Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/34—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against blood group antigens
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P17/00—Drugs for dermatological disorders
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/04—Antibacterial agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/02—Immunomodulators
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/02—Immunomodulators
  • A61P37/04—Immunostimulants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/02—Immunomodulators
  • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
  • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
  • C07K2317/14—Specific host cells or culture conditions, e.g. components, pH or temperature
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
  • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/40—Immunoglobulins specific features characterized by post-translational modification
  • C07K2317/41—Glycosylation, sialylation, or fucosylation
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
  • C07K2317/52—Constant or Fc region; Isotype
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
  • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
  • C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]

Definitions

• the present invention relates to a process for obtaining and selecting monoclonal antibodies by an ADCC type test, said antibodies being able to activate type III Fc ⁇ receptors.
• the invention also relates to monoclonal antibodies having a particular glycan structure, the cells producing said antibodies, the methods for preparing the producing cells, as well as pharmaceutical compositions or diagnostic tests comprising said antibodies.
• the anti-D antibodies according to the invention can be used for the prevention of Rhesus isoimmunization of Rh negative individuals, in particular of hemolytic disease of the newborn (MHNN) or in applications such as Idiopathic Thrombocytopenic Purpura (ITP) .
• Monoclonal antibodies have several advantages: they can be obtained in large quantities at reasonable prices, each batch of antibodies is homogeneous and the quality of the various batches is reproducible because they are produced by the same cell line which is cryopreserved in nitrogen liquid. Product safety can be assured as to the absence of viral contamination.
• EP 576093 (AETS (FR), Biotest Pharma GmbH (Germany); Composition for prophylaxis of the haemolytic disease of the new-born understood two human monoclonal antibodies of sub-class IgGl and IgG3, which are active against the Rh é sus D antigen ), RU 2094462, WO 85/02413 (Board of Trustées of the Leland Stanfor Jr liable Human Monoclonal Antibody against Rh (D) Antigen and its
• GB 86-10106 Central Blood Laboratories Authority, Production of heterohybridomas for manufacture of human monoclonal antibodies to Rhesus D antigen
• EP 0 251 440 Central Blood Laboratories Authority, Human Anti-Rhesus D Producing Heterohybridomas
• WO 89/02442, WO 89/02600 and WO 89/024443 Central Blood Laboratories Authority, Human Anti-Rh (D) Monoclonal Antibodies
• WO 8607740 Institut Pasteur, Protein Performance SA, Paris, FR, Obtaining of a recombinant monoclonal antibody from a human anti-rhesus D monoclonal antibody, its production in insect cells and its uses
• JP 88-50710 International Reagents Corp., Japan, Reagents for Determination of Blood Group Substance Rh (D) Factor
• JP 83-248865 Mitsubishi Chemical Industries Co., Ltd., Japan, Preparation of Monoclo
• the use of monoclonal antibodies has many advantages over the use of polyclonal antibody pools, it may, however, be difficult to obtain an effective monoclonal antibody.
• the Fc ⁇ fragment of the immunoglobulin obtained must have very specific properties in order to be able to interact and activate the receptors of the effector cells (macrophage, T H and NK lymphocyte).
• the biological activity of certain immunoglobulins G is dependent on the structure of the oligosaccharides present on the molecule, and in particular on its Fc part.
• the IgG molecules of all human and murine subclasses have an N-oligosaccharide attached to the CH 2 domain of each heavy chain (at residue Asn 297 for human IgG).
• the influence of this glycan residue on the ability of the antibody to interact with effector molecules (Fc receptors and complement) has been demonstrated.
• the inhibition of glycosylation of a human IgG1 by culture in the presence of Tunicamycin, causes for example a 50-fold decrease in the refinement of this antibody for the Fc ⁇ RI receptor present on monocytes and macrophages (Leatherbarrow et al, 1985).
• Binding to the Fc ⁇ RIII receptor is also affected by the loss of carbohydrates on IgG, since it has been described that an IgG3 not glycosylated is incapable of inducing ADCC type lysis via the Fc ⁇ Ri ⁇ receptor of NK cells (Lund et al, 1990).
• the protein backbone of IgG and in particular the amino acids in contact with the N-acetylglucosamine (GlcNAc) and galactose residues of the mannose arm ⁇ 1-6 (aa 246 and 258 IgG) can explain the existence of preferential structures (galactosylation) as shown by the study carried out on murine and chimeric IgGs of different isotypes (Lund et al, 1993).
