 장염 유무를 판별하는 방법 및 진단 장치 |
| KR102373888B1 (ko) * | 2021-03-26 | 2022-03-15 | 주식회사 에이치이엠파마 | 머신러닝 모델을 이용하여 변비 유무를 판별하는 방법 및 진단장치 |
| CN113106042A (zh) * | 2021-05-20 | 2021-07-13 | 广西壮族自治区兽医研究所 | 预防鸽形目念珠菌病的微生物菌剂、制剂及其制备方法和应用 |
| NL2028324B1 (en) | 2021-05-28 | 2022-12-12 | Caelus Pharmaceuticals B V | Insulin-sensitizing agent and butyrate-producing bacterium |
| EP4376836A1 (en) * | 2021-07-30 | 2024-06-05 | Oncomedics | Compositions and methods for decontaminating and culturing a gastrointestinal tract sample |
| KR102583365B1 (ko) * | 2021-08-11 | 2023-09-27 | 코스맥스 주식회사 | 마이크로코커스 안타르크티쿠스 균주 및 그의 피부 상태 개선 용도 |
| KR20240117164A (ko) * | 2021-11-11 | 2024-07-31 | 콘체르토 바이오사이언시스, 아이엔씨. | 피부 질환의 치료를 위한 미생물 조성물 |
| CN116135205A (zh) * | 2021-11-16 | 2023-05-19 | 葡萄王生技股份有限公司 | 戊醣片球菌gkp4用于制备改善肌少症之口服组成物的用途 |
| EP4183403A1 (en) * | 2021-11-19 | 2023-05-24 | Lietuvos Sveikatos Mokslu Universitetas | Modification of fecal microbiota with capsules containing gram-positive bacteria |
| IL313090A (en) * | 2021-12-02 | 2024-07-01 | Marvelbiome Inc | Methods and uses of microbiome compositions, components or metabolites for the treatment of diseases, disorders and conditions related to the vagus nerve |
| KR102438867B1 (ko) * | 2022-03-11 | 2022-09-02 | 주식회사 바이오뱅크힐링 | 코프로코커스 캐터스 균주, 및 그의 유래의 소포체 및 그의 항염증 및 항균 용도 |
| WO2023132628A1 (ko) * | 2022-01-04 | 2023-07-13 | 주식회사 바이오뱅크힐링 | 신규 균주, 및 그의 유래의 소포체 및 그의 항염증 및 항균 용도 |
| CN114317368B (zh) * | 2022-01-05 | 2022-09-09 | 中国水产科学研究院南海水产研究所 | 一种利用盐渍四生球菌改善快速发酵鱼露风味的方法 |
| MX2024009006A (es) * | 2022-02-23 | 2024-07-30 | Nestle Sa | Composiciones y metodos para reducir la aparicion de diarrea mediante la promocion de blautia obeum en la microbiota intestinal. |
| EP4514155A2 (en) * | 2022-04-26 | 2025-03-05 | Cedars-Sinai Medical Center | Methanogens and prevotella as microbial convener for the treatment of diseases and diagnosis thereof |
| CN114965764B (zh) * | 2022-05-18 | 2024-12-31 | 陕西安宁云生生物技术有限公司 | 便秘的诊断和治疗 |
| CN115466690A (zh) * | 2022-05-19 | 2022-12-13 | 同济大学 | 一种地芽孢杆菌新菌种及其培养方法和应用 |
| US20240033217A1 (en) * | 2022-08-01 | 2024-02-01 | Novel Biome Solutions Inc. | Method of orally administering a fecal microbiota transplant composition |
| CN116790402B (zh) * | 2023-01-14 | 2024-05-14 | 西北农林科技大学 | 一株具有抗炎特性的单形拟杆菌菌株、培养方法及应用 |
| WO2025064408A1 (en) | 2023-09-18 | 2025-03-27 | The Broad Institute, Inc. | Compositions and methods for treating cardiovascular disease |
| WO2025093777A1 (en) | 2023-11-05 | 2025-05-08 | Human Biome Institute S.A. | Functional compositions and methods of use thereof in the treatment and recurrence prophylaxis of clostridioides difficile infection and restoration of healthy microbiota |
| WO2025147266A1 (en) * | 2024-01-06 | 2025-07-10 | Jose Vega | Method of mitigation of death from epileptic seizures |
| WO2025189001A2 (en) * | 2024-03-06 | 2025-09-12 | University Of Florida Research Foundation, Incorporated | Methods of reducing occurrence of neurodevelopmental disorders |
| CN118360215B (zh) * | 2024-05-22 | 2025-03-07 | 吉林省农业科学院(中国农业科技东北创新中心) | 一种用于降低反刍动物甲烷排放量的菌剂及其制备方法以及含有该菌剂的配合饲料 |
Citations (131)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3009864A (en) | 1958-09-18 | 1961-11-21 | Union Carbide Corp | Process control |
| US3228838A (en) | 1959-04-23 | 1966-01-11 | Union Carbide Corp | Preservation of biological substances |
| US3608030A (en) | 1969-05-21 | 1971-09-21 | Howard Tint | Method of preparing a tablet dosage-form for the immunization of the intestinal tract with live virus preparations |
| US4077227A (en) | 1976-11-12 | 1978-03-07 | Regents Of The University Of Minnesota | Method of freezing liquid material in which agglomeration is inhibited |
| US4205132A (en) | 1978-07-17 | 1980-05-27 | Microlife Technics, Inc. | Lyophilization of bacteria |
| EP0033584A2 (en) | 1980-01-11 | 1981-08-12 | Farmos-Yhtyma Oy | Process for the production of a bacterial preparation for the prophylaxis of intestinal disturbances in poultry |
| US4655047A (en) | 1985-03-25 | 1987-04-07 | I.Q.F. Inc. | Process for freezing or chilling |
| US4839281A (en) | 1985-04-17 | 1989-06-13 | New England Medical Center Hospitals, Inc. | Lactobacillus strains and methods of selection |
| WO1990001335A1 (en) | 1988-08-02 | 1990-02-22 | Borody Thomas J | Treatment of gastro-intestinal disorders |
| EP0446069A1 (en) | 1990-03-09 | 1991-09-11 | Kabushiki Kaisha Miyarisan Seibutsu Igaku Kenkyusho | Treatment of Clostridium difficile diarrhoea and pseudomembranous colitis |
| EP0456418A2 (en) | 1990-05-07 | 1991-11-13 | Kabushiki Kaisha Miyarisan Seibutsu Igaku Kenkyusho | Treatment of clostridium difficile diarrhoea and pseudomembranous colitis |
| JPH0519563B2 (cg-RX-API-DMAC7.html) | 1985-04-12 | 1993-03-17 | Mitsubishi Petrochemical Co | |
| US5196205A (en) | 1987-10-12 | 1993-03-23 | Borody Thomas J | Method for treatment of gastro intestinal disorders |
| EP0479820B1 (en) | 1989-06-30 | 1994-09-07 | Orion-Yhtymä Oy | A bacterial preparation for use in poultry |
| RU2035186C1 (ru) | 1992-07-09 | 1995-05-20 | Семен Рафаилович Резник | Профилактический биопрепарат споролакт |
| US5425951A (en) | 1988-05-18 | 1995-06-20 | Cryopharm Corporation | Method of reconstituting lyophilized cells |
| US5436002A (en) | 1991-01-29 | 1995-07-25 | Mycogen Corporation | Bacillus thuringiensisisolate PS201T6 toxin |
| US5443826A (en) | 1988-08-02 | 1995-08-22 | Borody; Thomas J. | Treatment of gastro-intestinal disorders with a fecal composition or a composition of bacteroides and E. Coli |
| US5599795A (en) | 1994-08-19 | 1997-02-04 | Mccann; Michael | Method for treatment of idiopathic inflammatory bowel disease (IIBD) |
| WO1997009886A1 (en) | 1995-09-15 | 1997-03-20 | Gerding Dale N | Methods and compositions for prevention and treatment of clostridium difficile-associated diseases |
| WO1998026787A1 (en) | 1996-12-19 | 1998-06-25 | The University Of New South Wales | Prebiotics and probiotics |
| US5951977A (en) | 1997-10-14 | 1999-09-14 | The United States Of America, As Represented By The Secretary Of Agriculture | Competitive exclusion culture for swine |
| US5965128A (en) | 1997-08-13 | 1999-10-12 | University Of Georgia Research Foundation Inc. | Control of enterohemorrhagic E. coli 0157:H7 in cattle by probiotic bacteria and specific strains of E. coli |
| WO2000010582A2 (en) | 1998-08-24 | 2000-03-02 | Ganeden Biotech, Inc. | Probiotic, lactic acid-producing bacteria and uses thereof |
| US20010036453A1 (en) | 2000-02-10 | 2001-11-01 | Urex Biotech Inc. | Probiotic therapy for newborns |
| WO2001093904A1 (en) | 2000-06-05 | 2001-12-13 | The United States Of America As Represented By The Department Of Veterans Affairs | Method of treating gastrointestinal diseases associated with species of genus clostridium |
| WO2002007741A1 (en) | 2000-07-25 | 2002-01-31 | Borody Thomas J | Probiotic recolonisation therapy |
| WO2002043649A2 (en) | 2000-11-30 | 2002-06-06 | The Bio Balance Corp. | Preparation of compositions comprising bacterial strains and volatile plant extracts and therapeutic and industrial applications thereof |
| US6589771B1 (en) | 1999-10-28 | 2003-07-08 | Immunom Technologies, Inc. | Methods for arousing dormant bacteria |
| US20040170617A1 (en) | 2000-06-05 | 2004-09-02 | Finegold Sydney M. | Method of treating diseases associated with abnormal gastrointestinal flora |
| WO2005017095A2 (en) | 2003-08-18 | 2005-02-24 | The Bio Balance Corporation | A stable liquid probiotic composition, preparation and applications thereof |
| US20050048515A1 (en) | 2003-08-29 | 2005-03-03 | Garner Bryan E. | Methods for detecting and quantifying specific probiotic microorganisms in animal feed |
| US20050180962A1 (en) | 2003-01-30 | 2005-08-18 | Eyal Raz | Inactivated probiotic bacteria and methods of use thereof |
| WO2005110445A2 (en) | 2004-05-11 | 2005-11-24 | Ganeden Biotech, Inc. | Methods and compositions for the dietary management of autoimmune disorders |
| WO2006012586A2 (en) | 2004-07-27 | 2006-02-02 | Washington University In St. Louis | Modulation of fiaf and the gastrointestinal microbiota |
| US20060046246A1 (en) | 2003-04-24 | 2006-03-02 | Qiandong Zeng | Genus, group, species and/or strain specific 16S rDNA sequences |
| EA006847B1 (ru) | 2001-07-27 | 2006-04-28 | Санофи-Синтелябо Отц С.П.А. | Твердая композиция, содержащая споры непатогенных бактерий рода bacillus |
| US20060188523A1 (en) | 2005-01-10 | 2006-08-24 | Zhiheng Pei | Methods for diagnosing and treating chronic tonsillitis |
| US20060233830A1 (en) | 2002-09-23 | 2006-10-19 | Tuen-Yee Wong | Vaccines |
| WO2007036230A1 (en) | 2005-09-28 | 2007-04-05 | Nordisk Rebalance A/S | Treatment of ibd and ibs using both probiotic bacteria and fermented cereal as treatment effectors |
| US20070141139A1 (en) | 2000-01-27 | 2007-06-21 | Peros Systems Technologies Inc. | Composition for intestinal delivery |
| WO2007136553A2 (en) | 2006-05-18 | 2007-11-29 | Biobalance Llc | Bacterial strains, compositions including same and probiotic use thereof |
| WO2008076696A2 (en) | 2006-12-18 | 2008-06-26 | Washington University In St. Louis | The gut microbiome as a biomarker and therapeutic target for treating obesity or an obesity related disorder |
| WO2008083157A2 (en) | 2006-12-29 | 2008-07-10 | Washington University In St. Louis | Altering pgc-1alapha, ampk, fiaf, or the gastrointestinal microbiota as a means to modulate body fat and/or weight loss in a subject |
| US20080213752A1 (en) | 2004-11-01 | 2008-09-04 | Strategic Diagnostics Inc. | Bacteriophages as Selective Agents |
| EP1631312B1 (en) | 2003-04-23 | 2008-09-10 | Medarex, Inc. | Compositions and methods for the therapy of inflammatory bowel disease |
| US7427398B2 (en) | 2002-06-06 | 2008-09-23 | Mars, Inc. | Mammalian animal composition |
| US20090197249A1 (en) | 2004-11-01 | 2009-08-06 | George Mason University | Compositions and methods for diagnosing colon disorders |
| US7628982B2 (en) | 2001-12-21 | 2009-12-08 | King's College London | Composition and corresponding method of using spores of Bacillus subtilis to stimulate and/or enhance immune response in mammals |
| US7632520B2 (en) | 2004-02-16 | 2009-12-15 | Sanjeev Khandelwal | Synergistic antibacterial formulation and to a method of making the same |
| WO2010030997A1 (en) | 2008-09-12 | 2010-03-18 | The Washington University | Regulating intestinal microbiota dependent signaling as a means to modulate body fat and/or weight loss |
| US20100074872A1 (en) | 2008-09-25 | 2010-03-25 | New York University | Compositions and methods for characterizing and restoring gastrointestinal, skin, and nasal microbiota |
| WO2010062369A2 (en) | 2008-11-03 | 2010-06-03 | Tufts University | Methods and compositions for inhibiting clostridium difficile spore germination and outgrowth |
| US7731976B2 (en) | 2003-08-29 | 2010-06-08 | Cobb And Company, Llp | Treatment of irritable bowel syndrome using probiotic composition |
| US7763420B2 (en) | 2006-07-11 | 2010-07-27 | Genelux Corporation | Methods and compositions for detection of microorganisms and cells and treatment of diseases and disorders |
| US20100215745A1 (en) | 2009-02-25 | 2010-08-26 | Neuroscienze Pharmaness S.C. A.R.L. | Compositions of spores of non pathogenic bacteria |
| WO2010124387A1 (en) | 2009-05-01 | 2010-11-04 | Micropharma Limited | Bacterial compositions for prophylaxis and treatment of degenerative disease |
| WO2010151842A2 (en) | 2009-06-26 | 2010-12-29 | The Regents Of The University Of California | Methods and systems for phylogenetic analysis |
| WO2011005756A1 (en) | 2009-07-06 | 2011-01-13 | Puretech Ventures, Llc | Delivery of agents targeted to microbiota niches |
| WO2011022542A2 (en) | 2009-08-19 | 2011-02-24 | Puretech Ventures, Llc | Administration of factors normally present in a microbial niche to improve health |
| WO2011022660A1 (en) | 2009-08-21 | 2011-02-24 | Puretech Ventures, Llc | Methods of diagnosing and treating microbiome-associated disease using interaction network parameters |
| WO2011033310A1 (en) | 2009-09-17 | 2011-03-24 | William John Martin | Encapsulated intestinal flora extracted from feces for use in the treatment of gastrointestinal disorders |
| US20110081320A1 (en) | 2009-10-06 | 2011-04-07 | Nubiome, Inc. | Treatment/Cure of Autoimmune Disease |
| WO2011043654A1 (en) | 2009-10-05 | 2011-04-14 | Aak Patent B.V. | Methods for diagnosing irritable bowel syndrome |
| WO2011046616A2 (en) | 2009-10-15 | 2011-04-21 | New York University | Methods for modulating bacterial infection |
| US20110113863A1 (en) | 2008-07-15 | 2011-05-19 | Metanomics Health Gmbh | Means and methods diagnosing gastric bypass and conditions related thereto |
| EP2338989A1 (en) | 2008-08-26 | 2011-06-29 | Olympus Corporation | Method for preparing fecal sample, fecal sample preparation solution, and feces collection kit |
| US7981411B2 (en) | 2004-02-03 | 2011-07-19 | Valorisation—Recherche, Limited Partnership | Use of live bacteria for growth promotion in animals |
| US20110189132A1 (en) | 2010-02-01 | 2011-08-04 | Microbios, Inc. | Microbial product containing multiple microorganisms |
| WO2011094027A1 (en) | 2010-02-01 | 2011-08-04 | Hlavka Edwin J | Bacteriotherapy for clostridium difficile colitis |
| US7998473B2 (en) | 2003-12-19 | 2011-08-16 | The Procter & Gamble Company | Methods of treatment or prevention of gastrointestinal disorders using canine probiotic bifidobacterium |
| WO2011103123A2 (en) | 2010-02-16 | 2011-08-25 | Arizona Technology Enterprises | Reducing short-chain fatty acids and energy uptake in obese humans by managing their intestinal microbial communities |
| WO2011107481A2 (en) | 2010-03-01 | 2011-09-09 | Institut National De La Recherche Agronomique | Method of diagnostic of inflammatory bowel diseases |
| WO2011107482A2 (en) | 2010-03-01 | 2011-09-09 | Institut National De La Recherche Agronomique | Method of diagnostic of obesity |
| US8021654B2 (en) | 2008-03-14 | 2011-09-20 | Danisco A/S | Methods of treating pigs with Bacillus strains |
| WO2011113801A1 (en) | 2010-03-16 | 2011-09-22 | Universiteit Gent | Use of clostridium perfringens strain 23 to protect against necrotic enteritis |
| US8034601B2 (en) | 2005-05-31 | 2011-10-11 | The Procter & Gamble Company | Feline probiotic bifidobacteria |
| US20110280840A1 (en) | 2010-05-04 | 2011-11-17 | New York University | Compositions and methods for treating obesity and related disorders by characterizing and restoring mammalian bacterial microbiota |
| WO2011152566A2 (en) | 2010-06-04 | 2011-12-08 | The University Of Tokyo | Composition for inducing proliferation or accumulation of regulatory t cells |
| RU2439145C2 (ru) | 2006-12-08 | 2012-01-10 | Тарту Юликоол (Юниверсити Оф Тарту) | Штамм микроорганизма bacillus smithii tbmi12 mscl p737 и применение его в качестве пищевой или кормовой добавки, или компонента пробиотической композиции и пробиотическая композиция |
| WO2012009712A2 (en) | 2010-07-16 | 2012-01-19 | The Board Of Trustees Of The University Of Arkansas | Methods and compositions including spore-forming bacteria for increasing the health of animals |
| US20120020950A1 (en) | 2008-12-02 | 2012-01-26 | Summit Corporation Plc | Antibacterial compounds |
| US20120021921A1 (en) | 2008-04-01 | 2012-01-26 | Scott David L | Process and method for monitoring gastrointestinal microbiota |
| US20120021429A1 (en) | 2002-04-24 | 2012-01-26 | Rublee Parke A | Compositions, Products, Methods And Systems to Monitor Water And Other Ecosystems |
| WO2012016287A2 (en) | 2010-08-04 | 2012-02-09 | Borody Thomas J | Compositions for fecal floral transplantation and methods for making and using them and devices for deuvering them |
| US20120058094A1 (en) | 2010-08-20 | 2012-03-08 | Dow Global Technologies Llc | Compositions and methods for treating obesity and related disorders by characterizing and restoring mammalian bacterial microbiota |
| WO2012033814A2 (en) | 2010-09-10 | 2012-03-15 | Viropharma Incorporated | Environmental clostridial bacteriotherapy and related formulations and methods of manufacture and use |
| US20120064592A1 (en) | 2011-01-26 | 2012-03-15 | Qteros, Inc. | Biocatalysts synthesizing deregulated cellulases |
| US8147482B2 (en) | 2006-06-20 | 2012-04-03 | MEDIMETRICS Personalized Drug Delivery B.V. | Electronic capsule for treating gastrointestinal disease |
| WO2012045150A1 (en) | 2010-10-04 | 2012-04-12 | British Columbia Cancer Agency Branch | Detection of fusobacterium in a gastrointestinal sample to diagnose gastrointestinal cancer |
