Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/66—Microorganisms or materials therefrom
  • A61K35/74—Bacteria
  • A61K35/741—Probiotics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
  • A61K35/37—Digestive system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/66—Microorganisms or materials therefrom
  • A61K35/74—Bacteria
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/66—Microorganisms or materials therefrom
  • A61K35/74—Bacteria
  • A61K35/741—Probiotics
  • A61K35/742—Spore-forming bacteria, e.g. Bacillus coagulans, Bacillus subtilis, clostridium or Lactobacillus sporogenes
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/66—Microorganisms or materials therefrom
  • A61K35/74—Bacteria
  • A61K35/741—Probiotics
  • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/66—Microorganisms or materials therefrom
  • A61K35/74—Bacteria
  • A61K35/741—Probiotics
  • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
  • A61K35/745—Bifidobacteria
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/66—Microorganisms or materials therefrom
  • A61K35/74—Bacteria
  • A61K35/741—Probiotics
  • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
  • A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
  • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/0012—Galenical forms characterised by the site of application
  • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
  • A61K9/4816—Wall or shell material
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
  • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
  • A61P1/12—Antidiarrhoeals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/04—Antibacterial agents
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
  • C12N1/20—Bacteria; Culture media therefor
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
  • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
  • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

• This application includes a Sequence Listing submitted electronically as a text file named 25967PCT_CRF_sequencelisting.txt, created on February 4, 2013, with a size of 91 1 ,074 bytes. The sequence listing is incorporated by reference.
• Mammals are colonized by microbes in the gastrointestinal (Gl) tract, on the skin, and in other epithelial and tissue niches such as the oral cavity, eye surface and vagina.
• the gastrointestinal tract harbors an abundant and diverse microbial community. It is a complex system, providing an environment or niche for a community of many different species or organisms, including diverse strains of bacteria. Hundreds of different species may form a commensal community in the Gl tract in a healthy person, and this complement of organisms evolves from the time of birth to ultimately form a functionally mature microbial population by about 3 years of age.
• resources may be food, location and the availability of space to grow or a physical structure to which the microbe may attach.
• host diet is involved in shaping the Gl tract flora.
• a healthy microbiota provides the host with multiple benefits, including colonization resistance to a broad spectrum of pathogens, essential nutrient biosynthesis and absorption, and immune stimulation that maintains a healthy gut epithelium and an appropriately controlled systemic immunity.
• microbiota functions can be lost or deranged, resulting in increased susceptibility to pathogens, altered metabolic profiles, or induction of proinflammatory signals that can result in local or systemic inflammation or autoimmunity.
• the intestinal microbiota plays a significant role in the pathogenesis of many diseases and disorders, including a variety of pathogenic infections of the gut. For instance, subjects become more susceptible to pathogenic infections when the normal intestinal microbiota has been disturbed due to use of broad-spectrum antibiotics. Many of these diseases and disorders are chronic conditions that significantly decrease a subject's quality of life and can be ultimately fatal.
• a mammalian subject includes the step of orally administering to the mammalian subject an effective amount of a therapeutic composition comprising a purified population of spore-forming bacteria produced by the steps of a) providing a fecal material and b) subjecting the material to a treatment step resulting in purification of spore-forming bacteria, wherein the purified population is present in an amount effective to engraft and/or augment in the gastrointestinal tract in order to treat or prevent a dysbiosis in the mammalian subject.
• a method for populating the gastrointestinal tract of a mammalian subject comprising the step of orally administering to the subject an effective amount of a therapeutic composition comprising a purified population of spore-forming bacteria in an amount effective to engraft and/or augment in the gastrointestinal tract in order to treat or prevent a dysbiosis in a mammalian subject.
• a therapeutic composition comprising a purified population of spore-forming bacteria or bacteria having a substantial activity of spore-forming bacteria in an amount effective to populate the gastrointestinal tract of a mammalian subject to whom the therapeutic composition is administered.
• the population is effective to i) treat a gastrointestinal dysbiosis, and/or ii) engraft at least one type of bacteria present in the therapeutic composition but not present in a mammalian subject prior to treatment; and/or iii) augment at least one type of bacteria not present in the therapeutic composition in a mammalian subject to whom the therapeutic composition is administered.
• compositions comprising a purified population of spore-forming bacteria in an amount effective to populate the gastrointestinal tract of a mammalian subject to whom the therapeutic composition is administered, wherein the purified population is obtained by the steps of a) providing a fecal material comprising spore-forming bacteria and b) subjecting the spore- forming bacteria to a treatment step resulting in purification of the spore-forming bacteria.
• the invention also includes therapeutic compositions comprising a purified bacterial spore population comprising at least about 1 x10 3 , 1 x10 4 , 1 x10 5 , or 1 x10 6 spores, wherein the composition does not exceed about 1 gram in weight, formulated for oral administration to populate the gastrointestinal trace in a mammalian subject in need thereof, in order to i) engraft in the mammalian recipient and/or ii) augment a bacterial population in the mammalian recipient and thereby treat or prevent a dysbiosis.
• a purified bacterial spore population comprising at least about 1 x10 3 , 1 x10 4 , 1 x10 5 , or 1 x10 6 spores, wherein the composition does not exceed about 1 gram in weight, formulated for oral administration to populate the gastrointestinal trace in a mammalian subject in need thereof, in order to i) engraft in the mammalian recipient and/or ii
• kits comprising in one or more containers a fecal material collection apparatus and a solvent solution, and instructions for use thereof for generating purified populations of spore-forming bacteria.
• the invention includes methods of populating the gastrointestinal tract of a human subject, comprising the step of administering to the human subject a therapeutic composition comprising a purified population of spore-forming bacteria, under conditions such that a microbial population present in the gastrointestinal tract and/or a microbial population outside the gastrointestinal tract is modulated.
• the invention also includes methods of populating a bacterial population in the gastrointestinal tract of a human subject, comprising the step of administering to the human subject a therapeutic composition comprising a purified population of spore-forming bacteria, under conditions such that at least i) a subset of the spore- forming bacteria sustainably engraft within the gastrointestinal tract, or ii) at least one type of bacteria not present in the therapeutic composition is augmented within the gastrointestinal tract.
• the invention includes methods of populating the gastrointestinal tract of a mammalian subject, comprising the step of orally administering to the subject an effective amount of a bacterial composition comprising at least a first type of isolated bacteria and a second type of isolated bacteria, wherein the first type and the second type are not identical, under conditions such that the first type of isolated bacteria and the second type of isolated bacteria functionally populate the gastrointestinal tract of the subject.
• the invention includes methods of populating the gastrointestinal tract of a mammalian subject, comprising the step of orally
• a therapeutic composition comprising a purified population of spore-forming bacteria produced by the steps of a) providing a fecal material and b) subjecting the material to a treatment step resulting in purification of spore-forming bacteria, wherein the purified population is present in an amount effective to treat or prevent a dysbiosis in a mammalian recipient subject to whom the therapeutic composition is administered.
• the invention also includes methods of populating the gastrointestinal tract of a mammalian subject, comprising the step of orally administering to the subject an effective amount of a therapeutic composition comprising a purified population of spore-forming bacteria, in an amount effective to treat or prevent a dysbiosis in a mammalian recipient subject to whom the therapeutic composition is administered.
• FIG. 1A provides a schematic of 16S rRNA gene and denotes the coordinates of hypervariable regions 1 -9 (V1 -V9), according to an embodiment of the invention. Coordinates of V1 -V9 are 69-99, 137-242, 433-497, 576-682, 822-879, 986-1043, 1 1 17-1 173, 1243-1294, and 1435-1465 respectively, based on numbering using E. coli system of nomenclature defined by Brosius et ai, Complete nucleotide sequence of a 16S ribosomal RNA gene (16S rRNA) from Escherichia coli, PNAS 75(10):4801 -4805 (1978). [022] Figure 1 B highlights in bold the nucleotide sequences for each hypervariable region in the exemplary reference E. coli 16S sequence described by Brosius et al.
• Figure 2 shows a photograph of a CsCI gradient demonstrating the spore separation from other residual habitat material, according to an embodiment of the invention.
• Figure 3 shows three phase contrast images demonstrating the
• Figure 4 shows a set of survival curves demonstrating efficacy of the spore population in a hamster prophylaxis model of C. difficile.
• Cercles are ethanol-treated spores + Vancomycin (orange); Squares are ethanol-treated, gradient purified spores + Vancomycin (light blue); X's are vancomycin control (green); and Diamonds are the vehicle control (dark blue)).
• Figure 5 provides a set of survival curves demonstrating efficacy of the spore population in a hamster relapse prevention model of C. difficile.
• Opaque diamonds are ethanol-treated spores + Vancomycin (blue diamond); squares are ethanol-treated, gradient purified spores + Vancomycin (red squares); X's are vancomycin control; and Clear Diamonds are vehicle control (green)).
• Figure 6 demonstrates the cell viability under a variety of ethanol and heat treatments for varying lengths of time.
• Figure 7 shows the strong correlation and linear correspondence between the measurement of DPA concentration by a coupled fluorescence assay and the viable spore colony forming units.
• Figure 8 demonstrates the effect on various germination treatments on the ability to cultivate vegetative bacteria from a spore population.
• Figure 9 demonstrates the increase in bacterial diversity from using a germinant treatment to grow vegetative bacteria from spore populations.
• Figure 10 demonstrates the role of heat activation at various temperatures on spores from three different donor fecal samples.
• Figure 1 1 demonstrates that a lysozyme treatment with heat activation improves germination at most temperatures.
• Figure 12 demonstrates the microbial diversity measured in the ethanol treated spore treatment sample and patient pre- and post-treatment samples.
• Total microbial diversity is defined using the Chaol Alpha-Diversity Index and is measured at the same genomic sampling depths to confirm adequate sequence coverage to assay the microbiome in the target samples.
• the patient pretreatment harbored a microbiome that was significantly reduced in total diversity as compared to the ethanol treated spore treatment (red) and patient post treatment at days 5 (blue), 14 (orange), and 25 (green).
• Figure 13 demonstrates how the patient microbial ecology is shifted by treatment with an ethanol treated spore treatment from a dysbiotic state to a state of health.
• Principle coordinates analysis based on the total diversity and structure of the microbiome (Bray Curtis Beta Diversity) of the patient pre- and post-treatment delineates that the combination of engraftment of the OTUs from the spore treatment and the augmentation of the patient microbial ecology leads to a microbial ecology that is distinct from both the pretreatment microbiome and the ecology of the ethanol treated spore treatment.
• Figure 14 demonstrates the augmentation of bacteroides species in patients treated with the spore population.
• Figure 15 demonstrates the increase in number of species engrafting and species augmenting in patient's microbiomes after treatment with an ethanol-treated spore population. Relative abundance of species that engrafted or augmented as described were determined based on the number of 16S sequence reads. Each plot is from a different patient treated with the ethanol-treated spore population for recurrent C. difficile.
• Microbiota refers to the community of microorganisms that occur
• an animal subject typically a mammal such as a human, including eukaryotes, archaea, bacteria, and viruses (including bacterial viruses i.e., phage).
• Microbiome refers to the genetic content of the communities of microbes that live in and on the human body, both sustainably and transiently, including eukaryotes, archaea, bacteria, and viruses (including bacterial viruses (i.e., phage)), wherein "genetic content” includes genomic DNA, RNA such as ribosomal RNA, the epigenome, plasmids, and all other types of genetic information.
• Microbial Carriage or simply “Carriage” refers to the population of microbes inhabiting a niche within or on humans. Carriage is often defined in terms of relative abundance. For example, OTU1 comprises 60% of the total microbial carriage, meaning that OTU1 has a relative abundance of 60% compared to the other OTUs in the sample from which the measurement was made. Carriage is most often based on genomic sequencing data where the relative abundance or carriage of a single OTU or group of OTUs is defined by the number of sequencing reads that are assigned to that OTU/s relative to the total number of sequencing reads for the sample.
• microbes that are (i) absent or undetectable (as determined by the use of standard genomic and microbiological techniques) from the administered therapeutic microbial composition, (ii) absent, undetectable, or present at low frequencies in the host niche (for example:
• the microbes that comprise an augmented ecology can be derived from exogenous sources such as food and the environment, or grow out from micro- niches within the host where they reside at low frequency.
• the administration of the therapeutic microbial composition induces an environmental shift in the target niche that promotes favorable conditions for the growth of these commensal microbes.
• the host can be constantly exposed to these microbes; however, sustained growth and the positive health effects associated with the stable population of increased levels of the microbes comprising the augmented ecology are not observed.
• Microbial Engraftment or simply “engraftment” refers to the establishment of OTUs comprising a therapeutic microbial composition in a target niche that are absent in the treated host prior to treatment.
• the microbes that comprise the engrafted ecology are found in the therapeutic microbial composition and establish as constituents of the host microbial ecology upon treatment.
• Engrafted OTUs can establish for a transient period of time, or demonstrate long-term stability in the microbial ecology that populates the host post treatment with a therapeutic microbial composition.
• the engrafted ecology can induce an environmental shift in the target niche that promotes favorable conditions for the growth of commensal microbes capable of catalyzing a shift from a dysbiotic ecology to one representative of a health state.
• Ecological Niche or simply “Niche” refers to the ecological space in which an organism or group of organisms occupies. Nicohe describes how an organism or population or organisms responds to the distribution of resources, physical parameters (e.g., host tissue space) and competitors (e.g., by growing when resources are abundant, and when predators, parasites and pathogens are scarce) and how it in turn alters those same factors (e.g., limiting access to resources by other organisms, acting as a food source for predators and a consumer of prey).
• physical parameters e.g., host tissue space
• competitors e.g., by growing when resources are abundant, and when predators, parasites and pathogens are scarce
• Dysbiosis refers to a state of the microbiota or microbiome of the gut or other body area, including mucosal or skin surfaces in which the normal diversity and/or function of the ecological network is disrupted. Any disruption from the preferred (e.g., ideal) state of the microbiota can be considered a dysbiosis, even if such dysbiosis does not result in a detectable decrease in health. This state of dysbiosis may be unhealthy, it may be unhealthy under only certain conditions, or it may prevent a subject from becoming healthier.
• Dysbiosis may be due to a decrease in diversity, the overgrowth of one or more pathogens or pathobionts, symbiotic organisms able to cause disease only when certain genetic and/or environmental conditions are present in a patient, or the shift to an ecological network that no longer provides a beneficial function to the host and therefore no longer promotes health.
• pathobiont refers to specific bacterial species found in healthy hosts that may trigger immune-mediated pathology and/or disease in response to certain genetic or environmental factors. Chow et al., (201 1 ) Curr Op
• a pathobiont is a pathogen that is mechanistically distinct from an acquired infectious organism.
• pathogen includes both acquired infectious organisms and pathobionts.
• pathogen in reference to a bacterium or any other organism or entity includes any such organism or entity that is capable of causing or affecting a disease, disorder or condition of a host organism containing the organism or entity.
• Physical tree refers to a graphical representation of the evolutionary relationships of one genetic sequence to another that is generated using a defined set of phylogenetic reconstruction algorithms (e.g. parsimony, maximum likelihood, or Bayesian). Nodes in the tree represent distinct ancestral sequences and the confidence of any node is provided by a bootstrap or Bayesian posterior probability, which measures branch uncertainty.
• phylogenetic reconstruction algorithms e.g. parsimony, maximum likelihood, or Bayesian
• Operational taxonomic units refer to a terminal leaf in a phylogenetic tree and is defined by a nucleic acid sequence, e.g., the entire genome, or a specific genetic sequence, and all sequences that share sequence identity to this nucleic acid sequence at the level of species.
• the specific genetic sequence may be the 16S sequence or a portion of the 16S sequence.
• the entire genomes of two entities are sequenced and compared.
• select regions such as multilocus sequence tags (MLST), specific genes, or sets of genes may be genetically compared.
• OTUs that share >97% average nucleotide identity across the entire 16S or some variable region of the 16S are considered the same OTU (see e.g. Claesson MJ, Wang Q, O'Sullivan O, Greene-Diniz R, Cole JR, Ross RP, and O'Toole PW. 2010. Comparison of two next-generation sequencing technologies for resolving highly complex microbiota composition using tandem variable 16S rRNA gene regions. Nucleic Acids Res 38: e200. Konstantinidis KT, Ramette A, and Tiedje JM. 2006. The bacterial species definition in the genomic era. Philos Trans R Soc Lond B Biol Sci 361 : 1929-1940.).
• OTUs that share >95% average nucleotide identity are considered the same OTU (see e.g. Achtman M, and Wagner M. 2008. Microbial diversity and the genetic nature of microbial species. Nat. Rev. Microbiol. 6: 431-440. Konstantinidis KT, Ramette A, and Tiedje JM. 2006. The bacterial species definition in the genomic era. Philos Trans R Soc Lond B Biol Sci 361 : 1929-1940.). OTUs are frequently defined by comparing sequences between organisms. Generally, sequences with less than 95% sequence identity are not considered to form part of the same OTU.
• OTUs may also be characterized by any combination of nucleotide markers or genes, in particular highly conserved genes (e.g., "house-keeping" genes), or a combination thereof. Such characterization employs, e.g., WGS data or a whole genome sequence.
• Table 1 below shows a List of Operational Taxonomic Units (OTU) with taxonomic assignments made to Genus, Species, and Phylogenetic Clade.
• Clade membership of bacterial OTUs is based on 16S sequence data.
• Clades are defined based on the topology of a phylogenetic tree that is constructed from full-length 16S sequences using maximum likelihood methods familiar to individuals with ordinary skill in the art of phylogenetics. Clades are constructed to ensure that all OTUs in a given clade are: (i) within a specified number of bootstrap supported nodes from one another, and (ii) within 5% genetic similarity.
• OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S-V4 sequence data, while OTUs falling within the same clade are closely related. OTUs falling within the same clade are evolutionarily closely related and may or may not be distinguishable from one another using 16S- V4 sequence data. Members of the same clade, due to their evolutionary
• OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont (see Definitions for description of "Pathobiont").
• NIAID Priority Pathogens are denoted as 'Category-A', 'Category-B', or 'Category-C, and Opportunistic Pathogens are denoted as ⁇ '.
• OTUs that are not pathogenic or for which their ability to exist as a pathogen is unknown are denoted as 'N'.
• the 'SEQ ID Number' denotes the identifier of the OTU in the Sequence Listing File and 'Public DB Accession' denotes the identifier of the OTU in a public sequence repository.
• Table 2 contains bacterial OTUs identified from the 16s analysis of the ethanol treated spore population before and after a CsCI gradient purification.
• Residual habitat products refers to material derived from the habitat for microbiota within or on a human or animal.
• microbiota live in feces in the gastrointestinal tract, on the skin itself, in saliva, mucus of the respiratory tract, or secretions of the genitourinary tract (i.e., biological matter associated with the microbial community).
• Substantially free of residual habitat products means that the bacterial composition no longer contains the biological matter associated with the microbial environment on or in the human or animal subject and is 100% free, 99% free, 98% free, 97% free, 96% free, or 95% free of any contaminating biological matter associated with the microbial community.
• Residual habitat products can include abiotic materials (including undigested food) or it can include unwanted microorganisms. Substantially free of residual habitat products may also mean that the bacterial composition contains no detectable cells from a human or animal and that only microbial cells are detectable. In one embodiment, substantially free of residual habitat products may also mean that the bacterial composition contains no detectable viral (including bacterial viruses (i.e., phage)), fungal, mycoplasmal contaminants.
• bacterial viruses i.e., phage
• it means that fewer than 1 x10 "2 %, 1 x10 "3 %, 1 x10 "4 %, 1 x10 "5 %, 1 x10 "6 %, 1 x10 "7 %, 1 x10 “8 of the viable cells in the bacterial composition are human or animal, as compared to microbial cells.
• contamination may be reduced by isolating desired constituents through multiple steps of streaking to single colonies on solid media until replicate (such as, but not limited to, two) streaks from serial single colonies have shown only a single colony morphology.
• reduction of contamination can be accomplished by multiple rounds of serial dilutions to single desired cells (e.g., a dilution of 10 "8 or 10 " 9 ), such as through multiple 10-fold serial dilutions. This can further be confirmed by showing that multiple isolated colonies have similar cell shapes and Gram staining behavior.
• Other methods for confirming adequate purity include genetic analysis (e.g. PCR, DNA sequencing), serology and antigen analysis, enzymatic and metabolic analysis, and methods using instrumentation such as flow cytometry with reagents that distinguish desired constituents from contaminants.
• Clade refers to the OTUs or members of a phylogenetic tree that are downstream of a statistically valid node in a phylogenetic tree.
• the clade comprises a set of terminal leaves in the phylogenetic tree that is a distinct monophyletic evolutionary unit and that share some extent of sequence similarity.
• 16s Sequencing, 16s, 16s-rRNA, 16s-NGS In microbiology, "16S sequencing" or “16S-rRNA” or “16S” refers to sequence derived by characterizing the nucleotides that comprise the 16S ribosomal RNA gene(s).
• the bacterial 16S rDNA is approximately 1500 nucleotides in length and is used in reconstructing the evolutionary relationships and sequence similarity of one bacterial isolate to another using phylogenetic approaches. 16S sequences are used for phylogenetic reconstruction as they are in general highly conserved, but contain specific hypervariable regions that harbor sufficient nucleotide diversity to differentiate genera and species of most bacteria.
• V1 -V9 regions of the 16S rRNA refers to the first through ninth hypervariable regions of the 16S rRNA gene that are used for genetic typing of bacterial samples. These regions in bacteria are defined by nucleotides 69-99, 137- 242, 433-497, 576-682, 822-879, 986-1043, 1 1 17-1 173, 1243-1294 and 1435-1465 respectively using numbering based on the E. coli system of nomenclature. Brosius et al., Complete nucleotide sequence of a 16S ribosomal RNA gene from
• V1 , V2, V3, V4, V5, V6, V7, V8, and V9 regions are used to characterize an OTU.
• the V1 , V2, and V3 regions are used to characterize an OTU.
• the V3, V4, and V5 regions are used to characterize an OTU.
• the V4 region is used to characterize an OTU.
• a person of ordinary skill in the art can identify the specific hypervariable regions of a candidate 16S rRNA by comparing the candidate sequence in question to a reference sequence and identifying the hypervariable regions based on similarity to the reference hypervariable regions, or alternatively, one can employ Whole
• Genome Shotgun (WGS) sequence characterization of microbes or a microbial community.
• subject refers to any animal subject including humans, laboratory animals (e.g., primates, rats, mice), livestock (e.g., cows, sheep, goats, pigs, turkeys, and chickens), and household pets (e.g., dogs, cats, and rodents).
• the subject may be suffering from a dysbiosis, including, but not limited to, an infection due to a gastrointestinal pathogen or may be at risk of developing or transmitting to others an infection due to a gastrointestinal pathogen.
• phenotype refers to a set of observable characteristics of an individual entity.
• an individual subject may have a phenotype of "health” or "disease”.