• Rh Rhesus
• the Rhesus (Rh) system comprises 5 molecules or antigens: D, C, c, E and e (ISSITT, 1988).
• the D antigen is the most important of these molecules because it is the most immunogenic, i.e. it can induce the production of anti-D antibodies if Rh D positive red blood cells are transfused to Rh negative subjects.
• the D antigen is normally expressed in 85% of Caucasoid subjects, these people are called Rh positive; 25% of these subjects are therefore Rh negative, that is to say that their red cells do not present a D antigen.
• the expression of the D antigens presents certain variants which can be linked either to a low antigenic density, we will then speak weak D antigens, either with a different or partial antigenicity, we will then speak of partial D antigens.
• the weak character D is characterized by the fact that it it is a normal antigen but the number of sites per red cell is more or less reduced; this character is transmissible according to Mendelian laws.
• Partial D phenotypes were discovered in Rh D positive subjects who had serum anti-D antibodies; these partial D antigens can therefore be characterized as having only part of the mosaic. Studies carried out with polyclonal and monoclonal antibodies have made it possible to define 7 categories of partial D antigens with the description of at least 8 epitopes constituting the D antigen (LOMAS et al. 1989; TIPETT 1988).
• anti-Rh D antibodies appeared with the discovery of the mechanisms leading to hemolytic disease of the newborn (MHNN). This corresponds to the different pathological conditions observed in certain fetuses or in certain newborns when there is a foeto-materiel incompatibility of blood group which is responsible for the formation of maternal anti-Rh D antibodies capable of crossing the barrier. placenta. Indeed, the passage of Rh positive fetal red cells in an Rh negative mother can lead to the formation of anti-D antibodies.
• anti-D antibodies of class IgG are capable of crossing the placental barrier and of fixing themselves on the fetal red cells Rh positive. This fixation leads to the activation of immunocompetent cells via their surface Fc receptors, thus inducing hemolysis of sensitized fetal red cells. Depending on the intensity of the reaction, several degrees of severity of MHNN can be observed.
• a diagnosis of MHNN can be made before and after birth.
• the prenatal diagnosis is based on the evolution of the level of anti-D antibodies in the mother using several immunohematological techniques.
• Postpartum diagnosis can be made from a cord blood sample by analyzing the following parameters: determination of the blood groups of the fetus and father; anti-D antibody testing; hemoglobin and bilirubin assays.
• Prophylaxis of MHNN is currently routinely performed in all women with an Rh negative blood group who have given birth to an Rh positive child with injections of human anti-D immunoglobulins. The first real immunoprophylaxis trials began in 1964. For prevention to be effective, the immunoglobulins must be injected before immunization, that is to say within 72 hours of delivery and the doses antibodies are sufficient (10 ⁇ g of anti-D antibodies for 0.5 ml of Rh + red cells).
• the invention proposes to provide monoclonal antibodies responding to the abovementioned problems, that is to say antibodies selected by a test of the ADCC type specific for and / or antibodies having a glycan structure necessary for obtaining good efficiency.
• the present invention relates to a process for the preparation of a monoclonal antibody capable of activating the effector cells expressing Fc ⁇ RIII, characterized in that it comprises the following steps: a) purification of monoclonal antibodies obtained from different clones originating from cell lines selected from hybridomas, in particular heterohybridomas, and animal or human cell lines transfected using a vector comprising the gene coding for said antibody; b) addition of each antibody obtained in step a) in a separate reaction mixture comprising: - the target cells of said antibodies,
• the clones can come from heterohybrid cell lines obtained by fusion of human B lymphocytes (coming from immunized subjects) with murine, human or heterohybrid myeloma cells, in particular myeloma K6H6-B5 (ATCC n ° CRL 1823); or also animal or human cell lines transfected using a vector containing the gene coding for a human immunoglobulin of the IgG type, said lines being able to be selected in particular from the CHO-K, CHO-Lec10, CHO Lec-1 lines.
• Polyvalent IgGs are used to inhibit the lysis mechanism of effector cells via Fc ⁇ RHI.
• the antibodies are selected having an ADCC level of Fc ⁇ RIII type greater than 60%, 70%, 80% or preferably greater than 90%.
• Target cells can be red cells treated with papain.
• Polyclonal antibodies of commercial origin can also be used as positive controls and a monoclonal antibody incapable of inducing clearance in vivo as a negative control.
• this process makes it possible to prepare monoclonal anti-Rh (D) antibodies, as indicated above. Rhesus D red cells are then used as target cells.
