WO2010030997A1 - Regulating intestinal microbiota dependent signaling as a means to modulate body fat and/or weight loss - Google Patents

Abstract

The invention provides methods for modulating fat storage and weight loss in a subject. In particular, fat storage and weight loss is modulated by altering intestinal microbiota dependent signaling.

Description

REGULATING INTESTINAL MICROBIOTA DEPENDENT SIGNALING AS A MEANS TO MODULATE BODY FAT AND/OR WEIGHT LOSS

GOVERNMENTAL RIGHTS

[0001] This invention was made in part with governmental support under grants DK070977 and DK30292 awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD OF INVENTION

[0002] The current invention generally relates to the effects of the gastrointestinal microbiota on the regulation of energy storage in a subject. In particular, the invention provides methods to promote weight loss and/or treat obesity in a subject by reducing intestinal microbiota dependent signaling.

BACKGROUND OF THE INVENTION

[0003] According to the Centers for Disease Control (CDC), over sixty percent of the United States population is overweight, and almost twenty percent are obese. This translates into 38.8 million adults in the United States with a Body Mass Index (BMI) of 30 or above. Obesity is also a world-wide health problem with an estimated 500 million overweight adult humans [BMI of 25.0-29.9 kg/m²] and 250 million obese adults (Bouchard, C (2000) N Engl J Med. 343, 1888-9). This epidemic of obesity is leading to worldwide increases in the prevalence of obesity-related disorders, such as diabetes, hypertension, cardiac pathology, and non-alcoholic fatty liver disease (NAFLD: Wanless, and Lentz(1990) Hepatology 12, 1106-1110. Silverman, et al., (1990). Am. J. Gastroenterol. 85, 1349-1255; Neuschwander-Tetri and Caldwell (2003) Hepatology 37 , 1202-1219).

[0004] According to the National Institute of Diabetes, Digestive and

Kidney Diseases (NIDDK) approximately 280,000 deaths annually are directly related to obesity. The NIDDK further estimated that the direct cost of healthcare in the U.S. associated with obesity is $51 billion. In addition, Americans spend $33 billion per year on weight loss products. In spite of this economic cost and consumer commitment, the prevalence of obesity continues to rise at alarming rates. From 1991 to 2000, obesity in the U.S. grew by 61 %.

[0005] Although the physiologic mechanisms that support development of obesity are complex, the medical consensus is that the root cause relates to an excess intake of calories compared to caloric expenditure. While the treatment seems quite intuitive, dieting is not an adequate long-term solution for most people; about 90 to 95 percent of persons who lose weight subsequently regain it. Although surgical intervention has had some measured success, various types of surgeries have relatively high rates of morbidity and mortality.

[0006] Pharmacotherapeutic principles are limited. In addition, because of undesirable side effects, the FDA has had to recall several obesity drugs from the market. Those that are approved also have side-effects. Currently, two FDA-approved anti-obesity drugs are orlistat, a lipase inhibitor, and sibutramine, a serotonin reuptake inhibitor. Orlistat acts by blocking the absorption of fat into the body. An unpleasant side effect with orlistat, however, is the passage of undigested oily fat from the body. Sibutramine is an appetite suppressant that acts by altering brain levels of serotonin. In the process, it also causes elevation of blood pressure and an increase in heart rate. Other appetite suppressants, such as amphetamine derivatives, are highly addictive and have the potential for abuse. Moreover, different subjects respond differently and unpredictably to weight loss medications.

[0007] In summary, current surgical and pharmacotherapy treatments are problematic. Novel non-cognitive strategies are needed to prevent and treat obesity and obesity-related disorders.

BRIEF DESCRIPTION OF THE DRAWINGS

[0008] The application file contains at least one photograph executed in color. Copies of this patent application publication with color photographs will be provided by the Office upon request and payment of the necessary fee.

[0009] FIG. 1 demonstrates that the Gpr41 expression is highest in the intestine. A quantitative real time RT-PCR analysis of RNA isolated from different tissues of conventionally-raised (CONV-R) adult wildtype 129SV mice shows that the levels of Gpr41 are highest in the intestine. The levels of Gpr41 were normalized to the levels of GAPDH. Mean values ± standard deviation (SD) are plotted (n=3-4 animals, each assayed in triplicate).

[0010] FIG. 2 shows that Gpr41 is expressed in small intestinal epithelial cells with the morphologic appearance of members of the enteroendocrine cell lineage. In situ hybridization, using Gpr4λ ³⁵S labeled RNA probes, of mouse ileal sections reveal localization of Gpr41 mRNA to cells with the morphologic appearance of enteroendocrine cells (FIGs. 2A-D). FIGs. 2A and 2C show results obtained using an anti-sense probe, while FIGs. 2B and 2D show results generated with the control sense probe. The boxed regions of FIGs. 2C and 2D are shown as hematoxylin and eosin stained images in FIGs. 2E and 2F, respectively. Key: Bars = 25 μm.

[0011] FIG. 3 depicts fluorescence images of sections obtained from the distal small intestine (FIG. 3A) and colon (FIG. 3B) of CCK-GFP transgenic mice expressing Green Fluorescent Protein under the control of regulatory elements from the cholecystokinin gene that is specifically expressed in the enteroendocrine cell lineage of the intestinal epithelium. FIG. 3C graphically illustrates a flow-assisted cell sorting (FACS) analysis of the mechanically dispersed intestinal cells from CCK-GFP transgenic mice. The boxed area shows the designated GFP-positive cell population. Key: Bars = 25 μm.

[0012] FIG. 4 graphically depicts a quantitative real time RT-PCR analysis of RNA isolated from FACS sorted GFP-positive cells harvested from the small intestines of GFP-CCK mice. Note the enrichment in levels of enteroendocrine biomarkers in sorted cells versus the starting material or the GFP-negative fraction. Key: GIc, glucagon; NTS, neurotensin; TAC, tachykinin; PYY, peptide YY; SECR, secretin; GIP, Glucose-regulated intestinal peptide; PPY peptide Y.

[0013] FIG. 5 graphically depicts a quantitative real time RT-PCR analysis of RNA from FACS sorted GFP-positive small intestinal and colonic cells recovered from CCK-GFP mice. GFP-positive samples exhibit highly enriched expression of Gpr41. [0014] FIG. 6 graphically demonstrates a quantitative real time RT-PCR of

RNA isolated from small intestinal intraepithelial lymphocytes (IELs), recovered from the small intestine by magnetic immuno-affinity purification (using CD8 antibody). There is an enrichment of mRNAs encoding T-cell specific markers (TCRδ/γ, CD103, and CD8) but not Gpr41.

[0015] FIG. 7 illustrates the targeted deletion of the mouse Gpr41 gene. A partial map of a mouse genomic DNA fragment containing the complete Gpr41 gene and Gpr40 gene is shown. A 4.5 kb insert consisting of a LacZ expression cassette, followed by a neomycin resistance cassette and the mouse phosphoglycerol kinase (PGK) promoter was substituted for a 1.2 kb segment of mouse DNA containing the exon coding for Gpr41. Probes used for the Southern blot shown in FIG. 8A and 8B are indicated below the map of the targeted allele. The lengths of the EcoRI and Xbal restriction fragments hybridized to probes outside the long and short arm of the targeting vector are shown on the maps of the wildtype and targeted alleles. KEY: Restriction enzymes include B, BamHI; H, Hindlll; Rl, EcoRI; S, Sail; and Xb, Xbal.

[0016] FIG. 8 shows a Southern blot analysis of tail DNA prepared from

Gpr41-/- mice. DNA was extracted from F2 littermates of a heterozygote cross, digested completely with EcoRI (FIG. 8A) and Xbal (FIG. 8B), and Southern blots of the digest probed with the random-primed ³²P-labeled probes shows the loss of the Gpr41 gene.

[0017] FIG. 9 demonstrates that a loss of Gpr41 does not affect microbial suppression of expression of other fatty acid binding G protein coupled receptors (GPCRs) in the distal small intestine. A quantitative real time RT-PCR analysis of ileal RNA isolated from germ free (GF) or Bacteroides thetaiotaomicron (Bt) and Methanobrevibacter smithii (Ms) co-colonized Gpr41-/- and +/+ mice shows levels of short-chain fatty-acid-responsive GPCRs (Gpr41 and Gpr43), and long-chain fatty-acid- responsive GPCRs (GPR40 and GPR120) mRNAs expressed in relation to their expression in wildtype GF controls (n=5-7 animals assayed/group; mean values ± SEM are plotted; samples assayed in triplicate). Key: N. D., not detected. ^*, P<0.05, ^**, P<0.01. [0018] FIG. 10 shows that a microbiota-mediated increase in adiposity is blunted in Bt/Ms co-colonized gnotobiotic Gpr41-I- mice. FIG. 10A shows epididymal fat pad weights in Gpr41-/- and +/+ littermates that are germ free (GF), or raised GF and then colonized at 4-6 weeks of age with Bacteroides thetaiotaomicron (Bt) and Methanobrevibacter smithii (Ms) (n=4-14 males/group; 3 independent experiments). FIG. 10B graphically illustrates the average daily weight gain for Gpr41-/- and +/+ littermates that are GF, or raised GF and then colonized with Bt and Ms (n=4-9/group; followed for 1 -2 times per week for up to 4 weeks between the ages of 5 and 9 weeks of age in the case of GF animals, and for 4 weeks after gavage in the case of Bt/Ms co- colonized gnotobiotic animals). The mean values ± SEM are plotted. Key: ^*, P<0.05; **, P<0.01 ; and N. S., not significantly different.

[0019] FIG. 11 demonstrates that microbiota-mediated increase in adiposity is blunted in CONV-R Gpr41-/- mice. FIG. 11 A depicts epididymal fat pad weights in CONV-R wildtype (CONV-R +/+) compared to CONV-R knockout (CONV-R - /-) mice (n=12 males/group). FIG. 11 B depicts the average daily weight gain in CONV- R wildtype compared to CONV-R knockout mice (n=6/group; followed for 1 -2 times per week for up to 4 weeks between the ages of 5 and 9 weeks of age CONV-R animals). FIG. 11 C demonstrates adiposity in CONV-R wildtype and knockout mice, defined by dual energy X-ray absorptiometry (DEXA) (n=9-13 males/group; 8-10 weeks old). FIGs. 11 D and 11 E illustrate fasting (4h) serum leptin levels plotted against percent total body fat for CONV-R wildtype compared to CONV-R Gpr41 deficient (i.e. knockout Gpr41 -/- mice (n=5/group). Key: ^*, P<0.05; ^**, P<0.01 (Student's t-test).

[0020] FIG. 12 shows that energy intake, locomotor activity, and body temperature are similar in CONV-R knockout and wildtype mice. A telemetry-based assessment of body temperature (FIG. 12A) and locomotor activity (FIG. 12B, plots average counts with 10 minute intervals) was conducted over the course of 5 days (n=4 animals/group). FIG. 12C graphically represents the calories of chow consumed per day by CONV-R wildtype and knockout mice (n=11 -16 males/group). The mean values are plotted ± SEM. [0021] FIG. 13 shows an increased rate of intestinal transit in Bt/Ms colonized gnotobiotic Gpr41-/- mice. FIG. 13A depicts fasting serum PYY levels in GF and Bt/MS co-colonized, Gpr41 -/- and Gpr41 +/+ mice (n=4-8/group; 2 independent experiments; all samples assayed in duplicate). FIG. 13B shows gut transit time measured by oral gavage of a fluorescently labeled non-absorbable substrate [fluorescine isothiocyanate-dextran; 70,000 MW] in GF and co-colonized wildtype and Gpr41 deficient animals. The distribution of fluorescence signal intensity 60 minutes after gavage along the length of the gut is depicted. The data were plotted as a fraction of total fluorescence. No signal was observed in the ceca or colons in any of the animals. FIG. 13C graphically illustrates the calculated geometric center of the fluorescence for GF and co-colonized wildtype (and Gpr41 -/- animals (n=4-8 animals analyzed/group). Key: ^*, P<0.05; ^**, P<0.01 ; and ^***, P<0.005; GF +/+, GF wildtype; GF -/-, GF-Gpr41 deficient; Bt/Ms +/+, co-colonized wildtype; and Bt/Ms -/-, co- colonized Gpr41 deficient.

