US5441868A - Production of recombinant erythropoietin - Google Patents

Production of recombinant erythropoietin Download PDF

Info

Publication number
US5441868A
US5441868A US07/113,179 US11317987A US5441868A US 5441868 A US5441868 A US 5441868A US 11317987 A US11317987 A US 11317987A US 5441868 A US5441868 A US 5441868A
Authority
US
United States
Prior art keywords
epo
dna
cells
human
erythropoietin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US07/113,179
Other languages
English (en)
Inventor
Fu-Kuen Lin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Amgen Inc
Original Assignee
Kirin Amgen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
US case filed in Massachusetts District Court litigation Critical https://portal.unifiedpatents.com/litigation/Massachusetts%20District%20Court/case/2009-1096 Source: District Court Jurisdiction: Massachusetts District Court "Unified Patents Litigation Data" by Unified Patents is licensed under a Creative Commons Attribution 4.0 International License.
US case filed in International Trade Commission litigation https://portal.unifiedpatents.com/litigation/International%20Trade%20Commission/case/337-TA-568 Source: International Trade Commission Jurisdiction: International Trade Commission "Unified Patents Litigation Data" by Unified Patents is licensed under a Creative Commons Attribution 4.0 International License.
US case filed in Court of Appeals for the Federal Circuit litigation https://portal.unifiedpatents.com/litigation/Court%20of%20Appeals%20for%20the%20Federal%20Circuit/case/2008-1300 Source: Court of Appeals for the Federal Circuit Jurisdiction: Court of Appeals for the Federal Circuit "Unified Patents Litigation Data" by Unified Patents is licensed under a Creative Commons Attribution 4.0 International License.
First worldwide family litigation filed litigation https://patents.darts-ip.com/?family=27504819&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US5441868(A) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from US06/675,298 external-priority patent/US4703008A/en
Priority to US07/113,179 priority Critical patent/US5441868A/en
Application filed by Kirin Amgen Inc filed Critical Kirin Amgen Inc
Priority to US08/100,197 priority patent/US5955422A/en
Priority to US08/468,369 priority patent/US5756349A/en
Priority to US08/468,381 priority patent/US5618698A/en
Publication of US5441868A publication Critical patent/US5441868A/en
Application granted granted Critical
Assigned to AMGEN INC. reassignment AMGEN INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KIRIN-AMGEN INC.
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/505Erythropoietin [EPO]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/10Plasmid DNA
    • C12N2800/108Plasmid DNA episomal vectors