• the invention is therefore based on the development of an in vitro biological activity test in which the activities measured are correlated with the in vivo biological activity of the monoclonal or polyclonal antibodies already evaluated from the clinical point of view as to their potential to induce clearance of Rh (D) positive red cells in Rh (D) negative volunteers.
• the invention relates to the antibodies capable of being obtained from the method described above, said antibodies having ADCC levels of the type
• Fc ⁇ RIII greater than 60%, 70%, 80% or preferably greater than 90% compared to the reference polyclonal.
• the monoclonal antibodies of the invention directed against a given antigen, activate the effector cells expressing Fc ⁇ RIII causing lysis greater than 60%, 70%, 80%, preferably greater than 90% of the lysis caused by polyclonal antibodies directed against said antigen.
• said monoclonal antibodies are directed against rhesus D.
• They can preferably be produced by clones derived from the Nero lines.
• the invention also relates to antibodies having a particular glycan structure conferring an effector activity dependent on Fc ⁇ RIII.
• Such antibodies can be obtained from a process explained above and have on their glycosylation site (Asn 297) of Fc ⁇ glycan structures of biantennary type, with short chains and low sialylation.
• their glycan structure has terminal mannoses and / or non-intermediate terminal GlcNAc.
• Such antibodies are more particularly selected from the forms
• the invention relates to a monoclonal antibody characterized in that it has, on its glycosylation site (Asn 297) of Fc ⁇ , biantennary-type glycan structures, with short chains, weak sialylation, mannoses and GlcNAc from the point d '' non-intermediate terminal attachment.
• Said antibodies directed against a given antigen, activate the effector cells expressing Fc ⁇ RI ⁇ causing lysis greater than 60%, 70%, 80%, preferably greater than 90% of the lysis caused by polyclonal antibodies directed against said antigen.
• the invention relates to antibodies and compositions comprising said antibodies as defined above, in which the sialic acid content is less than 25%, 20%, 15%, or 10%, preferably 5%. , 4% 3% or 2%.
• the invention relates to antibodies and compositions comprising said antibodies as defined above, in which the fucose content is less than 65%, 60%, 50%, 40%, or 30%. Preferably, the fucose content is between 20% and 45% or even between 25% and 40%.
• a composition according to the invention which is particularly effective comprises, for example, a content greater than 60%, preferably greater than 80% for the forms G0 + Gl + GOF + GIF, it being understood that the forms GOF + GIF are less than 50%, preferably less than 30%.
• the invention relates to a cell producing an antibody mentioned above. It may be a hybridoma, in particular a heterohybridoma obtained with the fusion partner K6H6-B5 (ATCC n ° CRL 1823); or of an animal or human cell transfected using a vector comprising the gene coding for the said antibody, in particular a cell derived from the Nero lines (ATCC n ° CCL 81), YB2 / 0 (ATCC n ° CRL 1662) or CHO Lec-1 (ATCC n ° CRL 1735). These cells correspond to the cell lines selected by the method according to the invention, said cells producing antibodies having the characteristics mentioned above.
• a hybridoma in particular a heterohybridoma obtained with the fusion partner K6H6-B5 (ATCC n ° CRL 1823); or of an animal or human cell transfected using a vector comprising the gene coding for the said antibody, in particular a cell derived from the Nero lines
• a preferred antibody according to the invention shows significant biological activity (greater than or equal to that of the reference anti-Rh (D) polyclonal antibody) in the ADCC test using Fc ⁇ RIII positive effector cells. Its ability to activate the Fc ⁇ RIII receptors (after fixation) is confirmed in in vitro models which demonstrate the modification of the intracellular calcium flow, the phosphorylation of molecules for transduction of the activation signal or the release of chemical mediators.
• This antibody has therapeutic applications: prevention of MHNN, treatment of ITP in Rh (D) positive individuals, and any other application concerned with the use of anti-D polyclonal immunoglobulins.
• a preferred antibody according to the invention can also have a specificity other than anti-Rh (D) (anti-cancer cell for example).
• the invention relates to the use of an anti-Rh (D) antibody described above for the manufacture of a medicament intended for the prevention of Rhesus alloimmunization of Rh negative individuals.
• the mode of action of anti-D immunoglobulins in vivo is a specific binding of antibodies to the D antigen of Rh (D) positive red blood cells, followed by elimination of these red blood cells essentially from the spleen. . This clearance is associated with a dynamic mechanism of suppression of the primary immune response in individuals and therefore prevents immunization.