[0022] FIG. 14 demonstrates gnotobiotic Gpr41-/- mice extract fewer calories from their polysacchahde-hch chow diet and excrete more SCFAs than wildtype mice. FIG. 14A depicts the dietary energy intake in GF and Bt/Ms co-colonized +/+ and Gpr41-/- littermates (calories of chow consumed/day monitored concurrently with body weight, as in Fig. 10). FIG. 14B shows a bomb calohmetry-based assessment of remaining calories in the feces of co-colonized (Bt/Ms) Gpr41-/- and +/+ mice (n=7- 8/group). FIG. 14C shows a gas chromatography-mass spectrometric (GC-MS) assay of cecal SCFA levels (n=5-7/group; each sample assayed in duplicate). FIG. 14D demonstrates a GC-MS study of fecal SFCAs from the same mice assayed in FIG. 14C. Key: ^*, P<0.05; ^**, P<0.01 ; ^***, P<0.005; GF +/+, GF wildtype; GF -/-, GF-Gpr41 -/-; Bt/Ms +/+, co-colonized wildtype; and Bt/Ms -/-, co-colonized Gpr41 -/-. (Student's t-test used for comparisons of two groups.)

[0023] FIG. 15 demonstrates that the colonization-mediated increase in hepatic de novo lipogenesis is attenuated in Gpr41 -/- mice. FIG. 15A shows biochemical analyses of liver triglyceride levels in GF and Bt/Ms co-colonized, Gpr41-/- and +/+ mice (n=7-8/group). FIG. 15B depicts quantitative real time RT-PCR assays of fatty acid synthase (Fas) expression (n=5-7/group). The mean values ± SEM are plotted. Key: ^*, P<0.05; ^**, P<0.01 ; GF +/+, GF wildtype; GF -/-, GF-Gpr41 deficient; Bt/Ms +/+, co-colonized wildtype; and Bt/Ms -/-, co-colonized Gpr41 deficient.

DETAILED DESCRIPTION OF THE INVENTION

[0024] The present invention generally provides methods for preventing or treating obesity and/or obesity-related disorders in a subject. The inventors have discovered that modulating the intestinal microbiota activation of the G-protein coupled receptor Gpr41 in intestinal enteroendochne cells affects the efficiency of caloric extraction from the diet. The invention provides methods of altering a microbiota- dependent metabolic circuit that regulates the flow of calories from the diet to the host. Specifically, the invention provides methods for regulating microbiota-mediated Gpr41 signaling to promote weight loss, modulate body fat, and treat or prevent obesity and/or obesity-related disorders.

Methods For Promoting Weight Loss And/Or Reducing Body Fat

[0025] The present invention provides methods for preventing or treating obesity by reducing body fat and/or promoting weight loss in a subject. In particular, methods are provided in which intestinal microbiota dependent signaling is regulated as a means to 1 ) promote weight loss in a subject, 2) decrease energy harvesting in a subject, and 3) reduce hepatic lipogenesis in a subject. The methods comprise administering a Gpr41 inhibitor to the subject in a manner such that the inhibitor is substantially non-absorbed in the gastrointestinal tract of the subject, and the inhibitor substantially reduces intestinal microbiota dependent signaling through the enteroendochne cells that express Gpr41. As used herein, the phrase "substantially non-absorbed in the gastrointestinal track of the subject" means that the inhibitor does not enter the intestinal vascular or lymphatic system and consequently is not distributed to other surrounding cells or other tissues (which may also express Gpr41 ).

[0026] Gpr41 is a G-protein coupled receptor that binds to and is activated by free fatty acids, and in particular short chain free fatty acids having from two to six carbon atoms. Gpr41 is also known as FFAR3 (free fatty acid receptor 3). As demonstrated in the examples, Gpr41 is expressed predominantly in the small intestine (i.e., ileum) and the large intestine (e.g., colon) (see FIG. 1 ). Furthermore, Gpr41 is expressed specifically in the enteroendocrine cells of the intestine (see FIG. 2) and mediates intestinal microbiota dependent signaling (see FIG. 10-FIG.15).

(I) Gpr41 Inhibitors

[0027] The type of Gpr41 inhibitor used to reduce microbiota-dependent signaling through Gpr41 can and will vary. As used herein, the phrase "Gpr41 inhibitor" refers to those agents that substantially reduce microbiota-dependent Gpr41 signaling by, for instance, disrupting the intestinal Gpr41 signaling pathway or decreasing the expression of Gpr41 in the intestine. In either case, without being bound by any theory, it is believed that the Gpr41 inhibitor may substantially reduce the harvest of energy from the diet, thereby facilitating reduced caloric intake and promoting weight loss (or preventing weight gain). Furthermore, administration of the Gpr41 inhibitor generally results in altered secretion of peptide YY (PYY).

[0028] Suitable inhibitors may include, but are not limited to, fatty acid analogs, small molecules, peptides and peptidomimetics, proteins, antibodies, or nucleic acids. In some instances, the inhibitor may be derived from the Gpr41 signaling family and/or may block the action of a natural ligand, and resultantly inhibit Gpr41 signaling in the intestine. In another embodiment, a Gpr41 inhibitor may interact with Gpr41 targets, such as PYY, to inhibit the effects of Gpr41 signaling in the intestine.

(a) small organic molecule inhibitors

[0029] In some embodiments, the Gpr41 inhibitor may be a small organic molecule or other small compound that inhibits microbiota dependent signaling through intestinal Gpr41. The small organic molecule may be a natural molecule or a synthetic molecule. For example, the small organic molecule may be a member of a combinatorial library of small organic molecules. Alternatively, the small molecule may be designed through rational drug design as known in the art. The small molecule inhibitor may compete with ligand binding to intestinal Gpr41 , prevent interaction between microbiota-mediated ligands and intestinal Gpr41 , and/or prevent activation of intestinal Gpr41. Suitable small molecule regulators include, but are not limited to, small molecule inhibitors and may be either short chain acyl-containing, or peptidic or other nonpeptidic compounds. For example, small molecule regulators may be isolated using techniques known to those skilled in the art, such as high-throughput screening of chemical libraries, protein-protein binding assays, biochemical screening assays, immunoassays and cell based assays.

[0030] In some embodiments, the inhibitor may comprise the known organic compound 2-Methyl-4-[5-(2-nitro-4- trifluoromethyl-phenyl)-furan-2-yl]-5-oxo- 1,4,5,6, 7, δ-hexahydro-quinoline-3-carboxylic acid o-tolylamide, 4-(5-Biphenyl-2-yl-furan- 2-yl)-2-methyl-5-oxo-l ,4,5,6,7,8- hexahydro-qumoline-3-carboxylic acid o-tolylamide, 2- Methyl-4-[5-(2-nitro-phenyl)- furan-2-yl]-5-oxo-l,4,5,6,7,8-hexahydro-quinoline-3- carboxylic acid (2-chloro-phenyl)- amide, 2-Methyl-5-oxo-4-(4-phenoxy-phenyl)- l,4,5,6,7,8-hexahydro-quinoline-3- carboxylic acid o-tolylamide, 2-Methyl-5-oxo-4-[5-(2- trifluoromethoxy-phenyl)-furan-2- yl]-l,4,5,6,7,8-hexahydro-quinoline-3-carboxylic acid o- tolylamide, or 4-[5-(2,5- Dichloro-phenyl)-furan-2-yl]-2-methyl-5-oxo-l,4,5,6,7,8- hexahydro-quinoline-3- carboxylic acid o-tolylamide; or a pharmaceutically acceptable salt thereof. The structure of these molecules may be found in Table A. Without being bound by a theory, it is believed that these organic molecules may inhibit the binding of ligand to intestinal enteroendocrine cell-associated Gpr41 or block the activation of intestinal Gpr41.

TABLE A.

TABLE A.

TABLE A.

[0031] In other embodiments, the small molecule inhibitor may alter expression of intestinal Gpr41 such that the level of Gpr41 is reduced in intestinal cells. For instance, the small molecule may block activity of the promoter of the Gpr41 gene, affect stability of the Gpr41 mRNA, or block the translation of the Gpr41 , or affect the stability of the protein produce of Gpr41 mRNA. (b) peptides or proteins

[0032] In some embodiments, the Gpr41 inhibitor may comprise a peptide that binds microbiota-produced ligands (e.g., short chain fatty acids), a peptide that blocks the interaction between microbiota-produced ligands (e.g., short chain fatty acids) and Gpr41 , a peptide that blocks activation of Gpr41 , or a peptide that blocks the intracellular signaling of Gpr41. In one embodiment, the peptide may be a Gpr41 peptide, i.e., a peptide derived from Gpr41 or a related protein, wherein the peptide binds Gpr41 ligands and, thus, prevents the ligands from interacting with Gpr41. Several Gpr41 peptides known in the art may be suitable for use in the present invention. Generally speaking, the Gpr41 peptide is derived from a mammal Gpr41 protein. By way of non-limiting example, suitable Gpr41 peptides may be derived from a Gpr41 protein delineated in Table B.

TABLE B. Gpr41 proteins and nucleotides.

[0033] For example, any peptide of at least 20, preferably 25, 30, 35, 40,

50 or more amino acids encoded by a Gpr41 family member or fragment thereof may be used to bind to microbiota-mediated ligands or interfere with the interaction between microbiota-mediated ligands and intestinal Gpr41

[0034] Other suitable peptides for use in the invention include homologs, orthologs, mimics, or degenerate variants of Gpr41 or a fragment thereof. Numerous methods may be employed to determine whether a particular homolog, mimic or degenerative variant possesses substantially similar biological activity relative to Gpr41 or a fragment thereof. Specific activity or function may be determined by convenient in vitro, cell-based, or in vivo assays, such as those known in the art or those described in WO0161359, which is incorporated herein by reference. [0035] In addition to having a substantially similar biological function, a homolog, ortholog, mimic or degenerative variant will also typically share substantial sequence similarity to Gpr41 or a fragment thereof. For example, suitable homologs, orthologs, or degenerative variants preferably share at least 30% sequence similarity with Gpr41 or a fragment thereof, more preferably, 50% sequence similarity, and even more preferably, greater than about 75% sequence similarity with Gpr41 or a fragment thereof. Alternatively, peptide mimics may be used that retain critical molecular recognition elements, although peptide bonds, side chain structures, chiral centers and/or other features of the parental active protein sequence may be replaced by chemical entities that are not native to protein but, nevertheless, confer activity. Preferably, such alterations may result in a Gpr41 -related peptide or mimic that may bind microbiota-mediated ligands, but not exhibit ligand dependent signaling events in the intestine.