• Phenotypes describe the state of an entity and all entities within a phenotype share the same set of characteristics that describe the phenotype.
• the phenotype of an individual results in part, or in whole, from the interaction of the entities genome and/or microbiome with the environment.
• Network Ecology refers to a consortium of OTUs that co-occur in some number of subjects.
• a "network” is defined mathematically by a graph delineating how specific nodes (i.e. OTUs) and edges (connections between specific OTUs) relate to one another to define the structural ecology of a consortium of OTUs. Any given Network Ecology will possess inherent phylogenetic diversity and functional properties.
• a Network Ecology can also be defined in terms of function where for example the nodes would be comprised of elements such as, but not limited to, enzymes, clusters of orthologous groups (COGS;
• Network Class, Core Network, Core Network Ecology refers to a group of network ecologies that in general are computationally determined to comprise ecologies with similar phylogenetic and/or functional characteristics.
• a Core Network therefore contains important biological features, defined either phylogenetically or functionally, of a group (i.e., a cluster) of related network ecologies.
• One representation of a Core Network Ecology is a designed consortium of microbes, typically nonpathogenic bacteria, that represents core features of a set of phylogenetically or functionally related network ecologies seen in many different subjects.
• a Core Network while designed as described herein, exists as a Network Ecology observed in one or more subjects. Core Network ecologies are useful for reversing or reducing a dysbiosis in subjects where the underlying, related Network Ecology has been disrupted.
• the term "Keystone OTU” refers to one or more OTUs that are common to many network ecologies and are members of networks ecologies that occur in many subjects (i.e. are pervasive). Due to the ubiquitous nature of Keystone OTUs, they are central to the function of network ecologies in healthy subjects and are often missing or at reduced levels in subjects with disease. Keystone OTUs may exist in low, moderate, or high abundance in subjects.
• non-Keystone OTU refers to an OTU that is observed in a Network Ecology and is not a keystone OTU.
• the term "Phylogenetic Diversity” refers to the biodiversity present in a given Network Ecology or Core Network Ecology based on the OTUs that comprise the network. Phylogenetic diversity is a relative term, meaning that a Network Ecology or Core Network that is comparatively more phylogenetically diverse than another network contains a greater number of unique species, genera, and taxonomic families. Uniqueness of a species, genera, or taxonomic family is generally defined using a phylogenetic tree that represents the genetic diversity all species, genera, or taxonomic families relative to one another. In another embodiment phylogenetic diversity may be measured using the total branch length or average branch length of a phylogenetic tree.
• a "spore” or a population of “spores” includes bacteria (or other single- celled organisms) that are generally viable, more resistant to environmental influences such as heat and bacteriocidal agents than vegetative forms of the same bacteria, and typically capable of germination and out-growth.
• "Spore-formers” or bacteria “capable of forming spores” are those bacteria containing the genes and other necessary abilities to produce spores under suitable environmental conditions.
• a "spore population” refers to a plurality of spores present in a composition. Synonymous terms used herein include spore composition, spore preparation, ethanol treated spore fraction and spore ecology.
• a spore population may be purified from a fecal donation, e.g. via ethanol or heat treatment, or a density gradient separation or any combination of methods described herein to increase the purity, potency and/or concentration of spores in a sample.
• a spore population may be derived through culture methods starting from isolated spore former species or spore former OTUs or from a mixture of such species, either in vegetative or spore form.
• the spore preparation comprises spore forming species wherein residual non-spore forming species have been inactivated by chemical or physical treatments including ethanol, detergent, heat, sonication, and the like; or wherein the non-spore forming species have been removed from the spore preparation by various separations steps including density gradients, centrifugation, filtration and/or chromatography; or wherein inactivation and separation methods are combined to make the spore preparation.
• the spore preparation comprises spore forming species that are enriched over viable non-spore formers or vegetative forms of spore formers.
• spores are enriched by 2-fold, 5-fold, 10-fold, 50-fold, 100-fold, 1000- fold, 10,000-fold or greater than 10,000-fold compared to all vegetative forms of bacteria.
• the spores in the spore preparation undergo partial germination during processing and formulation such that the final composition comprises spores and vegetative bacteria derived from spore forming species.
• isolated encompasses a bacterium or other entity or substance that has been (1 ) separated from at least some of the components with which it was associated when initially produced (whether in nature or in an experimental setting), and/or (2) produced, prepared, purified, and/or manufactured by the hand of man.
• Isolated bacteria include those bacteria that are cultured, even if such cultures are not monocultures. Isolated bacteria may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more of the other components with which they were initially
• isolated bacteria are more than about 80%, about 85%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure.
• a substance is "pure” if it is substantially free of other components.
• the terms "purify,” “purifying” and “purified” refer to a bacterium or other material that has been separated from at least some of the components with which it was associated either when initially produced or generated (e.g., whether in nature or in an experimental setting), or during any time after its initial production.
• a bacterium or a bacterial population may be considered purified if it is isolated at or after production, such as from a material or environment containing the bacterium or bacterial population, or by passage through culture, and a purified bacterium or bacterial population may contain other materials up to about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or above about 90% and still be considered "isolated.”
• purified bacteria and bacterial populations are more than about 80%, about 85%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure.
• the one or more bacterial types present in the composition can be independently purified from one or more other bacteria produced and/or present in the material or environment containing the bacterial type.
• Bacterial compositions and the bacterial components thereof are generally purified from residual habitat products.
• Demonstrations of pathogen inhibition such as decrease in the growth of a pathogenic bacterium or reduction in the level of colonization of a pathogenic bacterium are provided herein and otherwise recognized by one of ordinary skill in the art.
• Inhibition of a pathogenic bacterium's "growth” may include inhibiting the increase in size of the pathogenic bacterium and/or inhibiting the proliferation (or multiplication) of the pathogenic bacterium.
• Inhibition of colonization of a pathogenic bacterium may be demonstrated by measuring the amount or burden of a pathogen before and after a treatment.
• An "inhibition" or the act of “inhibiting” includes the total cessation and partial reduction of one or more activities of a pathogen, such as growth, proliferation, colonization, and function.
• a “germinant” is a material or composition or physical-chemical process capable of inducing vegetative growth of a bacterium that is in a dormant spore form, or group of bacteria in the spore form, either directly or indirectly in a host organism and/or in vitro.
• a "sporulation induction agent” is a material or physical-chemical process that is capable of inducing sporulation in a bacterium, either directly or indirectly, in a host organism and/or in vitro.
• To "increase production of bacterial spores” includes an activity or a sporulation induction agent. “Production” includes conversion of vegetative bacterial cells into spores and augmentation of the rate of such conversion, as well as decreasing the germination of bacteria in spore form, decreasing the rate of spore decay in vivo, or ex vivo, or to increasing the total output of spores (e.g. via an increase in volumetric output of fecal material).
• the "colonization" of a host organism includes the non-transitory residence of a bacterium or other microscopic organism.
• colonization of a host subject's gastrointestinal tract (or any other microbiotal niche) by a pathogenic bacterium includes a reduction in the residence time of the pathogen in the gastrointestinal tract as well as a reduction in the number (or concentration) of the pathogen in the gastrointestinal tract or adhered to the luminal surface of the gastrointestinal tract. Measuring reductions of adherent pathogens may be demonstrated, e.g., by a biopsy sample, or reductions may be measured indirectly, e.g., by measuring the pathogenic burden in the stool of a mammalian host.
• a "combination" of two or more bacteria includes the physical co-existence of the two bacteria, either in the same material or product or in physically connected products, as well as the temporal co-administration or co-localization of the two bacteria.
• a "cytotoxic” activity or bacterium includes the ability to kill a bacterial cell, such as a pathogenic bacterial cell.
• a “cytostatic” activity or bacterium includes the ability to inhibit, partially or fully, growth, metabolism, and/or proliferation of a bacterial cell, such as a pathogenic bacterial cell.
• Non-comestible products To be free of "non-comestible products” means that a bacterial composition or other material provided herein does not have a substantial amount of a non-comestible product, e.g., a product or material that is inedible, harmful or otherwise undesired in a product suitable for administration, e.g., oral administration, to a human subject. Non-comestible products are often found in preparations of bacteria from the prior art.
• vitamin is understood to include any of various fat-soluble or water-soluble organic substances (non-limiting examples
• Vitamin B1 examples include vitamin A, Vitamin B1 (thiamine), Vitamin B2 (riboflavin), Vitamin B3
• Vitamin B5 pantothenic acid
• Vitamin B6 pyridoxine, pyridoxal, or pyridoxamine, or pyridoxine hydrochloride
• Vitamin B7 biotin
• Vitamin B9 folic acid
• Vitamin B12 variant cobalamins; commonly cyanocobalamin in vitamin supplements
• vitamin C vitamin D, vitamin E, vitamin K, K1 and K2 (i.e. MK- 4, MK-7), folic acid and biotin) essential in minute amounts for normal growth and activity of the body and obtained naturally from plant and animal foods or
• the term "minerals” is understood to include boron, calcium, chromium, copper, iodine, iron, magnesium, manganese, molybdenum, nickel, phosphorus, potassium, selenium, silicon, tin, vanadium, zinc, or
• antioxidant is understood to include any one or more of various substances such as beta-carotene (a vitamin A precursor), vitamin C, vitamin E, and selenium) that inhibit oxidation or reactions promoted by Reactive Oxygen Species ("ROS”) and other radical and non-radical species. Additionally, antioxidants are molecules capable of slowing or preventing the oxidation of other molecules.
• ROS Reactive Oxygen Species
• Non-limiting examples of antioxidants include astaxanthin, carotenoids, coenzyme Q10 ("CoQ10"), flavonoids, glutathione, Goji (wolfberry), hesperidin, lactowolfberry, lignan, lutein, lycopene, polyphenols, selenium, vitamin A, vitamin C, vitamin E, zeaxanthin, or combinations thereof.
• bacteria and combinations of bacteria of the human gut microbiota with the capacity to meaningfully provide functions of a healthy microbiota when administered to mammalian hosts. Without being limited to a specific mechanism, it is thought that such compositions inhibit the growth, proliferation, and/or colonization of one or a plurality of pathogenic bacteria in the dysbiotic microbiotal niche, so that a healthy, diverse and protective microbiota colonizes and populates the intestinal lumen to establish or reestablish ecological control over pathogens or potential pathogens (e.g., some bacteria are pathogenic bacteria only when present in a dysbiotic environment).
• bacterial composition engraft in the host gut are detectable 1 , 2, 3, 4, 5, or 6 days, 1 or 2 weeks, 1 , 3 or 6 months, 1 year or greater than 1 year after the administration of composition when the bacteria compositions were not present before treatment.
• the bacteria compositions delivered shift the gut environment to a state allowing other healthy commensal bacteria to augment the delivered population. In this manner, augmentation of the commensal bacteria not directly delivered increases the overall diversity of the subsequent microbiome with healthy commensal bacteria and improves host health.
• pathogens include those pathogens such as C. difficile, Salmonella spp., enteropathogenic E coli, multi-drug resistant bacteria such as Klebsiella, and E. coli, Carbapenem-resistent Enterobacteriaceae (CRE), extended spectrum beta-lactam resistant Enterococci (ESBL), and vancomycin-resistant Enterococci (VRE).
• CRE Carbapenem-resistent Enterobacteriaceae
• ESBL extended spectrum beta-lactam resistant Enterococci
• VRE vancomycin-resistant Enterococci
• a "type" or more than one "types” of bacteria may be differentiated at the genus level, the species, level, the sub-species level, the strain level or by any other taxonomic method, as described herein and otherwise known in the art.
• Bacterial compositions may comprise two types of bacteria (termed “binary combinations” or “binary pairs”) or greater than two types of bacteria.
• a bacterial composition may comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 , 22, 23, 24, 25, 26, 27, 28, 29 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or at least 40, at least 50 or greater than 50 types of bacteria, as defined by species or operational taxonomic unit (OTU), or otherwise as provided herein.
• OTU operational taxonomic unit
• the number of types of bacteria present in a bacterial composition is at or below a known value. For example, in such
• the bacterial composition comprises 50 or fewer types of bacteria, such as 49, 48, 47, 46, 45, 44, 43, 42, 41 , 40, 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , or 10 or fewer, or 9 or fewer types of bacteria, 8 or fewer types of bacteria, 7 or fewer types of bacteria, 6 or fewer types of bacteria, 5 or fewer types of bacteria, 4 or fewer types of bacteria, or 3 or fewer types of bacteria.
• types of bacteria such as 49, 48, 47, 46, 45, 44, 43, 42, 41 , 40, 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , or 10 or fewer, or 9 or fewer types of bacteria, 8 or fewer types of bacteria, 7 or fewer types of bacteria, 6 or fewer types of bacteria
• a bacterial composition comprises from 2 to no more than 40, from 2 to no more than 30, from 2 to no more than 20, from 2 to no more than 15, from 2 to no more than 10, or from 2 to no more than 5 types of bacteria.
• bacterial compositions are provided with the ability to exclude pathogenic bacteria. Exemplary bacterial compositions are demonstrated to reduce the growth rate of one pathogen, C.
• compositions is demonstrated by assessing the antagonism activity of a combination of OTUs or strains towards a given pathogen using in vitro assays.
• Bacterial compositions may be prepared comprising at least two types of isolated bacteria, chosen from the species in Table 1 .
• the bacterial composition comprises at least one and preferably more than one of the following: Enterococcus faecalis (previously known as Streptococcus faecalis), Clostridium innocuum, Clostridium ramosum,
• Escherichia coli (1 109 and 1 108-1 ), Clostridum bifermentans, and Blautia producta (previously known as Peptostreptococcus productus).
• at least one of the preceding species is not substantially present in the bacterial composition.
• the bacterial composition comprises at least one and preferably more than one of the following: Enterococcus faecalis (previously known as Streptococcus faecalis), Clostridium innocuum, Clostridium ramosum,
• the bacterial composition comprises at least one and preferably more than one of the following: Acidaminococcus intestinalis,
• Bacteroides ovatus two strains of Bifidobacterium adolescentis, two strains of Bifidobacterium longum, Blautia producta, Clostridium cocleatum, Collinsella aerofaciens, two strains of Dorea longicatena, Escherichia coli, Eubacterium desmolans, Eubacterium eligens, Eubacterium limosum, four strains of Eubacterium rectale, Eubacterium ventriosumi, Faecalibacterium prausnitzii, Lachnospira pectinoshiza, Lactobacillus casei, Lactobacillus casei/paracasei, Paracateroides distasonis, Raoultella sp., one strain of Roseburia (chosen from Roseburia faecalis or Roseburia faecis), Roseburia intestinalis, two strains of Ruminococcus torques, two strains of Ruminococcus
• the bacterial composition comprises at least one and preferably more than one of the following: Barnesiella intestinihominis;
• Lactobacillus reuteri a species characterized as one of Enterococcus hirae
• Enterococus faecium, or Enterococcus durans a species characterized as one of Anaerostipes caccae or Clostridium indolis
• Adiercreutzia equolifaciens at least one of the preceding species is not
• the bacterial composition comprises at least one and preferably more than one of the following: Clostridium absonum, Clostridium argentinense, Clostridium baratii, Clostridium bartlettii, Clostridium bifermentans, Clostridium botulinum, Clostridium butyricum, Clostridium cadaveris, Clostridium camis, Clostridium celatum, Clostridium chauvoei, Clostridium clostridioforme, Clostridium cochlearium, Clostridium difficile, Clostridium fallax, Clostridium
• felsineum Clostridium ghonii, Clostridium glycolicum, Clostridium haemolyticum, Clostridium hastiforme, Clostridium histolyticum, Clostridium indolis, Clostridium innocuum, Clostridium irregulare, Clostridium limosum, Clostridium malenominatum, Clostridium novyi, Clostridium oroticum, Clostridium paraputrificum, Clostridium perfringens, Clostridium piliforme, Clostridium putrefaciens, Clostridium putrificum, Clostridium ramosum, Clostridium sardiniense, Clostridium sartagoforme,
• Clostridium scindens Clostridium septicum, Clostridium sordellii, Clostridium sphenoides, Clostridium spiroforme, Clostridium sporogenes, Clostridium
• Clostridium symbiosum Clostridium tertium
• Clostridium tetani Clostridium welchii
• Clostridium villosum In an alternative embodiment, at least one of the preceding species is not substantially present in the bacterial composition.
• the bacterial composition comprises at least one and preferably more than one of the following: Clostridium innocuum, Clostridum bifermentans, Clostridium butyricum, Bacteroides fragilis, Bacteroides
• Lactobacillus sp In an alternative embodiment, at least one of the preceding species is not substantially present in the bacterial composition.
• the bacterial composition comprises at least one and preferably more than one of the following: Clostridium bifermentans, Clostridium innocuum, Clostridium butyricum, three strains of Escherichia coli, three strains of Bacteroides, and Blautia producta. In an alternative embodiment, at least one of the preceding species is not substantially present in the bacterial composition. [090] In one embodiment, the bacterial composition comprises at least one and preferably more than one of the following: Bacteroides sp., Escherichia coli, and non pathogenic Clostridia, including Clostridium innocuum, Clostridium bifermentans and Clostridium ramosum. In an alternative embodiment, at least one of the preceding species is not substantially present in the bacterial composition.
• the bacterial composition comprises at least one and preferably more than one of the following: Bacteroides species, Escherichia coli and non-pathogenic Clostridia, such as Clostridium butyricum, Clostridium bifermentans and Clostridium innocuum. In an alternative embodiment, at least one of the preceding species is not substantially present in the bacterial composition.
• the bacterial composition comprises at least one and preferably more than one of the following: Bacteroides caccae, Bacteroides capillosus, Bacteroides coagulans, Bacteroides distasonis, Bacteroides eggerthii, Bacteroides forsythus, Bacteroides fragilis, Bacteroides fragilis-ryhm, Bacteroides gracilis, Bacteroides levii, Bacteroides macacae, Bacteroides merdae, Bacteroides ovatus, Bacteroides pneumosintes, Bacteroides putredinis, Bacteroides pyogenes, Bacteroides splanchnicus, Bacteroides stercoris, Bacteroides tectum, Bacteroides thetaiotaomicron, Bacteroides uniformis, Bacteroides ureolyticus, and Bacteroides vulgatus. In an alternative embodiment, at least one of the preceding species
• the bacterial composition comprises at least one and preferably more than one of the following: Bacteroides, Eubacteria, Fusobacteria, Propionibacteria, Lactobacilli, anaerobic cocci, Ruminococcus, Escherichia coli, Gemmiger, Desulfomonas, and Peptostreptococcus.
• Bacteroides Eubacteria, Fusobacteria, Propionibacteria, Lactobacilli, anaerobic cocci, Ruminococcus, Escherichia coli, Gemmiger, Desulfomonas, and Peptostreptococcus.
• at least one of the preceding species is not substantially present in the bacterial composition.
• the bacterial composition comprises at least one and preferably more than one of the following: Bacteroides fragilis ss. Vulgatus,
• Eubacterium aerofaciens Bacteroides fragilis ss. Thetaiotaomicron, Blautia producta (previously known as Peptostreptococcus productus II), Bacteroides fragilis ss.
• A Eubacterium biforme, Bifidobacterium infantis, Eubacterium rectale lll-F, Coprococcus comes, Bacteroides capillosus, Ruminococcus albus, Eubacterium formicigenerans, Eubacterium hallii, Eubacterium ventriosum I, Fusobacterium russii, Ruminococcus obeum, Eubacterium rectale II, Clostridium ramosum I, Lactobacillus leichmanii, Ruminococcus cailidus, Butyrivibrio crossotus, Acidaminococcus fermentans, Eubacterium ventriosum, Bacteroides fragilis ss. fragilis, Bacteroides AR, Coprococcus catus, Eubacterium hadrum, Eubacterium cylindroides, Eubacterium ruminantium, Eubacterium CH-1,
• Coprococcus BH -CC; Eubacterium ska, Eubacterium ramulus, Eubacterium AE, -
• Fusobacterium H Fusobacterium H, Lactobacillus G, and Succinivibrio A.
• at least one of the preceding species is not substantially present in the bacterial composition.
• Bacterial compositions may be prepared comprising at least two types of isolated bacteria, chosen from Table 1 .
• the OTUs can be characterized by one or more of the variable regions of the 16S sequence (V1 -V9). These regions in bacteria are defined by nucleotides 69-99, 137-242, 433-497, 576-682, 822-879, 986-1043, 1 1 17-1 173,
• V1 , V2, V3, V4, V5, V6, V7, V8, and V9 regions are used to characterize an OTU.
• the V1 , V2, and V3 regions are used to characterize an OTU.
• V5 regions are used to characterize an OTU.
• the V4 region is used to characterize an OTU.
• Bacterial Compositions Exclusive of Certain Bacterial Species Or Strains [097]
• the bacterial composition does not comprise at least one of Enterococcus faecalis (previously known as Streptococcus faecalis),
• Clostridium innocuum Clostridium ramosum, Bacteroides ovatus, Bacteroides vulgatus, Bacteroides thetaoiotaomicron, Escherichia coli (1 109 and 1 108-1 ), Clostridum bifermentans, and Blautia producta (previously known as
• the bacterial composition does not comprise at least one of Acidaminococcus intestinalis, Bacteroides ovatus, two species of Bifidobacterium adolescentis, two species of Bifidobacterium longum, Collinsella aerofaciens, two species of Dorea longicatena, Escherichia coli, Eubacterium eligens, Eubacterium limosum, four species of Eubacterium rectale, Eubacterium ventriosumi, Faecalibacterium prausnitzii, Lactobacillus casei, Lactobacillus paracasei, Paracateroides distasonis, Raoultella sp., one species of Roseburia (chosen from Roseburia faecalis or Roseburia faecis), Roseburia intestinalis, two species of Ruminococcus torques, and Streptococcus mitis.
• Acidaminococcus intestinalis Bacteroides ovatus
• the bacterial composition does not comprise at least one of Barnesiella intestinihominis; Lactobacillus reuteri; a species
• Enterococcus hirae Enterococus faecium, or Enterococcus durans
• a species characterized as one of Staphylococcus warneri or Staphylococcus pasteuri a species characterized as one of Staphylococcus warneri or Staphylococcus pasteuri; and Adlercreutzia equolifaciens.
• the bacterial composition does not comprise at least one of Clostridium absonum, Clostridium argentinense, Clostridium baratii, Clostridium bifermentans, Clostridium botulinum, Clostridium butyricum, Clostridium cadaveris, Clostridium camis, Clostridium celatum, Clostridium chauvoei, Clostridium clostridioforme, Clostridium cochlearium, Clostridium difficile, Clostridium fallax, Clostridium felsineum, Clostridium ghonii, Clostridium glycolicum, Clostridium haemolyticum, Clostridium hastiforme, Clostridium histolyticum, Clostridium indolis, Clostridium innocuum, Clostridium irregulare, Clostridium limosum, Clostridium malenominatum, Clostridium novyi, Clo
• Clostridium symbiosum Clostridium tertium
• Clostridium tetani Clostridium welchii
• Clostridium villosum Clostridium villosum
• the bacterial composition does not comprise at least one of Clostridium innocuum, Clostridum bifermentans, Clostridium butyricum, Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides uniformis, three strains of Escherichia coli, and Lactobacillus sp.