| WO2012064981A2 (en) | 2010-11-10 | 2012-05-18 | National Jewish Health | Methods to test allergic conditions |
| US20120128634A1 (en) | 2009-04-30 | 2012-05-24 | Campagnie Gervaise Donone | Use of collinsella aerofaciens for reducing bloating |
| US20120148629A1 (en) | 2009-08-18 | 2012-06-14 | Nestec S.A. | Nutritional composition comprising lactococcus strains and reducing allergy symptoms, especially in infants and children |
| US20120177650A1 (en) | 2009-09-23 | 2012-07-12 | Borody Thomas J | Therapy for enteric infections |
| US8236508B2 (en) | 2008-01-29 | 2012-08-07 | Drexel University | Detecting and measuring live pathogens utilizing a mass detection device |
| WO2012108830A1 (en) | 2011-02-09 | 2012-08-16 | Lavivo Ab | Synbiotic compositions for restoration and reconstitution of gut microbiota |
| US20120207726A1 (en) | 2009-06-16 | 2012-08-16 | The Trustees Of Columbia University In The City Of New York | Autism-associated biomarkers and uses thereof |
| WO2012116289A2 (en) | 2011-02-25 | 2012-08-30 | Tricorder Diagnostics, Llc | Microbial signatures as indicators of radiation exposure |
| JP5019563B2 (ja) | 2006-06-16 | 2012-09-05 | 旭化成ケミカルズ株式会社 | 腸内細菌賦活剤 |
| WO2012122478A1 (en) | 2011-03-09 | 2012-09-13 | Regents Of The University Of Minnesota | Compositions and methods for transplantation of colon microbiota |
| WO2012122522A2 (en) | 2011-03-09 | 2012-09-13 | Washington University | Cultured collection of gut microbial community |
| WO2012142605A1 (en) | 2011-04-15 | 2012-10-18 | Samaritan Health Services | Rapid recolonization deployment agent |
| US20120264637A1 (en) | 2009-06-26 | 2012-10-18 | The Regents Of The University Of California | Methods and systems for phylogenetic analysis |
| WO2012148991A1 (en) | 2011-04-26 | 2012-11-01 | Bochenek Wieslaw J | A method for use of biologic agents including live or dormant forms of bacteria and other organisms in treating infections, inflammation and other diseases of distal small intestine and large intestine |
| US20120276201A1 (en) | 2009-12-31 | 2012-11-01 | Ira Milton Trachtman | Compositions and method for treatment and prophylaxis of inflammatory bowel disease |
| WO2012159023A2 (en) | 2011-05-19 | 2012-11-22 | Virginia Commonwealth University | Gut microflora as biomarkers for the prognosis of cirrhosis and brain dysfunction |
| US20120315249A1 (en) | 2011-06-10 | 2012-12-13 | Olmstead Stephen F | Pharmaceutical compositions containing pediococcus and methods for reducing the symptoms of gastroenterological syndromes |
| US20130017999A1 (en) | 2011-07-14 | 2013-01-17 | Marc Fremont | Methods and Compositions for Evaluating and/or Treating Chronic Immune Diseases |
| US20130022575A1 (en) | 2011-07-19 | 2013-01-24 | Microbial Rx | Systems and methods of replacing intestinal flora |
| WO2013019896A1 (en) | 2011-08-01 | 2013-02-07 | Symbiotix Biotherapies, Inc. | Platform for identifying and/or characterizing immunomodulatory agents |
| US8388996B2 (en) | 2005-03-25 | 2013-03-05 | Kimberly-Clark Worldwide, Inc. | Methods of manufacturing a medicated tampon assembly |
| WO2013032328A1 (en) | 2011-08-30 | 2013-03-07 | Academisch Medisch Centrum | Method for preventing and/or treating insulin resistance |
| WO2013037068A1 (en) | 2011-09-14 | 2013-03-21 | Queen's University At Kingston | Method for treatment of disorders of the gastrointestinal system |
| WO2013053836A1 (en) | 2011-10-11 | 2013-04-18 | Quantum Pharmaceuticals Sa | Composition comprising anaerobically cultivated human intestinal microbiota |
| US20130121968A1 (en) | 2011-10-03 | 2013-05-16 | Atossa Genetics, Inc. | Methods of combining metagenome and the metatranscriptome in multiplex profiles |
| WO2013080561A1 (en) | 2011-12-01 | 2013-06-06 | University Of Tokyo | Human-derived bacteria that induce proliferation or accumulation of regulatory t cells |
| US20130149375A1 (en) | 2010-07-06 | 2013-06-13 | Andrew Geall | Immunisation of large mammals with low doses of rna |
| EP2626076A1 (en) | 2010-03-08 | 2013-08-14 | Probiotical S.p.a. | Composition comprising probiotic bacteria for the treatment of pathologies associated with alterations of the immune system |
| WO2013166031A1 (en) | 2012-04-30 | 2013-11-07 | The Washington University | Method of isolating and characterizing microorganisms that are targets of host immune responses |
| WO2013171515A1 (en) | 2012-05-18 | 2013-11-21 | Genome Research Limited | Methods and groups |
| WO2013176774A1 (en) | 2012-05-25 | 2013-11-28 | Arizona Board Of Regents | Microbiome markers and therapies for autism spectrum disorders |
| EP2684469A1 (en) | 2012-07-13 | 2014-01-15 | Nederlandse Organisatie voor toegepast -natuurwetenschappelijk onderzoek TNO | Methods for strengthening and assessment of the natural defence of the colon against C. difficile overgrowth |
| WO2014015319A1 (en) | 2012-07-20 | 2014-01-23 | Verinata Health, Inc. | System for determining a copy number variation |
| WO2014082050A1 (en) | 2012-11-23 | 2014-05-30 | Seres Health, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| US20140199281A1 (en) | 2012-11-23 | 2014-07-17 | Seres Health, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| WO2014121301A1 (en) | 2013-02-04 | 2014-08-07 | Seres Health, Inc. | Compositions and methods for inhibition of pathogenic bacterial growth |
| WO2014121304A1 (en) | 2013-02-04 | 2014-08-07 | Seres Health, Inc. | Compositions and methods |
| WO2014145958A2 (en) | 2013-03-15 | 2014-09-18 | Seres Health, Inc. | Network-based microbial compositions and methods |
| WO2015077794A1 (en) | 2013-11-25 | 2015-05-28 | Seres Health, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| WO2015095241A2 (en) | 2013-12-16 | 2015-06-25 | Seres Health, Inc. | Bacterial compositions and methods of use thereof for treatment of immune system disorders |
| US20160271188A1 (en) | 2014-11-25 | 2016-09-22 | Epiva Biosciences, Inc. | Probiotic and prebiotic compositions, and methods of use thereof for treatment of gastrointestinal disorders |
Family Cites Families (44)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3009861A (en) * | 1961-01-13 | 1961-11-21 | Alderton Gordon | Isolation of bacterial spores |
| US3892842A (en) * | 1971-09-01 | 1975-07-01 | Alza Corp | Intrauterine contraceptive device for releasing steroid having double bond functionality |
| DE2414156A1 (de) * | 1974-03-23 | 1975-09-25 | Kleist Johann Georg Dr | Arzneimittel zur beseitigung uraemischer symptome und verfahren zu seiner herstellung |
| US4780987A (en) * | 1983-10-25 | 1988-11-01 | Plant Genetics, Inc. | Method for the preparation of hydrated, pregerminated seeds in gel capsules |
| ES2157225T3 (es) | 1992-10-09 | 2001-08-16 | Advanced Tissue Sciences Inc | Celulas hepaticas de reserva. |
| US5851545A (en) * | 1995-08-25 | 1998-12-22 | Sandoz Ltd. | Insecticidal matrix and process for preparation thereof |
| WO1997008598A1 (de) | 1995-08-25 | 1997-03-06 | Gff Technopark | Verfahren zur simultanen, digitalen phasenempfindlichen detektion von zeitaufgelösten, quasi-gleichzeitig erfassten datenarrays eines periodisch stimulierten systems |
| US6024370A (en) | 1997-07-03 | 2000-02-15 | Rockshox, Inc. | Damping cartridge for high performance suspension systems |
| AU2001289438A1 (en) * | 2000-09-22 | 2002-04-02 | Galephar M/F | Pharmaceutical semi-solid composition of isotretinoin |
| KR100437497B1 (ko) * | 2001-03-07 | 2004-06-25 | 주식회사 프로바이오닉 | 로타바이러스 및 유해 미생물 억제 활성을 가지는 신규내산성 락토바실러스 루테리 프로바이오-16 및 이를함유하는 생균활성제 |
| CN1678735A (zh) | 2001-05-04 | 2005-10-05 | 佛罗里达大学研究基金会有限公司 | 来源于细菌的丙酮酸脱羧酶(pdc)基因的克隆和测序及其用途 |
| WO2004101770A1 (en) | 2003-03-13 | 2004-11-25 | Universite De Moncton (Bureau De Soutien A L'innovation) | Antioxidant producing bacterium and uses thereof |
| US7261861B2 (en) | 2003-04-24 | 2007-08-28 | Haemoscope Corporation | Hemostasis analyzer and method |
| WO2004104175A2 (en) | 2003-05-14 | 2004-12-02 | University Of Georgia Research Foundation, Inc. | Probiotic bacteria and methods |
| US7452872B2 (en) | 2005-08-24 | 2008-11-18 | Salix Pharmaceuticals, Inc. | Formulations and uses of 2-hydroxy-5-phenylazobenzoic acid derivatives |
| US8968721B2 (en) * | 2005-12-28 | 2015-03-03 | Advanced Bionutrition Corporation | Delivery vehicle for probiotic bacteria comprising a dry matrix of polysaccharides, saccharides and polyols in a glass form and methods of making same |
| US20090324638A1 (en) * | 2006-06-12 | 2009-12-31 | Biopeptides Corp. | Live bacterial vaccine |
| DE102006062250A1 (de) | 2006-12-22 | 2008-06-26 | Roland Saur-Brosch | Verwendung einer Zusammensetzung aus Mineralstoffen und/oder Vitaminen und gegebenenfalls acetogenen und/oder butyrogenen Bakterien zur oralen oder rektalen Verabreichung für die Behandlung und Vorbeugung von abdominalen Beschwerden |
| AR066984A1 (es) | 2007-06-15 | 2009-09-23 | Novartis Ag | Inhibicion de la expresion de la subunidad alfa del canal epitelial de sodio (enac) por medio de arni (arn de interferencia) |
| WO2009036121A1 (en) * | 2007-09-12 | 2009-03-19 | Targanta Therapeutics Corp. | Method of inhibiting clostridium difficile by administration of oritavancin |
| EP2207277A4 (en) | 2007-10-16 | 2015-08-12 | Fujitsu Ltd | RELAY STATION DEVICE, DEVICE STATION DEVICE, WIRELESS COMMUNICATION SYSTEM AND LOAD DISTRIBUTION METHOD |
| CN101264107A (zh) * | 2008-05-09 | 2008-09-17 | 东北制药集团公司沈阳第一制药厂 | 地衣芽孢杆菌药物组合物及其制剂 |
| CN102940652B (zh) | 2008-05-28 | 2015-03-25 | 青岛东海药业有限公司 | 两形真杆菌制剂及其应用 |
| FR2938057B1 (fr) | 2008-11-05 | 2013-05-17 | Patrick Wozna | Doseur a delta de pression |
| WO2011060123A1 (en) * | 2009-11-12 | 2011-05-19 | Nestec S.A. | Nutritional composition for promoting gut microbiota balance and health |
| FI20105825A7 (fi) | 2010-07-26 | 2012-01-27 | Suomen Punainen Risti Veripalvelu | Veriryhmästatuksen käyttö III |
| US20130196944A1 (en) * | 2010-08-19 | 2013-08-01 | Merz Pharma Gmbh & Co. Kgaa | Filler composition comprising beta-glucans |
| US20120278201A1 (en) | 2011-04-26 | 2012-11-01 | Dwolla Corp. | Location transaction processing system |
| US20120284637A1 (en) | 2011-05-02 | 2012-11-08 | John Edward Boyer | Unified Virtual Group Calendar System |
| WO2013016636A1 (en) | 2011-07-27 | 2013-01-31 | Max International, Llc | Compositions comprising sugar-cysteine products |
| US20130115232A1 (en) | 2011-10-03 | 2013-05-09 | Fred Hutchinson Cancer Research Center | Methods for detecting graft-versus-host disease |
| GB201117313D0 (en) | 2011-10-07 | 2011-11-16 | Gt Biolog Ltd | Bacterium for use in medicine |
| GB201201766D0 (en) | 2012-02-01 | 2012-03-14 | Imp Innovations Ltd | Method |
| AU2013266069B2 (en) | 2012-05-25 | 2018-03-15 | Sloan Kettering Institute For Cancer Research | Methods for treating GI syndrome and graft versus host disease |
| US20140112985A1 (en) * | 2012-10-22 | 2014-04-24 | Polonez Therapeutics Llc | Method of prevention and treatment of clostridium difficile infection |
| EP2971148A4 (en) | 2013-03-14 | 2016-08-17 | Seres Therapeutics Inc | METHODS OF DETECTING PATHOGENS AND ENRICHING FROM MATERIALS AND COMPOSITIONS |
| EP2991659B1 (en) | 2013-05-03 | 2018-10-10 | Nestec S.A. | Lachnospiraceae in the gut microbiota and association with body weight |
| US20170087196A1 (en) | 2014-05-19 | 2017-03-30 | Memorial Sloan-Kettering Cancer Center | Methods and compositions for reducing clostridium difficile infection |
| WO2016086161A1 (en) | 2014-11-25 | 2016-06-02 | Memorial Sloan-Kettering Cancer Center | Intestinal microbiota and gvhd |
| EP3319619A4 (en) | 2015-07-08 | 2019-01-02 | Seres Therapeutics, Inc. | Methods of treating colitis |
| PL3380108T3 (pl) | 2015-11-24 | 2023-03-27 | Seres Therapeutics, Inc. | Zaprojektowane kompozycje bakteryjne |
| WO2017091753A1 (en) | 2015-11-25 | 2017-06-01 | Memorial Sloan-Kettering Cancer Center | Methods and compositions for reducing vancomycin-resistant enterococci infection or colonization |
| EP3429604A1 (en) | 2016-03-14 | 2019-01-23 | Holobiome, Inc. | Modulation of the gut microbiome to treat mental disorders or diseases of the central nervous system |
| BR112020008552A2 (pt) | 2017-10-30 | 2020-12-29 | Seres Therapeutics, Inc. | métodos e composições para tratamento de resistência a antibiótico |
-
2014
- 2014-02-04 JP JP2015556241A patent/JP2016509003A/ja active Pending
- 2014-02-04 EP EP14746341.8A patent/EP2951285A4/en active Pending
- 2014-02-04 CA CA2899925A patent/CA2899925A1/en active Pending
- 2014-02-04 CA CA2899926A patent/CA2899926C/en active Active
- 2014-02-04 US US14/765,810 patent/US10064900B2/en active Active
- 2014-02-04 JP JP2015556240A patent/JP6479685B2/ja active Active
- 2014-02-04 EP EP19176003.2A patent/EP3587558A3/en active Pending
- 2014-02-04 BR BR122021010444-1A patent/BR122021010444B1/pt active IP Right Grant
- 2014-02-04 WO PCT/US2014/014738 patent/WO2014121298A2/en not_active Ceased
- 2014-02-04 CN CN201911025655.3A patent/CN110917220A/zh active Pending
- 2014-02-04 CA CA3280244A patent/CA3280244A1/en active Pending
- 2014-02-04 NZ NZ711771A patent/NZ711771A/en unknown
- 2014-02-04 KR KR1020217005615A patent/KR102553134B1/ko active Active
- 2014-02-04 EP EP19175191.6A patent/EP3584308A3/en not_active Withdrawn
- 2014-02-04 HK HK16106858.0A patent/HK1218837A1/zh unknown
- 2014-02-04 WO PCT/US2014/014745 patent/WO2014121302A2/en not_active Ceased
- 2014-02-04 AU AU2014212004A patent/AU2014212004B2/en active Active
- 2014-02-04 EP EP14745749.3A patent/EP2956006A4/en not_active Withdrawn
- 2014-02-04 EP EP14746455.6A patent/EP2953474A4/en not_active Withdrawn
- 2014-02-04 MX MX2015009991A patent/MX369877B/es active IP Right Grant
- 2014-02-04 RU RU2015137399A patent/RU2664479C2/ru active
- 2014-02-04 HK HK16107086.2A patent/HK1219022A1/zh unknown
- 2014-02-04 WO PCT/US2014/014744 patent/WO2014121301A1/en not_active Ceased
- 2014-02-04 KR KR1020237022575A patent/KR20230110367A/ko not_active Ceased
- 2014-02-04 AU AU2014212003A patent/AU2014212003C1/en active Active
- 2014-02-04 HK HK16106460.0A patent/HK1218559A1/zh unknown
- 2014-02-04 BR BR112015018625A patent/BR112015018625A2/pt not_active Application Discontinuation
- 2014-02-04 CN CN201480019395.8A patent/CN105451561A/zh active Pending
- 2014-02-04 KR KR1020157024002A patent/KR102222273B1/ko active Active
- 2014-02-04 US US14/765,814 patent/US11185562B2/en active Active
- 2014-03-04 US US14/197,044 patent/US9011834B1/en active Active
- 2014-06-24 US US14/313,828 patent/US9180147B2/en active Active
-
2015
- 2015-08-03 MX MX2019014045A patent/MX2019014045A/es unknown
- 2015-10-15 US US14/884,655 patent/US9585921B2/en active Active
-
2016
- 2016-03-11 US US15/068,438 patent/US9446080B2/en active Active
-
2017
- 2017-01-25 US US15/415,745 patent/US9855303B2/en active Active
- 2017-12-19 US US15/847,623 patent/US10064901B2/en active Active
-
2018
- 2018-08-01 US US16/051,747 patent/US20190192581A1/en not_active Abandoned
- 2018-08-03 US US16/054,864 patent/US10967011B2/en active Active
- 2018-12-19 AU AU2018282348A patent/AU2018282348A1/en not_active Abandoned
-
2019
- 2019-02-06 JP JP2019020032A patent/JP6908332B2/ja active Active
- 2019-02-27 JP JP2019034615A patent/JP6942745B2/ja active Active
-
2020
- 2020-04-01 AU AU2020202312A patent/AU2020202312B2/en active Active
- 2020-10-30 AU AU2020260564A patent/AU2020260564A1/en not_active Abandoned
-
2021
- 2021-04-05 US US17/222,778 patent/US11730775B2/en active Active
- 2021-07-01 JP JP2021110109A patent/JP7409743B2/ja active Active
- 2021-11-23 US US17/534,361 patent/US20220249578A1/en not_active Abandoned
-
2023
- 2023-02-24 AU AU2023201132A patent/AU2023201132A1/en not_active Abandoned
- 2023-07-11 US US18/350,081 patent/US12605415B2/en active Active
- 2023-12-18 JP JP2023212983A patent/JP2024045100A/ja active Pending
-
2024
- 2024-02-02 US US18/431,885 patent/US20250000915A1/en not_active Abandoned
- 2024-04-12 AU AU2024202421A patent/AU2024202421A1/en active Pending
Patent Citations (169)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3009864A (en) | 1958-09-18 | 1961-11-21 | Union Carbide Corp | Process control |
| US3228838A (en) | 1959-04-23 | 1966-01-11 | Union Carbide Corp | Preservation of biological substances |
| US3608030A (en) | 1969-05-21 | 1971-09-21 | Howard Tint | Method of preparing a tablet dosage-form for the immunization of the intestinal tract with live virus preparations |
| US4077227A (en) | 1976-11-12 | 1978-03-07 | Regents Of The University Of Minnesota | Method of freezing liquid material in which agglomeration is inhibited |
| US4205132A (en) | 1978-07-17 | 1980-05-27 | Microlife Technics, Inc. | Lyophilization of bacteria |