[0036] To determine whether a peptide is substantially homologous to

Gpr41 or a fragment thereof, sequence similarity may be determined by conventional algorithms, which typically allow introduction of a small number of gaps in order to achieve the best fit. In particular, "percent identity" of two peptides or two nucleic acid sequences is determined using the algorithm of Karlin and Altschul (1993, Proc. Natl. Acad. Sci. USA 87:2264). Such an algorithm is incorporated into the BLASTN and BLASTX programs of Altschul, et al. (1990, J. MoI. Biol. 215:403). BLAST nucleotide searches may be performed with the BLASTN program to obtain nucleotide sequences homologous to a nucleic acid molecule of the invention. Equally, BLAST protein searches may be performed with the BLASTX program to obtain amino acid sequences that are homologous to a peptide of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST is utilized as described in Altschul, et al. (1997, Nucleic Acids Res. 25:3389). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTX and BLASTN) are employed. In another embodiment, the Gpr41 inhibitor may be a non-Gpr41 peptide that blocks the interaction between a ligand and Gpr41 , competes with ligand binding to Gpr41 , or prevents activation of Gpr41. [0037] In a further embodiment, the non-Gpr41 peptide may be peptide that is structurally unrelated to Gpr41 , but blocks the binding of microbiota-mediated ligands to Gpr41 , blocks activation of Gpr41 , and/or blocks the intracellular signaling of Gpr41. Alternatively, the non-Gpr41 peptide may affect expression of intestinal Gpr41 , such that less Gpr41 is present in intestinal cells. For example, the non-Gpr41 peptide may regulate the promoter of the Gpr41 gene, affect stability of the Gpr41 mRNA, affect the translation of the Gpr41 , or affect the stability of the protein product of Gpr41 mRNA.

[0038] Proteins and peptides useful in the invention may be isolated from natural sources, prepared synthetically or recombinantly, or any combination thereof using techniques well known to those of skill in the art. Generally, any purification protocol suitable for isolating proteins and known to those of skill in the art may be used. For example, affinity purification, column chromatography techniques, precipitation protocols and other methods for separating proteins may be used (see, e.g., Scopes, (1982) Protein Purification: Principles and Practice). Recombinant peptides or proteins may be generated and purified using procedures well know to those of skill in the art (see, e.g., see e.g., Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory; Ausubel, et al., Current Protocols in Molecular Biology, Wiley-lnterscience, New York). Furthermore, peptides may be produced synthetically using solid phase techniques and other techniques known to those skilled in the art (see, Barany, G. and Merrifield, R. B. (1980) Solid Phase Peptide Synthesis in PEPTIDES, Vol. 2, Academic Press, New York, N.Y., pp. 100-118). Peptides and proteins of the invention may also be available commercially, or may be produced commercially.

(c) antibodies

[0039] In still other embodiments, the Gpr41 inhibitor may be an antibody or fragment thereof that inhibits the interaction between intestinal GRP41 and its ligands or inhibits the activation of intestinal Gpr41 , such that microbiota dependent signaling through intestinal Gpr41 is blocked. In some embodiments, an antibody may deliver an inhibitor of Gpr41 (either through recognition of Gpr41 epitopes or other epitopes expressed on the surfaces of Gpr41 expressing enteroendocrine cells). Suitable antibodies include, but are not limited to those that recognize Gpr41 or Gpr41 signaling proteins, peptides, amino acid sequences, ligands, or fragments thereof.

[0040] In general, suitable antibodies may be obtained by immunizing a host animal with a suitable antigen, e.g., a Gpr41 protein, peptide, homolog, ortholog, variant, ligand, or fragment thereof. For example, a suitable antigen may have at least 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% identity to at least 5, 8, 10, 12, 15, 20, or 25 contiguous amino acids of a Gpr41 protein or ligand. More preferably, the antibody specifically binds a peptide having at least 75%, 80%, 85%, 90%, 95%, 99% or more identity to at least 5, 8, 10, 15, 20 or more contiguous amino acids of a Gpr41 protein or ligand.

i) monoclonal antibodies

[0041] In one embodiment, the antibody that inhibits intestinal Gpr41 may be a monoclonal antibody. Monoclonal antibodies (MAbs) may be readily prepared through use of well-known techniques to those skilled in the art, such as those exemplified in U.S. Pat. No. 4,196,265, incorporated herein by reference. Typically, this technique involves immunizing a suitable animal with the selected antigen. The antigen is administered in a manner effective to stimulate antibody-producing cells. Rodents such as mice and rats are preferred animals, however, the use of rabbit, sheep and frog cells is also possible.

[0042] By way of example, following immunization, the somatic cells with the potential for producing antigen specific antibodies, specifically B lymphocytes (B cells), are selected for use in the MAb generating protocol. These cells may be obtained from biopsied spleens, tonsils or lymph nodes, or from a peripheral blood sample. Spleen cells and peripheral blood cells are preferred, the former because they are a rich source of antibody-producing cells that are in the dividing plasmablast stage, and the latter because peripheral blood is easily accessible. Often, a panel of animals will be immunized and the spleen of the animal with the highest antibody titer will be removed and processed. [0043] The anti-antigen antibody-producing B lymphocytes from the immunized animal are then fused with cells of an immortal myeloma cell, generally one of the same species as the animal that was immunized. Myeloma cell lines suited for use in hybridoma-producing fusion procedures preferably are non-antibody-producing, have high fusion efficiency, and enzyme deficiencies that render them incapable of growing in certain selective media which support the growth of only the desired fused cells (hybridomas).

[0044] Any one of a number of myeloma cells may be used, as are known to those of skill in the art (Goding, pp. 65 66, 1986; Campbell, pp. 75 83, 1984; each incorporated herein by reference). For example, where the immunized animal is a mouse, one may use P3-X63/Ag8, X63-Ag8.653, NS1/1.Ag 41 , Sp210-Ag14, FO, NSO/U, MPC-11 , MPC11 -X45-GTG 1.7 and S194/5XX0 BuI; for rats, one may use R210.RCY3, Y3-Ag 1.2.3, IR983F, 4B210 or one of the above listed mouse cell lines; and U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6, are all useful in connection with human cell fusions.

[0045] The heterogeneous cell population may be cultured in the presence of a selection medium to select out the hybhdoma cells. A suitable selection medium includes an inhibitor of de novo synthesis, such as aminoptehn in HAT medium, methotrexate in HMT medium, or azaserine in AzaH medium plus the necessary purine and/or pyrimidine salvage precursors (i.e. hypoxanthine and thymidine in HAT or HMT media; hypoxanthine in AzaH medium). Only cells capable of operating nucleotide salvage pathways are able to survive in the selection medium. The myeloma cells are defective in key enzymes of the salvage pathway, e.g., hypoxanthine phosphohbosyl transferase (HPRT), and cannot survive. The B cells can operate this pathway, but they have a limited life span in culture and generally die within about two weeks. Therefore, the only cells that can survive in the selective media are those hybrids formed from myeloma and B cells (hybridomas).

[0046] Cultuhng provides a population of hybridomas from which specific hybridomas are selected. Typically, selection of hybridomas is performed by cultuhng the cells by single-clone dilution in microtiter plates, followed by testing the individual clonal supernatants (after about two to three weeks) for the desired anti-antigen reactivity. The assay for testing is generally sensitive, simple and rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity assays, plaque assays, dot immunobinding assays, and the like.

[0047] The selected hybridomas are then serially diluted and cloned into individual anti-antigen antibody-producing cell lines, which then may be propagated indefinitely to provide MAbs. The cell lines may be exploited for MAb production in two basic ways. A sample of the hybridoma may be injected (often into the peritoneal cavity) into a histocompatible animal of the type that was used to provide the somatic and myeloma cells for the original fusion. The injected animal develops tumors secreting the specific monoclonal antibody produced by the fused cell hybrid. The body fluids of the animal, such as serum or ascites fluid, then may be tapped to provide MAbs in high concentration. The individual cell lines also may be cultured in vitro, where the MAbs are naturally secreted into the culture medium from which they can be readily obtained in high concentrations.

[0048] MAbs produced by either means will generally be further purified, e.g., using filtration, centrifugation and various chromatographic methods, such as HPLC or affinity chromatography, all of which purification techniques are well known to those of skill in the art. These purification techniques each involve fractionation to separate the desired antibody from other components of a mixture. Analytical methods particularly suited to the preparation of antibodies include, for example, protein A- Sepharose and/or protein G-Sepharose chromatography.

H) humanized antibodies

[0049] In yet another embodiment the antibody that inhibits intestinal

Gpr41 may be a humanized antibody. Methods of humanizing antibodies are known in the art. The humanized antibody may be the product of an animal having transgenic human immunoglobulin constant region genes (see for example International Patent Applications WO 90/10077 and WO 90/04036, both incorporated herein by reference). Alternatively, the antibody of interest may be engineered by recombinant DNA techniques to substitute the CH1 , CH2, CH3, hinge domains, and/or the framework domain with the corresponding human sequence (see International Patent Application WO 92/02190 and incorporated herein by reference).

[0050] The use of immunoglobulin (Ig) cDNA for construction of chimeric immunoglobulin genes is known in the art (Liu et al., 1987, Proc. Natl. Acad. Sci. 84:3439, and incorporated herein by reference). Briefly, mRNA is isolated from a hybhdoma or other cell producing the antibody and used to produce cDNA. The cDNA of interest may be amplified by the polymerase chain reaction using specific primers (see U.S. Patent Nos. 4,683,195 and 4,683,202, both incorporated herein by reference). Alternatively, a library is made and screened to isolate the sequence of interest. The DNA sequence encoding the variable region of the antibody is then fused to human constant region sequences. The sequences of human constant region genes may be found in Kabat et al. Sequences of Proteins of Immunological Interest, N. I. H. publication no. 91 -3242, 1991 and incorporated herein by reference. Human C region genes are readily available from known clones. The chimeric, humanized antibody is then expressed by conventional methods known to those of skill in the art.

Hi) antibody fragments

[0051] In a further embodiment, the antibody that inhibits microbiota mediated Gpr41 signaling in the intestine may be an antibody fragment. Antibody fragments, such as Fab, Fab,' F(ab')₂, Fv, or Fd fragments may be prepared by cleavage of the intact protein, e.g. by protease or chemical cleavage. Alternatively, a truncated gene may be designed. For example, a chimeric gene encoding a portion of the F(ab')2 fragment includes DNA sequences encoding the CH1 domain and hinge region of the H chain, followed by a translational stop codon to yield the truncated molecule. The following patents and patent applications are specifically incorporated herein by reference for the preparation and use of functional, antigen-binding regions of antibodies and antibody fragments: U.S. Patent Nos. 5,855,866; 5,965,132; 6,051 ,230; 6,004,555; and 5,877,289. iv) other antibodies

[0052] In an alternate embodiment, the antibody that inhibits intestinal

Gpr41 may be a single chain antibody. The single chain antibody may be a single chain Fv (scFv) fragment in which the variable regions of the light and heavy chains are joined by a flexible linker moiety. The single chain Fv antibody may be generated using methods disclosed in U.S. Pat. No. 4,946,778 or using phage display library techniques (Huse et al., 1989, Science 246:1275-1281 ; McCafferty et al., 1990, Nature 348:552- 554) (each of these is incorporated in its entirety by reference).

[0053] The antibody used in the invention may also be a diabody, which is a small antibody fragment with two antigen-binding sites. The fragment may include a heavy chain variable domain (V_H) connected to a light chain variable domain (VL) in the same peptide chain (V_H V_L). By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites. Techniques for generating diabodies are well known to those of skill in the art and are also described in EP 404,097 and WO 93/11161 , each specifically incorporated herein by reference. Also, linear antibodies, which can be bispecific or monospecific, may include a pair of tandem Fd segments (V_H Cm-V_H C_H1 ) that form a pair of antigen binding regions may be useful to the invention as described in Zapata et al. (1995; Protein Engineering, 8(10):1057-1062), and incorporated herein by reference.