Definitions

  • the present invention relates generally to the manipulation of genetic materials and, more particularly, to recombinant procedures making possible the production of polypeptides possessing part or all of the primary structural conformation and/or one or more of the biological properties of naturally-occurring erythropoietin.
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acids
  • the repeating units in DNA polymers are four different nucleotides, each of which consists of either a purine (adenine or guanine) or a pyrimidine (thymine or cytosine) bound to a deoxyribose sugar to which a phosphate group is attached.
  • nucleotides in linear polymeric form is by means of fusion of the 5' phosphate of one nucleotide to the 3' hydroxyl group of another.
  • Functional DNA occurs in the form of stable double stranded associations of single strands of nucleotides (known as deoxyoligonucleotides), which associations occur by means of hydrogen bonding between purine and pyrimidine bases [i.e., "complementary" associations existing either between adenine (A) and thymine (T) or guanine (G) and cytosine (C)].
  • nucleotides are referred to by the names of their constituent purine or pyrimidine bases, and the complementary associations of nucleotides in double stranded DNA (i.e., A-T and G-C) are referred to as "base pairs".
  • Ribonucleic acid is a polynucleotide comprising adenine, guanine, cytosine and uracil (U), rather than thymine, bound to ribose and a phosphate group.
  • DNA nucleotide sequences genes
  • mRNA messenger RNA
  • This mRNA "translation" process involves the operations of small RNA strands (tRNA) which transport and align individual amino acids along the mRNA strand to allow for formation of polypeptides in proper amino acid sequences.
  • mRNA "message” derived from DNA and providing the basis for the tRNA supply and orientation of any given one of the twenty amino acids for polypeptide "expression", is in the form of triplet "codons" --sequential groupings of three nucleotide bases. In one sense, the formation of a protein is the ultimate form of "expression” of the programmed genetic message provided by the nucleotide sequence of a gene.
  • Promoter DNA sequences usually "precede” a gene in a DNA polymer and provide a site for initiation of the transcription into mRNA.
  • "Regulator” DNA sequences also usually "upstream” of (i.e., preceding) a gene in a given DNA polymer, bind proteins that determine the frequency (or rate) of transcriptional initiation.
  • promoter/regulator or "control” DNA sequence, these sequences which precede a selected gene (or series of genes) in a functional DNA polymer cooperate to determine whether the transcription (and eventual expression) of a gene will occur.
  • DNA sequences which "follow" a gene in a DNA polymer and provide a signal for termination of the transcription into mRNA are referred to as transcription "terminator" sequences.
  • a focus of microbiological processing for the last decade has been the attempt to manufacture industrially and pharmaceutically significant substances using organisms which either do not initially have genetically coded information concerning the desired product included in their DNA, or (in the case of mammalian cells in culture) do not ordinarily express a chromosomal gene at appreciable levels.
  • a gene that specifies the structure of a desired polypeptide product is either isolated from a "donor" organism or chemically synthesized and then stably introduced into another organism which is preferably a self-replicating unicellular organism such as bacteria, yeast or mammalian cells in culture.
  • the existing machinery for gene expression in the "transformed” or “transfected” microbial host cells operates to construct the desired product, using the exogenous DNA as a template for transcription of mRNA which is then translated into a continuous sequence of amino acid residues.
  • Selected foreign ("exogenous” or “heterologous”) DNA strands usually including sequences coding for desired product are prepared in linear form through use of similar enzymes.
  • the linear vital or plasmid DNA is incubated with the foreign DNA in the presence of ligating enzymes capable of effecting a restoration process and "hybrid" vectors are formed which include the selected exogenous DNA segment "spliced" into the viral or circular DNA plasmid.
  • Transformation of compatible unicellular host organisms with the hybrid vector results in the formation of multiple copies of the exogenous DNA in the host cell population.
  • the desired result is simply the amplification of the foreign DNA and the "product" harvested is DNA.
  • the goal of transformation is the expression by the host cells of the exogenous DNA in the form of large scale synthesis of isolatable quantities of commercially significant protein or polypeptide fragments coded for by the foreign DNA. See also, e.g., U.S. Pat. Nos. 4,264,731 (to Shine), 4,273,875 (to Manis), 4,293,652 (to Cohen), and European Patent Application 093,619, published Nov. 9, 1983.
  • single-stranded DNA probe sequences duplicating a sequence putatively present in the "target" cDNA may be employed in DNA/DNA hybridization procedures carried out on cloned copies of the cDNA which have been denatured to single stranded form.
  • genomic DNA isolates are the least common of the three above-noted methods for developing specific DNA sequences for use in recombinant procedures. This is especially true in the area of recombinant procedures directed to securing microbial expression of mammalian polypeptides and is due, principally to the complexity of mammalian genomic DNA.
  • phage-borne libraries of genomic DNA of human and other mammalian species origins See, e.g., Lawn, et al. Cell, 15, pp, 1157-1174 (1978) relating to procedures for generating a human genomic library commonly referred to as the "Maniatis Library"; Karn, et al., P.N.A.S.
  • 6838-6842 (1983) report the isolation of genomic clone for bovine pancreatic trypsin inhibitor (BPTI) using a single probe 86 base pairs in length and constructed according to the known amino acid sequence of BPTI.
  • BPTI bovine pancreatic trypsin inhibitor
  • the authors note a determination of poor prospects for isolating mRNA suitable for synthesis of a cDNA library due to apparent low levels of mRNA in initially targeted parotid gland and lung tissue sources and then address the prospects of success in probing a genomic library using a mixture of labelled probes, stating: "More generally, mixed-sequence oligodeoxynucleotide probes have been used to isolate protein genes of unknown sequence from cDNA libraries.
  • Such probes are typically mixtures of 8-32 oligonucleotides, 14-17 nucleotides in length, representing every possible codon combination for a small stretch (5-6 residues) of amino acid sequence. Under stringent hybridization conditions that discriminate against incorrectly base-paired probes, these mixtures are capable of locating specific gene sequences in clone libraries of low-to-moderate complexity. Nevertheless, because of their short length and heterogeneity, mixed probes often lack the specificity required for probing sequences as complex as a mammalian genome. This makes such a method impractical for the isolation of mammalian protein genes when the corresponding mRNAs are unavailable.” (Citations omitted).
  • Erythropoiesis the production of red blood cells, occurs continuously throughout the human life span to offset cell destruction. Erythropoiesis is a very precisely controlled physiological mechanism enabling sufficient numbers of red blood cells to be available in the blood for proper tissue oxygenation, but not so many that the cells would impede circulation. The formation of red blood cells occurs in the bone marrow and is under the control of the hormone, erythropoietin.
  • Erythropoietin an acidic glycoprotein of approximately 34,000 dalton molecular weight, may occur in three forms: ⁇ , ⁇ and asialo.
  • the ⁇ and ⁇ forms differ slightly in carbohydrate components, but have the same potency, biological activity and molecular weight.
  • the asialo form is an ⁇ or ⁇ form with the terminal carbohydrate (sialic acid) removed.
  • Erythropoietin is present in very low concentrations in plasma when the body is in a healthy state wherein tissues receive sufficient oxygenation from the existing number of erythrocytes. This normal low concentration is enough to stimulate replacement of red blood cells which are lost normally through aging.
  • the amount of erythropoietin in the circulation is increased under conditions of hypoxia when oxygen transport by blood cells in the circulation is reduced.
  • Hypoxia may be caused by loss of large amounts of blood through hemorrhage, destruction of red blood cells by over-exposure to radiation, reduction in oxygen intake due to high altitudes or prolonged unconsciousness, or various forms of anemia.
  • erythropoietin will increase red blood cell production by stimulating the conversion of primitive precursor cells in the bone marrow into proerythroblasts which subsequently mature, synthesize hemoglobin and are released into the circulation as red blood cells.
  • the number of red blood cells in circulation is greater than needed for normal tissue oxygen requirements, erythropoietin in circulation is decreased.
  • erythropoietin is essential in the process of red blood cell formation, the hormone has potential useful application in both the diagnosis and the treatment of blood disorders characterized by low or defective red blood cell production. See, generally, Pennathur-Das, et al., Blood, 63(5), 1168-71 (1984) and Haddy, Am. Jour. Ped. Hematol./Oncol., 4, 191-196, (1982) relating to erythropoietin in possible therapies for sickle cell disease, and Eschbach, et al. J. Clin. Invest., 74(2), pp.
  • U.S. Pat. No. 3,033,753 describes a method for partially purifying erythropoietin from sheep blood plasma which provides low yields of a crude solid extract containing erythropoietin.
  • a polyclonal, serum-derived antibody directed against erythropoietin is developed by injecting an animal, preferably a rat or rabbit, with human erythropoietin.
  • the injected human erythropoietin is recognized as a foreign antigenic substance by the immune system of the animal and elicits production of antibodies against the antigen.
  • Differing cells responding to stimulation by the antigenic substance produce and release into circulation antibodies slightly different from those produced by other responding cells.
  • the antibody activity remains in the serum of the animal when its blood is extracted.
  • HB8209 which produces a highly specific monoclonal, anti-erythropoietin antibody which is also specifically immunoreactive with a polypeptide comprising the following sequence of amino acids: NH 2 -Ala-Pro-Pro-Arg-Leu-Ile-Cys-Asp-Ser-Arg-Val-Leu-Glu-Arg-Tyr-Leu-Leu-Glu-Ala-Lys-COOH.
  • the polypeptide sequence is one assigned to the first twenty amino acid residues of mature human erythropoietin isolated according to the method of Miyake, et al., J. Biol.
  • polyclonal and monoclonal antibodies as described above provide highly useful materials for use in immunoassays for detection and quantification of erythropoietin and can be useful in the affinity purification of erythropoietin, it appears unlikely that these materials can readily provide for the large scale isolation of quantities of erythropoietin from mammalian sources sufficient for further analysis, clinical testing and potential wide-ranging therapeutic use of the substance in treatment of, e.g., chronic kidney disease wherein diseased tissues fail to sustain production of erythropoietin.
  • the twenty amino acid sequence employed to generate the above-named monoclonal antibody produced by A.T.C.C. No. HB8209 does not admit to the construction of an unambiguous, 60 base oligonucleotide probe in the manner described by Anderson, et al., supra. It is estimated that the human gene for erythropoietin may appear as a "single copy gene" within the human genome and, in any event, the genetic material coding for human erythropoietin is likely to constitute less than 0.00005% of total human genomic DNA which would be present in a genomic library.
  • the present invention provides, for the first time, novel purified and isolated polypeptide products having part or all of the primary structural conformation (i.e., continuous sequence of amino acid residues) and one or more of the biological properties (e.g., immunological properties and in vivo and in vitro biological activity) of naturally-occurring erythropoietin, including allelic variants thereof.
  • These polypeptides are also uniquely characterized by being the product of procaryotic or eucaryotic host expression (e.g., by bacterial, yeast and mammalian cells in culture) of exogenous DNA sequences obtained by genomic or cDNA cloning or by gene synthesis.
  • Products of microbial expression in vertebrate (e.g., mammalian and avian) cells may be further characterized by freedom from association with human proteins or other contaminants which may be associated with erythropoietin in its natural mammalian cellular environment or in extracellular fluids such as plasma or urine.
  • the products of typical yeast (e.g., Saccaromyces cerevisiae) or procaryote (e.g., E.coli) host cells are free of association with any mammalian proteins.
  • polypeptides of the invention may be glycosylated with mammalian or other eucaryotic carbohydrates or may be non-glycosylated.
  • Polypeptides of the invention may also include an initial methionine amino acid residue (at position-1).
  • Novel glycoprotein products of the invention include those having a primary structural conformation sufficiently duplicative of that of a naturally-occurring (e.g., human) erythropoietin to allow possession of one or more of the biological properties thereof and having an average carbohydrate composition which differs from that of naturally-occurring (e.g., human) erythropoietin.
  • a naturally-occurring e.g., human
  • erythropoietin erythropoietin
  • Vertebrate (e.g., COS-1 and CHO) cells provided by the present invention comprise the first cells ever available which can be propagated in vitro continuously and which upon growth in culture are capable of producing in the medium of their growth in excess of 100 U (preferably in excess of 500 U and most preferably in excess of 1,000 to 5,000 U) of erythropoietin per 10 6 cells in 48 hours as determined by radioimmunoassay.
  • synthetic polypeptides wholly or partially duplicative of continuous sequences of erythropoietin amino acid residues which are herein for the first time elucidated.
  • sequences by virtue of sharing primary, secondary or tertiary structural and conformational characteristics with naturally-occurring erythropoietin may possess biological activity and/or immunological properties in common with the naturally-occurring product such that they may be employed as biologically active or immunological substitutes for erythropoietin in therapeutic and immunological processes.
  • monoclonal and polyclonal antibodies generated by standard means which are immunoreactive with such polypeptides and, preferably, also immunoreactive with naturally-occurring erythropoietin.
  • Illustrating the present invention are cloned DNA sequences of monkey and human species origins and polypeptide sequences suitably deduced therefrom which represent, respectively, the primary structural conformation of erythropoietins of monkey and human species origins.
  • novel biologically functional viral and circular plasmid DNA vectors incorporating DNA sequences of the invention and microbial (e.g., bacterial, yeast and mammalian cell) host organisms stably transformed or transfected with such vectors.
  • microbial e.g., bacterial, yeast and mammalian cell
  • novel methods for the production of useful polypeptides comprising cultured growth of such transformed or transfected microbial hosts under conditions facilitative of large scale expression of the exogenous, vector-borne DNA sequences and isolation of the desired polypeptides from the growth medium, cellular lysates or cellular membrane fractions.
  • Isolation and purification of microbially expressed polypeptides may be by conventional means including, e.g., preparative chromatographic separations and immunological separations involving monoclonal and/or polyclonal antibody preparations.
  • the present invention provides for the total and/or partial manfucture of DNA sequences coding for erythropoietin and including such advantageous characteristics as incorporation of codons "preferred" for expression by selected non-mammalian hosts, provision of sites for cleavage by restriction endonuclease enzymes and provision of additional initial, terminal or intermediate DNA sequences which facilitate construction of readily expressed vectors.
  • the present invention provides for manufacture (and development by site specific mutagenesis of cDNA and genomic DNA) of DNA sequences coding for microbial expression of polypeptide analogs or derivatives of erythropoietin which differ from naturally-occurring forms in terms of the identity or location of one or more amino acid residues (i.e., deletion analogs containing less than all of the residues specified for EPO and/or substitution analogs wherein one or more residues specified are replaced by other residues and/or addition analogs wherein one or more amino acid residues is added to a terminal or medial portion of the polypeptide); and which share some or all the properties of naturally-occurring forms.
  • Novel DNA sequences of the invention include all sequences useful in securing expression in procaryotic or eucaryotic host cells of polypeptide products having at least a part of the primary structural conformation and one or more of the biological properties of erythropoietin which are comprehended by: (a) the DNA sequences set out in FIGS. 5, and 6 herein or their complementary strands; (b) DNA sequences which hybridize (under hybridization conditions such as illustrated herein or more stringent conditions) to DNA sequences defined in (a) or fragments thereof; and (c) DNA sequences which, but for the degeneracy of the genetic code, would hybridize to DNA sequences defined in (a) and (b) above.
  • part (b) are genomic DNA sequences encoding allelic variant forms of monkey and human erythropoietin and/or encoding other mammalian species of erythropoietin.
  • part (c) are manufactured DNA sequences encoding EPO, EPO fragments and EPO analogs which DNA sequences may incorporate codons facilitating translation of messenger RNA in non-vertebrate hosts.
  • Comprehended by the present invention is that class of polypeptides coded for by portions of the DNA complement to the top strand human genomic DNA sequence of FIG. 6 herein, i.e., "complementary inverted proteins" as described by Tramontano, et al., Nucleic Acids Research, 12, pp. 5049-5059 (1984).
  • compositions comprising effective amounts of polypeptide products of the invention together with suitable diluents, adjuvants and/or carriers which allow for provision of erythropoietin therapy, especially in the treatment of anemic disease states and most especially such anemic states as attend chronic renal failure.
  • Polypeptide products of the invention may be "labelled" by covalent association with a detectable marker substance (e.g., radiolabelled with 125 I) to provide reagents useful in detection and quantification of erythropoietin in solid tissue and fluid samples such as blood or urine.
  • DNA products of the invention may also be labelled with detectable markers (such as radiolabels and non-isotopic labels such as biotin) and employed in DNA hybridization processes to locate the erythropoietin gene position and/or the position of any related gene family in the human, monkey and other mammalian species chromosomal map. They can also be used for identifying the erythropoietin gene disorders at the DNA level and used as gene markers for identifying neighboring genes and their disorders.
  • detectable marker substance e.g., radiolabelled with 125 I
  • detectable markers such as radiolabels and non-isotopic labels such as biotin
  • the present invention further provides significant improvements in methods for detection of a specific single stranded polynucleotide of unknown sequence in a heterogeneous cellular or viral sample including multiple single-stranded polynucleotides
  • a mixture of labelled single-stranded polynucleotide probes is prepared having uniformly varying sequences of bases, each of said probes being potentially specifically complementary to a sequence of bases which is putatively unique to the polynucleotide to be detected,
  • the specific polynucleotide is detected by monitoring for the presence of a hybridization reaction between it and a totally complementary probe within said mixture of labelled probes, as evidenced by the presence of a higher density of labelled material on the substrate at the locus of the specific polynucleotide in comparison to a background density of labelled material resulting from non-specific binding of labelled probes to the substrate.
  • the procedures are especially effective in situations dictating use of 64, 128, 256, 512, 1024 or more mixed polynucleotide probes having a length of 17 to 20 bases in DNA/DNA or RNA/RNA or DNA/RNA hybridizations.
  • the above-noted improved procedures have illustratively allowed for the identification of cDNA clones coding for erythropoietin of monkey species origins within a library prepared from anemic monkey kidney cell mRNA. More specifically, a mixture of 128 uniformly varying 20-mer probes based on amino acid sequence information derived from sequencing fractions of human erythropoietin was employed in colony hybridization procedures to identify seven "positive" erythropoietin cDNA clones within a total of 200,000 colonies. Even more remarkably, practice of the improved procedures of the invention have allowed for the rapid isolation of three positive clones from within a screening of 1,500,000 phage plaques constituting a human genomic library. This was accomplished through use of the above-noted mixture of 128 20-mer probes together with a second set of 128 17-mer probes based on amino acid analysis of a different continuous sequence of human erythropoietin.
  • the above-noted illustrative procedures constitute the first known instance of the use of multiple mixed oligonucleotide probes in DNA/DNA hybridization processes directed toward isolation of mammalian genomic clones and the first known instance of the use of a mixture of more than 32 oligonucleotide probes in the isolation of cDNA clones.
  • FIG. 1 is a graphic representation of a radioimmunoassay analysis of products of the invention
  • FIG. 2 shows vector pDSVL-MkE.
  • FIG. 3 shows vector pSVgHuEPO.
  • FIG. 4 shows vector pDSVL-gHuEPO.
  • FIGS. 5A, 5B and 5C (collectively referred to as FIG. 5) how the sequence of monkey EPO cDNA and the encoded EPO.
  • FIGS. 6A, 6B, 6C, 6D and 6E (collectively referred to as FIG. 6) show the sequence of human genomic EPO DNA and the encoded EPO.
  • FIG. 7 shows the sequence of the ECEPO gene.
  • FIG. 8 shows the sequence of the SCEPO gene.
  • FIG. 9 shows a comparison of the human and monkey EPO polypeptides.
  • FIG. 10 shows the ECEPO section 1 oligonucleotides.
  • FIG. 11 shows section 1 of the ECEPO gene.
  • FIG. 12 shows the ECEPO section 2 oligonucleotides.
  • FIG. 13 shows section 2 of the ECEPO gene.
  • FIG. 14 shows the ECEPO section 3 oligonucleotides.
  • FIG. 15 shows section 3 of the ECEPO gene.
  • FIG. 16 shows the SCEPO section 1 oligonucleotides.
  • FIG. 17 shows section 1 of the SCEPO gene.
  • FIG. 18 shows the SCEPO section 2 oligonucleotides.
  • FIG. 19 shows section 2 of the SCEPO gene.
  • FIG. 20 shows the SCEPO section 3 oligonucleotides.
  • FIG. 21 shows section 3 of the SCEPO gene.
  • DNA sequences encoding part or all of the polypeptide sequence of human and monkey species erythropoietin have been isolated and characterized. Further, the monkey and human origin DNA has been made the subject of eucaryotic and procaryotic expression providing isolatable quantities of polypeptides displaying biological (e.g., immunological) properties of naturally-occurring EPO as well as both in vivo and in vitro biological activities of EPO.
  • biological e.g., immunological
  • the DNA of monkey species origins was isolated from a cDNA library constructed with mRNA derived from kidney tissue of a monkey in a chemically induced anemic state and whose serum was immunologically determined to include high levels of EPO compared to normal monkey serum.
  • the isolation of the desired cDNA clones containing EPO encoding DNA was accomplished through use of DNA/DNA colony hybridization employing a pool of 128 mixed, radiolabelled, 20-mer oligonucleotide probes and involved the rapid screening of 200,000 colonies. Design of the oligonucleotide probes was based on amino acid sequence information provided by enzymatic fragmentation and sequencing a small sample of human EPO.
  • the DNA of human species origins was isolated from a human genomic DNA library.
  • the isolation of clones containing EPO-encoding DNA was accomplished through DNA/DNA plaque hybridization employing the above-noted pool of 128 mixed 20-mer oligonucleotide probes and a second pool of 128 radiolabelled 17-mer probes whose sequences were based on amino acids sequence information obtained from a different enzymatic human EPO fragment.
  • a selected positive monkey cDNA clone and a selected positive human genomic clone were each inserted in a "shuttle" DNA vector which was amplified in E.coli and employed to transfect mammalian cells in culture. Cultured growth of transfected host cells resulted in culture medium supernatant preparations estimated to contain as much as 3000 mU of EPO per ml of culture fluid.
  • Example 1 is directed to amino acid sequencing of human EPO fragments and construction of mixtures of radiolabelled probes based on the results of this sequencing.
  • Example 2 is generally directed to procedures involved in the identification of positive monkey cDNA clones and thus provides information concerning animal treatment and preliminary radioimmunoassay (RIA) analysis of animal sera.
  • Example 3 is directed to the preparation of the cDNA library, colony hybridization screening and verification of positive clones, DNA sequencing of a positive cDNA clone and the generation of monkey EPO polypeptide primary structural conformation (amino acid sequence) information.
  • Example 4 is directed to procedures involved in the identification of positive human genomic clones and thus provides information concerning the source of the genomic library, plaque hybridization procedures and verification of positive clones.
  • Example 5 is directed to DNA sequencing of a positive genomic clone and the generation of human EPO polypeptide amino acid sequence information including a comparison thereof to the monkey EPO sequence information.
  • Example 6 is directed to procedures for construction of a vector incorporating EPO-encoding DNA derived from a positive monkey cDNA clone, the use of the vector for transfection of COS-1 cells and cultured growth of the transfected cells.
  • Example 7 is directed to procedures for construction of a vector incorporating EPO-encoding DNA derived from a positive human genomic clone, the use of the vector for transfection of COS-1 cells and the cultured growth of the transfected cells.
  • Example 8 is directed to immunoassay procedures performed on media supernatants obtained from the cultured growth of transfected cells according to Example 6 and 7.
  • Example 9 is directed to in vitro and in vivo biological activity of microbially expressed EPO of Examples 6 and 7.
  • Example 10 is directed to a development of mammalian host expression systems for monkey species EPO cDNA and human species genomic DNA involving Chinese hamster ovary (“CHO") cells and to the immunological and biological activities of products of these expression systems as well as characterization of such products.
  • Example 11 is directed to the preparation of manufactured genes encoding human species EPO and EPO analogs, which genes include a number of preference codons for expression in E.coli and yeast host cells, and to expression systems based thereon.
  • Example 12 relates to the immunological and biological activity profiles of expression products of the systems of Example 11.
  • Human EPO was isolated from urine and subjected to tryptic digestion resulting in the development and isolation of 17 discrete fragments in quantities approximating 100-150 picomoles.
  • Fragments were arbitrarily assigned numbers and were analyzed for amino acid sequence by microsequence analysis using a gas phase sequencer (Applied Biosystems) to provide the sequence information set out in Table I, below, wherein single letter codes are employed and "X" designates a residue which was not unambiguously determined.
  • Oligonucleotide probes were labelled at the 5' end with gamma - 32 P-ATP, 7500-8000 Ci/mmole (ICN) using T 4 polynucleotide kinase (NEN).
  • Radioimmunoassay procedures applied for quantitative detection of EPO in samples were conducted according to the following procedures:
  • erythropoietin standard or unknown sample was incubated together with antiserum for two hours at 37° C. After the two hour incubation, the sample tubes were cooled on ice, 125 I-labelled erythropoietin was added, and the tubes were incubated at 0° C. for at least 15 more hours.
  • Each assay tube contained 500 ⁇ l of incubation mixture consisting of 50 ⁇ l of diluted immune sera, 10,000 cpm of 125 I-erythropoietin, 5 ⁇ l trasylol and 0-250 ⁇ l of either EPO standard or unknown sample, with PBS containing 0.1% BSA making up the remaining volume.
  • the antiserum used was the second test bleed of a rabbit immunized with a 1% pure preparation of human urinary erythropoietin.
  • the final antiserum dilution on the assay was adjusted so that the antibody-bound 125 I-EPO did not exceed 10-20% of the input total counts. In general, this corresponded to a final antiserum dilution of from 1:50,000 to 1:100,000.
  • the antibody-bound 125 I-erythropoietin was precipitated by the addition of 150 ⁇ l Staph A. After a 40 min. incubation, the samples were centrifuged and the pellets were washed two times with 0.75 ml 10 mM Tris-HCl pH 8.2 containing 0.15 M NaCl, 2 mM EDTA, and 0.05% Triton X-100. The washed pellets were counted in a gamma counter to determine the percent of 125 I-erythropoietin bound. Counts bound by pre-immune sera were subtracted from all final values to correct for nonspecific precipitation. The erythropoietin content of the unknown samples was determined by comparison to the standard curve.
  • RNA was isolated from normal and anemic monkey kidneys by the guanidinium thiocyanate procedure of Chirgwin, et al., Biochemistry, 18, p. 5294 (1979) and poly (A) + mRNA was purified by two runs of oligo(dT)-cellulose column chromatography as described at pp. 197-198 in Maniatis, et al., "Molecular Cloning, A Laboratory Manual” (Cold Springs Harbor Laboratory, Cold Springs Harbor, N.Y., 1982).
  • the cDNA library was constructed according to a modification of the general procedures of Okayama, et al., Mol. and Cell. Biol., 2, pp. 161-170 (1982).
  • pUC8 was used as the sole vector, cut with PstI and then tailed with oligo dT of 60-80 bases in length;
  • HincII digestion was used to remove the oligo dT tail from one end of the vector;
  • first strand synthesis and oligo dG tailing was carried out according to the published procedure;
  • BamHI digestion was employed to remove the oligo dG tail from one end of the vector;
  • replacement of the RNA strand by DNA was in the presence of two linkers (GATCTAAAGACCGTCCCCCCCCC and ACGGTCTTTA) in a three-fold molar excess over the oligo dG tailed vector.
  • Transformed E.coli were spread out at a density of 9000 colonies per 10 ⁇ 10 cm plate on nutrient plates containing 50 micrograms/ml Ampicillin.
  • GeneScreen filters New England Nuclear Catalog No. NEF-972 were pre-wet on a BHI-CAM plate (Bacto brain heart infusion 37 g/L, Casamino acids 2 g/L and agar 15 g/L, containing 500 micrograms/ml Chloramphenicol) and were used to lift the colonies off the plate.
  • the colonies were grown in the same medium for 12 hours or longer to amplify the plasmid copy numbers.
  • the amplified colonies (colony side up) were treated by serially placing the filters over 2 pieces of Whatman 3 MM paper saturated with each of the following solutions:
  • the filters were then air dried in a vacuum over at 80° C. for two hours.
  • the filters were then subjected to Proteinase K digestion through treatment with a solution containing 50 micrograms/ml of the protease enzyme in Buffer K [0.1 M Tris-HCl (pH 8.0) - 0.15 M NaCl - 10 mM EDTA (pH 8.2) -0.2% SDS]. Specifically, 5 ml of the solution was added to each filter and the digestion was allowed to proceed at 55° C. for 30 minutes, after which the solution was removed.
  • Buffer K 0.1 M Tris-HCl (pH 8.0) - 0.15 M NaCl - 10 mM EDTA (pH 8.2) -0.2% SDS.
  • the filters were then treated with 4 ml of a prehybridization buffer (5 ⁇ SSPE-0.5% SDS-100 micrograms/ml SS E.coli DNA - 5 ⁇ BFP).
  • the prehybridization treatment was carried out at 55° C., generally for 4 hours or longer, after which the prehybridization buffer was removed.
  • hybridization process was carried out in the following manner. To each filter was added 3 ml of hybridization buffer (5 ⁇ SSPE-0.5% SOS-100 micrograms/ml yeast tRNA) containing 0.025 picomoles of each of the 128 probe sequences of Table II (the total mixture being designated the EPV mixture) and the filters were maintained at 48° C. for 20 hours. This temperature was 2° C. less than the lowest of the calculated dissociation temperatures (Td) determined for any of the probes.
  • hybridization buffer 5 ⁇ SSPE-0.5% SOS-100 micrograms/ml yeast tRNA
  • the filters were washed three times for ten minutes on a shaker with 6 ⁇ SSC -0.1% SDS at room temperature and washed two to three times with 6 ⁇ SSC-1% SDS at the hybridization temperature (48° C.).
  • Nucleotide sequence analysis of clone 83 was carried out by the procedures of Messing, Methods in Enzymology, 101, pp. 20-78 (1983). Set out in Table IV is a preliminary restriction map analysis of the approximately 1600 base pair EcoRI/HindIII cloned fragment of clone 83. Approximate locations of restriction endonuclease enzyme recognition sites are provided in terms of number of bases 3' to the EcoRI site at the 5' end of the fragment. Nucleotide sequencing was carried out by sequencing individual restriction fragments with the intent of matching overlapping fragments.
  • the presence of a methionine-specifying ATG codon (designated -27) "upstream" of the initial amino terminal alanine residue as the first residue designated for the amino acid sequence of the mature protein is indicative of the likelihood that EPO is initially expressed in the cytoplasm in a precursor form including a 27 amino acid "leader" region which is excised prior to entry of mature EPO into circulation.
  • Potential glycosylation sites within the polypeptide are designated by asterisks.
  • the estimated molecular weight of the translated region was determine to be 21,117 daltons and the M.W. of the 165 residues of the polypeptide constituting mature monkey EPO was determined to be 18,236 daltons.
  • the polypeptide sequence of FIG. 5 may readily be subjected to analysis for the presence of highly hydrophilic regions and/or secondary conformational characteristics indicative of potentially highly immunogenic regions by, e.g., the methods of Hopp, et al., P.N.A.S. (U.S.A.), 78, pp. 3824-3828 (1981) and Kyte et al., J. Mol. Biol., 157, pp. 105-132 (1982) and/or Chou, et al., Biochem., 13, pp. 222-245 (1974) and Advances in Enzymology, 47, pp. 45-47 (1978).
  • Computer-assisted analysis according to the Hopp, et al. method is available by means of a program designated PEP Reference Section 6.7 made available by Intelligenetics, Inc., 124 University Avenue, Palo Alto, Calif.
  • Ch4A phage-borne human fetal liver genomic library prepared according to the procedures of Lawn, et al., Cell, supra, was obtained and maintained for use in a plaque hybridization assay.
  • Phage particles were lysed and the DNAs were fixed on filters (50,000 plaques per filter) according to the procedures of Woo, Methods In Enzymology, 68, pp. 389-395 (1979) except for the use of GeneScreen Plus filters (New England Nuclear Catalog No. NEF-972) and NZYAM plates (NaCl, 5 g; MgCl 2 -6H 2 O, 2 g; NZ-Amine A, 10 g; yeast extract, 5 g; casamino acids, 2 g; maltose; 2 g; and agar, 15 g per liter).
  • GeneScreen Plus filters New England Nuclear Catalog No. NEF-972
  • NZYAM plates NaCl, 5 g; MgCl 2 -6H 2 O, 2 g; NZ-Amine A, 10 g; yeast extract, 5 g; casamino acids, 2 g; maltose; 2 g; and agar, 15 g per liter).
  • Example 3 The air-dried filters were baked at 80° C. for 1 hour and then digested with Proteinase K as described in Example 3, Part 8. Prehybridization was carried out with a 1 M NaCl - 1% SDS buffer for 55° C. for 4 hours or more, after which the buffer was removed. Hybridization and post-hybridization washings were carried out as described in Example 3, Part B. Both the mixture of 128 20-mer probes designated EPV and the mixture of 128 17-mer probes of Table III (designated the EPQ mixture) were employed. Hybridization was carried out at 48° C. using the EPV probe mixture. EPQ probe mixture hybridization was carried out at 46° C. --4 degrees below the lowest calculated Td for members of the mixture.
  • the initial continuous DNA sequence designates a top strand of 620 bases in what is apparently an untranslated sequence immediately preceding a translated portion of the human EPO gene. More specifically, the sequence appears to comprise the 5' end of the gene which leads up to a translated DNA region coding for the first four amino acids (--27 through -24) of a leader sequence ("presequence"). Four base pairs in the sequence prior to that encoding the beginning of the leader have not yet been unambiguously determined and are therefore designated by an "X".
  • FIG. 6 identifies a sequence of 568 base pairs in what appears to be an untranslated 3' region of the human EPO gene, two base pairs of which ("X") have not yet been unambiguously sequenced.
  • FIG. 9, below illustrates the extent of polypeptide sequence homology between human and monkey EPO.
  • single letter designations are employed to represent the deduced translated polypeptide sequences of human EPO commencing with residue -27 and the lower continuous line shows the deduced polypeptide sequence of monkey EPO commencing at assigned residue number -27.
  • Asterisks are employed to highlight the sequence homologies.
  • the deduced human and monkey EPO sequences reveal an "additional" lysine (K) residue at (human) position 116.
  • Cross-reference to FIG. 6 indicates that this residue is at the margin of a putative mRNA splice junction in the genomic sequence. Presence of the lysine residue in the human polypeptide sequence was further verified by sequencing of a cDNA human sequence clone prepared from mRNA isolated from COS-1 cells transformed with the human genomic DNA in Example 7, infra.
  • the expression system selected for initial attempts at microbial synthesis of isolatable quantities of EPO polypeptide material coded for by the monkey cDNA provided by the procedures of Example 3 was one involving mammalian host cells (i.e., COS-1 cells, A.T.C.C. No. CRL-1650).
  • the cells were transfected with a "shuttle" vector capable of autonomous replication in E.coli host (by virtue of the presence of pBR322-derived DNA) and the mammalian hosts (by virtue of the presence of SV40 virus-derived DNA).
  • an expression vector was constructed according to the following procedures.
  • the plasmid clone 83 provided in Example 3 was amplified in E.coli and the approximately 1.4 kb monkey EPO-encoding DNA was isolated by EcoRI and HindIII digestion. Separately isolated was an approximately 4.0 kb, HindIII/SalI fragment from pBR322. An approximately 30 bp, EcoRI/SalI "linker” fragment was obtained from M13mp10 RF DNA (P and L Laboratories). This linker included, in series, an EcoRI sticky end, followed by SstI, SmaI, BamHI and XbaI recognition sites and a SalI sticky end.
  • pERS intermediate plasmid
  • the M13 linker fragment was characterized by a HindIII sticky end, followed by PstI, SalI, XbaI recognition sites and a BamHI sticky end.
  • the ligation product was, again, a useful intermediate plasmid ("pBR-EPO") including the EPO DNA flanked on both sides by banks of restriction site.
  • the vector chosen for expression of the EPO DNA in COS-1 cells (“pDSVL1”) had previously been constructed to allow for selection and autonomous replication in E.coli. These characteristics are provided by the origin of replication and Ampicillin resistance gene DNA sequences present in the region spanning nucleotides 2448 through 4362 of pBR322. This sequence was structurally modified by the addition of a linker providing a HindIII recognition immediately adjacent nucleotide 2448 prior to incorporation into the vector. Among the selected vector's other useful properties was the capacity to autonomously replicate in COS-1 cells and the presence of a viral promoter sequence functional in mammalian cells.
  • the mammalian gene comprised an approximately 2,500 bp mouse dihydrofolate reductase (DHFR) mini-gene isolated from plasmid pMG-1 as in Gasser, et al., P.N.A.S. (U.S.A.), 79, pp.
  • DHFR dihydrofolate reductase
  • plasmid pDSVL1 comprise nucleotides 2448 through 4362 of pBR322 along with nucleotides 5171 through 270 (342bp) and 2553 through 2770 (237bp) of SV40 DNA.
  • the EPO-encoding DNA was isolated from plasmid pBR-EPO as a BamHI fragment and ligated into plasmid pDSVL1 cut with BamHI. Restriction enzyme analysis was employed to confirm insertion of the EPO gene in the correct orientation in two of the resulting cloned vectors (duplicate vectors H and L). See FIG. 2, illustrating plasmid pDSVL-MkE. Vectors with EPO genes in the wrong orientation (Vectors F, X and G) were saved for use as negative controls in transfection experiments designed to determine EPO expression levels in hosts transformed with vectors having EPO DNA in the correct orientation.
  • Vectors H, L, F, X and G were combined with carrier DNA (mouse liver and spleen DNA) were employed to transfect duplicate 60 mm plates by calcium phosphate microprecipitate methods. Duplicate 60 mm plates were also transfected with carrier DNA as a "mock" transformation negative control. After five days all culture media were tested for the presence of polypeptides possessing the immunological properties of naturally-occurring EPO.
  • the human EPO gene was first sub-cloned into a "shuttle" vector which is capable of autonomous replication in both E.coli hosts (by virtue of the presence of pBR322 derived DNA) and in the mammalian cell line COS-1 (by virtue of the presence of SV40 virus derived DNA).
  • the shuttle vector, containing the EPO gene was then transfected into COS-1 cells. EPO polypeptide material was produced in the transfected cells and secreted into the cell culture media.
  • an expression vector was constructed according to the following procedures. DNA isolated from lambda clone ⁇ hE1, containing the human genomic EPO gene, was digested with BamHI and HindIII restriction endonucleases, and a 5.6 Kb DNA fragment known to contain the entire EPO gene was isolated. This fragment was mixed and ligated with the bacterial plasmid pUC8 (Bethesda Research Laboratories, Inc.) which had been similarly digested, creating the intermediate plasmid "pUC8 HuE", providing a convenient source of this restriction fragment.
  • Plasmid pSV4SEt contained DNA sequences allowing selection and autonomous replication in E.coli. These characteristics are provided by the origin of replication and Ampicillin resistance gene DNA sequences present in the region spanning nucleotides 2448 through 4362 of the bacterial plasmid pBR322. This sequence was structurally modified by the addition of a linker providing a HindIII recognition site immediately adjacent to nucleotide 2448. Plasmid pSV4SEt was also capable of autonomous replication in COS-1 cells. This characteristic was provided by a 342 bp fragment containing the SV40 virus origin of replication (nucleotide numbers 5171 through 270).
  • This fragment had been modified by the addition of a linker providing an EcoRI recognition site adjacent to nucleotide 270 and a linker providing a Sall recognition site adjacent nucleotide 5171.
  • a 1061 bp fragment of SV40 was also present in this vector (nucleotide numbers 1711 through 2772 plus a linker providing a Sall recognition site next to nucleotide number 2772). Within this fragment was an unique BamHI recognition sequence.
  • plasmid pSV4SEt contained unique BamHI and HindIII recognition sites, allowing insertion of the human EPO gene, sequences allowing replication and selection in E.coli, and sequences allowing replication in COS-1 cells.
  • plasmid pUC8-HuE was digested with BamHI and HindIII restriction endonucleases and the 5.6 kb EPO encoding DNA fragment isolated.
  • pSV4SEt was also digested with BamHI and HindIII and the major 2513 bp fragment isolated (preserving all necessary functions). These fragments were mixed and ligated, creating the final vector "pSVgHuEPO". (See, FIG. 3.) This vector was propagated in E.coli and vector DNA isolated. Restriction enzyme analysis was employed to confirm insertion of the EPO gene.
  • Plasmid pSVgHuEPO DNA was used to express human EPO polypeptide material in COS-1 cells. More specifically, pSVgHuEPO DNA was combined with carrier DNA and transfected into triplicate 60 mm plates of COS-1 cells. As a control, carrier DNA alone was also transfected into COS-1 cells. Cell culture media were sampled five and seven days later and tested for the presence of polypeptides possessing the immunological properties of naturally occurring human EPO.
  • Still another system was designed to provide improved production of human EPO polypeptide material coded by the human genomic DNA EPO clone in COS-1 cells (A.T.C.C. No. CRL-1650).
  • EPO was expressed in COS-1 cells using its own promoter which is within the 5.6 Kb BamHI to HindIII restriction fragment.
  • the EPO gene is altered so that it is expressed using the SV40 late promoter.
  • the cloned 5.6 Kb BamHI to HindIII genomic human EPO restriction fragment was modified by the following procedures. Plasmid pUC8-HuE, as described above, was cleaved with BamHI and with BstEII restriction endonucleases. BstEII cleaves within the 5.6 Kb EPO gene at a position which is 44 base pairs 5' to the initiating ATG coding for the pre-peptide and approximately 680 base pairs 3' to the HindIII restriction site. The approximately 4900 base pair fragment was isolated. A synthetic linker DNA fragment, containing SalI and BstEII sticky ends and an internal BamHI recognition site was synthesized and purified.
  • the two fragments were mixed and ligated with plasmid pBR322 which had been cut with SalI and BamHI to produce the intermediate plasmid pBRgHE.
  • the genomic human EPO gene can be isolated therefrom as a 4900 base pair BamHI digestion fragment carrying the complete structural gene with a single ATG 44 base pairs 3' to BamHI site adjacent the amino terminal coding region.
  • This fragment was isolated and inserted as a BamHI fragment into BamHI cleaved expression vector plasmid pDSVL1 (described in Example 6).
  • the resulting plasmid, pSVLgHuEPO, as illustrated in FIG. 4, was used to express EPO polypeptide material from COS-1 cells, as described in Examples 6 and 7A.
  • Example 6 Culture media from growth of the six transfected COS-1 cultures of Example 6 were analyzed by radioimmunoassay according to the procedures set forth in Example 2, Part B. Each sample was assayed at 250, 125, 50, and 25 microliter aliquot levels. Supernatants from growth of cells mock transfected or transfected with vectors having incorrect EPO gene orientation were unambiguously negative for EPO immunoreactivity. For each sample of the two supernatants derived from growth of COS-1 cells transfected with vectors (H and L) having the EPO DNA in the correct orientation, the % inhibition of 125 I-EPO binding to antibody ranged from 72 to 88%, which places all values at the top of the standard curve. The exact concentration of EPO in the culture supernatant could not then reliably be estimated. A quite conservative estimate of 300 mU/ml was made, however, from the value calculation of the largest aliquot size (250 microliter).
  • Example 6 A representative culture fluid according to Example 6 and five and seven day culture fluids obtained according to Example 7A were tested in the RIA in order to compare activity of recombinant monkey and human EPO materials to a naturally-occurring human EPO standard and the results are set out in graphic form in FIG. 1. Briefly, the results expectedly revealed that the recombinant monkey EPO significantly competed for anti-human EPO antibody although it was not able to completely inhibit binding under the test conditions. The maximum percent inhibition values for recombinant human EPO, however, closely approximated those of the human EPO standard. The parallel nature of the dose response curves suggests immunological identity of the sequences (epitopes) in common.
  • Culture fluids prepared according to Examples 6 and 7 were subjected to an in vitro assay for EPO activity according to the procedure of Goldwasser, et al., Endocrinology, 97, 1, pp. 315-323 (1975).
  • Estimated monkey EPO values for culture fluids tested ranged from 3.2 to 4.3 U/ml.
  • Human EPO culture fluids were also active in this in vitro assay and, further, this activity could be neutralized by anti-EPO antibody.
  • the recombinant monkey EPO culture fluids according to Example 6 were also subjected to an assay for in vivo biological activity according to the general procedures of Cotes, et al., Nature, 191, pp. 1065-1067 (1961) and Hammond, et al., Ann. N.Y. Acad. Sci., 149, pp. 516-527 (1968) and activity levels ranged from 0.94 to 1.24 U/ml.
  • recombinant monkey or human EPO material was produced from vectors used to transfect COS-1 cells. These vectors replicate in COS-1 cells due to the presence of SV40 T antigen within the cell and an SV40 origin of replication on the vectors. Though these vectors produce useful quantities of EPO in COS-1 cells, expression is only transient (7 to 14 days) due to the eventual loss of the vector. Additionally, only a small percentage of COS-1 became productively transfected with the vectors.
  • the present example describes expression systems employing Chinese hamster ovary (CHO) DHFR - cells and the selectable marker, DHFR. [For discussion of related expression systems, see U.S. Pat. No. 4,399,216 and European Patent Applications 117058, 117059 and 117060, all published Aug. 29, 1984.]
  • CHO DHFR - cells (DuX-Bll) CHO K1 cells, Urlaub, et al., Proc. Nat. Acad. Sci. (U.S.A.), Vol. 77, 4461 (1980) lack the enzyme dihydrofolate reductase (DHFR) due to mutations in the structural genes and therefore require the presence of glycine, hypoxanthine, and thymidine in the culture media.
  • DHFR dihydrofolate reductase
  • Plasmids pDSVL-MkE (Example 6) or pDSVL-gHuEPO (Example 7B) were transfected along with carrier DNA into CHO DHFR - cells growing in media containing hypoxanthine, thymidine, and glycine in 60 mm culture plates.
  • Plasmid pSVgHuEPO (Example 7A) was mixed with the plasmid pMG2 containing a mouse dihydrofolate reductase gene cloned into the bacterial plasmid vector pBR322 (per Gasser, et al., supra.) The plasmid mixture and carrier DNA was transfected into CHO DHFR - cells.
  • Cells which acquire one plasmid will generally also acquire a second plasmid.
  • the cells were dispersed by trypsinization into several 100 mm culture plates in media lacking hypoxanthine and thymidine. Only those cells which have been stably transformed with the DHFR gene, and thereby the EPO gene, survive in this media. After 7-21 days, colonies of surviving cells became apparent. These transformant colonies, after dispersion by trypsinization can be continuously propagated in media lacking hypoxanthine and thymidine, creating new cell strains (e.g., CHO pDSVL-MkEPO, CHO pSVgHuEPO, CHO-pDSVL-gHuEPO).
  • Culture fluids from the above cell strains were tested in the RIA for the presence of recombinant monkey or human EPO.
  • Media for strain CHO pDSVL-MkEPO contained EPO with immunological properties like that obtained from COS-1 cells transfected with plasmid pDSVL-MkEPO.
  • a representative 65 hour culture fluid contained monkey EPO at 0.60 U/ml.
  • Culture fluids from CHO pSVgHuEPO and CHO pDSVL-gHuEPO contained recombinant human EPO with immunological properties like that obtained with COS-1 cells transfected with plasmid pSVgHuEPO or pDSVL-gHuEPO.
  • a representative 3 day culture fluid from CHO pSVgHuEPO contained 2.99 U/ml of human EPO and a 5.5 day sample from CHO pDSVL-gHuEPO had 18.2 U/ml of human EPO as measured by the RIA.
  • the quantity of EPO produced by the cell strains described above can be increased by gene amplification giving new cell strains of greater productivity.
  • the enzyme dihydrofolate reductase (DHFR) which is the product coded for by the DHFR gene can be inhibited by the drug methotrexate (MTX). More specifically, cells propagated in media lacking hypoxanthine and thymidine are inhibited or killed by MTX. Under the appropriate conditions, (e.g., minimal concentrations of MTX) cells resistant to and able to grow in MTX can be obtained. These cells are found to be resistent to MTX due to an amplification of the number of their DHFR genes, resulting in increased production of DHFR enzyme.
  • MTX drug methotrexate
  • the surviving cells can, in turn, be treated with increasing concentrations of MTX, resulting in cell strains containing greater numbers of DHFR genes.
  • Passenger genes e.g., EPO
  • EPO Error genes
  • cell strain CHO pDSVL-MkE was subjected to increasing MTX concentrations (0 nM, 30 nM and 100 nM). Representative 65-hour culture media samples from each amplification step were assayed by RIA and determined to contain 0.60, 2.45 and 6.10 U/ml, respectively.
  • Cell strain CHO pDSVL-gHuEPO was subjected to a series of increasing MTX concentrations of 30 nM, 50 nM, 100 nM, 200 nM, 1 ⁇ M, and 5 ⁇ M MTX.
  • a representative 3-day culture media sample from the 100 nM MTX step contained human EPO at 3089 ⁇ 129 u/ml as judged by RIA.
  • Representative 48 hour cultural medium samples from the 100 nM and 1 ⁇ M MTX steps contained, respectively, human EPO at 466 and 1352 U/ml as judged by RIA (average of triplicate assays).
  • 1 ⁇ 10 6 cells were plated in 5 ml of media in 60 mm culture dishes. Twenty-four hours later the media were removed and replaced with 5 ml of serum-free media (high glucose DMEM supplemented with 0.1 mM non-essential amino acids and L-glutamine). EPO was allowed to accumulate for 48 hours in the serum-free media. The media was collected for RIA assay and the cells were trypsinized and counted.
  • the average cell numbers per plate were 1.94 ⁇ 10 6 and 3.12 ⁇ 10 6 cells, respectively.
  • the effective production rates for these culture conditions were thus 1264 and 2167 U/10 6 cells/48 hours.
  • the cells in the cultures described immediately above are a genetically heterogeneous population. Standard screening procedures are being employed in an attempt to isolate genetically homogeneous clones with the highest production capacity. See, Section A, Part 2, of "Points to Consider in the Characterization of Cell Lines Used to Produce Biologics" Jun. 1, 1984, Office of Biologics Research Review, Center for Drugs and Biologics, U.S. Food and Drug Administration.
  • the productivity of the EPO producing CHO cell lines described above can be improved by appropriate cell culture techniques.
  • the propagation of mammalian cells in culture generally requires the presence of serum in the growth media.
  • a method for production of erythropoietin from CHO cells in media that does not contain serum greatly facilitates the purification of erythropoietin from the culture medium.
  • the method described below is capable of economically producing erythropoietin in serum-free media in large quantities sufficient for production.
  • Strain CHO pDSVL-gHuEPO cells grown in standard cell culture conditions, are used to seed spinner cell culture flasks.
  • the cells are propagated as a suspension cell line in the spinner cell culture flask in media consisting of a 50-50 mixture of high glucose DMEM and Ham's F12 supplemented with 5% fetal calf serum, L-glutamine, Penicillin and Streptomycin, 0.05 mM non-essential amino acids and the appropriate concentration of methotrexate.
  • Suspension cell culture allows the EPO-producing CHO cells to be expanded easily to large volumes.
  • CHO cells grown in suspension, are used to seed roller bottles at an initial seeding density of 1.5 ⁇ 10 7 viable cells per 850 cm 2 roller bottle in 200 ml of media.
  • the cells are allowed to grow to confluency as an adherent cell line over a three-day period.
  • the media used for this phase of the growth is the same as used for growth in suspension.
  • the serum containing media is removed and replaced with 100 ml of serum-free media; 50-50 mixture of high glucose DMEM and Ham's F12 supplemented with 0.05 mM non-essential amino acids and L-glutamine.
  • the roller bottles are returned to the roller bottle incubator for a period of 1-3 hours and the media again is removed and replaced with 100 ml of fresh serum-free media.
  • the 1-3 hour incubation of the serum-free media reduces the concentration of contaminating serum proteins.
  • the roller bottles are returned to the incubator for seven days during which erythropoietin accumulates in the serum-free culture media.
  • the conditioned media is removed and replaced with fresh serum-free medium for a second production cycle.
  • a representative seven-day, serum-free media sample contained human erythropoietin at 3892 ⁇ 409 U/ml as judged by the RIA.
  • each 850 cm 2 roller bottle contained from 0.75 to 1.5 ⁇ 10 8 cells and thus the rate of production of EPO in the 7-day, 100 ml culture was 750 to 1470 U/10 6 cells/48 hours.
  • Culture fluids from cell strain CHO pDSVL-MkEPO carried in 10 nM MTX were subjected to RIA in vitro and in vivo EPO activity assays.
  • the conditioned media sample contained 41.2 ⁇ 1.4 U/ml of MkEPO as measured by the RIA, 41.2 ⁇ 0.064 U/ml as measured by the in vitro biological activity assay and 42.5 ⁇ 5 U/ml as measured by the in vivo biological activity assay.
  • Amino acid sequencing of polypeptide products revealed the presence of EPO products, a principle species having 3 residues of the "leader" sequence adjacent the putative amino terminal alanine. Whether this is the result of incorrect membrane processing of the polypeptide in CHO cells or reflects a difference in structure of the amino terminus of monkey EPO vis-a-vis human EPO, is presently unknown.
  • Culture fluids from cell strain CHO pDSVL-gHuEPO were subjected to the three assays.
  • a 5.5 day sample contained recombinant human EPO in the media at a level of 18.2 U/ml by RIA assay, 15.8 ⁇ 4.6 U/ml by in vitro assay and 16.8 ⁇ 3.0 U/ml by in vivo assay.
  • Culture fluid from CHO pDSVL-gHuEPO cells prepared amplified by stepwise 100 nM MTX were subjected to the three assays.
  • a 3.0 day sample contained recombinant human EPO at a level of 3089 ⁇ 129 U/ml by RIA, 2589 ⁇ 71.5 U/ml by in vitro assay, and 2040 ⁇ 160 U/ml by in vivo assay.
  • Amino acid sequencing of this product reveals an amino terminal corresponding to that designated in FIG. 6.
  • EPO-CCM EPO activity of 221 ⁇ 5.1 U/ml
  • mice Over the course of 5 weeks, the seven mice were injected intraperitoneally, 3 times per week. After the eighth injection, average hematocrit values for the control group were determined to be 50.4%; for the 4U group, 55.1%; and, for the 44U group, 67.9%.
  • Mammalian cell expression products may be readily recovered in substantially purified form from culture media using HPLC (C 4 ) employing an ethanol gradient, preferably at pH7.
  • Corresponding values for the recombinant product were as follows: Hexoses, 15.09; N-acetylglucosamine, 1; N-acetylneuraminic acid, 0.998; Fucose, 0; and N-acetylgalactosamine, 0. These findings are consistent with the Western blot and SDS-PAGE analysis described above.
  • Glycoprotein products provided by the present invention are thus comprehensive of products having a primary structural conformation sufficiently duplicative of that of a naturally-occurring erythropoietin to allow possession of one or more of the biological properties thereof and having an average carbohydrate composition which differs from that of naturally-occurring erythropoietin.
  • the present example relates to the total manufacture by assembly of nucleotide bases of two structural genes encoding the human species EPO sequence of FIG. 6 and incorporating, respectively "preferred" codons for expression in E.coli and yeast (S.cerevisiae) cells. Also described is the construction of genes encoding analogs of human EPO. Briefly stated, the protocol employed was generally as set out in the previously noted disclosure of Alton, et al. (WO 83/04053). The genes were designed for initial assembly of component oligonucleotides into multiple duplexes which, in turn, were assembled into three discrete sections. These sections were designed for ready amplification and, upon removal from the amplification system, could be assembled sequentially or through a multiple fragment ligation in a suitable expression vector.
  • FIGS. 10 through 15 and 7 illustrate the design and assembly of a manufactured gene encoding a human EPO translation product lacking any leader or presequence but including an initial methionine residue at position -1. Moreoever, the gene incorporated in substantial part E.coli preference codons and the construction was therefore referred to as the "ECEPO" gene.
  • FIG. 10 illustrates oligonucleotides employed to generate the Section 1 of the ECEPO gene encoding amino terminal residues of the human species polypeptide. Oligonucleotides were assembled into duplexes (1 and 2, 3 and 4, etc.) and the duplexes were then ligated to provide ECEPO Section 1 as in FIG. 11. Note that the assembled section includes respective terminal EcoRI and BamHI sticky ends, that "downstream" of the EcoRI sticky end is a XbaI restriction enzyme recognition site; and that "upstream" of the BamHI sticky end is a KpnI recognition site. Section 1 could readily be amplified using the M13 phage vector employed for verification of sequence of the section.
  • ECEPO gene Sections 2 and 3 were constructed in a similar manner from the oligonucleotides of FIGS. 12 and 14, respectively. Each section was amplified in the M13 vector employed for sequence verification and was isolated from phage DNA. As is apparent from FIG. 13, ECEPO Section 2 was constructed with EcoRI and BamHI sticky ends and could be isolated as a KpnI/BglII fragment. Similarly, ECEPO Section 3 was prepared with BamHI and SalI sticky ends and could be isolated from phage RF DNA as a BglII/SalI fragment. The three sections thus prepared can readily be assembled into a continuous DNA sequence (FIG.
  • Any suitable expression vector may be employed to carry the ECEPO.
  • the particular vector chosen for expression of the ECEPO gene as the "temperature sensitive" plasmid pCFM536 - a derivative of plasmid pCFM414 (A.T.C.C. 40076) - as described in co-pending U.S. patent application Ser. No. 636,727, filed Aug. 6, 1984, (Published EOP Application No. 136,490) by Charles F. Morris. More specifically, pCFM536 was digested with XbaI and HindIII; the large fragment was isolated and employed in a two-part ligation with the ECEPO gene.
  • the manufactured ECEPO gene above may be variously modified to encode erythropoietin analogs such as [Asn 2 , des-Pro 2 through Ile 6 ]hEPO and [His 7 ]hEPO, as described below.
  • Plasmid 536 carrying the ECEPO manufactured gene of FIG. 7 as a XbaI to HindIII insert was digested with HindIII and XhoI.
  • the latter endonuclease cuts the ECEPO gene at a unique, 6 base pair recognition site spanning the last base of the codon encoding Asp 8 through the second base of the Arg 10 codon.
  • a XbaI/XhoI "linker" sequence was manufactured having the following sequence: ##STR33##
  • the XbaI/XhoI linker and the XhoI/HindIII ECEPO gene sequence fragment were inserted into the large fragment resulting from XbaI and HindIII digestion of plasmid pCFM526--a derivative of plasmid pCFM414 (A.T.C.C. 40076]--as described in co-pending U.S. patent application Ser. No. 636,727, filed Aug. 6, 1984, by Charles F. Morris, to generate a plasmid-borne DNA sequence encoding E.coli expression of the Met -1 form of the desired analog.
  • Plasmid 536 was digested with HindIII and XhoI as in part A above.
  • a XbaI/XhoI linker was manufactured having the following sequence: ##STR34##
  • the linker and the XhoI/HindIII ECEPO sequence fragment were then inserted into pCFM526 to generate a plasmid-borne DNA sequence encoding E.coli expression of the Met -1 form of the desired analog.
  • FIGS. 16 through 21 and 8 Construction of a manufactured gene (“SCEPO") incorporating yeast preference codons is as described in the following FIGS. 16 through 21 and 8.
  • SCEPO manufactured gene
  • ECEPO yeast preference codons
  • FIGS. 16 through 21 and 8 the entire construction involved formation of three sets of oligonucleotides (FIGS. 16, 18 and 20) which were formed into duplexes and assembled into sections (FIGS. 17, 19 and 21). Note that synthesis was facilitated in part by use of some sub-optimal codons in both the SCEPO and ECEPO constructions, i.e., oligonucleotides 7-12 of Section 1 of both genes were identical, as were oligonucleotides 1-6 of Section 2 in each gene.
  • the assembled SCEPO sections were sequenced in M13 and Sections 1, 2 and 3 were isolatable from the phage as HindIII/KpnI, KpnI/BglII, and BglII/SalI fragments.
  • the presently preferred expression system for SCEPO gene products is a secretion system based on S.cerevisiae ⁇ -factor secretion, as described in copending U.S. patent application Ser. No. 487,753, filed Apr. 22, 1983, by Grant A. Bitter, published Oct. 31, 1984 as European Patent Application 0 123,294. Briefly put, the system involves constructions wherein DNA encoding the leader sequence of the yeast ⁇ -factor gene product is positioned immediately 5' to the coding region of the exogenous gene to be expressed. As a result, the gene product translated includes a leader or signal sequence which is "processed off" by an endogenous yeast enzyme in the course of secretion of the remainder of the product.
  • the construction makes use of the ⁇ -factor translation initiation (ATG) codon, there was no need to provide such a codon at the -1 position of the SCEPO gene.
  • the alanine (+1) encoding sequence is preceded by a linker sequence allowing for direct insertion into a plasmid including the DNA for the first 80 residues of the ⁇ -factor leader following the ⁇ -factor promoter.
  • the specific preferred construction for SCEPO gene expression involved a four-part ligation including the above-noted SCEPO section fragments and the large fragment of HindIII/SalI digestion of plasmid p ⁇ C3.
  • the ⁇ -factor promoter and leader sequence and SCEPO gene were isolated by digestion with BamHI and ligated into BamHI digested plasmid pYE to form expression plasmid pYE/SCEPO.
  • the present example relates to expression of recombinant products of the manufactured ECEPO and SCEPO genes within the expression systems of Example 11.
  • plasmid p536 of Example 11 was transformed into AM7 E.coli cells previously transformed with a suitable plasmid, pMW1, harboring a C I857 gene.
  • Radioimmunoassay activity for the isolates was at a level of 150,000 to 160,000 U/mg; in vitro assay activity was at a level of 30,000 to 62,000 U/mg; and in vivo assay activity ranged from about 120 to 720 U/mg. (Cf., human urinary isolate standard of 70,000 U/mg in each assay.)
  • the dose response curve for the recombinant product in the in vivo assay differed markedly from that of the human urinary EPO standard.
  • the EPO analog plasmids formed in parts A and B of Example 11 were each transformed into pMW1-transformed AM7 E.coli cells and the cells were cultured as above. Purified isolates were tested in both RIA and in vitro assays. RIA and in vitro assay values for [Asn 2 , des-Pro 2 through Ile 6 ]hEPO expression products were approximately 11,000 U/mg and 6,000 U/mg protein, respectively, while the assay values for [His 7 ]hEPO were about 41,000 U/mg and 14,000 U/mg protein, respectively, indicating that the analog products were from one-fourth to one-tenth as "active" as the "parent" expression product in the assays.
  • plasmid pYE/SCEPO was transformed into two different strains, YSDP4 (genotype ⁇ pep4-3 trpl) and RK81 (genotype ⁇ pep4-3trpl).
  • Transformed YSDP4 hosts were grown in SD medium (Methods in Yeast Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., p. 62 (1983) supplemented with casamino acids at 0.5%, pH 6.5 at 30° C. Media harvested when the cells had been grown to 36 O.D. contained EPO products at levels of about 244 U/ml (97 ⁇ g/OD liter by RIA).
  • Transformed RK81 cells grown to either 6.5 O.D. or 60 O.D. provided media with EPO concentrations of about 80-90 U/ml (34 ⁇ g/OD liter by RIA).
  • Preliminary analyses reveal significant heterogeneity in products produced by the expression system, likely to be due to variations in glycosylation of proteins expressed, and relatively high mannose content of the associated carbohydrate.
  • Plasmids P ⁇ C3 and pYE in HB101 E.coli cells were deposited in accordance with the Rules of Practice of the U.S. Patent Office on Sep. 7, 1984, with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md., under deposit numbers A.T.C.C. 39881 and A.T.C.C. 39882, respectively.
  • Plasmids pCFM526 in AM7 cells, pCFM536 in JM103 cells, and pMW1 in JM103 cells were likewise deposited on Nov. 21, 1984 as A.T.C.C. 39932, 39934, and 39933, respectively. Saccharomyces cerevisiae strains YSPD4 and RK81 were deposited on Nov. 21, 1984 as A.T.C.C. 20734 and 20733, respectively.
  • Polypeptides provided by the invention are conspicuously useful materials, whether they are microbially expressed products or synthetic products, the primary, secondary or tertiary structural conformation of which was first made known by the present invention.
  • polypeptide products of the invention share the in vivo activity of natural EPO isolates they are conspicuously suitable for use in erythropoietin therapy procedures practiced on mammals, including humans, to develop any or all of the effects herefore attributed in vivo to EPO, e.g., stimulation of reticulocyte response, development of ferrokinetic effects (such as plasma iron turnover effects and marrow transit time effects), erythrocyte mass changes, stimulation of hemoglobin C synthesis (see, Eschbach, et al., supra) and, as indicated in Example 10, increasing hematocrit levels in mammals.
  • the minimization of the need for transfusion therapy through use of EPO therapy can be expected to result in reduced transmission of infectious agents.
  • Products of the invention by virtue of their production by recombinant methods, are expected to be free of pyrogens, natural inhibitory substances, and the like, and are thus likely to provide enhanced overall effectiveness in therapeutic processes vis-a-vis naturally derived products.
  • Erythropoietin therapy with products of the present invention is also expected to be useful in the enhancement of oxygen carrying capacity of individuals encountering hypoxic environmental conditions and possibly in providing beneficial cardiovascular effects.
  • a preferred method for administration of polypeptide products of the invention is by parenteral (e.g., IV, IM, SC, or IP) routes and the compositions administered would ordinarily include therapeutically effective amounts of product in combination with acceptable diluents, carriers and/or adjuvants.
  • parenteral e.g., IV, IM, SC, or IP
  • the compositions administered would ordinarily include therapeutically effective amounts of product in combination with acceptable diluents, carriers and/or adjuvants.
  • Preliminary pharmacokinetic studies indicate a longer half-life in vivo for monkey EPO products when administered IM rather than IV.
  • Effective dosages are expected to vary substantially depending upon the condition treated but therapeutic doses are presently expected to be in the range of 0.1 ( ⁇ 7U) to 100 ( ⁇ 7000U) ⁇ g/kg body weight of the active material.
  • Standard diluents such as human serum albumin are contemplated for pharmaceutical compositions of the invention, as are standard carriers such as
  • Adjuvant materials suitable for use in compositions of the invention include compounds independently noted for erythropoietic stimulatory effects, such as testosterones, progenitor cell stimulators, insulin-like growth factor, prostaglandins, serotonin, cyclic AMP, prolactin and triiodothyronine, as well as agents generally employed in treatment of aplastic anemia, such as methenolene, stanozolol and nandrolone [see, e.g., Resegotti, et al., Panminerva Medics, 23,, 243-248 (1981); McGonigle, et al., Kidney Int., 25(2), 437-444 (1984); Pavlovic-Kantera, et al., Expt.
  • erythropoietic stimulatory effects such as testosterones, progenitor cell stimulators, insulin-like growth factor, prostaglandins, serotonin, cyclic AMP, prolactin and triiodo
  • erythropoietin or asialo-EPO also contemplated as adjuvants are substances reported to enhance the effects of, or synergize, erythropoietin or asialo-EPO, such as the adrenergic agonists, thyroid hormones, androgens and BPA [see, Dunn, "Current Concepts in Erythropoiesis", John Wiley and Sons (Chichester, England, 1983); Weiland, et al., Blut, 44(3), 173-175 (1982); Kalmanti, Kidney Int., 22, 383-391 (1982); Shahidi, New. Eng.
  • polypeptides of the invention are similarly extensive and include use in labelled and labelled forms in a variety of immunoassay techniques including RIA's, ELISA's and the like, as well as a variety of in vitro and in vivo activity assays. See, e.g., Dunn, et al., Expt. Hematol., 11(7), 590-800 (1983); Gibson, et al., Pathology, 16, 155-156 (1984); Krystal, Expt. Hematol., 11(7), 649-660 (1983); Saito, et al., Jap. J. Med., 23(1), 16-21 (1984); Nathan, et al., New Eng. J.
  • Polypeptides of the invention including synthetic peptides comprising sequences of residues of EPO first revealed herein, also provide highly useful pure materials for generating polyclonal antibodies and "banks" of monoclonal antibodies specific for differing continuous and discontinuous epitopes of EPO.
  • hEPO 144-166 V-Y-S-N-F-L-R-G-K-L-K-L-Y-T-G-E-A-C-R-T-G-O-R.
  • Preliminary immunization studies employing the above-noted polypeptides have revealed a relatively weak positive response to hEPO 41-57, no appreciable response to hEPO 116-128, and a strong positive resopnse to hEPO 144-166, as measured by capacity of rabbit serum antibodies to immunoprecipitate 125 I-labelled human urinary EPO isolates.
  • Preliminary in vivo activity studies on the three peptides revealed no significant activity either alone or in combination.
  • EPO EPO published application 0 077 670 and the species reported to have glutamine at position No. 140 in Gray, et al., Nature, 295, pp. 503-508 (1982). Both species are characterized as constituting "mature" human ⁇ interferon sequences.)
  • Allelic forms of mature EPO polypeptides may vary from each other and from the sequences of FIGS. 5 and 6 in terms of length of sequence and/or in terms of deletions, substitutions, insertions or additions of amino acids in the sequence, with consequent potential variations in the capacity for glycosylation.
  • one putative allelic form of human species EPO is believed to include a methionine residue at position 126.
  • allelic forms of EPO-encoding DNA genomic and cDNA sequences are also likely to occur which code for the above-noted types of allelic polypeptides or simply employ differing codons for designation of the same polypeptides as specified.
  • EPO products such as polypeptide analogs of EPO and fragments of "mature" EPO.
  • Alton, et al. WO/83/04053
  • modifications of cDNA and genomic EPO genes may be readily accomplished by well-known site-directed mutagenesis techniques and employed to generate analogs and derivatives of EPO.
  • EPO products would share at least one of the biological properties of EPO but may differ in others.
  • projected EPO products of the invention include those which are foreshortened by e.g , deletions [Asn 2 , des-Pro 2 through Ile6]hEPO, [des-Thr 163 through Arg 166 ]hEPO and " ⁇ 27-55hEPO", the latter having the residues coded for by an entire exon deleted; or which are more stable to hydrolysis (and, therefore, may have more pronounced or longer lasting effects than naturally-occurring EPO); or which have been altered to delete one or more a potential sites for glycosylation (which may result in higher activities for yeast-produced products); or which have one or more cystein residues deleted or replaced by, e.g., histidine or serine residues (such as the analog [His 7 ]hEPO) and are potentially more easily isolated in active form from microbial systems; or which have one or more tyrosine residues replaced by phenylalanine (such
  • polypeptide fragments duplicating only a part of the continuous amino acid sequence or secondary conformations within mature EPO which fragments may possess one activity of EPO (e.g., receptor binding) and not others (e.g., erythropoietic activity).
  • EPO e.g., receptor binding
  • erythropoietic activity e.g., erythropoietic activity
  • the cloned DNA sequences described herein which encode human and monkey EPO polypeptides are conspicuously valuable for the information which they provide concerning the amino acid sequence of mammalian erythropoietin which has heretofore been unavailable despite decades of analytical processing of isolates of naturally-occurring products.
  • the DNA sequences are also conspicuously valuable as products useful in effecting the large scale microbial synthesis of erthropoietin by a variety of recombinant techniques.
  • DNA sequences provided by the invention are useful in generating new and useful viral and circular plasmid DNA vectors, new and useful transformed and transfected microbial procaryotic and eucaryotic host cells (including bacterial and yeast cells and mammalian cells grown in culture), and new and useful methods for cultured growth of such microbial host cells capable of expression of EPO and EPO products.
  • DNA sequences of the invention are also conspicuously suitable materials for use as labelled probes in isolating EPO and related protein encoding cDNA and genomic DNA sequences of mammalian species other than human and monkey species herein specifically illustrated.
  • DNA sequences of the invention are expected to be useful in developing transgenic mammalian species which may serve as eucaryotic "hosts" for production of erythropoietin and erythropoietin products in quantity. See, generally, Palmiter, et al., Science, 222(4625), 809-814 (1983).
  • DNA sequences provided by the illustrative examples include cDNA and genomic DNA sequences, because this application provides amino acid sequence information essential to manufacture of DNA sequence, the invention also comprehends such manufactured DNA sequences as may be constructed based on knowledge of EPO amino acid sequences. These may code for EPO (as in Example 12) as well as for EPO fragments and EPO polypeptide analogs (i.e., "EPO Products") which may share one or more biological properties of naturally-occurring EPO but not share others (or possess others to different degrees).
  • DNA sequences provided by the present invention are thus seen to comprehend all DNA sequences suitable for use in securing expression in a procaryotic or eucaryotic host cell of a polypeptide product having at least a part of the primary structural conformation and one or more of the biological properties of erythropoietin, and selected from among: (a) the DNA sequences set out in FIGS. 5 and 6; (b) DNA sequences which hybridize to the DNA sequences defined in (a) or fragments thereof; and (c) DNA sequences which, but for the degeneracy of the genetic code, would hybridize to the DNA sequences defined in (a) and (b).
  • allelic monkey and human EPO gene sequences and other mammalian species gene sequences are expected to hybridize to the sequences of FIGS. 5 and 6 or to fragments thereof.
  • SCEPO and ECEPO genes and the manufactured or mutagenized cDNA or genomic DNA sequences encoding various EPO fragments and analogs would also hybridize to the above-mentioned DNA sequences.
  • Such hybridizations could readily be carried out under the hybridization conditions described herein with respect to the initial isolation of the monkey and human EPO-encoding DNA or more stringent conditions, if desired to reduce background hybridization.
  • expression of, e.g., monkey origin DNA in monkey host cells in culture and human host cells in culture actually constitute instances of "exogenous" DNA expression inasmuch as the EPO DNA whose high level expression is sought would not have its origins in the genome of the host.
  • Expression systems of the invention further contemplate these practices resulting in cytoplasmic formation of EPO products and accumulation of glycosylated and non-glycosylated EPO products in host cell cytoplasm or membranes (e.g., accumulation in bacterial periplasmic spaces) or in culture medium supernatants as above illustrated, or in rather uncommon systems such as P.aeruginosa expression systems (described in Gray, et al., Biotechnology, 2, pp. 161-165 (1984)).
  • Improved hybridization methodologies of the invention while illustratively applied above to DNA/DNA hybridization screenings are equally applicable to RNA/RNA and RNA/DNA screening.
  • Mixed probe techniques as herein illustrated generally constitute a number of improvements in hybridization processes allowing for more rapid and reliable polynucleotide isolations. These many individual processing improvements include: improved colony transfer and maintenance procedures; use of nylon-based filters such as GeneScreen and GeneScreen Plus to allow reprobing with same filters and repeated use of the filter, application of novel protease treatments [compared, e.g., to Taub, et al. Anal. Biochem., 126, pp.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Toxicology (AREA)
  • Hematology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Diabetes (AREA)
  • Immunology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Saccharide Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US07/113,179 1983-12-13 1987-10-23 Production of recombinant erythropoietin Expired - Lifetime US5441868A (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US07/113,179 US5441868A (en) 1983-12-13 1987-10-23 Production of recombinant erythropoietin
US08/100,197 US5955422A (en) 1983-12-13 1993-08-02 Production of erthropoietin
US08/468,381 US5618698A (en) 1983-12-13 1995-06-06 Production of erythropoietin
US08/468,369 US5756349A (en) 1983-12-13 1995-06-06 Production of erythropoietin