| EP0033584A2 (en) | 1980-01-11 | 1981-08-12 | Farmos-Yhtyma Oy | Process for the production of a bacterial preparation for the prophylaxis of intestinal disturbances in poultry |
| EP0033584A3 (en) | 1980-01-11 | 1982-04-21 | Farmos-Yhtyma Oy | Process for the production of a bacterial preparation for the prophylaxis of intestinal disturbances in poultry |
| US4689226A (en) | 1980-01-11 | 1987-08-25 | Farmos-Yhtyma Oy | Process for the production of a bacterial preparation for the prophylaxis of intestinal disturbances in poultry |
| US4655047A (en) | 1985-03-25 | 1987-04-07 | I.Q.F. Inc. | Process for freezing or chilling |
| JPH0519563B2 (cg-RX-API-DMAC7.html) | 1985-04-12 | 1993-03-17 | Mitsubishi Petrochemical Co | |
| US4839281A (en) | 1985-04-17 | 1989-06-13 | New England Medical Center Hospitals, Inc. | Lactobacillus strains and methods of selection |
| US5196205A (en) | 1987-10-12 | 1993-03-23 | Borody Thomas J | Method for treatment of gastro intestinal disorders |
| US5425951A (en) | 1988-05-18 | 1995-06-20 | Cryopharm Corporation | Method of reconstituting lyophilized cells |
| EP0433299A4 (en) | 1988-08-02 | 1992-04-08 | Thomas Julius Borody | Treatment of gastro-intestinal disorders |
| US6645530B1 (en) | 1988-08-02 | 2003-11-11 | Gastro Services Pty Limited | Treatment of gastro-intestinal disorders |
| WO1990001335A1 (en) | 1988-08-02 | 1990-02-22 | Borody Thomas J | Treatment of gastro-intestinal disorders |
| US5443826A (en) | 1988-08-02 | 1995-08-22 | Borody; Thomas J. | Treatment of gastro-intestinal disorders with a fecal composition or a composition of bacteroides and E. Coli |
| EP0433299A1 (en) | 1988-08-02 | 1991-06-26 | Exomed Australia Pty. Ltd. (ACN 051 976 446) | Treatment of gastro-intestinal disorders |
| US5648206A (en) | 1988-08-26 | 1997-07-15 | Cobe Laboratories, Inc. | Lyophilization of cells |
| EP0479820B1 (en) | 1989-06-30 | 1994-09-07 | Orion-Yhtymä Oy | A bacterial preparation for use in poultry |
| EP0446069A1 (en) | 1990-03-09 | 1991-09-11 | Kabushiki Kaisha Miyarisan Seibutsu Igaku Kenkyusho | Treatment of Clostridium difficile diarrhoea and pseudomembranous colitis |
| EP0456418A2 (en) | 1990-05-07 | 1991-11-13 | Kabushiki Kaisha Miyarisan Seibutsu Igaku Kenkyusho | Treatment of clostridium difficile diarrhoea and pseudomembranous colitis |
| US5436002A (en) | 1991-01-29 | 1995-07-25 | Mycogen Corporation | Bacillus thuringiensisisolate PS201T6 toxin |
| RU2035186C1 (ru) | 1992-07-09 | 1995-05-20 | Семен Рафаилович Резник | Профилактический биопрепарат споролакт |
| US5599795A (en) | 1994-08-19 | 1997-02-04 | Mccann; Michael | Method for treatment of idiopathic inflammatory bowel disease (IIBD) |
| WO1997009886A1 (en) | 1995-09-15 | 1997-03-20 | Gerding Dale N | Methods and compositions for prevention and treatment of clostridium difficile-associated diseases |
| WO1998026787A1 (en) | 1996-12-19 | 1998-06-25 | The University Of New South Wales | Prebiotics and probiotics |
| US5965128A (en) | 1997-08-13 | 1999-10-12 | University Of Georgia Research Foundation Inc. | Control of enterohemorrhagic E. coli 0157:H7 in cattle by probiotic bacteria and specific strains of E. coli |
| US5951977A (en) | 1997-10-14 | 1999-09-14 | The United States Of America, As Represented By The Secretary Of Agriculture | Competitive exclusion culture for swine |
| WO2000010582A2 (en) | 1998-08-24 | 2000-03-02 | Ganeden Biotech, Inc. | Probiotic, lactic acid-producing bacteria and uses thereof |
| US7708988B2 (en) | 1998-08-24 | 2010-05-04 | Ganeden Biotech, Incorporated | Probiotic, lactic acid-producing bacteria and uses thereof |
| EP1107772B1 (en) | 1998-08-24 | 2006-04-19 | Ganeden Biotech, Inc. | Composition with bacillus coagulans and use thereof |
| US8187590B2 (en) | 1998-08-24 | 2012-05-29 | Ganeden Biotech, Inc. | Probiotic, lactic acid-producing bacteria and uses thereof |
| US6589771B1 (en) | 1999-10-28 | 2003-07-08 | Immunom Technologies, Inc. | Methods for arousing dormant bacteria |
| US20070141139A1 (en) | 2000-01-27 | 2007-06-21 | Peros Systems Technologies Inc. | Composition for intestinal delivery |
| US20010036453A1 (en) | 2000-02-10 | 2001-11-01 | Urex Biotech Inc. | Probiotic therapy for newborns |
| WO2001093904A1 (en) | 2000-06-05 | 2001-12-13 | The United States Of America As Represented By The Department Of Veterans Affairs | Method of treating gastrointestinal diseases associated with species of genus clostridium |
| US20040170617A1 (en) | 2000-06-05 | 2004-09-02 | Finegold Sydney M. | Method of treating diseases associated with abnormal gastrointestinal flora |
| US9408872B2 (en) | 2000-07-25 | 2016-08-09 | Crestovo Llc | Probiotic recolonisation therapy |
| US20130266539A1 (en) | 2000-07-25 | 2013-10-10 | Thomas Julius Borody | Probiotic recolonisation therapy |
| US20040028689A1 (en) | 2000-07-25 | 2004-02-12 | Borody Thomas Julius | Probiotic recolonisation therapy |
| WO2002007741A1 (en) | 2000-07-25 | 2002-01-31 | Borody Thomas J | Probiotic recolonisation therapy |
| US8460648B2 (en) | 2000-07-25 | 2013-06-11 | Thomas Julius Borody | Probiotic recolonisation therapy |
| WO2002043649A2 (en) | 2000-11-30 | 2002-06-06 | The Bio Balance Corp. | Preparation of compositions comprising bacterial strains and volatile plant extracts and therapeutic and industrial applications thereof |
| EA006847B1 (ru) | 2001-07-27 | 2006-04-28 | Санофи-Синтелябо Отц С.П.А. | Твердая композиция, содержащая споры непатогенных бактерий рода bacillus |
| US8039006B2 (en) | 2001-07-27 | 2011-10-18 | Sanofi-Aventis S.P.A. | Solid composition containing bacillus-type non-pathogenic bacterial spores |
| US7628982B2 (en) | 2001-12-21 | 2009-12-08 | King's College London | Composition and corresponding method of using spores of Bacillus subtilis to stimulate and/or enhance immune response in mammals |
| US20120021429A1 (en) | 2002-04-24 | 2012-01-26 | Rublee Parke A | Compositions, Products, Methods And Systems to Monitor Water And Other Ecosystems |
| US7427398B2 (en) | 2002-06-06 | 2008-09-23 | Mars, Inc. | Mammalian animal composition |
| US20060233830A1 (en) | 2002-09-23 | 2006-10-19 | Tuen-Yee Wong | Vaccines |
| US20050180962A1 (en) | 2003-01-30 | 2005-08-18 | Eyal Raz | Inactivated probiotic bacteria and methods of use thereof |
| EP1631312B1 (en) | 2003-04-23 | 2008-09-10 | Medarex, Inc. | Compositions and methods for the therapy of inflammatory bowel disease |
| US20060046246A1 (en) | 2003-04-24 | 2006-03-02 | Qiandong Zeng | Genus, group, species and/or strain specific 16S rDNA sequences |
| WO2005017095A2 (en) | 2003-08-18 | 2005-02-24 | The Bio Balance Corporation | A stable liquid probiotic composition, preparation and applications thereof |
| US20050048515A1 (en) | 2003-08-29 | 2005-03-03 | Garner Bryan E. | Methods for detecting and quantifying specific probiotic microorganisms in animal feed |
| US7731976B2 (en) | 2003-08-29 | 2010-06-08 | Cobb And Company, Llp | Treatment of irritable bowel syndrome using probiotic composition |
| US7998473B2 (en) | 2003-12-19 | 2011-08-16 | The Procter & Gamble Company | Methods of treatment or prevention of gastrointestinal disorders using canine probiotic bifidobacterium |
| US7981411B2 (en) | 2004-02-03 | 2011-07-19 | Valorisation—Recherche, Limited Partnership | Use of live bacteria for growth promotion in animals |
| US7632520B2 (en) | 2004-02-16 | 2009-12-15 | Sanjeev Khandelwal | Synergistic antibacterial formulation and to a method of making the same |
| WO2005110445A2 (en) | 2004-05-11 | 2005-11-24 | Ganeden Biotech, Inc. | Methods and compositions for the dietary management of autoimmune disorders |
| WO2006012586A2 (en) | 2004-07-27 | 2006-02-02 | Washington University In St. Louis | Modulation of fiaf and the gastrointestinal microbiota |
| US20090197249A1 (en) | 2004-11-01 | 2009-08-06 | George Mason University | Compositions and methods for diagnosing colon disorders |
| US20080213752A1 (en) | 2004-11-01 | 2008-09-04 | Strategic Diagnostics Inc. | Bacteriophages as Selective Agents |
| US20060188523A1 (en) | 2005-01-10 | 2006-08-24 | Zhiheng Pei | Methods for diagnosing and treating chronic tonsillitis |
| US8388996B2 (en) | 2005-03-25 | 2013-03-05 | Kimberly-Clark Worldwide, Inc. | Methods of manufacturing a medicated tampon assembly |
| US8034601B2 (en) | 2005-05-31 | 2011-10-11 | The Procter & Gamble Company | Feline probiotic bifidobacteria |
| WO2007036230A1 (en) | 2005-09-28 | 2007-04-05 | Nordisk Rebalance A/S | Treatment of ibd and ibs using both probiotic bacteria and fermented cereal as treatment effectors |
| WO2007136553A2 (en) | 2006-05-18 | 2007-11-29 | Biobalance Llc | Bacterial strains, compositions including same and probiotic use thereof |
| JP5019563B2 (ja) | 2006-06-16 | 2012-09-05 | 旭化成ケミカルズ株式会社 | 腸内細菌賦活剤 |
| US8147482B2 (en) | 2006-06-20 | 2012-04-03 | MEDIMETRICS Personalized Drug Delivery B.V. | Electronic capsule for treating gastrointestinal disease |
| US7763420B2 (en) | 2006-07-11 | 2010-07-27 | Genelux Corporation | Methods and compositions for detection of microorganisms and cells and treatment of diseases and disorders |
| RU2439145C2 (ru) | 2006-12-08 | 2012-01-10 | Тарту Юликоол (Юниверсити Оф Тарту) | Штамм микроорганизма bacillus smithii tbmi12 mscl p737 и применение его в качестве пищевой или кормовой добавки, или компонента пробиотической композиции и пробиотическая композиция |
| WO2008076696A2 (en) | 2006-12-18 | 2008-06-26 | Washington University In St. Louis | The gut microbiome as a biomarker and therapeutic target for treating obesity or an obesity related disorder |
| WO2008083157A2 (en) | 2006-12-29 | 2008-07-10 | Washington University In St. Louis | Altering pgc-1alapha, ampk, fiaf, or the gastrointestinal microbiota as a means to modulate body fat and/or weight loss in a subject |
| US8236508B2 (en) | 2008-01-29 | 2012-08-07 | Drexel University | Detecting and measuring live pathogens utilizing a mass detection device |
| US8021654B2 (en) | 2008-03-14 | 2011-09-20 | Danisco A/S | Methods of treating pigs with Bacillus strains |
| US20120021921A1 (en) | 2008-04-01 | 2012-01-26 | Scott David L | Process and method for monitoring gastrointestinal microbiota |
| US20110113863A1 (en) | 2008-07-15 | 2011-05-19 | Metanomics Health Gmbh | Means and methods diagnosing gastric bypass and conditions related thereto |
| EP2338989A1 (en) | 2008-08-26 | 2011-06-29 | Olympus Corporation | Method for preparing fecal sample, fecal sample preparation solution, and feces collection kit |
| CN102131928A (zh) | 2008-08-26 | 2011-07-20 | 奥林巴斯株式会社 | 粪便试样的调制方法、粪便试样调制用溶液、及粪便采集用试剂盒 |
| WO2010030997A1 (en) | 2008-09-12 | 2010-03-18 | The Washington University | Regulating intestinal microbiota dependent signaling as a means to modulate body fat and/or weight loss |
| US20100074872A1 (en) | 2008-09-25 | 2010-03-25 | New York University | Compositions and methods for characterizing and restoring gastrointestinal, skin, and nasal microbiota |
| EP2337569A2 (en) | 2008-09-25 | 2011-06-29 | New York University | Compositions and methods for characterizing and restoring gastrointestinal, skin, and nasal microbiota |
| WO2010062369A2 (en) | 2008-11-03 | 2010-06-03 | Tufts University | Methods and compositions for inhibiting clostridium difficile spore germination and outgrowth |
| US20120020950A1 (en) | 2008-12-02 | 2012-01-26 | Summit Corporation Plc | Antibacterial compounds |
| US20100215745A1 (en) | 2009-02-25 | 2010-08-26 | Neuroscienze Pharmaness S.C. A.R.L. | Compositions of spores of non pathogenic bacteria |
| US20120128633A1 (en) | 2009-04-30 | 2012-05-24 | Campagnie Gervaise Donone | Use of collinsella aerofaciens for reducing bloating |
| US20120128634A1 (en) | 2009-04-30 | 2012-05-24 | Campagnie Gervaise Donone | Use of collinsella aerofaciens for reducing bloating |
| WO2010124387A1 (en) | 2009-05-01 | 2010-11-04 | Micropharma Limited | Bacterial compositions for prophylaxis and treatment of degenerative disease |
| US20120207726A1 (en) | 2009-06-16 | 2012-08-16 | The Trustees Of Columbia University In The City Of New York | Autism-associated biomarkers and uses thereof |
| WO2010151842A2 (en) | 2009-06-26 | 2010-12-29 | The Regents Of The University Of California | Methods and systems for phylogenetic analysis |
| US20120165215A1 (en) | 2009-06-26 | 2012-06-28 | The Regents Of The University Of California | Methods and systems for phylogenetic analysis |
| US20120264637A1 (en) | 2009-06-26 | 2012-10-18 | The Regents Of The University Of California | Methods and systems for phylogenetic analysis |
| WO2011005756A1 (en) | 2009-07-06 | 2011-01-13 | Puretech Ventures, Llc | Delivery of agents targeted to microbiota niches |
| US20120148629A1 (en) | 2009-08-18 | 2012-06-14 | Nestec S.A. | Nutritional composition comprising lactococcus strains and reducing allergy symptoms, especially in infants and children |
| WO2011022542A2 (en) | 2009-08-19 | 2011-02-24 | Puretech Ventures, Llc | Administration of factors normally present in a microbial niche to improve health |
| WO2011022660A1 (en) | 2009-08-21 | 2011-02-24 | Puretech Ventures, Llc | Methods of diagnosing and treating microbiome-associated disease using interaction network parameters |
| US20120149584A1 (en) | 2009-08-21 | 2012-06-14 | Bernat Olle | Methods of diagnosing and treating microbiome-associated disease using interaction network parameters |
| WO2011033310A1 (en) | 2009-09-17 | 2011-03-24 | William John Martin | Encapsulated intestinal flora extracted from feces for use in the treatment of gastrointestinal disorders |
| US20120177650A1 (en) | 2009-09-23 | 2012-07-12 | Borody Thomas J | Therapy for enteric infections |
| US20120238468A1 (en) | 2009-10-05 | 2012-09-20 | Aak Patent B.V. | Methods for diagnosing irritable bowel syndrome |
| WO2011043654A1 (en) | 2009-10-05 | 2011-04-14 | Aak Patent B.V. | Methods for diagnosing irritable bowel syndrome |
| US20110081320A1 (en) | 2009-10-06 | 2011-04-07 | Nubiome, Inc. | Treatment/Cure of Autoimmune Disease |
| WO2011046616A2 (en) | 2009-10-15 | 2011-04-21 | New York University | Methods for modulating bacterial infection |
| WO2011046616A3 (en) | 2009-10-15 | 2011-08-11 | New York University | Methods for modulating bacterial infection |
| US20120276149A1 (en) | 2009-10-15 | 2012-11-01 | Dan Littman | Methods for modulating bacterial infection |
| US20120276201A1 (en) | 2009-12-31 | 2012-11-01 | Ira Milton Trachtman | Compositions and method for treatment and prophylaxis of inflammatory bowel disease |
| EP2519108A1 (en) | 2009-12-31 | 2012-11-07 | Ira Milton Trachtman | Compositions and method for treatment and prophylaxis of inflammatory bowel disease |
| US20110189132A1 (en) | 2010-02-01 | 2011-08-04 | Microbios, Inc. | Microbial product containing multiple microorganisms |
| US20130045274A1 (en) | 2010-02-01 | 2013-02-21 | Mikrobex | Bacteriotherapy for clostridium difficile colitis |
| WO2011094027A1 (en) | 2010-02-01 | 2011-08-04 | Hlavka Edwin J | Bacteriotherapy for clostridium difficile colitis |
| WO2011103123A2 (en) | 2010-02-16 | 2011-08-25 | Arizona Technology Enterprises | Reducing short-chain fatty acids and energy uptake in obese humans by managing their intestinal microbial communities |
| WO2011107481A2 (en) | 2010-03-01 | 2011-09-09 | Institut National De La Recherche Agronomique | Method of diagnostic of inflammatory bowel diseases |
| US20130045874A1 (en) | 2010-03-01 | 2013-02-21 | Institut National De La Recherche Agronomique | Method of Diagnostic of Inflammatory Bowel Diseases |
| WO2011107482A2 (en) | 2010-03-01 | 2011-09-09 | Institut National De La Recherche Agronomique | Method of diagnostic of obesity |
| EP2626076A1 (en) | 2010-03-08 | 2013-08-14 | Probiotical S.p.a. | Composition comprising probiotic bacteria for the treatment of pathologies associated with alterations of the immune system |
| WO2011113801A1 (en) | 2010-03-16 | 2011-09-22 | Universiteit Gent | Use of clostridium perfringens strain 23 to protect against necrotic enteritis |
| US20110280840A1 (en) | 2010-05-04 | 2011-11-17 | New York University | Compositions and methods for treating obesity and related disorders by characterizing and restoring mammalian bacterial microbiota |
| WO2011152566A2 (en) | 2010-06-04 | 2011-12-08 | The University Of Tokyo | Composition for inducing proliferation or accumulation of regulatory t cells |
| US20130149339A1 (en) | 2010-06-04 | 2013-06-13 | The University Of Tokyo | Composition for inducing proliferation or accumulation of regulatory t cells |