[0054] In still another alternate embodiment, the antibody that inhibits

Gpr41 signaling in the gut may be a camelid antibody, which is a small antibody molecule that lacks light chains (Hamers-Casterman et al., 1993, Nature 363(6428):446-448).

(d) nucleic acids

[0055] In a further embodiment the inhibitor that blocks microbiota mediated Gpr41 signaling in the intestine may be a nucleic acid. Suitable nucleic acids may include short interfering RNAs (siRNA), microRNAs (miRNA), short hairpin RNA (shRNA), anti-sense nucleic acids, or complementary DNAs (cDNA). For example, siRNAs targeting a gene encoding Gpr41 may be utilized to down-regulate expression level of the gene. Interference with the function and expression of endogenous genes by double-stranded RNA has been shown in various organisms such as C. elegans as described, e.g., in Fire et al. Nature 391 : 806-811 (1998); Drosophila as described, e.g., in Kennerdell et al., Cell 95(7): 1017-1026 (1998); and mouse embryos as described, e.g., in Wianni et al., Nat. Cell Biol., 2(2): 70-75 (2000). Such double-stranded RNA may be synthesized by in vitro transcription of single-stranded RNA read from both directions of a template and in vitro annealing of sense and antisense RNA strands. Double-stranded RNA may also be synthesized from a cDNA vector construct in which the gene of interest is cloned in opposing orientations separated by an inverted repeat. Following cell transfection, the RNA is transcribed and the complementary strands re- anneal. Double-stranded RNA targeting the gene of interest may be introduced into a cell by transfection of an appropriate construct. The described nucleic acid inhibitors and others known in the art may be generated by methods commonly known in the art. Specific siRNAs targeting the Gpr41 gene have been described in the art, e.g., Xiong et al., Proc. Natl. Acad. Sci. USA 101 :1045-1050 (2004).

(II) Administering the Gpr41 Inhibitor

[0056] The Gpr41 inhibitor may be administered to the subject alone or as the active ingredient of a pharmaceutical composition, such that the Gpr41 inhibitor is delivered predominately to the gastrointestinal tract. As detailed above, the Gpr41 inhibitor is substantially non-absorbed in the intestinal tract, wherein it inhibits substantially only intestinal Gpr41.

[0057] Administration of the Gpr41 inhibitor blocks microbiota mediated signaling of intestinal Gpr41 , which may result in altered secretion of enteroendocrine- derived hormones, such as PYY. Furthermore, administration of the Gpr41 inhibitor results in decreased triglyceride storage in the adipocytes of the subject (i.e., modulates body fat) and promotes weight loss in the subject.

[0058] In some embodiments, the Gpr41 inhibitor may be modified with a protectant such that its solubility is altered at specific pH levels relative to the unmodified inhibitor. This modification may be used to ensure that the inhibitor is substantially non-absorbed in the gastrointestinal tract. In one embodiment, the protectant may be an organic acid, an amino acid, a fatty acid, or a protein. For example, a mineral complexed or chelated with an organic acid, such as lactic acid or gluconic acid, is more soluble at neutral pH than the inorganic salts of the mineral. Likewise, a drug may be complexed with an organic acid, an amino acid, or a fatty acid to generate a pharmaceutically acceptable salt, such as citrate, glutamate, lactate, malate, palmitate, tartrate, and the like. Methods to make organic mineral salts or pharmaceutically acceptable salts of biologically active agents are well known in the art.

[0059] In embodiments in which the Gpr41 inhibitor is part of a pharmaceutical composition, the pharmaceutical composition may also comprise a pharmaceutically acceptable excipient. Excipients may include, for example, sugars, starches, celluloses, gums, proteins, etc. that act as binders, fillers, diluents, lubricants, preservatives, and the like. Various formulations are commonly known and are thoroughly discussed in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing, Easton Pa.). The pharmaceutical composition may comprise about 1 %, about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% of the Gpr41 inhibitor, with the balance substantially comprising an excipient or a combination of excipients.

[0060] In another embodiment, the Gpr41 inhibitor or the pharmaceutical composition comprising the Gpr41 inhibitor may be modified with a protective coating or encapsulation such that the inhibitor may be selectively released throughout the length of the gastrointestinal tract. Such regulated release my help ensure that the Gpr41 inhibitor is substantially non-absorbed in the intestinal tract. Typically, one or more of the ingredients forming the pharmaceutical composition is microencapsulated or dry coated prior to being formulated into a dosage form. By varying the amount and type of coating and its thickness, the timing and location of release of a given ingredient or several ingredients may be varied. The coating material may be a biopolymer, a semisynthetic polymer, or a mixture thereof. The microcapsule may comprise one coating layer or many coating layers, of which the layers may be of the same material or different materials. In some embodiments, release of the inhibitor may be independent of pH. For this, the protective coating may be a polysaccharide, a protein, a fat or lipid, an edible wax, or combinations thereof. Alternatively, the protective coating may be an enteric coating or coatings such that release of the inhibitor may be pH dependent. The enteric coating generally will provide for controlled release of the Gpr41 inhibitor at some generally predictable location in the lower intestinal tract below the point at which inhibitor release would occur without the enteric coating. The enteric coating is generally a polymeric material that is pH sensitive. A variety of anionic polymers exhibiting a pH-dependent solubility profile are well known to those of skill in the art.

[0061] In general, the Gpr41 inhibitor or pharmaceutical composition comprising the Gpr41 inhibitor will be administered to the subject orally, such that the Gpr41 inhibitor is delivered directly to the gastrointestinal tract. The Gpr41 inhibitor may be administered as a tablet, a pill, a capsule, a powder, pellets, granules, a liquid, a suspension, an emulsion, or a gel. Alternatively, the Gpr41 inhibitor or the pharmaceutical composition comprising the Gpr41 inhibitor may be incorporated into a food product or powder for mixing with a liquid, or administered orally after only mixing with a non-foodstuff liquid.

[0062] The methods of the invention comprise administering at least one

Gpr41 inhibitor. It is also envisioned that two or more Gpr41 inhibitors also may be administered to the subject in order to modulate microbiota-mediated Gpr41 signaling to a more extensive degree than when one Gpr41 inhibitor is used. For example, a first Gpr41 inhibitor may be administered in combination with a second Gpr41 inhibitor. The two or more Gpr41 inhibitors may be administered simultaneously or sequentially.

[0063] The effective amount of the Gpr41 inhibitor or inhibitors administered to the subject can and will vary according to the specific inhibitor being utilized, as well as the age, weight, and generally health status of the subject. The effective amount may vary depending upon the composition of the individual's intestinal microbiota. Dosages for a particular individual subject may be determined by one of ordinary skill in the art using conventional considerations. Those skilled in the art will appreciate that dosages may also be determined with guidance from Goodman & Gilman's The Pharmacological Basis of Therapeutics, Ninth Edition (1996), Appendix II, pp. 1707-1711 and from Goodman & Gilman's The Pharmacological Basis of Therapeutics, Tenth Edition (2001 ), Appendix II, pp. 475-493.

[0064] The duration of administering the Gpr41 inhibitor or inhibitors will also vary depending upon the inhibitor being utilized and the health status of the subject. A suitable treatment regimen may be determined by one of ordinary skill in the art using conventional considerations.

[0065] It is also envisioned that the Gpr41 inhibitor may be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy may be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. Generally speaking, agents will include those that modulate body fat and/or weight loss by a mechanism other the mechanisms detailed herein.

[0066] In one embodiment, a compound that reduces the ability of the gut microbiota to ferment polysaccharides to short chain fatty acids is administered with any compound described herein. This could be achieved, for example, through administration of a compound that reduces the representation or methanogenic activity of the principal human gut methanogen, Methanobrevibacter smithii. The ability of this methanogenic archaeon to prevent hydrogen from building up in the distal gut is essential for maintaining efficient fermentation. Studies in gnotobiotic mice have shown that the combination of M. smithii and human gut-derived saccharolytic bacterium, such as Bacteroides thetaiotaomicron, produces greater adiposity in the host than does colonization with either organism alone. A reduction in the representation or methanogenic activity of M. smithii through administration of an anti-archaeal compound would be expected to decrease short chain fatty acid production and diminish adiposity. For more details, see US Patent Application serial no. 11/909,126, hereby incorporated by reference in its entirety. In certain embodiments, the Gpr41 inhibitor may be administered in combination with a compound that reduces the production of a microbiota-dehved ligand for Gpr41. [0067] In another embodiment, acarbose may be administered with the

Gpr41 inhibitor. Acarbose is an inhibitor of α-glucosidases and is required to break down carbohydrates into simple sugars within the gastrointestinal tract of the subject. In another embodiment, an appetite suppressant such as an amphetamine or a selective serotonin reuptake inhibitor such as sibutramine may be administered with the Gpr41 inhibitor. In still another embodiment, a lipase inhibitor such as orlistat or an inhibitor of lipid absorption such as Xenical may be administered with the Gpr41 inhibitor. The combination of therapeutic agents may act synergistically to modulate body fat and/or weight loss. In yet still another embodiment, a compound that increases body fat and/or weight gain may be administered with the Gpr41 inhibitor. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.

[0068] In yet another embodiment, the Gpr41 inhibitor may be administered in combination with a weight-loss diet. Non-limiting examples of such a diet may be calorie restricted, low carbohydrate, or low fat.

DEFINITIONS

[0069] To facilitate understanding of the invention, several terms or phrases are defined below.

[0070] The term "antagonist" refers to a molecule that inhibits or attenuates the biological activity of Gpr41 and in particular, the ability of SCFAs to activate Gpr41 signaling. Antagonists may include fatty acids or fatty acid derivatives, fatty acyl-containing compounds, peptides, proteins, antibodies, nucleic acids, carbohydrates, small molecules, or other compounds or compositions that modulate the activity of Gpr41 either by directly interacting with the receptor or by acting on components of the biological pathway in which Gpr41 participates.

[0071] "BMI" as used herein is defined as a human subject's weight (in kilograms) divided by height (in meters) squared.

[0072] An "effective amount" is a therapeutically-effective amount that is intended to qualify the amount of agent that will achieve the goal of a decrease in body fat, decrease in energy harvesting, decrease in hepatic lipogenesis, and/or in promoting weight loss.

[0073] A "gene" is a hereditary unit that has one or more specific effects upon the phenotype of the organism, and that can mutate to various allelic forms.

[0074] GF stands for germ free.

[0075] CONV-R stands for conventionally-raised, i.e., acquiring microbes beginning at birth.

[0076] The term "nucleic acid" refers to a polymer of deoxyribnucleotides, ribonucleotides, or combinations thereof. The nucleotides may be standard nucleotides (i.e., adenosine, guanosine, cytidine, thymidine, and uridine) or nucleotide analogs. A nucleotide analog refers to a nucleotide having a modified purine or pyhmidine base or a modified ribose moiety. A nucleotide analog may be a naturally occurring nucleotide (e.g., inosine) or a non-naturally occurring nucleotide. Non-limiting examples of modifications on the sugar or base moieties of a nucleotide include the addition (or removal) of acetyl groups, amino groups, carboxyl groups, carboxymethyl groups, hydroxyl groups, methyl groups, phosphoryl groups, and thiol groups, as well as the substitution of the carbon and nitrogen atoms of the bases with other atoms (e.g., 7- deaza purines). Nucleotide analogs also include dideoxy nucleotides, 2'-O-methyl nucleotides, locked nucleic acids (LNA), peptide nucleic acids (PNA), and morpholinos. The nucleotides may be linked by phosphodiester, phosphothioate, phosphoramidite, or phosphorodiamidate bonds.