• an antibody of the invention prophylactically for the prevention of falloimmunization of Rhesus negative woman, immediately after the birth of a Rhesus positive child, and to prevent, in subsequent pregnancies, hemolytic disease of the new born (MHNN); during abortions, ectopic pregnancies in a Rhesus D incompatibility situation or during transplacental haemorrhages resulting from amniocentesis, chorionic biopsies, or traumatic obstetric manipulations in a Rhesus D incompatibility situation.
• the invention also relates to the use of an antibody of the invention for the manufacture of a medicament for therapeutic use in Idiopathic Thrombocytopenic Purpura (ITP).
• IDP Idiopathic Thrombocytopenic Purpura
• the antibodies of the invention are also useful for the manufacture of a medicated drug or for the treatment of infections caused by viral or bacterial pathogens.
• a complementary aspect of the invention relates to the use of said antibodies, in particular for diagnosis.
• the invention therefore relates to a kit comprising an antibody described above.
• This figure represents the percentage of lysis obtained as a function of the antibody concentration in the presence of 100 and 500 ⁇ g / well of TEGELINE TM (LFB, France).
• a high lysis percentage is obtained for the antibodies according to the invention F60 and T125.
• FIG. 1 binding of anti-D to the receptor (Fc ⁇ R-TI) A strong binding index is obtained for the antibodies according to the invention F60 and T125.
• FIG. 1 Construction of the expression vector T125-H26 for the expression of the H chain of T125.
• Figure 4 Construction of the expression vector T125-K47 for the expression of the L chain of TI25
• Figure 5 construction of the expression vector T125-IG24 for the expression of the whole antibody T125.
• the ADCC test is established according to the operating mode described in ⁇ 3.3 in the presence of the anti-
• 3G8 Commercial CD16 3G8 (TEBU) whose action is to block the FcRIII receptors present on the effector cells.
• the final concentration of 3G8 is 5 ⁇ g / well
• Figure 7 Characterization of Anti-D glycans by Mass Spectrometry (MS).
• Figure 8 Comparison of the MS spectra of R 290 and DF5.
• Figure 9 Study of the glycosylation of Anti-D D31DMM by MS.
• the donor of B lymphocytes is selected from the donors of anti-Rh (D) in plasmapheresis, on the activity of his serum anti-Rh (D) antibodies in the ADCC activity test described in ⁇ 33. After a donation of whole blood in 1998, the “buffy coat” fraction (leukocyte concentrate) is recovered.
• peripheral blood mononuclear cells are separated from the other elements by centrifugation on Ficoll Plus (Pharmacia). They are then diluted to 10 6 cells / ml in IMDM containing 20% (v IV) of fetal calf serum (SNF), to which are added 20% of culture supernatant of the line B95-8 (ATCC-CRL1612), 0 , 1 ⁇ g ml of cyclosporin A (Sandoz), 50 ⁇ g / ml of gentamycin sulfate (Life Technologies), and distributed in 24-well plates (P24 Greiner) or in 96-well plates with round bottom. They are then placed in an incubator at 37 ° C, 7% CO2. After 3 weeks, the presence of anti-Rh (D) antibodies is sought by ADCC
• SNF fetal calf serum
• Each of the 16 microwells from a P24 positive plate well is transferred to a new P24 well. This enrichment is repeated after 10 to 15 days of culture and each microwell is amplified in P96 then in P24.
• Cells from one or more P24 wells are enriched in specific cells by formation and separation of rosettes with Rh (D) positive red cells from papain: 1 volume of red cells washed in 0.9% NaCl is incubated for 10 minutes at 37 ° C with 1 volume of papain solution (Merck) in l / 1000 th (m / v), then washed 3 times in 0.9% NaCl. The cells are then washed once in Hanks solution, suspended in SVF and mixed with papain red cells in the ratio 1 cell for 33 red cells. The mixture is placed in a conical bottom centrifuge tube, centrifuged for 5 minutes at 80 g and incubated for one hour in melting ice.
• Rh (D) positive red cells from papain 1 volume of red cells washed in 0.9% NaCl is incubated for 10 minutes at 37 ° C with 1 volume of papain solution (Merck) in l / 1000 th (m / v), then washed 3 times in 0.9% NaCl. The cells are then
• the mixture is then gently stirred and the Ficoll deposited at the bottom of the tube for separation 20 minutes at 900g.
• the pellet containing the rosettes is hemolysed in NFLCl solution for 5 minutes and the cells re-cultured in P24 containing irradiated human mononuclear cells.
• the supernatants are evaluated in CELA (paragraph 3.2) and ADCC tests for the presence of anti-Rh (D) antibodies having good activity.
• a new enrichment cycle is carried out if the percentage of rosette-forming cells increases significantly compared to the previous cycle.
• the cells enriched by RI are distributed at 5 and 0.5 cells per well in 96-well round bottom plates containing irradiated human mononuclear cells. After approximately 4 weeks of culture, the supernatants of the wells containing cell clusters are evaluated by ADCC test.
• the supernatants from the wells containing cell clusters are evaluated by ADCC test.
• 1.6- cloning of heterophybrids Cloning by limiting dilution is carried out at 4, 2 and 1 cells / well in P96 with flat bottom. After 2 weeks, the microscopic appearance of the wells is examined to identify the unique clones, then the medium is renewed. After approximately 2 weeks, the supernatants of the wells containing cell clusters are evaluated by ADCC test.