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US56102483A 1983-12-13 1983-12-13
US58218584A 1984-02-21 1984-02-21
US65584184A 1984-09-28 1984-09-28
US06/675,298 US4703008A (en) 1983-12-13 1984-11-30 DNA sequences encoding erythropoietin
US07/113,179 US5441868A (en) 1983-12-13 1987-10-23 Production of recombinant erythropoietin

Related Parent Applications (3)

Application Number Title Priority Date Filing Date
US58218584A Continuation-In-Part 1983-12-13 1984-02-21
US65584184A Continuation-In-Part 1983-12-13 1984-09-28
US06/675,298 Continuation US4703008A (en) 1983-12-13 1984-11-30 DNA sequences encoding erythropoietin

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US60974490A Continuation 1983-12-13 1990-11-06
US08/468,381 Continuation US5618698A (en) 1983-12-13 1995-06-06 Production of erythropoietin
US08/468,369 Continuation US5756349A (en) 1983-12-13 1995-06-06 Production of erythropoietin

Publications (1)

Publication Number Publication Date
US5441868A true US5441868A (en) 1995-08-15

Family

ID=27504819

Family Applications (3)

Application Number Title Priority Date Filing Date
US07/113,179 Expired - Lifetime US5441868A (en) 1983-12-13 1987-10-23 Production of recombinant erythropoietin
US08/468,369 Expired - Lifetime US5756349A (en) 1983-12-13 1995-06-06 Production of erythropoietin
US08/468,381 Expired - Lifetime US5618698A (en) 1983-12-13 1995-06-06 Production of erythropoietin

Family Applications After (2)

Application Number Title Priority Date Filing Date
US08/468,369 Expired - Lifetime US5756349A (en) 1983-12-13 1995-06-06 Production of erythropoietin
US08/468,381 Expired - Lifetime US5618698A (en) 1983-12-13 1995-06-06 Production of erythropoietin

Country Status (15)

Country Link
US (3) US5441868A (enExample)
EP (1) EP0148605B2 (enExample)
JP (9) JPH0655136B2 (enExample)
AU (5) AU5750490A (enExample)
CA (1) CA1339047C (enExample)
CY (1) CY1643A (enExample)
DE (1) DE3482828D1 (enExample)
ES (1) ES8802329A1 (enExample)
HK (1) HK20093A (enExample)
IL (1) IL73785A (enExample)
MX (1) MX9203598A (enExample)
NL (1) NL930128I1 (enExample)
NZ (1) NZ210501A (enExample)
SG (1) SG92891G (enExample)
WO (1) WO1985002610A1 (enExample)