• the bacterial composition does not comprise at least one of Clostridium bifermentans, Clostridium innocuum, Clostridium butyricum, three strains of Escherichia coli, three strains of Bacteroides, and Blautia producta (previously known as Peptostreptococcus productus).
• the bacterial composition does not comprise at least one of Bacteroides sp., Escherichia coli, and non pathogenic Clostridia, including Clostridium innocuum, Clostridium bifermentans and Clostridium ramosum.
• the bacterial composition does not comprise at least one of more than one Bacteroides species, Escherichia coli and non- pathogenic Clostridia, such as Clostridium butyricum, Clostridium bifermentans and Clostridium innocuum.
• the bacterial composition does not comprise at least one of Bacteroides caccae, Bacteroides capillosus, Bacteroides coagulans, Bacteroides distasonis, Bacteroides eggerthii, Bacteroides forsythus, Bacteroides fragilis, Bacteroides fragilis-ryhm, Bacteroides gracilis, Bacteroides levii, Bacteroides macacae, Bacteroides merdae, Bacteroides ovatus, Bacteroides pneumosintes, Bacteroides putredinis, Bacteroides pyogenes, Bacteroides splanchnicus,
• the bacterial composition does not comprise at least one of Bacteroides, Eubacteria, Fusobacteria, Propionibacteria, Lactobacilli, anaerobic cocci, Ruminococcus, Escherichia coli, Gemmiger, Desulfomonas, and Peptostreptococcus.
• the bacterial composition does not comprise at least one of Bacteroides fragilis ss. Vulgatus, Eubacterium aerofaciens, Bacteroides fragilis ss. Thetaiotaomicron, Blautia producta (previously known as
• Peptostreptococcus productus II Bacteroides fragilis ss. Distasonis, Fusobacterium prausnitzii, Coprococcus eutactus, Eubacterium aerofaciens III, Blautia producta (previously known as Peptostreptococcus productus I), Ruminococcus bromii, Bifidobacterium adolescentis, Gemmiger formicilis, Bifidobacterium longum,
• Eubacterium rectale IV Eubacterium eligens, Bacteroides eggerthii, Clostridium leptum, Bacteroides fragilis ss.
• A Eubacterium biforme, Bifidobacterium infantis, Eubacterium rectale lll-F, Coprococcus comes, Bacteroides capillosus, Ruminococcus albus, Eubacterium formicigenerans, Eubacterium hallii, Eubacterium ventriosum I, Fusobacterium russii, Ruminococcus obeum, Eubacterium rectale II, Clostridium ramosum I, Lactobacillus leichmanii, Ruminococcus cailidus, Butyrivibrio crossotus, Acidaminococcus fermentans, Eubacterium ventriosum, Bacteroides fragilis ss. fragilis, Bacteroides AR, Coprococcus catus, Eubacterium hadrum, Eubacterium cylindroides, Eubacterium ruminant
• the bacterial composition provides a protective or therapeutic effect against infection by one or more Gl pathogens of interest.
• a list of exemplary bacterial pathogens is provided in Table 1 , demarcated by the pathogen status column.
• the pathogenic bacterium or pathobiont is selected from the group categorized as pathogens or pathobionts in Table 1 .
• the pathogenic bacterium is selected from the group consisting of Yersinia, Vibrio, Treponema, Streptococcus, Staphylococcus, Shigella, Salmonella, Rickettsia, Orientia, Pseudomonas, Neisseria, Mycoplasma, Mycobacterium, Listeria, Leptospira, Legionella, Klebsiella, Helicobacter, Haemophilus, Francisella, Escherichia, Ehrlichia, Enterococcus, Coxiella, Corynebacterium, Clostridium, Chlamydia, Chlamydophila, Campylobacter, Burkholderia, Brucella, Borrelia, Bordetella, Bifidobacterium , Bacillus, multi-drug resistant bacteria, extended spectrum beta-lactam resistant Enterococci (ESBL), Carbapenem-resistent
• CRE Enterobacteriaceae
• VRE vancomycin-resistant Enterococci
• these pathogens include, but are not limited to, Aeromonas hydrophila, Campylobacter fetus, Plesiomonas shigelloides, Bacillus cereus, Campylobacter jejuni , Clostridium botulinum, Clostridium difficile, Clostridium perfringens, enteroaggregative Escherichia coli, enterohemorrhagic Escherichia coli, enteroinvasive Escherichia coli, enterotoxigenic Escherichia coli (such as, but not limited to, LT and/or ST), Escherichia coli 0157:H7, Helicobacter pylori, Klebsiellia pneumonia, Lysteria monocytogenes, Plesiomonas shigelloides, Salmonella spp., Salmonella typhi, Salmonella paratyphi, Shigella spp., Staphylococcus spp.
• Aeromonas hydrophila Camp
• Staphylococcus aureus vancomycin-resistant enterococcus spp., Vibrio spp., Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, and Yersinia enterocolitica.
• the pathogen of interest is at least one pathogen chosen from Clostridium difficile, Salmonella spp., pathogenic Escherichia coli, vancomycin-resistant Enterococcus spp., and extended spectrum beta-lactam resistant Enterococci (ESBL). Purified Spore Populations
• the bacterial compositions comprise purified spore populations.
• Purified spore populations contain combinations of commensal bacteria of the human gut microbiota with the capacity to meaningfully provide functions of a healthy microbiota when administered to a mammalian subject. Without being limited to a specific mechanism, it is thought that such compositions inhibit the growth of a pathogen such as C. difficile, Salmonella spp., enteropathogenic E. coli, and vancomycin-resistant Enterococcus spp., so that a healthy, diverse and protective microbiota can be maintained or, in the case of pathogenic bacterial infections such as C. difficile infection, repopulate the intestinal lumen to reestablish ecological control over potential pathogens.
• a pathogen such as C. difficile, Salmonella spp., enteropathogenic E. coli, and vancomycin-resistant Enterococcus spp.
• Spore forming bacteria often exist in both a spore form and a vegetative form in a given population of cells.
• the biological activity and resistance to environmental stress can vary in each form and as a result both forms might be advantageous for different purposes.
• Bacterial compositions and methods described allow one to purify compositions containing spores to produce bacterial compositions that are resistant to environmental stresses such as but not limited to aerobic conditions, lack of nutrients, low pH, and temperature variations to populate the gut. In vegatitative form, the proper bacterial compositions disclosed herein can produce beneficial health effects.
• compositions containing non-pathogenic, germination-competent bacterial spores for the prevention, control, and treatment of gastrointestinal diseases, disorders and conditions and for general nutritional health. These compositions are advantageous in being suitable for safe administration to humans and other mammalian subjects and are efficacious in numerous
• spore-based compositions are known, these are generally prepared according to various techniques such as lyophilization or spray-drying of liquid bacterial cultures, resulting in poor efficacy, instability, substantial variability and lack of adequate safety.
• populations of bacterial spores can be obtained from biological materials obtained from mammalian subjects, including humans. These populations are formulated into compositions as provided herein, and administered to mammalian subjects using the methods as provided herein.
• compositions containing a purified population of bacterial spores are provided herein.
• purify refers to the state of a population (e.g., a plurality of known or unknown amount and/or concentration) of desired bacterial spores, that have undergone one or more processes of purification, e.g., a selection or an enrichment of the desired bacterial spore, or alternatively a removal or reduction of residual habitat products as described herein.
• a purified population has no detectable undesired activity or, alternatively, the level or amount of the undesired activity is at or below an acceptable level or amount.
• a purified population has an amount and/or concentration of desired bacterial spores at or above an acceptable amount and/or concentration.
• the purified population of bacterial spores is enriched as compared to the starting material (e.g., a fecal material) from which the population is obtained. This enrichment may be by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, 99.9999%, or greater than 99.9999% as compared to the starting material.
• the purified populations of bacterial spores have reduced or undetectable levels of one or more pathogenic activities, such as toxicity, an infection of the mammalian recipient subject, an immunomodulatory activity, an autoimmune response, a metabolic response, or an inflammatory response or a neurological response.
• pathogenic activities such as toxicity, an infection of the mammalian recipient subject, an immunomodulatory activity, an autoimmune response, a metabolic response, or an inflammatory response or a neurological response.
• pathogenic activities such as toxicity, an infection of the mammalian recipient subject, an immunomodulatory activity, an autoimmune response, a metabolic response, or an inflammatory response or a neurological response.
• pathogenic activities such as toxicity, an infection of the mammalian recipient subject, an immunomodulatory activity, an autoimmune response, a metabolic response, or an inflammatory response or a neurological response.
• Such a reduction in a pathogenic activity may be by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 9
• purified populations of bacterial spores that are substantially free of residual habitat products.
• Substantially free of residual habitat products may also mean that the bacterial spore composition contains no detectable cells from a human or animal, and that only microbial cells are detectable, in particular, only desired microbial cells are detectable.
• the residual habitat product present in the purified population is reduced at least a certain level from the fecal material obtained from the mammalian donor subject, e.g., reduced by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, 99.9999%, or greater than 99.9999%.
• substantially free of residual habitat products or substantially free of a detectable level of a pathogenic material means that the bacterial composition contains no detectable viral (including bacterial viruses (i.e., phage)), fungal, or mycoplasmal or toxoplasmal contaminants, or a eukaryotic parasite such as a helminth.
• the purified spore populations are substantially free of an acellular material, e.g., DNA, viral coat material, or non-viable bacterial material.
• purified spore populations can be demonstrated by genetic analysis (e.g., PCR, DNA sequencing), serology and antigen analysis, and methods using instrumentation such as flow cytometry with reagents that distinguish desired bacterial spores from non-desired, contaminating materials.
• Exemplary biological materials include fecal materials such as feces or materials isolated from the various segments of the small and large intestines.
• Fecal materials are obtained from a mammalian donor subject, or can be obtained from more than one donor subject, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 200, 300, 400, 500, 750, 1000 or from greater than 1000 donors, where such materials are then pooled prior to purification of the desired bacterial spores.
• the desired bacterial spores are purified from a single fecal material sample obtained from a single donor, and after such purification are combined with purified spore populations from other purifications, either from the same donor at a different time, or from one or more different donors, or both.
• Preferred bacterial genera include Acetonema, Alkaliphilus, Alicyclobacillus, Amphibacillus, Ammonifex, Anaerobacter, Anaerofustis,
• Anaerostipes Anaerotruncus, Anoxybacillus, Bacillus, Blautia, Brevibacillus,
• Heliobacterium Heliophilum, Heliorestis, Lachnoanaerobaculum, Lysinibacillus, Moorella, Oceanobacillus, Orenia (S.), Oxalophagus, Oxobacter, Paenibacillus, Pelospora, Pelotomaculum, Propionispora, Roseburia, Ruminococcus, Sarcina, Sporobacterium, Sporohalobacter, Sporolactobacillus, Sporomusa, Sporosarcina, Sporotomaculum, Subdoligranulum, Symbiobacterium, Syntrophobotulus,
• Preferred bacterial species are provided at Table 1 , demarcated as spore former or non-spore former. Where specific strains of a species are provided, one of skill in the art will recognize that other strains of the species or species in the same clade can be substituted for the named strain.
• spore-forming bacteria are identified by the presence of nucleic acid sequences that modulate sporulation.
• signature sporulation genes are highly conserved across members of distantly related genera including Clostridium and Bacillus.
• Traditional approaches of forward genetics have identified many, if not all, genes that are essential for sporulation (spo).
• the developmental program of sporulation is governed in part by the successive action of four compartment-specific sigma factors (appearing in the order oF, ⁇ , ⁇ and ⁇ ), whose activities are confined to the forespore (oF and oG) or the mother cell ( ⁇ and ⁇ ).
• spore populations containing more than one type of bacterium are provided.
• a "type" or more than one "types” of bacteria may be differentiated at the genus level, the species, level, the sub-species level, the strain level or by any other taxonomic method, as described herein and otherwise known in the art.
• all or essentially all of the bacterial spores present in a purified population are obtained from a fecal material treated as described herein or otherwise known in the art.
• one or more than one bacterial spores or types of bacterial spores are generated in culture and combined to form a purified spore population.
• one or more of these culture-generated spore populations are combined with a fecal material-derived spore population to generate a hybrid spore population.
• Bacterial compositions may contain at least two types of these preferred bacteria, including strains of the same species.
• a bacterial composition may comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 or more than 20 types of bacteria, as defined by species or operational taxonomic unit (OTU) encompassing such species.
• OTU operational taxonomic unit
• compositions containing a population of bacterial spores suitable for therapeutic administration to a mammalian subject in need thereof are produced by generally following the steps of: (a) providing a fecal material obtained from a mammalian donor subject; and (b) subjecting the fecal material to at least one purification treatment or step under conditions such that a population of bacterial spores is produced from the fecal material.
• composition is formulated such that a single oral dose contains at least about 1 x10 4 colony forming units of the bacterial spores, and a single oral dose will typically contain about 1 x10 4 , 1 x10 5 , 1 x10 6 , 1 x10 7 , 1 x10 8 , 1 x10 9 , 1 x10 10 , 1 x10 1 1 , 1 x10 12 , 1 x10 13 , 1 x10 14 , 1 x10 15 , or greater than 1 x10 15 CFUs of the bacterial spores.
• the presence and/or concentration of a given type of bacteria spore may be known or unknown in a given purified spore population.
• the concentration of spores of a given strain, or the aggregate of all strains is e.g., 1 x10 4 , 1 x10 5 , 1 x10 6 , 1 x10 7 , 1 x10 8 , 1 x10 9 , 1 x10 10 , 1 x10 11 , 1x10 12 , 1 x10 13 , 1 x10 14 , 1 x10 15 , or greater than 1 x10 15 viable bacterial spores per gram of
• composition or per administered dose comprising
• the composition contains at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than 90% spores on a mass basis.
• the administered dose does not exceed 200, 300, 400, 500, 600, 700, 800, 900 milligrams or 1 , 1 .1 , 1 .2, 1 .3, 1 .4, 1 .5, 1 .6, 1 .7, 1 .8, or 1 .9 grams in mass.
• the bacterial spore compositions are generally formulated for oral or gastric administration, typically to a mammalian subject.
• the composition is formulated for oral administration as a solid, semi-solid, gel, or liquid form, such as in the form of a pill, tablet, capsule, or lozenge.
• such formulations contain or are coated by an enteric coating to protect the bacteria through the stomach and small intestine, although spores are generally resistant to the stomach and small intestines.
• the bacterial spore compositions may be formulated to be effective in a given mammalian subject in a single administration or over multiple administrations.
• a single administration is substantially effective to reduce CI. difficile and/or CI. difficile toxin content in a mammalian subject to whom the composition is administered.
• substantially effective means that CI. difficile and/or CI. difficile toxin content in the subject is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%,
• composition 80%, 90%, 95%, 98%, 99% or greater than 99% following administration of the composition.
• an In Vitro Assay utilizing competition between the bacterial compositions or subsets thereof and C. difficile. Exemplary embodiments of this Assay are provided herein and in the Examples.
• an In Vitro Assay utilizing 10% (wt/vol) Sterile-Filtered Feces.
• an in vitro assay to test for the protective effect of the bacterial compositions and to screen in vitro for combinations of microbes that inhibit the growth of a pathogen.
• the assay can operate in automated high- throughput or manual modes.
• human or animal feces may be re-suspended in an anaerobic buffer solution, such as pre-reduced PBS or other suitable buffer, the particulate removed by centrifugation, and filter sterilized.
• an anaerobic buffer solution such as pre-reduced PBS or other suitable buffer
• This 10% sterile-filtered feces material serves as the base media for the in vitro assay.
• an investigator may add it to the sterile-filtered feces material for a first incubation period and then may inoculate the incubated microbial solution with the pathogen of interest for a second incubation period.
• the resulting titer of the pathogen may be quantified by any number of methods such as those described below, and the change in the amount of pathogen is compared to standard controls including the pathogen cultivated in the absence of the bacterial composition.
• the assay is conducted using at least one control. Feces from a healthy subject may be used as a positive control. As a negative control, antibiotic- treated feces or heat-treated feces may be used. Various bacterial compositions may be tested in this material and the bacterial compositions optionally compared to the positive and/or negative controls. The ability to inhibit the growth of the pathogen may be measured by plating the incubated material on C. difficile selective media and counting colonies. After competition between the bacterial composition and C.
• each well of the in vitro assay plate is serially diluted ten-fold six times, and plated on selective media, such as but not limited to cycloserine cefoxitin mannitol agar (CCMA) or cycloserine cefoxitin fructose agar (CCFA), and incubated. Colonies of C. difficile are then counted to calculate the concentration of viable cells in each well at the end of the competition. Colonies of C. difficile are confirmed by their characteristic diffuse colony edge morphology as well as fluorescence under UV light.
• selective media such as but not limited to cycloserine cefoxitin mannitol agar (CCMA) or cycloserine cefoxitin fructose agar (CCFA)
• the in vitro assay utilizes Antibiotic-Treated Feces.
• human or animal feces may be resuspended in an anaerobic buffer solution, such as pre- reduced PBS or other suitable buffer.
• the resuspended feces is treated with an antibiotic, such as clindamycin, or a cocktail of several antibiotics in order to reduce the ability of feces from a healthy subject to inhibit the growth of C. difficile; this material is termed the antibiotic-treated matrix. While not being bound by any mechanism, it is believed that beneficial bacteria in healthy subjects protects them from infection by competing out C. difficile.
• Antibiotics in addition to clindamycin that inhibit the normal flora include ceftriaxone and piperacillin-tazobactam and may be substituted for the clindamycin.
• the antibiotic-treated matrix is centrifuged, the supernatant removed, and the pelleted material resuspended in filter-sterilized, diluted feces in order to remove any residual antibiotic. This washed antibiotic-treated matrix may be used in the in vitro assay described above in lieu of the 10% sterile-filtered feces.
• the ability to inhibit the growth of the pathogen may be measured by quantitative PCR (qPCR). Standard techniques may be followed to generate a standard curve for the pathogen of interest. Genomic DNA may be extracted from samples using commercially-available kits, such as the Mo Bio
• the qPCR may be conducted using HotMasterMix
• the Cq value for each well on the FAM channel is determined by the CFX ManagerTM software version 2.1 .
• the log 10 (cfu/ml) of each experimental sample is calculated by inputting a given sample's Cq value into linear regression model generated from the standard curve comparing the Cq values of the standard curve wells to the known log 10 (cfu/ml) of those samples.
• the skilled artisan may employ alternative qPCR modes.
• in vitrro assays establishing the protective effect of bacterial compositions.
• an in vivo mouse model to test for the protective effect of the bacterial compositions against C. difficile.
• mice are made susceptible to C.
• Bacterial compositions may be given either before (prophylactic treatment) or after (therapeutic treatment) C. difficile gavage.
• bacterial compositions may be given after (optional) vancomycin treatment (see below) to assess their ability to prevent recurrence and thus suppress the pathogen in vivo.
• the outcomes assessed each day from day -1 to day 6 (or beyond, for prevention of recurrence) are weight, clinical signs, mortality and shedding of C. difficile in the feces. Weight loss, clinical signs of disease, and C. difficile shedding are typically observed without treatment.
• Vancomycin provided by oral gavage on days -1 to 4 protects against these outcomes and serves as a positive control.
• Clinical signs are subjective, and scored each day by the same experienced observer. Animals that lose greater than or equal to 25% of their body weight are euthanized and counted as infection-related mortalities.
• Feces are gathered from mouse cages (5 mice per cage) each day, and the shedding of C. difficile spores is detected in the feces using a selective plating assay as described for the in vitro assay above, or via qPCR for the toxin gene as described herein.
• the effects of test materials including 10% suspension of human feces (as a positive control), bacterial compositions, or PBS (as a negative vehicle control), are determined by introducing the test article in a 0.2 ml_ volume into the mice via oral gavage on day -1 , one day prior to C. difficile challenge, on day 1 , 2 and 3 as treatment or post-vancomycin treatment on days 5, 6, 7 and 8.
• Vancomycin as discussed above, is given on days 1 to 4 as another positive control.
• Alternative dosing schedules and routes of administration e.g. rectal
• 10 3 to 10 10 of a given organism or composition may be delivered.
• OTUs can be defined either by full 16S sequencing of the rRNA gene, by sequencing of a specific hypervariable region of this gene (i.e. V1 , V2, V3, V4, V5, V6, V7, V8, or V9), or by sequencing of any combination of hypervariable regions from this gene (e.g. V1 -3 or V3-5).
• the bacterial 16S rDNA is approximately 1500 nucleotides in length and is used in reconstructing the evolutionary relationships and sequence similarity of one bacterial isolate to another using phylogenetic
• 16S sequences are used for phylogenetic reconstruction as they are in general highly conserved, but contain specific hypervariable regions that harbor sufficient nucleotide diversity to differentiate genera and species of most microbes.
• genomic DNA is extracted from a bacterial sample, the 16S rDNA (full region or specific hypervariable regions) amplified using polymerase chain reaction (PCR), the PCR products cleaned, and nucleotide sequences delineated to determine the genetic composition of 16S gene or subdomain of the gene.
• PCR polymerase chain reaction
• the sequencing method used may be, but is not limited to, Sanger sequencing.
• the sequencing can be, but is not limited to being, performed using the Sanger method or using a next- generation sequencing method, such as an lllumina (sequencing by synthesis) method using barcoded primers allowing for multiplex reactions.
• OTUs can be defined by a combination of nucleotide markers or genes, in particular highly conserved genes (e.g., "house-keeping" genes), or a combination thereof, full-genome sequence, or partial genome sequence generated using amplified genetic products, or whole genome sequence (WGS).
• DNA extracted from a bacterial sample will have specific genomic regions amplified using PCR and sequenced to determine the nucleotide sequence of the amplified products.
• genomic regions amplified using PCR and sequenced to determine the nucleotide sequence of the amplified products.
• WGS whole genome shotgun
• Sequence data can be generated using any sequencing technology including, but not limited to Sanger, lllumina, 454 Life Sciences, Ion Torrent, ABI, Pacific Biosciences, and/or Oxford Nanopore.
• Methods for producing bacterial compositions can include three main processing steps, combined with one or more mixing steps.
• the steps include organism banking, organism production, and preservation.
• the strains included in the bacterial composition may be (1 ) isolated directly from a specimen or taken from a banked stock, (2) optionally cultured on a nutrient agar or broth that supports growth to generate viable biomass, and (3) the biomass optionally preserved in multiple aliquots in long-term storage.
• the agar or broth can contain nutrients that provide essential elements and specific factors that enable growth.
• medium can be added to the culture at the start, may be added during the culture, or may be intermittently/continuously flowed through the culture.