| US20130149375A1 (en) | 2010-07-06 | 2013-06-13 | Andrew Geall | Immunisation of large mammals with low doses of rna |
| WO2012009712A2 (en) | 2010-07-16 | 2012-01-19 | The Board Of Trustees Of The University Of Arkansas | Methods and compositions including spore-forming bacteria for increasing the health of animals |
| WO2012016287A2 (en) | 2010-08-04 | 2012-02-09 | Borody Thomas J | Compositions for fecal floral transplantation and methods for making and using them and devices for deuvering them |
| US20120058094A1 (en) | 2010-08-20 | 2012-03-08 | Dow Global Technologies Llc | Compositions and methods for treating obesity and related disorders by characterizing and restoring mammalian bacterial microbiota |
| WO2012033814A2 (en) | 2010-09-10 | 2012-03-15 | Viropharma Incorporated | Environmental clostridial bacteriotherapy and related formulations and methods of manufacture and use |
| WO2012045150A1 (en) | 2010-10-04 | 2012-04-12 | British Columbia Cancer Agency Branch | Detection of fusobacterium in a gastrointestinal sample to diagnose gastrointestinal cancer |
| WO2012064981A2 (en) | 2010-11-10 | 2012-05-18 | National Jewish Health | Methods to test allergic conditions |
| US20120064592A1 (en) | 2011-01-26 | 2012-03-15 | Qteros, Inc. | Biocatalysts synthesizing deregulated cellulases |
| WO2012108830A1 (en) | 2011-02-09 | 2012-08-16 | Lavivo Ab | Synbiotic compositions for restoration and reconstitution of gut microbiota |
| WO2012116289A2 (en) | 2011-02-25 | 2012-08-30 | Tricorder Diagnostics, Llc | Microbial signatures as indicators of radiation exposure |
| WO2012122522A2 (en) | 2011-03-09 | 2012-09-13 | Washington University | Cultured collection of gut microbial community |
| US20140147417A1 (en) * | 2011-03-09 | 2014-05-29 | Regents Of The University Of Minnesota | Compositions and methods for transplantation of colon microbiota |
| WO2012122478A1 (en) | 2011-03-09 | 2012-09-13 | Regents Of The University Of Minnesota | Compositions and methods for transplantation of colon microbiota |
| US20140045744A1 (en) | 2011-03-09 | 2014-02-13 | The Washington University | Cultured collection of gut microbial community |
| WO2012142605A1 (en) | 2011-04-15 | 2012-10-18 | Samaritan Health Services | Rapid recolonization deployment agent |
| WO2012148991A1 (en) | 2011-04-26 | 2012-11-01 | Bochenek Wieslaw J | A method for use of biologic agents including live or dormant forms of bacteria and other organisms in treating infections, inflammation and other diseases of distal small intestine and large intestine |
| WO2012159023A2 (en) | 2011-05-19 | 2012-11-22 | Virginia Commonwealth University | Gut microflora as biomarkers for the prognosis of cirrhosis and brain dysfunction |
| US20120315249A1 (en) | 2011-06-10 | 2012-12-13 | Olmstead Stephen F | Pharmaceutical compositions containing pediococcus and methods for reducing the symptoms of gastroenterological syndromes |
| US20130017999A1 (en) | 2011-07-14 | 2013-01-17 | Marc Fremont | Methods and Compositions for Evaluating and/or Treating Chronic Immune Diseases |
| US20130022575A1 (en) | 2011-07-19 | 2013-01-24 | Microbial Rx | Systems and methods of replacing intestinal flora |
| WO2013019896A1 (en) | 2011-08-01 | 2013-02-07 | Symbiotix Biotherapies, Inc. | Platform for identifying and/or characterizing immunomodulatory agents |
| WO2013032328A1 (en) | 2011-08-30 | 2013-03-07 | Academisch Medisch Centrum | Method for preventing and/or treating insulin resistance |
| WO2013037067A1 (en) | 2011-09-14 | 2013-03-21 | University Of Guelph | Media supplements and methods to culture human gastrointestinal anaerobic microorganisms |
| WO2013037068A1 (en) | 2011-09-14 | 2013-03-21 | Queen's University At Kingston | Method for treatment of disorders of the gastrointestinal system |
| US20130121968A1 (en) | 2011-10-03 | 2013-05-16 | Atossa Genetics, Inc. | Methods of combining metagenome and the metatranscriptome in multiplex profiles |
| WO2013053836A1 (en) | 2011-10-11 | 2013-04-18 | Quantum Pharmaceuticals Sa | Composition comprising anaerobically cultivated human intestinal microbiota |
| EP2750682B1 (en) | 2011-10-11 | 2016-05-18 | Achim Biotherapeutics AB | Composition comprising anaerobically cultivated human intestinal microbiota |
| WO2013080561A1 (en) | 2011-12-01 | 2013-06-06 | University Of Tokyo | Human-derived bacteria that induce proliferation or accumulation of regulatory t cells |
| WO2013166031A1 (en) | 2012-04-30 | 2013-11-07 | The Washington University | Method of isolating and characterizing microorganisms that are targets of host immune responses |
| WO2013171515A1 (en) | 2012-05-18 | 2013-11-21 | Genome Research Limited | Methods and groups |
| WO2013176774A1 (en) | 2012-05-25 | 2013-11-28 | Arizona Board Of Regents | Microbiome markers and therapies for autism spectrum disorders |
| EP2684469A1 (en) | 2012-07-13 | 2014-01-15 | Nederlandse Organisatie voor toegepast -natuurwetenschappelijk onderzoek TNO | Methods for strengthening and assessment of the natural defence of the colon against C. difficile overgrowth |
| WO2014015319A1 (en) | 2012-07-20 | 2014-01-23 | Verinata Health, Inc. | System for determining a copy number variation |
| US9028841B2 (en) | 2012-11-23 | 2015-05-12 | Seres Health, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| US8906668B2 (en) | 2012-11-23 | 2014-12-09 | Seres Health, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| WO2014082050A1 (en) | 2012-11-23 | 2014-05-30 | Seres Health, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| US20140199281A1 (en) | 2012-11-23 | 2014-07-17 | Seres Health, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| US20150190435A1 (en) | 2012-11-23 | 2015-07-09 | Seres Health, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| WO2014121301A1 (en) | 2013-02-04 | 2014-08-07 | Seres Health, Inc. | Compositions and methods for inhibition of pathogenic bacterial growth |
| US9011834B1 (en) | 2013-02-04 | 2015-04-21 | Seres Health, Inc. | Compositions and methods |
| WO2014121302A2 (en) | 2013-02-04 | 2014-08-07 | Seres Health, Inc. | Compositions and methods |
| US9180147B2 (en) | 2013-02-04 | 2015-11-10 | Seres Therapeutics, Inc. | Compositions and methods |
| WO2014121304A1 (en) | 2013-02-04 | 2014-08-07 | Seres Health, Inc. | Compositions and methods |
| WO2014121298A2 (en) | 2013-02-04 | 2014-08-07 | Seres Health, Inc. | Methods of populating a gastrointestinal tract |
| US9446080B2 (en) | 2013-02-04 | 2016-09-20 | Seres Therapeutics, Inc. | Compositions and methods |
| WO2014145958A2 (en) | 2013-03-15 | 2014-09-18 | Seres Health, Inc. | Network-based microbial compositions and methods |
| WO2015077794A1 (en) | 2013-11-25 | 2015-05-28 | Seres Health, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| WO2015095241A2 (en) | 2013-12-16 | 2015-06-25 | Seres Health, Inc. | Bacterial compositions and methods of use thereof for treatment of immune system disorders |
| US20160271188A1 (en) | 2014-11-25 | 2016-09-22 | Epiva Biosciences, Inc. | Probiotic and prebiotic compositions, and methods of use thereof for treatment of gastrointestinal disorders |
Non-Patent Citations (356)
| Title |
|---|
| "Potentials of Probiotics in Pig Nutrition," AllAboutFeed News, Jan. 31, 2007, 6 pages. |
| Aas, J., Gessert, C.E., and Bakken, J.S. (2003). Recurrent Clostridium difficile colitis: case series involving 18 patients treated with donor stool administered via a nasogastric tube. Clinical Infectious Diseases 36(5), 580-585. |
| Abrams, R.S., "Open-Label, Uncontrolled Trial of Bowel Sterilization and Repopulation with Normal Bowel Flora for Treatment of Inflammatory Bowel Disease," Current Therapeutic Research, Dec. 1997, pp. 1001-1012, vol. 58, No. 12. |
| Accoceberry, I. et al., "One-Step Purification of Enterocytozoon Bieneusi Spores from Human Stools by Immunoaffinity Expanded-Bed Adsorption," Journal of Clinical Microbiology, May 2001, pp. 1974-1951, vol. 39, No. 5. |
| Achtman, M., and Wagner, M. (2008). Microbial diversity and the genetic nature of microbial species. Nat. Rev. Microbiol. 6(6), 431-440. |
| Allen-Vercoe, E., Reid, G., Viner, N., Gloor, G.B., Hota, S., Kim, P., Lee, C., O'Doherty, K., Vanner, S.J., Weese, J.S., et al. (2012). A Canadian Working Group report on fecal microbial therapy: microbial ecosystems therapeutics. Can. J. Gastroenterol. 26(7), 457-462. |
| Allen-Vercoe, E., Strauss, J., and Chadee, K. (2011). Fusobacterium nucleatum: an emerging gut pathogen? Gut Microbes 2(5), 294-298. |
| Anderson, K.F., Lonsway, D.R., Rasheed, J.K., Biddle, J., Jensen, B., McDougal, L.K., Carey, R.B., Thompson, A., Stocker, S., Limbago, B., et al. (2007). Evaluation of Methods to Identify the Klebsiella pneumoniae Carbapenemase in Enterobacteriaceae. J. Clin. Microbiol. 45(8), 2723-2725. |
| Arumugam, M., Raes, J., Pelletier, E., Paslier, D.L., Yamada, T., Mende, D.R., Fernandes, G.R., Tap, J., Bruls, T., Batto, J.-M., et al. (2011). Enterotypes of the human gut microbiome. Nature 473(7346), 174-180. |
| Atarashi, K., Tanoue, T., Oshima, K., Suda, W., Nagano, Y., Nishikawa, H., Fukuda, S., Saito, T., Narushima, S., Hase, K., et al. (2013). Treg induction by a rationally selected mixture of Clostridia strains from the human microbiota. Nature 500(7461), 232-236. |
| Atarashi, K., Tanoue, T., Shima, T., Imaoka, A., Kuwahara, T., Momose, Y., Cheng, G., Yamasaki, S., Saito, T., Ohba, Y., et al. (2011). Induction of colonic regulatory T cells by indigenous Clostridium species. Science 331(6015), 337-341. |
| Australian First Examination Report, Australian Application No. 2013347805, dated Apr. 13, 2017, 3 pages. |
| Backhed, F. et al., (2004). The gut microbiota as an environmental factor that regulates fat storage, PNAS, Nov. 2, 2014, pp. 15718-15723, vol. 101, No. 44. |
| Bader, J., Albin, A., and Stahl, U. (2012). Spore-forming bacteria and their utilisation as probiotics. Benef Microbes 3(1), 67-75. |
| Bakken, J.S. (2009). Fecal bacteriotherapy for recurrent Clostridium difficile infection. Anaerobe 15(6), 285-289. |
| Bakken, J.S., Borody, T., Brandt, L.J., Brill, J.V., Demarco, D.C., Franzos, M.A., Kelly, C., Khoruts, A., Louie, T., Martinelli, L.P., et al. (2011). Treating Clostridium difficile infection with fecal microbiota transplantation. Clin. Gastroenterol. Hepatol. 9(12), 1044-1049. |
| Barreau, M., Pagnier, I., and La Scola, B. (2013). Improving the identification of anaerobes in the clinical microbiology laboratory through MALDI-TOF mass spectrometry. Anaerobe 22,123-125. |
| Bauer, T.M. et al., "Derivation and Validation of Guidelines for Stool Cultures for Enteropathogenic Bacteria Other Than Clostridium difficile in Hospitalized Adults," The Journal of the American Medical Association, Jan. 17, 2001, pp. 313-319, vol. 285. |
| Ben-Amor, K., Heilig, H., Smidt, H., Vaughan, E.E., Abee, T., and De Vos, W.M. (2005). Genetic diversity of viable, injured, and dead fecal bacteria assessed by fluorescence-activated cell sorting and 16S rRNA gene analysis. Applied and Environmental Microbiology 71(8), 4679-4689. |
| Berstad, A. et al., "Fecal Fat Determination with a Modified Titration Method," Scandinavian Journal of Gastroenterology, 2010, pp. 603-607, vol. 45. |
| Bhatia, A. et al., "Proionibacterium Acnes and Chronic Diseases," The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effects: Workshop Summary., Knobler, S.L. et al. (eds.), 2004, pp. 74-80, may be downloaded at<URL:http://www.nap.edu/catalog/11026.html>. |
| Bidawid, S., Farber, J.M., Sattar, S.A., and Hayward, S. (2000). Heat inactivation of hepatitis A virus in dairy foods. J. Food Prot. 63(4), 522-528. |
| Bloedt, K., Riecker, M., Poppert, S., and Wellinghausen, N. (2009). Evaluation of new selective culture media and a rapid fluorescence in situ hybridization assay for identification of Clostridium difficile from stool samples. J Med Microbiol 58(7), 874-877. |
| Bokulich, N.A., Subramanian, S., Faith, J.J., Gevers, D., Gordon, J.I., Knight, R., Mills, D.A., and Caporaso, J.G. (2013). Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat Methods 10(1), 57-59. |
| Bolivar, I. et al., "Bacterial Diversity in Oral Samples of Children in Niger with Acute Noma, Acute Necrotizing Gingivitis and Healthy Controls," PLOS Neglected Tropical Diseases, Mar. 2012, pp. 1-11, vol. 6, No. 3, E1556; Uncultured Catonella sp. partial 16S rRNA Gene, Clone 402A04(oral): Nucleotide: NCBI: GenBank: AM420133.1, last accessed Mar. 12, 2014, pp. 12-13. |
| Borody, T.J. et al. (2011). Fecal microbiota transplantation (FMT) in multiple sclerosis. Poster abstract at American College of Gastroenterology Annual Scientific Meeting and Postgraduate Course Oct. 28, 2011. |
| Borody, T.J., and Khoruts, A. (2012). Fecal microbiota transplantation and emerging applications. Nat Rev Gastroenterol Hepatol 9(2), 88-96. |
| Borriello, S.P. (1990). The influence of the normal flora on Clostridium difficile colonisation of the gut. Ann. Med. 22(1), 61-67. |
| Borriello, S.P., and Barclay, F.E. (1985). Protection of hamsters against Clostridium difficile ileocaecitis by prior colonisation with non-pathogenic strains. J Med Microbiol 19(3), 339-350. |
| Borriello, S.P., and Barclay, F.E. (1986). An in-vitro model of colonisation resistance to Clostridium difficile infection. Journal of Medical Microbiology 21(4), 299-309. |
| Borriello, S.P., and Honour, P. (1981). Simplified procedure for the routine isolation of Clostridium difficile from faeces. J Clin Pathol 34(10), 1124-1127. |
| Boyles, W.A., and Lincoln, R.E. (1958). Separation and concentration of bacterial spores and vegetative cells by foam flotation. Appl Microbiol 6(5), 327-334. |
| Brandt, L.J. (2012). Fecal Transplantation for the Treatment of Clostridium difficile Infection. Gastroenterol Hepatol (N Y) 8(3), 191-194. |
| Brandt, L.J., Aroniadis, O.C., Mellow, M., Kanatzar, A., Kelly, C., Park, T., Stollman, N., Rohlke, F., and Surawicz, C. (2012). Long-Term Follow-Up of Colonoscopic Fecal Microbiota Transplant for Recurrent Clostridium difficile Infection. The American Journal of Gastroenterology 107(7), 1079-1087. |
| Bräuniger, S., Peters, J., Borchers, U., and Kao, M. (2000). Further studies on thermal resistance of bovine parvovirus against moist and dry heat. International Journal of Hygiene and Environmental Health 203(1), 71-75. |
| Broda, D.M., De Lacy, K.M., and Bell, R.G. (1998). Efficacy of heat and ethanol spore treatments for the isolation of psychrotrophic Clostridium spp. associated with the spoilage of chilled vacuum-packed meats. International Journal of Food Microbiology 39(1-2), 61-68. |
| Brosius, J. et al., "Complete Nucleotide Sequence of a 16S Ribosomal RNA Gene from Eschericia coli," Proc. Natl. Acad. Sci., Oct. 1978, pp. 4801-4805, vol. 75, No. 10. |
| Bueche, M., Wunderlin, T., Roussel-Delif, L., Junier, T., Sauvain, L., Jeanneret, N., and Junier, P. (2013). Quantification of Endospore-Forming Firmicutes by Quantitative PCR with the Functional Gene spo0A. Applied and Environmental Microbiology 79(17), 5302-5312. |
| Buffie, C.G., and Pamer, E.G. (2013). Microbiota-mediated colonization resistance against intestinal pathogens. Nature Reviews Immunology 13(11), 790-801. |
| Burke, C.J., Hsu, T.A., and Volkin, D.B. (1999). Formulation, stability, and delivery of live attenuated vaccines for human use. Crit Rev Ther Drug Carrier Syst 16(1), 1-83. |
| Cani, P.D., Possemiers, S., Wiele, T.V. De, Guiot, Y., Everard, A., Rottier, O., Geurts, L., Naslain, D., Neyrinck, A., Lambert, D.M., et al. (2009). Changes in gut microbiota control inflammation in obese mice through a mechanism involving GLP-2-driven improvement of gut permeability. Gut 58(8), 1091-1103. |
| Carvalho, A.S., Silva, J., Ho, P., Teixeira, P., Malcata, F.X., and Gibbs, P. (2008). Effects of Various Sugars Added to Growth and Drying Media upon Thermotolerance and Survival throughout Storage of Freeze-Dried Lactobacillus delbrueckii ssp. bulgaricus. Biotechnology Progress 20(1), 248-254. |
| Champagne, C.P., Mondou, F., Raymond, Y., and Roy, D. (1996). Effect of polymers and storage temperature on the stability of freeze-dried lactic acid bacteria. Food Research International 29(5-6), 555-562. |
| Chang, J.Y., Antonopoulos, D.A., Kalra, A., Tonelli, A., Khalife, W.T., Schmidt, T.M., and Young, V.B. (2008). Decreased diversity of the fecal Microbiome in recurrent Clostridium difficile-associated diarrhea. J. Infect. Dis. 197(3), 435-438. |