Cited By (208)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5688679A (en) * 1986-06-27 1997-11-18 University Of Washington Human erythropoietin gene; high level expression in stably transfected mammalian cells
US5728536A (en) * 1993-07-29 1998-03-17 St. Jude Children's Research Hospital Jak kinases and regulation of Cytokine signal transduction
EP0851917A1 (en) * 1995-08-24 1998-07-08 Il-Dong Pharm. Co., Ltd. Heterologous protein production system using avian cells
RU2125093C1 (ru) * 1998-02-12 1999-01-20 Государственный научно-исследовательский институт особо чистых биопрепаратов Способ получения рекомбинантного человеческого эритропоэтина, штамм культивируемых клеток яичника китайского хомяка - продуцент эритропоэтина
US5952226A (en) * 1996-11-05 1999-09-14 Modex Therapeutiques Hypoxia responsive EPO producing cells
US5994127A (en) * 1991-11-05 1999-11-30 Transkaryotic Therapies, Inc. In vivo production and delivery of erythropoietin or insulinotropin for gene therapy
US6204247B1 (en) 1997-08-15 2001-03-20 Amgen Inc. Chemical modification of proteins to improve biocompatibility and bioactivity
US6245740B1 (en) 1998-12-23 2001-06-12 Amgen Inc. Polyol:oil suspensions for the sustained release of proteins
US6420339B1 (en) 1998-10-14 2002-07-16 Amgen Inc. Site-directed dual pegylation of proteins for improved bioactivity and biocompatibility
US20020147311A1 (en) * 2000-02-11 2002-10-10 Gillies Stephen D. Enhancing the circulating half-life of antibody-based fusion proteins
US20020155998A1 (en) * 1998-06-15 2002-10-24 Genzyme Transgenics Corporation, A Massachusetts Corporation Erythropoietin analog-human serum albumin fusion
US20020193570A1 (en) * 1997-12-08 2002-12-19 Gillies Stephen D. Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation
US20030022308A1 (en) * 1992-01-31 2003-01-30 Aventis Behring L.L.C. Fusion polypeptides of human serum albumin and a therapeutically active polypeptide
US20030044423A1 (en) * 2001-03-07 2003-03-06 Lexigen Pharmaceuticals Corp. Expression technology for proteins containing a hybrid isotype antibody moiety
US6531124B1 (en) 1992-07-10 2003-03-11 Transkaryotic Therapies, Inc. In vivo production and delivery of insulinotropin for gene therapy
US20030049227A1 (en) * 2000-06-29 2003-03-13 Gillies Stephen D. Enhancement of antibody-cytokine fusion protein mediated immune responses by combined treatment with immunocytokine uptake enhancing agents
US6541033B1 (en) 1998-06-30 2003-04-01 Amgen Inc. Thermosensitive biodegradable hydrogels for sustained delivery of leptin
US20030092160A1 (en) * 1999-04-15 2003-05-15 Abraham Bout Recombinant protein production in a human cell
US20030099709A1 (en) * 1998-12-23 2003-05-29 Amgen Inc. Biodegradable pH/thermosensitive hydrogels for sustained delivery of biologically active agents
US20030105294A1 (en) * 1998-02-25 2003-06-05 Stephen Gillies Enhancing the circulating half life of antibody-based fusion proteins
US20030104996A1 (en) * 2001-08-30 2003-06-05 Tiansheng Li L-methionine as a stabilizer for NESP/EPO in HSA-free formulations
US20030166163A1 (en) * 2001-12-04 2003-09-04 Emd Lexigen Research Center Corp. Immunocytokines with modulated selectivity
US20030166877A1 (en) * 2001-03-30 2003-09-04 Lexigen Pharmaceuticals Corp. Reducing the immunogenicity of fusion proteins
WO2003086444A1 (en) 2002-04-04 2003-10-23 Amgen Inc. Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins
US6670178B1 (en) 1992-07-10 2003-12-30 Transkaryotic Therapies, Inc. In Vivo production and delivery of insulinotropin for gene therapy
US6696411B1 (en) 1998-04-22 2004-02-24 Cornell Research Foundation, Inc. Canine erythropoietin gene and recombinant protein
US20040072299A1 (en) * 1999-08-09 2004-04-15 Gillies Stephen D. Multiple cytokine protein complexes
US20040077086A1 (en) * 2002-07-09 2004-04-22 Manfred Reiter Animal protein free media for cultivation of cells
US6780607B2 (en) * 2001-02-07 2004-08-24 Dreambiogen Co., Ltd. Method for cell-free protein complete post-translational modification
US20040180035A1 (en) * 1998-04-15 2004-09-16 Emd Lexigen Research Center Corp. IL-15 immunoconjugates and uses thereof
US20040203100A1 (en) * 2002-12-17 2004-10-14 Emd Lexigen Research Center Corp. Immunocytokine sequences and uses thereof
KR100434729B1 (ko) * 1998-03-18 2004-11-03 주식회사 엘지생명과학 천연 추출물을 첨가하여 중국햄스터 난소 유래세포에서 에리스로포이에틴의 생산 증대방법
US20040259071A1 (en) * 2003-04-23 2004-12-23 Rush University Medical Center Erythropoietin administration to improve graft survival
US20050069979A1 (en) * 2001-11-28 2005-03-31 Steffen Zeng Cell culture process
US20050106722A1 (en) * 1999-04-15 2005-05-19 Jones David H. Efficient production of IgA in recombinant mammalian cells
US20050107297A1 (en) * 2003-05-12 2005-05-19 Holmes Christopher P. Novel poly(ethylene glycol) modified compounds and uses thereof
US20050123564A1 (en) * 2001-12-07 2005-06-09 Giuseppe Marzio Production of viruses viral isolates and vaccines
US20050137329A1 (en) * 2003-05-12 2005-06-23 Affymax, Inc. Novel peptides that bind to the erythropoietin receptor
US20050164386A1 (en) * 1999-04-15 2005-07-28 Uytdehaag Alphonsus G. Overexpression of enzymes involved in post-translational protein modifications in human cells
US20050170463A1 (en) * 1999-04-15 2005-08-04 Abraham Bout Recombinant protein production in permanent amniocytic cells that comprise nucleic acid encoding adenovirus E1A and E1B proteins
US20050181359A1 (en) * 1999-04-15 2005-08-18 Crucell Holland B.V. Compositions of erythropoietin isoforms comprising Lewis-X structures and high sialic acid content
US20050192211A1 (en) * 2003-12-31 2005-09-01 Emd Lexigen Research Center Corp. Fc-erythropoietin fusion protein with improved pharmacokinetics
US20050194459A1 (en) * 2004-03-08 2005-09-08 Chan Wan S. Aroma therapy for fountain
US20050202538A1 (en) * 1999-11-12 2005-09-15 Merck Patent Gmbh Fc-erythropoietin fusion protein with improved pharmacokinetics
US20050245436A1 (en) * 2004-02-13 2005-11-03 Stem Cell Therapeutics Corp. Pheromones and the luteinizing hormone for inducing proliferation of neural stem cells and neurogenesis
US6969517B2 (en) 2001-05-03 2005-11-29 Emd Lexigen Research Center Corp. Recombinant tumor specific antibody and use thereof
US20060051747A1 (en) * 1999-11-26 2006-03-09 Crucell Holland B.V. Production of vaccines
US20060063234A1 (en) * 2003-05-23 2006-03-23 Crucell Holland B.V. Efficient production of IgM in recombinant mammalian cells
US20060063261A1 (en) * 1999-11-26 2006-03-23 Crucell Holland B.V. Production of vaccines
US20060094104A1 (en) * 2004-10-29 2006-05-04 Leopold Grillberger Animal protein-free media for cultivation of cells
US20060111441A1 (en) * 2000-08-24 2006-05-25 Dalton James T Treating wasting disorders with selective androgen receptor modulators
US20060121007A1 (en) * 2001-08-30 2006-06-08 Stem Cell Therapeutics Inc. Combined regulation of neural cell production
US7067110B1 (en) 1999-07-21 2006-06-27 Emd Lexigen Research Center Corp. Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens
US20060148084A1 (en) * 2001-09-18 2006-07-06 Stem Cell Therapeutics Inc. Effect of growth hormone and IGF-1 on neural stem cells
US20060172389A1 (en) * 1998-04-22 2006-08-03 Macleod James N Canine erythropoietin gene and recombinant protein
US20060240513A1 (en) * 2003-05-09 2006-10-26 Crucell Holland B.V. Cultures of E1-immortalized cells and processes for culturing the same to increase product yields therefrom
US20070027074A1 (en) * 2003-05-12 2007-02-01 Affymax, Inc. Novel peptides that bind to the erythropoietin receptor
US20070032408A1 (en) * 2003-05-12 2007-02-08 Holmes Christopher P Novel spacer moiety for poly (ethylene glycol) modified peptide based compounds
US7192759B1 (en) 1999-11-26 2007-03-20 Crucell Holland B.V. Production of vaccines
US7211253B1 (en) 1999-11-12 2007-05-01 Merck Patentgesellschaft Mit Beschrankter Haftung Erythropoietin forms with improved properties
US20070098698A1 (en) * 2005-09-27 2007-05-03 Stem Cell Therapeutics Corp. Pregnancy-induced Oligodendrocyte Precursor Cell Proliferation Regulated by Prolactin
US20070104704A1 (en) * 2005-06-03 2007-05-10 Affymax, Inc. Erythropoietin receptor peptide formulations and uses
US20070123563A1 (en) * 2000-08-24 2007-05-31 Dalton James T Selective androgen receptor modulators and method of use thereof
US20070161079A1 (en) * 1997-06-20 2007-07-12 Baxter Aktiengesellschaft Recombinant cell clones having increased stability and methods of making and using the same
US20070161608A1 (en) * 2001-12-06 2007-07-12 Dalton James T Selective androgen receptor modulators for treating muscle wasting
US20070179092A1 (en) * 2002-07-31 2007-08-02 Stem Cell Therapeutics Inc. Method of Enhancing Neural Stem Cell Proliferation, Differentiation, and Survival Using Pituitary Adenylate Cyclase Activating Polypeptide (PACAP)
US20070254838A1 (en) * 2002-09-09 2007-11-01 Rene Gantier Rational evolution of cytokines for higher stability, the cytokines and encoding nucleic acid molecules
US20070281906A1 (en) * 2001-12-06 2007-12-06 Dalton James T Selective androgen receptor modulators for treating diabetes
WO2008008433A2 (en) 2006-07-12 2008-01-17 University Of Tennessee Research Foundation Substituted acylanilides and methods of use thereof
US20080019940A1 (en) * 1999-08-09 2008-01-24 Papisov Mikhail I Protein conjugates with a water-soluble biocompatible, biodegradable polymer
US20080039389A1 (en) * 2006-03-17 2008-02-14 Stem Cell Therapeutics Corp. Dosing regimens for neural stem cell proliferating agents and differentiating agents for the treatment of neurological disorders
US20080090777A1 (en) * 2006-09-14 2008-04-17 Pearlman Andrew L Long lasting drug formulations
US20080108564A1 (en) * 2004-11-11 2008-05-08 Affymax, Inc. Novel peptides that bind to the erythropoietin receptor
US20080113409A1 (en) * 1999-04-15 2008-05-15 Guus Hateboer Transient protein expression methods
US20080181873A1 (en) * 2001-09-14 2008-07-31 Stem Cell Therapeutics Inc. Prolactin induced increase in neural stem cell numbers
WO2007060213A3 (en) * 2005-11-24 2008-08-14 Serono Lab Erythropoietin polypeptides and uses thereof
US20080213277A1 (en) * 2007-02-02 2008-09-04 Amgen Inc. Hepcidin, hepcidin antagonists and methods of use
US20090005292A1 (en) * 2004-11-11 2009-01-01 Affymax, Inc. Novel Peptides that Bind to the Erythropoietin Receptor
US20090022734A1 (en) * 2007-07-19 2009-01-22 Hannelore Ehrenreich Use of epo receptor activation or stimulation for the improvement of the edss score in patients with multiple sclerosis
US20090118183A1 (en) * 2005-06-03 2009-05-07 Affymax, Inc. Erythropoietin receptor peptide formulations and uses
WO2009094551A1 (en) 2008-01-25 2009-07-30 Amgen Inc. Ferroportin antibodies and methods of use
US20090246194A1 (en) * 1998-06-15 2009-10-01 Gtc Biotherapeutics, Inc. ERYTHROPOIETIN ANALOG-IgG FUSION PROTEINS
US7622503B2 (en) 2000-08-24 2009-11-24 University Of Tennessee Research Foundation Selective androgen receptor modulators and methods of use thereof
US20090324478A1 (en) * 2004-04-13 2009-12-31 Hinman Norman D Method for Making Silicon-Containing Products
US20100004326A1 (en) * 2008-06-20 2010-01-07 Veverka Karen A Metabolites of selective androgen receptor modulators and methods of use thereof
US20100068175A1 (en) * 1999-07-21 2010-03-18 Gillies Stephen D Methods of using Fc-Cytokine fusion proteins
US20100093608A1 (en) * 2008-09-26 2010-04-15 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
WO2010056981A2 (en) 2008-11-13 2010-05-20 Massachusetts General Hospital Methods and compositions for regulating iron homeostasis by modulation bmp-6
US20100184655A1 (en) * 2006-08-04 2010-07-22 Prolong Pharmaceuticals, Inc. Modified erythropoietin
US20100297106A1 (en) * 2007-09-27 2010-11-25 Christopher James Sloey Pharmaceutical Formulations
EP2286791A1 (en) 2003-12-30 2011-02-23 Durect Corporation Polymeric implants, preferably containing a mixture of PEG and PLG, for controlled release of active agents, preferably a GnRH
US7919461B2 (en) 2005-06-03 2011-04-05 Affymax, Inc. Erythropoietin receptor peptide formulations and uses
US7919647B2 (en) 2000-08-24 2011-04-05 University Of Tennessee Research Foundation Selective androgen receptor modulators and methods of use thereof
WO2011050333A1 (en) 2009-10-23 2011-04-28 Amgen Inc. Vial adapter and system
US20110112018A1 (en) * 2006-01-27 2011-05-12 Hannelore Ehrenreich Method for the Treatment and/or Prophylaxis of Multiple Sclerosis, and Use of Erythropoietin for the Manufacture of a Medicament for the Intermittent and/or Intermittent Prophylaxis of Multiple Sclerosis
US20110123993A1 (en) * 2008-02-27 2011-05-26 Yasuhiko Suzuki Expression vector for mass production of foreign gene-derived protein using animal cell and use thereof
US20110151512A1 (en) * 2006-01-04 2011-06-23 Baxter International Inc. Oligopeptide-free cell culture media
US20110189732A1 (en) * 2008-06-04 2011-08-04 Evonik Degussa Gmbh Process for the Fermentative Production of Erythropoietin
US8021881B2 (en) 1999-09-28 2011-09-20 Baxter Innovations Gmbh Medium for the protein-free and serum-free cultivation of cells
US20110237664A1 (en) * 2004-06-07 2011-09-29 Dalton James T Selective androgen receptor modulators for treating diabetes
WO2011156373A1 (en) 2010-06-07 2011-12-15 Amgen Inc. Drug delivery device
EP2425715A1 (en) 2005-08-31 2012-03-07 The University of Tennessee Research Foundation Treating symptoms of renal disease with selective androgen receptor modulators (SARM)
US8192955B1 (en) * 1994-01-03 2012-06-05 Genentech, Inc. Nucleic acids encoding MPL ligand (thrombopoietin), variants, and fragments thereof
US8236293B2 (en) 1995-06-15 2012-08-07 Crucell Holland B.V. Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer
US8252743B2 (en) 2006-11-28 2012-08-28 Hanall Biopharma Co., Ltd. Modified erythropoietin polypeptides and uses thereof for treatment
WO2012135315A1 (en) 2011-03-31 2012-10-04 Amgen Inc. Vial adapter and system
WO2013055873A1 (en) 2011-10-14 2013-04-18 Amgen Inc. Injector and method of assembly
US8426465B2 (en) 2006-08-24 2013-04-23 University Of Tennesse Research Foundation Substituted acylanilides and methods of use thereof
US8454948B2 (en) 2006-09-14 2013-06-04 Medgenics Medical Israel Ltd. Long lasting drug formulations
EP2620448A1 (en) 2008-05-01 2013-07-31 Amgen Inc. Anti-hepcidin antibodies and methods of use
WO2014081780A1 (en) 2012-11-21 2014-05-30 Amgen Inc. Drug delivery device
WO2014144096A1 (en) 2013-03-15 2014-09-18 Amgen Inc. Drug cassette, autoinjector, and autoinjector system
WO2014143770A1 (en) 2013-03-15 2014-09-18 Amgen Inc. Body contour adaptable autoinjector device
WO2014149357A1 (en) 2013-03-22 2014-09-25 Amgen Inc. Injector and method of assembly
WO2015061389A1 (en) 2013-10-24 2015-04-30 Amgen Inc. Drug delivery system with temperature-sensitive control
WO2015061386A1 (en) 2013-10-24 2015-04-30 Amgen Inc. Injector and method of assembly
WO2015059701A1 (en) 2013-10-24 2015-04-30 Medgenics Medical Israel Ltd. Micro-organs providing sustained delivery of a therapeutic polypeptide and methods of use thereof
WO2015119906A1 (en) 2014-02-05 2015-08-13 Amgen Inc. Drug delivery system with electromagnetic field generator
US9127084B2 (en) 2006-09-14 2015-09-08 Medgenics Medical Israel Ltd. Long lasting drug formulations
US9150501B2 (en) 2007-09-11 2015-10-06 Gtx, Inc. Solid forms of selective androgen receptor modulators
CN105026411A (zh) * 2013-03-14 2015-11-04 夏尔人类遗传性治疗公司 含4’-硫代修饰的核苷酸的核糖核酸及相关方法
WO2015171777A1 (en) 2014-05-07 2015-11-12 Amgen Inc. Autoinjector with shock reducing elements
WO2015181676A1 (en) 2014-05-30 2015-12-03 Pfizer Inc. Carbonitrile derivatives as selective androgen receptor modulators
WO2015187799A1 (en) 2014-06-03 2015-12-10 Amgen Inc. Systems and methods for remotely processing data collected by a drug delivery device
WO2016049036A1 (en) 2014-09-22 2016-03-31 Intrinsic Lifesciences Llc Humanized anti-hepcidin antibodies and uses thereof
WO2016061220A2 (en) 2014-10-14 2016-04-21 Amgen Inc. Drug injection device with visual and audio indicators
WO2016100055A1 (en) 2014-12-19 2016-06-23 Amgen Inc. Drug delivery device with live button or user interface field
WO2016100781A1 (en) 2014-12-19 2016-06-23 Amgen Inc. Drug delivery device with proximity sensor
EP3103880A1 (en) 2008-02-08 2016-12-14 Ambrx, Inc. Modified leptin polypeptides and their uses
WO2017039786A1 (en) 2015-09-02 2017-03-09 Amgen Inc. Syringe assembly adapter for a syringe
US9604916B2 (en) 2012-07-13 2017-03-28 Gtx, Inc. Method of treating androgen receptor (AR)-positive breast cancers with selective androgen receptor modulator (SARMs)
US9622992B2 (en) 2012-07-13 2017-04-18 Gtx, Inc. Method of treating androgen receptor (AR)-positive breast cancers with selective androgen receptor modulator (SARMs)
US9657098B2 (en) 2013-03-15 2017-05-23 Intrinsic Lifesciences, Llc Anti-hepcidin antibodies and uses thereof
WO2017100501A1 (en) 2015-12-09 2017-06-15 Amgen Inc. Auto-injector with signaling cap
WO2017120178A1 (en) 2016-01-06 2017-07-13 Amgen Inc. Auto-injector with signaling electronics
US9744149B2 (en) 2012-07-13 2017-08-29 Gtx, Inc. Method of treating androgen receptor (AR)-positive breast cancers with selective androgen receptor modulator (SARMs)
WO2017160799A1 (en) 2016-03-15 2017-09-21 Amgen Inc. Reducing probability of glass breakage in drug delivery devices
WO2017189089A1 (en) 2016-04-29 2017-11-02 Amgen Inc. Drug delivery device with messaging label
WO2017192287A1 (en) 2016-05-02 2017-11-09 Amgen Inc. Syringe adapter and guide for filling an on-body injector
WO2017197222A1 (en) 2016-05-13 2017-11-16 Amgen Inc. Vial sleeve assembly
WO2017200989A1 (en) 2016-05-16 2017-11-23 Amgen Inc. Data encryption in medical devices with limited computational capability
WO2017209899A1 (en) 2016-06-03 2017-12-07 Amgen Inc. Impact testing apparatuses and methods for drug delivery devices
WO2018004842A1 (en) 2016-07-01 2018-01-04 Amgen Inc. Drug delivery device having minimized risk of component fracture upon impact events
US9884038B2 (en) 2004-06-07 2018-02-06 University Of Tennessee Research Foundation Selective androgen receptor modulator and methods of use thereof
US9889110B2 (en) 2004-06-07 2018-02-13 University Of Tennessee Research Foundation Selective androgen receptor modulator for treating hormone-related conditions
WO2018034784A1 (en) 2016-08-17 2018-02-22 Amgen Inc. Drug delivery device with placement detection
WO2018081234A1 (en) 2016-10-25 2018-05-03 Amgen Inc. On-body injector
US9969683B2 (en) 2012-07-13 2018-05-15 Gtx, Inc. Method of treating estrogen receptor (ER)-positive breast cancers with selective androgen receptor modulator (SARMS)
WO2018136398A1 (en) 2017-01-17 2018-07-26 Amgen Inc. Injection devices and related methods of use and assembly
WO2018151890A1 (en) 2017-02-17 2018-08-23 Amgen Inc. Drug delivery device with sterile fluid flowpath and related method of assembly
WO2018152073A1 (en) 2017-02-17 2018-08-23 Amgen Inc. Insertion mechanism for drug delivery device
WO2018165499A1 (en) 2017-03-09 2018-09-13 Amgen Inc. Insertion mechanism for drug delivery device
WO2018165143A1 (en) 2017-03-06 2018-09-13 Amgen Inc. Drug delivery device with activation prevention feature
WO2018164829A1 (en) 2017-03-07 2018-09-13 Amgen Inc. Needle insertion by overpressure
WO2018172219A1 (en) 2017-03-20 2018-09-27 F. Hoffmann-La Roche Ag Method for in vitro glycoengineering of an erythropoiesis stimulating protein
EP3381445A2 (en) 2007-11-15 2018-10-03 Amgen Inc. Aqueous formulation of antibody stablised by antioxidants for parenteral administration
WO2018183039A1 (en) 2017-03-28 2018-10-04 Amgen Inc. Plunger rod and syringe assembly system and method
WO2018226515A1 (en) 2017-06-08 2018-12-13 Amgen Inc. Syringe assembly for a drug delivery device and method of assembly
WO2018226565A1 (en) 2017-06-08 2018-12-13 Amgen Inc. Torque driven drug delivery device
WO2018236619A1 (en) 2017-06-22 2018-12-27 Amgen Inc. Device activation impact/shock reduction
WO2018237225A1 (en) 2017-06-23 2018-12-27 Amgen Inc. Electronic drug delivery device comprising a cap activated by a switch assembly
WO2019014014A1 (en) 2017-07-14 2019-01-17 Amgen Inc. NEEDLE INSERTION-RETRACTING SYSTEM HAVING DOUBLE TORSION SPRING SYSTEM
WO2019018169A1 (en) 2017-07-21 2019-01-24 Amgen Inc. PERMEABLE GAS SEALING ELEMENT FOR MEDICINE CONTAINER AND METHODS OF ASSEMBLY
WO2019022950A1 (en) 2017-07-25 2019-01-31 Amgen Inc. DRUG DELIVERY DEVICE WITH CONTAINER ACCESS SYSTEM AND ASSEMBLY METHOD THEREOF
WO2019022951A1 (en) 2017-07-25 2019-01-31 Amgen Inc. DRUG DELIVERY DEVICE WITH GEAR MODULE AND ASSEMBLY METHOD THEREOF
WO2019032482A2 (en) 2017-08-09 2019-02-14 Amgen Inc. HYDRAULIC-PNEUMATIC PRESSURE CHAMBER DELIVERY SYSTEM
WO2019036181A1 (en) 2017-08-18 2019-02-21 Amgen Inc. BODY INJECTOR WITH STERILE ADHESIVE PATCH
WO2019040548A1 (en) 2017-08-22 2019-02-28 Amgen Inc. NEEDLE INSERTION MECHANISM FOR DRUG DELIVERY DEVICE
WO2019070552A1 (en) 2017-10-06 2019-04-11 Amgen Inc. DRUG DELIVERY DEVICE COMPRISING A LOCKOUT ASSEMBLY AND ASSOCIATED ASSEMBLY METHOD
WO2019070472A1 (en) 2017-10-04 2019-04-11 Amgen Inc. FLOW ADAPTER FOR MEDICATION DELIVERY DEVICE
US10258596B2 (en) 2012-07-13 2019-04-16 Gtx, Inc. Method of treating HER2-positive breast cancers with selective androgen receptor modulators (SARMS)
WO2019074579A1 (en) 2017-10-09 2019-04-18 Amgen Inc. DRUG DELIVERY DEVICE COMPRISING A DRIVE ASSEMBLY AND ASSEMBLY METHOD THEREOF
WO2019090303A1 (en) 2017-11-06 2019-05-09 Amgen Inc. Fill-finish assemblies and related methods
WO2019090086A1 (en) 2017-11-03 2019-05-09 Amgen Inc. Systems and approaches for sterilizing a drug delivery device
WO2019089178A1 (en) 2017-11-06 2019-05-09 Amgen Inc. Drug delivery device with placement and flow sensing
WO2019094138A1 (en) 2017-11-10 2019-05-16 Amgen Inc. Plungers for drug delivery devices
WO2019099322A1 (en) 2017-11-16 2019-05-23 Amgen Inc. Autoinjector with stall and end point detection
WO2019099324A1 (en) 2017-11-16 2019-05-23 Amgen Inc. Door latch mechanism for drug delivery device
US10314807B2 (en) 2012-07-13 2019-06-11 Gtx, Inc. Method of treating HER2-positive breast cancers with selective androgen receptor modulators (SARMS)
EP3498323A2 (en) 2011-04-20 2019-06-19 Amgen Inc. Autoinjector apparatus
EP3556411A1 (en) 2015-02-17 2019-10-23 Amgen Inc. Drug delivery device with vacuum assisted securement and/or feedback
WO2019231618A1 (en) 2018-06-01 2019-12-05 Amgen Inc. Modular fluid path assemblies for drug delivery devices
WO2019231582A1 (en) 2018-05-30 2019-12-05 Amgen Inc. Thermal spring release mechanism for a drug delivery device
EP3593839A1 (en) 2013-03-15 2020-01-15 Amgen Inc. Drug cassette
WO2020023336A1 (en) 2018-07-24 2020-01-30 Amgen Inc. Hybrid drug delivery devices with grip portion
WO2020023444A1 (en) 2018-07-24 2020-01-30 Amgen Inc. Delivery devices for administering drugs
WO2020023451A1 (en) 2018-07-24 2020-01-30 Amgen Inc. Delivery devices for administering drugs
WO2020023220A1 (en) 2018-07-24 2020-01-30 Amgen Inc. Hybrid drug delivery devices with tacky skin attachment portion and related method of preparation
WO2020028009A1 (en) 2018-07-31 2020-02-06 Amgen Inc. Fluid path assembly for a drug delivery device
WO2020068476A1 (en) 2018-09-28 2020-04-02 Amgen Inc. Muscle wire escapement activation assembly for a drug delivery device
WO2020068623A1 (en) 2018-09-24 2020-04-02 Amgen Inc. Interventional dosing systems and methods
WO2020072577A1 (en) 2018-10-02 2020-04-09 Amgen Inc. Injection systems for drug delivery with internal force transmission
WO2020072846A1 (en) 2018-10-05 2020-04-09 Amgen Inc. Drug delivery device having dose indicator
WO2020081480A1 (en) 2018-10-15 2020-04-23 Amgen Inc. Platform assembly process for drug delivery device
WO2020081479A1 (en) 2018-10-15 2020-04-23 Amgen Inc. Drug delivery device having damping mechanism
WO2020091956A1 (en) 2018-11-01 2020-05-07 Amgen Inc. Drug delivery devices with partial drug delivery member retraction
WO2020092056A1 (en) 2018-11-01 2020-05-07 Amgen Inc. Drug delivery devices with partial needle retraction
WO2020091981A1 (en) 2018-11-01 2020-05-07 Amgen Inc. Drug delivery devices with partial drug delivery member retraction
WO2020219482A1 (en) 2019-04-24 2020-10-29 Amgen Inc. Syringe sterilization verification assemblies and methods
US10849873B2 (en) 2012-07-13 2020-12-01 Oncternal Therapeutics, Inc Non-invasive method of evaluating breast cancers for selective androgen receptor modulator (SARM) therapy
WO2021041067A2 (en) 2019-08-23 2021-03-04 Amgen Inc. Drug delivery device with configurable needle shield engagement components and related methods
EP3981450A1 (en) 2015-02-27 2022-04-13 Amgen, Inc Drug delivery device having a needle guard mechanism with a tunable threshold of resistance to needle guard movement
WO2022159414A1 (en) 2021-01-22 2022-07-28 University Of Rochester Erythropoietin for gastroinfestinal dysfunction
WO2022246055A1 (en) 2021-05-21 2022-11-24 Amgen Inc. Method of optimizing a filling recipe for a drug container
US11535659B2 (en) 2010-09-28 2022-12-27 Amryt Pharmaceuticals Inc. Engineered polypeptides having enhanced duration of action
WO2023275715A1 (en) 2021-06-30 2023-01-05 Pfizer Inc. Metabolites of selective androgen receptor modulators
WO2023209074A1 (en) 2022-04-28 2023-11-02 Institut National de la Santé et de la Recherche Médicale Methods of restoring erythropoiesis in patients suffering from a sf3b1 mutant myelodysplastic syndrome by correcting coasy mis-splicing
WO2024094457A1 (en) 2022-11-02 2024-05-10 F. Hoffmann-La Roche Ag Method for producing glycoprotein compositions