[0077] "Obesity" or a "subject in need of treatment for obesity" is defined by at least one of three criteria: (i) BMI over 30; (ii) 100 pounds overweight; or (iii) 100% above an "ideal" body weight. In addition, non-limiting examples of obesity-related disorders that may be treated by the methods of the invention include metabolic syndrome, type Il diabetes, hypertension, cardiovascular disease, and nonalcoholic fatty liver disease. In general, a subject in need of treatment for obesity is diagnosed and then administered any of the treatments detailed herein.

[0078] "Peptide" is defined as a compound formed of two or more amino acids, with an amino acid defined according to standard definitions. [0079] The term "pharmaceutically acceptable" is used adjectivally herein to mean that the modified noun is appropriate for use in a pharmaceutical product; that is the "pharmaceutically acceptable" material is relatively safe and/or non-toxic, though not necessarily providing a separable therapeutic benefit by itself. Pharmaceutically acceptable cations include metallic ions and organic ions. More preferred metallic ions include, but are not limited to appropriate alkali metal salts, alkaline earth metal salts and other physiologically acceptable metal ions. Exemplary ions include aluminum, calcium, lithium, magnesium, potassium, sodium and zinc in their usual valences. Preferred organic ions include protonated tertiary amines and quaternary ammonium cations, including in part, trimethylamine, diethylamine, N,N'-dibenzy1 ethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N methylglucamine) and procaine. Exemplary pharmaceutically acceptable acids include without limitation hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, methanesulfonic acid, acetic acid, formic acid, tartaric acid, maleic acid, malic acid, citric acid, isocitric acid, succinic acid, lactic acid, gluconic acid, glucuronic acid, pyruvic acid, oxalacetic acid, fumaric acid, propionic acid, aspartic acid, glutamic acid, benzoic acid, and the like.

[0080] "Subject" as used herein typically is a mammalian species. The subject may be a rodent, a human, a livestock animal, a companion animal, or a zoological animal. In one embodiment, the subject is a human. In another embodiment, the subject is a rodent, i.e. a mouse, a rat, a guinea pig, etc. In yet another embodiment the subject is a livestock animal. Non-limiting examples of livestock animals include pigs, cows, horses, goats, sheep, llamas and alpacas. In still another embodiment, the subject is a companion animal. Non-limiting examples of companion animals include pets, such as dogs, cats, rabbits, and birds. In still yet another embodiment, the subject is a zoological animal. As used herein, a "zoological animal" refers to an animal that may be found in a zoo. Such animals may include non- human primates, large cats, wolves, and bears. In a further embodiment, subjects that may be treated by the methods of the invention include a human, a dog, a cat, a cow, a horse, a rabbit, a pig, a sheep, a goat, as well as non-mammalian species including an avian species and a fish species.

[0081] The term "modulate" with respect to biological activities of Gpr41 refers to a change in its cellular level, subcellular localization, enzymatic modification, binding characteristics (e.g., binding to a ligand or protein partner), or any other functional, immunological, or biological properties (e.g., its G protein coupled receptor activity). The change in activity can arise from, for example, a decrease in expression of the Gpr41 gene, the stability of mRNA that encodes Gpr41 protein, translation efficiency, Gpr41 protein stability (turnover), or from a change in other bioactivities of the Gpr41 protein. The mode of action of a Gpr41 inhibitor can be direct, e.g., through binding to the protein's ligand, the protein itself, a protein partner, or the gene encoding Gpr41 or a protein partner of the ligand required for signaling. The change can also be indirect, e.g., through binding to and/or modifying (e.g., enzymatically) another molecule which otherwise modulates Gpr41.

[0082] The term "substantially reduce" refers to any detectable reduction of Gpr41 signaling as compared to a previous level of Gpr41 signaling or to a standard control level established for the subject or for the general subject based on species, age, race, or other factors.

[0083] The term "substantially non-absorbable" or "substantially non- absorbed" refers to a composition wherein at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the Gpr41 inhibitor is non-absorbed from the lumen of the gastrointestinal tract into the surrounding tissue. In some embodiments, at least 50, 75%, or 90% or more of the Gpr41 inhibitor is non- absorbed.

[0084] As various changes could be made in the above compounds, products and methods without departing from the scope of the invention, it is intended that all matter contained in the above description and in the examples given below, shall be interpreted as illustrative and not in a limiting sense. EXAMPLES

[0085] The following examples illustrate various iterations of the invention.

[0086] The ability to effectively digest food reflects the combined activities of enzymes encoded in the host genome and in the genomes of trillions of microbes that reside in the host distal gut (the microbiome). This microbial community, or microbiota, affects both sides of the energy balance equation, influencing both the harvest of calories and the activity of host genes involved in the metabolism and storage of absorbed energy (1 ).

Example 1. Experimental materials and methods used to analyze microbiota- mediated Gpr41 signaling.

[0087] To analyze the molecular mechanisms underlying the effect of the microbiota on energy harvesting, a myriad of mouse models were employed. Specifically, germ free (GF) wildtype (+/+) and Gpr41 knockout (-/-) mice with and without a model fermentative microbial community composed of B. thetaiotaiomicron (Bt) and M. smithii (Ms), or with or without a complete gut microbial community were used. A description of the mouse models and experimental methods used throughout the Examples follow below.

[0088] Generation of Gpr41 Knockout Mice. A 129/SV mouse BAC clone obtained from Children's Hospital Oakland Research Institute (CHORI) was used to construct the targeting vector depicted in FIG. 7. SM-1 ES cells (18), cultured on irradiated LIF-producing STO feeder layers were electroporated with the linearized targeting vector and selected for resistance to G418 (18). Resistant ES cell clones were screened by Southern blotting using a flanking 3' genomic fragment external to the targeting vector (FIG. 8A and 8B). Two of these ES cell clones were microinjected into C57BI/6 blastocysts to produce germline transmitting chimeric mice. PCR genotyping used the primer set 5'-CACACTGCTCGATCCGGAACCCTT (SEQ. ID NO. 1 ) and 5'- GAGAACTGTCTGGAAAACGCTCAC (SEQ. ID NO. 2) to identify the mutant Gpr41 allele, and 5'-CGACGCCCAGTGGCTGTGGACTTA (SEQ. ID NO. 3) and 5'- GTACCACAGTGGATAGGCCACGC (SEQ. ID NO. 4) to detect the wildtype allele. This PCR genotyping protocol was validated by Southern blotting (FIG. 8A and 8B). The mice were provided with food and water ad libitum and maintained on a strict 12 hour (h) light-dark cycle. All procedures involving genetically engineered mice used in this study were approved by the Institutional Review Board for Animal Research of the University of Texas Southwestern Medical Center at Dallas.

[0089] Husbandry of αnotobiotic mice. Gpr41-I- mice and their +/+ littermates (mixed C57BI6/129 background) were re-derived as GF and housed in flexible film plastic gnotobiotic isolators (19) where they were maintained on a strict 12h light cycle (lights on at 060Oh) and fed a standard autoclaved polysaccharide rich chow diet [B&K Universal, East Yorkshire, UK] ad libitum. Male mice, 4-6 weeks old, were inoculated with a single gavage of 10⁸ CFU of the sequenced human gut-derived B. thetaiotaomicron strain VPI-5482 [harvested from overnight culture in TYG medium (6)], and M. smithii strain PS [cultured at 37⁰C for 5 days (d) in 125ml serum bottles containing 15ml MBC medium supplemented with 3 g/L formate, 3 g/L acetate, and 0.3 ml of a freshly prepared oxygen-free solution of filter-sterilized 2.5% Na2S (note that the remaining volume (headspace) in the bottle contained a 4:1 mixture of H₂ and CO₂ and the headspace was rejuvenated every 1 -2d) (8)]. All colonized mice were killed 28 days after gavage. The density of colonization was determined in cecal contents using quantitative PCR assays that utilized species-specific primers (8). Age-matched, male conventionally raised (CONV-R) wildtype and Gpr41 -/- male mice were also fed the same autoclaved polysaccharide rich chow diet ad libitum as the co-colonized gnotobiotic animals. All experiments performed with gnotobiotic mice used protocols approved by the Washington University Animal Studies Committee.

[0090] Analysis of host adiposity and energy harvest. All mice were fasted (4h) prior to sacrifice. Epididymal fat pads, livers, and segments of the distal intestine (ileum) and colon were removed and flash-frozen in liquid nitrogen. Epididymal fat pad and liver weights were recorded prior to freezing.

[0091] Prior to sacrifice, total body fat content was measured by dual-energy x-ray absorptiometry (Lunar PIXImus Mouse, GE Medical Systems, Waukesha, Wl), 5 min after mice had been anesthesized with an intra-pehtoneal injection of ketamine (10 mg/kg body weight) and xylazine (10 mg/kg). Weight gain and chow consumption were monitored weekly in mice that were individually caged for the duration of the experiment. The energy content of fecal samples (freeze-dried immediately after collection) was defined using a bomb-calorimeter (Parr Instruments) and previously established methods (8).

[0092] Measurement of physiological parameters. Locomotor activity and body temperature were assessed for 5 days using a telemetry device (minimitter PDT- 4000; Mini Mitter, Bend, OR) beginning 7 days after implantation (20). Locomotor activity data were processed using VitalView software (Mini Mitter).

[0093] Gastric emptying and intestinal transit time was measured in GF and Bt/Ms-colonized Gpr41-I- and +/+ littermates using established methods, following an 18h overnight fast (21 , 22). FITC-labeled dextran (70,000 MW; Molecular Probes) was administered by gavage (100 μl of a 5mg/ml solution prepared in PBS). Sixty minutes later, the entire Gl tract from stomach to rectum was removed and placed in ice-cold PBS for 30 seconds to inhibit motility. The stomach, small intestine (divided into 10 equal length segments), cecum, and colon (subdivided into two equal-length segments) were each placed in a separate tube containing 1 ml of PBS (5 ml for stomach and cecum). The segments were coarsely chopped with a scissors, and luminal contents were suspended using a combination of vigorous washing and vortexing. A dilution series was completed for each sample (1 : 10 to 1 :1000 in PBS) and the fluorescent signal quantified in a multi-well fluorescence plate reader (Stratagene Mx3000; excitation at 485 nm; emission at 530 nm). A histogram of the fluorescence signal distributed along the gastrointestinal tract was then plotted and the geometric center determined (SUM [% of total fluorescence per segment x segment number])/100) (23). Gastric emptying was calculated based on the amount of FITC-dextran left in the stomach compared to the total amount of fluorescence in the intestine.

[0094] Statistical analysis. Unless otherwise noted, the significance of differences noted among different groups of mice was defined using ANOVA and Tukey's post-hoc test. [0095] Transgenic mice that produce GFP in CCK- NeuroD- and

Neuroαenin3-exDressinα enteroendocrine suboopulations. CCK-GFP and NeuroD-GFP mice were generated using a recombinant BAC clone in which GFP replaced the first coding exon of Cck and NeuroD respectively. These mice were made by the Gensat project (http://gensat.org) and were obtained from MMRRC (www.mmrrc.org) by resuscitation of cryopreserved embryos. Ngn3 knock-out mice (24), obtained from MMRC, had GFP knocked into the Ngn3 locus.

[0096] In situ hybridization. A mouse Gpr41 cDNA was used to generate labeled sense (control) and antisense hboprobes using SP6 and T7 polymerases (respectively), the Maxiscript kit (Ambion) and ³⁵S-CTP (Amersham). Paraffin- embedded sections were prepared from the ileum and colon of adult CONV-R 129/SvEv animals. Following pre-hybridization, sections were hybridized at 55°C with sense and antisense hboprobes (7 x10⁵ cpm per slide) (25). Following overnight incubation, unhybridized probe was removed with stringent washes and treatment with RNAse A. Slides were subsequently coated with K.5 nuclear emulsion, exposed at 4°C for 21 d, developed, counterstained with hematoxylin, and examined using bright and darkfield optics.