• the strains in the bacterial composition may be cultivated alone, as a subset of the bacterial composition, or as an entire collection comprising the bacterial composition.
• a first strain may be cultivated together with a second strain in a mixed continuous culture, at a dilution rate lower than the maximum growth rate of either cell to prevent the culture from washing out of the cultivation.
• the inoculated culture is incubated under favorable conditions for a time sufficient to build biomass.
• bacterial compositions for human use this is often at 37°C temperature, pH, and other parameter with values similar to the normal human niche.
• the environment can be actively controlled, passively controlled (e.g., via buffers), or allowed to drift.
• anaerobic bacterial compositions e.g., gut microbiota
• anoxic/reducing environment can be employed. This can be accomplished by addition of reducing agents such as cysteine to the broth, and/or stripping it of oxygen.
• a culture of a bacterial composition can be grown at 37°C, pH 7, in the medium above, pre-reduced with 1 g/L cysteine HCI.
• the culture When the culture has generated sufficient biomass, it can be preserved for banking.
• the organisms can be placed into a chemical milieu that protects from freezing (adding 'cryoprotectants'), drying ('lyoprotectants'), and/or osmotic shock ('osmoprotectants'), dispensing into multiple (optionally identical) containers to create a uniform bank, and then treating the culture for preservation.
• Containers are generally impermeable and have closures that assure isolation from the environment. Cryopreservation treatment is accomplished by freezing a liquid at ultra-low temperatures (e.g., at or below -80°C).
• Dried preservation removes water from the culture by evaporation (in the case of spray drying or 'cool drying') or by sublimation (e.g., for freeze drying, spray freeze drying). Removal of water improves long-term bacterial composition storage stability at temperatures elevated above cryogenic. If the bacterial composition comprises spore forming species and results in the production of spores, the final composition can be purified by additional means, such as density gradient centrifugation preserved using the techniques described above. Bacterial composition banking can be done by culturing and preserving the strains individually, or by mixing the strains together to create a combined bank.
• a bacterial composition culture can be harvested by centrifugation to pellet the cells from the culture medium, the supernate decanted and replaced with fresh culture broth containing 15% glycerol. The culture can then be aliquoted into 1 mL cryotubes, sealed, and placed at -80°C for long-term viability retention. This procedure achieves acceptable viability upon recovery from frozen storage.
• Organism production can be conducted using similar culture steps to banking, including medium composition and culture conditions. It can be conducted at larger scales of operation, especially for clinical development or commercial production. At larger scales, there can be several subcultivations of the bacterial composition prior to the final cultivation. At the end of cultivation, the culture is harvested to enable further formulation into a dosage form for administration. This can involve concentration, removal of undesirable medium components, and/or introduction into a chemical milieu that preserves the bacterial composition and renders it acceptable for administration via the chosen route.
• a bacterial composition can be cultivated to a concentration of 10 10 CFU/mL, then concentrated 20-fold by tangential flow microfiltration; the spent medium can be exchanged by diafiltering with a preservative medium consisting of 2% gelatin, 100 mM trehalose, and 10 mM sodium phosphate buffer. The suspension can then be freeze-dried to a powder and titrated.
• the powder After drying, the powder can be blended to an appropriate potency, and mixed with other cultures and/or a filler such as microcrystalline cellulose for consistency and ease of handling, and the bacterial composition formulated as provided herein.
• a filler such as microcrystalline cellulose for consistency and ease of handling, and the bacterial composition formulated as provided herein.
• compositions disclosed herein are:
• administer and “administration” encompasses embodiments in which one person directs another to consume a bacterial composition in a certain manner and/or for a certain purpose, and also situations in which a user uses a bacteria composition in a certain manner and/or for a certain purpose independently of or in variance to any instructions received from a second person.
• Non-limiting examples of embodiments in which one person directs another to consume a bacterial composition in a certain manner and/or for a certain purpose include when a physician prescribes a course of conduct and/or treatment to a patient, when a parent commands a minor user (such as a child) to consume a bacterial
• composition when a trainer advises a user (such as an athlete) to follow a particular course of conduct and/or treatment, and when a manufacturer, distributer, or marketer recommends conditions of use to an end user, for example through advertisements or labeling on packaging or on other materials provided in association with the sale or marketing of a product.
• a trainer advises a user (such as an athlete) to follow a particular course of conduct and/or treatment
• a manufacturer, distributer, or marketer recommends conditions of use to an end user, for example through advertisements or labeling on packaging or on other materials provided in association with the sale or marketing of a product.
• the bacterial compositions offer a protective and/or therapeutic effect against infection by one or more Gl pathogens of interest and can be administered after an acute case of infection has been resolved in order to prevent relapse, during an acute case of infection as a complement to antibiotic therapy if the bacterial composition is not sensitive to the same antibiotics as the Gl pathogen, or to prevent infection or reduce transmission from disease carriers.
• a bacterial compositions administered to the gut are used to treat disorders that are not gut-related. Altering the gut microbiome can have effects on the skin and vagina of mammalian hosts (Levkovich et al, Probiotic bacteria induce a 'glow of health', PlosOne, Vol 8, Issue 1 , e53867.
• the present bacterial compositions can be useful in a variety of clinical situations.
• the bacterial compositions can be administered as a complementary treatment to antibiotics when a patient is suffering from an acute infection, to reduce the risk of recurrence after an acute infection has subsided, or when a patient will be in close proximity to others with or at risk of serious
• the present bacterial compositions can be administered to animals, including humans, laboratory animals (e.g., primates, rats, mice), livestock (e.g., cows, sheep, goats, pigs, turkeys, chickens), and household pets (e.g., dogs, cats, rodents).
• laboratory animals e.g., primates, rats, mice
• livestock e.g., cows, sheep, goats, pigs, turkeys, chickens
• household pets e.g., dogs, cats, rodents.
• the bacterial composition can be administered enterically, in other words, by a route of access to the gastrointestinal tract.
• the patient Prior to administration of the bacterial composition, the patient can optionally have a pretreatment protocol to prepare the gastrointestinal tract to receive the bacterial composition.
• the pretreatment protocol is advisable, such as when a patient has an acute infection with a highly resilient pathogen.
• the pretreatment protocol is entirely optional, such as when the pathogen causing the infection is not resilient, or the patient has had an acute infection that has been successfully treated but where the physician is concerned that the infection may recur.
• the pretreatment protocol can enhance the ability of the bacterial composition to affect the patient's microbiome.
• At least one antibiotic can be administered to alter the bacteria in the patient.
• a standard colon-cleansing preparation can be administered to the patient to substantially empty the contents of the colon, such as used to prepare a patient for a colonscopy.
• substantially emptying the contents of the colon this application means removing at least 75%, at least 80%, at least 90%, at least 95%, or about 100% of the contents of the ordinary volume of colon contents.
• Antibiotic treatment can precede the colon-cleansing protocol.
• the antibiotic can be stopped in sufficient time to allow the antibiotic to be substantially reduced in concentration in the gut before the bacterial composition is administered.
• the antibiotic can be discontinued 1 , 2, or 3 days before the administration of the bacterial composition.
• the antibiotic can be discontinued 3, 4, 5, 6, or 7 antibiotic half-lives before administration of the bacterial composition.
• the antibiotic can be chosen so the constituents in the bacterial composition have an MIC50 that is higher than the concentration of the antibiotic in the gut.
• MIC50 of a bacterial composition or the elements in the composition can be determined by methods well known in the art. Reller et al., Antimicrobial
• the additional time between antibiotic administration and administration of the bacterial composition is not necessary. If the pretreatment protocol is part of treatment of an acute infection, the antibiotic can be chosen so that the infection is sensitive to the antibiotic, but the constituents in the bacterial composition are not sensitive to the antibiotic.
• the bacterial compositions of the invention are suitable for administration to mammals and non-mammalian animals in need thereof.
• the mammalian subject is a human subject who has one or more symptoms of a dysbiosis.
• the bacterial compositions described herein are suitable for treatment thereof.
• the mammalian subject has not received antibiotics in advance of treatment with the bacterial compositions.
• the mammalian subject has not been administered at least two doses of vancomycin, metronidazole and/or or similar antibiotic compound within one week prior to administration of the therapeutic composition.
• the mammalian subject has not previously received an antibiotic compound in the one month prior to administration of the therapeutic composition.
• the mammalian subject has received one or more treatments with one or more different antibiotic compounds and such treatment(s) resulted in no improvement or a worsening of symptoms.
• the gastrointestinal disease, disorder or condition is diarrhea caused by C. difficile including recurrent C. difficile infection, ulcerative colitis, colitis, Crohn's disease, or irritable bowel disease.
• the therapeutic composition is administered only once prior to improvement of the disease, disorder or condition.
• the therapeutic composition is administered at intervals greater than two days, such as once every three, four, five or six days, or every week or less frequently than every week. In other words,
• the preparation can be administered intermittently according to a set schedule, e.g., once a day, once weekly, or once monthly, or when the subject relapses from the primary illness.
• the preparation may be administered on a long-term basis to subjects who are at risk for infection with or who may be carriers of these pathogens, including subjects who will have an invasive medical procedure (such as surgery), who will be hospitalized, who live in a long-term care or rehabilitation facility, who are exposed to pathogens by virtue of their profession (livestock and animal processing workers), or who could be carriers of pathogens (including hospital workers such as physicians, nurses, and other health care professionals).
• the bacterial composition is administered enterically.
• an oral or nasal tube including nasogastric, nasojejunal, oral gastric, or oral jejunal.
• administration includes rectal administration (including enema, suppository, or colonoscopy).
• the bacterial composition can be administered to at least one region of the gastrointestinal tract, including the mouth, esophagus, stomach, small intestine, large intestine, and rectum. In some embodiments, it is administered to all regions of the gastrointestinal tract.
• the bacterial compositions can be administered orally in the form of medicaments such as powders, capsules, tablets, gels or liquids.
• the bacterial compositions can also be administered in gel or liquid form by the oral route or through a nasogastric tube, or by the rectal route in a gel or liquid form, by enema or instillation through a colonoscope or by a suppository.
• the composition is administered colonoscopically and, optionally, if the bacterial composition is administered by other rectal routes (such as an enema or suppository) or even if the subject has an oral administration, the subject can have a colon-cleansing preparation.
• the colon-cleansing preparation can facilitate proper use of the colonoscope or other administration devices, but even when it does not serve a mechanical purpose, it can also maximize the proportion of the bacterial composition relative to the other organisms previously residing in the gastrointestinal tract of the subject. Any ordinarily acceptable colon-cleansing preparation may be used such as those typically provided when a subject undergoes a colonoscopy.
• the bacteria and bacterial compositions are provided in a dosage form.
• the dosage form is designed for administration of at least one OTU or combination thereof disclosed herein, wherein the total amount of bacterial composition administered is selected from 0.1 ng to 10g, 10ng to 1 g, 100ng to 0.1 g, 0.1 mg to 500mg, 1 mg to 100mg, or from 10-15mg.
• the bacterial composition is consumed at a rate of from 0.1 ng to 10g a day, 10ng to 1 g a day, 100ng to 0.1 g a day, 0.1 mg to 500mg a day, 1 mg to 100mg a day, or from 10-15mg a day, or more.
• the treatment period is at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, or at least 1 year.
• the treatment period is from 1 day to 1 week, from 1 week to 4 weeks, from 1 month, to 3 months, from 3 months to 6 months, from 6 months to 1 year, or for over a year.
• 10 5 and 10 12 microorganisms total can be
• an effective amount can be provided in from 1 to 500 ml or from 1 to 500 grams of the bacterial composition having from 10 7 to 10 11 bacteria per ml or per gram, or a capsule, tablet or suppository having from 1 mg to 1000 mg lyophilized powder having from 10 7 to 10 1 1 bacteria.
• Those receiving acute treatment can receive higher doses than those who are receiving chronic administration (such as hospital workers or those admitted into long-term care facilities).
• any of the preparations described herein can be administered once on a single occasion or on multiple occasions, such as once a day for several days or more than once a day on the day of administration (including twice daily, three times daily, or up to five times daily).
• the preparation can be administered intermittently according to a set schedule, e.g., once weekly, once monthly, or when the patient relapses from the primary illness.
• the preparation can be administered on a long-term basis to individuals who are at risk for infection with or who may be carriers of these pathogens, including
• Particular bacterial compositions can be selected for individual patients or for patients with particular profiles.
• 16S sequencing can be performed for a given patient to identify the bacteria present in his or her microbiota.
• the sequencing can either profile the patient's entire microbiome using 16S sequencing (to the family, genera, or species level), a portion of the patient's microbiome using 16S sequencing, or it can be used to detect the presence or absence of specific candidate bacteria that are biomarkers for health or a particular disease state, such as markers of multi-drug resistant organisms or specific genera of concern such as Escherichia.
• a particular composition can be selected for administration to a patient to supplement or complement a patient's microbiota in order to restore health or treat or prevent disease.
• patients can be screened to determine the composition of their microbiota to determine the likelihood of successful treatment.
• the bacterial compositions can be administered with other agents in a combination therapy mode, including anti-microbial agents and prebiotics.
• Administration can be sequential, over a period of hours or days, or simultaneous.
• the bacterial compositions are included in
• combination therapy with one or more anti-microbial agents which include antibacterial agents, anti-fungal agents, anti-viral agents and anti-parasitic agents.
• Anti-bacterial agents can include cephalosporin antibiotics (cephalexin, cefuroxime, cefadroxil, cefazolin, cephalothin, cefaclor, cefamandole, cefoxitin, cefprozil, and ceftobiprole); fluoroquinolone antibiotics (cipro, Levaquin, floxin, tequin, avelox, and norflox); tetracycline antibiotics (tetracycline, minocycline, oxytetracycline, and doxycycline); penicillin antibiotics (amoxicillin, ampicillin, penicillin V, dicloxacillin, carbenicillin, vancomycin, and methicillin); and carbapenem antibiotics (ertapenem, doripenem, imipenem/cilastatin, and meropenem).
• cephalosporin antibiotics cephalexin, cefuroxime, cefadroxil, cefazolin, cephalothin
• Anti-viral agents can include Abacavir, Acyclovir, Adefovir, Amprenavir, Atazanavir, Cidofovir, Darunavir, Delavirdine, Didanosine, Docosanol, Efavirenz, Elvitegravir, Emtricitabine, Enfuvirtide, Etravirine, Famciclovir, Foscarnet,
• Fomivirsen Ganciclovir, Indinavir, Idoxuridine, Lamivudine, Lopinavir Maraviroc, MK- 2048, Nelfinavir, Nevirapine, Penciclovir, Raltegravir, Rilpivirine, Ritonavir,
• antifungal compounds include, but are not limited to polyene antifungals such as natamycin, rimocidin, filipin, nystatin, amphotericin B, candicin, and hamycin; imidazole antifungals such as miconazole, ketoconazole, clotrimazole, econazole, omoconazole, bifonazole, butoconazole, fenticonazole, isoconazole, oxiconazole, sertaconazole, sulconazole, and tioconazole; triazole antifungals such as fluconazole, itraconazole, isavuconazole, ravuconazole, posaconazole, voriconazole, terconazole, and albaconazole; thiazole antifungals such as abafungin; allylamine antifungals such as terbinafine, naftifine,
• echinocandin antifungals such as anidulafungin, caspofungin, and micafungin.
• Other compounds that have antifungal properties include, but are not limited to polygodial, benzoic acid, ciclopirox, tolnaftate, undecylenic acid, flucytosine or 5-fluorocytosine, griseofulvin, and haloprogin.
• the bacterial compositions are included in
• combination therapy with one or more corticosteroids, mesalazine, mesalamine, sulfasalazine, sulfasalazine derivatives, immunosuppressive drugs, cyclosporin A, mercaptopurine, azathiopurine, prednisone, methotrexate, antihistamines,
• glucocorticoids epinephrine, theophylline, cromolyn sodium, anti-leukotrienes, anticholinergic drugs for rhinitis, anti-cholinergic decongestants, mast-cell stabilizers, monoclonal anti-lgE antibodies, vaccines, and combinations thereof.
• a prebiotic is a selectively fermented ingredient that allows specific changes, both in the composition and/or activity in the gastrointestinal microbiota that confers benefits upon host well-being and health.
• Prebiotics can include complex carbohydrates, amino acids, peptides, or other essential nutritional components for the survival of the bacterial composition.
• Prebiotics include, but are not limited to, amino acids, biotin, fructooligosaccharide, galactooligosaccharides, inulin, lactulose, mannan oligosaccharides, oligofructose-enriched inulin,
• oligofructose oligodextrose
• tagatose oligodextrose
• trans-galactooligosaccharide oligodextrose
• Composition Populates a Subject's Gastrointestinal Tract
• an animal model such as a mouse model
• the model can begin by evaluating the microbiota of the mice.
• Qualitative assessments can be accomplished using 16S profiling of the microbial community in the feces of normal mice. It can also be accomplished by full genome sequencing, whole genome shotgun sequencing (WGS), or traditional microbiological techniques. Quantitative assessments can be conducted using quantitative PCR (qPCR), described below, or by using traditional microbiological techniques and counting colony formation.
• the mice can receive an antibiotic treatment to mimic the condition of dysbiosis.
• Antibiotic treatment can decrease the taxonomic richness, diversity, and evenness of the community, including a reduction of abundance of a significant number of bacterial taxa.
• Dethlefsen et ai The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing, PLoS Biology 6(1 1 ):3280 (2008). At least one antibiotic can be used, and antibiotics are well known.
• Antibiotics can include aminoglycoside antibiotic (amikacin, arbekacin,gentamicin, kanamycin, neomycin, netilmicin, paromomycin,
• rhodostreptomycin streptomycin, tobramycin, and apramycin
• amoxicillin ampicillin
• Augmentin an amoxicillin/clavulanate potassium combination
• cephalosporin cefaclor, defadroxil, cefazolin, cefixime, fefoxitin, cefprozil, ceftazimdime, cefuroxime, cephalexin
• clavulanate potassium clindamycin, colistin, gentamycin, kanamycin, metronidazole, or vancomycin.
• mice can be provided with drinking water containing a mixture of the antibiotics kanamycin, colistin, gentamycin, metronidazole and vancomycin at 40 mg/kg, 4.2 mg/kg, 3.5 mg/kg, 21 .5 mg/kg, and 4.5 mg/kg (mg per average mouse body weight), respectively, for 7 days.
• mice can be administered ciprofloxacin at a dose of 15-20 mg/kg (mg per average mouse body weight), for 7 days.
• mice are provided with an antibiotic, a wash out period of from one day to three days may be provided with no antibiotic treatment and no bacterial composition treatment.
• test bacterial composition is administered to the mice by oral gavage.
• the test bacterial composition may be administered in a volume of 0.2 ml containing 10 4 CFUs of each type of bacteria in the bacterial composition.
• Dose- response may be assessed by using a range of doses, including, but not limited to 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , and/or 10 10 .
• mice can be evaluated using 16S sequencing, full genome
• microbiological techniques to determine whether the test bacterial composition has populated the gastrointestinal tract of the mice. For example only, one day, three days, one week, two weeks, and one month after administration of the bacterial composition to the mice, 16S profiling is conducted to determine whether the test bacterial composition has populated the gastrointestinal tract of the mice. Quantitative assessments, including qPCR and traditional microbiological techniques such as colony counting, can additionally or alternatively be performed, at the same time intervals.
• the number of sequence counts that correspond exactly to those in the bacterial composition over time can be assessed to determine specifically which components of the bacterial composition reside in the gastrointestinal tract over a particular period of time.
• the strains of the bacterial composition persist for a desired period of time.
• the components of the bacterial composition persist for a desired period of time, while also increasing the ability of other microbes (such as those present in the environment, food, etc.) to populate the gastrointestinal tract, further increasing overall diversity, as discussed below.
• the present bacterial compositions can also be assessed for their ability to populate different regions on the gastrointestinal tract.
• a bacterial composition can be chosen for its ability to populate one or more than one region of the gastrointestinal tract, including, but not limited to the stomach, the small intestine (duodenum, jejunum, and ileum), the large intestine (the cecum, the colon (the ascending, transverse, descending, and sigmoid colon), and the rectum).
• An in vivo study can be conducted to determine which regions of the gastrointestinal tract a given bacterial composition will populate.
• a mouse model similar to the one described above can be conducted, except instead of assessing the feces produced by the mice, particular regions of the gastrointestinal tract can be removed and studied individually. For example, at least one particular region of the gastrointestinal tract can be removed and a qualitative or quantitative determination can be performed on the contents of that region of the gastrointestinal tract. In another embodiment, the contents can optionally be removed and the qualitative or quantitative determination may be conducted on the tissue removed from the mouse.
• Genomic DNA can be extracted from samples using commercially-available kits, such as the Mo Bio Powersoil®-htp 96 Well Soil DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA), the Mo Bio Powersoil® DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA), or the QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, CA) according to the Mo Bio Powersoil®-htp 96 Well Soil DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA), the Mo Bio Powersoil® DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA), or the QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, CA) according to the Mo Bio Powersoil®-htp 96 Well Soil DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA), the Mo Bio Powersoil® DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA), or the
• qPCR can be conducted using HotMasterMix (5PRIME, Gaithersburg, MD) and primers specific for the bacterial composition of interest, and may be conducted on a MicroAmp ® Fast Optical 96-well Reaction Plate with Barcode (0.1 mL) (Life Technologies, Grand Island, NY) and performed on a BioRad C1000TM Thermal Cycler equipped with a CFX96TM Real-Time System (BioRad, Hercules, CA), with fluorescent readings of the FAM and ROX channels. The Cq value for each well on the FAM channel is determined by the CFX
• the logio(cfu/ml) of each experimental sample is calculated by inputting a given sample's Cq value into linear regression model generated from the standard curve comparing the Cq values of the standard curve wells to the known logio(cfu/ml) of those samples.
• the skilled artisan may employ alternative qPCR modes.
• bacterial compositions For example, the sensitivity of bacterial compositions to certain environmental variables is determined, e.g., in order to select for particular desirable characteristics in a given composition, formulation and/or use.
• the constituents in the bacterial composition can be tested for pH resistance, bile acid resistance, and/or antibiotic sensitivity, either individually on a constituent-by-constituent basis or collectively as a bacterial composition comprised of multiple bacterial constituents (collectively referred to in this section as bacterial composition).
• a bacterial composition will be administered other than to the colon or rectum (i.e., for example, an oral route), optionally testing for pH resistance enhances the selection of bacterial compositions that will survive at the highest yield possible through the varying pH environments of the distinct regions of the Gl tract. Understanding how the bacterial compositions react to the pH of the Gl tract also assists in formulation, so that the number of bacteria in a dosage form can be increased if beneficial and/or so that the composition may be administered in an enteric-coated capsule or tablet or with a buffering or protective composition.