Families Citing this family (151)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT72786B (en) 1980-04-03 1983-01-10 Biogen Nv Process for producing dna sequences recombinant dna molecules and human fibroplast interferon-like polypeptides
IT1185503B (it) * 1984-01-11 1987-11-12 Univ New York Cloni di odna di eritropietina umana
IL77081A (en) * 1984-12-04 1999-10-28 Genetics Inst Dna sequence encoding human erythropoietin process for the preparation thereof and a pharmaceutical composition of human erythropoietin
JPS62501010A (ja) 1984-12-04 1987-04-23 ジェネティックス・インスチチュ−ト・インコ−ポレ−テッド エリトロポエチンの生産方法
US4677195A (en) * 1985-01-11 1987-06-30 Genetics Institute, Inc. Method for the purification of erythropoietin and erythropoietin compositions
US4732889A (en) * 1985-02-06 1988-03-22 Chugai Seiyaku Kabushiki Kaisha Pharmaceutical composition for the treatment of the anemia of rheumatoid arthritis
US4745099A (en) * 1985-02-06 1988-05-17 Chugai Seiyaku Kabushiki Kaisha Pharmaceutical composition for the treatment of the anemia of malignant tumors
GB2177914B (en) * 1985-06-04 1989-10-25 Chugai Pharmaceutical Co Ltd A pharmaceutical composition containing human erythropoietin and a surface active agent for nasal administration for the treatment of anemia
IL79176A (en) * 1985-06-20 1992-06-21 Kirin Amgen Inc Process for the recovery of erythropoietin from a fluid
JPS63500636A (ja) * 1985-08-23 1988-03-10 麒麟麦酒株式会社 多分化能性顆粒球コロニー刺激因子をコードするdna
US4810643A (en) * 1985-08-23 1989-03-07 Kirin- Amgen Inc. Production of pluripotent granulocyte colony-stimulating factor
US6004548A (en) 1985-08-23 1999-12-21 Amgen, Inc. Analogs of pluripotent granulocyte colony-stimulating factor
US4935350A (en) * 1985-11-18 1990-06-19 Amgen Materials and methods for controlling plasmid copy number and stability
JPS62171696A (ja) * 1986-01-23 1987-07-28 Sumitomo Chem Co Ltd ヒトエリスロポエチンの製造方法
EP0236059B1 (en) * 1986-02-27 1994-04-27 Snow Brand Milk Products Co. Ltd. Preparation of erythropoietin-producing cells and production process of erythropoietin using same
GR871029B (en) 1986-07-14 1987-11-02 Genetics Inst Novel osteoinductive factors
US4954437A (en) * 1986-09-15 1990-09-04 Integrated Genetics, Inc. Cell encoding recombinant human erythropoietin
US5013718A (en) * 1986-11-21 1991-05-07 Amgen, Inc. Method for treating iron overload using EPO
WO1988005466A2 (en) * 1987-01-15 1988-07-28 Codon Tandem gene eukaryotic expression vectors
US4835260A (en) * 1987-03-20 1989-05-30 Genetics Institute, Inc. Erythropoietin composition
JP2791418B2 (ja) 1987-12-02 1998-08-27 株式会社ミドリ十字 異種蛋白質の製造方法、組換えdna、形質転換体
DE3923963A1 (de) * 1989-07-20 1991-01-31 Behringwerke Ag Muteine des menschlichen erythropoetins, ihre herstellung und ihre verwendung
DE3924746A1 (de) * 1989-07-26 1991-01-31 Behringwerke Ag Erythropoietin (epo)-peptide und dagegen gerichtete antikoerper
US6932968B1 (en) 1989-07-26 2005-08-23 Dade Behring Marburg Gmbh Erythropoietin (EPO) peptides and antibodies directed against these
KR100263845B1 (ko) * 1989-10-13 2000-08-16 스튜어트 엘.왓트 에리트로포이에틴 동형체와 그의 제조방법 및 그를 포함하는제약학적 조성물
US7217689B1 (en) 1989-10-13 2007-05-15 Amgen Inc. Glycosylation analogs of erythropoietin
DE4115722A1 (de) * 1991-05-14 1992-11-19 Boehringer Mannheim Gmbh Serumfreies medium zur kultivierung von saeugerzellen
US5968502A (en) * 1991-11-05 1999-10-19 Transkaryotic Therapies, Inc. Protein production and protein delivery
US6270989B1 (en) 1991-11-05 2001-08-07 Transkaryotic Therapies, Inc. Protein production and delivery
WO1994005679A1 (fr) * 1992-09-09 1994-03-17 Nippon Kayaku Kabushiki Kaisha Nouvelle substance physiologiquement active appelee nk175203, son procede de production et son utilisation pharmaceutique
WO1994024160A2 (en) * 1993-04-21 1994-10-27 Brigham And Women's Hospital Erythropoietin muteins with enhanced activity
IL192290A0 (en) * 1993-08-17 2008-12-29 Kirin Amgen Inc Erythropoietin analogs
US5888774A (en) * 1994-12-19 1999-03-30 Cangene Corporation Recombinant DNA molecules and expression vectors for erythropoietin
IL118201A (en) * 1995-05-11 2004-12-15 Roche Diagnostics Gmbh Preparation comprising a protein with human erythropoietin activity which is free of serum and non-recombinant mammalian protein and process for the preparation thereof
KR100459984B1 (ko) * 1995-06-07 2005-06-20 아피맥스 테크놀로지스, 엔.브이. 에리트로포이에틴수용체(epo-r)에결합하는화합물및펩티드
EP0752474A1 (en) * 1995-07-07 1997-01-08 Boehringer Mannheim Gmbh Nucleic acid coding for CMP-N-acetyl-neuraminic acid hydroxylase and its use for the production of modified glycoproteins
WO1997003200A1 (en) * 1995-07-07 1997-01-30 Boehringer Mannheim Gmbh Nucleic acid coding for cmp-n-acetyl-neuraminic acid hydroxylase and its use for the production of modified glycoproteins
ES2206695T3 (es) 1996-03-14 2004-05-16 Genentech, Inc. Receptor de gdnf y utiolizacion del mismo.
GB2318352A (en) * 1996-06-25 1998-04-22 Dejan Markovic Polypeptides mimicking the activity of human erythropoietin
AU753701B2 (en) * 1997-04-21 2002-10-24 Glycozyme, Inc. Determination of recombinant glycosylated proteins and peptides in biological fluids
US6187564B1 (en) * 1997-07-10 2001-02-13 Beth Israel Deaconess Medical Center DNA encoding erythropoietin multimers having modified 5′ and 3′ sequences and its use to prepare EPO therapeutics
DE19729769A1 (de) 1997-07-11 1999-01-14 Cardiogene Gentherapeutische S Transfektionssystem, seine Herstellung und Verwendung in der somatischen Gentherapie
US6740503B1 (en) 1997-09-26 2004-05-25 Athersys, Inc. Compositions and methods for non-targeted activation of endogenous genes
US6897066B1 (en) * 1997-09-26 2005-05-24 Athersys, Inc. Compositions and methods for non-targeted activation of endogenous genes
PT1023442E (pt) * 1997-10-16 2011-02-25 Synageva Biopharma Corp Vectores compreendendo um promotor específico do magno para transgénese aviária
US7037663B2 (en) * 1998-02-19 2006-05-02 Eastern Virginia Medical School Human zona pellucida protein 3 and uses thereof
EP1056858B1 (en) * 1998-02-19 2004-12-08 Eastern Virginia Medical School RECOMBINANT ACTIVE HUMAN ZONA PELLUCIDA PROTEIN 3 (hZP3)
ES2224299T3 (es) 1998-02-23 2005-03-01 Cilag Ag International Dispersion liposomal de eritroyetina.
JP2002509729A (ja) * 1998-03-27 2002-04-02 サイトス バイオテクノロジー アーゲー 誘導性のアルファウイルス遺伝子発現系
AR019025A1 (es) 1998-04-09 2001-12-26 Roche Diagnostics Gmbh Uso de eritropoyetina en bajas dosis para producir un preparado farmaceutico para el tratamiento de hemocromatosis, preparado farmaceutico combinadoutilizado segun dicho uso y envase farmaceutico unitario que contiene al referido preparado farmaceutico combinado
EP1100545A4 (en) * 1998-07-29 2002-03-20 Invitrogen Corp REGULATED EXPRESSION OF RECOMBINANT PROTEINS USING RNA VIRUSES
EP0984062A1 (en) * 1998-09-04 2000-03-08 Cytos Biotechnology AG Production of human erythropoietin
US7304150B1 (en) 1998-10-23 2007-12-04 Amgen Inc. Methods and compositions for the prevention and treatment of anemia
US6660843B1 (en) 1998-10-23 2003-12-09 Amgen Inc. Modified peptides as therapeutic agents
BR9917606A (pt) 1998-11-06 2002-12-31 Bio Sidus S A Procedimento para a purificação de eritropoetina humana recombinante a partir de sobrenadantes de cultivo de células e eritropoetina humana recombinante obtida com tal procedimento
US6777205B1 (en) 1998-11-06 2004-08-17 Sterrenbeld Biotechnologie North America, Inc. Host cells expressing recombinant human erythropoietin
BR9905867A (pt) * 1998-11-06 2001-01-23 Bio Sidus S A Linhagem celular produtora de eritropoietina humana recombinante e a eritropoietina humana recombinante produzida por esta célula
BR9905868A (pt) 1998-11-06 2001-01-23 Bio Sidus S A Procedimento de cultivo massivo de células de mamìfero para a obtenção de eritropoetina humana, recombinante e a eritropoetina humana recombinante obtida com tal procedimento
DE19857609A1 (de) 1998-12-14 2000-06-15 Hannelore Ehrenreich Verwendung von Erythropoietin zur Behandlung von cerebralen Ischämien des Menschen
DE19905501B4 (de) 1999-02-10 2005-05-19 MediGene AG, Gesellschaft für molekularbiologische Kardiologie und Onkologie Verfahren zur Herstellung eines rekombinanten Adeno-assoziierten Virus, geeignete Mittel hierzu sowie Verwendung zur Herstellung eines Arzneimittels
US7345019B1 (en) * 1999-04-13 2008-03-18 The Kenneth S. Warren Institute, Inc. Modulation of excitable tissue function by peripherally administered erythropoietin
US7309687B1 (en) 1999-04-13 2007-12-18 The Kenneth S. Warren Institute, Inc. Methods for treatment and prevention of neuromuscular and muscular conditions by peripherally administered erythropoietin
AU766507B2 (en) * 1999-05-07 2003-10-16 Genentech Inc. Novel chimpanzee erythropoietin (CHEPO) polypeptides and nucleic acids encoding the same
US6555343B1 (en) 1999-05-07 2003-04-29 Genentech Inc. Chimpanzee erythropoietin (CHEPO) polypeptides and nucleic acids encoding the same
US6831060B2 (en) 1999-05-07 2004-12-14 Genentech, Inc. Chimpanzee erythropoietin (CHEPO) polypeptides and nucleic acids encoding the same
US6737519B1 (en) * 1999-07-30 2004-05-18 Genome Therapeutics Corporation Human genes relating to respiratory diseases and obesity
US6703480B1 (en) 1999-11-24 2004-03-09 Palani Balu Peptide dimers as agonists of the erythropoientin (EPO) receptor, and associated methods of synthesis and use
WO2001042442A2 (en) 1999-12-10 2001-06-14 Cytos Biotechnology Ag Activation of endogenous genes by genomic introduction of a replicon
EP1274720A4 (en) 2000-04-12 2004-08-18 Human Genome Sciences Inc ALBUMIN FUSED PROTEINS
US20050100991A1 (en) * 2001-04-12 2005-05-12 Human Genome Sciences, Inc. Albumin fusion proteins
IES20010462A2 (en) * 2000-05-12 2001-11-14 Cyril John Higgins Use of the world wide web
US20020012982A1 (en) * 2000-07-13 2002-01-31 Invitrogen Corporation Methods and compositions for rapid protein and peptide extraction and isolation using a lysis matrix
ATE428790T1 (de) 2000-09-25 2009-05-15 Genetronics Inc Verbessertes system zur regulation der transgenexpression
US7087224B2 (en) 2000-10-31 2006-08-08 Amgen Inc. Method of treating anemia by administering IL-1ra
KR100645843B1 (ko) 2000-12-20 2006-11-14 에프. 호프만-라 로슈 아게 에리트로포이에틴 접합체
US20030072737A1 (en) * 2000-12-29 2003-04-17 Michael Brines Tissue protective cytokines for the protection, restoration, and enhancement of responsive cells, tissues and organs
US6531121B2 (en) 2000-12-29 2003-03-11 The Kenneth S. Warren Institute, Inc. Protection and enhancement of erythropoietin-responsive cells, tissues and organs
US7767643B2 (en) * 2000-12-29 2010-08-03 The Kenneth S. Warren Institute, Inc. Protection, restoration, and enhancement of erythropoietin-responsive cells, tissues and organs
DE10112825A1 (de) 2001-03-16 2002-10-02 Fresenius Kabi De Gmbh HESylierung von Wirkstoffen in wässriger Lösung
AU2002310122A1 (en) * 2001-05-25 2002-12-09 Human Genome Sciences, Inc. Chemokine beta-1 fusion proteins
US7148021B2 (en) * 2001-08-02 2006-12-12 Eastern Virginia Meical School Human zona pellucida proteins and methods of their use in diagnosing male infertility
WO2005003296A2 (en) 2003-01-22 2005-01-13 Human Genome Sciences, Inc. Albumin fusion proteins
CA2841097A1 (en) 2001-12-21 2003-07-24 Human Genome Sciences, Inc. Albumin and g-csf fusion proteins
WO2003059934A2 (en) * 2001-12-21 2003-07-24 Human Genome Sciences, Inc. Albumin fusion proteins
AU2003226960B2 (en) 2002-01-17 2007-11-22 Lonza Biologics Plc. Glutamine-auxothrophic human cells capable of producing proteins and capable of growing in a glutamine-free medium
DE10209822A1 (de) 2002-03-06 2003-09-25 Biotechnologie Ges Mittelhesse Kopplung niedermolekularer Substanzen an ein modifiziertes Polysaccharid
DE10209821A1 (de) 2002-03-06 2003-09-25 Biotechnologie Ges Mittelhesse Kopplung von Proteinen an ein modifiziertes Polysaccharid
CA2485365A1 (en) * 2002-05-13 2003-11-20 Modigenetech Ltd. Ctp-extended erythropoietin
EA010200B1 (ru) * 2002-07-01 2008-06-30 Дзе Кеннет С. Уоррен Инститьют, Инк. Рекомбинантные тканезащитные цитокины и кодирующие их нуклеиновые кислоты для защиты, восстановления и усиления чувствительных клеток, тканей и органов
DE10234192B4 (de) 2002-07-26 2009-11-26 Epoplus Gmbh Co.Kg Verwendung von Erythropoetin
KR100521309B1 (ko) * 2002-08-31 2005-10-14 씨제이 주식회사 당쇄화된 인간 과립구 형성인자
DE20321793U1 (de) 2002-09-11 2010-06-02 Fresenius Kabi Deutschland Gmbh Hydroxyalkylstärke-Derivate
EP1681303B1 (en) 2002-09-11 2013-09-04 Fresenius Kabi Deutschland GmbH HASylated polypeptides, especially HASylated erythropoietin
PL217085B1 (pl) 2002-09-11 2014-06-30 Fresenius Kabi Gmbh Koniugat hydroksyalkiloskrobi i polipeptydu, sposób wytwarzania koniugatu hydroksyalkiloskrobi i polipeptydu, zastosowanie koniugatu hydroksyalkiloskrobi i polipeptydu oraz kompozycja farmaceutyczna koniugatu hydroksyalkiloskrobi i polipeptydu
EP1549350B1 (en) 2002-10-08 2008-09-24 Fresenius Kabi Deutschland GmbH Pharmaceutically active oligosaccharide conjugates
ZA200506196B (en) * 2003-02-03 2006-10-25 Japan Immuno Inc High-expression vector for animal cells
EP1624883A4 (en) * 2003-04-09 2008-11-26 Univ Utah Res Found COMPOSITIONS AND METHODS RELATING TO THE PRODUCTION OF ERYTHROPOIETIN
CA2528988C (en) 2003-06-10 2012-05-01 Lg Life Sciences Ltd. Stable, aqueous solution of human erythropoietin, not containing serum albumin
EP2216415B2 (en) * 2003-08-01 2017-01-04 Life Technologies Corporation Methods for preparing short RNA molecules
WO2005014655A2 (en) 2003-08-08 2005-02-17 Fresenius Kabi Deutschland Gmbh Conjugates of hydroxyalkyl starch and a protein
US7645733B2 (en) 2003-09-29 2010-01-12 The Kenneth S. Warren Institute, Inc. Tissue protective cytokines for the treatment and prevention of sepsis and the formation of adhesions
DE502004011252D1 (de) 2003-12-30 2010-07-15 Augustinus Bader Verwendung des erythropoietins zur regeneration von lebergewebe
DE102004004509B4 (de) 2004-01-23 2010-07-01 Epoplus Gmbh Co.Kg Einsatz von niedrig dosiertem Erythropoietin zur Stimulation endothelialer Vorläuferzellen sowie zur Organregeneration und Progressionsverlangsamung von Endorganschäden
JP5396019B2 (ja) 2004-03-11 2014-01-22 フレゼニウス・カビ・ドイチュラント・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツング ヒドロキシアルキルデンプンとタンパク質とのコンジュゲート
CN1946742A (zh) 2004-03-11 2007-04-11 弗雷泽纽斯卡比德国有限公司 通过还原氨基化制备的羟烷基淀粉和蛋白质的偶联物
WO2006061853A2 (en) * 2004-12-10 2006-06-15 Serum Institute Of India Limited Novel erythropoietic compounds and a process for producing erythropoietic compounds
WO2006089228A2 (en) * 2005-02-16 2006-08-24 Nektar Therapeutics Al, Corporation Conjugates of an epo moiety and a polymer
EP1762250A1 (en) 2005-09-12 2007-03-14 Fresenius Kabi Deutschland GmbH Conjugates of hydroxyalkyl starch and an active substance, prepared by chemical ligation via thiazolidine
US9388382B2 (en) * 2005-10-05 2016-07-12 The Board Of Trustees Of The University Of Illinois Isolation of CD14 negative, CD45 positive and CD117 positive embryonic-like stem cells free of monocytes from human umbilical cord blood mononuclear cells
WO2008048671A1 (en) * 2006-10-18 2008-04-24 University Of Illinois Embryonic-like stem cells derived from adult human peripheral blood and methods of use
US7972810B2 (en) 2005-12-08 2011-07-05 Amgen Inc. Production of glycoproteins using manganese
US7625564B2 (en) 2006-01-27 2009-12-01 Novagen Holding Corporation Recombinant human EPO-Fc fusion proteins with prolonged half-life and enhanced erythropoietic activity in vivo
EP1997505A4 (en) 2006-03-22 2013-02-13 Chugai Pharmaceutical Co Ltd PREPARATION OF ERYTHROPOIETIN SOLUTION
CN101062407A (zh) 2006-04-29 2007-10-31 中国科学院上海生命科学研究院 促红细胞生成素在预防或治疗视网膜损伤中的用途
JPWO2008023725A1 (ja) 2006-08-22 2010-01-14 中外製薬株式会社 末梢神経障害の予防および/または治療剤
EP2089424B1 (en) * 2006-12-06 2015-07-01 JCR PHARMACEUTICALS Co., LTD. Method for production of human erythropoietin
EP2121017A2 (en) * 2006-12-19 2009-11-25 Nokad Method for inhibiting the expression of endogenous erythropoietin (epo)
AR065613A1 (es) 2007-03-09 2009-06-17 Chugai Pharmaceutical Co Ltd Agentes de proteccion para organos transplantados
US20080260820A1 (en) * 2007-04-19 2008-10-23 Gilles Borrelly Oral dosage formulations of protease-resistant polypeptides
US20100172919A1 (en) 2007-06-15 2010-07-08 Jan Grimm Noveltreatment for neurological disorders
CA2720628A1 (en) 2007-07-26 2009-01-29 Novagen Holding Corporation Fusion proteins having mutated immunoglobulin hinge region
EP2070950A1 (en) 2007-12-14 2009-06-17 Fresenius Kabi Deutschland GmbH Hydroxyalkyl starch derivatives and process for their preparation
EP2095829A1 (en) 2008-02-27 2009-09-02 LEK Pharmaceuticals D.D. Selenium containing modifying agents and conjugates
DE102008002209A1 (de) 2008-06-04 2009-12-10 Evonik Degussa Gmbh Verfahren zur Aufreinigung von Erythropoietin
US20120172299A1 (en) 2008-09-23 2012-07-05 F. Hoffmann-La Roche Ag Purification of erythropoietin
DE102008054716A1 (de) 2008-12-16 2010-06-17 Evonik Degussa Gmbh Inprozesskontrolle in einem Verfahren zur Herstellung von EPO
EP2385115B1 (en) 2008-12-22 2015-09-09 National University Corporation Hokkaido University Expression vector for producing protein derived from foreign gene in large quantity using animal cells, and use thereof
US20100272816A1 (en) 2009-04-27 2010-10-28 Wolfgang Rudinger Microcapsules comprising liver cells and erythropoietin, methods for preparing said microcapsules and methods for treating a patient comprising applying said microcapsules to the patient
MX356669B (es) 2009-05-02 2018-06-08 Genzyme Corp Terapia genica para trastornos neurodegenerativos.
CN102712688B (zh) 2009-09-23 2015-06-24 通益制药有限公司 重组人红细胞生成素(epo)的纯化方法、由此纯化的epo以及包含纯化的epo的药物组合物
KR101443257B1 (ko) * 2011-10-18 2014-09-19 주식회사 종근당 낮은 등전점을 갖는 에리스로포이에틴 유사체의 정제방법
US11707410B2 (en) 2011-10-25 2023-07-25 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US10350139B2 (en) 2011-10-25 2019-07-16 Corning Incorporated Pharmaceutical glass packaging assuring pharmaceutical sterility
US9650411B2 (en) 2012-08-07 2017-05-16 Kyowa Hakko Kirin Co., Ltd. Method of purifying protein
EP2906683B1 (en) 2012-10-15 2017-05-31 Bristol-Myers Squibb Company Mammalian cell culture processes for protein production
WO2014138921A1 (en) 2013-03-15 2014-09-18 Apotex Inc. Enhanced liquid formulation stability of erythropoietin alpha through purification processing
US9700485B2 (en) 2013-04-24 2017-07-11 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9700486B2 (en) 2013-04-24 2017-07-11 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9707153B2 (en) 2013-04-24 2017-07-18 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9717649B2 (en) 2013-04-24 2017-08-01 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9849066B2 (en) 2013-04-24 2017-12-26 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9603775B2 (en) 2013-04-24 2017-03-28 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9717648B2 (en) 2013-04-24 2017-08-01 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9707154B2 (en) 2013-04-24 2017-07-18 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9707155B2 (en) 2013-04-24 2017-07-18 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9713572B2 (en) 2013-04-24 2017-07-25 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
US9839579B2 (en) 2013-04-24 2017-12-12 Corning Incorporated Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients
AU2014310555B2 (en) 2013-08-20 2018-01-18 Lek Pharmaceuticals D.D. Cell culture medium and process for controlling alpha-amidation and/or C-terminal amino acid cleavage of polypeptides
WO2017068051A1 (en) 2015-10-21 2017-04-27 Lek Pharmaceuticals D.D. Peg-based dendron and process for producing the same
KR102268647B1 (ko) 2017-06-12 2021-06-23 한국코러스 주식회사 안정성이 향상된 에리스로포이에틴 조성물 및 이의 제조방법
JP7264353B2 (ja) 2018-05-24 2023-04-25 国立大学法人北海道大学 新規ベクターおよびその利用

Citations (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3033753A (en) * 1959-08-31 1962-05-08 Wilfrid F White Erythropoietic factor purification
US3865801A (en) * 1973-06-15 1975-02-11 Atomic Energy Commission Stabilization of urinary erythropoietin using sodium p-aminosalicylate and extracting into phenol
US4237224A (en) * 1974-11-04 1980-12-02 Board Of Trustees Of The Leland Stanford Jr. University Process for producing biologically functional molecular chimeras
US4254095A (en) * 1978-04-27 1981-03-03 Research Corporation Radioimmunoassay for erythropoietin
US4264731A (en) * 1977-05-27 1981-04-28 The Regents Of The University Of California DNA Joining method
US4273875A (en) * 1979-03-05 1981-06-16 The Upjohn Company Plasmid and process of isolating same
US4293652A (en) * 1979-05-25 1981-10-06 Cetus Corporation Method for synthesizing DNA sequentially
US4303650A (en) * 1979-10-09 1981-12-01 Ajinomoto Co., Inc. Process for production of erythropoietin
GB2085887A (en) * 1980-08-25 1982-05-06 Ashida Shin Process for the production of human erythropoietin
US4338397A (en) * 1980-04-11 1982-07-06 President And Fellows Of Harvard College Mature protein synthesis
US4358535A (en) * 1980-12-08 1982-11-09 Board Of Regents Of The University Of Washington Specific DNA probes in diagnostic microbiology
EP0070685A2 (en) * 1981-07-17 1983-01-26 Amoco Corporation Homogeneous nucleic acid hybridization diagnostics by non-radiative energy transfer
EP0070687A2 (en) * 1981-07-17 1983-01-26 Amoco Corporation Light-emitting polynucleotide hybridization diagnostic method
EP0077670A2 (en) * 1981-10-19 1983-04-27 Genentech, Inc. Human immune interferon
US4394443A (en) * 1980-12-18 1983-07-19 Yale University Method for cloning genes
US4397840A (en) * 1981-03-11 1983-08-09 Ajinomoto Co., Inc. Novel erythropoietin product and method for the preparation thereof
US4399216A (en) * 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4411994A (en) * 1978-06-08 1983-10-25 The President And Fellows Of Harvard College Protein synthesis
EP0093619A1 (en) * 1982-05-05 1983-11-09 Genentech, Inc. Human tissue plasminogen activator, pharmaceutical compositions containing it, processes for making it, and DNA and transformed cell intermediates therefor
WO1983004053A1 (en) * 1982-05-06 1983-11-24 Applied Molecular Genetics, Inc. The manufacture and expression of large structural genes
US4442205A (en) * 1981-09-22 1984-04-10 The United States Of America As Represented By The Department Of Health And Human Services Simian virus recombinant that directs the synthesis of hepatitis B surface antigen
US4465624A (en) * 1983-02-21 1984-08-14 Snow Brand Milk Products Co., Ltd. Process for producing erythropoietin
EP0116446A2 (en) * 1983-02-04 1984-08-22 Kirin-Amgen, Inc. Hybridoma cell line and its monoclonal antibody to erythropoletin
US4468464A (en) * 1974-11-04 1984-08-28 The Board Of Trustees Of The Leland Stanford Junior University Biologically functional molecular chimeras
EP0117058A2 (en) * 1983-01-19 1984-08-29 Genentech, Inc. Methods for producing mature protein in vertebrate host cells
EP0117060A2 (en) * 1983-01-19 1984-08-29 Genentech, Inc. Methods of screening and amplification in eukaryotic host cells, and nucleotide sequences and expression vectors for use therein
EP0117059A2 (en) * 1983-01-19 1984-08-29 Genentech, Inc. Methods for producing human tPA and expression vectors therefor
EP0123294A1 (en) * 1983-04-22 1984-10-31 Amgen Inc. Yeast cell transformation vectors
US4503151A (en) * 1980-12-10 1985-03-05 Research Corporation Recombinant cDNA construction method and hybrid nucleotides useful in cloning
EP0136490A2 (en) * 1983-08-10 1985-04-10 Amgen Inc. DNA plasmids
WO1985001961A1 (en) * 1983-10-28 1985-05-09 Genetics Institute Production of factor viii and related products
WO1985003079A1 (en) * 1984-01-11 1985-07-18 New York University HUMAN ERYTHROPOIETIN cDNA CLONES
WO1985004419A1 (en) * 1984-03-22 1985-10-10 Biogen N.V. High copy number expression vectors
US4558005A (en) * 1982-09-13 1985-12-10 University Patents, Inc. Monoclonal anti-erythropoietin
US4568488A (en) * 1984-01-11 1986-02-04 Lee Huang Sylvia Reverse immunoaffinity chromatography purification method
WO1986003520A1 (en) * 1984-12-04 1986-06-19 Genetics Institute, Inc. Method for the production of erythropoietin
US4667016A (en) * 1985-06-20 1987-05-19 Kirin-Amgen, Inc. Erythropoietin purification
US4677195A (en) * 1985-01-11 1987-06-30 Genetics Institute, Inc. Method for the purification of erythropoietin and erythropoietin compositions
US4695542A (en) * 1983-10-04 1987-09-22 Dnax Research Institute Of Molecular And Cellular Biology, Inc. cDNA clones coding for polypeptides exhibiting multi-lineage cellular growth factor activity
US4703008A (en) * 1983-12-13 1987-10-27 Kiren-Amgen, Inc. DNA sequences encoding erythropoietin
US4757006A (en) * 1983-10-28 1988-07-12 Genetics Institute, Inc. Human factor VIII:C gene and recombinant methods for production

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5455790A (en) * 1977-10-05 1979-05-04 Tomoyuki Tajima Production of erythropoetin
US4568448A (en) * 1980-11-26 1986-02-04 Mobil Oil Corporation Hydrodesulfurization process employing poison-resistant catalyst
JPS6043395A (ja) * 1983-08-19 1985-03-07 Sumitomo Chem Co Ltd エリスロポエチンの製造法
JPS60215632A (ja) * 1984-04-12 1985-10-29 Japan Found Cancer エリスロポエチンの製造法
JP3344027B2 (ja) * 1993-09-21 2002-11-11 ソニー株式会社 ドライエッチング方法

Patent Citations (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3033753A (en) * 1959-08-31 1962-05-08 Wilfrid F White Erythropoietic factor purification
US3865801A (en) * 1973-06-15 1975-02-11 Atomic Energy Commission Stabilization of urinary erythropoietin using sodium p-aminosalicylate and extracting into phenol
US4237224A (en) * 1974-11-04 1980-12-02 Board Of Trustees Of The Leland Stanford Jr. University Process for producing biologically functional molecular chimeras
US4468464A (en) * 1974-11-04 1984-08-28 The Board Of Trustees Of The Leland Stanford Junior University Biologically functional molecular chimeras
US4264731A (en) * 1977-05-27 1981-04-28 The Regents Of The University Of California DNA Joining method
US4254095A (en) * 1978-04-27 1981-03-03 Research Corporation Radioimmunoassay for erythropoietin
US4411994A (en) * 1978-06-08 1983-10-25 The President And Fellows Of Harvard College Protein synthesis
US4273875A (en) * 1979-03-05 1981-06-16 The Upjohn Company Plasmid and process of isolating same
US4293652A (en) * 1979-05-25 1981-10-06 Cetus Corporation Method for synthesizing DNA sequentially
US4303650A (en) * 1979-10-09 1981-12-01 Ajinomoto Co., Inc. Process for production of erythropoietin
US4399216A (en) * 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4338397A (en) * 1980-04-11 1982-07-06 President And Fellows Of Harvard College Mature protein synthesis
GB2085887A (en) * 1980-08-25 1982-05-06 Ashida Shin Process for the production of human erythropoietin
US4377513A (en) * 1980-08-25 1983-03-22 Ken Hayashibara Process for the production of human erythropoietin
US4358535A (en) * 1980-12-08 1982-11-09 Board Of Regents Of The University Of Washington Specific DNA probes in diagnostic microbiology
US4358535B1 (enExample) * 1980-12-08 1986-05-13
US4503151A (en) * 1980-12-10 1985-03-05 Research Corporation Recombinant cDNA construction method and hybrid nucleotides useful in cloning
US4394443A (en) * 1980-12-18 1983-07-19 Yale University Method for cloning genes
US4397840A (en) * 1981-03-11 1983-08-09 Ajinomoto Co., Inc. Novel erythropoietin product and method for the preparation thereof
EP0070687A2 (en) * 1981-07-17 1983-01-26 Amoco Corporation Light-emitting polynucleotide hybridization diagnostic method
EP0070685A2 (en) * 1981-07-17 1983-01-26 Amoco Corporation Homogeneous nucleic acid hybridization diagnostics by non-radiative energy transfer
US4442205A (en) * 1981-09-22 1984-04-10 The United States Of America As Represented By The Department Of Health And Human Services Simian virus recombinant that directs the synthesis of hepatitis B surface antigen
EP0077670A2 (en) * 1981-10-19 1983-04-27 Genentech, Inc. Human immune interferon
DE3316297A1 (de) * 1982-05-05 1983-11-17 Genentech, Inc., 94080 South San Francisco, Calif. Humangewebe-plasminogen-aktivator
EP0093619A1 (en) * 1982-05-05 1983-11-09 Genentech, Inc. Human tissue plasminogen activator, pharmaceutical compositions containing it, processes for making it, and DNA and transformed cell intermediates therefor
WO1983004053A1 (en) * 1982-05-06 1983-11-24 Applied Molecular Genetics, Inc. The manufacture and expression of large structural genes
US4558005A (en) * 1982-09-13 1985-12-10 University Patents, Inc. Monoclonal anti-erythropoietin
EP0117059A2 (en) * 1983-01-19 1984-08-29 Genentech, Inc. Methods for producing human tPA and expression vectors therefor
EP0117060A2 (en) * 1983-01-19 1984-08-29 Genentech, Inc. Methods of screening and amplification in eukaryotic host cells, and nucleotide sequences and expression vectors for use therein
EP0117058A2 (en) * 1983-01-19 1984-08-29 Genentech, Inc. Methods for producing mature protein in vertebrate host cells
EP0116446A2 (en) * 1983-02-04 1984-08-22 Kirin-Amgen, Inc. Hybridoma cell line and its monoclonal antibody to erythropoletin
US4558006A (en) * 1983-02-04 1985-12-10 Kirin-Amgen, Inc. A.T.C.C. HB8209 and its monoclonal antibody to erythropoietin
US4465624A (en) * 1983-02-21 1984-08-14 Snow Brand Milk Products Co., Ltd. Process for producing erythropoietin
EP0123294A1 (en) * 1983-04-22 1984-10-31 Amgen Inc. Yeast cell transformation vectors
EP0136490A2 (en) * 1983-08-10 1985-04-10 Amgen Inc. DNA plasmids
US4710473A (en) * 1983-08-10 1987-12-01 Amgen, Inc. DNA plasmids
US4695542A (en) * 1983-10-04 1987-09-22 Dnax Research Institute Of Molecular And Cellular Biology, Inc. cDNA clones coding for polypeptides exhibiting multi-lineage cellular growth factor activity
WO1985001961A1 (en) * 1983-10-28 1985-05-09 Genetics Institute Production of factor viii and related products
US4757006A (en) * 1983-10-28 1988-07-12 Genetics Institute, Inc. Human factor VIII:C gene and recombinant methods for production
US4703008A (en) * 1983-12-13 1987-10-27 Kiren-Amgen, Inc. DNA sequences encoding erythropoietin
US4568488A (en) * 1984-01-11 1986-02-04 Lee Huang Sylvia Reverse immunoaffinity chromatography purification method
WO1985003079A1 (en) * 1984-01-11 1985-07-18 New York University HUMAN ERYTHROPOIETIN cDNA CLONES
WO1985004419A1 (en) * 1984-03-22 1985-10-10 Biogen N.V. High copy number expression vectors
WO1986003520A1 (en) * 1984-12-04 1986-06-19 Genetics Institute, Inc. Method for the production of erythropoietin
US4677195A (en) * 1985-01-11 1987-06-30 Genetics Institute, Inc. Method for the purification of erythropoietin and erythropoietin compositions
US4667016A (en) * 1985-06-20 1987-05-19 Kirin-Amgen, Inc. Erythropoietin purification