• a line producing an IgG3 was prepared.
• the original cells come from a whole blood donation, from another designated donor, whose “buf y coat” fraction (leukocyte concentrate) has been recovered. It is an IgG3 having a Kappa light chain.
• the concentration of the T125 antibody is determined by ELISA technique.
• the biological activity in vitro is then measured by the ADCC technique.
• Coating anti-IgG (Calbiochem) at 2 ⁇ g / ml in 0.05M carbonate buffer pH 9.5, 1 night at 4 ° C.
• Saturation dilution buffer (PBS + 1% BSA + 0.05% Tween 20, pH 7.2) lh at room temperature. Washing (to be renewed at each step): H2O + 150mM NaCl + 0.05% Tween 20. Dilution of the samples in dilution buffer to approximately 100ng / ml and of the control range constituted from polyvalent human IgG LFB ' prediluted to Loong / ml. 2h incubation at room temperature.
• Conjugate anti-IgG (Pasteur Diagnosis) diluted to 1/5000, 2 hours at room temperature.
• Substrate OPD 0.5mg / ml (sigma) in citrate phosphate buffer, Na perborate (Sigma), 10 minutes in the dark. Stop the reaction with HCL IN, and read at 492 nm.
• LFB (Kappa / gamma 3) prediluted at 100ng / ml. Incubation 2 h at room temperature Conjugate: biotinylated anti-kappa (Pierce) diluted 1/1000 in the presence of Streptavidin- peroxidase (Pierce) diluted 1/1500, 2 hours at room temperature. Substrate: OPD to 0.5 mg / ml (sigma) in citrate phosphate buffer, Na perborate (Sigma), 10 minutes in the dark. Stop the reaction with HCL IN, and read at 492 nm.
• This method is used for the specific assay of anti-D antibodies, in particular when it is a question of culture supernatant at culture stages where other non-anti-D immunoglobulins are present in the solution (early stages after EBV transformation). .
• the anti-D antibody is incubated with Rhesus positive red cells and then revealed by a human anti-Ig labeled with alkaline phosphatase. 100 ⁇ l 10% Rh + red cells diluted in 1% Liss-BSA dilution buffer. Dilution of the samples in dilution buffer to approximately 500 ng / ml and of the control range constituted from a purified monoclonal anti-D human IgG (DF5, LFB) prediluted to 500 ng / ml.
• DF5 monoclonal anti-D human IgG
• the ADCC (Antibody-Dependent Cellular Cytotoxicity) technique assesses the ability of antibodies (anti-D) to induce lysis of Rh positive red cells, in the presence of effector cells (mononuclear cells or lymphocytes). Briefly, the red cells of an Rh positive globular concentrate are treated with papain
• the effector cells are isolated from a pool of at least 3 buffy coats, by centrifugation on Ficoll (Pharmacia), followed by an adhesion step in the presence of 25% SNF, so as to obtain a lymphocyte / monocyte ratio of the order of 9.
• a microtiter plate (96 wells) is deposited per well: lOO ⁇ l of anti-D antibody purified at 200 ng / ml, 25 ⁇ l of papain red blood cells Rh + (i.e. lxl 0 6 ), 25 ⁇ l of effector cells (i.e.
• FIG. 1 show the activity of the antibody produced by the F60 heterohybrid compared to that of the reference antibodies:
• Two concentrations of human IgG (Tegeline LFB) are used to show that the inhibition of activity of the negative control is linked to the binding of competitive IgGs on type I Fc ⁇ receptors.
• Rh + red blood cell membranes coated with a microtiter plate the antibody to be tested (anti-D) is added, then transfected Jurkat cells expressing the Fc ⁇ RIII receptor on their surface. After centrifugation, the interaction “Rh + membrane / anti-D / Jurkat CD 16” is visualized by a homogeneous spreading of Jurkat CD 16 in the well. On the contrary, the cells gather in the center of the well in the absence of interaction. The intensity of the reaction is expressed in numbers of +. Method: 1) Incubation for 1 hour at 37 ° C.
• OPD revelation then reading of the optical density (OD) at 492 nm.
• OD optical density
• results an arbitrary value of 0 to 3 is assigned according to the fixation and spreading of the Jurkat CD 16 cells. These values are assigned to each defined DO interval (from 0.1 to 0.1).
• the anti-Rh (D) antibodies of isotype IgGl show a binding index close to that of polyclonal IgGl (WinRho), while the negative control antibodies DF5 and AD1 do not bind.
• the isotype antibody shows a binding index close to that of polyclonal IgGl (WinRho), while the negative control antibodies DF5 and AD1 do not bind.
• IgG3 (F41) has a good fixation index, slightly lower than that of IgG3 purified from the polyclonal Winrho and higher than that of the antibody AD3 (other IgG3 tested and ineffective in clinical trial, mixed with AD1 (Biotest / LFB, 1997, unpublished).
• RNAs were extracted from a clone producing anti-D Ab (IgG Gl Kappa) obtained by EBN transformation: T125 A2 (5/1) A2 (see paragraph 2, example 1)
• the corresponding cD ⁇ A were synthesized by reverse transcription of total AR ⁇ using oligo dT primers.
• the NH T125-A2 sequence is obtained by amplification of the cD ⁇ As of T125-A2 using the following primers: - primer A2NH5 located 5 ′ of the leader region of the NH gene of T125-A2, introduced a consensus leader sequence (in bold) deduced from already published leader sequences associated with VH genes belonging to the same NH3-30 family as the NH gene of T125-A2; this sequence also includes an Eco RI restriction site (in italics) and a Kozak sequence (underlined): A2NH5 (SEQ ID ⁇ 0 1):