[0097] FACS analysis. Small intestine and colon were harvested from 3-4 months old CONV-R mice, cut open, rinsed with PBS, cut into 2-3cm long fragments and washed 3 times in a 10cm dish containing RPMI 1640 medium supplemented with 5% fetal calf serum (FCS). The fragments were then placed in a 50 ml conical tube containing RPMM 640 medium with 5% FCS, 0.5mM DTT and 1 mM EDTA. The conical tube was then shaken at 225 rpm (37⁰C) to dislodge the epithelial cells. The residual intestinal fragments were discarded and the dislodged cells pelleted, washed with RPMI containing 5%FCS, passed through a 40μm pore-diameter cell strainer and resuspended (5.0 x 10⁶ cells/ml) in RPMI 1640 containing 5% FCS. The cells were then sorted by FACS (MoFIo, Cytomation, Inc., Fort Collins, CO). Approximately 1 -1.5x 10⁵ cells were sorted into RLT buffer (Qiagen) and total RNA purified (Picopure kit; Qiagen). RNA was then reverse transcribed and resulting cDNA quantified by qRT PCR as described below. [0098] Biochemical analyses. A portion of the liver was assayed for triglyceride content using a standard method described in Lee, CS. et al. Genes Dev. 16:1488-1497 (2002) and incorporated herein by reference. Serum was collected from fasted (4h) animals by retro-orbital phlebotomy, aliquoted, and stored at -8O⁰C until analysis. Standard biochemical methods were used to assay sera for glucose (26), lactate (27), cholesterol (28), triglycerides (28), and nonestehfied fatty acids (24). Insulin and leptin levels were defined using ELISA (Crystal Chemical, Chicago). A luminex- bead based assay (Millipore) was employed to quantify levels of PYY.

[0099] Cecal glucans were measured using a microanalytic assay (29).

Cecal samples were collected with a 10μl inoculation loop just prior to sacrifice, freeze dried at -35⁰C for 4d, weighed, and stored under vacuum at -8O⁰C until use (stable for at least one month). Samples (10-15 mg) were then homogenized at 1⁰C in 0.25 ml of 1 % oxalic acid (prepared in H₂O) and divided into two equal-sized aliquots: one was heated to 100⁰C for 30 min (acid hydrolysis sample); the other was maintained at 1⁰C (control sample). A 10 μl aliquot of each sample was added to a 1 ml solution containing 5OmM Tris HCI pH 8.1 , 1 mM MgCI₂, 0.02% BSA, 0.5 mM ATP, 0.1 mM NADP+, 2 μg/ml Leuconostoc mesenteroides glucose-6 phosphate dehydrogenase (253 U/mg protein; Calbiochem), 10μg/mL yeast hexokinase (50 U/mg protein; Sigma) and 10μg/ml yeast phosphoglucose isomerase (500 U/mg protein; Sigma). The mixture was subsequently incubated for 30 min at 24⁰C. The resulting NADPH product was detected using a fluorimeter. Glucose standards (5-10 nmol) were carried through all steps.

[0100] SCFAs in cecal and fecal samples were assayed by GC-MS using a modification of the method of Moreau et al. (30). 100-200 mg of frozen fecal or cecal contents were transferred to a 4 ml glass vial fitted with a septum cap PTFE liner (National Scientific) containing 10 μl of a stock solution of internal standards (Isotec; each of the following components at 2OmM: [²H₂]- and [1 -¹³C]acetate, [²H₅]propionate, and [¹³C₄]butyrate). Following acidification with 10μl of 37% HCI, SCFAs were extracted (2 ml diethyl ether/extraction; 2 cycles). An aliquot of each sample was then dehvatized with N-tert-butyldimethylsilyl-N-methyltrifluoracetamide (MTBSTFA; Sigma). SCFAs were subsequently quantified using a gas chromatograph (Hewlett Packard 6890) coupled to a mass spectrometer detector (Agilent 5973) as previously described (31 ).

[0101] RNA isolation and quantitative RT-PCR analysis. Host RNA was extracted from liver, epididymal fat pad, the 'ileum' (segment 14 of a small intestine that had been divided into 16 equal size segments), and proximal half of the colon, by homogenizing each sample in 2ml of Buffer RLT, followed by isolation on QIAgen RNeasy mini columns (Qiagen). Oligo(dT)-primed cDNA synthesis was performed using Superscript Il (Invitrogen).

[0102] For isolation of microbial RNA, 100-300mg of frozen cecal contents from each gnotobiotic mouse was added to 2ml tubes containing 250μl of 212-300 μm- diameter acid-washed glass beads (Sigma), 500μl of Buffer A (200 mM NaCI, 20 mM EDTA), 210μl of 20% SDS, and 500μl of a mixture of phenol :chloroform:isoamyl alcohol (125:24:1 ; pH 4.5; Ambion). Samples were lysed using a bead beater (BioSpec; 'high' setting for 5 min at room temperature). Cellular debris were pelleted by centrifugation (10,000 x g at 4^°C for 3 min). The extraction was repeated by adding another 500μl of phenol:chloroform:isoamyl alcohol to the aqueous supernatant. RNA was precipitated, resuspended in 10Oμl nuclease-free water (Ambion), 350μl Buffer RLT (QIAgen) was added, and RNA further purified using QIAgen RNeasy mini kit. cDNA synthesis was completed using Superscript Il (Invitrogen) and random hexamer primers.

[0103] qRT-PCR analyses were performed using a Mx3000 real-time PCR system (Stratagene). The 25μl reactions contained SYBRGreen Supermix (Bio-Rad), 300 nM of gene-specific primers, uracil-DNA glycosidase (0.01 U/μl), and 10 ng of cDNA. Data were normalized to either 16S rRNA (microbial transcripts) or L32 mRNA (host transcripts) (ΔΔC_T method) prior to comparing treatment groups. Primers are listed in Table 1. All amplicons were 100-150bp in length.

Tablei. Primers used for qRT-PCR assays.

Gene Primer Sequence (5¹ -> 3¹) SEQ. ID NO.

Gpr41 Gpr41.F TTCTTGCAGCCACACTGCTC 5

Gpr41.R GCCCACCACATGGGACATAT 6 Gpr43 mGPR43.F TGGTTGGACCGTGAAGACATG 7 mGPR43.R TGGAACCTGTAATCCCAGCAC 8

Gpr40 mGPR40.F AGTCCTCGTCACACATATTG 9 mGPR40.R AATGCCTCCAATGTGGATAG 10

Gpr120 mGPR120.F GCATAGGAGAAATCTCATGG 11 mGPR120.R GAGTTGGCAAACGTGAAGGC 12

Peptide YY (PYY) mPYY.F GGCAGCGGTATGGAAAAAGA 13 mPYY.R TCCAAACCTTCTGGCCTGAA 14 lnterleukin 2 Receptor (IL-2R) mTAC.F AATCGATGCCAACGATGATCT 15 mTAC.R AACTGCTGAGGCTTGGGTCTT 16

Neurotensin (NTS) mNTS.F AGCAAAGCAAGTCCTCCGTCT 17 mNTS.R TTTTGCCAACAAGGTCGTCAT 18

Glucose-regulated intestinal peptide (GIP) mGIP.F GCAAGATCCTGAGAGCCAACA 19 mGIP.R AGCAGGTCTTCAAAGCCACCAT 20

Pancreatic polypeptide Y (PPY) mPPY.F TGAAACTCAGCTCCGCAGATAC 21 mPPY.R AGCAGGGAATCAAGCCAACTG 22

Monocarboxylate transporter (Mct1 ) MctlF TGTTAGTCGGAGCCTTCATTTC 23 MctlR CACTGGTCGTTGCACTGAATA 24

Acetyl-Coenzyme A synthetase 2 AceCS2.F AAACACGCTCAGGGAAAATCA 25 AceCS2.R ACCGTAGATGTATCCCCCAGG 26

Lipid-binding lipoprotein (Fat/Cd36) mCD36.F TTACTGGAGCCGTTATTGGTG 27 mCD36.R CTGTCTTTGGGGTCCTGAGTTA 28

Liver fatty-acid binding protein (Fabp-pm) mFABP.F CAGGTCACCAAGTAATCACCA 29 mFABP.R AGGAGTTATGCACCGTGGTT 30

Example 2. Gpr41 is expressed in enteroendocrine cells.

[0104] Analysis of the tissue distribution of Gpr41 mRNA CONV-R adult mice indicated that highest levels were present in the distal small intestine (ileum) and colon (FIG. 1 ). Enteroendocrine cells are strategically positioned to transduce information about the nutrient milieu of gut, and the metabolic activity of the microbiota, to the host: they produce different sets of peptide hormones depending upon their location along the length of the gut (12); these neuroactive and endocrine factors are secreted basolaterally into the portal and systemic circulation where they influence a wide variety of extra-intestinal physiological activities.

[0105] In situ hybridization studies indicated that Gpr41 is expressed in cells with the morphologic appearance of enteroendocrine cells (FIG. 2A-F). Cholecystokinin (CCK) is a known biomarker of this gut epithelial cell lineage. Therefore, flow-assisted cell sorting (FACS) was used to purify CCK-positive cells from the small intestines of CONV-R transgenic mice engineered to express green fluorescent protein (GFP) in this enteroendocine subpopulation (FIG. 3A-C). Quantitative RT-PCR (qRT-PCR) assays of the expression of Gpr41 and seven other known enteroendocrine biomarkers in the crude starting material and in the FACS-purified population confirmed that Gpr41 is expressed in this enteroendocrine subset (FIGs. 4 and 5). A similar approach was used in transgenic mice engineered to express GFP in NeuroD- and Neurogenin3-producing enteroendocrine subpopulations to show that Gpr41 was also localized to these cells. Finally, intraepithelial lymphocytes, which have some of the morphologic features of enteroendocrine cells when viewed by light microscopy, were purified using a T-cell antibody plus magnetic bead sorting: qRT-PCR established that they do not express Gpr41 (FIG. 6).

Example 3. Microbial suppression of Gpr41 expression.

[0106] Ligand-induced down regulation is a hallmark of GPCR activation (13). Therefore, Gpr41-/- mice were (FIG. 7, 8A, and 8B) re-derived as GF. 8-10 week old male GF knockout (Gpr41-/-) mice and their wild type (+/+) littermates (mixed C57BI6/J:129/Sv background) were co-colonized for 28 days with Bt and Ms.

[0107] Quantitative PCR assays established that levels of colonization of the distal gut (cecum) with each microbial species were not significantly affected by the presence or absence of Gpr41 (mean 8.2±4.3x10¹²/g of luminal contents for B. thetaiotaomicron; 2.4±1.5x10⁶ for M. smithii; n=7-8 mice/genotype). Therefore, any phenotypic differences observed between gnotobiotic wildtype and knockout animals could not be attributed to differences in their gut microbial ecology.

[0108] qRT-PCR assays of ileal RNAs revealed that, compared to GF +/+ controls, co-colonization of wildtype mice produced statistically significant two-fold reductions in the steady state levels of Gpr41 , Gpr43, and Gpr120 mRNAs (FIG. 9, P<0.05; ANOVA). In contrast, expression of Gpr40 in +/+ mice was not significantly altered by colonization (FIG. 9). Moreover, the magnitude of the reduction in Gpr40, Gpr43, and Gpr120 expression was not affected by the absence of Gpr41 (FIG. 9). [0109] Together, these findings indicate that Gpr41-I- mice have a specific deficiency affecting only one of these four fatty acid binding GPCRs and therefore can, in principle, be used to assess the role of Gpr41 in mediating the effects of the microbiota on host energy homeostasis.