Non-Patent Citations (473)

* Cited by examiner, † Cited by third party
Title
"Points to Consider in the Characterization of Cell Lines Used to Produce Biologics," Jun. 1, 1984, Office of Biologics Research Review, Center for Drugs & Biologics, U.S. Food & Drug Administration (Section A, Part 2) (not enclosed).
Abraham et al., "Nucleotide Sequence of a Bovine Clone Encoding the Angiogenic Protein, Basic Fibroblast Growth Factor," Science, 233, 545-548 (Aug. 1, 1986).
Abraham et al., Nucleotide Sequence of a Bovine Clone Encoding the Angiogenic Protein, Basic Fibroblast Growth Factor, Science, 233, 545 548 (Aug. 1, 1986). *
Adamson, "The Polycythemias: Diagnosis and Treatment," Hosp. Practice, 18(12), 49-57 (Dec. 1983).
Adamson, The Polycythemias: Diagnosis and Treatment, Hosp. Practice, 18(12), 49 57 (Dec. 1983). *
Aebi et al., "Sequence Requirements for Splicing of Higher Eukaryotic Nuclear Pre-mRNA," Cell, 47, 555-565 (Nov. 21, 1986).
Aebi et al., Sequence Requirements for Splicing of Higher Eukaryotic Nuclear Pre mRNA, Cell, 47, 555 565 (Nov. 21, 1986). *
Agarwal et al., "A General Method for Detection and Characterization of an mRNA using an Oligonucleotide Probe," J. Biol. Chem., 256, 1023-1028 (Jan. 25, 1981).
Agarwal et al., A General Method for Detection and Characterization of an mRNA using an Oligonucleotide Probe, J. Biol. Chem., 256, 1023 1028 (Jan. 25, 1981). *
Anderson et al., "Isolation of a genomic clone for bovine pancreatic trypsin inhibitor by using a unique-sequence synthetic DNA probe," P.N.A.S. (USA), 80, 6838-6842 (Nov. 1983).
Anderson et al., Isolation of a genomic clone for bovine pancreatic trypsin inhibitor by using a unique sequence synthetic DNA probe, P.N.A.S. (USA), 80, 6838 6842 (Nov. 1983). *
Baciu et al., "Erythropoietin Interaction with the Mature Red Cell Membrane," Ann. N.Y. Acad. Sci., 414, 66-72 (1983).
Baciu et al., Erythropoietin Interaction with the Mature Red Cell Membrane, Ann. N.Y. Acad. Sci., 414, 66 72 (1983). *
Baron et al., "Antibodies against the Chemically Synthesized Genome-Linked Protein of Poliovirus React with Native Virus-Specific Proteins," Cell, 28, 395-404 (Feb. 1982).
Baron et al., Antibodies against the Chemically Synthesized Genome Linked Protein of Poliovirus React with Native Virus Specific Proteins, Cell, 28, 395 404 (Feb. 1982). *
Beaucage et al., "Deoxynucleoside Phosphoramidites-A new Class of Key Intermediates for Deoxypolynucleotide Synthesis," Tetrahedron Letters, 22(20), 1859-1862 (1981).
Beaucage et al., Deoxynucleoside Phosphoramidites A new Class of Key Intermediates for Deoxypolynucleotide Synthesis, Tetrahedron Letters, 22(20), 1859 1862 (1981). *
Benedum et al., "The primary structure of bovine chromogranin A: a representative of a class of acidic secretory proteins common to a variety of peptidergic cells," EMBO J. 5(7), 1495-1502 (1986).
Benedum et al., The primary structure of bovine chromogranin A: a representative of a class of acidic secretory proteins common to a variety of peptidergic cells, EMBO J. 5(7), 1495 1502 (1986). *
Bennetzen et al., "Codon Selection in Yeast," J. Biol. Chem., 257(6), 3026-3031 (Mar. 25, 1982).
Bennetzen et al., Codon Selection in Yeast, J. Biol. Chem., 257(6), 3026 3031 (Mar. 25, 1982). *
Bentley et al., "Human immunoglobulin variable region genes-DNA sequences of two Vk genes and a pseudogene," Nature 288, 730-733 (Dec. 1980).
Bentley et al., Human immunoglobulin variable region genes DNA sequences of two V k genes and a pseudogene, Nature 288, 730 733 (Dec. 1980). *
Benton et al., "Screening λgt Recombinant Clones by Hybridization to single Plaques in situ," Science 196, 180-182 (Apr. 8, 1977).
Benton et al., Screening gt Recombinant Clones by Hybridization to single Plaques in situ, Science 196, 180 182 (Apr. 8, 1977). *
Berzofsky et al., "Properties of Monoclonal Antibodies Specific for Determinants of a Protein Antigen, Myoblobin," J. Biol. Chem. 255(23), 11188-11191 (Dec. 10, 1980).
Berzofsky et al., "Topographic Antigenic Determinants REcognized by Monoclonal Antibodies to Sperm Whale Myoglobin," J. Biol. Chem. 257(6), 3189-3198 (Mar. 25, 1982).
Berzofsky et al., Properties of Monoclonal Antibodies Specific for Determinants of a Protein Antigen, Myoblobin, J. Biol. Chem. 255(23), 11188 11191 (Dec. 10, 1980). *
Berzofsky et al., Topographic Antigenic Determinants REcognized by Monoclonal Antibodies to Sperm Whale Myoglobin, J. Biol. Chem. 257(6), 3189 3198 (Mar. 25, 1982). *
Betsholtz et al., "cDNA sequence and chromosomal localization of human platelet-derived growth factor A-chain and its expression in tumour cell lines," Nature 320, 695-699 (Apr. 24, 1986).
Betsholtz et al., cDNA sequence and chromosomal localization of human platelet derived growth factor A chain and its expression in tumour cell lines, Nature 320, 695 699 (Apr. 24, 1986). *
Billat et al., "In vitro and In Vivo Regulation of Hepatic Erythropoiesis by Erythropoietin and Glucocorticoids in the Rat Fetus," Exp. Hematol., 10(1), 133-140 (1982).
Billat et al., In vitro and In Vivo Regulation of Hepatic Erythropoiesis by Erythropoietin and Glucocorticoids in the Rat Fetus, Exp. Hematol., 10(1), 133 140 (1982). *
Blattner et al., "Charon Phages: Safer Derivatives of Bacteriophage Lambda for DNA Cloning," Science, 196, 161-169 (Apr. 8, 1977).
Blattner et al., Charon Phages: Safer Derivatives of Bacteriophage Lambda for DNA Cloning, Science, 196, 161 169 (Apr. 8, 1977). *
Bos et al., pp. 125-130, in Proc.Symp.Mol.Biol.Negat., Strand Viruses Meeting, 1983, Compans, et al., eds. Acad. Press (1984).
Bray et al., "Human cDNA clones for four species of Gα-signal transduction protein," P.N.A.S. (USA), 83, 8893-8897 (Dec. 1986).
Bray et al., Human cDNA clones for four species of G signal transduction protein, P.N.A.S. ( USA ), 83, 8893 8897 (Dec. 1986). *
Breslow et al., "Isolation and characterization of cDNA clones for human apolipoprotein A-I," P.N.A.S.(USA), 79, 6861-6865 (Nov. 1982).
Breslow et al., Isolation and characterization of cDNA clones for human apolipoprotein A I, P.N.A.S. ( USA ), 79, 6861 6865 (Nov. 1982). *
Broome et al., "Immunological screening method to detect specific translation products," P.N.A.S. (USA), 75(6), 2746-2749 (Jun. 1978).
Broome et al., Immunological screening method to detect specific translation products, P.N.A.S. ( USA ), 75(6), 2746 2749 (Jun. 1978). *
Canaani et al., "Regulated expression of human interferon β1 gene after transduction into cultured mouse and rabbit cells," P.N.A.S. (USA), 79, 5166-5170 (Sep. 1982).
Canaani et al., Regulated expression of human interferon 1 gene after transduction into cultured mouse and rabbit cells, P.N.A.S. ( USA ), 79, 5166 5170 (Sep. 1982). *
Chan et al., "Construction and selection of recombinant plasmids containing full-length complementary DNAs corresponding to rat insulins I and II," P.N.A.S. (USA), 76(10), 5036-5040 (Oct. 1979).
Chan et al., Construction and selection of recombinant plasmids containing full length complementary DNAs corresponding to rat insulins I and II, P.N.A.S. ( USA ), 76(10), 5036 5040 (Oct. 1979). *
Chia et al., "The construction of cosmid libraries of eukaryotic DNA using the Homer series of vectors," Nucleic Acids Res. 10(8), 2503-2520 (1982).
Chia et al., The construction of cosmid libraries of eukaryotic DNA using the Homer series of vectors, Nucleic Acids Res. 10(8), 2503 2520 (1982). *
Chiba et al., "Stabilization of Urinary Erythropoietin," Biochem. and Biophys. Res. Commun., 47(6), 1372-1377 (1972).
Chiba et al., Stabilization of Urinary Erythropoietin, Biochem. and Biophys. Res. Commun., 47(6), 1372 1377 (1972). *
Chirgwin et al., "Isolation of Biologically Active Ribonucleic Acid from Sources Enriched in Ribonuclease," Biochemistry, 18(24), 5294-5299 (1979).
Chirgwin et al., Isolation of Biologically Active Ribonucleic Acid from Sources Enriched in Ribonuclease, Biochemistry, 18(24), 5294 5299 (1979). *
Chisholm, "On the Trail of the Magic Bullet: Monoclonal antibodies promise perfectly targeted chemicals," High Technology, vol. 2(1), 57-63 (Jan. 1983).
Chisholm, On the Trail of the Magic Bullet: Monoclonal antibodies promise perfectly targeted chemicals, High Technology, vol. 2(1), 57 63 (Jan. 1983). *
Chomczynski et al., "Alkaline Transfer of DNA to Plastic Membrane," Biochem. Biophys. Res. Commun., 122(1), 340-44 (Jul. 18, 1984).
Chomczynski et al., Alkaline Transfer of DNA to Plastic Membrane, Biochem. Biophys. Res. Commun., 122(1), 340 44 (Jul. 18, 1984). *
Choo et al., "Molecular cloning of the gene for human anti-haemophilic factor IX," Nature, 299, 178-180 (Sep. 9, 1982).
Choo et al., Molecular cloning of the gene for human anti haemophilic factor IX, Nature, 299, 178 180 (Sep. 9, 1982). *
Choppin et al., "Characterization of Erythropoietin Produced by IW32 Murine Erythroleukemia Cells," Blood, 64(2), 341-347 (Aug. 1984).
Choppin et al., Characterization of Erythropoietin Produced by IW32 Murine Erythroleukemia Cells, Blood, 64(2), 341 347 (Aug. 1984). *
Chou et al., "Empirical Predictions of Protein Conformation," Ann. Rev. Biochem., 47, 251-77 (1978).
Chou et al., "Prediction of Protein Conformation," Biochem., 13(2), 222-245 (1974).
Chou et al., "Prediction of the Secondary Structure of Proteins from their Amino Acid Sequence," Advances in Enzymology, 47, 45-47 (1978).
Chou et al., Empirical Predictions of Protein Conformation, Ann. Rev. Biochem., 47, 251 77 (1978). *
Chou et al., Prediction of Protein Conformation, Biochem., 13(2), 222 245 (1974). *
Chou et al., Prediction of the Secondary Structure of Proteins from their Amino Acid Sequence, Advances in Enzymology, 47, 45 47 (1978). *
Christman et al., "Amplification of expression of hepatitis B surface antigen in 3T3 cells cotransfected with a dominant-acting gene and cloned viral DNA," P.N.A.S. 79, 1815-1819 (Mar. 1982).
Christman et al., Amplification of expression of hepatitis B surface antigen in 3T3 cells cotransfected with a dominant acting gene and cloned viral DNA, P.N.A.S. 79, 1815 1819 (Mar. 1982). *
Claus Walker et al., Spinal Cord Injury and Serum Erythropoietin, Arch. Phys. Med. Rehabil., 65, 370 374 (Jul. 1984). *
Claus-Walker et al., "Spinal Cord Injury and Serum Erythropoietin," Arch. Phys. Med. Rehabil., 65, 370-374 (Jul. 1984).
Colby et al., J.Immunol., 133(6), 3091-3095 (1984).
Collen et al., "Biological Properties of Human Tissue-Type Plasminogen Activator Obtained by Expression of Recombinant DNA in Mammalian Cells," J. of Pharmacology and Exp. Therapeutics, 231(1), 146-152 (1984).
Collen et al., Biological Properties of Human Tissue Type Plasminogen Activator Obtained by Expression of Recombinant DNA in Mammalian Cells, J. of Pharmacology and Exp. Therapeutics, 231(1), 146 152 (1984). *
Colman, "Cells that secrete foreign proteins," TIBS, 435-437 (Dec. 1982).
Colman, Cells that secrete foreign proteins, TIBS, 435 437 (Dec. 1982). *
Comb et al., "Primary structure of the human Met- and Leu-enkephalin precursor and its mRNA," Nature, 295, 663-666 (Feb. 25, 1982).
Comb et al., Primary structure of the human Met and Leu enkephalin precursor and its mRNA, Nature, 295, 663 666 (Feb. 25, 1982). *
Congote et al., "The Erythrotropins, New Erythroid Cell Stimulating Factors Extractd From Human and Bovine Fetal Tissues," Abstract 364, Proceedings 7th International Congress of Endocrinology (Quebec City, Quebec, Jul. 1-7, 1984).
Congote et al., The Erythrotropins, New Erythroid Cell Stimulating Factors Extractd From Human and Bovine Fetal Tissues, Abstract 364, Proceedings 7th International Congress of Endocrinology (Quebec City, Quebec, Jul. 1 7, 1984). *
Congote, "Extraction from Fetal Bovine Serum of Erythrotropin, an Erythroid Cell-Stimulating Factor," Anal. Biochem., 140, 428-433 (1984).
Congote, "Isolation of Two Biologically Active Peptides, Erythrotropin I and Erythrotropin II from Fetal Calf Intestine," Biochem. Biophys. Res. Comm., 115(2), 477-483 (Sep. 15, 1983).
Congote, "Regulation of Fetal Liver Erythropoiesis," J. of Steroid Biochemistry, 3, 423-428 (1977).
Congote, Extraction from Fetal Bovine Serum of Erythrotropin, an Erythroid Cell Stimulating Factor, Anal. Biochem., 140, 428 433 (1984). *
Congote, Isolation of Two Biologically Active Peptides, Erythrotropin I and Erythrotropin II from Fetal Calf Intestine, Biochem. Biophys. Res. Comm., 115(2), 477 483 (Sep. 15, 1983). *
Congote, Regulation of Fetal Liver Erythropoiesis, J. of Steroid Biochemistry, 3, 423 428 (1977). *
Contrera et al., "Extraction of erythropoietin from Kidneys of Hypoxic and Phenylhydrazine-treated rats," Blood, 25(5), 809-816 (May 1965).
Contrera et al., Extraction of erythropoietin from Kidneys of Hypoxic and Phenylhydrazine treated rats, Blood, 25(5), 809 816 (May 1965). *
Costantini et al., "Gene Transfer into the Mouse Germ-Line," J. Cell Physiol. Supp. 1, 219-226 (1982).
Costantini et al., "Introduction of a Rabbit Betaglobin Gene into the Mouse Germ Line," Nature, 294, 92-94 (Nov. 5, 1981).
Costantini et al., Gene Transfer into the Mouse Germ Line, J. Cell Physiol. Supp. 1, 219 226 (1982). *
Costantini et al., Introduction of a Rabbit Betaglobin Gene into the Mouse Germ Line, Nature, 294, 92 94 (Nov. 5, 1981). *
Cotes et al., "Bio-Assay of Erythropoietin in Mice made Polycythaemic by Exposure to Air at a Reduced Pressure," Nature, 191, 1065-1067 (Sep. 9, 1961).
Cotes et al., "Changes in serum immunoreactive erythropoietin during the menstrual cycle and normal pregnancy," Brit. J. Obstet. Gynaecol., 90, 304-311 (Apr. 1983).
Cotes et al., Bio Assay of Erythropoietin in Mice made Polycythaemic by Exposure to Air at a Reduced Pressure, Nature, 191, 1065 1067 (Sep. 9, 1961). *
Cotes et al., Changes in serum immunoreactive erythropoietin during the menstrual cycle and normal pregnancy, Brit. J. Obstet. Gynae col., 90, 304 311 (Apr. 1983). *
Dainiak et al., "Mechanisms of Abnormal Erythropoiesis in Malignancy," Cancer, 51(6), 1101-1106 (1983).
Dainiak et al., Mechanisms of Abnormal Erythropoiesis in Malignancy, Cancer, 51(6), 1101 1106 (1983). *
Das et al., "Use of synthetic oligonucleotide probes complementary to genes for human HLA-DRα and β as extension primers for the isolation of 5'-specific genomic clones," P.N.A.S. (USA), 80, 1531-1535 (Mar. 1983).
Das et al., Use of synthetic oligonucleotide probes complementary to genes for human HLA DR and as extension primers for the isolation of 5 specific genomic clones, P.N.A.S. ( USA ), 80, 1531 1535 (Mar. 1983). *
Davis et al., "A Manual for Genetic Engineering, Advanced Bacterial Genetics", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1983), pp. 55-58 & 174-176.
Davis et al., A Manual for Genetic Engineering, Advanced Bacterial Genetics , Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1983), pp. 55 58 & 174 176. *
Davis et al., Proc.Natl.Acad.Sci.(USA), 80, 3976-3980 (1983).
Derynck et al., "Human Transforming Growth Factor-α: Precursor Structure and Expression in E. coli," Cell, 38, 287-297 (Aug. 1984).
Derynck et al., "Human transforming growth factor-β complementary DNA sequence and expression in normal and transformed cells," Nature, 316, 701-705 (Aug. 22, 1985).
Derynck et al., Human Transforming Growth Factor : Precursor Structure and Expression in E. coli, Cell, 38, 287 297 (Aug. 1984). *
Derynck et al., Human transforming growth factor complementary DNA sequence and expression in normal and transformed cells, Nature, 316, 701 705 (Aug. 22, 1985). *
Dessypris et al., "Effect of pure erythropoietin on DNA-synthesis by human marrow day 15 erythroid burst forming units in short-term liquid culture," Brit. J. Haematol., 56, 295-306 (1984).
Dessypris et al., Effect of pure erythropoietin on DNA synthesis by human marrow day 15 erythroid burst forming units in short term liquid culture, Brit. J. Haematol., 56, 295 306 (1984). *
Devos et al., J.Interferon Research, 4, 461-468 (1984).
Docherty et al., "Sequence of human tissue inhibitor of metalloproteinases and its identity to erythroid-potentiating activity," Nature, 318, 66-69 (Nov. 7, 1985).
Docherty et al., Sequence of human tissue inhibitor of metalloproteinases and its identity to erythroid potentiating activity, Nature, 318, 66 69 (Nov. 7, 1985). *
Dordal et al., "The Role of Carbohydrate in Erythropoietin Action," Endocrinology, 116(6), 2293-2299 (1985).
Dordal et al., The Role of Carbohydrate in Erythropoietin Action, Endocrinology, 116(6), 2293 2299 (1985). *
Dressman et al., "Antibody to hepatitis B surface antigen after a single inoculation of uncoupled synthetic HBsAg peptides," Nature, 295, 158-160 (Jan. 14, 1982).
Dressman et al., Antibody to hepatitis B surface antigen after a single inoculation of uncoupled synthetic HBsAg peptides, Nature, 295, 158 160 (Jan. 14, 1982). *
Dunn et al., "Erythropoietin Bioassays Using Fetal Mouse Liver Cells: Validations and Technical Improvements," Exp. Hematol., 11(7), 590-600 (Aug. 1983).
Dunn et al., "Serum erythropoietin titers during prolonged bedrest; relevance to the anaemia of space flight," Eur. J. Appln. Physiol., 52, 178-182 (1984).
Dunn et al., Erythropoietin Bioassays Using Fetal Mouse Liver Cells: Validations and Technical Improvements, Exp. Hematol., 11(7), 590 600 (Aug. 1983). *
Dunn et al., Serum erythropoietin titers during prolonged bedrest; relevance to the anaemia of space flight, Eur. J. Appln. Physiol., 52, 178 182 (1984). *
Dunn et al., Use of a computer model in the understanding of erythropoietic control mechanisms, Chemical Abstracts, 91, 190417r (1979). *
Dunn, "Current Concepts in Erythropoiesis", John Wiley & Sons, Chichester, England, 1983.
Dunn, Current Concepts in Erythropoiesis , John Wiley & Sons, Chichester, England, 1983. *
Edman et al., "A Protein Sequentator," Eur. J. Biochem. 1, 80-91 (1967).
Edman et al., A Protein Sequentator, Eur. J. Biochem. 1, 80 91 (1967). *
Emmanouel et al., "Metabolism of pure human erythropoietin in the rat," Am. J. Physiol., 247(1 Pt 2), F168-76 (1984).
Emmanouel et al., Metabolism of pure human erythropoietin in the rat, Am. J. Physiol., 247(1 Pt 2), F168 76 (1984). *
Eschbach et al., "The Anemia of Chronic Renal Failure in Sheep," J. Clin. Invest., 74(2), 434-441 (Aug. 1984).
Eschbach et al., Correction by Erythropoietin (EPO) Therapy of the Anemia of chronic Renal Failure (CRP) in Sheep, Clin. Res. 29(2), 518A (1981). *
Eschbach et al., The Anemia of Chronic Renal Failure in Sheep, J. Clin. Invest., 74(2), 434 441 (Aug. 1984). *
Espada et al., Purification of Human Urinary Erythropoietin, Fed. Proc. 41, 1159 (1982). *
Fan et al., Proc.Natl.Acad. Sci.(USA), 80, 5965-5969 (1983).
Farber et al., Translation of mRNA from Anemic Baboon Kidney into Biologically Active Erythropoietin, Exp. Hematol., 11, Supp. 14, Abstract 101 (1983). *
Farber et al., Translation of mRNA from Human Kidneys into Biologically Active Erythropoietin Following Microinjection into Xenopus Laevis Oocytes, Blood, 62(5), Supp. No. 1, Abstract 392, 122a (1983). *
Farber et al., Translation of mRNA from human kidneys into biologically active erythropoietin following microinjection into xenopus laevis oocytes, J. Lab. Clin. Med., 102, 681 abstract (Nov. 1983). *
Farber, Translation of RNA from Human Kidneys into Biologically Active Erythropoietin Following Microinjection into Xenopus Laevis Oocytes, Clin. Res., 31(4), 769A (Nov. 1983). *
Fiddes et al., "The Gene Encoding the Common Alpha Subunit of the Four Human Glycoprotein Hormones," J. Mol. & App. Genetics, 1, 3-18 (1981).
Fiddes et al., The Gene Encoding the Common Alpha Subunit of the Four Human Glycoprotein Hormones, J. Mol. & App. Genetics, 1, 3 18 (1981). *
Fiers et al., Phil.Trans.R.Soc.Lond., B299, 29-38 (1982).
Finch, "Erythropoiesis, Erythropoietin, and Iron," Blood, 60(6), 1241-1246 (Dec. 1982).
Finch, Erythropoiesis, Erythropoietin, and Iron, Blood, 60(6), 1241 1246 (Dec. 1982). *
Fischinger et al., Proc.Natl.Acad.Sci.(USA), 78, 1920-1924 (1981).
Fisher et al., "Cooperative Erythropoietic Assay of Several Steroid Metabolites in Polycythemic Mice," Steroids, 30(6), 833-845 (Dec. 1977).
Fisher et al., "Effects of testosterone, cobalt & hypoxia on erythropoietin production in the isolated perfused dog kidney," Ann. N.Y. Acad. Sci., 75-87 (1967).
Fisher et al., Cooperative Erythropoietic Assay of Several Steroid Metabolites in Polycythemic Mice, Steroids, 30(6), 833 845 (Dec. 1977). *
Fisher et al., Effects of testosterone, cobalt & hypoxia on erythropoietin production in the isolated perfused dog kidney, Ann. N.Y. Acad. Sci., 75 87 (1967). *
Fisher, "Control of Erythropoietin Production," Proc. Soc. Exp. Biol. & Med. 173, 289-305 (1983).
Fisher, "Erythropoietin: Pharmacology, Biogenesis and Control of Production," Pharmacological Review, 24(3), 459-508 (1972).
Fisher, Control of Erythropoietin Production, Proc. Soc. Exp. Biol. & Med. 173, 289 305 (1983). *
Fisher, Erythropoietin: Pharmacology, Biogenesis and Control of Production, Pharmacological Review, 24(3), 459 508 (1972). *
Garcia et al., "Immunological Neutralization of Various Erythropoietins," Proc. Soc. Exptl. Biol. Med., 112, 712-714 (1963).
Garcia et al., "Radioimmunoassay of Erythropoietin," Blood Cells 5, 405-419 (1979).
Garcia et al., "Radioimmunoassay of erythropoietin: circulating levels in normal and polycythemic human beings," J. Lab. Clin. Med., 99, 624-635 (May 1982).
Garcia et al., Immunological Neutralization of Various Erythropoietins, Proc. Soc. Exptl. Biol. Med., 112, 712 714 (1963). *
Garcia et al., Radioimmunoassay of Erythropoietin, Blood Cells 5, 405 419 (1979). *
Garcia et al., Radioimmunoassay of erythropoietin: circulating levels in normal and polycythemic human beings, J. Lab. Clin. Med., 99, 624 635 (May 1982). *
Garoff et al., J.Cell.Biol., 97, 652-658 (1983).
Gasser et al., "Expression of abbbreviated mouse dihydrofolate reductase genes in cultured hamster cells," P.N.A.S. (USA), 79, 6522-6526 (Nov. 1982).
Gasser et al., Expression of abbbreviated mouse dihydrofolate reductase genes in cultured hamster cells, P.N.A.S. ( USA ), 79, 6522 6526 (Nov. 1982). *
Gene Screen, New England Nuclear, Catalog No. NEF 972. *
Gene Screen, New England Nuclear, Catalog No. NEF-972.
Gething et al, Nature vol. 300 pp. 598 608 Dec. 16, 1982. *
Gething et al, Nature vol. 300 pp. 598-608 Dec. 16, 1982.
Gething et al., "Cell-surface expression of influenza haemagglutinin from a cloned DNA copy of the RNA gene", Nature, 293:620-625 (22 Oct. 1981).
Gething et al., pp. 263-268 in Modern Approaches To Vaccines, Chanock et al., eds. Cold Spring Harbor Lab (1984).
Gibson et al., "An Evaluation of Serum Erythropoietin Estimation By a Hemagglutination Inhibition assay in the Differential Diagnosis of Polycythemia," Pathology, 16, 155-156 (Apr. 1984).
Gibson et al., An Evaluation of Serum Erythropoietin Estimation By a Hemagglutination Inhibition assay in the Differential Diagnosis of Polycythemia, Pathology, 16, 155 156 (Apr. 1984). *
Gluzman, "SV40-Transformed Simian Cells Support the Replication of Early SV40 Mutants," Cell 23, 175-182 (Jan. 1981).
Gluzman, SV40 Transformed Simian Cells Support the Replication of Early SV40 Mutants, Cell 23, 175 182 (Jan. 1981). *
Goeddel et al., "Human leukocyte Interferon Produced by E. coli is biologically active," Nature, 287:411-416 (Oct. 2, 1980).
Goeddel et al., "Synthesis of human fibroblast interferon by E. coli," Nucleic Acids Res., 8(18), 4057-4074 (1980).
Goeddel et al., Human leukocyte Interferon Produced by E. coli is biologically active, Nature, 287:411 416 (Oct. 2, 1980). *
Goeddel et al., Synthesis of human fibroblast interferon by E. coli, Nucleic Acids Res., 8(18), 4057 4074 (1980). *
Goldwasser et al., "An Assay for Erythropoietin in Vitro at the Milliunit Level," Endocrinology, 97(2), 315-323 (Aug. 1975).
Goldwasser et al., "Erythropoietin and the differentiation of red blood cells," Fed. Proc. 34, 2285-2292 (Dec. 1975).
Goldwasser et al., "Erythropoietin: Assay and Study of Its Mode of Action," Meth. in Enzymol., 37, 109-121 (1975).
Goldwasser et al., "Further purification of sheep plasma erythropoietin", Bioch. Biophys. Acta, 64, 487-496 (1962).
Goldwasser et al., "On the mechanism of Erythropoietin-induced Differentiation," J. of Biol. Chem., 249(13), 4202-4206 (Jul. 10, 1974).
Goldwasser et al., "Progress in the purification of erythropoietin," Ann. N.Y. Acad. Sci., 149:49-53 (1968).
Goldwasser et al., "Purification of Erythropoietin," P.N.A.S. (USA), 68(4), 697-698 (Apr. 1971).
Goldwasser et al., "The Molecular Weight of Sheep Plasma Erythropoietin," J. of Biol. Chem., 247(16), 5159-60 (Aug. 25, 1972).
Goldwasser et al., An Assay for Erythropoietin in Vitro at the Milliunit Level, Endocrinology, 97(2), 315 323 (Aug. 1975). *
Goldwasser et al., Erythropoietin and the differentiation of red blood cells, Fed. Proc. 34, 2285 2292 (Dec. 1975). *
Goldwasser et al., Erythropoietin: Assay and Study of Its Mode of Action, Meth. in Enzymol., 37, 109 121 (1975). *
Goldwasser et al., Further purification of sheep plasma erythropoietin , Bioch. Biophys. Acta, 64, 487 496 (1962). *
Goldwasser et al., On the mechanism of Erythropoietin induced Differentiation, J. of Biol. Chem., 249(13), 4202 4206 (Jul. 10, 1974). *
Goldwasser et al., Progress in the purification of erythropoietin, Ann. N.Y. Acad. Sci., 149:49 53 (1968). *
Goldwasser et al., Purification of Erythropoietin, P.N.A.S. ( USA ), 68(4), 697 698 (Apr. 1971). *
Goldwasser et al., The Molecular Weight of Sheep Plasma Erythropoietin, J. of Biol. Chem., 247(16), 5159 60 (Aug. 25, 1972). *
Goldwasser, "Biochemical Control of Erythroid Development", Current Topics in Developmental Biology, ed. A. Monroy and A. A. Noscona, 173-211, Academic Press, N.Y. (1966).
Goldwasser, "From Protein to Gene to Protein: The Molecular Biology of Erythropoietin," Am. J. of Kidney Diseases, 18(4) Suppl. 1, 10-13 (Oct. 1991).
Goldwasser, "Some Thoughts on the Nature of Erythropoietin-Responsive Cells," J. Cell. Physiol., 110 (Supp. 1), 133-135 (1982).
Goldwasser, Biochemical Control of Erythroid Development , Current Topics in Developmental Biology, ed. A. Monroy and A. A. Noscona, 173 211, Academic Press, N.Y. (1966). *
Goldwasser, From Protein to Gene to Protein: The Molecular Biology of Erythropoietin, Am. J. of Kidney Diseases, 18(4) Suppl. 1, 10 13 (Oct. 1991). *
Goldwasser, Some Thoughts on the Nature of Erythropoietin Responsive Cells, J. Cell. Physiol., 110 ( Supp. 1 ), 133 135 (1982). *
Goochee et al., "Environmental Effects on Protein Glycosylation," Biotechnology, 8, 421-427 (May 1990).
Goochee et al., "The Oligosaccharides of Glycoproteins: Bioprocess Factors Affecting Oligosaccharide Structure and their Effect on Glycoprotein Properties," Biotechnology, 9, 1347-1555 (Dec. 1991).
Goochee et al., Environmental Effects on Protein Glycosylation, Biotechnology, 8, 421 427 (May 1990). *
Goochee et al., The Oligosaccharides of Glycoproteins: Bioprocess Factors Affecting Oligosaccharide Structure and their Effect on Glycoprotein Properties, Biotechnology, 9, 1347 1555 (Dec. 1991). *
Goodman et al., "Cloning of Homone Genes from a Mixture of cDNA Molecules," Meth. in Enzymol. 68, 75-90 (1979).
Goodman et al., Cloning of Homone Genes from a Mixture of cDNA Molecules, Meth. in Enzymol. 68, 75 90 (1979). *
Gordon et al., "A plasma extract with erythropoietic activity," Proc. Soc. Expt. Biol. Med., 86:255-258 (1954).
Goto et al., "Production of Recombinant Human Erythropoietin in Mammalian Cells: Host-Cell Dependency of the Biological Activity of the Cloned Glycoprotein," Bio/Tech. 6, 67-71 (Jan. 1988).
Gough et al., "Immunoprecipitation of Specific Polysomes Using Staphylococcus aureus: Purification of the Immunoglobulin-Chain Messenger RNA from the Mouse Myeloma MPC11," Biochemistry 17(25), 5560-5566 (1978).
Gough et al., Nature, 309, 763-767 (1984).
Gouy et al., "Codon Usage in Bacteria: Correlation with Gene Expressivity," Nucleic Acids Res. 10, 7055-7074 (1982).
Graham et al., "A New Technique for the Assay of Infectivity of Human Adenovirus 5 DNA," Virology 52, 456-467 (1973).
Grantham et al., "Codon catalog usage is a genome strategy modulated for gene expressivity," Nucleic Acids Res. 9, r43-74 (1981).
Gray et al., "Expression of human immune interferon cDNA in E. coli and monkey cells," Nature, 295, 503-508 (Feb. 11, 1982).
Gray et al., "Pseudomonas Aeruginosa Secretes and Correctly Processes Human Growth Hormone," Biotechnology, 2, 161-165 (Feb. 1984).
Green et al., "Immunogenic Structure of the Influenza Virus Hemagglutinin," Cell, 28, 477-487 (Mar. 1982).
Greenwood et al., "The Preparation of 131 I-Labelled Human Growth Hormone of High Specific Radioactivity," Biochem. J., 89, 114-123 (1963).
Grimaldi et al., "Interspersed repeated sequences in the African green monkey genome that are homologous to the human Alu family," Nucleic Acid Research, 9(21), 5553-5568 (1981).
Groffen et al "Isolation of Human Oncogene Sequences (v-fes Homolog) from a Cosmid Library," Science, 216, 1136-1138 (Jun. 4, 1982).
Grundmann et al., "Characterization of cDNA coding for human factor XIIIa," P.N.A.S. (USA), 83, 8024-8028 (Nov. 1986).
Grunstein et al., "Colony Hybridization," Meth. in Enzym. 68, 379-389 (1979).
Grunstein et al., "Colony hybridization: A method for the isolation of cloned DNAs that contain a specific gene," P.N.A.S. USA), 72(10), 3961-3965 (Oct. 1975).
Gruss et al., "Expression of simian virus 40-rat preproinsulin recombinants in monkey kidney cells: Use of preproinsulin RNA processing signals," P.N.A.S. (USA), 78(1), 133-137 (Jan. 1981).
Gubler et al., "A simple and very efficient method for generting cDNA libraries," Gene 25, 263-269 (1983).
Haddy, "Erythropoietin in sickle cell disease," Am. Jour. Ped. Hematol./Oncol., 4(2), 191-196 (Summer 1982).
Haga et al., "Plasma Erythropoietin Concentrations During the Erly Anemia of Prematurity," Acta. Pediatr. Scand., 72, 827-831 (1983).
Hagiwara et al., "Erythropoietin Production in a Primary Culture of Human Renal Carcinoma Cells Maintained in Nude Mice," Blood, 63(4), 828-835 (Apr. 1984).
Hamer et al., "A Mouse Globin Gene Promoter is Functional in SV40," Cell, 21, 697-708 (Oct. 1980).
Hamer et al., "Expression of the chromosomal mouse βmaj -globin gene cloned in SV40," Nature, 281, 35-40 (Sep. 6, 1979).
Hammond et al., "Production, Utilization and Excretion of Erythropoietin: I. Chronic Anemias. II. Aplastic Crisis. III. Erythropoietic Effects of Normal Plasma," Ann. N.Y. Acad. Sci., 149, 516-527 (1968).
Hanahan et al., "Plasmid screening at high colony density," Gene, 10, 63-67 (1980).
Hartman et al., Proc.Natl.Acad.Sci.(USA), 79, 233-237 (1982).
Hauser et al., "Inducibility of human β-interferon in mouse L-cell clones," Nature, 297, 650-654 (Jun. 24, 1982).
Haynes et al., Nucleic Acids Res., 11(3), 587-706 (1983).
Haynes et al., pp. 111-129 in Humoral Factors in Host Defense, Yamamura et al., eds. Acad. Press (1983).
Hellmann et al., "Familial erythrocytosis with over-production of erythropoietin," Clin. Lab. Haemat., 5, 335-342 (1983).
Hewick et al., "A Gas-Liquid Solid Phase Peptide and Protein Sequenators," J. Biol. Chem., 256, 7990-7997 (Aug. 1981).
Higashi et al., "Structure and Expression of a Cloned cDNA for Mouse Intefferon-β*," J. Biol. Chem., 258(15):9522-9529 (1983).
Hirs et al., "Peptides Obtained by Tryptic Hydrolysis of Performic Acid-Oxidized Ribonuclease," J. Biol. Chem. 219, 623-642 (1955).
Hopp et al., "Prediction of protein antigenic determinants from amino acid sequences," P.N.A.S. (USA), 78(6), 3824-3838 D-7182 (Jun. 1981).
Houghton et al., "The amino-terminal sequence of human fibroblast interferon as deduced from reverse transcripts obtained using synthetic oligonucleotide primers," Nucleic Acids Res. 8(9), 1913-1931 (1980).
Huang et al., "Characterization of Human Erythropoietin cDNA clones," Am. Soc. of Biological Chemists, Am. Assoc. of Immunologists, Fed. Pract. (USA) 43(6) Abst. 1795, p. 1724 (DATE).