• bacterial compositions can be prepared that survive these varying pH ranges (specifically wherein at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or as much as 100% of the bacteria can survive gut transit times through various pH ranges). This can be tested by exposing the bacterial
• compositions to varying pH ranges for the expected gut transit times through those pH ranges. Therefore, as a nonlimiting example only, 18-hour cultures of bacterial compositions can be grown in standard media, such as gut microbiota medium ("GMM", see Goodman et al., Extensive personal human gut microbiota culture collections characterized and manipulated in gnotobiotic mice, PNAS 108(15):6252- 6257 (201 1 )) or another animal-products-free medium, with the addition of pH adjusting agents for a pH of 1 to 2 for 30 minutes, a pH of 3 to 4 for 1 hour, a pH of 4 to 5 for 1 to 2 hours, and a pH of 6 to 7.4 for 2.5 to 3 hours.
• GMM gut microbiota medium
• PNAS 108(15):6252- 6257 (201 1 ) or another animal-products-free medium
• pH adjusting agents for a pH of 1 to 2 for 30 minutes, a pH of 3 to 4 for 1 hour, a pH of
• testing for bile-acid resistance enhances the selection of bacterial compositions that will survive exposures to bile acid during transit through the Gl tract.
• Bile acids are secreted into the small intestine and can, like pH, affect the survival of bacterial compositions. This can be tested by exposing the bacterial compositions to bile acids for the expected gut exposure time to bile acids.
• bile acid solutions can be prepared at desired concentrations using 0.05 mM Tris at pH 9 as the solvent. After the bile acid is dissolved, the pH of the solution may be adjusted to 7.2 with 10% HCI.
• Bacterial compositions can be cultured in 2.2 ml of a bile acid composition mimicking the concentration and type of bile acids in the patient, 1 .0 ml of 10% sterile-filtered feces media and 0.1 ml of an 18-hour culture of the given strain of bacteria. Incubations may be conducted for from 2.5 to 3 hours or longer.
• An alternative method for testing stability to bile acid is described in U.S. Patent No. 4,839,281 . Survival of bacteria may be determined by culturing the bacteria and counting colonies on appropriate selective or non-selective media.
• bacterial compositions can be tested for sensitivity to antibiotics.
• bacterial compositions can be chosen so that the bacterial constituents are sensitive to antibiotics such that if necessary they can be eliminated or substantially reduced from the patient's gastrointestinal tract by at least one antibiotic targeting the bacterial composition.
• the bacterial compositions may optionally be tested for the ability to adhere to gastrointestinal cells.
• a method for testing adherence to gastrointestinal cells is described in U.S. Patent No. 4,839,281 .
• a solvent treatment is a miscible solvent treatment (either partially miscible or fully miscible) or an immiscible solvent treatment.
• Miscibility is the ability of two liquids to mix with each to form a homogeneous solution. Water and ethanol, for example, are fully miscible such that a mixture containing water and ethanol in any ratio will show only one phase. Miscibility is provided as a wt/wt%, or weight of one solvent in 100 g of final solution. If two solvents are fully miscible in all proportions, their miscibility is 100%.
• alcohols e.g., methanol, ethanol, isopropanol, butanol, etc.
• the alcohols can be provided already combined with water; e.g., a solution containing10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 89%, 85%, 90%, 95% or greater than 95%
• Other solvents are only partially miscible, meaning that only some portion will dissolve in water.
• Diethyl ether for example, is partially miscible with water. Up to 7 grams of diethyl ether will dissolve in 93 g of water to give a 7% (wt/wt%) solution.
• miscible materials include ethers, dimethoxyethane, or tetrahydrofuran
• an oil such as an alkane and water are immiscible and form two phases.
• immiscible treatments are optionally combined with a detergent, either an ionic detergent or a non-ionic detergent.
• Exemplary detergents include Triton X-100, Tween 20, Tween 80, Nonidet P40, a pluronic, or a polyol.
• the fecal materials are subjected to one or more chromatographic treatments, either sequentially or in parallel.
• chromatographic treatments either sequentially or in parallel.
• a solution containing the fecal material is contacted with a solid medium containing a hydrophobic interaction chromatographic (HIC) medium or an affinity chromatographic medium.
• HIC hydrophobic interaction chromatographic
• a solid medium capable of absorbing a residual habitat product present in the fecal material is contacted with a solid medium that adsorbs a residual habitat product.
• the HIC medium contains sepharose or a derivatized sepharose such as butyl sepharose, octyl sepharose, phenyl sepharose, or butyl-s sepharose.
• the affinity chromatographic medium contains material derivatized with mucin type I, II, III, IV, V, or VI, or oligosaccharides derived from or similar to those of mucins type I, II, III, IV, V, or VI.
• the affinity chromatographic medium contains material derivatized with antibodies that recognize spore-forming bacteria.
• the physical disruption of the fecal material particularly by one or more mechanical treatment such as blending, mixing, shaking, vortexing, impact pulverization, and sonication.
• the mechanical disrupting treatment substantially disrupts a non-spore material present in the fecal material and does not substantially disrupt a spore present in the fecal material.
• Mechanical treatments optionally include filtration treatments, where the desired spore
• the spore fraction retained on the filter medium is subjected to a diafiltration step, wherein the retained spores are contacted with a wash liquid, typically a sterile saline-containing solution or other diluent, in order to further reduce or remove the undesirable fecal components.
• a wash liquid typically a sterile saline-containing solution or other diluent
• the thermal disruption of the fecal material is provided herein.
• the fecal material is mixed in a saline-containing solution such as phosphate- buffered saline (PBS) and subjected to a heated environment, such as a warm room, incubator, water-bath, or the like, such that efficient heat transfer occurs between the heated environment and the fecal material.
• a heated environment such as a warm room, incubator, water-bath, or the like
• the fecal material solution is mixed during the incubation to enhance thermal conductivity and disrupt particulate aggregates.
• Thermal treatments can be modulated by the temperature of the environment and/or the duration of the thermal treatment.
• the fecal material or a liquid comprising the fecal material is subjected to a heated
• a hot water bath of at least about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or greater than 100 degrees Celsius, for at least about 1 , 5, 10, 15, 20, 30, 45 seconds, or 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50 minutes, or 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 hours.
• the thermal treatment occurs at two different temperatures, such as 30 seconds in a 100 degree Celsius environment followed by 10 minutes in a 50 degree Celsius environment.
• the temperature and duration of the thermal treatment are sufficient to kill or remove pathogenic materials while not substantially damaging or reducing the germination-competency of the spores.
• ionizing radiation typically gamma irradiation, ultraviolet irradiation or electron beam irradiation provided at an energy level sufficient to kill pathogenic materials while not substantially damaging the desired spore populations.
• ionizing radiation typically gamma irradiation, ultraviolet irradiation or electron beam irradiation provided at an energy level sufficient to kill pathogenic materials while not substantially damaging the desired spore populations.
• ultraviolet radiation at 254nm provided at an energy level below about 22,000 microwatt seconds per cm 2 will not generally destroy desired spores.
• a solution containing the fecal material is subjected to one or more centrifugation treatments, e.g., at about 1000 x g, 2000 x g, 3000 x g, 4000 x g, 5000 x g, 6000 x g, 7000 x g, 8000 x g or greater than 8000 x g.
• Differential centrifugation separates desired spores from undesired non-spore material; at low forces the spores are retained in solution, while at higher forces the spores are pelleted while smaller impurities (e.g., virus particles, phage) are retained in solution.
• impurities e.g., virus particles, phage
• density or mobility gradients or cushions e.g., step cushions
• Percoll, Ficoll, Nycodenz, Histodenz or sucrose gradients are used to separate desired spore populations from other materials in the fecal material.
• formulations for administration to humans and other subjects in need thereof are combined with additional active and/or inactive materials in order to produce a final product, which may be in single dosage unit or in a multi-dose format.
• the composition comprises at least one carbohydrate.
• a “carbohydrate” refers to a sugar or polymer of sugars.
• saccharide The terms “saccharide,” “polysaccharide,” “carbohydrate,” and “oligosaccharide” may be used interchangeably.
• Most carbohydrates are aldehydes or ketones with many hydroxyl groups, usually one on each carbon atom of the molecule. Carbohydrates generally have the molecular formula C n H2nO n .
• a carbohydrate can be a monosaccharide, a disaccharide, trisaccharide, oligosaccharide, or polysaccharide.
• the most basic carbohydrate is a monosaccharide, such as glucose, sucrose, galactose, mannose, ribose, arabinose, xylose, and fructose. Disaccharides are two joined
• oligosaccharide typically includes between three and six
• Carbohydrates can contain modified saccharide units, such as 2'- deoxyribose wherein a hydroxyl group is removed, 2'-fluororibose wherein a hydroxyl group is replace with a fluorine, or N-acetylglucosamine, a nitrogen-containing form of glucose (e.g., 2'-fluororibose, deoxyribose, and hexose).
• Carbohydrates can exist in many different forms, for example, conformers, cyclic forms, acyclic forms, stereoisomers, tautomers, anomers, and isomers.
• the composition comprises at least one lipid.
• a "lipid” includes fats, oils, triglycerides, cholesterol, phospholipids, fatty acids in any form including free fatty acids. Fats, oils and fatty acids can be saturated, unsaturated (cis or trans) or partially unsaturated (cis or trans).
• the lipid comprises at least one fatty acid selected from lauric acid (12:0), myristic acid (14:0), palmitic acid (16:0), palmitoleic acid (16:1 ), margaric acid (17:0), heptadecenoic acid (17:1 ), stearic acid (18:0), oleic acid (18:1 ), linoleic acid (18:2), linolenic acid (18:3), octadecatetraenoic acid (18:4), arachidic acid (20:0), eicosenoic acid (20:1 ), eicosadienoic acid (20:2), eicosatetraenoic acid (20:4), eicosapentaenoic acid (20:5) (EPA), docosanoic acid (22:0), docosenoic acid (22:1 ), docosapentaenoic acid (22:5), docosahexaenoic acid (22:6) (
• the composition comprises at least one
• supplemental mineral or mineral source examples include, without limitation: chloride, sodium, calcium, iron, chromium, copper, iodine, zinc,
• Suitable forms of any of the foregoing minerals include soluble mineral salts, slightly soluble mineral salts, insoluble mineral salts, chelated minerals, mineral complexes, non-reactive minerals such as carbonyl minerals, and reduced minerals, and combinations thereof.
• the composition comprises at least one
• the at least one vitamin can be fat-soluble or water soluble vitamins.
• Suitable vitamins include but are not limited to vitamin C, vitamin A, vitamin E, vitamin B12, vitamin K, riboflavin, niacin, vitamin D, vitamin B6, folic acid, pyridoxine, thiamine, pantothenic acid, and biotin.
• Suitable forms of any of the foregoing are salts of the vitamin, derivatives of the vitamin, compounds having the same or similar activity of the vitamin, and metabolites of the vitamin.
• the composition comprises an excipient.
• excipients include a buffering agent, a preservative, a stabilizer, a binder, a compaction agent, a lubricant, a dispersion enhancer, a disintegration agent, a flavoring agent, a sweetener, and a coloring agent.
• the excipient is a buffering agent.
• suitable buffering agents include sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, and calcium bicarbonate.
• the excipient comprises a preservative.
• suitable preservatives include antioxidants, such as alpha- tocopherol and ascorbate, and antimicrobials, such as parabens, chlorobutanol, and phenol.
• the composition comprises a binder as an excipient.
• suitable binders include starches, pregelatinized starches, gelatin, polyvinylpyrolidone, cellulose, methylcellulose, sodium
• the composition comprises a lubricant as an excipient.
• suitable lubricants include magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oils, sterotex,
• polyoxyethylene monostearate polyoxyethylene monostearate, talc, polyethyleneglycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, and light mineral oil.
• the composition comprises a dispersion enhancer as an excipient.
• suitable dispersants include starch, alginic acid, polyvinylpyrrolidones, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isoamorphous silicate, and microcrystalline cellulose as high HLB emulsifier surfactants.
• the composition comprises a disintegrant as an excipient.
• the disintegrant is a non-effervescent disintegrant.
• suitable non-effervescent disintegrants include starches such as corn starch, potato starch, pregelatinized and modified starches thereof, sweeteners, clays, such as bentonite, micro-crystalline cellulose, alginates, sodium starch glycolate, gums such as agar, guar, locust bean, karaya, pecitin, and tragacanth.
• the disintegrant is an effervescent disintegrant.
• suitable effervescent disintegrants include sodium
• bicarbonate in combination with citric acid and sodium bicarbonate in combination with tartaric acid.
• the excipient comprises a flavoring agent.
• Flavoring agents can be chosen from synthetic flavor oils and flavoring aromatics; natural oils; extracts from plants, leaves, flowers, and fruits; and combinations thereof.
• the flavoring agent is selected from cinnamon oils; oil of wintergreen; peppermint oils; clover oil; hay oil; anise oil; eucalyptus; vanilla; citrus oil such as lemon oil, orange oil, grape and grapefruit oil; and fruit essences including apple, peach, pear, strawberry, raspberry, cherry, plum, pineapple, and apricot.
• the excipient comprises a sweetener.
• suitable sweeteners include glucose (corn syrup), dextrose, invert sugar, fructose, and mixtures thereof (when not used as a carrier); saccharin and its various salts such as the sodium salt; dipeptide sweeteners such as aspartame; dihydrochalcone compounds, glycyrrhizin; Stevia Rebaudiana (Stevioside); chloro derivatives of sucrose such as sucralose; and sugar alcohols such as sorbitol, mannitol, sylitol, and the like.
• hydrogenated starch also contemplated are also contemplated.
• the composition comprises a coloring agent.
• suitable color agents include food, drug and cosmetic colors (FD&C), drug and cosmetic colors (D&C), and external drug and cosmetic colors (Ext. D&C).
• the coloring agents can be used as dyes or their corresponding lakes.
• the weight fraction of the excipient or combination of excipients in the formulation is usually about 99% or less, such as about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 2% or less, or about 1 % or less of the total weight of the composition.
• the bacterial compositions disclosed herein can be formulated into a variety of forms and administered by a number of different means.
• the compositions can be administered orally, rectally, or parenterally, in formulations containing conventionally acceptable carriers, adjuvants, and vehicles as desired.
• parenteral as used herein includes subcutaneous, intravenous, intramuscular, or intrasternal injection and infusion techniques.
• the bacterial composition is administered orally.
• Solid dosage forms for oral administration include capsules, tablets, caplets, pills, troches, lozenges, powders, and granules.
• a capsule typically comprises a core material comprising a bacterial composition and a shell wall that encapsulates the core material.
• the core material comprises at least one of a solid, a liquid, and an emulsion.
• the shell wall material comprises at least one of a soft gelatin, a hard gelatin, and a polymer.
• Suitable polymers include, but are not limited to: cellulosic polymers such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose (HPMC), methyl cellulose, ethyl cellulose, cellulose acetate, cellulose acetate phthalate, cellulose acetate trimellitate, hydroxypropylmethyl cellulose phthalate, hydroxypropyl methyl cellulose succinate and carboxymethylcellulose sodium; acrylic acid polymers and copolymers, such as those formed from acrylic acid, methacrylic acid, methyl acrylate, ammonio methylacrylate, ethyl acrylate, methyl methacrylate and/or ethyl methacrylate (e.g., those copolymers sold under the trade name
• At least one polymer functions as taste-masking agents.
• Tablets, pills, and the like can be compressed, multiply compressed, multiply layered, and/or coated.
• the coating can be single or multiple.
• the coating material comprises at least one of a saccharide, a polysaccharide, and glycoproteins extracted from at least one of a plant, a fungus, and a microbe.
• Non-limiting examples include corn starch, wheat starch, potato starch, tapioca starch, cellulose, hemicellulose, dextrans, maltodextrin, cyclodextrins, inulins, pectin, mannans, gum arabic, locust bean gum, mesquite gum, guar gum, gum karaya, gum ghatti, tragacanth gum, funori, carrageenans, agar, alginates, chitosans, or gellan gum.
• the coating material comprises a protein.
• the coating material comprises at least one of a fat and an oil.
• the at least one of a fat and an oil is high temperature melting.
• the at least one of a fat and an oil is hydrogenated or partially hydrogenated.
• the at least one of a fat and an oil is derived from a plant.
• the at least one of a fat and an oil comprises at least one of glycerides, free fatty acids, and fatty acid esters.
• the coating material comprises at least one edible wax.
• the edible wax can be derived from animals, insects, or plants. Non-limiting examples include beeswax, lanolin, bayberry wax, carnauba wax, and rice bran wax. Tablets and pills can additionally be prepared with enteric coatings.
• powders or granules embodying the bacterial compositions disclosed herein can be incorporated into a food product.
• the food product is a drink for oral administration.
• suitable drink include fruit juice, a fruit drink, an artificially flavored drink, an artificially sweetened drink, a carbonated beverage, a sports drink, a liquid diary product, a shake, an alcoholic beverage, a caffeinated beverage, infant formula and so forth.
• suitable means for oral administration include aqueous and nonaqueous solutions, emulsions, suspensions and solutions and/or suspensions reconstituted from non-effervescent granules, containing at least one of suitable solvents, preservatives, emulsifying agents, suspending agents, diluents, sweeteners, coloring agents, and flavoring agents.
• the food product can be a solid foodstuff.
• a solid foodstuff include without limitation a food bar, a snack bar, a cookie, a brownie, a muffin, a cracker, an ice cream bar, a frozen yogurt bar, and the like.
• compositions disclosed herein are incorporated into a therapeutic food.
• the therapeutic food is a ready-to- use food that optionally contains some or all essential macronutrients and
• compositions disclosed herein are incorporated into a supplementary food that is designed to be blended into an existing meal.
• the supplemental food contains some or all essential macronuthents and micron uthents.
• the bacterial compositions disclosed herein are blended with or added to an existing food to fortify the food's protein nutrition. Examples include food staples (grain, salt, sugar, cooking oil, margarine), beverages (coffee, tea, soda, beer, liquor, sports drinks), snacks, sweets and other foods.
• the formulations are filled into gelatin capsules for oral administration.
• An example of an appropriate capsule is a 250 mg gelatin capsule containing from 10 (up to 100 mg) of lyophilized powder (10 8 to 10 11 bacteria), 160 mg microcrystalline cellulose, 77.5 mg gelatin, and 2.5 mg magnesium stearate.
• from 10 5 to 10 12 bacteria may be used, 10 5 to 10 7 , 10 6 to 10 7 , or 10 8 to 10 10 , with attendant adjustments of the excipients if necessary.
• an enteric-coated capsule or tablet or with a buffering or protective composition can be used.
• the identity of the bacterial species which grew up from a complex fraction can be determined in multiple ways. First, individual colonies can be picked into liquid media in a 96 well format, grown up and saved as 15% glycerol stocks at - 80°C. Aliquots of the cultures can be placed into cell lysis buffer and colony PCR methods can be used to amplify and sequence the 16S rDNA gene (Example 2 and described above). Alternatively, colonies may be streaked to purity in several passages on solid media. Well separated colonies are streaked onto the fresh plates of the same kind and incubated for 48-72 hours at 37°C. The process is repeated multiple times in order to ensure purity. Pure cultures can be analyzed by
• Sequence characterization of pure isolates or mixed communities e.g. plate scrapes and spore fractions can also include whole genome shotgun sequencing. The latter is valuable to determine the presence of genes associated with sporulation, antibiotic resistance, pathogenicity, and virulence. Colonies can also be scraped from plates en masse and sequenced using a massively parallel sequencing method as described in Examples 2 and 3, such that individual 16S signatures can be identified in a complex mixture.
• the sample can be sequenced prior to germination (if appropriate DNA isolation procedures are used to Isye and release the DNA from spores) in order to compare the diversity of germinable species with the total number of species in a spore sample.
• MALDI-TOF-mass spec can also be used for species identification (as reviewed in Anaerobe 22:123).
• Example 2 16s Sequencing to Determine Operational Taxonomic Unit ipTUl
• OTUs can be defined either by full 16S sequencing of the rRNA gene, by sequencing of a specific hypervariable region of this gene (i.e. V1 , V2, V3, V4, V5, V6, V7, V8, or V9), or by sequencing of any combination of hypervariable regions from this gene (e.g. V1 -3 or V3-5).
• the bacterial 16S rDNA is approximately 1500 nucleotides in length and is used in reconstructing the evolutionary relationships and sequence similarity of one bacterial isolate to another using phylogenetic
• 16S sequences are used for phylogenetic reconstruction as they are in general highly conserved, but contain specific hypervariable regions that harbor sufficient nucleotide diversity to differentiate genera and species of most microbes.
• genomic DNA is extracted from a bacterial sample, the 16S rDNA (full region or specific hypervariable regions) amplified using polymerase chain reaction (PCR), the PCR products cleaned, and nucleotide sequences delineated to determine the genetic composition of 16S gene or subdomain of the gene.
• PCR polymerase chain reaction
• the sequencing method used may be, but is not limited to, Sanger sequencing.
• the sequencing may be, but is not limited to being, performed using the Sanger method or using a next- generation sequencing method, such as an lllumina (sequencing by synthesis) method using barcoded primers allowing for multiplex reactions.
• a next- generation sequencing method such as an lllumina (sequencing by synthesis) method using barcoded primers allowing for multiplex reactions.
• VT1 , VT2, and VT2e cytotoxic necrotizing factors
• CNF1 and CNF2 attaching and effacing mechanisms
• eae>4 attaching and effacing mechanisms
• Eugg enteroaggregative mechanisms
• Euv enteroinvasive mechanisms
• Genomic DNA is extracted from pure microbial cultures using a hot alkaline lysis method. 1 ⁇ of microbial culture is added to 9 ⁇ of Lysis Buffer (25mM
• genomic DNA is extracted from pure microbial cultures using commercially available kits such as the Mo Bio Ultraclean® Microbial
• the V1 , V2, and V3 regions are used to characterize an OTU.
• the V3, V4, and V5 regions are used to characterize an OTU.
• the V4 region is used to characterize an OTU.
• the PCR can be performed on commercially available thermocyclers such as a BioRad MyCyclerTM Thermal Cycler (BioRad, Hercules, CA). The reactions are run at 94°C for 2 minutes followed by 30 cycles of 94°C for 30 seconds, 51 °C for 30 seconds, and 68°C for 1 minute 30 seconds, followed by a 7 minute extension at 72°C and an indefinite hold at 4°C. Following PCR, gel electrophoresis of a portion of the reaction products is used to confirm successful amplification of a ⁇ 1 .5 kb product.
• thermocyclers such as a BioRad MyCyclerTM Thermal Cycler (BioRad, Hercules, CA).
• the reactions are run at 94°C for 2 minutes followed by 30 cycles of 94°C for 30 seconds, 51 °C for 30 seconds, and 68°C for 1 minute 30 seconds, followed by a 7 minute extension at 72°C and an indefinite hold at 4°C.
• Amplification performed for downstream sequencing by short read technologies such as lllumina require amplification using primers known to those skilled in the art that additionally include a sequence-based barcoded tag.