• GSP2ANP (SEQ ID N ° 2): 5'- GGAAGTAGTCCTTGACCAGGCAG -3 '.
• T125-A2 sequence CH / T125-A2
• the CH / T125-A2 sequence is obtained by amplification of the T125-A2 cDNAs using the following primers:
• Gl (SEQ ID N ° 3): 5'- ⁇ CCTCCACCAAGGGCCCATCGGTC -3 '
• the first base G of the sequence CH is here replaced by a C (underlined) in order to recreate after cloning an Eco RI site (see paragraph 2.1.1)
• H3'Xba (SEQ ID N 0 4): 5'- GAGAGGTCTAGACTATTTACCCGGAGACAGGGAGAG -3 '
• the entire Kappa chain of T125-A2 (sequence K / T125-A2) is amplified from the cDNAs of T125-A2 using the following primers: - primer A2NK3 located 5 'to the leader region of the VK gene of T125-A2 , introduces a consensus sequence (in bold) deduced from the sequence of several leader regions of NK NH genes belonging to the same NK1 subgroup as the NK gene of T125-A2; this sequence also includes an Eco RI restriction site (in italics) and a Kozak sequence (underlined): A2VK3 (SEQ ID 0 5):
• KSE1 located 3 'to Kappa, introduces an Eco RI site (underlined): KSE1 (SEQ ID N 0 6):
• Fig. 1 diagrams the strategies for amplifying the heavy and light chains of
• T125-H26 The construction of T125-H26 is summarized in Fig. 2. It is carried out in two stages: firstly, construction of the intermediate vector N51-CH / T125-A2 by insertion of the constant region of T125-A2 into the expression vector N51 derived from pCI-neo (FIG. 3) then cloning of the variable region in N51-CH / T125-A2.
• the amplified CH / T125-A2 sequence is inserted after phosphorylation at the Eco RI site of the vector N51 (FIG. 3).
• the ligation is carried out after treatment beforehand with Klenow polymerase of the Eco RI cohesive ends of N51 in order to make them "blunt end”.
• the primer Gl used for the amplification of CH T125-A2 makes it possible to recreate, after its insertion into N51, an Eco RI site 5 ′ of CH / T125-A2.
• the NH / T125-A2 sequence obtained by amplification is digested with Eco RI and Apa I and then inserted at the Eco RI and Apa I sites of the vector N51-G1 / T125-A2.
• T125-K47 The construction of T125-K47 is presented in Fig. 4.
• the K / T125-A2 sequence obtained by PCR is digested with Eco RI and inserted at the Eco RI site of the expression vector N47 derived from pCI-neo (FIG. 5).
• T125-IG24 T125-IG24
• T125-IG24 The construction of T125-IG24 is shown diagrammatically in Fig. 6.
• This vector which contains the two transcription units of the heavy and kappa chains of T125-A2 is obtained by insertion of the Sal I - Xho I fragment of T125-K47 containing the transcription unit of K / T125-A2 at the Xho sites I and Sal I of T125-H26.
• Heavy and light AmsUes-r.balnp.s of T125-A2 are expressed under the dependence of the CMN promoter; other promoters can be used: RSN, heavy chain promoter IgG, LTR MMLN, HJN, ⁇ actin, etc.
• 2.4- Leader specific vector heavy and light chains of T125-A2 T125-LS4
• a second expression vector of T125-A2 is also constructed in which the consensus leader sequence of the Kappa chain is replaced by the real sequence of the leader region of T125-A2 previously determined by sequencing of “PCR 5'-RACE products. ”(Rapid Amplification of cDNA 5 'Ends).
• this vector T125-LS4 is described in FIG. 7. It is carried out in two stages: first the construction of a new expression vector of the Kappa chain of T125-A2, T125-KLS18, then the assembly of the final expression vector, T125- LS4, containing the two modified light chain and heavy chain transcription units.
• the 5 ′ part of the Kappa consensus leader sequence of the vector T125-K47 is replaced by the specific leader sequence of T125 (KLS / T125-A2) during an amplification step of the K / T125-A2 sequence carried out at using the following primers:
• A2NK9 modifies the 5 'part of the leader region (in bold) and introduces an Eco RI site (underlined) as well as a Kozak sequence (in italics):
• A2NK9 5'- CCTACCGAATT ⁇ GCCGCG4CCATGAGGGTCCCCGCTCAGCTC - 3' - primer KSE1 (described in paragraph 1.4)
• the T125-KLS18 vector is then obtained by replacing the Eco RI fragment of T125-K47 containing the original K / T125-A2 sequence with the new KLS / T125-A2 sequence digested with Eco RI.
• T125-LS4 The Sal I - Xho I fragment of T125-KLS18 containing the modified sequence KLS / T125-A2 is inserted into T125-H26 at the Xho I and Sal I sites.
• the two expression vectors T125-IG24 and T125-LS4 were used for the transfection of cells of the line YB2 / 0 (rat myeloma, line ATCC No. 1662).
• the gene amplification system implemented is based on the selection of methotrexate resistant transformants (MTX). It requires the prior introduction of a transcription unit coding for the enzyme DHFR (dihydrofolate reductase) into the expression vector of the recombinant Ab (SHITARI et al, 1994)
• MTX methotrexate resistant transformants
• FIG. 8 describes the construction of the T125-A2 expression vector containing the murine dhfr gene.