Huang et al., "Identification of Human Erythropoietin Receptor," Am. Soci. of Biological Chemists, Am. Assoc. of Immunologists, Fed. Pract. (USA) 43(7) Abst. 2770, p. 1891 (1984).
Itakura, et al., "Synthesis and Use of Synthetic Oligonucleotides," Ann. Rev. Biochem., 53, 323-356 (1984).
Ito et al., "Solid phase synthesis of polynucloetides. VI. Further studies on polystryene copolymers for the solid support", Nucleic Acids Res. 10(5), 1755-1769 (1982).
Jacobs et al., "Isolation and characterization of genomic and cDNA clones of human erythropoietin," Nature, 313, 806-809 (Feb. 28, 1985).
Jacobsen et al., "Relative effectiveness of phenylhydrazine treatment and hemorrhage in the production of an erythropoietic factor," Blood, 11:937-945 (1956).
Jacobsen et al., "Role of the kidney in erythropoiesis," Nature, 179:633-634 (Mar. 23, 1957).
Jaye et al., "Isolation of human anti-haemophilic factor IX cDNA clone using a unique 52-base synthetic oligonucleotide probe deduced form the amino acid sequence of bovine factor IX," Nucleic Acids Res. 11(8), 2325-2335 (1983).
Jeffreys et al., "Sequence variation and evolution of nuclear DNA in man and the primates," Phil. Trans. R. Soc. Lond., B 292 133-142 (1981).
Jelkman et al., "Extraction of Erythropoietin from Isolated Renal Glomeruli of Hypoxic Rats," Exp. Hematol., 11(7), 581-588 (Aug. 1983).
Kaiser et al., "Amphiphilic Secondary Structure: Design of Peptide Hormones," Science, 223, 249-255 (1984).
Kajimura et al., "Cloning the Heavy Chain of Human HLA-DR Antigen Using Synthetic Oligodeoxyribonucleotides as Hybridization Probes," DNA, 2(3), 175-182 (1983).
Kakidani et al., "Cloning and sequence analysis of cDNA for porcine β-neoendorphin/dynorphin precursor," Nature, 298, 245-249 (Jul. 15, 1982).
Kalmanti, "Correlation of clinical and in vitro erythropoietic responses to androgens in renal failure," Kidney Int'l., 22, 383-391 (1982).
Karn et al., "Novel bacteriophage λ cloning vector," P.N.A.S. (USA), 77, 5712-5176 (Sep. 1980).
Katsuoka et al., "Erythropoietin Production in Human renal Carcinoma Cells Passaged in Nude Mice and in Tissue Culture," Gann, 74, 534-541 (Aug. 1983).
Kaufman et al., "Amplification and Expression of Sequences Cotransfected with a Modular Dihydrofolate Reductase Complementary DNA Gene," J. Mol. Biol. 159, 601-621 (1982).
Kaufman et al., "Expression and Amplification of DNA Introduced into Mammalian Cells," Gene Amplification, R. T. Schimke ed., Cold Spring Harbor, N.Y., 245-250 (1982).
Kennell, "Principles and Practices of Nucleic Acid Hybridization," Prog. Nucl. Acid Res. Mol. Biol. 11, 259-301, p. 293 (1971).
Kenter et al., J.Cell Biol., 98, 2215-2221 (1984).
Kieny et al., Nature, 312, 163-166 (1984).
Kimura et al., "A frameshift addition causes silencing of the δ-globin gene in old world monkeys, an anubis," Nucleic Acids Res., 11(9):2541-2550 (1983).
Knopf et al., "Cloning and Expression of Multiple Protein Kinase C cDNAs," Cell 46, 491-502 (Aug. 15, 1986).
Kohne, "Evolution of Higher-organism DNA," Quarterly Reviews of Biophysics, 3:327-375 (1970).
Kondor-Koch et al., J.Cell.Biol., 97, 644-651 (1983).
Konrad, Ann.N.Y.Acad.Sci., 413, 12-22 (1983).
Konwalinka et al., "A Miniaturized Agar Culture System for Cloning Human Erythropoietic Progenitor Cells," Exp. Hematol., 12, 75-79 (1984).
Korman, "cDNA clones for the heavy chain of HLA-DR antigens obtained after immunopurification of polysomes by monoclonal antibody," P.N.A.S. (USA), 79, 1844-1848 (Mar. 1982).
Kornblihtt et al., "Isolation and characterization of cDNA clones for human and bovine fibronectins," P.N.A.S. (USA), 80, 3218-3222 (Jun. 1983).
Kramer et al., "Comparisons of the Complete Sequences of Two Collagen Genes from Caenorhabditis elegans," Cell 30, 599-606 (Sep. 1982).
Krane, "The Role of Erythropoietin in the Anemia of Chronic Renal Failure," Henry Ford Hosp. Med. J., 31(3), 177-181 (1983).
Krystal, "A Simple Microassay for Erythropoietin Based on 3 H-Thymidine Incorporation into Spleen cells from Phenylhydrazine Treated Mice," Exp. Hematol., 11(7), 649-660 (Aug. 1983).
Kuhn et al., Cell, 37, 95-103 (1984).
Kurachi et al., "Isolation and characterization of a cDNA coding for human factor IX," P.N.A.S. (USA), 79, 6461-6464 (Nov. 1982).
Kuratowska et al., "Studies on the production of erythropoietin by isolated perfused organs," Blood, 18:527-534 (1961).
Kurtz, "A New candidate for the regulation of erythropoiesis: Insulin-like growth factor I," FEBS Letters, 149(1), 105-108 (Nov. 1982).
Kyte et al., "A Simple Method for Displaying the Hydropathic Character of a Protein," J. Mol. Biol., 157, 105-132 (1982).
Lai et al., "Ovalbumin is synthesized in mouse cells transformed with the natural chicken ovalbumin gene," P.N.A.S. (USA), 77(1), 244-248 (Jan. 1980).
Lai et al., "Structural Characterization of Human Erythropoietin," J. of Biol. Chem., 261, 3116-3121 (Mar. 5, 1986).
Lai, "Technical improvements in Protein Microsequencing," Analytica Chimica Acta, 163, 243-248 (1984).
Lange et al., "Application of erythropoietin antisera to studies of erythropoiesis," Ann. N.Y. Acad. Sci., 149:281-291 (1968).
Lappin et al., "The Effect of Erythropoietin and Other Factors on DNA synthesis by Mouse Spleen Cells," Exp. Hematol., 11(7), 661-666 (Aug. 1983).
Lasky et al., pp. 189-194 in Modern Approaches To Vaccines, Chanock et al., eds. Cold Spring Harbor Lab. (1984).
Lathe, "Synthetic Oligonucleotide Probes Deduced from Amino Acid Sequence Data," J. Mol. Biol. 183, 1-12 (1985).
Laub and Ritter, "Expression of the Human Insulin Gene and cDNA in a Heterologous Mammalian System," J. Biol. Chem., 258(10), 6043-6050 (May 25, 1983).
Laub et al., J.Virol., 48(1), 271-280 (1983).
Lauffer et al., "Topology of signal recognition particle receptor in endoplasmic reticulum membrane," Nature, 318, 334-338 (Nov. 28, 1985).
Lawn et al., "The Isolation and Characterization of Linked δ- and β-Globin Genes from a Cloned Library of Human DNA," Cell, 15, 1157-1174 (Dec. 1978).
Ledeen et al., "Gangliosides: Structure, Isolation, and Analysis," Methods in Enzymology, 83 (Part D), 139-191 (1982).
Lee-Huang, "A New Preparative Method for Isolation of Human Erythropoietin With Hydrophobic Interaction Chromatography," Blood, 56(4), 620-624 (Oct. 1980).
Lee-Huang, "Cloning and Expression of Human EPO cDNA in E. coli," P.N.A.S. (USA), 81, 2708-2712 (May 1984).
Lee-Huang, "Cloning of Human Erythropoietin," Biophysical J., 45(Part 2 of 2), ABT. M-PM-A12, p. 30a (1984).
Lee-Huang, "Monoclonal Antibodies to Human Erythropoietin," Abstract No. 1463, Fed. Proc., 41, 520 (1982).
Lee-Huang, "The Erythropoietin Gene," Oncogenes, Genes and Growth Factors, Chap. 7, pp. 199-222, ed. Gordon Caraft, John Wiley & Sons, Inc. (1987).
Lerner et al., "Antibodies to Chemically Synthesized Peptides Predicted from DNA Sequences as Probes of Gene Expression," Cell, 23, 309-310 (Feb. 1981).
Lerner et al., "Chemically synthesized peptides predicted from the nucleotide sequence of the hepatitis B virus genome elicit antibodies reactive with the native envelope protein of Dane particles," P.N.A.S. (USA), 78(6), 3403-3407 (Jun. 1981).
Lerner, "Synthetic Vaccines," Scientific American, 248(2) 66-74 (1983).
Lewin Genes, 1983, John Wiley & Sons, p. 307.
Lin et al., "Cloning and Expression of Monkey and Human Erythropoietin," Exp. Hematol. 12, 357 (1984).
Lin et al., "Cloning and expression of the human erythropoietin gene," P.N.A.S. (USA), 82, 7580-7584 (Nov. 1985).
Lin et al., "Cloning of the Monkey EPO Gene," Abstract, J. Cell. Bioch., Suppl. 8B, p. 45 (Mar. 31-Apr. 24, 1984).
Lin et al., "Monkey erythropoietin gene: cloning, expression and comparison with the human erythropoietin gene," Gene, 44, 201-209 (1986).
Lipschitz et al., "Effect of Age on Hematopoiesis in Man," Blood, 63(3), 502-509 (Mar. 1983).
LKB Technical Bulletin #2217.
Maniatis et al., "Molecular Cloning, a Laboratory Manual", pp. 5, 197-199, 392-393, 479-487, 493-503 Cold Springs Harbor, N.Y. (1982).
Maniatis et al., "The Isolation of Structural Genes from Libraries of Eucaryotic DNA," Cell 15, 687-701 (Oct. 1978).
Markoff et al., Mol. & Cell. Biol., 4(1), 8-16 (1984).
Marshall, "Glycoproteins," Annual Review of Biochemistry, Snell et al. eds., vol. 41, pp. 673-702, Annual Reviews Inc., Palo Alto, Calif. (1972).
Martial et al., "Human Growth Hormones: Complementary DNA Cloning and Expression in Bacteria," Science, 205, 602-606 (Aug. 10, 1979).
Mason et al., "Complementary DNA sequences of ovarian follicular fluid inhibin show precursor structure and homology with transforming growth factor-β," Nature 318, 659-663 (Dec. 1985).
Maurer, "Immunochemical Isolation of Prolactin Messenger RNA," J. Biol. Chem 255(1), 854-859 (Feb. 10, 1980).
Maxam et al., "Sequencing End-Labeled DNA with Base-Specific Chemical Cleavages," Methods in Enzymol. 65, 499-560 (1980).
McCormick et al., "Regulated Expression of Human Intefferon Genes In Chinese Hamster Ovary Cells," DNA, 2(1): 86 Abst 86 (1983).
McCormick et al., Mol. & Cell. Biol., 4(1), 166-172 (1984).
McGonigle et al., "Erythropoietin deficiency and inhibition of erythropoiesis in renal insufficiency," Kidney Int'l., 25(2), 437-444 (1984).
Meier et al., Biochem. & Biophys.Res.Comm., 118(1), 73-81 (1984).
Mellon et al., "Identification of DNA Sequences Required for transcription of the human α1-Globin Gene in a New SV40 Host-Vector System," Cell, 27, 279-288 (Dec. 1981 ).
Mellor et al., "Expression of Murine H-2Khu b l histocompatibility antigen in cells transferred with cloned H-2 genes," Nature, 298:529-534 (Aug. 1982).
Messing, "New M13 Vectors for Cloning," Methods in Enzymology, 101, 20-78 (1983).
Metcalf et al., "Effects of Purified Bacterially Synthesized Murine Multi-CSF (IL-3) on Hematopoiesis in Normal Adult Mice," Blood, 68(1), 46-57 (Jul. 1986).
Metcalf et al., "Quantitative Responsiveness of Murine Hemopoietic Populations in vitro and in vivo to Recombinant Multi-CSF (IL-3)," Exp. Hematol., 15, 288-295 (1987).
Methods in Yeast Genetics, Cold Spring Harbor Lab, Cold Spring Harbor, N.Y., p. 62 (1983) (not enclosed).
Miller et al., "Plasma levels of immunoreactive erythropoietin after acute blood loss in man," Brit. J. Haematol., 52, 545-549 (1982).
Mirand et al., "Current studies on the role of erythropoietin on erythropoiesis", Ann. N.Y. Acad. Sci., 77:677-702 (1959).
Mirand, "Extra-renal and renal control of erythropoietin production," Ann. N.Y. Acad. Sci., 149:94-106 (1968).
Miyake et al., "Purification of Human Erythropoietin," J. Biol. Chem., vol. 252(15), 5558-5564 (Aug. 1977).
Mladenovic et al., "Anemia of Chronic Renal Failure (CRF) in the Sheep: Reponse to Erythropoietin (EP) In Vivo and In Vitro," Blood, 58(5), Suppl. 1, 99a (1981).
Montgomery et al., "Identification and Isolation of the Yeast Cytochrome c Gene," Cell, 14, 673-680 (Jul. 1978).
Moriarty et al., "Expression of the Hepatitis B Virus Surface Antigen Gene in Cell Culture by using a Simian Virus 40 Vector," P.N.A.S. (USA), 78(4):2606-10 (Apr. 1981).
Moriuchi et al., "Thy-1 cDNa sequence suggests a novel regulatory mechanism," Nature, 301, 80-82 (Jan. 1983).
Morrison, "Bioprocessing in Space--an Overview", The World Biotech Report, vol. 2:USA, 557-571 (1984).
Munjaal et al., "A cloned calmodulin structural gene probe is complementary to DNA sequence from diverse species," P.N.A.S. (USA), 78(4):2330-2334 (Apr. 1981).
Murphy et al., "The Role of Glycoprotein Hormones in the Regulation of Hematopoiesis," Acta. Haematologica Japonica, 46(7), 1380-1396 (Dec. 1983).
Myers et al., "Construction and Analysis of Simian Virus 40 Origins Defective in Tumor Antigen Binding and DNA Replication," P.N.A.S. (USA), 77, 6491-6495 (Nov. 1980).
Myklebost et al., "The Isolation and Characterization of cDNA clones for Human Apolioprotein CII," J. of Biol. Chem., 259(7), 4401-4404 (Apr. 10, 1984).
Naets, "The role of the kidney in erythropoiesis," J. Clin. Invest., 39:102-110 (1960).
Nagata et al., "Synthesis in E. coli of a polypeptide with human leukocyte interferon activity," Nature, 284, 316-320 (Mar. 27, 1980).
Nakao et al., "Erythropoiesis in anephric or kidney transplated patients," Israel J. Med. Sci., 7:986-989 (Jul.-Aug. 1971).
Nathan et al., "Erythropoietin and the Regulation of Erythropoiesis," New Eng. J. Med., 308(9), 520-522 (Mar. 3, 1983).
Naughton et al., "Evidence for a Hepatic-Renal Antagoinism in the Production of Hepatic Erythropoietin," Ann. Clin. Lab. Sci. 13(5), 432-438 (1983).
Naughton et al., "Evidence for an Erythropoietin-Stimulating Factor in Patients with Renal and Hepatic Disease," Acta. Haemat., 69, 171-179 (1983).
Nayak et al., pp. 165-172 in Modern Approaches To Vaccines, Chanock et al., eds. Cold Spring Harbor Lab. (1984).
Neeser et al., "A Quantitative Determination by Capillary Gas-Liquid Chromatography of Neutral and Amino Sugars (as O-Methyloxime Acetates), and a Study on Hydrolytic Conditions for Glycoproteins and Polysaccharides In Order to Increase Sugar Recoveries," Anal. Blochem., 142, 58-67 (1984).
Newman et al., Nature, 304, 643-645 (1983).
Nigg et al., "Immunofluorescent localization of the transforming protein of Rous sarcoma virus with antibodies against a synthetic src peptide," P.N.A.S. (USA), 79, 322-5326 (Sep. 1982).
Noda et al., "Cloning and sequence analysis of cDNA for bovine adrenal preproenkephalin," Nature, 295, 202-206 (Jan. 21, 1982).
Noda et al., "Primary structure of α-subunit precursor of Torpedo californica acetylcholine receptor deduced from cDNA sequence," Nature, 299, 793-797 (Oct. 28, 1982).
Noyes et al., "Detection and partial sequence analysis of gastrin mRNA by using an oligodeoxynucleotide probe," P.N.A.S. (USA), 76(4), 1770-1774 (Apr. 1979).
Nussinov, "Eukaryotic Dinucleotide Preference Rules and their Implications for Degenerate Codon Usage," J. Mol. Biol., 149, 125-131 (1981).
Ogle et al., "Production of erythropoietin in vitro: a review," In Vitro, 14(11), 945-949 (1978).
Ohkubo et al., "Cloning and sequence analysis of cDNA for rat angiotensinogen," P.N.A.S. (USA), 80, 2196-2200 (Apr. 1983).
Ohno et al., "Inducer-responsive expression of the cloned human interferons β1 gene introduced into cultured mouse cells," Nucleic Acids Res., 10(3), 967-976 (1982).
Okayama et al., "High-Efficiency Cloning of Full-Length cDNA," Mol. & Cell. Biol., 2(2), 161-170 (Feb. 1982).
Ovchinnikov et al., "The Primary Structure of Escherichia coli RNA Polymerase," J. Biochem., 116, 621-629 (1981).
Paabo et al., Cell, 35, 445-453 (1983).
Palmiter et al. "Metallothionein-Human GH Fusion Genes Stimulate Growth of Mice," Science, 222, 809-814 (Nov. 18, 1983).
Pankratz et al., "A Simple 3-Step Procedure for Purifying Baboon Urinary Erythropoietin to Apparent Homogeneity," Exp. Hematol., 11, Supp. 14, Abst. 102 (1983).
Papayannopoulou et al., "On the In Vivo Action of Erythropoietin: A Quantitative Analysis," J. of Clin. Investigation, 51, 1179-1185 (1972).
Parekh et al., "N-Glycosylation and in vitro Enzymatic Activity of Human Recombinant Tissue Plasminogen Activator Expressed in Chines Hamster Ovary Cells and a murine Cell Line," Biochemistry, 28, 7670-7679 (1989).
Pavlovic-Kentera et al., "Effects of Prostaglandin Synthetase Inhibitors, Salt Overload and Renomedullary Dissection on the Hypoxia Stimulated Erythropoietin Production in Rats," Exp. Hematol., 8(Supp. 8), 283-291 (1980).
Pellicer et al., "Altering Genotype and Phenotype by DNA-Mediated Gene Transfer," Science, 209, 1414-1422 (Sept. 19, 1980).
Pennathur-Das et al., "Evidence for the Presence of CFU-E with Increased In Vitro Sensitivity to Erythropoietin in Sickle Cell Anemia," Blood, 63(5), 1168-71 (May 1984).
Pennica et al., "Cloning and expression of human tissue-type plasminogen activator cDNA in E-coli," Nature, 301,214-221 (Jan. 20, 1983).
Pennica et al., Nature, 312, 724-729 (1984).
Pitha et al., "Induction of human β-interferon synthesis with poly (rI•rC) in mouse cells transfected with cloned cDNA plasmids," P.N.A.S. (USA), 79, 4337-4341 (Jul. 1982).
Powell et al., "Human erythropoietin gene: High level expression in stably transfected mammalian cells and chromosome localization," P.N.A.S. (USA), 83, 6465-6469 (Sep. 1986).
Prooijen-Knegt, "In Situ Hybridization of DNA Sequences in Human Metaphase Chromosomes Visualized by an Indirect Fluorescent Immunocytochemical Procedure," Exp. Cell Res., 141, 398-407 (1982).
Ramabhadran et al,. Proc.Natl.Acad.Sci.(USA), 81, 6701-6705 (1984).
Rambach et al., "Acid Hydrolysis of Erythropoietin," Proc. Soc. Exp. Biol., 99, 482-483 (1958).
Ravetech et al., "Evolutionary approach to the question of immunoglobulin heavy chain switching: Evidence from cloned human and mouse genes," P.N.A.S. (USA), 77(11), 6734-6738 (Nov. 1980).
Recny et al., "Structural Characterization of Natural Human Urinary and Recombinant DNA-derived Erythropoietin," J. Biol. Chem., 262(35), 17156-17163 (Dec. 15, 1987).
Reilly et al., "Use of synthetic oligonucleotides to clone genomic DNA: isolation of a tRNAhu Phe l gene from mouse," DNA, 1:192 (1982).
Resegotti et al., "Treatment of aplastic anaemia with methenolone, stanozolol and nandrolone," Panminerva Medica, 23, 243-248 (1981).
Reyes et al., "Identification of an H-2Kb -Related Molecule by Molecular Cloning," Immunogenetics, 14, 383-392 (1981).
Reyes et al., "Isolation of a cDNA clone for the murine transplantation antigen H-2Kb," P.N.A.S. (USA), 79, 3270-3274 (May 1982).
Rigby, "Expression of cloned genes in eukaryotic cells using vector systems derived from vital replicons," Genetic Engineering, R. Willisamson, ed., 3:83-140, Academic Press, London 1982.
Riggs et al., "Synthetic DNA and Medicine," Am. J. Hum. Genet., 31, 531-538 (1979).
Ringold et al., "Co-Expression and Amplification of Dihydrofolate Reductase cDNA and the Escherichia coli XGPRT Gene in Chinese Hamster Ovary Cells," J. Mol. & Appl. Genetics, 1(3), 165-175 (1981).
Robson et al., "Polysome immunoprecipitation of phenylalanine hydroxylase mRNA from rat liver and cloning of its cDNA," P.N.A.S. (USA), 79, 4701-4705 (Aug. 1982).
Roh et al., "Plasma Disappearance of I125 labeled Human Uninary Erythropoietin in Rabbits," Fed. Proc., 29(2), 782 Abst. 3030 (1970).
Rose et al., Cell, 30, 753-762 (1982).
Ross et al., "Phosphotyrosine-containing proteins isolated by affinity chromatography with antibodies to a synthetic hapten," Nature, 294, 654-656 (Dec. 17, 1981).
Roth et al., Cell, 33, 435-443 (1983).
Rothmann et al., "Erythropoietin-Dependent Erythrocytosis Associated with Hepatic Angiosarcoma," J. Surg. Oncol., 20, 105-108 (1982).
Saito et al., "In Vitro Assay of Erythropoietin: Simple Determination in a Small Amount of Human Serum Samples," Jap. J. Med., 23(1), 16-21 (Feb. 1984).
Saito et al., "Translation of Human Erythropoietin-mRNAs," Exp. Hematol., 11 (14), 228 (1983).
Sambrook et al., pp. 225-246 in Experimental Manipulation of Gene Expression, Acad. Press. (1983).
Sanger et al., "DNA Sequencing with chain-terminating inhibitors," P.N.A.S. (USA), 74, 5463-5467 (Dec. 1977).
Sasaki, "Carbohydrate Structure of Erythropoietin Expressed in Chinese Hamster Ovary Cells by a Human Erythropoietin cDNA," J. Biol. Chem., 262(25), 12059-12070 (Sep. 5, 1987).
Sasaki, "Isolation of erythropoietin by monoclonal antibody," Biomed. Biochim. Acta., 42(11/12), S202-S206 (1983).
Scahill et al., Proc.Natl.Acad.Sci.(USA), 80, 4654-4658 (1983).
Schulze et al., "Identification of the cloned gene for the murine transplantation antigen H-2Khu b l by hybridization with synthetic oligonucleotides," Mol. & Cell Biol., 3(4), 750-755 (Apr. 1983).
Schwartz et al., "Severe Anemia as a Manifestation of Metastatic Jugular Paraganglioma," Arch Otolaryngol, 109, 269-272 (Apr. 1983).
Seeburg et al., "Synthesis of growth hormone by bacteria," Nature, 276, 795-798 (Dec. 1978).
Seki et al., "Isolation of a genomic clone containing structural information for the DRα subunit", Fed. Proc., 41:365 (1982)/Chemistry and Molecular Biology of Ia/Dr Antigens Abstract 563 (1982).
Shahidi, "Androgens and Erythropoiesis," New Eng. J. Med., 289, 72-80 (Jul. 12, 1973).
Sherwood et al., "A Radioimmunoassay for Erythropoietin," Blood, 54(4), 885-893 (Oct. 1979).
Sherwood et al., "Erythropoietin Titers in Sickle Cell Disease & Chronic Renal Failure," Blood Suppl. 1, 58, Abstract 105 (1981).
Sherwood et al., "Extraction of erythropoietin from normal kidneys," Endo, 103(3), 866-870 (1978).
Shiramizu et al., "Human Renal Carcinoma Cells Secreting Erythropoietin in vivo and in vitro," Blood, 78(10), Supp. 1 (Nov. 15, 1991).
Singer-Sam et al., "Isolation of a cDNA clone for human X-linked 3-phosphoglycerate kinase by use of a mixture of synthetic oligodeoxyribonucleotides as a detection probe," P.N.A.S. (USA), 80, 802-806 (Feb. 1983).
Smith et al., Proc.Natl.Acad.Sci.(USA), 80, 7155-7159 (1983).
Soggs et al. (1981) Proceedings of the National Academy of Sciences, vol. 78, pp. 6613 6617. *
Soggs et al. (1981) Proceedings of the National Academy of Sciences, vol. 78, pp. 6613-6617.
Southern et al., "Transformation of Mammalian Cells to Antibiotic Resistance with a Bacterial Gene Under Control of the SV40 Early Region Promoter," J. Mol. Appl. Genet., 1(4), 327-341 (1982).
Southern, "Detection of Specific Sequences Among DNA Fragments Separated by Gel Electrophoresis," J. Mol. Biol., 98, 503-517 (1975).
Spellman et al., "Carbohydrate Structure of Human Tissue Plasminogen Activator Expressed in Chinese Hamster Ovary Cells," J. of Biol. Chem., 264(24), 14100-14111 (Aug. 26, 1989).
Spellman et al., "Carbohydrate Structure of Recombinant Soluble Human CD4 Expressed in Chinese Hamster Ovary Cells," Biochemistry, 30(9), 2395-2406 (1991).
Srinivas et al., J.Biol.Chem., 258, 14718-14724 (1983).
Stanley, "Surface Carbohydrate Alterations of Mutant Mammalian Cells Selected for Resistance to Plant Lectins," The Biochemistry of Glycoproteins and Proteoglycans, Chapter 4:161-189, Lennarz ed., Plenum Press (1980).
Steck et al. Transplantation Proceedings, 16, 355-360 (1984).
Storring et al., "The International Standard for Recombinant DNA derived Erythropoietin: Collaborative Study of four recombinant DNA derived erythropoietins and two highly purified human urinary erythropoietins," J. of Endo., 134, 459-84 (1992).
Strickland, "Occurrence of Sulfate on the N-Linked Oligosaccharides of Human Erythropoietin," J. of Cellular Biochemistry, Suppl. 16D, Abstract No. P324 (1992).
Sue et al., "Site-specific antibodies to human erythropoietin directed toward the NH2 -terminal region," Proc. Nat. Acad. Sci. (USA), 80, 3651-3655 (1983).
Suggs et al., "Use of Synthetic Oligodeoxyribonucleotide for the Isolation of Specific Cloned DNA Sequences," Developmental Biology Using Purified Genes, 683-693 (D. Brown, Ed., 1981).
Sveda et al., "Functional expression in primate cells of cloned DNA coding for the hemagglutinin surface glycoprotein of influenza virus," Proc. Nat'l. Acad. Sci. (USA), 78(10):5488-5492 (Sep. 1981).
Sytowski et al., "A Novel Radioimmunoassay for Human Erythropoietin Using a Synthetic NH2 -Terminal Polypeptide and Anti-Peptide Antibodies," J. Immunol. Methods, 69, 181-186 (1984).
Sytowski et al., "The Biochemistry of Erythropoietin: An Approach to its mode of Action," Exp. Hematol., 8(Supp. 8), 52-63 (1980).
Szostak et al., "Hybridization with Synthetic Oligonucleotides," Meth. in Enzymol., 68, 419-429 (1979).
Takeuchi et al., "Relationship between sugar chain structure and biological activity of recombinant human erythropoietin produced in Chinese hamster ovary cells," P.N.A.S. (USA), 86, 7819-7822 (Oct. 1989).
Takeuchi, "Comparative Study of the Asparagine-linked Sugar Chains of Human Erythropoietin Purified from Urine and the Culture Medium of Recombinant Chinese Hamster ovary Cells," J. Biol. Chem., 263(8), 3657-3663 (Mar. 15, 1988).
Talmadge et al., "Eukaryotic Signal Sequence Transports Insulin Antigen in Escherichia coli," P.N.A.S. USA 77(6), 3369-3373 (Jun. 1980).
Tambourin et al., "Production of erythropoietin-like activity by a murine erythroleukemia cell line," P.N.A.S. (USA), 80, 6269-6273 (1983).
Taniguchi et al., "Structure and expression of a cloned cDNA for human intefieukin-2," Nature, 302:305-310 (24 Mar. 1983).
Taub et al., "An Improved Method for Preparing Large Arrays of Bacterial Colonies Containing Plasmids for Hybridization: In Situ Purification and Stable Binding of DNA on Paper Filters," Anal. Biochem., 126, 222-230 (1982).
Taub et al., "An improved method for preparing large arrays of bacterial colonies containing plasmids for hybridization: in situ purification and stable binding of DNA on paper filters," Chemical Abstracts, 97(23), 164, Abstract No. 194002y (Dec. 12, 1982).
Testa et al., "Role of Purified Erythropoietin in the Amplification of the Erythroid Compartment," Exp. Hematol., 8(Supp. 8), 144-152 (1980).
Tong et al., "The Formation of Erythrocyte Membrane Proteins during Erythropoietin-induced Differentiation," J. Biol. Chem., 256(24), 12666-12672 (Dec. 25, 1981).
Toole et al., "Molecular cloning of a cDNA encoding human antihaemophilic factor," Nature, 312, 342-347 (Nov. 8, 1984).
Tramontano et al., "Statistical evaluation of the coding capacity of complementary DNA strands," Nucleic Acids Research, 12(12), 5049-5059 (1984).
Udupa et al., "Erythropoiesis in the aged mouse," J. Lab. Clin. Med., 103(4), 574-580 & 581-588 (1984).
Ullrich et al., "Human epidermal growth factor receptor cDNA sequence and aberrant expression of the amplified gene in A431 epidermoid carcinoma cells," Nature, 309, 418-425 (May 31, 1984).
Ullrich et al., "Human insulin receptor and its relationship to the tyrosine kinase family of oncogenes," Nature, 313, 756-761 (Feb. 28, 1985).
Ullrich et al., "Isolation of the Human Insulin-like Growth Factor I Gene Using a Single Synthetic DNA Probe," EMBO J., 3(2):361-364 (1984).
Ullrich et al., "Rat Insulin Genes: Construction of Plasmids Containing the Coding Sequences," Science, 196, 1313-1319 (Jun. 17, 1977).
Ullrich et at., "Insulin-like growth factor I receptor primary structure: comparison with insulin receptor suggests structural determinants that define functional specificity," EMBO J., 5(10), 2503-2512 (1986).
Urabe et at., "The Influence of Steroid Hormone Metabolites on the In Vitro Development of Erythroid Colonies Derived from Human Bone Marrow," J. Exp. Med., 149, 1314-1325 (Jun. 1979).
Urlaub et at., "Isolation of Chinese Hamster cell mutants deficient in dihydrofolate reductase activity," Proc. Nat. Acad. Sci. (USA), vol. 77(7), 4216-4220 (Jul. 1980).
Van der Ploeg et at., "DNA Methylation in the Human νδβ-Globin Locus in Erythroid and Nonerythroid Tissues," Cell, 19, 947-958 (Apr. 1980).
Van Stone et al., "Effect of erythropoietin on anemia of peritoneally dialyzed anephric rats," Kidney Int'l., 15, 370-375 (1979).
Vedovato et at., "Erythropoietin Levels in Heterozygous Beta-Thalassemia," Acta. Haematol., 71,211-213 (1984).
Vichinsky et al., "Inadequate erythroid response to hypoxia in cystic fibrosis," J. Pediatr., 105(1), 15-21 (Jul. 1984).
Vieira et al., "The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers," Gene, 19, 259-268 (1982).
Villasante et al., "Binding of microtubule protein to DNA and chromatin: possibility of simultaneous linkage of microtubule to nucleic acid and assembly of the microtubule structure," Nucleic Acids Res, 9(4), 895 (1981).
Walker et al., Techniques in Molecular Biology, Macmillan Pub. Co., N.Y., p. 280 (1983).
Wallace et al., "A set of synthetic oligodeoxyribonucleotide primers for DNA sequencing in the plasmid vector pBR322," Gene, 16, 21-26 (1981).
Wallace et al., "Directed Deletion of a Yeast Transfer RNA Intervening Sequence," Science, 209:1396-1400 (Sep. 19, 1980).
Wallace et al., "Hybridization of synthetic oligodeoxyribonucleotides to Phi-chi 174 DNA: the effect of single base pair mismatch," Nuc. Acids Res., 6(11), 3543-3557 (1979).
Wallace et al., "Oligonucleotide Directed Mutagenesis of the Human β-globin gene: A General Method for Producing Specific Point Mutations in cloned DNA," Nucleic Acids Research, 9(15):3647-3657 (1981).
Wallace et al., "The use of synthetic oligonucleotides as hybridization probes. II. Hybridization of oligonucleotides of mixed sequence to rabbit β-globin DNA," Nuc. Acids Res., 9(4), 879-894 (1981).
Wallis et al., "The isolation of cDNA clones for human apolipoprotein E and the detection of apoE RNA in hepatic and extra-hepatic tissues," EMBO J., 2, 2369-2373 (1983).
Walter et al., "Antibodies specific for the carboxy- and amino-terminal regions of simian virus 40 large tumor antigen," P.N.A.S. (USA), 77(9), 5197-5200 (Sep. 1980).
Walter et al., "Antibodies specific for the polyoma virus middle-size tumor antigen," P.N.A.S. (USA), 78, 4882-4886 (Aug. 1981).
Wang et al., "Renal and extrarenal erythropoietin production in male and female rats of various ages," J. Lab. Clin. Med., 79(2), 181-186 (Feb. 1972).
Wang et al., "Some Chemical Properties of Human Erythropoietin", Endo, 116(6), 2286-2292 (1985).
Weiland et al., "In vivo Activity of Asialo-Erythropoietin in Combination with Asialo-Glycoproteins," Blut, 44(3), 173-175 (1982).
Weiss et al., "Characterization of a monoclonal antibody to human erythropoietin," P.N.A.S. (USA), 79, 5465-5469 (1982).
Weiss et al., "Studies of the pathogenesis of anemia of inflammation: Mechanism of impaired erythropoiesis," Am. J. Vet. Res., 44(10), 1832-1835 (Oct. 1983).
Weissmann et al., Phil.Trans.R.Soc.Lond., B299, 7-28 (1982).
White et al., "Studies on Erythropoietin," Recent Progr. Hormone Res., 16:219-262 (1960).
White et al., Nature, 300, 658-659 (1982).
Whitehead et al., "Use of a cDNa Clone for the Fourth Component of Human Complement (C4) for Analysis of a Genetic Deficiency of C4 in Guinea Pig", PNAS (USA), 80:5387-5391 (Sep. 1983).
Wiaderkiewicz et al., "Mismatch and blunt to protruding-end joining by DNA ligases," Nucleic Acids Res, 15(19), 7831-7848 (1987).
Wickens et al., "Expression of a chicken chromosomal ovalbumin gene injected into frog oocyte nuclei," Nature, 285:628-634 (26 Jun. 1980).
Wide et al., "Molecular charge heterogeneity of human serum erythropoietin," British J. Haemat., 76, 121-127 (1990).
Wiktor et al., Proc.Natl.Acad.Sci.(USA), 81, 7194-7198 (1984).
Wong et al., "Intefferon-γ Induces Enhanced Expression of Ia And H-2 Antigens on B Lymphoid, Macrophage, and Myeloid Cell Lines," J. Immun., 131(2):788-793 (Aug. 1983).
Wong et al., "Synthetic peptide fragment of src gene product inhibits the src protein kinase and crossreacts immunologically with avian onc kinases and cellular phosphoproteins," P.N.A.S. (USA), 78(12), 7412-7416 (Dec. 1981).
Woo, "A Sensitive and Rapid Method for Recombinant Phage Screening," Methods in Enzymology, 68, 389-395 (1979).
Wood et al., "Expression of active human factor VIII from recombinant DNA clones," Nature, 312, 330-336 (Nov. 22, 1984).
Woods et al., "Isolation of a cDNA Clone Corresponding to the MHC Linked Complement Protein Factor B," Mol. Immunology, 19, 1411 (1982).
Woods et al., "Isolation of cDNA clones for the human complement protein factor B, a class III major histocompatability complex gene product," P.N.A.S. USA 79, 5661-5665 (Sept. 1982).
Woods et al., "Isolation of Class III cDNA Clones," Second Meeting on Cloning of the HLA and H-2 Regions, Abstract (Apr. 17-19, 1983).
Yanagawa et al., "Hybridomas for Production of Monoclonal antibodies to Human Erythropoetin," Blood, 64(2), 357-364 (Aug. 1984).
Yanagawa et al., "Isolation of Human Erythropoietin with Monoclonal Antibodies," J. Biol. Chem., 259(5), 2707-2710 (Mar. 10, 1984).
Young et al., "Efficient isolation of genes by using antibody probes," P.N.A.S. 80, 1194-1198 (Mar. 1983).
Yuen et al., "The Spectrum of N-linked oligosaccharide structures detected by enzymic microsequencing on a recombinant soluble CD4 glycoprotein from Chinese hamster ovary cells," Eur. J. Biochem., 192, 523-528 (1990).
Zinn et al., "Regulated expression of an extrachromosomal human β-interferon gene in mouse cells," P.N.A.S. (USA), 79, 4897-4901 (Aug. 1982).