Example 4. Gpr41 is needed for microbiota-induced increases in host adiposity.

[0110] Short chain fatty acids (SCFAs) represent an important part of how the gut microbiota impacts energy balance and gut physiology. Our proteome has a very limited repertoire of glycoside hydrolases needed to digest complex dietary plant polysaccharides: the microbiota synthesizes a large arsenal of these enzymes (2), and allows us to ferment complex dietary carbohydrates to SCFAs, principally acetate, propionate and butyrate. Host recovery of SCFAs is generally efficient and occurs by both passive diffusion and via mono-carboxylic acid transporters (e.g., MCT1 in the case of butyrate and lactate) (3). Butyrate is the preferred source of energy for colonic epithelial cells. Absorbed acetate and propionate are delivered to hepatocytes, which consume most of the propionate for gluconeogenesis. Although acetate can be used for lipogenesis in colonocytes, hepatocytes and adipocytes are the principal sites for c/e novo lipogenesis, at least in rodents.

[0111] Studies in gnotobiotic mice have emphasized the contributions of the gut microbiota and microbial fermentation of dietary polysaccharides to host energy balance. Adult germ-free (GF) mice are leaner than their age- and gender-matched conventionally-raised (CONV-R) counterparts who have acquired a microbiota beginning at birth (1 ). Transplantation of an unfractionated gut microbiota from a CONV- R donor to an adult GF recipient results in an increase in adiposity: this increase is greater if the donors are obese because they are homozygous for a null allele in the leptin gene (pb/ob), or if they have diet-induced obesity (4,5). Comparative metagenomic studies of distal gut (cecal) microbial community DNA (microbiome) prepared from mice with either form of obesity, and from lean controls, have shown that the obesity-associated microbiomes have a greater capacity to ferment carbohydrates to SCFAs (4,5). In addition, colonization of adult germ-free (GF) mice, fed a standard polysaccharide-rich chow diet, with two organisms - Bacteroides thetaiotaomicron, a prominent saccharoSytic bacterium in the norma! dista! human gut microbiota and an adept adaptive forager of polysaccharides (8), and Melhanobrevibacter smilhii, a dominant methanogenic archaeon in this community (7) that promotes polysaccharide fermentation by removing the H₂ end product - results in higher levels of SCFA in the colon, and significantly greater host adiposity than does colonization of GF animals with either organism alone (8).

[0112] To determine the requirement of Gpr41 for microbiota-mediated adiposity, 8-10 week old male GF Gpr41-/- mice, maintained on a standard polysaccharide-rich chow diet were analyzed. These germ-free mice exhibited no significant differences in their epididymal fat pad or total body weights compared to +/+ littermates (FIG. 10A; P>0.05; n=5/group). In contrast, Gpr41-/- mice co-colonized with Bt/Ms had significantly lower epididymal fat pad weights (FIG. 10A; 14.4±0.9 vs. 11.4±0.6 mg/g body weight, respectively; P<0.05), gained significantly less body weight per day than +/+ controls (FIG. 10B; 0.08±0.03 vs. 0.19±0.02 g/day, respectively; P<0.05), and weighed significantly less at the end of the 28d colonization period (24±0.4g vs. 26±0.4g; P<0.05) (n=13-14 animals/group representing two independent experiments).

[0113] These gut microbiota-dependent differences were not a unique feature of the Bt/Ms gnotobiotic model. CONV-R Gpr41-I- animals, maintained on the same polysaccharide-rich, low fat chow diet as their co-colonized gnotobiotic counterparts also exhibited statistically significant decreases in weight gain, total body weight, and fat pad weight compared to age- and gender-matched CONV-R +/+ littermates (P<0.05; FIG. 11 A and 11 B). Dual energy x-ray absorptiometry (DEXA) confirmed their reduced adiposity (13±1 % versus 19±1 % in +/+ controls; P<0.005; n=9- 13 group; FIG. 11 C). The differences in body weight and adiposity observed in CONV- R Gpr41 -deficient versus wildtype mice were not attributable to differences in their locomotor activity or body temperature (FIG. 12A and 12B; n=4/group; P>0.05).

[0114] Fasting serum levels of leptin were similar in GF Gpr41-/- and +/+ littermates, but significantly lower in Bt/Ms co-colonized and CONV-R Gpr41-/- animals (Table 2; P<0.05; n=5-7 mice/genotype/treatment group). Moreover, serum leptin levels were significantly lower in CONV-R Gpr41-I- animals than would be expected based solely on the observed decrease in their adiposity (FIG. 11 D and 11 E; P=O.02). Together, these findings implicate Gpr41 in microbiota-dependent regulation of host adiposity and leptin production.

Table 2. Biochemical analyses of fasting sera obtained from GF and Bt/Ms colonized Gpr41-/- and +/+ littermates.

Gertrt-Res P-VU!«S

<B:'?^? VS Q?)

... P -0 CS p .-β.Cδ P "0 CS δ.-StQ.fi P 'δ.C5 P-'G.CS F

&3 6+7 t 71 +4.2 ^'Ii i'±δ.5 Df. P*0,05 ^""""pTrTcg P ■'^•0 55

K-;-? Fisny ACMJS 0 fi-G ^:"'~ a;:.to t 9*0.1 DP F =^■0 Cf- Ls ptln χ^t 0 ^•&*& % G 4 J*0 ! 1 * 1 +0. 0 ^™ i+0.1 P<0.δO1 P«0.0G1 P ■=-o e 5

4 e-'tel! 4 8. 4 7+-S.7 F >aO5 P<0.0β1

Mean values ± SEM are presented; n=4-14 animals/group; P-values were obtained by ANOVA followed by Tukey's posthoc test.

Example 5. Loss of Gpr41 is associated with increased intestinal transit rate and reduced efficiency of energy harvest from the diet.

[0115] Signals communicated from the gut to the brain via enteroendochne- cell derived hormones are important regulators of satiety and energy balance. Compared with GF +/+ controls, we found that Bt/Ms-colonization of +/+ mice led to significantly increased circulating levels of peptide YY (PYY). This increase was significantly blunted in their Gpr41-I- littermates (FIG. 13A; n=4-8/group; P<0.05).

[0116] Despite decreases in levels of several anorexigenic hormones (leptin, PYY), Bt/Ms co-colonized (and CONV-R) Gpr41-/- animals consumed equivalent amounts of chow as their co-colonized (and CONV-R) +/+ counterparts (FIG. 14A and FIG. 12C; n=11 -16 animals/group; P>0.3). Although energy input was similar, bomb- calohmethc assays of feces demonstrated that the efficiency of caloric extraction from the diet was significantly reduced in co-colonized Gpr41 -deficient animals (FIG. 14B; 4.5±0.1 vs. 3.4±0.2 kcal/g; n=6-7/group; P<0.0001 ).

[0117] PYY is also an important regulator of gut motility: it produces a dose- related inhibition of transit rate along the length of the gut (17). To test whether Gpr41 - deficiency and the associated decrease in PYY is accompanied by an increased transit rate through the gut, we gavaged GF and Bt/Ms co-colonized Gpr41-I- and +/+ mice with a non-absorbable fluorogenic marker (FITC-dextran; MW 70,000). Although no statistically significant differences in gastric emptying rates were observed, intestinal transit rate was significantly faster in Bt/Ms-colonized Gpr41-I- versus +/+ littermates (FIG. 13B and 13C). The effect of Gpr41 -deficiency on intestinal transit rate was microbiota-dependent: no significant differences were noted between GF animals of either genotype (FIG. 13B and 13C; n=4-8/group; P<0.005). The differences in transit time between Bt/Ms-colonized Gpr41-/- and +/+ littermates were not attributable to differences in the length of their small intestines, which were not significantly different [1.8±0.06 vs. 1.9±0.07 cm/g body weight, respectively; n=4-8 animals/group; P>0.05].

[0118] Based on the observed increase in intestinal transit rate, it is likely that more undigested polysaccharides may reach the distal gut in Gpr41-I- versus +/+ mice. This was confirmed by microanalytic biochemical assays of glucans (glucose- containing polysaccharides) cecal contents. Bt/Ms-colonized, Gpr41 -deficient animals had significantly higher cecal glucan levels than their colonized +/+ littermates (19% increase; 2.2±0.1 vs. 1.8±0.1 μmoles/g dry weight of cecal contents; P<0.05; n=5- 6/group; P<0.05), and higher levels of monomehc glucose (28% increase; 2.7±0.2 versus 2.1 ±0.2 μmol/g dry weight of cecal contents; P<0.05). In addition, GC-MS-based analyses of cecal SCFA levels revealed that the concentrations of propionate and acetate were significantly increased in Bt/Ms-colonized Gpr41-I- mice (n=5-7 animals/group; P<0.05) (FIG. 14C).

[0119] Follow-up whole genome transcriptional profiling of Bt using (i) microbial RNA isolated from the cecal contents of Bt/Ms-colonized Gpr41 -deficient and +/+ littermates, and (ii) custom Bt GeneChips containing probe sets specific for >98% of the organism's protein-coding genes, failed to reveal statistically significant differences in the expression of bacterial genes involved in fermentation of polysaccharides to SCFA between the two groups of animals (n=5/group; P<0.05; FDR<1 %). Follow-up qRT-PCR assays of these RNAs confirmed that several key genes in the pathway involved in SCFA production, including pyruvate formate lyase (BT4738; EC 2.3.1.54), acetate kinase (BT3963; EC 2.7.2.1 ) exhibited no significant differences in their expression between Bt/Ms colonized Grp41-I- and +/+ mice).

[0120] GC-MS analysis of feces indicated that Bt/Ms-colonized Gpr41-I- animals had a statistically significant (37±9%) increase in total SCFAs compared to their +/+ littermates (FIG. 14D; n=5-7/group; P<0.05). In contrast, fecal levels of free C6-C18 fatty acids (FFA) and triglycerides were not significantly different between the two groups of mice [0.6±0.1 versus 0.7±0.1 mg/g weight of feces (FFA), and 1.9±0.2 versus 1.9±0.1 mg/g weight of feces (triglycerides); n=7-8 animals assayed/group; P>0.05). qRT-PCR assays of distal small intestinal (ileal) RNA indicated that there were no significant differences in expression of key host genes involved in the active uptake and/or trans-epithelial transport of lipids [e.g., Mct1 (mono-carboxylate transporter), CD36 (lipid-binding glycoprotein), or ApoB (chylomicron-mediated transport); Table 3 n=5-7/group; P>0.05]. These findings were not surprising given that the majority of long chain fatty acids are absorbed in the proximal intestine.

[0121] The observed increase in fecal SCFAs reflects, at minimum, reduced host passive absorption. SCFAs stimulate, and are substrates for, de novo lipogenesis in the liver. Bt/Ms-colonization of GF +/+ animals resulted in statistically significant increases in liver triglyceride levels (FIG. 15A; n=7-8/group; P<0.05). This effect of colonization was not seen in Gpr41-/- animals, nor were any differences observed between GF Gpr47-/- and +/+ mice (FIG. 15A; n=7-8/group; P>0.05). qRT-PCR assays confirmed reduced expression of fatty acid synthase {Fas) in the livers of Bt/Ms- colonized Gpr41-I- mice compared to their +/+ littermates (FIG. 15B; 77±12% lower; n=5-7/group; P<0.01 ). In addition, fasting (4h) serum triglyceride levels were significantly decreased in Bt/Ms-colonized Gpr41 -deficient animals (Table 2; n=7- 8/group; P<0.05). These differences were not attributable to alterations in hepatic expression of genes involved in long chain fatty acid transport, trafficking, or fatty-acid re-esterification (Table 3; n=5-7/group; P>0.05). Together, these results indicate that Gpr41 -deficient mice have reduced hepatic lipogenesis, consistent with reduced intestinal absorption and delivery of SCFAs.