• a first vector (N64) was constructed from a vector derived from pCI-neo, N43 (FIG. 9), replacing, 3 'to the SN40 promoter and 5' to a synthetic polyadenylation sequence, the neo gene (Hind III-Csp 45 I fragment) with the cD ⁇ A of the murine dhfr gene (obtained by amplification from the plasmid pMT2).
• This vector is then modified so as to create a Cla I site 5 ′ of the dhfr transcription unit.
• the Cla I fragment containing the dhfr transcription unit is then inserted at the Cla I site of T125-LS4.
• the YB2 / 0 cells transfected by electroporation with vector T125-dhfrl3 are selected in the presence of G418.
• the best transformants producing recombinant Ab are cloned by limiting dilution before selection in the presence of increasing doses of MTX.
• the evolution of the production of each clone, a witness to the gene amplification process, is followed during the selection stages in MTX.
• the level and the stability of the production of recombinant Ab is evaluated for each MTX-resistant clone obtained.
• DCM Deoxymannojirimycin
• D Different anti-Rh (D) antibody producing lines were brought into contact with DMM and the functional activity of the monoclonal antibodies produced was evaluated in the form of culture supernatants or after purification.
• the cells are seeded between 1 and 3 ⁇ 10 5 cells / ml, and cultured in an IMDM culture medium (Life Technologies) with 10% FCS and in the presence of 20 ⁇ g / ml of DMM (Sigma, Boehringer). After 3 medium renewals, the culture supernatants are tested by human IgG ELISA and then by ADCC.
• DMM Deoxymannoiirimycin
• a human-mouse hybridoma D31 A human DF5 lymphoblastoid line
• the corresponding cDNAs are first synthesized from total RNA extracted from the clone producer of anti-D Ab (IgG Gl / Lambda) 2MDF5 obtained by EBV transformation. • The amplification of the heavy and light chains is then carried out from these cDNAs using the primers presented below.
• DF5VLBD1 located in the 5 'leader region of the VL gene of DF5
• the three expression vectors T125-IG24, T125-LS4 and DF5-IgGl are used for the transfection of cells of different lines:
• Stable or transient transfections are carried out by electroporation or using transfection reagent.
• Table 3 Cell lines used for the transfection of anti-Rh (D) antibodies m ⁇ miâ wm'm, 1
• Molt-4 ATCC CRL 1582 Human T cell (Acute lymphoblastic leukemia)
• the characterization of the glycan structures of the anti Rh-D antibody was carried out on four purified products having ADCC activity (F60, and three recombinant proteins derived from T125) in comparison with two purified products inactive or very weakly active in the ADCC test. according to the invention (D31 and DF5).
• the oligosaccharides are separated from the protein by a specific enzymatic deglycosylation by PNGase F at the level of Asn 297.
• the oligosaccharides thus released are marked by a fluorophore, separated and identified by different complementary techniques which allow:
• MALDI matrix-assisted laser desorption mass spectrometry
• the different active forms studied are F60 and three recombinant antibodies, R 290, R 297 and R 270, originating from T 125 and produced in YB2 / 0.
• the fine characterization of the glycan structures by mass spectrometry shows that these forms are all of the biantennary type.
• R 270 the majority form is of the non-fucosylated agalactosylated type (G0, mass exp. 1459.37 Da, fig 1).
• the different inactive forms studied are D31 and DF5.
• the quantification of glycan structures by the different chromatographic techniques and capillary electrophoresis (Table I) reveals, for these two antibodies, a rate of sialylation close to 50%, and a rate of fucosylation of 88 and 100% for D31 and DF5, respectively. These rates of sialylation and fucosylation are much higher than those obtained from the active forms.
• the characterization of the glycan structures shows that the majority form is, for the two antibodies, of the biantenal monosialylated bigalactosylated fucosylated type (G2S1F, table I).
• the characterization by mass spectrometry of D31 (FIG. 7) reveals that the neutral forms are mainly of monogalactosylated fucosylated type (GIF at 1767.43 Da) and bigalactosylated fucosylated (G2F at 1929.66 Da).
• the inactive antibody DF5 is characterized by the presence of oligosaccharides having an intermediate GlcNAc residue.
• mass analysis Figure 8 reveals the presence of a majority neutral form of the monogalactosylated fucosylated Bisec- type.
• GlcNAc interlayer G1FB at 1851.03 Da).
• these structural forms are not detectable or present in a trace state on the active antibodies studied.
• the ADCC activity of D31 after DMM action goes from 10% to 60%.
• the glycan structures of D31 DMM differ from those of D31 by the presence of oligomannosis forms (Man 5, Man 6 and Man 7) (see Figure 9).
• the various active antibodies are modified on Asn 297 by N-glycosylations of the biantenate and / or oligomanosidic type.
• these are short structures that are very weakly sialylated, weakly fucosylated, weakly galactosylated and without intermediate GlcNAc.
• a protein structural change in aglycosylated IgG3 correlates with loss of hu FcDRI and hu Fc ⁇ RUI binding and / or activation. Molec. Immun. 27, 1145-1153 (1990).