• primers known to those skilled in the art that additionally include a sequence-based barcoded tag.
• 2 ⁇ of extracted gDNA is added to a 20 ⁇ final volume PCR reaction.
• the PCR reaction also contains 1x HotMasterMix (5PRIME, Gaithersburg, MD), 200 nM of V4_515f_adapt
• thermostable polymerases known to those skilled in the art are used to obtain different amplification and sequencing error rates as well as results on alternative sequencing technologies.
• thermocyclers such as a BioRad MyCyclerTM Thermal Cycler (BioRad, Hercules,
• the prepared library can be sequenced on lllumina HiSeq or MiSeq sequencers (lllumina, San Diego, CA) with cluster generation, template hybridization, iso-thermal amplification, linearization, blocking and denaturization and hybridization of the sequencing primers performed according to the manufacturer's instructions. 16SV4SeqFw
• Nucleic acid sequences can be analyzed and annotated to define taxonomic assignments using sequence similarity and phylogenetic placement methods or a combination of the two strategies.
• a similar approach can be used to annotate protein names, transcription factor names, and any other classification schema for nucleic acid sequences.
• Sequence similarity based methods include those familiar to individuals skilled in the art including, but not limited to BLAST, BLASTx, tBLASTn, tBLASTx, RDP-classifier, DNAclust, and various
• Annotations are made based on the placement of the read in the phylogenetic tree.
• the certainty or significance of the OTU annotation is defined based on the OTU's sequence similarity to a reference nucleic acid sequence and the proximity of the OTU sequence relative to one or more reference sequences in the phylogeny.
• the specificity of a taxonomic assignment is defined with confidence at the the level of Family, Genus, Species, or Strain with the confidence determined based on the position of bootstrap supported branches in the reference phylogenetic tree relative to the placement of the OTU sequence being interrogated.
• Clades are constructed to ensure that all OTUs in a given clade are: (i) within a specified number of bootstrap supported nodes from one another (generally, 1 -5 bootstraps), and (ii) within a 5% genetic similarity.
• OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S-V4 sequence data.
• OTUs falling within the same clade are evolutionarily closely related and may or may not be distinguishable from one another using 16S-V4 sequence data.
• the power of clade based analysis is that members of the same clade, due to their evolutionary relatedness, are likely to play similar functional roles in a microbial ecology such as that found in the human gut.
• 16S sequences of isolates of a given OTU are phylogenetically placed within their respective clades, sometimes in conflict with the microbiological- based assignment of species and genus that may have preceded 16S-based assignment. Discrepancies between taxonomic assignment based on
• Mixtures of bacteria can include species that are in spore form.
• Germinating a spore fraction increases the number of viable bacteria that will grow on various media types.
• the sample is moved to the anaerobic chamber, resuspended in prereduced PBS, mixed and incubated for 1 hour at 37C to allow for germination.
• Germinants can include amino-acids (e.g., alanine, glycine), sugars (e.g., fructose), nucleosides (e.g., inosine), bile salts (e.g., cholate and taurocholate), metal cations (e.g., Mg2+, Ca2+), fatty acids, and long- chain alkyl amines (e.g., dodecylamine, Germination of bacterial spores with alkyl primary amines" J. Bacteriology, 1961 .). Mixtures of these or more complex natural mixtures, such as rumen fluid or Oxgall, can be used to induce germination.
• amino-acids e.g., alanine, glycine
• sugars e.g., fructose
• nucleosides e.g., inosine
• bile salts e.g., cholate and taurocholate
• Oxgall is dehydrated bovine bile composed of fatty acids, bile acids, inorganic salts, sulfates, bile pigments, cholesterol, mucin, lecithin, glycuronic acids, porphyrins, and urea.
• the germination can also be performed in a growth medium like prereduced BHIS/oxgall germination medium, in which BHIS (Brain heart infusion powder (37 g/L), yeast extract (5 g/L), L-cysteine HCI (1 g/L)) provides peptides, amino acids, inorganic ions and sugars in the complex BHI and yeast extract mixtures and Oxgall provides additional bile acid germinants.
• BHIS Brain heart infusion powder (37 g/L), yeast extract (5 g/L), L-cysteine HCI (1 g/L)
• pressure may be used to germinate spores.
• the selection of germinants can vary with the microbe being sought. Different species require different germinants and different isolates of the same species can require different germinants for optimal germination.
• it is important to dilute the mixture prior to plating because some germinants are inhibitory to growth of the vegetative-state microorganisms. For instance, it has been shown that alkyl amines must be neutralized with anionic lipophiles in order to promote optimal growth. Bile acids can also inhibit growth of some organisms despite promoting their germination, and must be diluted away prior to plating for viable cells.
• BHIS/oxgall solution is used as a germinant and contains 0.5X BHIS medium with 0.25% oxgall (dehydrated bovine bile) where 1 x BHIS medium contains the following per L of solution: 6g Brain Heart Infusion from solids, 7g peptic digest of animal tissue, 14.5g of pancreatic digest of casein, 5g of yeast extract, 5g sodium chloride, 2g glucose, 2.5g disodium phosphate, and 1 g cysteine. Additionally, Ca-DPA is a germinant and contains 40mM CaCI2, and 40mM dipicolinic acid (DPA). Rumen fluid (Bar Diamond, Inc.) is also a germinant.
• Simulated gastric fluid (Ricca Chemical) is a germinant and is 0.2% (w/v) Sodium Chloride in 0.7% (v/v) Hydrochloric Acid.
• Mucin medium is a germinant and prepared by adding the following items to 1 L of distilled sterile water: 0.4 g KH 2 PO 4 , 0.53 g Na 2 HPO 4 , 0.3 g NH 4 CI, 0.3 g NaCI, 0.1 g MgCI 2 x 6H 2 O, 0.1 1 g CaCI 2 , 1 ml alkaline trace element solution, 1 ml acid trace element solution, 1 ml vitamin solution, 0.5 mg resazurin, 4 g NaHCO3, 0.25 g Na 2 S x 9 H 2 O.
• the trace element and vitamin solutions prepared as described previously (Stams et al., 1993). All compounds were autoclaved, except the vitamins, which were filter-sterilized.
• the basal medium was supplemented with 0.7% (v/v) clarified, sterile rumen fluid and 0.25% (v/v) commercial hog gastric mucin (Type III; Sigma), purified by ethanol precipitation as described previously (Miller & Hoskins, 1981 ). This medium is referred herein as mucin medium.
• Fetal Bovine Serum can be used as a germinant and contains 5% FBS heat inactivated, in Phosphate Buffered Saline (PBS, Fisher Scientific) containing 0.137M Sodium Chloride, 0.0027M Potassium Chloride, 0.01 19M
• Thioglycollate is a germinant as described previously (Kamiya et al Journal of Medical Microbiology 1989) and contains 0.25M (pH10) sodium thioglycollate.
• Dodecylamine solution containing 1 mM dodecylamine in PBS is a germinant.
• a sugar solution can be used as a germinant and contains 0.2% fructose, 0.2% glucose, and 0.2% mannitol.
• Amino acid solution can also be used as a germinant and contains 5mM alanine, 1 mM arginine, 1 mM histidine, 1 mM lysine, 1 mM proline, 1 mM asparagine, 1 mM aspartic acid, 1 mM phenylalanine.
• a germinant mixture referred to herein as Germix 3 can be a germinant and contains 5mM alanine, 1 mM arginine, 1 mM histidine, 1 mM lysine, 1 mM proline, 1 mM asparagine, 1 mM aspartic acid, 1 mM phenylalanine, 0.2%taurocholate, 0.2% fructose, 0.2% mannitol, 0.2% glucose, 1 mM inosine, 2.5mM Ca-DPA, and 5mM KCI.
• BHIS medium + DPA is a germinant mixture and contains BHIS medium and 2mM Ca-DPA.
• EcSN Escherichia coli spent medium supernatant referred to herein as EcSN is a germinant and is prepared by growing E. coli MG1655 in SweetB/Fos inulin medium anaerobically for 48 hr, spinning down cells at 20,000rcf for 20 minutes, collecting the supernatant and heating to 60C for 40 min. Finally, the solution is filter sterilized and used as a germinant solution.
• Example 5 Selection of Media for Growth
• media to support growth including preferred carbon sources.
• preferred carbon sources include complex sugars such as cellobiose over simple sugars.
• media used in the isolation of sporulating organisms include EYA, BHI, BHIS, and GAM (see below for complete names and references). Multiple dilutions are plated out to ensure that some plates will have well isolated colonies on them for analysis, or alternatively plates with dense colonies may scraped and suspended in PBS to generate a mixed diverse community.
• Plates are incubated anaerobically or aerobically at 37 C for 48-72 or more hours, targeting anaerobic or aerobic spore formers, respectively.
• Solid plate media include:
• Gifu Anaerobic Medium without dextrose supplemented with fructooligosaccharides/inulin (0.4%), mannitol (0.4%), inulin (0.4%), or fructose (0.4%), or a combination thereof.
• glucose, cellobiose, maltose, L-arabinose, fructose is supplemented with glucose, cellobiose, maltose, L-arabinose, fructose,
• fructooligosaccharides/inulin, mannitol and sodium lactate
• PEA sheep blood (Anaerobe Systems; 5% Sheep Blood Agar with
• M2 agar (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) supplemented with starch (1 %), mannitol (0.4%), lactate (1 .5g/L) or lactose (0.4%)
• PY-salicin peptone-yeast extract agar supplemented with salicin
• Modified Brain Heart Infusion [[sweet and sour]] contains the following per L: 37.5g Brain Heart Infusion powder (Remel), 5g yeast extract, 2.2g meat extract, 1 .2g liver extract, 1 g cystein HCI, 0.3g sodium thioglycolate, 10mg hemin, 2g soluble starch, 2g FOS/lnulin, 1 g cellobiose, 1 g L-arabinose, 1 g mannitol, 1 Na-lactate, 1 ml_ Tween 80, 0.6g MgSO4x7H2O, 0.6g CaCI2, 6g (NH4)2SO4, 3g KH2PO4, 0.5g K2HPO4, 33mM Acetic acid, 9mM propionic acid, 1 mM Isobutyric acid, 1 mM isovaleric acid, 15g agar, and after autoclaving add 50ml_ of 8% NaHCO3 solution and 50m
• a donation is first blended with saline using a homogenization device (e.g., laboratory blender) to produce a 20% slurry (w/v). 100% ethanol is added for an inactivation treatment that lasts 10 seconds to 1 hour. The final alcohol concentration can range from 30-90%, preferably 50-70%. High speed centrifugation (3200 rcf for 10min) is performed to remove solvent and the pellet is retained and washed.
• a homogenization device e.g., laboratory blender
• 100% ethanol is added for an inactivation treatment that lasts 10 seconds to 1 hour.
• the final alcohol concentration can range from 30-90%, preferably 50-70%.
• High speed centrifugation (3200 rcf for 10min) is performed to remove solvent and the pellet is retained and washed.
• a low speed centrifugation step (200 rcf for 4 min) is performed to remove large particulate vegetative matter and the supernatant containing the spores is retained.
• High speed centrifugation (3200 rcf for 10 min) is performed on the supernatant to concentrate the spore material.
• the pellet is then washed and resuspended to generate a 20% slurry. This is the ethanol treated spore preparation.
• the concentrated slurry is then separated with a density based gradient e.g. a CsCI gradient, sucrose gradient or combination of the two generating a ethanol treated, gradient-purified spore preparation.
• a CsCI gradient is performed by loading a 20% volume of spore suspension on top a 80% volume of a stepwise CsCI gradient (w/v) containing the steps of 64%, 50%, 40% CsCI (w/v) and centrifuging for 20 min at 3200 rcf.
• the spore fraction is then run on a sucrose step gradient with steps of 67%, 50%, 40%, and 30% (w/v).
• the spores run roughly in the 30% and 40% sucrose fractions.
• the lower spore fraction ( Figure 2) is then removed and washed to produce a concentrated ethanol treated, gradient-purified spore
• a prophylactic mouse model of C. difficile infection (model based on Chen, et al., A mouse model of Clostridium difficile associated disease, Gastroenterology 135(6):1984-1992) was used. Two cages of five mice each were tested for each arm of the experiment.
• antibiotic cocktail consisting of 10% glucose, kanamycin (0.5 mg/ml), gentamicin (0.044 mg/ml), colistin (1062.5 U/ml), metronidazole (0.269 mg/ml), ciprofloxacin (0.156 mg/
• a positive control group received vancomycin from day -1 through day 3 in addition to the antibiotic protocol and C. difficile challenge specified above.
• Feces were collected from the cages for analysis of bacterial carriage, mortality was assessed every day from day 0 to day 6 and the weight and subsequent weight change of the animal was assessed with weight loss being associated with C. difficile infection. Mortality and reduced weight loss of the test article compared to the vehicle were used to assess the success of the test article. Additionally, a C. difficile symptom scoring was performed each day from day -1 through day 6.
• Clinical Score was based on a 0-4 scale by combining scores for Appearance (0-2 pts based on normal, hunched, piloerection, or lethargic), and Clinical Signs (0-2 points based on normal, wet tail, cold-to-the-touch, or isolation from other animals).
• animals were challenged with C. difficile.
• vancomycin positive control arm animals were dosed with C. difficile and treated with vancomycin from day -1 through day 3.
• the negative control was gavaged with PBS alone and no bacteria.
• the test arms of the experiment tested 1x, 0.1 x, ⁇ . ⁇ ⁇ dilutions derived from a single donor preparation of ethanol treated spores (e.g.
• Clindamycin (10mg/kg s.c.) is given on day -5, the bacterial composition or control is administered on day - 3, and C. difficile challenge occurs on day 0.
• vancomycin is then administered on day 1 -5 (and vehicle control is delivered on day -3).
• Feces are collected on day -5, -4, -1 , 1 , 3, 5, 7, 9 and fecal samples are assessed for pathogen carriage and reduction by microbiological methods, 16S sequencing approaches or other methods utilized by one skilled in the art. Mortality is assessed throughout the experiment through 21 days post C. difficile challenge.
• percentage survival curves show that ethanol treated spores and ethanol treated, gradient-purified spores better protect the hamsters compared to the Vancomycin control, and vehicle control.
• Figure 4 shows a prophylaxis model with the ethanol treated spore preparation and the ethanol treated, gradient-purified spore preparation.
• hamsters are challenged with toxigenic C. difficile strains on day 0, and treated with clindamycin by oral gavage on day 1 , and vancomycin dosing day 2-6. Test or control treatment was then administered on day 7, 8, and 9.
• the groups of hamsters for each arm consist of 8 hamsters per group. Fecal material is collected on day -1 , 1 , 3, 5, 7, 10 and 13 and hamster mortality is assessed throughout. Survival curves are used to assess the success of the test article e.g. ethanol treated or ethanol treated, gradient purified spores versus the control treatment in preventing hamster death.
• FIG. 5 shows the relapse prevention model with ethanol treated spores and ethanol treated, gradient purified spores
• Example 9 Clinical treatment of recurrent C. difficile in patients
• test articles like bacterial composition including but not limited to a ethanol treated spore preparations (e.g. see Example 6) to treat recurrent C. difficile in human patients
• the following procedure was performed to take feces from a healthy donor, inactivate via the ethanol treated spore preparation protocol described below, and treat recurrent C. difficile in patients presenting with this indication.
• Non-related donors were screened for general health history for absence of chronic medical conditions (including inflammatory bowel disease;
• irritable bowel syndrome Celiac disease; or any history of gastrointestinal malignancy or polyposis
• absence of risk factors for transmissible infections antibiotic non-use in the previous 6 months
• negative results in laboratory assays for blood-borne pathogens HBV, HTLV, HCV, HBV, CMV, HAV and
• Treponema pallidum and fecal bacterial pathogens (Salmonella, Shigella, Yersinia, Campylobacter, E. coli 0157), ova and parasites, and other infectious agents (Giardia, Cryptosporidium Cyclospora, Isospora) prior to stool donation.
• Donor stool was frozen shortly after donation and sampled for testing. At the time of use, approximately 75 g of donor stool was thawed and resuspended in 500 mL of non-bacteriostatic normal saline and mixed in a single use glass or plastic blender. The resulting slurry was sequentially passed through sterile, disposable mesh screens that remove particles of size 600, 300 and 200 microns. The slurry was then centrifuged briefly (200 rcf for 4 min) to separate fibrous and particulate materials, and the supernatant (containing bacterial cells and spores) was transferred to a fresh container. Ethanol was added to a final concentration of 50% and the resulting -1500 ml slurry was incubated at room temperature for 1 hr with continuous mixing to inactivate vegetative bacterial cells. Midway through
• the slurry was transferred to a new bottle to ensure complete contact with the ethanol.
• the solid matter was pelleted in a centrifuge and washed 3 times with normal saline to remove residual ethanol.
• the final pellet was resuspended in 100% sterile, USP glycerol at a minimum volume, and filled into approximately 30 size 0 delayed release capsules (hypromellose DRcaps, Capsugel, Inc.) at 0.65 mL suspension each.
• the capsules were immediately capped and placed onto an aluminum freezing block held at -80° C via dry ice to freeze.
• the frozen capsules were in turn over-capsulated with size 00 DRcaps to enhance capsule stability, labeled, and placed into ⁇ -65° C storage immediately.
• the final product was stored at ⁇ -65° C until the day and time of use. Encapsulated product may be stored for indefinitely at ⁇ -65° C. On the day of dosing capsules were warmed on wet ice for 1 to 2 hours to improve tolerability, and were then dosed with water ad libitium.
• Patient 1 is a 45-year old woman with a history of C. difficile infection and diarrhea for at least 1 year prior to treatment. She has been previously treated with multiple courses of antibiotics followed each time by recurrence of C. difficile- associated diarrhea.
• Patient 2 is an 81 -year old female who has experienced recurrent C.
• compositions e.g. vegetative cells, spore preparations, and combinations thereof.
• Microbiological Media 4th ed, ASM Press, 2010
• yeast extract for example, hemin, cysteine, and carbohydrates (for example, maltose, cellobiose, soluble starch) or other media described previously (e.g. see example AAAE).
• the culture was centrifuged at 10,000 x g for 5 min to pellet the bacteria, the spent culture media was removed, and the bacteria were resuspended in sterile PBS. Sterile 75% glycerol was added to a final concentration of 20%. An aliquot of glycerol stock was titered by serial dilution and plating. The remainder of the stock was frozen on dry ice for 10-15 min and then placed at -80C for long term storage.
• Cell banks (RCBs) of bacterial strains were prepared as follows. Bacterial strains were struck from -80°C frozen glycerol stocks to Brucella blood agar with Hemin or Vitamin K (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010), M2GSC (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) or other solid growth media and incubated for 24 to 48 h at 37°C in an anaerobic chamber with a gas mixture of H 2 :CO2:N 2 of 10:10:80.
• Single colonies were then picked and used to inoculate 250 ml to 1 L of Wilkins-Chalgren broth, Brain-Heart Infusion broth, M2GSC broth or other growth media, and grown to mid to late exponential phase or into the stationary phase of growth.
• the single colonies may be used to inoculate a pilot culture of 10 ml, which were then used to inoculate a large volume culture.
• the growth media and the growth phase at harvest were selected to enhance cell titer, sporulation (if desired) and phenotypes that might be associated desired in vitro or in vivo.
• Cultures were grown static or shaking, depending which yielded maximal cell titer.
• the cultures were then concentrated 10 fold or more by centrifugation at 5000 rpm for 20 min, and resuspended in sterile phosphate buffered saline (PBS) plus 15% glycerol. 1 ml aliquots were transferred into 1 .8 ml cryovials which were then frozen on dry ice and stored at -80C.
• the identity of a given cell bank was confirmed by PCR amplification of the 16S rDNA gene, followed by Sanger direct cycle sequencing, and comparison to a curated rDNA database to determine a taxonomic ID. Each bank was confirmed to yield colonies of a single morphology upon streaking to Brucella blood agar or M2GSC agar.
• colonies were confirmed to be the expected species by PCR and sequencing analysis of the 16S rDNA gene.
• Variant colony morphologies can be observed within pure cultures, and in a variety of bacteria the mechanisms of varying colony morphologies have been well described (van der Woude, Clinical Microbiology Reviews, 17:518, 2004), including in Clostridium species (Wadsworth-KTL Anaerobic Bacteriology Manual, 6th Ed, Jousimie-Somer, et al 2002).
• RCBs were confirmed to lack aerobic colony forming units at a limit of detection of 10 cfu/ml.
• the number of viable cells per ml was determined on the freshly harvested, washed and concentrated culture by plating serial dilutions of the RCB to Brucella blood agar or other solid media, and varied from 10 6 to 10 10 cfu/ml.
• the impact of freezing on viability was determined by titering the banks after one or two freeze-thaw cycles on dry ice or at -80°C, followed by thawing in an anaerobic chamber at room temperature. Some strains displayed a 1 -3 log drop in viable cfu/ml after the 1 st and/or 2nd freeze thaw, while the viability of others were unaffected.
• strains were typically thawed on ice and combined in an anaerobic chamber to create mixtures, followed by a second freeze at -80°C to preserve the mixed samples.
• the cfu in the final mixture was estimated based on the second freeze- thaw titer of the individual strains.
• strains may be combined at equal counts in order to deliver between 1 e4 and 1 e10 per strain. Additionally, some bacteria may not grow to sufficient titer to yield cell banks that allowed the production of compositions where all bacteria were present at 1 e10.
• Fresh gut microbiome samples e.g. fecal samples were obtained from healthy human donors who have been screened for general good health and for the absence of infectious diseases, and meet inclusion and exclusion criteria, inclusion criteria include being in good general health, without significant medical history, physical examination findings, or clinical laboratory abnormalities, regular bowel movements with stool appearance typically Type 2, 3, 4, 5 or 6 on the Bristol Stool Scale, and having a BMI > 18 kg/m 2 and ⁇ 25 kg/m 2 .
• Exclusion criteria generally included significant chronic or acute medical conditions including renal, hepatic, pulmonary, gastrointestinal, cardiovascular, genitourinary, endocrine, immunologic, metabolic, neurologic or hematological disease, a family history of, inflammatory bowel disease including Crohn's disease and ulcerative colitis, Irritable bowel syndrome, colon, stomach or other gastrointestinal malignancies, or gastrointestinal polyposis syndromes, or recent use of yogurt or commercial probiotic materials in which an organism(s) is a primary component. Samples were collected directly using a commode specimen collection system, which contains a plastic support placed on the toilet seat and a collection container that rests on the support. Gut microbiome samples e.g.
• feces were deposited into the container, and the lid was then placed on the container and sealed tightly. The sample was then delivered on ice within 1 -4 hours for processing. Samples were mixed with a sterile disposable tool, and 2-4 g aliquots were weighed and placed into tubes and flash frozen in a dry ice/ethanol bath. Aliquots are frozen at -80 degrees Celsius until use.