Table 3

Relative Expression (vs. Bt/Ms co-colonized +/+ mice)

Gene Bt/Ms (+/+) Bt/Ms (-/-) P-value

ILEUM

MCT-1 1 ±0.1 1.1+0.1 0.54

CD36 1 ±0.2 0.7±0.2 0.48

FABP 1 ±0.1 1±0.1 0.96

ApoB 1 ±0.2 1±0.2 0.70

LIVER

CD36 1 ±0.2 1.9±0.6 0.20

FABP 1 ±0.1 1.9±0.7 0.25

ApoB 1 ±0.1 1.3±0.2 0.26

DGAT 1 ±0.1 1.1±0.3 0.30

Mean values ± SEM are presented; n=6 animals/group; P-values were obtained by Student's t-test.

REFERENCES

1. Backhed, F, Ding, H, Wang, T, Hooper, LV, Koh, GY, Nagy, A, Semenkovich, CF, & Gordon, Jl (2004) The gut microbiota as an environmental factor that regulates fat storage. Proc Natl Acad Sci U S A 101 , 15718-15723.

2. Gill, SR, Pop, M, Deboy, RT, Eckburg, PB, Turnbaugh, PJ, Samuel, BS, Gordon, Jl, Relman, DA, Fraser-Liggett, CM, & Nelson, KE (2006) Metagenomic analysis of the human distal gut microbiome. Science 312, 1355-1359.

3. Ritzhaupt, A, Wood, IS, Ellis, A, Hosie, KB, & Shirazi-Beechey, SP (1998) Identification and characterization of a monocarboxylate transporter (MCT1 ) in pig and human colon: its potential to transport L-lactate as well as butyrate. J Physiol 513, 719-732. 4. Turnbaugh, PJ, Ley, RE, Mahowald, MA, Magrini, V, Mardis, ER, & Gordon, Jl (2006) An obesity-associated gut microbiome with increased capacity for energy harvest. Nature 444, 1027-1031.

5. Turnbaugh, P & Gordon, Jl (2008) Diet-induced obesity is linked to marked but reversible alterations in the mouse distal gut microbiome. Cell Host Microbre 17, 213-223.

6. Sonnenburg, JL, Xu, J, Leip, DD, Chen, CH, Westover, BP, Weatherford, J, Buhler, JD, & Gordon, Jl (2005) Glycan foraging in vivo by an intestine-adapted bacterial symbiont. Science 307, 1955-1959.

7. Eckburg, PB, Bik, EM, Bernstein, CN, Purdom, E, Dethlefsen, L, Sargent, M, Gill, SR, Nelson, KE, & Relman, DA (2005) Diversity of the human intestinal microbial flora. Science 308, 1635-1638.

8. Samuel, BS & Gordon, Jl (2006) A humanized gnotobiotic mouse model of host- archaeal-bactehal mutualism. Proc Natl Acad Sci U S A 103, 10011 -10016.

9. Brown, AJ, Goldsworthy, SM, Barnes, AA, Eilert, MM, Tcheang, L, Daniels, D, Muir, Al, Wigglesworth, MJ, Kinghorn, I, Fraser, NJ, et al. (2003) The Orphan G protein- coupled receptors Gpr41 and Gpr43 are activated by propionate and other short chain carboxylic acids. J Biol Chem 278, 11312-11319.

10. Le Poul, E, Loison, C, Struyf, S, Springael, JY, Lannoy, V, Decobecq, ME, Brezillon, S, Dupriez, V, Vassart, G, Van Damme, J, et al (2003) Functional characterization of human receptors for short chain fatty acids and their role in polymorphonuclear cell activation. J Biol Chem 278, 25481 -25489.

11.Xiong, Y, Miyamoto, N, Shibata, K, Valasek, MA, Motoike, T, Kedzierski, RM, & Yanagisawa, M (2004) Short-chain fatty acids stimulate leptin production in adipocytes through the G protein-coupled receptor Gpr41. Proc Natl Acad Sci U S A 101 , 1045-1050.

12. Roth, KA, Hertz, JW, and Gordon, Jl (1990) Mapping enteroendochne cell populations in transgenic mice reveals an unexpected degree of complexity in cellular differentiation within the gastrointestinal tract. J Cell Biol 110, 1791 -1801. 13. Bunemann, M & Hosey, MM (1999) G-protein coupled receptor kinases as modulators of G-protein signaling. J Physiol 517, 5-23.

14. Briscoe CP, Tadayyon M, Andrews JL, Benson WG, Chambers JK, Eilert MM, Ellis C, Elshourbagy NA, Goetz AS, Minnick DT, et al. (2003) The orphan G protein- coupled receptor GPR40 is activated by medium and long chain fatty acids. J Biol Chem 278, 11303-11311.

15. Hirasawa A, Tsumaya K, Awaji T, Katsuma S, Adachi T, Yamada M, Sugimoto Y, Miyazaki S, & Tsujimoto G (2005) Free fatty acids regulate gut incretin glucagon-like peptide-1 secretion through GPR120. Nat Med 11 , 90-94.

16. ltoh Y, Kawamata Y, Harada M, Kobayashi M, Fujii R, Fukusumi S, Ogi K, Hosoya M, Tanaka Y, Uejima H., et al. (2003) Free fatty acids regulate insulin secretion from pancreatic beta cells through GPR40. Nature 422, 173-176.

17. Lin HC, Neevel C, & Chen JH (2004) Slowing intestinal transit by PYY depends on serotonergic and opioid pathways. Am J Physiol 286, G558-563.

18.Yanagisawa H, Yanagisawa M, Kapur RP, Richardson JA, Williams SC, Clouthier

DE, D de Wit, Emoto N & Hammer RE (1998) Dual genetic pathways of endothelin- mediated intercellular signaling revealed by targeted disruption of endothelin converting enzyme-1 gene. Development 125 825-836. 19. Hooper LV, Mills JC, Roth KA, Stappenbeck TS, Wong MH, & Gordon Jl (2002) in

Molecular Cellular Microbiology, eds. Sansonetti, P & Zychlinsky, A. (Academic, San

Diego, CA), 559-589. 2O. Backhed F, Manchester JK, Semenkovich CF, & Gordon Jl (2007) Mechanisms underlying the resistance to diet-induced obesity in germ-free mice. Proc Natl Acad

Sci U S A 104, 979-984. 21. Moore BA, Otterbein LE, Turler A, Choi AM, & Bauer AJ (2003) Inhaled carbon monoxide suppresses the development of postoperative ileus in the murine small intestine. Gastroenterol 124, 377-391. 22.Wehner S, Behrendt FF, Lyutenski BN, Lysson M, Bauer AJ, Hirner A, & Kalff JC

(2007) Inhibition of macrophage function prevents intestinal inflammation and postoperative ileus in rodents. Gut 56, 176-185. 23. Miller, MS, Galligan, JJ, & Burks, TF (1981 ) Accurate measurement of intestinal transit in the rat. J Pharmacol Methods 6, 211 -217.

24. Lee CS, Perreault N, Brestelli JE, Kaestner KH (2002) Neurogenin 3 is essential for the proper specification of gastric enteroendocrine cells and the maintenance of gastric epithelial cell identity. Genes Dev 16:1488-1497.

25.Sakurai T, Amemiya A, lshii M,Matsuzaki I, Chemelli RM,Tanaka H, Williams SC, Richardson JA, Kozlowski GP, Wilson et al (1998) Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell 92, 573-585.

26. Manchester, J., Kong, X., Nerbonne, J., Lowry, O. H., & Lawrence, J. C, Jr. (1994) Glucose transport and phosphorylation in single cardiac myocytes: rate-limiting steps in glucose metabolism. Am J Physiol 266, 326-333.

27. Salmons, S., Jarvis, J. C, Mayne, C. N., Chi, M. M., Manchester, J. K., McDougal, D. B., Jr., & Lowry, O. H. (1996) Changes in ATP, phosphocreatine, and 16 metabolites in muscle stimulated for up to 96 hours. Am. J. Physiol. 271 , C1167- 1171.

28. Marshall, BA, Tordjman, K, Host, HH, Ensor, NJ, Kwon, G, Marshall, CA, Coleman, T, McDaniel, ML, & Semenkovich, CF (1999) Relative hypoglycemia and hyperinsulinemia in mice with heterozygous lipoprotein lipase (LPL) deficiency. Islet LPL regulates insulin secretion. J Biol Chem 274, 27426-27432.

29. Passonneau, JV & Lowry, OH (1993) Enzymatic Analysis: A Practical Guide (Humana Press, Totawa, NJ).

30. Moreau, NM, Goupry, SM, Antignac, JP, Monteau, FJ, Le Bizec, BJ, Champ, MM, Martin, LJ, & Dumon, HJ (2003) Simultaneous measurement of plasma concentrations and 13C-enrichment of short-chain fatty acids, lactic acid and ketone bodies by gas chromatography coupled to mass spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci 784, 395-403.

31.Samuel, B. S. & Gordon, J. I. (2006) A humanized gnotobiotic mouse model of host- archaeal-bactehal mutualism. Proc Natl Acad Sci U S A 103, 10011 -10016.

Claims

CLAIMSWhat is claimed is:

1. A method for promoting weight loss in a subject, the method comprising administering a Gpr41 inhibitor to the subject in a manner such that the inhibitor is substantially non-absorbed in the gastrointestinal tract of the subject and substantially reduces intestinal microbiota dependent signaling through intestinal Gpr41.

2. The method of claim 1 , wherein Gpr41 is expressed in intestinal enteroendochne cells of the subject.

3. The method of claim 1 , wherein administering the Gpr41 inhibitor results in altered enteroendocrine cell hormone secretion in the subject.

4. The method of claim 1 , wherein reduced Gpr41 signaling results in a decrease of triglyceride storage in adipocytes of the subject.

5. A method for decreasing energy harvesting in a subject, the method comprising administering a Gpr41 inhibitor to the subject in a manner such that the inhibitor is substantially non-absorbed in the gastrointestinal tract of the subject and substantially reduces intestinal microbiota dependent signaling through intestinal Gpr41.

6. The method of claim 5, wherein Gpr41 is expressed in intestinal enteroendocrine cells of the subject.

7. The method of claim 5, wherein administering the inhibitor results in altered PYY secretion in the subject.

8. The method of claim 5, wherein administering the inhibitor promotes weight loss in the subject.

9. The method of claim 5, wherein reduced Gpr41 signaling results in a decrease of triglyceride storage in adipocytes of the subject.

10. A method for reducing hepatic lipogenesis in a subject, the method comprising administering a Gpr41 inhibitor to the subject in a manner such that the inhibitor is substantially non-absorbed by the gastrointestinal tract of the subject and substantially reduces intestinal microbiota dependent signaling through intestinal Gpr41.

11. The method of claim 10, wherein Gpr41 is expressed in intestinal enteroendochne cells of the subject.

12. The method of claim 10, wherein administering the inhibitor results in altered PYY secretion in the subject.

13. The method of claim 10, wherein administering the inhibitor promotes weight loss in the subject.

14. The method of claim 10, wherein reduced Gpr41 signaling results in a decrease of triglyceride storage in adipocytes of the subject.

15. A method for promoting weight loss in a subject, the method comprising administering a Gpr41 inhibitor in combination with an agent that reduces the production of a microbiota-dehved ligand for Gpr41.

16. The method of claim 15, wherein the microbiota-dehved ligand is a short chain fatty acid.