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• Medicinal Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Immunology (AREA)
• Veterinary Medicine (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• General Chemical & Material Sciences (AREA)
• Public Health (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Engineering & Computer Science (AREA)
• Hematology (AREA)
• Communicable Diseases (AREA)
• Oncology (AREA)
• Biochemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Molecular Biology (AREA)
• Genetics & Genomics (AREA)
• Biophysics (AREA)
• Diabetes (AREA)
• Reproductive Health (AREA)
• Endocrinology (AREA)
• Dermatology (AREA)
• Virology (AREA)
• Transplantation (AREA)
• Peptides Or Proteins (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (23)

Applications Claiming Priority (2)

Related Child Applications (7)

Publications (2)

Family

ID=8849165

Family Applications (1)

Country Status (11)

Cited By (39)

Families Citing this family (132)

Citations (4)

Family Cites Families (57)

• 2000
  • 2000-04-12 FR FR0004685A patent/FR2807767B1/fr not_active Expired - Lifetime
• 2001
  • 2001-04-12 JP JP2001575651A patent/JP5192625B2/ja not_active Expired - Fee Related
  • 2001-04-12 CA CA2406033A patent/CA2406033C/fr not_active Expired - Lifetime
  • 2001-04-12 ES ES10180551.3T patent/ES2601241T3/es not_active Expired - Lifetime
  • 2001-04-12 AT AT01927974T patent/ATE419276T2/de active
  • 2001-04-12 DE DE60137210T patent/DE60137210D1/de not_active Expired - Lifetime
  • 2001-04-12 EP EP10180551.3A patent/EP2341078B1/fr not_active Revoked
  • 2001-04-12 DK DK01927974.4T patent/DK1272527T4/da active
  • 2001-04-12 AU AU2001254858A patent/AU2001254858B2/en not_active Ceased
  • 2001-04-12 DK DK04028814.4T patent/DK1518864T4/da active
  • 2001-04-12 EP EP15173391.2A patent/EP2947099A1/fr not_active Withdrawn
  • 2001-04-12 DK DK10180551.3T patent/DK2341078T3/en active
  • 2001-04-12 EP EP01927974.4A patent/EP1272527B2/fr not_active Expired - Lifetime
  • 2001-04-12 ES ES01927974T patent/ES2320412T5/es not_active Expired - Lifetime
  • 2001-04-12 EP EP04028814.4A patent/EP1518864B2/fr not_active Expired - Lifetime
  • 2001-04-12 ES ES04028814T patent/ES2525762T5/es not_active Expired - Lifetime
  • 2001-04-12 US US10/257,477 patent/US7579170B2/en not_active Expired - Fee Related
  • 2001-04-12 WO PCT/FR2001/001127 patent/WO2001077181A2/fr not_active Ceased
• 2005
  • 2005-01-24 US US11/039,877 patent/US7931895B2/en not_active Expired - Fee Related
• 2006
  • 2006-09-08 US US11/517,525 patent/US7541029B2/en not_active Expired - Lifetime
• 2007
  • 2007-05-08 AU AU2007202060A patent/AU2007202060B2/en not_active Ceased
• 2009
  • 2009-07-14 US US12/502,911 patent/US8124078B2/en not_active Expired - Fee Related
  • 2009-07-14 US US12/502,915 patent/US8153124B2/en not_active Expired - Fee Related
  • 2009-07-14 US US12/502,920 patent/US8178093B2/en not_active Expired - Fee Related
• 2010
  • 2010-12-23 AU AU2010257417A patent/AU2010257417B2/en not_active Ceased
• 2011
  • 2011-03-31 US US13/077,644 patent/US8685725B2/en not_active Expired - Fee Related
• 2012
  • 2012-03-30 US US13/436,114 patent/US8409572B2/en not_active Expired - Fee Related
  • 2012-04-10 US US13/443,532 patent/US8357370B2/en not_active Expired - Fee Related
  • 2012-06-06 JP JP2012128846A patent/JP5722279B2/ja not_active Expired - Lifetime
  • 2012-06-06 JP JP2012128845A patent/JP5722278B2/ja not_active Expired - Lifetime
  • 2012-06-06 JP JP2012128847A patent/JP5837859B2/ja not_active Expired - Lifetime
• 2013
  • 2013-05-15 JP JP2013103336A patent/JP5788432B2/ja not_active Expired - Lifetime
• 2014
  • 2014-01-16 US US14/157,061 patent/US9708409B2/en not_active Expired - Fee Related
• 2015
  • 2015-02-09 US US14/617,836 patent/US9718889B2/en not_active Expired - Fee Related
  • 2015-04-01 US US14/676,508 patent/US9718890B2/en not_active Expired - Fee Related
  • 2015-08-21 JP JP2015163589A patent/JP6124958B2/ja not_active Expired - Lifetime
  • 2015-08-21 JP JP2015163588A patent/JP2015221827A/ja active Pending
• 2016
  • 2016-10-11 JP JP2016199815A patent/JP2017012199A/ja active Pending
• 2017
  • 2017-06-07 US US15/616,596 patent/US10081683B2/en not_active Expired - Fee Related
  • 2017-09-11 JP JP2017174012A patent/JP2017214427A/ja active Pending

Patent Citations (4)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events