| Chapman, C.M.C., Gibson, G.R., and Rowland, I. (2012). In vitro evaluation of single- and multi-strain probiotics: Inter-species inhibition between probiotic strains, and inhibition of pathogens. Anaerobe 18(4), 405-413. |
| Chen, X., Katchar, K., Goldsmith, J.D., Nanthakumar, N., Cheknis, A., Gerding, D.N., and Kelly, C.P. (2008). A Mouse Model of Clostridium difficile- Associated Disease. Gastroenterology 135(6), 1984-1992. |
| Chiu, C-H. et al., "Rapid Identification of Salmonella serovars in Feces by Specific Detection of Virulence Genes, invA and spvC, by an Enrichment Broth Culture-Multiplex PCR Combination Assay," Journal of Clinical Microbiology, Oct. 1996, pp. 2619-2622, vol. 34, No. 10. |
| Chow, J., Tang, H., and Mazmanian, S.K. (2011). Pathobionts of the Gastrointestinal Microbiota and Inflammatory Disease. Curr Opin Immunol 23(4), 473-480. |
| Claesson, M.J., Wang, Q., O'Sullivan, O., Greene-Diniz, R., Cole, J.R., Ross, R.P., and O'Toole, P.W. (2010). Comparison of two next-generation sequencing technologies for resolving highly complex microbiota composition using tandem variable 16S rRNA gene regions. Nucleic Acids Res 38(22), e200. |
| Clemente, J.C., Ursell, L.K., Parfrey, L.W., and Knight, R. (2012). The impact of the gut microbiota on human health: an integrative view. Cell 148(6), 1258-1270. |
| Coleman, W.H., "Mechanism of Killing Spores of Bacillus Cereus and Bacillus Megaterium by Wet Heat," The Society for Applied Microbiology, Letters in Applied Microbiology, 2010. pp. 507-514, vol. 50. |
| David, L.A., Maurice, C.F., Carmody, R.N., Gootenberg, D.B., Button, J.E., Wolfe, B.E., Ling, A.V., Devlin, A.S., Varma, Y., Fischbach, M.A., et al. (2013). Diet rapidly and reproducibly alters the human gut microbiome. Nature advance online publication. |
| De Angelis, M., Piccolo, M., Vannini, L., Siragusa, S., De Giacomo, A., Serrazzanetti, D.I., Cristofori, F., Guerzoni, M.E., Gobbetti, M., and Francavilla, R. (2013). Fecal Microbiota and Metabolome of Children with Autism and Pervasive Developmental Disorder Not Otherwise Specified. PLoS ONE 8(10), e76993. |
| De Vos, W.M. (2013). Fame and future of faecal transplantations—developing next-generation therapies with synthetic microbiomes: Fame and future of faecal transplantations. Microbial Biotechnology 6(4), 316-325. |
| Defined Fecal Microbiota Transplantation for Clostridium Difficile Diarrhea. <http://clinicaltrials.gov/ct2/show/NCT01868373> Accessed Mar. 26, 2014. |
| Dendukuri, N., "Probiotic Therapy for the Prevention and Treatment of Clostridium Difficile-Associated Diarrhea: A Systematic Review," Canadian Medical Association Journal, Jul. 19, 2005, pp. 167-170, vol. 173, No. 2. |
| Derrien, M. (2004). Akkermansia muciniphila gen. nov., sp. nov., a human intestinal mucin-degrading bacterium. International Journal of Systematic and Evolutionary Microbiology 54(5), 1469-1476. |
| Dethlefsen, L., Huse, S., Sogin, M.L., and Relman, D.A. (2008). The Pervasive Effects of an Antibiotic on the Human Gut Microbiota, as Revealed by Deep 16S rRNA Sequencing. PLoS Biology 6(11), e280. |
| Detmer, A., and Glenting, J. (2006). Live bacterial vaccines—a review and identification of potential hazards. Microb Cell Fact 5, 23. |
| Dezfulian, M. et al., "Selective Medium for Isolation of Clostridium botulinum from Human Feces," Journal of Clinical Microbiology, Mar. 1981, pp. 526-531, vol. 13, No. 3. |
| Dharmani, P., De Simone, C., and Chadee, K. (2013). The Probiotic Mixture VSL#3 Accelerates Gastric Ulcer Healing by Stimulating Vascular Endothelial Growth Factor. PLoS ONE 8(3), e58671. |
| Dietrich, G., Collioud, A., and Rothen, S.A. (2008). Developing and Manufacturing Attenuated Live Bacterial Vaccines. <http://www.biopharminternational.com/biopharm/Vaccine+Manufacturing+Articles/Developing-and-Manufacturing-Attenuated-Live-Bacte/ArticleStandard/Article/detail/557306> Accessed Mar. 25, 2014. |
| Dowell, V.R. et al., "Coproexamination for Botulinal Toxin and Clostridium botulinum," JAMA, Oct. 24, 1977, pp. 1829-1832, vol. 238, No. 7. |
| Dragon, D.C., and Rennie, R.P. (2001). Evaluation of spore extraction and purification methods for selective recovery of viable Bacillus anthracis spores. Lett. Appl. Microbiol. 33(2), 100-105. |
| D'Souza, D.H., and Su, X. (2010). Efficacy of chemical treatments against murine norovirus, feline calicivirus, and MS2 bacteriophage. Foodborne Pathogens and Disease 7(3), 319-326. |
| Duc, L. (2003). Germination of the spore in the gastrointestinal tract provides a novel route for heterologous antigen delivery. Vaccine 21(27-30), 4215-4224. |
| Duc, L.H., Hong, H.A., Fairweather, N., Ricca, E., and Cutting, S.M. (2003). Bacterial Spores as Vaccine Vehicles. Infection and Immunity 71(5), 2810-2818. |
| Dumas, M.E. et al., (2006). Metabolic profiling reveals a contribution of gut microbiota to fatty liver phenotype in insulin-resistant mice, PNAS, Aug. 15, 2006, pp. 12511-12516, vol. 103, No. 33. |
| Dutta, S.K., Girotra, M., Garg, S., Dutta, A., Von Rosenvinge, E.C., Maddox, C., Song, Y., Bartlett, J.G., Vinayek, R., and Fricke, W.F. (2014). Efficacy of Combined Jejunal and Colonic Fecal Microbiota Transplantation for Recurrent Clostridium difficile Infection. Clinical Gastroenterology and Hepatology. |
| Edwards, A.D., and Slater, N.K.H. (2008). Formulation of a live bacterial vaccine for stable room temperature storage results in loss of acid, bile and bile salt resistance. Vaccine 26(45), 5675-5678. |
| Eiseman, B., Silen, W., Bascom, G.S., and Kauvar, A.J. (1958). Fecal enema as an adjunct in the treatment of pseudomembranous enterocolitis. Surgery 44(5), 854-859. |
| Elving, J., Emmoth, E., Albihn, A., Vinneras, B., and Ottoson, J. (2012). Composting for Avian Influenza Virus Elimination. Applied and Environmental Microbiology 78(9), 3280-3285. |
| Emanuelsson, F., Claesson, B.E.B., Ljungström, L., Tvede, M., and Ung, K.-A. (2014). Faecal microbiota transplantation and bacteriotherapy for recurrent Clostridium difficile infection: A retrospective evaluation of 31 patients. Scandinavian Journal of Infectious Diseases 46(2), 89-97. |
| Endt, K., Stecher, B., Chaffron, S., Slack, E., Tchitchek, N., Benecke, A., Van Maele, L., Sirard, J.-C., Mueller, A.J., Heikenwalder, M., et al. (2010). The Microbiota Mediates Pathogen Clearance from the Gut Lumen after Non-Typhoidal Salmonella diarrhea. PLoS Pathog 6(9), e1001097. |
| European Examination Report, European Application No. 14746341.8, dated Jun. 13, 2017, 11 pages. |
| European Extended Search Report, European Application No. 13856249.1, dated Jan. 26, 2017, 19 pages. |
| European Extended Search Report, European Application No. 14745749.3, dated Jan. 23, 2017, 13 pages. |
| European Extended Search Report, European Application No. 14745792.3, dated Dec. 23, 2016, 17 pages. |
| European Extended Search Report, European Application No. 14746341.8, dated Sep. 28, 2016, 10 pages. |
| European Extended Search Report, European Application No. 14746455.6, dated Nov. 24, 2016, 10 pages. |
| European Extended Search Report, European Application No. 14763266.5, dated Aug. 16, 2016, 7 pages. |
| European Extended Search Report, European Application No. 14768281.9, dated Jul. 18, 2016, 10 pages. |
| European Partial Supplementary Report, European Application No. 14745749.3, dated Oct. 14, 2016, 6 pages. |
| European Partial Supplementary Report, European Application No. 14745792.3, dated Sep. 20, 2016, 11 pages. |
| Everard, A., Belzer, C., Geurts, L., Ouwerkerk, J.P., Druart, C., Bindels, L.B., Guiot, Y., Derrien, M., Muccioli, G.G., Delzenne, N.M., et al. (2013). Cross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity. Proceedings of the National Academy of Sciences 110(22), 9066-9071. |
| Fairhead, H., Setlow, B., Waites, W.M., and Setlow, P. (1994). Small, acid-soluble proteins bound to DNA protect Bacillus subtilis spores from being killed by freeze-drying. Applied and Environmental Microbiology 60(7), 2647-2649. |
| Faith, J.J., Ahern, P.P., Ridaura, V.K., Cheng, J., and Gordon, J.I. (2014). Identifying Gut Microbe—Host Phenotype Relationships Using Combinatorial Communities in Gnotobiotic Mice. Sci Transl Med 6(220), 220ra11-220ra11. |
| Fakhry, S., Sorrentini, I., Ricca, E., De Felice, M., and Baccigalupi, L. (2008). Characterization of spore forming Bacilli isolated from the human gastrointestinal tract. Journal of Applied Microbiology 105(6), 2178-2186. |
| Faust, et al., "Microbial Co-occurrence Relationships in the Human Microbiome," PLoS Computational Biology, Jul. 2012, e1002606, 17 pages, vol. 8, No. 7. |
| Fell Jr., N.F., Pellegrino, P.M., and Gillespie, J.B. (2001). Mitigating phosphate interference in bacterial endospore detection by Tb dipicolinate photoluminescence. Analytica Chimica Acta 426(1), 43-50. |
| Fichtel, J., Köster, J., Rullkötter, J., and Sass, H. (2007). Spore dipicolinic acid contents used for estimating the number of endospores in sediments. FEMS Microbiology Ecology 61(3), 522-532. |
| Fischbach, M.A., Bluestone, J.A., and Lim, W.A. (2013). Cell-Based Therapeutics: The Next Pillar of Medicine. Sci Transl Med 5(179), 179ps7. |
| Fonseca, F., Béal, C., and Corrieu, G. (2001). Operating Conditions That Affect the Resistance of Lactic Acid Bacteria to Freezing and Frozen Storage. Cryobiology 43(3), 189-198. |
| Franz, C.M.A.P., Huch, M., Abriouel, H., Holzapfel, W., and Gálvez, A. (2011). Enterococci as probiotics and their implications in food safety. International Journal of Food Microbiology 151(2), 125-140. |
| Friedman-Moraco, R.J., Mehta, A.K., Lyon, G.M., and Kraft, C.S. (2014). Fecal Microbiota Transplantation for Refractory Clostridium difficile Colitis in Solid Organ Transplant Recipients: Fecal Microbiota Transplantation in Solid Organ Transplant Recipients. American Journal of Transplantation 14(2), 477-480. |
| Fuentes, S., Van Nood, E., Tims, S., Heikamp-De Jong, I., Ter Braak, C.J., Keller, J.J., Zoetendal, E.G., and De Vos, W.M. (2014). Reset of a critically disturbed microbial ecosystem: faecal transplant in recurrent Clostridium difficile infection. The ISME Journal. |
| GenBank HQ819637, "Uncultured Organism Clone ELU0180-T56-S-NIPCRAMgANa_000311 Small Subunit Ribosomal RNA Gene, Partial Sequence," Jul. 30, 2012, 1 page, [Online] [Retrieved on Aug. 21, 2014] Retrieved from the Internet<URL:http://www.ncbi.nlm.nih.gov/nuccore/HQ819637>. |
| Gevers, D., Kugathasan, S., Denson, L.A., Vázquez-Baeza, Y., Van Treuren, W., Ren, B., Schwager, E., Knights, D., Song, S.J., Yassour, M., et al. (2014). The Treatment-Naive Microbiome in New-Onset Crohn's Disease. Cell Host & Microbe 15(3), 382-392. |
| Gilligan, P.H. (2013). Identification of Pathogens by Classical Clinical Tests. In the Prokaryotes, E. Rosenberg, E.F. DeLong, S. Lory, E. Stackebrandt, and F. Thompson, eds. (Springer Berlin Heidelberg), pp. 57-89. |
| Goodman, A.L., Kallstrom, G., Faith, J.J., Reyes, A., Moore, A., Dantas, G., and Gordon, J.I. (2011). From the Cover: Extensive personal human gut microbiota culture collections characterized and manipulated in gnotobiotic mice. Proceedings of the National Academy of Sciences 108(15), 6252-6257. |
| Goodman, N.S., Gottfried, R.J., and Rogoff, M.H. (1967). Biphasic system for separation of spores and crystals of Bacillus thuringiensis. Journal of Bacteriology 94(2), 485. |
| Gough, E. et al., "Systematic Review of Intestinal Microbiota Transplantation (Fecal Bacteriotherapy) for Recurrent Clostridium Dfficile Infection," Clin. Infect. Dis., Nov. 15, 2011, pp. 994-1002, vol. 53, No. 10. |
| Gould, G.W., and Sale, A.J. (1970). Initiation of germination of bacterial spores by hydrostatic pressure. J. Gen. Microbiol. 60(3), 335-346. |
| Grabow, W.O., Clay, C.G., Dhaliwal, W., Vrey, M.A., and Müller, E.E. (1999). Elimination of viruses, phages, bacteria and Cryptosporidium by a new generation Aquaguard point-of-use water treatment unit. Zentralbl Hyg Umweltmed 202(5), 399-410. |
| Greenway, F., Wang, S., and Heiman, M. (2014). A novel cobiotic containing a prebiotic and an antioxidant augments the glucose control and gastrointestinal tolerability of metformin: a case report. Beneficial Microbes 5(1), 29-32. |
| Grehan, M.J., Borody, T.J., Leis, S.M., Campbell, J., Mitchell, H., and Wettstein, A. (2010). Durable alteration of the colonic microbiota by the administration of donor fecal flora. J. Clin. Gastroenterol. 44(8), 551-561. |
| Grimoud, J. et al., "In Vitro Screening of Probiotic Lactic Acid Bacteria and Prebiotic Glucooligosaccharides to Select Effective Synbiotics," Anaerobe, Clinical Microbiology, Oct. 2010, pp. 493-500, vol. 16, No. 5. |
| Gupta, R.K. et al., "Differentiation Between Heat Resistance and Octyl Alcohol Resistance of the Cells of Bacillus Cereus T.," Biochemical and Biophysical Research Communications, 1970, pp. 23-30, vol. 38, No. 1. |
| Halmann, M. et al., "Stages in Germination of Spores of Bacillus Lichenformis," J. Bacteriol., 1962, pp. 1187-1193, vol. 84. |
| Hamilton, M.J., Weingarden, A.R., Sadowsky, M.J., and Khoruts, A. (2012). Standardized frozen preparation for transplantation of fecal microbiota for recurrent Clostridium difficile infection. Am. J. Gastroenterol. 107(5), 761-767. |
| Hamilton, M.J., Weingarden, A.R., Unno, T., Khoruts, A., and Sadowsky, M.J. (2013). High-throughput DNA sequence analysis reveals stable engraftment of gut microbiota following transplantation of previously frozen fecal bacteria. Gut Microbes 4(2), 125-135. |
| Harmsen, H. J. M., Gibson, G. R., Elfferich, P., Raangs, G. C., Wildeboer-Veloo, A. C. M., Argaiz, A., Roberfroid, M. B., and Welling, G. W. (2000). Comparison of viable cell counts and fluorescence in situ hybridization using specific rRNA-based probes for the quantification of human fecal bacteria. FEMS Microbiology Letters 183(1), 125-129. |
| Harrison, F., "Bacterial Cooperation in the Wild and in the Clinic: Are Pathogen Social Behaviours Relevant Outside the Laboratory?" Bioessays, Dec. 27, 2012, pp. 108-112, vol. 35, No. 2. |
| Hasan, J.A., Japal, K.M., Christensen, E.R., and Samalot-Freire, L.C. (2011). In vitro production of Clostridium difficile spores for use in the efficacy evaluation of disinfectants: a precollaborative investigation. J AOAC Int 94(1), 259-272. |
| Hayashi, Y. et al., "Western Blot (Immunoblot) Assay of Small Round-Structured Virus Associated with an Acute Gastroenteritis Outbreak in Tokyo," Journal of Clinical Microbiology, Aug. 1989, pp. 1728-1733, vol. 27. |
| Hell, M., Bernhofer, C., Stalzer, P., Kern, J.M., and Claassen, E. (2013). Probiotics in Clostridium difficile infection: reviewing the need for a multistrain probiotic. Beneficial Microbes 4(1), 39-51. |
| Hemmerling, A., Harrison, W., Schroeder, A., Park, J., Korn, A., Shiboski, S., Foster-Rosales, A., and Cohen, C.R. (2010). Phase 2a Study Assessing Colonization Efficiency, Safety, and Acceptability of Lactobacillus crispatus CTV-05 in Women With Bacterial Vaginosis: Sexually Transmitted Diseases 37(12), 745-750. |
| Herron, P.R., and Wellington, E.M.H. (1990). New Method for Extraction of Streptomycete Spores from Soil and Application to the Study of Lysogeny in Sterile Amended and Nonsterile Soil. Appl Environ Microbiol 56(5), 1406-1412. |
| Hewitt, J., Rivera-Aban, M., and Greening, G.E. (2009). Evaluation of murine norovirus as a surrogate for human norovirus and hepatitis A virus in heat inactivation studies. Journal of Applied Microbiology 107(1), 65-71. |
| Hindle, A.A., and Hall, E.A.H. (1999). Dipicolinic acid (DPA) assay revisited and appraised for spore detection. The Analyst 124(11), 1599-1604. |
| Hirsch, E.B., and Tam, V.H. (2010). Detection and treatment options for Klebsiella pneumoniae carbapenemases (KPCs): an emerging cause of multidrug-resistant infection. J. Antimicrob. Chemother. 65(6), 1119-1125. |
| Hofsten, B.V. (1966). Partition of Escherichia coli in an aqueous polymer two-phase system. Experimental Cell Research 41(1), 117-123. |
| Holmes, E., Kinross, J., Gibson, G.R., Burcelin, R., Jia, W., Pettersson, S., and Nicholson, J.K. (2012). Therapeutic Modulation of Microbiota-Host Metabolic Interactions. Science Translational Medicine 4(137), 137rv6-137rv6. |
| Hoppe, B., Groothoff, J.W., Hulton, S.-A., Cochat, P., Niaudet, P., Kemper, M.J., Deschênes, G., Unwin, R., and Milliner, D. (2011). Efficacy and safety of Oxalobacter formigenes to reduce urinary oxalate in primary hyperoxaluria. Nephrol. Dial. Transplant. 26(11), 3609-3615. |