• the microbiome sample was suspended in a solution, and/or fibrous and/or particulate materials were removed.
• a frozen aliquot containing a known weight of sample was removed from storage at -80 degrees Celsius and allowed to thaw at room temperature.
• Sterile 1 x PBS was added to create a 10% w/v suspension, and vigorous vortexing was performed to suspend the sample until the material appeared homogeneous.
• the sample was then left to sit for 10 minutes at room temperature to sediment fibrous and particulate matter.
• the suspension above the sediment was then carefully removed into a new tube and contains a purified spore population.
• the suspension was then centrifuged at a low speed, e.g., 1000 x g, for 5 minutes to pellet particulate matter including fibers.
• the pellet was discarded and the supernatant, which contained vegetative organisms and spores, was removed into a new tube.
• the supernatant was then centrifuged at 6000 x g for 10 minutes to pellet the vegetative organisms and spores.
• the pellet was then resuspended in 1 x PBS with vigorous vortexing until the sample material appears homogenous.
• Example 15 Bacterial Compositions Populating the Gut in a Mouse Model
• Example 13 Compositions were pre-made under anaerobic conditions and suspended in PBS + 15% glycerol and stored at > -70°C prior to use.
• mice (10 females/group; 5 per cage) were pre-treated on Days - 14 to -5 with an antibiotic cocktail consisting of 10% glucose, kanamycin (0.5 mg/ml), gentamicin (0.044 mg/ml), colistin (1062.5 U/ml), metronidazole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), ampicillin (0.1 mg/ml) and vancomycin (0.056 mg/ml) in their drinking water. On Day -3 they received 10 mg/kg Clindamycin by oral gavage. On Day -1 , they were dosed with a microbial compositions by oral gavage in a volume of 0.2 ml_ (Table 6).
• Microbial compositions comprised approximately equal numbers of each OTU and were dosed at approximately 1 x10 9 , 1x10 8 and 1 x10 7 per OTU for each composition (e.g. microbial composition 1 , comprising 15 strains, was dosed at approximately 1 .5x10 10 , 1 .5x10 9 , and 1 .5x10 8 total CFU).
• Fecal samples were collected from each cage on Day -1 (approximately 1 hour before dosing) and on Days 2, 3 and 4 post-dosing. Feces were stored frozen prior to processing and sequencing. Weight gain of mice treated with either microbial compositions was similar to that of naive, control mice.
• Fecal samples were processed by isolating and sequencing DNA according to Examples 2 and 3.
• the OTU assignment of fecal samples from Days - 1 , 2, 3 and 4 was determined by analyzing 16S-V4 sequence reads and assigning OTUs as described in Example 2. Clades were assigned as described in Example 2. Total read counts were determined for each OTU or each clade by summing the results from cages of the same experimental group. Samples with 10 or fewer sequence reads for a given OTU or clade were considered to be below background and were not included in the summation process. Results are shown by OTU (Table 7) and by clade (Table 8).
• composition 2 Co. aerofaciens is detected transiently on Day 2 in the 1 x10 8 and 1 x10 7 dose groups; E. rectale in the same experimental groups is detected on Day 3, suggesting a possible relationship between transient population by Co. aerofaciens followed by E. rectale in these groups of mice.
• a striking observation is that the observed population of OTU sequence reads is not highly dose dependent. Overall, the data is consistent with a model whereby OTUs populate rapidly following oral administration.
• mice challenged in parallel with C. difficile were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile animals were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile animals were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile animals were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile animals were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile animals were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile animals were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile animals were significantly protected as shown in Table 9.
• mice challenged in parallel with C. difficile animals were significantly protected as
• Methods to assess spore concentration in complex mixtures typically require the separation and selection of spores and subsequent growth of individual species to determine the colony forming units.
• the art does not teach how to quantitatively germinate all the spores in a complex mixture as there are many species for which appropriate germinants have not been identified.
• sporulation is thought to be a stochastic process as a result of evolutionary selection, meaning that not all spores from a single species germinate with same response to germinant concentration, time and other environmental conditions.
• DPA dipicolinic acid
• the assay utilizes the fact that DPA chelates Terbium 3+ to form a luminescent complex (Fichtel et al, FEMS Microbiology Ecology, 2007; Kort et al, Applied and Environmental Microbiology, 2005; Shafaat and Ponce, Applied and Environmental Microbiology, 2006; Yang and Ponce, International Journal of Food Microbiology, 2009; Hindle and Hall, Analyst, 1999).
• a time-resolved fluorescence assay detects terbium luminescence in the presence of DPA giving a quantitative measurement of DPA concentration in a solution.
• spore content varies greatly per 30 capsules. As measured by germinable SCFU, spore content varies by greater than 10,000-fold. As measured by DPA, spore content varies by greater than 100-fold. In the absence of the DPA assay, it would be difficult to set a minimum dose for administration to a patient. For instance, without data from the DPA assay, one would conclude that a minimum effective dose of spores is 4 x 10 5 or less using the SCFU assay (e.g. Preparation 1 , See Table 10 below). If that SCFU dose was used to normalize dosing in a clinical setting, however, then the actual spore doses given to patients would be much lower for other ethanol treated spore preparations as measured as by the DPA assay (See Table 1 1 below).
• spores from three different donors were germinated by various treatments and plated on various media. Germination with BHIS/oxgall (BHIS ox), Ca-DPA, rumen fluid (RF), simulated gastric fluid (SGF), mucin medium (Muc), fetal bovine serum (FBS), or thioglycollate (Thi) for 1 hour at 37C in anaerobic conditions was performed as described previously (e.g. see Examples 4 and 5) with samples derived from two independent donors ( Figure 8).
• BHIS/oxgall BHIS ox
• Ca-DPA rumen fluid
• RF rumen fluid
• SGF simulated gastric fluid
• Muc mucin medium
• FBS fetal bovine serum
• Thi thioglycollate
• the spore-germinant mixture was serially diluted and plated on different plate media including BBA, Sweet B, Sweet B + lysozyme (2ug/ml), M2GSC and M2GSC + lysozyme (2ug/ml) as previously described (e.g. see Examples 4 and 5) to determine spore germination.
• Colony forming units were tallied and titers were determined using standard techniques by one skilled in the art. As Figure 8 shows, maximum colony forming units are derived from BHI-oxgall treatment. This germination treatment also greatly increases the diversity as measured by the number of OTUs identified when samples were submitted for 16S sequencing (e.g. see Examples 2 and 3) compared to plating without a germination step ( Figure 9).
• Figure 8 shows liferent germinant treatments have variable effects on CFU counts from donor A (upper left) and donor B (lower right).
• the Y-Axes are spore CFU per ml.
• Figure 9 shows germinates greatly increase the diversity of cultured spore forming OTUs.
• Lysozyme addition to the plates (2ug/ml) was also tested on a single donor sample by the testing of various activation temperature followed by an incubation in the presence or absence of lysozyme.
• the addition of lysozyme had a small effect when plated on Sweet B or M2GSC media but less so than treatment with BHIS oxgall without lysozyme for 1 hr ( Figure 1 1 ).
• Figure 10 shows heat activation as a germination treatment with BHIS+oxgall.
• FIG. 1 1 shows the effect of lysozyme slightly enhances germination
• Germination time was also tested by treating a 10% suspension of a single donor ethanol treated feces (e.g. see Example AAAF) incubated in either BHIS, taurocholate, oxgall, or germix for 0, 15, 30, or 60 minutes and subsequently plated on BHIS, EYA, or BBA media (e.g. see Examples AAAD and AAAE). 60 minutes resulted in the most CFU units across all various combinations germinates and plate media tested.
• this protocol and germination treatment can be applied to mixtures of bacteria and spore forming species to enrich the population of spore- forming bacterial growth. In this manner, spore formers growth can be enhanced in a mixed population by addition of a germinate or germination treatment step as described above.
• the in vitro assay is a high-throughput assay designed to screen for combinations of microbes that inhibit the growth of a pathogen or pathobiont.
• Feces from a human donor is resuspended 10% w/v in pre-reduced PBS under anaerobic conditions and then is pelleted in an Eppendorf Centrifuge 581 OR, Rotor F34-6-38 at 8,500 rpm (9289 rcf) for 5 min to remove cells and particulates.
• the supernatant is then filter-sterilized using a 0.22 ⁇ filter to produce the background media for in vitro competitions.
• the 10% sterile-filtered feces media is then added in 178 ⁇ _ aliquots to wells of a 96-well plate. 20 ⁇ _ of candidate bacterial strains or
• the in vitro assay plate is then incubated anaerobically at 37°C for 3 hr. before inoculation of Clostridium difficile ATCC 9689.
• the C. difficile inoculum is prepared by inoculating 5 ml_ BHI (Brain Heart Infusion Broth) and incubating 37°C for 18 hr.
• the overnight culture is then diluted 100 fold in PBS before inoculating 2 ⁇ _ into each well to produce a final dilution of 10,000 fold from the overnight culture.
• In vitro assay plates are then incubated anaerobically for 24 hr. before assaying for viable counts of C. difficile by plating serial dilutions on C. difficile selective agar plates with cycloserine cefoxitin mannitol agar (CCMA).
• CCMA cycloserine cefoxitin mannitol agar
• Colonies of C. difficile are confirmed by their characteristic diffuse colony edge morphology as well as fluorescence under UV light.
• the standard curve is generated from wells containing pathogenic C. difficile grown in 10% sterile-filtered feces media from Example 2 by selective spot plating. Serial dilutions of duplicate cultures are performed in sterile phosphate- buffered saline. Genomic DNA is then extracted from the standard curve samples along with the other wells.
• Genomic DNA can be extracted from 50 ⁇ of each sample using the Mo Bio Powersoil ® -htp 96 Well Soil DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA) according to the manufacturer's instructions with two exceptions: the bead beating is performed for 2 x 4:40 minutes using a BioSpec Mini-Beadbeater-96 (BioSpec Products, Bartlesville, OK) and the DNA is eluted in 50 ⁇ of Solution C6.
• genomic DNA could be isolated using the Mo Bio Powersoil ® DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA) or the QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions.
• the qPCR contains 1x HotMasterMix (5PRIME, Gaithersburg, MD), 900 nM of Wr-tcdB-F (AGCAGTTGAATATAGTGGTTTAGTTAGAGTTG, IDT, Coralville, IA), 900 nM of Wr-tcdB-R (CATGCTTTTTTAGTTTCTGGATTGAA, IDT, Coralville, IA), 250 nM of We-tcdB-P (6FAM-CATCCAGTCTCAATTGTATATGTTTCTCCA- MGB, Life Technologies, Grand Island, NY), and PCR Water (Mo Bio Laboratories, Carlsbad, CA) to 18 ⁇ (Primers adapted from: Wroblewski, D.
• This reaction mixture is aliquoted to wells of a MicroAmp ® Fast Optical 96-well Reaction Plate with Barcode (0.1 mL) (Life Technologies, Grand Island, NY). To this reaction mixture, 2 ⁇ of extracted genomic DNA is added. The qPCR is performed on a BioRad C1000TM Thermal Cycler equipped with a CFX96TM Real-Time System (BioRad, Hercules, CA). The thermocycling conditions are 95°C for 2 minutes followed by 45 cycles of 95°C for 3 seconds, 60°C for 30 seconds, and fluorescent readings of the FAM and ROX channels.
• the logio(cfu/ml) of each experimental sample is calculated by inputting a given sample's Cq value into linear regression model generated from the standard curve comparing the Cq values of the standard curve wells to the known logio(cfu/ml) of those samples.
• Example 20 Construction of an In Vitro Assay to Screen for
• the in vitro assay is used to screen for combinations of bacteria inhibitory to the growth of E. coli by modifying the media used for growth of the pathogen inoculum.
• One of several choices of media is used for growth of the pathogen such as Reinforced Clostridial Media (RCM), Brain Heart Infusion Broth (BHI) or Luria
• E. coli is quantified by using alternative selective media specific for E. coli or using qPCR probes specific for the pathogen. For example, aerobic growth on MacConkey lactose medium selects for enteric Gram negatives, including E. coli. qPCR is conducted using probes specific for the Shiga toxin of pathogenic E. coli.
• Example 21 Construction of an In Vitro Assay to Screen for
• VRE Vancomvcin- Resistant Enterococcus
• VRE Vancomycin-Resistant Enterococcus spp.
• RCM Reinforced Clostridial Media
• BHI Brain Heart Infusion Broth
• LB Luria Bertani Broth
• VRE is quantified by using alternative selective media specific for VRE or using qPCR probes specific for the pathogen. For example, m-Enterococcus agar containing sodium azide is selective for Enterococcus spp. and a small number of other species. Probes specific to the van genes conferring vancomycin resistance are used in the qPCR.
• Example 22 Prophylactic Use and Treatment In a Mouse Model of Vancomycin Resistant Enterococcus (VRE) colonization
• VRE infection mouse model is used as previously described (Ubeda et al, Infectious Immunity 2013, Ubeda et al, Journal of clinical investigation, 2010). Briefly, experiments are done with 7-week-old C57BL/6J female mice purchased from Jackson Laboratory, housed with irradiated food, and provided with acidified water. Mice are individually housed to avoid contamination between mice due to coprophagia. For experimental infections with VRE, mice are treated with ampicillin (0.5 g/liter) in their drinking water, which is changed every 3 days.
• mice are infected by means of oral gavage with 10 8 CFU of the vancomycin-resistant Enterococcus faecium strain purchased from ATCC (ATCC 700221 ).
• 10 8 CFU the vancomycin-resistant Enterococcus faecium strain purchased from ATCC (ATCC 700221 ).
• antibiotic treatment is stopped and VRE levels are determined at different time points by plating serial dilutions of fecal pellets on Enterococcosel agar plates (Difco) with vancomycin (8 ug/ml; Sigma).
• VRE colonies are identified by appearance and confirmed by Gram staining or other methods previously described (e.g. see
• PCR of the vanA gene which confers resistance to vancomycin, confirms the presence of VRE in infected mice.
• the bacterial composition test article such as but not limited to an ethanol treated, gradient purified spore preparation (as described herein), fecal suspension, or antibiotic treatment is delivered in PBS on days 1 -3 while the negative control contains only PBS and is also delivered on days 1 -3 by oral gavage.
• Fresh fecal stool pellets are obtained daily for the duration of the experiment from days -7 to day 10. The samples are immediately frozen and stored at -80°C. DNA was extracted using standard techniques and analyzed with 16S or comparable methods (e.g. see Examples 2 and 3).
• Example 23 Prophylactic Use and Treatment of a Mouse model of Carbapenem resistant klebsiella (CRKB) Colonization
• KPC K. pneumoniae carbapenemase
• KPC-Kp Klebsiella
• MDR multidrug-resistant organisms
• a treatment protocol in a mouse model as previously described e.g. Perez et al, Antimicrobial Agents Chemotherapy, 201 1 ) is used to evaluate the bacterial composition (test article) for treating carbapenem resistant Klebsiella and reducing carriage in the Gl tract.
• mice Female CF1 mice (Harlan Sprague-Dawley, Indianapolis, IN) are used and are individually housed and weighed between 25 and 30 g. [0317] The thoroughly characterized strain of K. pneumoniae, VA-367 (8, 9, 25) is used in this study. This clinical isolate is genetically related to the KPC-Kp strain circulating in the Eastern United States. Characterization of the resistance
• mice (10 per group) are assigned to either a bacterial composition (test article), ethanol treated, spore preparation (e.g. see Example 6), antibiotic
• Stool samples (100 mg diluted in 800 ml of PBS) are plated onto MacConkey agar with and without 0.5 ug/ml of imipenem, and the number of CFU per gram of stool was determined.
• Other methods may be used to measure the levels of carbapenem-resistant K. pneumoniae e.g. per, antigen testing, as one who's skilled in the art could perform.
• mice are treated with subcutaneous clindamycin to reduce the normal intestinal flora 1 day before receiving 10 4 CFU of KPC-Kp VA-367 by oral gavage, and the mice continued to receive subcutaneous clindamycin every other day for 7 days. Concurrently, for 7 days after oral gavage with KPC-Kp, mice received oral gavage of normal saline (control group), or the bacterial composition as specified. An additional dose of subcutaneous clindamycin was administered 20 days after the administration of KPC-Kp VA-367 to assess whether low levels of carbapenem- resistant K. pneumoniae were present that could be augmented by the elimination of the anaerobic microflora. Stool samples were collected at baseline and at 3, 6, 8, 1 1 , 16, and 21 days after KPC-Kp VA-367 was given by gavage. The bacterial composition will be examined by the reduction of CRKB in feces.
• the human body is an ecosystem in which the microbiota, and the microbiome, play a significant role in the basic healthy function of human systems (e.g. metabolic, immunological, and neurological).
• the microbiota and resulting microbiome comprise an ecology of microorganisms that co-exist within single subjects interacting with one another and their host (i.e., the mammalian subject) to form a dynamic unit with inherent biodiversity and functional characteristics.
• these networks of interacting microbes i.e. ecologies
• particular members can contribute more significantly than others; as such these members are also found in many different ecologies, and the loss of these microbes from the ecology can have a significant impact on the functional capabilities of the specific ecology.
• Keystone OTUs and/or Functions are computationally-derived by analysis of network ecologies elucidated from a defined set of samples that share a specific phenotype. Keystone OTUs and/or Functions are defined as all Nodes within a defined set of networks that meet two or more of the following criteria. Using
• Criterion 1 the node is frequently observed in networks, and the networks in which the node is observed are found in a large number of individual subjects; the frequency of occurrence of these Nodes in networks and the pervasiveness of the networks in individuals indicates these Nodes perform an important biological function in many individuals.
• Criterion 2 the node is frequently observed in networks, and each the networks in which the node is observed contain a large number of Nodes - these Nodes are thus "super-connectors", meaning that they form a nucleus of a majority of networks and as such have high biological significance with respect to their functional contributions to a given ecology.
• the node is found in networks containing a large number of Nodes (i.e. they are large networks), and the networks in which the node is found occur in a large number of subjects; these networks are potentially of high interest as it is unlikely that large networks occurring in many individuals would occur by chance alone strongly suggesting biological relevance.
• the required thresholds for the frequency at which a node is observed in network ecologies, the frequency at which a given network is observed across subject samples, and the size of a given network to be considered a Keystone node are defined by the 50th, 70th, 80th, or
• the required thresholds are defined by the value for a given variable that is significantly different from the mean or median value for a given variable using standard parametric or non-parametric measures of statistical significance.
• a threshold value for a given variable that is significantly different from the mean or median value for a given variable using standard parametric or non-parametric measures of statistical significance.
• Keystone node is defined as one that occurs in a sample phenotype of interest such as but not limited to "health” and simultaneously does not occur in a sample phenotype that is not of interest such as but not limited to "disease.”
• a sample phenotype of interest such as but not limited to "health”
• a sample phenotype that is not of interest such as but not limited to "disease.”
• Keystone Node is defined as one that is shown to be significantly different from what is observed using permuted test datasets to measure significance.
• Example 25 Microbial Population (Engraftment and Augmentation) and Reduction of Pathogen Carriage in Patients Treated with Spore
• pretreatment with an ethanol treated spore preparation and up to 25 days after receiving treatment.
• a bacterial composition in the vegetative state, or a mixture of vegetative bacteria and bacterial spores.
• the treatment of patient 1 with an ethanol treated spore preparation led to microbial population via the engraftment of OTUs from the spore treatment and augmentation in the microbiome of the patient ( Figure 12 and Figure 13).
• Table 12 shows bacterial OTUs associated with engraftment and ecological augmentation and establishment of a more diverse microbial ecology in patients treated with an ethanol treated spore preparation.
• OTUs that comprise an augmented ecology are not present in the patient prior to treatment and/or exist at extremely low frequencies such that they do not comprise a significant fraction of the total microbial carriage and are not detectable by genomic and/or microbiological assay methods.
• OTUs that are members of the engrafting and augmented ecologies were identified by characterizing the OTUs that increase in their relative abundance post treatment and that respectively are: (i) present in the ethanol treated spore preparation and absent in the patient pretreatment (engrafting OTUs), or (ii) absent in the ethanol treated spore preparation, but increase in their relative abundance through time post treatment with the preparation due to the formation of favorable growth conditions by the treatment (augmenting OTUs).
• the latter OTUs can grow from low frequency reservoirs in the patient, or be introduced from exogenous sources such as diet.
• OTUs that comprise a "core" augmented or engrafted ecology can be defined by the percentage of total patients in which they are observed to engraft and/or augment; the greater this percentage the more likely they are to be part of a core ecology responsible for catalyzing a shift away from a dysbiotic ecology.
• the dominant OTUs in an ecology can be identified using several methods including but not limited to defining the OTUs that have the greatest relative abundance in either the augmented or engrafted ecologies and defining a total relative abundance threshold.
• the dominant OTUs in the augmented ecology of Patient-1 were identified by defining the OTUs with the greatest relative abundance, which together comprise 60% of the microbial carriage in this patient's augmented ecology.
• Figure 12 shows the microbial diversity measured in the ethanol treated spore treatment sample and patient pre- and post-treatment samples.
• Total microbial diversity is defined using the Chaol Alpha-Diversity Index and is measured at different genomic sampling depths to confirm adequate sequence coverage to assay the microbiome in the target samples.
• the patient pretreatment harbored a microbiome that was significantly reduced in total diversity as compared to the ethanol treated spore treatment (red) and patient post treatment at days 5 (blue), 14 (orange), and 25 (green).
• Figure 13 shows patient microbial ecology is shifted by treatment with an ethanol treated spore treatment from a dysbiotic state to a state of health.
• Principle Coordinates Analysis based on the total diversity and structure of the microbiome (Bray-Curtis Beta-Diversity) of the patient pre- and post-treatment delineates that the engraftment of OTUs from the spore treatment and the augmentation of the patient microbial ecology leads to a microbial ecology that is distinct from both the pretreatment microbiome and the ecology of the ethanol treated spore treatment (Table 12).
• Figure 14 shows the augmentation of Bacteroides species in patients. Comparing the number of Bacteroides fragilis groups species per cfu/g of feces pretreatment and in week 4 post treatment reveals an increase of 4 logs or greater.
• the ability of 16S-V4 OTU identification to assign an OTU as a specific species depends in part on the resolution of the 16S-V4 region of the 16S gene for a particular species or group of species. Both the density of available reference 16S sequences for different regions of the tree as well as the inherent variability in the 16S gene between different species will determine the definitiveness of a taxonomic annotation to a given sequence read. Given the topological nature of a phylogenetic tree and that the tree represents hierarchical relationships of OTUs to one another based on their sequence similarity and an underlying evolutionary model, taxonomic
• annotations of a read can be rolled up to a higher level using a clade-based assignment procedure (Table 1 ).
• Table 1 clade-based assignment procedure
• Clades are constructed to ensure that all OTUs in a given clade are: (i) within a specified number of bootstrap supported nodes from one another (generally, 1 -5 bootstraps), and (ii) within a 5% genetic similarity.