| Hoyles, L., Honda, H., Logan, N.A., Halket, G., La Ragione, R.M., and McCartney, A.L. (2012). Recognition of greater diversity of Bacillus species and related bacteria in human faeces. Res. Microbiol. 163(1), 3-13. |
| Hurst, C.J., and Gerba, C.P. (1989). Fate of viruses during wastewater sludge treatment processes. Critical Reviews in Environmental Control 18(4), 317-343. |
| Iizuka, M. et al., "Elemental Diet Modulates the Growth of Clostridium difficile in the Gut Flora," Aliment Pharmacol. Ther., Jul. 2004, pp. 151-157, vol. 20, Suppl. 1. |
| International Search Report and Written Opinion, PCT Application No. PCT/US2014/030817, dated Dec. 5, 2014, 16 pages. |
| Israel Office Action, Israel Application No. 238973, dated Apr. 20, 2017, 4 pages (with concise explanation of relevance). |
| Itoh, K., and Mitsuoka, T. (1985). Characterization of clostridia isolated from faeces of limited flora mice and their effect on caecal size when associated with germ-free mice. Laboratory Animals 19(2), 111-118. |
| Itoh, K., Lee, W.K., Kawamura, H., Mitsuoka, T., and Magaribuchi, T. (1987). Intestinal bacteria antagonistic to Clostridium difficile in mice. Lab Anim 21(1), 20-25. |
| Itoh, K., Urano, T., and Mitsuoka, T. (1986). Colonization resistance against Pseudomonas aeruginosa in gnotobiotic mice. Lab Anim 20(3), 197-201. |
| Jalanka-Tuovinen, J., Salojarvi, J., Salonen, A., Immonen, O., Garsed, K., Kelly, F.M., Zaitoun, A., Palva, A., Spiller, R.C., and De Vos, W.M. (2013). Faecal microbiota composition and host-microbe cross-talk following gastroenteritis and in postinfectious irritable bowel syndrome. Gut 0,1-9. |
| Janda, J.M. et al., "16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils and Pitfalls," Journal of Clinical Microbiology, Sep. 2007, pp. 2761-2764, vol. 45, No. 9. |
| Jeffs, L.B., and Khachatourians, G.G. (1997). Estimation of spore hydrophobicity for members of the genera Beauveria, Metarhizium, and Tolypocladium by salt-mediated aggregation and sedimentation. Canadian Journal of Microbiology 43(1), 23-28. |
| Jensen, N.S., and Canale-Parola, E. (1986). Bacteroides pectinophilus sp. nov. and Bacteroides galacturonicus sp. nov.: two pectinolytic bacteria from the human intestinal tract. Appl. Environ. Microbiol. 52(4), 880-887. |
| Johnson, S. et al., "Is Primary Prevention of Clostridium Difficile Infection Possible with Specific Probiotics?" International Journal of Infectious Diseases, Nov. 2012, pp. e786-e792, vol. 16, No. 11. |
| Johnston, R. et al., "Method to Facilitate the Isolation of Clostridium botulinum Type E," J. Bacteriol., 1964, pp. 1521-1522, vol. 88. |
| Jones, M.L., Martoni, C.J., and Prakash, S. (2012a). Cholesterol lowering and inhibition of sterol absorption by Lactobacillus reuteri NCIMB 30242: a randomized controlled trial. Eur J Clin Nutr 66(11), 1234-1241. |
| Jones, M.L., Martoni, C.J., Parent, M., and Prakash, S. (2012b). Cholesterol-lowering efficacy of a microencapsulated bile salt hydrolase-active Lactobacillus reuteri NCIMB 30242 yoghurt formulation in hypercholesterolaemic adults. British Journal of Nutrition 107(10), 1505-1513. |
| Joosten, H. et al., "Salmonelle Detection in Probiotic Products," International Journal of Food Microbiology, Jul. 2006, pp. 104-107, vol. 110, No. 1. |
| Jorgensen, J.H., and Ferraro, M.J. (2009). Antimicrobial Susceptibility Testing: A Review of General Principles and Contemporary Practices. Clin Infect Dis., Medical Microbiology, 49(11), 1749-1755. |
| Jorup-Rönström, C., Håkanson, A., Sandell, S., Edvinsson, O., Midtvedt, T., Persson, A.-K., and Norin, E. (2012). Fecal transplant against relapsing Clostridium difficile-associated diarrhea in 32 patients. Scand. J. Gastroenterol. 47(5), 548-552. |
| Jousimies-Somer, H., Summanen, P., Citron, D.M., Baron, E.J., Wexler, H.M., and Finegold, S.M. (2002). Wadsworth-KLT Anaerobic Bacteriology Manual, 6th edition (California: Star), pp. 55-74, 81-132, 165-185. |
| Kailasapathy, K. (2002). Microencapsulation of probiotic bacteria: technology and potential applications. Curr Issues Intest Microbiol 3(2), 39-48. |
| Kamiya, S., Yamakawa, K., Ogura, H., and Nakamura, S. (1989). Recovery of spores of Clostridium difficile altered by heat or alkali. J Med Microbiol 28(3), 217-221. |
| Kanamoto, T. et al., "Genetic Heterogeneities and Phenotypic Characteristics of Strains of the Genus Abiotrophia and Proposal of Abiotrophia para-adiacens sp. nov.," Journal of Clinical Microbiology, Feb. 2000, pp. 492-498, vol. 38, No. 2; Abiotropia para-adjacens gene for 16S rRNA, partial sequence, strain: Nucleotide: NCBI: GenBank: AB022027.1, last accessed Mar. 12, 2014, p. 8. |
| Kanehisa Laboratories. KEGG: Kyoto encyclopedia of genes and genomes. <http://www.genome.jp/kegg/> Accessed Mar. 27, 2014. |
| Karasawa, T. et al., "A Defined Growth Medium for Clostridium difficile," Microbiology, Feb. 1995, pp. 371-375, vol. 151, No. 2. |
| Kazamias, M. et al., "Enhanced Fermentation of Mannitol and Release of Cytotoxin by Clostridium difficile in Alkaline Culture Media," Applied and Environmental Microbiology, Jun. 1995, pp. 2425-2427, vol. 61, No. 6. |
| Kelly, D., Campbell, J.I., King, T.P., Grant, G., Jansson, E.A., Coutts, A.G.P., Pettersson, S., and Conway, S. (2003). Commensal anaerobic gut bacteria attenuate inflammation by regulating nuclear-cytoplasmic shuttling of PPAR-γ and RelA. Nature Immunology 5(1), 104-112. |
| Khoruts, A. (2013). How Does Fecal Microbiota Transplantation Treat Clostridium difficile Infection? <https://www.genome.gov/Multimedia/Slides/HumanMicrobiomeScience2013/39_Khoruts.pdf> Accessed Mar. 21, 2014. |
| Khoruts, A., and Sadowsky, M.J. (2011). Therapeutic transplantation of the distal gut microbiota. Mucosal Immunol 4(1), 4-7. |
| Khoruts, A., Dicksved, J., Jansson, J.K., and Sadowsky, M.J. (2010). Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. J. Clin. Gastroenterol. 44(5), 354-360. |
| Kim, B., Kim, N.J., Kim, M., Kim, Y.S., Woo, J., and Ryu, J. (2003). Bacteraemia Due to Tribe Proteeae: A Review of 132 Cases During a Decade (1991-2000). Scandinavian Journal of Infectious Diseases 35(2), 98-103. |
| Klayraung, S., Viernstein, H., and Okonogi, S. (2009). Development of tablets containing probiotics: Effects of formulation and processing parameters on bacterial viability. International Journal of Pharmaceutics 370(1-2), 54-60. |
| Kollmann, M. et al., Design Principles of a Bacterial Signalling Network, Nature, Nov. 24, 2005, pp. 504-507, vol. 438, No. 7067. |
| Kong, Q., He, G.-Q., Jia, J.-L., Zhu, Q.-L., and Ruan, H. (2011). Oral Administration of Clostridium butyricum for Modulating Gastrointestinal Microflora in Mice. Curr Microbiol 62(2), 512-517. |
| Konstantinidis, K.T., Ramette, A., and Tiedje, J.M. (2006). The bacterial species definition in the genomic era. Philos Trans R Soc Lond B Biol Sci 361(1475), 1929-1940. |
| Koonin, E.V. (2002). Chapter 22 The clusters of orthologous groups (COGS) database: Phylogenetic classification of proteins from complete genomes. <http://www.ncbi.nlm.nih.gov/books/NBK21090/pdf/ch22.pdf> Accessed Mar. 27, 2014. |
| Koransky, J.R., Allen, S.D., and Dowell, V.R., Jr (1978). Use of ethanol for selective isolation of sporeforming microorganisms. Appl. Environ. Microbiol. 35(4), 762-765. |
| Kort, R., O'Brien, A.C., Stokkum, I.H.M. Van, Oomes, S.J.C.M., Crielaard, W., Hellingwerf, K.J., and Brul, S. (2005). Assessment of Heat Resistance of Bacterial Spores from Food Product Isolates by Fluorescence Monitoring of Dipicolinic Acid Release. Appl. Environ. Microbiol. 71(7), 3556-3564. |
| Kucerova, Z., Moura, H., Leitch, G.J., Sriram, R., Bern, C., Kawai, V., Vargas, D., Gilman, R.H., Ticona, E., and Vivar, A. (2004). Purification of Enterocytozoon bieneusi spores from stool specimens by gradient and cell sorting techniques. Journal of Clinical Microbiology 42(7), 3256-3261. |
| Kumar, M. et al., "Cholesterol-Lowering Probiotics as Potential Biotherapeutics for Metabolic Diseases," Experimental Diabetes Research, 2012, Article ID 902917, 14 pages, vol. 2012. |
| Kump, P.K., Gröchenig, H.-P., Lackner, S., Trajanoski, S., Reicht, G., Hoffmann, K.M., Deutschmann, A., Wenzl, H.H., Petritsch, W., Krejs, G.J., et al. (2013). Alteration of intestinal dysbiosis by fecal microbiota transplantation does not induce remission in patients with chronic active ulcerative colitis. Inflamm. Bowel Dis. 19(10), 2155-2165. |
| Kunde, S., Pham, A., Bonczyk, S., Crumb, T., Duba, M., Conrad, H., Jr, Cloney, D., and Kugathasan, S. (2013). Safety, tolerability, and clinical response after fecal transplantation in children and young adults with ulcerative colitis. J. Pediatr. Gastroenterol. Nutr. 56(6), 597-601. |
| Landy, J., Al-Hassi, H.O., McLaughlin, S.D., Walker, A.W., Ciclitira, P.J., Nicholls, R.J., Clark, S.K., and Hart, A.L. (2011). Review article: faecal transplantation therapy for gastrointestinal disease. Alimentary Pharmacology & Therapeutics 34(4), 409-415. |
| Lawley, T.D., Clare, S., Walker, A.W., Stares, M.D., Connor, T.R., Raisen, C., Goulding, D., Rad, R., Schreiber, F., Brandt, C., et al. (2012). Targeted Restoration of the Intestinal Microbiota with a Simple, Defined Bacteriotherapy Resolves Relapsing Clostridium difficile Disease in Mice. PLoS Pathog 8(10), e1002995. |
| Lawson, P.A., Song, Y., Liu, C., Molitoris, D.R., Vaisanen, M.-L., Collins, M.D., and Finegold, S.M. (2004). Anaerotruncus colihominis gen. nov., sp. nov., from human faeces. Int J Syst Evol Microbiol 54(2), 413-417. |
| Lee, I.-K., and Liu, J.-W. (2006). Clinical characteristics and risk factors for mortality in Morganella morganii bacteremia. J Microbiol Immunol Infect 39(4), 328-334. |
| Lee, J.S., Cha, D.S., and Park, H.J. (2004). Survival of Freeze-Dried Lactobacillus bulgaricus KFRI 673 in Chitosan-Coated Calcium Alginate Micropraticles. J. Agric. Food Chem. 52(24), 7300-7305. |
| Lee, M., Hesek, D., Shah, I.M., Oliver, A.G., Dworkin, J., and Mobashery, S. (2010). Synthetic peptidoglycan motifs for germination of bacterial spores. Chembiochem 11(18), 2525-2529. |
| Lehar, J. (2007). Chemical combination effects predict connectivity in biological systems, Molecular Systems Biology, pp. 1-14, vol. 3, Article No. 80. |
| Lemon, K.P., Armitage, G.C., Relman, D.A., and Fischbach, M.A. (2012). Microbiota-Targeted Therapies: An Ecological Perspective. Science Translational Medicine 4(137), 137rv5-137rv5. |
| Leslie, S.B., Israeli, E., Lighthart, B., Crowe, J.H., and Crowe, L.M. (1995). Trehalose and sucrose protect both membranes and proteins in intact bacteria during drying. Applied and Environmental Microbiology 61(10), 3592-3597. |
| Liggins, M., Ramirez, N., Magnuson, N., and Abel-Santos, E. (2011). Progesterone analogs influence germination of Clostridium sordellii and Clostridium difficile spores in vitro. J. Bacteriol. 193(11), 2776-2783. |
| Lindsay, J.A., Beaman, T.C., and Gerhardt, P. (1985). Protoplast water content of bacterial spores determined by buoyant density sedimentation. J. Bacteriol. 163(2), 735-737. |
| Liu, K., Linder, C.R., and Warnow, T. (2011). RAxML and FastTree: Comparing Two Methods for Large-Scale Maximum Likelihood Phylogeny Estimation. PLoS ONE 6(11), e27731. |
| Livingston, S.J., Kominos, S.D., and Yee, R.B. (1978). New medium for selection and presumptive identification of the Bacteroides fragilis group. J. Clin. Microbiol. 7(5), 448-453. |
| Lodish, H. et al., "Viruses: Structure, Function, and Uses," Molecular Cell Biology, 4th Edition, 2000, pp. 1-12. |
| Logan, N.A., "Bacillus and Relatives in Foodborne Illness," Journal of Applied Microbiology, Mar. 20, 2012, pp. 417-429, vol. 112, No. 3. |
| Lopetuso, L.R., Scaldaferri, F., Petito, V., and Gasbarrini, A. (2013). Commensal Clostridia: leading players in the maintenance of gut homeostasis. Gut Pathogens 5(1), 23. |
| Lozupone, C., Faust, K., Raes, J., Faith, J.J., Frank, D.N., Zaneveld, J., Gordon, J.I., and Knight, R. (2012). Identifying genomic and metabolic features that can underlie early successional and opportunistic lifestyles of human gut symbionts. Genome Res 22(10), 1974-1984. |
| Malik, K.A. (1988). A new freeze-drying method for the preservation of nitrogen-fixing and other fragile bacteria. Journal of Microbiological Methods 8(5), 259-271. |
| Manichanh, C. (2006). Reduced diversity of faecal microbiota in Crohn's disease revealed by a metagenomic approach. Gut 55(2), 205-211. |
| Matsuda, K. et al., "Sensitive Quantitative Detection of Commensal Bacteria by rRNA-Targeted Reverse Transcription-PCR," Applied and Environmental Microbiology, Jan. 2007, pp. 32-39, vol. 73, No. 1. |
| Mbithi, J.N., Springthorpe, V.S., and Sattar, S.A. (1990). Chemical disinfection of hepatitis A virus on environmental surfaces. Applied and Environmental Microbiology 56(11), 3601-3604. |
| McFarland, L.V. et al., "Pharmaceutical Probiotics for the Treatment of Anaerobic and Other Infections," Anaerobe, Jan. 1997, pp. 73-78, vol. 3, No. 2-3. |
| McFarland, L.V., "Use of Probiotics to Correct Dysbiosis of Normal Microbiota Following Disease or Disruptive Events: A Systematic Review," BMJ Open, 2014, pp. 1-18, vol. 4. |
| McGuire, G., Denham, M.C., and Balding, D.J. (2001). Models of Sequence Evolution for DNA Sequences Containing Gaps. Mol Biol Evol 18(4), 481-490. |
| McNulty, N.P., Yatsunenko, T., Hsiao, A., Faith, J.J., Muegge, B.D., Goodman, A.L., Henrissat, B., Oozeer, R., Cools-Portier, S., Gobert, G., et al. (2011). The impact of a consortium of fermented milk strains on the gut microbiome of gnotobiotic mice and monozygotic twins. Sci Transl Med 3(106), 106ra106. |
| Mevissen-Verhage, E.A., Marcelis, J.H., Vos, M.N. De, Amerongen, W.C.H., and Verhoef, J. (1987). Bifidobacterium, Bacteroides, and Clostridium spp. in fecal samples from breast-fed and bottle-fed infants with and without iron supplement. J. Clin. Microbiol. 25(2), 285-289. |
| Mierau, I. et al., "Industrial-Scale Production and Purification of a Heterologous Protein in Lactococcus Lactis Using the Nisin-Controlled Gene Expression System NICE: The Case of Lysostaphin," Microbial Cell Factories, May 27, 2005, pp. 1-9, vol. 4, No. 15. |
| Miller, R.S., and Hoskins, L.C. (1981). Mucin degradation in human colon ecosystems. Fecal population densities of mucin-degrading bacteria estimated by a "most probable number" method. Gastroenterology 81(4), 759-765. |
| Miyamoto-Shinohara, Y., Sukenobe, J., Imaizumi, T., Nakahara, T., and Others (2008). Survival of freeze-dried bacteria. The Journal of General and Applied Microbiology 54(1), 9. |
| Momose, Y. et al., "16S rRNA Gene Sequence-Based Analysis of Clostridia Related to Conversion of Germfree Mice to the Normal State," Journal of Applied Microbiology, 2009, pp. 2088-2097, vol. 107. |
| Morgan, C.A., Herman, N., White, P.A., and Vesey, G. (2006). Preservation of micro-organisms by drying; A review. Journal of Microbiological Methods 66(2), 183-193. |
| Murri, M., Leiva, I., Gomez-Zumaquero, J.M., Tinahones, F.J., Cardona, F., Soriguer, F., and Queipo-Ortuño, M.I. (2013). Gut microbiota in children with type 1 diabetes differs from that in healthy children: a case-control study. BMC Med 11(1), 1-12. |
| Myllyluoma, E. et al., "Effects of Multispecies Probiotic Combination on Helicobacter pylori Infection in Vitro," Clinical and Vaccine Immunology, Sep. 2008, pp. 1472-1482, vol. 15, No. 9. |
| Naaber P. et al., "Inhibition of Clostridium difficile Strains by Intestinal Lactobacillus Species" Journal of Medical Microbiology, 2004, pp. 551-554, vol. 53. |
| New Zealand Examination Report, New Zealand Application No. 709392, dated Jun. 9, 2016, 7 pages. |
| New Zealand First Examination Report, New Zealand Application No. 709392, dated Oct. 5, 2015,7 pages. |
| New Zealand First Examination Report, New Zealand Application No. 711771, dated Nov. 23, 2015, 6 pages. |
| New Zealand First Examination Report, New Zealand Application No. 711773, dated Nov. 24, 2015, 6 pages. |
| New Zealand First Examination Report, New Zealand Application No. 713298, dated Feb. 28, 2017, 6 pages. |
| New Zealand Third Examination Report, New Zealand Application No. 711771, dated Nov. 4, 2016, 4 pages. |
| Nicholson, W.L., and Law, J.F. (1999). Method for purification of bacterial endospores from soils: UV resistance of natural Sonoran desert soil populations of< i> Bacillus</i> spp. with reference to< i> B. subtilis</i> strain 168. Journal of Microbiological Methods 35(1), 13-21. |
| NIH human microbiome project. <http://www.hmpdacc.org/> Accessed Mar. 27, 2014. |
| Nishio, J., Atarashi, K., Tanoue, T., Baba, M., Negishi, H., Yanai, H., Honda, K., Benoist, C., Mathis, D., and Taniguchi, T. (2013). Impact of TCR repetoire on intestinal homeostasis (Taos, NM). |
| Nitert, M.D., Barrett, H.L., Foxcroft, K., Tremellen, A., Wilkinson, S., Lingwood, B., Tobin, J.M., McSweeney, C., O'Rourke, P., McIntyre, H.D., et al. (2013). SPRING: an RCT study of probiotics in the prevention of gestational diabetes mellitus in overweight and obese women. BMC Pregnancy and Childbirth 13(1), 50. |
| Noack, J., Kleessen, B., Proll, J., Dongowski, G., and Blaut, M. (1998). Dietary guar gum and pectin stimulate intestinal microbial polyamine synthesis in rats. J. Nutr. 128(8), 1385-1391. |
| Nyangale, et al., "Gut Microbial Activity, Implications for Health and Disease: the Potential Role of Metabolite Analysis," J. Proteome Res., 2012, pp. 5573-5585. vol. 11, No. 12. |
| O'Hara, C.M., Brenner, F.W., and Miller, J.M. (2000). Classification, identification, and clinical significance of Proteus, Providencia, and Morganella. Clin. Microbiol. Rev. 13(4), 534-546. |
| Okada, Y., Setoyama, H., Matsumoto, S., Imaoka, A., Nanno, M., Kawaguchi, M., and Umesaki, Y. (1994). Effects of fecal microorganisms and their chloroform-resistant variants derived from mice, rats, and humans on immunological and physiological characteristics of the intestines of ex-germfree mice. Infect. Immun. 62(12), 5442-5446. |
| Olle, B. (2013). Medicines from microbiota. Nat. Biotechnol. 31(4), 309-315. |
| OPENBIOME. Quality metrics. <http://static.squarespace.com/static/50e0c29ae4b0a05702af7e6a/t/52e19b89e4b0b28f802c9b4e/1390517129976/OpenBiome%20Quality%20Metrics.pdf> Accessed Mar. 21, 2014. |
| Owens, C., Broussard, E., and Surawicz, C. (2013). Fecal microbiota transplantation and donor standardization. Trends in Microbiology 21(9), 443-445. |
| Paine, R.T. (1969). A note on trophic complexity and community stability. American Naturalist 103(929), 91-93. |
| Palmfeldt, J., and Hahn-Hägerdal, B. (2000). Influence of culture pH on survival of< i> Lactobacillus reuteri</i> subjected to freeze-drying. International Journal of Food Microbiology 55(1), 235-238. |
| Pamer, E.G. (2014). Fecal microbiota transplantation: effectiveness, complexities, and lingering concerns. Mucosal Immunology 7(2), 210-214. |
| Paredes-Sabja, D., Udompijitkul, P., and Sarker, M.R. (2009). Inorganic phosphate and sodium ions are cogerminants for spores of Clostridium perfringens type A food poisoning-related isolates. Appl. Environ. Microbiol. 75(19), 6299-6305. |
| Path Vaccine and Pharmaceutical Technologies Group. Summary of stability data for investigational formulations of vaccines. <http://www.path.org/publications/files/TS_vaccine_stability_table_invest.pdf> Accessed Mar. 21, 2014. |
| PCT International Search Report and Written Opinion, PCT Application No. PCT/US13/71758, dated May 5, 2014, 45 pages. |
| PCT International Search Report and Written Opinion, PCT Application No. PCT/US14/14738, dated Jul. 30, 2014, 32 pages. |
| PCT International Search Report and Written Opinion, PCT Application No. PCT/US14/14744, dated May 21, 2014, 36 pages. |
| PCT International Search Report and Written Opinion, PCT Application No. PCT/US14/14745, dated Jul. 30, 2014, 31 pages. |
| PCT International Search Report and Written Opinion, PCT Application No. PCT/US14/14747, dated Jun. 13, 2014, 27 pages. |
| PCT International Search Report and Written Opinion, PCT Application No. PCT/US14/70684, dated Jun. 10, 2015, 24 pages. |
| PCT International Search Report and Written Opinion, PCT Application No. PCT/US2014/029539, dated Oct. 10, 2014, 17 pages. |
| PCT International Search Report and Written Opinion, PCT Application No. PCT/US2014/067491, dated Apr. 2, 2015, 14 pages. |
| PCT Invitation to Pay Additional Fees, PCT Application No. PCT/US13/71758, dated Feb. 25, 2014, 4 pages. |
| PCT Invitation to Pay Additional Fees, PCT Application No. PCT/US14/14745, dated May 16, 2014, 2 pages. |
| PCT Invitation to Pay Additional Fees, PCT Application No. PCT/US14/29539, dated Jul. 31, 2014, 3 pages. |
| PCT Invitation to Pay Additional Fees, PCT Application No. PCT/US14/70684, dated Mar. 24, 2015, 2 pages. |
| PCT Invitation to Pay Additional Fees, PCT Application No. PCT/US2014/014738, dated May 16, 2014, 2 pages. |
| PCT Invitation to Pay Additional Fees, PCT Application No. PCT/US2014/030817, dated Sep. 8, 2014, 5 pages. |
| Peck, M.W. et al., "Development and Application of a New Method for Specific and Sensitive Enumeration of Spores of Nonproteolytic Clostridium Botulinum Types B, E and F in Foods and Food Materials," Applied and Environmental Microbiology, Oct. 2010, pp. 6607-6614, vol. 76, No. 19. |
| Pehkonen, K.S., Roos, Y.H., Miao, S., Ross, R.P., and Stanton, C. (2008). State transitions and physicochemical aspects of cryoprotection and stabilization in freeze-drying of Lactobacillus rhamnosus GG (LGG). Journal of Applied Microbiology 104(6), 1732-1743. |
| Peighambardoust, S.H., Golshan Tafti, A., and Hesari, J. (2011). Application of spray drying for preservation of lactic acid starter cultures: a review. Trends in Food Science & Technology 22(5), 215-224. |
| Pellegrino, P.M., Fell Jr., N.F., and Gillespie, J.B. (2002). Enhanced spore detection using dipicolinate extraction techniques. Analytica Chimica Acta 455(2), 167-177. |
| Perez, F., Pultz, M.J., Endimiani, A., Bonomo, R.A., and Donskey, C.J. (2011). Effect of antibiotic treatment on establishment and elimination of intestinal colonization by KPC-producing Klebsiella pneumoniae in mice. Antimicrob. Agents Chemother. 55(6), 2585-2589. |
| Perez, J., Springthorpe, V.S., and Sattar, S.A. (2011). Clospore: a liquid medium for producing high titers of semi-purified spores of Clostridium difficile. J AOAC Int 94(2), 618-626. |
| Peterson, D.A. et al., "Metagenomic Approaches for Defining the Pathogenesis of Inflammatory Bowel Diseases," Cell Host Microbe, Jun. 2008, pp. 417-427, vol. 3, No. 6. |
| Petrof, E.O., Claud, E.C., Gloor, G.B., and Allen-Vercoe, E. (2013a). Microbial ecosystems therapeutics: a new paradigm in medicine? Beneficial Microbes 4(1), 53-65. |
| Petrof, E.O., Gloor, G.B., Vanner, S.J., Weese, S.J., Carter, D., Daigneault, M.C., Brown, E.M., Schroeter, K., and Allen-Vercoe, E. (2013b). Stool substitute transplant therapy for the eradication of Clostridium difficile infection: "RePOOPulating" the gut, Microbiome, Jan. 9, 2013, p. 3, vol. 1, No. 1. |
| Picot, A., and Lacroix, C. (2004). Encapsulation of bifidobacteria in whey protein-based microcapsules and survival in simulated gastrointestinal conditions and in yoghurt. International Dairy Journal 14(6), 505-515. |
| Pinn, D. et al. (2013). Follow-up Study of Fecal Microbiota Transplantation (FMT) for the Treatment of Refractory Irritable Bowel Syndrome (IBS). Abstract ACG 2013. |
| Postgate, J.R., and Hunter, J.R. (1961). On the Survival of Frozen Bacteria. J Gen Microbiol 26(3), 367-378. |
| Prilassnig, M. et al., "Are Probiotics Detectable in Human Feces After Oral Uptake by Healthy Volunteers?" The Middle European Journal of Medicine, Aug. 2007, pp. 456-462, vol. 119, Nos. 15-16. |
| Pultz, N.J., Hoyen, C.K., and Donskey, C.J. (2004). Inhibition of methicillin-resistant Staphylococcus aureus by an in vitro continuous-flow culture containing human stool microflora. FEMS Microbiology Letters 241(2), 201-205. |
| Queenan, A.M., and Bush, K. (2007). Carbapenemases: the Versatile β-Lactamases. Clin. Microbiol. Rev. 20(3), 440-458. |
| Quigley, E.M.M. et al., "Small Intestinal Bacterial Overgrowth: Roles of Antibiotics, Prebiotics and Probiotics," Gastroenterology, Feb. 2006, pp. 78-90, vol. 130. |
| Raibaud, P., Ducluzeau, R., Dubos, F., Hudault, S., Bewa, H., and Muller, M.C. (1980). Implantation of bacteria from the digestive tract of man and various animals into gnotobiotic mice. Am J Clin Nutr 33(11), 2440-2447. |
| Ramirez, N., and Abel-Santos, E. (2010). Requirements for germination of Clostridium sordellii spores in vitro. J. Bacteriol. 192(2), 418-425. |
| Rao, A.V., Shiwnarain, N., and Maharaj, I. (1989). Survival of Microencapsulated Bifidobacterium pseudolongum in Simulated Gastric and Intestinal Juices. Canadian Institute of Food Science and Technology Journal 22(4), 345-349. |
| Reeves, A.E., Koenigsknecht, M.J., Bergin, I.L., and Young, V.B. (2012). Suppression of Clostridium difficile in the Gastrointestinal Tracts of Germfree Mice Inoculated with a Murine Isolate from the Family Lachnospiraceae. Infection and Immunity 80(11), 3786-3794. |
| Rexroad, J., Wiethoff, C.M., Jones, L.S., and Middaugh, C.R. (2002). Lyophilization and the thermostability of vaccines. Cell Preservation Technology 1(2), 91-104. |
| Ridaura, V.K., Faith, J.J., Rey, F.E., Cheng, J., Duncan, A.E., Kau, A.L., Griffin, N.W., Lombard, V., Henrissat, B., Bain, J.R., et al. (2013). Gut Microbiota from Twins Discordant for Obesity Modulate Metabolism in Mice. Science 341(6150), 1241214-1241214. |
| Robinson, I.M. et al., "Emendation of Acetivibrio and Description of Acetivibrio ethanolgignens, a New Species from the Colons of Pigs with Dysentery," International Journal of Systematic Bacteriology, Jul. 1981, pp. 333-338, vol. 31, No. 3. |
| Rode, L.J., and Foster, J.W. (1961). Germination of bacterial spores with alkyl primary amines1. J Bacteriol 81(5), 768-779. |
| Roffe, C. (1996). Biotherapy for antibiotic-associated and other diarrhoeas. J. Infect. 32(1), 1-10. |
| Rohlke, F., Surawicz, C.M., and Stollman, N. (2010). Fecal flora reconstitution for recurrent Clostridium difficile infection: results and methodology. J. Clin. Gastroenterol. 44(8), 567-570. |
| Rosen, D.L., Sharpless, C., and McGown, L.B. (1997). Bacterial Spore Detection and Determination by Use of Terbium Dipicolinate Photoluminescence. Anal. Chem. 69(6), 1082-1085. |
| Russell, A.D., "The Destruction of Bacterial Spores," 1982, pp. 191-193. |
| Russian First Office Action, Russian Patent Application No. 2015124366, dated Dec. 13, 2016, 12 pages. |
| Russian Office Action, Russian Application No. 2015137399, dated Mar. 22, 2016, 8 pages. |
| Russian Second Office Action, Russian Patent Application No. 2015137399, dated Mar. 14, 2017, 8 pages. |
| Sack, D.A., Shimko, J., Sack, R.B., Gomes, J.G., MacLeod, K., O'Sullivan, D., and Spriggs, D. (1997). Comparison of alternative buffers for use with a new live oral cholera vaccine, Peru-15, in outpatient volunteers. Infect. Immun. 65(6), 2107-2111. |
| Sacks, L.E., and Alderton, G. (1961). Behavior of bacterial spores in aqueous polymer two-phase systems. J. Bacteriol. 82, 331-341. |
| Sahlström, L., Bagge, E., Emmoth, E., Holmqvist, A., Danielsson-Tham, M.-L., and Albihn, A. (2008). A laboratory study of survival of selected microorganisms after heat treatment of biowaste used in biogas plants. Bioresour. Technol. 99(16), 7859-7865. |
| Santivarangkna, C., Kulozik, U., and Foerst, P. (2007). Alternative Drying Processes for the Industrial Preservation of Lactic Acid Starter Cultures. Biotechnology Progress 23(2), 302-315. |
| Sattar, S.A., Jason, T., Bidawid, S., and Farber, J. (2000). Foodborne spread of hepatitis A: recent studies on virus survival, transfer and inactivation. The Canadian Journal of Infectious Diseases 11(3), 159. |
| Savaiano, D.A., Ritter, A.J., Klaenhammer, T., Walker, M.R., Carlson, H.L.F., and Ruckle, J. (2012). A Novel High Purity Short-Chain Galacto-Oligosaccharide (RP-G28) Improves Lactose Digestion and Symptoms of Lactose Intolerance. Gastroenterology 142(5), S-182. |
| Savaiano, D.A., Ritter, A.J., Klaenhammer, T.R., Walker, W.A., James, G.M., Longcore, A.T., Chandler, J.R., and Foyt, H.L. (2013). Improving lactose digestion and symptoms of lactose intolerance with a novel galacto-oligosaccharide (RP-G28): a randomized, double-blind clinical trial. Nutrition Journal 12(1), 160. |
| Seale, R.B., Flint, S.H., McQuillan, A.J., and Bremer, P.J. (2008). Recovery of Spores from Thermophilic Dairy Bacilli and Effects of Their Surface Characteristics on Attachment to Different Surfaces. Appl Environ Microbiol 74(3), 731-737. |
| Seo, M., Inoue, I., Tanaka, M., Matsuda, N., Nakano, T., Awata, T., Katayama, S., Alpers, D.H., and Komoda, T. (2013). Clostridium butyricum MIYAIRI 588 improves high-fat diet-induced non-alcoholic fatty liver disease in rats. Dig. Dis. Sci. 58(12), 3534-3544. |
| Setlow, B. et al., "Mechanisms of Killing Spores of Bacillus Subtilis by Acid, Alkali and Ethanol," Journal of Applied Microbiology, 2002, pp. 362-375, vol. 92. |
| Setlow, B., Cowan, A. E., and Setlow, P. (2003). Germination of spores of Bacillus subtilis with dodecylamine. Journal of Applied Microbiology 95(3), 637-648. |
| Setlow, B., Yu, J., Li, Y.-Q., and Setlow, P. (2013). Analysis of the germination kinetics of individual Bacillus subtilis spores treated with hydrogen peroxide or sodium hypochlorite. Letters in Applied Microbiology 57(4), 259-265. |
| Shafaat, H.S., and Ponce, A. (2006). Applications of a Rapid Endospore Viability Assay for Monitoring UV Inactivation and Characterizing Arctic Ice Cores. Appl Environ Microbiol 72(10), 6808-6814. |
| Shah, I.M., Laaberki, M.-H., Popham, D.L., and Dworkin, J. (2008). A eukaryotic-like Ser/Thr kinase signals bacteria to exit dormancy in response to peptidoglycan fragments. Cell 135(3), 486-496. |
| Shah, N.P. et al., "Microencapsulation of Probiotic Bacteria and Their Survival in Frozen Fermented Dairy Desserts," The Australian Journal of Dairy Technology, Oct. 2000, pp. 139-144, vol. 55, No. 3. |
| Shah, N.P., "Symposium: Probiotic Bacteria: Probiotic Bacteria: Selective Enumeration and Survival in Dairy Foods," Oct. 7, 1999, 14 pages. |
| Shah, S. (2012). Clostridium difficile in inflammatory Bowel Disease: a dangerous mix (Clostridium difficile Symposium, Miriam Hospital, Providence, RI). |
| Shahinas, D., Silverman, M., Sittler, T., Chiu, C., Kim, P., Allen-Vercoe, E., Weese, S., Wong, A., Low, D.E., and Pillai, D.R. (2012). Toward an Understanding of Changes in Diversity Associated with Fecal Microbiome Transplantation Based on 16S rRNA Gene Deep Sequencing. mBio 3(5), e00338-12-e00338-12. |
| Sharpe, E.S., Nickerson, K.W., Bulla Jr, L.A., and Aronson, J.N. (1975). Separation of spores and parasporal crystals of Bacillus thuringiensis in gradients of certain x-ray contrasting agents. Applied Microbiology 30(6), 1052. |
| Sheu, T.-Y., Marshall, R.T., and Heymann, H. (1993). Improving Survival of Culture Bacteria in Frozen Desserts by Microentrapment. Journal of Dairy Science 76(7), 1902-1907. |
| Siaterlis, A., Deepika, G., and Charalampopoulos, D. (2009). Effect of culture medium and cryoprotectants on the growth and survival of probiotic lactobacilli during freeze drying. Letters in Applied Microbiology 48(3), 295-301. |
| SIGMA-TAU. VSL#3. <http://www.vsl3.com/> Accessed Mar. 21, 2014. |
| Skaar, E., "The Battle for Iron Between Bacterial Pathogens and Their Vertebrate Hosts," PLoS Pathog., Aug. 12, 2010, pp. 1-4, vol. 6, No. 8. |
| Sleator, R.D. et al.,"Designer Probiotics: A Potential Therapeutic for Clostridium difficile?" Journal of Medical Microbiology, Jun. 2008, pp. 793-794, vol. 57, No. 6. |
| Snitkin, E.S., Zelazny, A.M., Thomas, P.J., Stock, F., Henderson, D.K., Palmore, T.N., and Segre, J.A. (2012). Tracking a Hospital Outbreak of Carbapenem-Resistant Klebsiella pneumoniae with Whole-Genome Sequencing. Sci Transl Med 4(148), 148ra116-148ra116. |
| Solanki, H.K., Pawar, D.D., Shah, D.A., Prajapati, V.D., Jani, G.K., Mulla, A.M., and Thakar, P.M. (2013). Development of Microencapsulation Delivery System for Long-Term Preservation of Probiotics as Biotherapeutics Agent. BioMed Research International 2013, 1-21. |
| SOP No. MB-28-00. <http://www.epa.gov/pesticides/methods/MB-28-00.pdf> Accessed Mar. 27, 2014. |
| Sorg, J.A., and Sonenshein, A.L. (2008). Bile Salts and Glycine as Cogerminants for Clostridium difficile Spores. J Bacteriol 190(7), 2505-2512. |
| Sow, H., Desbiens, M., Morales-Rayas, R., Ngazoa, S.E., and Jean, J. (2011). Heat Inactivation of Hepatitis A Virus and a Norovirus Surrogate in Soft-Shell Clams (Mya arenaria). Foodborne Pathogens and Disease 8(3), 387-393. |
| Stams, A.J.M., Van Dijk, J.B., Dijkema, C., and Plugge, C.M. (1993). Growth of Syntrophic Propionate-Oxidizing Bacteria with Fumarate in the Absence of Methanogenic Bacteria. Appl Environ Microbiol 59(4), 1114-1119. |
| Stefka, A.T. et al., "Commensal Bacteria Protect Against Food Allergen Sensitization," PNAS, Sep. 9, 2014, pp. 13145-13150, vol. 111, No. 36. |