• OTUs that are within the same clade can be distinguished as genetically and phylogenetically distinct from OTUs in a different clade based on 16S-V4 sequence data.
• OTUs falling within the same clade are evolutionarily closely related and may or may not be distinguishable from one another using 16S-V4 sequence data.
• compositions substituting one species with another from the same clade are likely to have conserved ecological function and therefore are useful in the present invention.
• Klebsiella is a resident of the human microbiome in only about 2% of subjects based on an analysis of HMP database (www.hmpdacc.org), and the mean relative abundance of
• Klebsiella is only about 0.09% in the stool of these people. Its surprising presence at 20% relative abundance in Patient 1 before treatment is an indicator of a
• Fusobacterium F. nucleatum (an OTU phylogenetically indistinguishable from Fusobacterium sp. 3_1_33 based on 16S-V4), has been termed "an emerging gut pathogen" based on its association with IBD, Crohn's disease, and colorectal cancer in humans and its demonstrated causative role in the development of colorectal cancer in animal models [Allen-Vercoe, Gut Microbes (201 1 ) 2:294-8]. Importantly, neither Klebsiella nor Fusobacterium was detected in the 16S-V4 reads by Day 25 (Table 13).
• Klebsiella spp. carriage is consistent across multiple patients.
• Four separate patients were evaluated for the presence of Klebsiella spp. pre treatment and 4 weeks post treatment.
• Klebsiella spp. were detected by growth on selective Simmons Citrate Inositol media as previously described.
• the genus Bacteroides is an important member of the gastrointestinal microbiota; 100% of stool samples from the Human Microbiome Project contain at least one species of Bacteroides with total relative abundance in these samples ranging from 0.96% to 93.92% with a median relative abundance of 52.67% (www.hmpdacc.orQ reference data set HMSMCP). Bacteroides in the gut has been associated with amino acid fermentation and degradation of complex
• the highly selective BBE agar had a limit of detection of ⁇ 2x10 3 cfu/g, while the limit of detection for Bacteroides on PFA agar was approximately 2x10 7 cfu/g due to the growth of multiple non-Bacteroides species in the pretreatment sample on that medium. Colony counts of Bacteroides species on Day 25 were up to 2x10 10 cfu/g, consistent with the 16S-V4 sequencing, demonstrating a profound reconstitution of the gut microbiota in Patient 1 (Table 15 below).
• Augmentation is an important phenomenon in that it shows the ability to use an ethanol treated spore ecology or other bacterial composition to restore a healthy microbiota by seeding a diverse array or commensal organisms beyond the actual component organisms in the bacterial composition such as but not limited to an ethanol treated spore population itself; specifically the spore composition treatment itself and the engraftment of OTUs from the spore composition create a niche that enables the outgrowth of OTUs required to shift a dysbiotic microbiome to a microbial ecology that is associated with health.
• Figure 15 shows species engrafting versus species augmenting in patients microbiomes after treatment with a bacterial composition such as but not limited to an ethanol-treated spore population. Relative abundance of species that engrafted or augmented as described were determined based on the number of 16S sequence reads. Each plot is from a different patient treated with the bacterial composition such as but not limited to an ethanol-treated spore population for recurrent C.
• Enterobacteriaceae was assessed by plating pretreatment and Day 28 clinical samples from Patients 2, 4 and 5 on MacConkey lactose plus 1 ug/mL of imipenem. Resistant organisms were scored by morphology, enumerated and DNA was submitted for full length 16S rDNA sequencing as described above. Isolates were identified as Morganella morganii, Providencia rettgeri and Proteus pennerii. Each of these are gut commensal organisms; overgrowth can lead to bacteremia and/or urinary tract infections requiring aggressive antibiotic treatment and, in some cases, hospitalization [Kim, B-N, et al Scan J.
• Example 6 Ten different bacterial compositions were made by the ethanol treated spore preparation methods from 6 different donors (as described in Example 6). The spore preparations were used to treat 10 patients, each suffering from recurrent C. difficile infection. Patients were identified using the inclusion/exclusion criteria described in Example 9, and donors were identified using the criteria described in Example 10. None of the patients experienced a relapse of C. difficile in the 4 weeks of follow up after treatment, whereas the literature would predict that 70-80% of subjects would experience a relapse following cessation of antibiotic [Van Nood, et al, NEJM (2013)]. Thus, the ethanol treated spore preparations derived from multiple different donors and donations showed remarkable clinical efficacy.
• ethanol treated spore preparations are a subset of the bacterial compositions described herein and the results should not be viewed as a limitation on the scope of the broader set of bacterial compositions.
• the OTU composition of the spore preparation was determined by 16S-V4 rDNA sequencing and computational assignment of OTUs per Example 2. A requirement to detect at least ten sequence reads in the ethanol treated spore preparation was set as a conservative threshold to define only OTUs that were highly unlikely to arise from errors during amplification or sequencing. Methods routinely employed by those familiar to the art of genomic-based
• microbiome characterization use a read relative abundance threshold of 0.005% (see e.g. Bokulich, A. et al. 2013. Quality-filtering vastly improves diversity estimates from lllumina amplicon sequencing. Nature Methods 10: 57-59), which would equate to >2 reads given the sequencing depth obtained for the samples analyzed in this example, as cut-off which is substantially lower than the >10 reads used in this analysis. All taxonomic and clade assignments were made for each OTU as described in Example 3. The resulting list of OTUs, clade assignments, and frequency of detection in the spore preparations are shown in Table 18.
• Table 18 shows OTUs detected by a minimum of ten 16S-V4 sequence reads in at least a one ethanol treated spore preparation (pan-microbiome). OTUs that engraft in a treated patients and the percentage of patients in which they engraft are denoted, as are the clades, spore forming status, and Keystone OTU status. Starred OTUs occur in >80% of the ethanol preps and engraft in >50% of the treated patients.
• OTUs that represent non-viable cells or contaminating sequences eliminates OTUs that represent non-viable cells or contaminating sequences.
• Table 18 also identifies all OTUs detected in the bacterial composition that also were shown to engraft in at least one patient post-treatment. OTUs that are present in a large percentage of the bacterial composition e.g. ethanol spore preparations analyzed and that engraft in a large number of patients represent a subset of the Core Ecology that are highly likely to catalyze the shift from a dysbiotic disease ecology to a healthy microbiome.
• a third lens was applied to further refine insights into the Core Ecology of the bacterial composition e.g. spore preparation.
• Computational-based, network analysis has enabled the description of microbial ecologies that are present in the microbiota of a broad population of healthy individuals. These network ecologies are comprised of multiple OTUs, some of which are defined as Keystone OTUs.
• Keystone OTUs are computationally defined as described in Example 24. Keystone OTUs form a foundation to the microbially ecologies in that they are found and as such are central to the function of network ecologies in healthy subjects. Keystone OTUs associated with microbial ecologies associated with healthy subjects are often are missing or exist at reduced levels in subjects with disease. Keystone OTUs may exist in low, moderate, or high abundance in subjects. Table 18 further notes which of the OTUs in the bacterial composition e.g. spore preparation are Keystone OTUs exclusively associated with individuals that are healthy and do not harbor disease. [0343] There are several important findings from this data. A relatively small number of species, 16 in total, are detected in all of the spore preparations from 6 donors and 10 donations. This is surprising because the HMP database
• CES Core Ecology Score
• the CES has a maximum possible score of 5 and a minimum possible score of 0.8.
• an OTU found in 8 of the 10 bacterial composition such as but not limited to a spore preparations that engrafted in 3 patients and was a Keystone OTU would be assigned the follow CES:
• Table 19 ranks the top 20 OTUs by CES with the further requirement that an OTU must be shown to engraft to be a considered an element of a core ecology.
• Another aspect of functional redundancy is that evolutionarily related organisms (i.e. those close to one another on the phylogenetic tree, e.g. those grouped into a single clade) will also be effective substitutes in the Core Ecology or a subset thereof for treating C. difficile.
• OTU subsets for testing in vitro (e.g. see Example 28 below) or in vivo (e.g. see Examples 7 or 8) is straightforward. Subsets may be selected by picking any 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 OTUs from Table 18, with a particular emphasis on those with higher CES, such as the OTUs described Table 19. In addition, using the clade
• OTUs can be selected as substitutes for OTUs with acceptable CES values.
• These organisms can be cultured anaerobically in vitro using the appropriate media (selected from those described in Example 5 above), and then combined in a desired ratio.
• a typical experiment in the mouse C. difficile model utilizes at least 10 4 and preferably at least 10 5 , 10 6 , 10 7 , 10 8 , 10 9 or more than 10 9 colony forming units of a each microbe in the composition. Variations in the culture yields may sometimes mean that organisms are combined in unequal ratios, e.g. 1 :10, 1 :100, 1 :1 ,000, 1 :10,000, 1 :100,000, or greater than 1 :100,000.
• each strain be provided in a minimum amount so that the strain's contribution to the efficacy of the Core Ecology subset can be measured.
• Table 18 describes the clades for each OTU detected in a spore preparation and Table 1 describes the OTUs that can be used for substitutions based on clade relationships.
• mice Two cages of five mice each were tested for each arm of the experiment. All mice received an antibiotic cocktail consisting of 10% glucose, kanamycin (0.5 mg/ml), gentamicin (0.044 mg/ml), colistin (1062.5 U/ml), metronidazole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), ampicillin (0.1 mg/ml) and Vancomycin (0.056 mg/ml) in their drinking water on days -14 through -5 and a dose of 10mg/kg
• Clindamycin by oral gavage on day -3 On day -1 , they received either the test articles or control articles via oral gavage. On day 0, they were challenged by administration of approximately 4.5 Iog10 cfu of C. difficile (ATCC 43255) via oral gavage. Mortality was assessed every day from day 0 to day 6 and the weight and subsequent weight change of the animal was assessed with weight loss being associated with C. difficile infection. Mortality and reduced weight loss of the test article compared to the empty vehicle was used to assess the success of the test article. Additionally, a C. difficile symptom scoring was performed each day from day -1 through day 6.
• Symptom scoring was based on Appearance (0-2 pts based on normal, hunched, piloerection, or lethargic), Respiration (0-2 pts based on normal, rapid or shallow, with abdominal breathing), Clinical Signs (0-2 points based on normal, wet tail, cold-to-the-touch, or isolation from other animals).
• the average minimum relative weight is calculated as the mean of each mouse's minimum weight relative to Day -1 and the average maximum clinical score is calculated as the mean of each mouse's maximum combined clinical score with a score of 4 assigned in the case of death.
• the results are reported in Table 21 below (Results of bacterial compositions tested in a C. difficile mouse model).
• Example 29 Defining Subsets of the Core Ecology in the in vitro C. difficile Inhibition Assay
• Vials of -80 °C glycerol stock banks were thawed and diluted to 1 e8 CFU/mL. Selected strains and their clade assignment are given in Table 22. Each strain was then diluted 10x (to a final concentration of 1 e7 CFU/mL of each strain) into 200 uL of PBS + 15% glycerol in the wells of a 96-well plate. Plates were then frozen at -80 °C. When needed for the assay, plates were removed from -80 °C and thawed at room temperature under anaerobic conditions when testing in a in vitro C. difficile inhibition assay (CivSim).
• SweetB-Fosln is a complex media composed of brain heart infusion, yeast extract, cysteine, cellobiose, maltose, soluble starch, and fructooligosaccharides/inulin, and hemin, and is buffered with MOPs. After 24 hr of growth the culture is diluted 100,000 fold into a complex media such as SweetB-Fosln which is suitable for the growth of a wide variety of anaerobic bacterial species. The diluted C.
• C. difficile mixture is then aliquoted to wells of a 96-well plate (180 uL to each well). 20 uL of a subset Core Ecology is then added to each well at a final concentration of 1 e6 CFU/mL of each species.
• the assay can be tested each species at different initial concentrations (1 e9 CFU/mL, 1 e8 CFU/mL, 1 e7 CFU/mL, 1 e5 CFU/mL, 1 e4 CFU/mL, 1 e3 CFU/mL, 1 e2 CFU/mL). Control wells only inoculated with C. difficile are included for a comparison to the growth of C. difficile without inhibition.
• Additional wells are used for controls that either inhibit or do not inhibit the growth of C. difficile.
• One example of a positive control that inhibits growth is a combination of Blautia producta, Clostridium bifermentans and Escherichia coli.
• One example of a control that shows reduced inhibition of C. difficile growth is a
• a standard curve is generated from a well on each assay plate containing only pathogenic C. difficile grown in SweetB + Fosln media and quantified by selective spot plating. Serial dilutions of the culture are performed in sterile
• Genomic DNA is extracted from the standard curve samples along with the other wells.
• Genomic DNA is extracted from 5 ⁇ of each sample using a dilution, freeze/thaw, and heat lysis protocol. 5 ⁇ _ of thawed samples is added to 45 ⁇ _ of UltraPure water (Life Technologies, Carlsbad, CA) and mixed by pipetting. The plates with diluted samples are frozen at -20 °C until use for qPCR which includes a heated lysis step prior to amplification.
• genomic DNA is isolated using the Mo Bio Powersoil ® -htp 96 Well Soil DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA), Mo Bio Powersoil ® DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA), or the QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions.
• the qPCR reaction mixture contains 1 x SsoAdvanced Universal Probes Supermix, 900 nM of Wr-tcdB-F primer
• This reaction mixture is aliquoted to wells of a Hard-shell Low-Profile Thin Wall 96-well Skirted PCR Plate (BioRad, Hercules, CA).
• BioRad Hercules, CA
• 2 ⁇ of diluted, frozen, and thawed samples are added and the plate sealed with a Microseal 'B' Adhesive Seal (BioRad, Hercules, CA).
• the qPCR is performed on a BioRad C1000TM Thermal Cycler equipped with a CFX96TM Real- Time System (BioRad, Hercules, CA).
• the thermocycling conditions are 95°C for 15 minutes followed by 45 cycles of 95°C for 5 seconds, 60°C for 30 seconds, and fluorescent readings of the FAM channel.
• the qPCR is performed with other standard methods known to those skilled in the art.
• the Cq value for each well on the FAM channel is determined by the CFX ManagerTM 3.0 software.
• the logio(cfu/mL) of C. difficile each experimental sample is calculated by inputting a given sample's Cq value into a linear regression model generated from the standard curve comparing the Cq values of the standard curve wells to the known logio(cfu/mL) of those samples.
• the log inhibition is calculated for each sample by subtracting the logio(cfu/mL) of C. difficile in the sample from the logio(cfu/mL) of C. difficile in the sample on each assay plate used for the generation of the standard curve that has no additional bacteria added.
• the mean log inhibition is calculated for all replicates for each composition.
• a histogram of the range and standard deviation of each composition is plotted. Ranges or standard deviations of the log inhibitions that are distinct from the overall distribution are examined as possible outliers. If the removal of a single log inhibition datum from one of the binary pairs that is identified in the histograms would bring the range or standard deviation in line with those from the majority of the samples, that datum is removed as an outlier, and the mean log inhibition is recalculated.
• the pooled variance of all samples evaluated in the assay is estimated as the average of the sample variances weighted by the sample's degrees of freedom.
• the pooled standard error is then calculated as the square root of the pooled variance divided by the square root of the number of samples.
• Confidence intervals for the null hypothesis are determined by multiplying the pooled standard error to the z score corresponding to a given percentage threshold. Mean log inhibitions outside the confidence interval are considered to be inhibitory if positive or stimulatory if negative with the percent confidence corresponding to the interval used.
• Ternary combinations with mean log inhibition greater than 0.312 are reported as ++++ (> 99% confidence interval (C.I.) of the null hypothesis), those with mean log inhibition between 0.221 and 0.
• Table 22 below shows OTUs and their clade assignments tested in ternary combinations with results in the in vitro inhibition assayThe CivSim shows that many ternary combinations inhibit C. difficile. 39 of 56 combinations show inhibition with a confidence interval >80%; 36 of 56 with a C.I. > 90%; 36 of 56 with a C.I. > 95%; 29 of 56 with a C.I. of >99%.
• Non-limiting but exemplary ternary combinations include those with mean log reduction greater than 0.171 , e.g. any combination shown in Table 22 with a score of ++++, such as Colinsella aerofaciens, Coprococcus comes, and Blautia producta.
• CivSim assay describes ternary combinations that do not effectively inhibit C. difficile. 5 of 56 combinations promote growth with >80% confidence; 2 of 56 promote growth with >90% confidence; 1 of 56, Coprococcus comes, Clostridium symbiosum and Eubacterium rectale, promote growth with >95% confidence. 12 of 56 combinations are neutral in the assay, meaning they neither promote nor inhibit C. difficile growth to the limit of measurement.
• An in vitro assay is performed to test the ability of a chosen species or combination of species to inhibit the growth of a pathogen such as Clostridium difficile in media that is otherwise suitable for growth of the pathogen.
• a liquid media suitable for growth of the pathogen is chosen, such as Brain Heart Infusion Broth (BHI) for C. difficile (see Example 5).
• BHI Brain Heart Infusion Broth
• the potential competitor species or a combination of competitor species are inoculated into 3 ml_ of the media and incubated anaerobically for 24 hr at 37° C. After incubation the cells are pelleted in a centrifuge at 10,000 rcf for 5 min. Supernatant is removed and filtered through a 0.22 ⁇ filter to remove all cells.
• C. difficile or another pathogen of interest is then inoculated into the filtered spent supernatant and grown anaerobically at 37° C for 24 hr.
• a control culture in fresh media is incubated in parallel.
• the titer of C. difficile is determined by serially diluting and plating to Brucella Blood Agar (BBA) plates and incubated anaerobically for 24 hr at 37° C. Colonies are counted to determine the final titer of the pathogen after incubation in competitor conditioned media and control media. The percent reduction in final titer is calculated and considered inhibitory if a statistically significant reduction in growth is measured. Alternatively, the inhibition of pathogen growth is monitored by OD 6 oo measurement of the test and control cultures.
• Example 30 Testing of Bacterial Composition Against Salmonella
• the in vitro assay is used to screen for combinations of bacteria inhibitory to the growth of Salmonella spp. by modifying the media used for growth of the pathogen inoculum.
• media such as Reinforced Clostridial Media (RCM), Brain Heart Infusion Broth (BHI) or Luria Bertani Broth (LB).
• Salmonella spp. are quantified by using alternative selective media specific for Salmonella spp. or using qPCR probes specific for the pathogen.
• MacConkey agar is used to select for Salmonella spp. and the invA gene is targeted with qPCR probes; this gene encodes an invasion protein carried by many pathogenic Salmonella spp. and is used in invading eukaryotic cells.
• Example 31 Method of Preparing the Bacterial Composition for
• strains for the bacterial composition are independently cultured and mixed together before administration. Both strains are independently be grown at
• Each strain is then be cultivated to a concentration of 10 10 CFU/mL, then concentrated 20-fold by tangential flow microfiltration; the spent medium is exchanged by diafiltering with a preservative medium consisting of 2% gelatin, 100 mM trehalose, and 10 mM sodium phosphate buffer, or other suitable preservative medium.
• the suspension is freeze-dried to a powder and titrated.
• the powder is blended with microcrystalline cellulose and magnesium stearate and formulated into a 250 mg gelatin capsule containing 10 mg of lyophilized powder (10 8 to 10 11 bacteria), 160 mg microcrystalline cellulose, 77.5 mg gelatin, and 2.5 mg magnesium stearate.
• Example 32 Method of Treating a Subject with a Bacterial Composition
• a patient has suffered from recurrent bouts of C. difficile.
• the patient In the most recent acute phase of illness, the patient is treated with an antibiotic sufficient to ameliorate the symptoms of the illness.
• the patient is administered one of the present bacterial compositions.
• the patient is administered Bacillus circulans and Roseburia
• inulinivorans at a dose of 10 8 bacteria total in a lyophilized form, specifically in a 250 mg gelatin capsule containing 10 mg of lyophilized bacteria, 160 mg microcrystalline cellulose, 77.5 mg gelatin, and 2.5 mg magnesium stearate.
• the patient takes the capsule by mouth and resumes a normal diet after 4, 8, 12, or 24 hours.
• the patient may take the capsule by mouth before, during, or immediately after a meal.
• Feces is collected before and at 1 day, 3 days, 1 week, and 1 month after administration.
• the presence of C. difficile is found in the feces before administration of the bacterial composition, but feces collections after administration show reducing (such as at least 50% less, 60%, 70%, 80%, 90%, or 95%) to no detectable levels of C. difficile, as measured by qPCR, as described above.
• ELISA for toxin protein or traditional microbiological identification techniques may also be used.
• a positive response may be defined as absence of diarrhea, which itself is defined as 3 or more loose or watery stools per day for at least 2 consecutive days or 8 or more loose or watery stools in 48 hours, or persisting diarrhea (due to other causes) with repeating (three times) negative stool tests for toxins of C. difficile.
• Treatment failure is defined as persisting diarrhea with a positive C.
• C. difficile toxin stool test or no reduction in levels of C. difficile, as measured by qPCR sequencing.
• ELISA or traditional microbiological identification techniques may also be used.
• Example 33 Method of Treating a Subject with a Bacterial Composition
• a patient has suffered from recurrent bouts of C. difficile.
• the patient In the most recent acute phase of illness, the patient is treated with an antibiotic sufficient to ameliorate the symptoms of the illness.
• the patient is administered one of the present bacterial compositions.
• the patient is administered a bacterial composition containing two bacterial types from Table 1 , at a dose of 10 8 bacteria total in a lyophilized form formulated in an enteric coated capsule.
• Example of the patient or samples derived from the patient is expected to demonstrate at least one measure of success as described herein (reducing levels of C. difficile as measured by qPCR, ELISA, or traditional microbiological identification; absence of diarrhea; persisting diarrhea with repeating (three times) negative stool tests for toxins of C. difficile.
• Coprococcus comes 674 ABVR01000038 clade 262 Y N

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Microbiology (AREA)
• Medicinal Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Mycology (AREA)
• Animal Behavior & Ethology (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Pharmacology & Pharmacy (AREA)
• Epidemiology (AREA)
• Molecular Biology (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Organic Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biotechnology (AREA)
• Genetics & Genomics (AREA)
• Wood Science & Technology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Biomedical Technology (AREA)
• Virology (AREA)
• Physiology (AREA)
• Nutrition Science (AREA)
• Tropical Medicine & Parasitology (AREA)
• Biochemistry (AREA)
• General Engineering & Computer Science (AREA)
• Cell Biology (AREA)
• Immunology (AREA)
• Developmental Biology & Embryology (AREA)
• Communicable Diseases (AREA)
• Oncology (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Coloring Foods And Improving Nutritive Qualities (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Priority Applications (6)

Applications Claiming Priority (10)

Related Child Applications (2)

Publications (2)

Family

ID=51263061

Family Applications (3)

Family Applications After (2)

Country Status (13)

Cited By (118)

Families Citing this family (242)