| Stevens, K.A., and Jaykus, L.-A. (2004). Bacterial Separation and Concentration from Complex Sample Matrices: A Review. Critical Reviews in Microbiology 30(1), 7-24. |
| Su, W.J., Waechter, M.J., Bourlioux, P., Dolegeal, M., Fourniat, J., and Mahuzier, G. (1987). Role of volatile fatty acids in colonization resistance to Clostridium difficile in gnotobiotic mice. Infect. Immun. 55(7), 1686-1691. |
| Talwalkar, A., and Kailasapathy, K. (2003). Effect of microencapsulation on oxygen toxicity in probiotic bacteria. Australian Journal of Dairy Technology 58(1), 36-39. |
| Tamir, H., and Gilvarg, C. (1966). Density Gradient Centrifugation for the Separation of Sporulating Forms of Bacteria. J. Biol. Chem. 241(5), 1085-1090. |
| Tanaka, M. et al., "Increased Fasting Plasma Ghrelin Levels in Patients with Bulimia Nervosa," European Journal of Endocrinology, Jun. 2002, pp. 1-3, vol. 146. |
| Taur, Y., and Pamer, E.G. (2014). Harnessing Microbiota to Kill a Pathogen: Fixing the microbiota to treat Clostridium difficile infections. Nature Medicine 20(3), 246-247. |
| Taur, Y., Xavier, J.B., Lipuma, L., Ubeda, C., Goldberg, J., Gobourne, A., Lee, Y.J., Dubin, K.A., Socci, N.D., Viale, A., et al. (2012). Intestinal Domination and the Risk of Bacteremia in Patients Undergoing Allogeneic Hematopoietic Stem Cell Transplantation. Clin Infect Dis 55(7), 905-914. |
| The Human Microbiome Project Consortium (2012). Structure, function and diversity of the healthy human microbiome. Nature 486(7402), 207-214. |
| Tisa, L.S., Koshikawa, T., and Gerhardt, P. (1982). Wet and dry bacterial spore densities determined by buoyant sedimentation. Applied and Environmental Microbiology 43(6), 1307-1310. |
| Tvede, M., and Rask-Madsen, J. (1989). Bacteriotherapy for chronic relapsing Clostridium difficile diarrhoea in six patients. Lancet 1(8648), 1156-1160. |
| Ubeda, C., Bucci, V., Caballero, S., Djukovic, A., Toussaint, N.C., Equinda, M., Lipuma, L., Ling, L., Gobourne, A., No, D., et al. (2013). Intestinal Microbiota Containing Barnesiella Species Cures Vancomycin-Resistant Enterococcus faecium Colonization. Infect. Immun. 81(3), 965-973. |
| Ubeda, C., Taur, Y., Jenq, R.R., Equinda, M.J., Son, T., Samstein, M., Viale, A., Socci, N.D., Van Den Brink, M.R.M., Kamboj, M., et al. (2010). Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. Journal of Clinical Investigation 120(12), 4332-4341. |
| United States Office Action, U.S. Appl. No. 14/091,201, dated Mar. 25, 2014, 19 pages. |
| United States Office Action, U.S. Appl. No. 14/197,044, dated Aug. 13, 2014, 5 pages. |
| United States Office Action, U.S. Appl. No. 14/221,190, dated Jul. 22, 2014, 19 pages. |
| United States Office Action, U.S. Appl. No. 14/313,828, dated Aug. 13, 2014, 5 pages. |
| United States Office Action, U.S. Appl. No. 14/313,828, dated Dec. 10, 2014, 7 pages. |
| United States Office Action, U.S. Appl. No. 14/313,828, dated May 15, 2015, 11 pages. |
| United States Office Action, U.S. Appl. No. 14/592,481, dated Dec. 22, 2015, 21 pages. |
| United States Office Action, U.S. Appl. No. 14/765,812, dated Aug. 25, 2016, 10 pages. |
| United States Office Action, U.S. Appl. No. 14/776,676, dated Mar. 23, 2017, 9 pages. |
| United States Office Action, U.S. Appl. No. 14/777,252, dated May 11, 2017, 9 pages. |
| United States Office Action, U.S. Appl. No. 14/777,252, dated Nov. 3, 2016, 16 pages. |
| United States Office Action, U.S. Appl. No. 14/884,655, dated Aug. 17, 2016, 9 pages. |
| United States Office Action, U.S. Appl. No. 14/884,655, dated May 5, 2016, 10 pages. |
| United States Office Action, U.S. Appl. No. 15/068,438, dated Apr. 28, 2016, 9 pages. |
| Van Der Woude, M.W., and Baumler, A.J. (2004). Phase and Antigenic Variation in Bacteria. Clin Microbiol Rev 17(3), 581-611. |
| Van Immerseel, F. et al., "Butyric Acid-Producing Anaerobic Bacteria as a Novel Probiotic Treatment Approach for Inflammatory Bowel Disease," Journal of Medical Microbiology, JMM Editorial, 2010, pp. 141-143. |
| Van Kregten, E., Westerdaal, N.A., and Willers, J.M. (1984). New, simple medium for selective recovery of Klebsiella pneumoniae and Klebsiella oxytoca from human feces. J Clin Microbiol 20(5), 936-941. |
| Van Nood, E., Vrieze, A., Nieuwdorp, M., Fuentes, S., Zoetendal, E.G., De Vos, W.M., Visser, C.E., Kuijper, E.J., Bartelsman, J.F.W.M., Tijssen, J.G.P., et al. (2013). Duodenal Infusion of Donor Feces for Recurrent Clostridium difficile. New England Journal of Medicine 368(5), 407-415. |
| Vandenplas, Y., Veereman, G., Van Der Werff Ten Bosch, J., Goossens, A., Pierard, D., Samsom, J.N., and Escher, J.C. (2014). Fecal Microbial Transplantation in a One-Year-Old Girl with Early Onset Colitis—Caution Advised: Journal of Pediatric Gastroenterology and Nutrition 1. |
| Vidal, M., Forestier, C., Charbonnel, N., Henard, S., Rabaud, C., and Lesens, O. (2010). Probiotics and Intestinal Colonization by Vancomycin-Resistant Enterococci in Mice and Humans. J Clin Microbiol 48(7), 2595-2598. |
| Villano, S.A., Seiberling, M., Tatarowicz, W., Monnot-Chase, E., and Gerding, D.N. (2012). Evaluation of an Oral Suspension of VP20621, Spores of Nontoxigenic Clostridium difficile Strain M3, in Healthy Subjects. Antimicrobial Agents and Chemotherapy 56(10), 5224-5229. |
| Wagman, J., and Weneck, E.J. (1963). Preservation of bacteria by circulating-gas freeze drying. Applied Microbiology 11(3), 244-248. |
| Waites, W.M., and Wyatt, L.R. (1971). Germination of spores of Clostridium bifermentans by certain amino acids, lactate and pyruvate in the presence of sodium or potassium ions. J. Gen. Microbiol. 67(2), 215-222. |
| Waites, W.M., and Wyatt, L.R. (1974). The effect of pH, germinants and temperature on the germination of spores of Clostridium bifermentans. J. Gen. Microbiol. 80(1), 253-258. |
| Walker, A.W., and Lawley, T.D. (2012). Therapeutic modulation of intestinal dysbiosis. Pharmacological Research 69(1), 75-86. |
| Wang, M. et al., "Comparison of Bacterial Diversity Along the Human Intestinal Tract by Direct Cloning and Sequencing of 16S rRNA Genes," FEMS Microbiology Ecology, 2005, pp. 219-231, vol. 54. |
| Wang, S., and Curtiss III, R. (2014). Development of Streptococcus pneumoniae Vaccines Using Live Vectors. Vaccines 2(1), 49-88. |
| Weingarden, A.R., Chen, C., Bobr, A., Yao, D., Lu, Y., Nelson, V.M., Sadowsky, M.J., and Khoruts, A. (2013). Microbiota transplantation restores normal fecal bile acid composition in recurrent Clostridium difficile infection. AJP: Gastrointestinal and Liver Physiology 306(4), G310-G319. |
| Wiencek, K.M. et al., "Hydrophobicity of Bacillus and Clostridium Spores," Applied and Environmental Microbiology, Sep. 1990, pp. 2600-2605, vol. 56, No. 9. |
| Wilson, K. et al., "Role of Competition for Nutrients in Suppression of Clostridium difficile by the Colonic Microflora," Infection and Immunity, Oct. 1988, pp. 2610-2614m vol. 56, No. 10. |
| Wilson, K.H., and Sheagren, J.N. (1983). Antagonism of toxigenic Clostridium difficile by nontoxigenic C. difficile. Journal of Infectious Diseases 147(4), 733. |
| Wilson, K.H., Silva, J., and Fekety, F.R. (1981). Suppression of Clostridium difficile by Normal Hamster Cecal Flora and Prevention of Antibiotic-Associated Cecitis. Infect Immun 34(2), 626-628. |
| Woo, T.D.H., Oka, K., Takahashi, M., Hojo, F., Osaki, T., Hanawa, T., Kurata, S., Yonezawa, H., and Kamiya, S. (2011). Inhibition of the cytotoxic effect of Clostridium difficile in vitro by Clostridium butyricum MIYAIRI 588 strain. J. Med. Microbiol. 60(Pt 11), 1617-1625. |
| Wróbel, B. (2008). Statistical measures of uncertainty for branches in phylogenetic trees inferred from molecular sequences by using model-based methods. J. Appl. Genet. 49(1), 49-67. |
| Wroblewski, D., Hannett, G.E., Bopp, D.J., Dumyati, G.K., Halse, T.A., Dumas, N.B., and Musser, K.A. (2009). Rapid Molecular Characterization of Clostridium difficile and Assessment of Populations of C. difficile in Stool Specimens. Journal of Clinical Microbiology 47(7), 2142-2148. |
| Yamakawa, K. et al., "Enhancement of Clostridium difficile Toxin Production in Biotin-Limited Conditions," J. Med. Microbiol., Feb. 1996, pp. 111-114, vol. 44, No. 2. |
| Yamamura, H., Hayakawa, M., and Iimura, Y. (2003). Application of sucrose-gradient centrifugation for selective isolation of Nocardia spp. from soil. Journal of Applied Microbiology 95(4), 677-685. |
| Yang, W.W. (2010). Fast Viability Assessment of Clostridium Spores Survival in Extreme Environments. PhD thesis California Institute of Technology. |
| Yang, W.-W., and Ponce, A. (2009). Rapid endospore viability assay of Clostridium sporogenes spores. International Journal of Food Microbiology 133(3), 213-216. |
| Yang, W.-W., and Ponce, A. (2011). Validation of a Clostridium Endospore Viability Assay and Analysis of Greenland Ices and Atacama Desert Soils. Appl. Environ. Microbiol. 77(7), 2352-2358. |
| Yang, W.-W., Crow-Willard, E.N., and Ponce, A. (2009). Production and characterization of pure Clostridium spore suspensions. J. Appl. Microbiol. 106(1), 27-33. |
| Yi, X., and Setlow, P. (2010). Studies of the Commitment Step in the Germination of Spores of Bacillus Species. J. Bacteriol. 192(13), 3424-3433. |
| Yung, P.T., and Ponce, A. (2008). Fast Sterility Assessment by Germinable-Endospore Biodosimetry. Appl. Environ. Microbiol. 74(24), 7669-7674. |
| Yunoki, M., Tsujikawa, M., Urayama, T., Sasaki, Y., Morita, M., Tanaka, H., Hattori, S., Takechi, K., and Ikuta, K. (2003). Heat sensitivity of human parvovirus B19. Vox Sanguinis 84(3), 164-169. |
| Zeng, Y., Fan, H., Chiueh, G., Pham, B., Martin, R., Lechuga-Ballesteros, D., Truong, V.L., Joshi, S.B., and Middaugh, C.R. (2009). Towards development of stable formulations of a live attenuated bacterial vaccine: a preformulation study facilitated by a biophysical approach. Hum Vaccin 5(5), 322-331. |
| Zhao, J., Krishna, V., Moudgil, B., and Koopman, B. (2008). Evaluation of endospore purification methods applied to Bacillus cereus. Separation and Purification Technology 61(3), 341-347. |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10555978B2 (en) | 2010-06-04 | 2020-02-11 | The University Of Tokyo | Composition for inducing proliferation or accumulation of regulatory T cells |
| US11090343B2 (en) | 2010-06-04 | 2021-08-17 | The University Of Tokyo | Composition for inducing proliferation or accumulation of regulatory T cells |
| US12214003B2 (en) | 2010-06-04 | 2025-02-04 | The University Of Tokyo | Composition for inducing proliferation or accumulation of regulatory T cells |
| US12409196B2 (en) | 2010-06-04 | 2025-09-09 | The University Of Tokyo | Composition for inducing proliferation or accumulation of regulatory T cells |
| US10588925B2 (en) | 2010-06-04 | 2020-03-17 | The University Of Tokyo | Composition for inducing proliferation or accumulation of regulatory T cells |
| US11547732B2 (en) | 2011-12-01 | 2023-01-10 | The University Of Tokyo | Human-derived bacteria that induce proliferation or accumulation of regulatory T cells |
| US10624933B2 (en) * | 2011-12-01 | 2020-04-21 | The University Of Tokyo | Human-derived bacteria that induce proliferation or accumulation of regulatory T cells |
| US10835559B2 (en) | 2011-12-01 | 2020-11-17 | The University Of Tokyo | Human-derived bacteria that induce proliferation or accumulation of regulatory T cells |
| US12502411B2 (en) | 2011-12-01 | 2025-12-23 | The University Of Tokyo | Proliferation or accumulation of regulatory T cells |
| US11458173B2 (en) | 2012-11-23 | 2022-10-04 | Seres Therapeutics, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| US11458174B2 (en) | 2012-11-23 | 2022-10-04 | Seres Therapeutics, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| US12083151B2 (en) | 2012-11-23 | 2024-09-10 | Seres Therapeutics, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| US11464812B2 (en) | 2012-11-23 | 2022-10-11 | Seres Therapeutics, Inc. | Synergistic bacterial compositions and methods of production and use thereof |
| US11666612B2 (en) | 2013-03-15 | 2023-06-06 | Seres Therapeutics, Inc | Network-based microbial compositions and methods |
| US11786562B2 (en) * | 2016-04-19 | 2023-10-17 | Genome Research Limited | Bacteriotherapy |
| US11701394B2 (en) | 2017-08-14 | 2023-07-18 | Seres Therapeutics, Inc. | Compositions and methods for treating cholestatic disease |
| US12214002B2 (en) | 2017-10-30 | 2025-02-04 | Seres Therapeutics, Inc. | Compositions and methods for treating antibiotic resistance |
| US20220000943A1 (en) * | 2018-10-08 | 2022-01-06 | Ajou University Industry-Academic Cooperation Foundation | Composition comprising tetragenococcus halophilus for prevetion or treatment of behcet's disease or herpes simplex virus infection |
| US20220256823A1 (en) * | 2019-09-12 | 2022-08-18 | MarvelBiome, Inc. | Compositions and methods for characterizing a microbiome |
| US12364721B2 (en) | 2019-09-24 | 2025-07-22 | Prolacta Bioscience, Inc. | Compositions and methods for treatment of inflammatory and immune diseases |
| US20230172996A1 (en) * | 2020-02-21 | 2023-06-08 | Yoshikazu NAKAOKA | Composition for alleviating pulmonary hypertension, method for predicting prognosis of pulmonary hypertension, method for assisting in determining severity of pulmonary hypertension, and method for assisting in diagnosing pulmonary hypertension |
| US11439671B2 (en) * | 2020-05-19 | 2022-09-13 | Microbiotica Limited | Therapeutic bacterial composition |
| US11376285B2 (en) * | 2020-05-19 | 2022-07-05 | Microbiotica Limited | Bacterial biomarker |
| WO2022036225A1 (en) | 2020-08-14 | 2022-02-17 | Prolacta Bioscience, Inc. | Human milk oligosaccharide compositions for use with bacteriotherapies |
| US20220265754A1 (en) * | 2021-02-19 | 2022-08-25 | Multistars Biotechnology Company Limited | Method of improving diseases using traditional chinese medicine polysaccharides and bacterial composition thereof |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250000915A1 (en) | Methods of populating a gastrointestinal tract | |
| US12409197B2 (en) | Synergistic bacterial compositions and methods of production and use thereof | |
| US20240408151A1 (en) | Compositions and methods | |
| US9028841B2 (en) | Synergistic bacterial compositions and methods of production and use thereof | |
| AU2013347805B2 (en) | Synergistic bacterial compositions and methods of production and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: SERES HEALTH, INC., MASSACHUSETTS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:VON MALTZAHN, GEOFFREY;HENN, MATTHEW R.;COOK, DAVID N.;AND OTHERS;SIGNING DATES FROM 20140204 TO 20140327;REEL/FRAME:032567/0225 |
|
| AS | Assignment |
Owner name: SERES THERAPEUTICS, INC., MASSACHUSETTS Free format text: CHANGE OF NAME;ASSIGNOR:SERES HEALTH, INC.;REEL/FRAME:035941/0642 Effective date: 20150520 |
|
| AS | Assignment |
Owner name: SERES HEALTH, INC., MASSACHUSETTS Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:VON MALTZHAN, GEOFFREY;HENN, MATTHEW R.;COOK, DAVID N.;AND OTHERS;SIGNING DATES FROM 20140204 TO 20140327;REEL/FRAME:037919/0925 Owner name: SERES THERAPEUTICS, INC., MASSACHUSETTS Free format text: CHANGE OF NAME;ASSIGNOR:SERES HEALTH, INC.;REEL/FRAME:038036/0404 Effective date: 20150520 |
|
| STCF | Information on status: patent grant |
Free format text: PATENTED CASE |
|
| FEPP | Fee payment procedure |
Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |
|
| MAFP | Maintenance fee payment |
Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY Year of fee payment: 4 |
|
| AS | Assignment |
Owner name: OAKTREE FUND ADMINISTRATION, LLC, CALIFORNIA Free format text: SECURITY INTEREST;ASSIGNOR:SERES THERAPEUTICS, INC.;REEL/FRAME:063485/0542 Effective date: 20230427 |
|
| AS | Assignment |
Owner name: SERES THERAPEUTICS, INC., MASSACHUSETTS Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:OAKTREE FUND ADMINISTRATION, LLC, AS ADMINISTRATIVE AGENT;REEL/FRAME:069082/0849 Effective date: 20240930 Owner name: SOCIETE DES PRODUITS NESTLE S.A., SWITZERLAND Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SERES THERAPEUTICS, INC.;REEL/FRAME:068746/0282 Effective date: 20240930 Owner name: SERES THERAPEUTICS, INC., MASSACHUSETTS Free format text: RELEASE OF SECURITY INTEREST;ASSIGNOR:OAKTREE FUND ADMINISTRATION, LLC, AS ADMINISTRATIVE AGENT;REEL/FRAME:069082/0849 Effective date: 20240930 |
|
| MAFP | Maintenance fee payment |
Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY Year of fee payment: 8 |