Cited By (456)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020045255A1 (en) * 1986-06-27 2002-04-18 Powell Jerry S. Method of making glycoprotein exhibiting erythropoiesis regulating activity and glycoprotein produced by this method
US6682910B2 (en) 1986-06-27 2004-01-27 University Of Washington Human erythropoietin gene: high level expression in stably transfected mammalian cells
US6867020B2 (en) 1986-06-27 2005-03-15 The Board Of Regents Of The University Of Washington Method of making glycoprotein exhibiting erythropoiesis regulating and glycoprotein produced by this method
US5688679A (en) * 1986-06-27 1997-11-18 University Of Washington Human erythropoietin gene; high level expression in stably transfected mammalian cells
US6048524A (en) * 1991-11-05 2000-04-11 Transkaryotic Therapies, Inc. In vivo production and delivery of erythropoietin for gene therapy
US7410799B2 (en) 1991-11-05 2008-08-12 Shire Human Genetic Therapies, Inc. In vivo production and delivery of erythropoietin or insulinotropin for gene therapy
US6846676B2 (en) 1991-11-05 2005-01-25 Transkaryotic Therapies, Inc. In Vivo production and delivery of erythropoietin or insulinotropin for gene therapy
US20050136041A1 (en) * 1991-11-05 2005-06-23 Selden Richard F. In vivo production and delivery of erythropoietin or insulinotropin for gene therapy
US5994127A (en) * 1991-11-05 1999-11-30 Transkaryotic Therapies, Inc. In vivo production and delivery of erythropoietin or insulinotropin for gene therapy
US6355241B1 (en) 1991-11-05 2002-03-12 Transkaryotic Therapies, Inc. In vivo production and delivery of erythropoietin
US20100143314A1 (en) * 1991-11-05 2010-06-10 Shire Human Genetic Therapies, Inc. In Vivo Production and Delivery of Erythropoietin or Insulinotropin for Gene Therapy
US6686179B2 (en) 1992-01-31 2004-02-03 Aventis Behring L.L.C. Fusion polypeptides of human serum albumin and a therapeutically active polypeptide
US6987006B2 (en) 1992-01-31 2006-01-17 Aventis Behring L.L.C. Erythropoietin and albumin fusion protein, nucleic acids, and methods thereof
US6989365B2 (en) 1992-01-31 2006-01-24 Aventis Behring L.L.C. Methods of treatment with erythropoietin and albumin fusion protein
US7041478B2 (en) 1992-01-31 2006-05-09 Aventis Behring L.L.C. G-CSF and albumin fusion protein
US20030022308A1 (en) * 1992-01-31 2003-01-30 Aventis Behring L.L.C. Fusion polypeptides of human serum albumin and a therapeutically active polypeptide
US6670178B1 (en) 1992-07-10 2003-12-30 Transkaryotic Therapies, Inc. In Vivo production and delivery of insulinotropin for gene therapy
US6531124B1 (en) 1992-07-10 2003-03-11 Transkaryotic Therapies, Inc. In vivo production and delivery of insulinotropin for gene therapy
US5728536A (en) * 1993-07-29 1998-03-17 St. Jude Children's Research Hospital Jak kinases and regulation of Cytokine signal transduction
US8192955B1 (en) * 1994-01-03 2012-06-05 Genentech, Inc. Nucleic acids encoding MPL ligand (thrombopoietin), variants, and fragments thereof
US8193323B1 (en) * 1994-01-03 2012-06-05 Genentech, Inc. mpl ligand (thrombopoietin), active fragments thereof, and fusion proteins and compositions comprising mpl ligand and other cytokines
US8236293B2 (en) 1995-06-15 2012-08-07 Crucell Holland B.V. Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer
EP0851917A1 (en) * 1995-08-24 1998-07-08 Il-Dong Pharm. Co., Ltd. Heterologous protein production system using avian cells
US5952226A (en) * 1996-11-05 1999-09-14 Modex Therapeutiques Hypoxia responsive EPO producing cells
US20090258391A1 (en) * 1997-06-20 2009-10-15 Baxter Aktiengesellschaft Recombinant cell clones having increased stability and methods of making and using same
US8084251B2 (en) 1997-06-20 2011-12-27 Baxter Innovations Gmbh Recombinant cell clones having increased stability and methods of making and using the same
USRE46745E1 (en) 1997-06-20 2018-03-06 Baxalta Incorporated Recombinant cell clones having increased stability and methods of making and using the same
US8084252B2 (en) 1997-06-20 2011-12-27 Baxter Innovations Gmbh Recombinant cell clones having increased stability and methods of making and using the same
US20070161079A1 (en) * 1997-06-20 2007-07-12 Baxter Aktiengesellschaft Recombinant cell clones having increased stability and methods of making and using the same
US20100317055A1 (en) * 1997-06-20 2010-12-16 Baxter Aktiengesellschaft Recombinant Cell Clones Having Increased Stability and Methods of Making and Using the Same
USRE46860E1 (en) 1997-06-20 2018-05-22 Baxalta Incorporated Recombinant cell clones having increased stability and methods of making and using the same
US8329465B2 (en) 1997-06-20 2012-12-11 Baxter Innovations Gmbh Recombinant cell clones having increased stability and methods of making and using the same
US20110104758A1 (en) * 1997-06-20 2011-05-05 Baxter Aktiengesellschaft Recombinant cell clones having increased stability and methods of making and using the same
US8080414B2 (en) 1997-06-20 2011-12-20 Baxter Innovations Gmbh Recombinant cell clones having increased stability and methods of making and using the same
USRE46897E1 (en) 1997-06-20 2018-06-19 Baxalta Incorporated Recombinant cell clones having increased stability and methods of making and using the same
US20100221828A1 (en) * 1997-06-20 2010-09-02 Baxter Aktiengesellschaft Recombinant cell clones having increased stability and methods of making and using the same
US20090253178A1 (en) * 1997-06-20 2009-10-08 Baxter Aktiengesellschaft Recombinant cell clones having increased stability and methods of making and using the same
US6420340B2 (en) 1997-08-15 2002-07-16 Amgen Inc. Chemical modification of proteins to improve biocompatibility and bioactivity
US6770746B2 (en) 1997-08-15 2004-08-03 Amgen Inc. Chemical modification of proteins to improve biocompatibility and bioactivity
US20030023048A1 (en) * 1997-08-15 2003-01-30 Amgen Inc. Chemical modification of proteins to improve biocompatibility and bioactivity
US6204247B1 (en) 1997-08-15 2001-03-20 Amgen Inc. Chemical modification of proteins to improve biocompatibility and bioactivity
US7576193B2 (en) 1997-12-08 2009-08-18 Merck Patent Gmbh Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation
US6838260B2 (en) 1997-12-08 2005-01-04 Emd Lexigen Research Center Corp. Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation
US20020193570A1 (en) * 1997-12-08 2002-12-19 Gillies Stephen D. Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation
US7226998B2 (en) 1997-12-08 2007-06-05 Emd Lexigen Research Center Corp. Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation
US7879319B2 (en) 1997-12-08 2011-02-01 Merk Patent Gmbh Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation
RU2125093C1 (ru) * 1998-02-12 1999-01-20 Государственный научно-исследовательский институт особо чистых биопрепаратов Способ получения рекомбинантного человеческого эритропоэтина, штамм культивируемых клеток яичника китайского хомяка - продуцент эритропоэтина
US20060194952A1 (en) * 1998-02-25 2006-08-31 Emd Lexigen Research Center Corp. Enhancing the circulating half-life of antibody-based fusion proteins
US20030105294A1 (en) * 1998-02-25 2003-06-05 Stephen Gillies Enhancing the circulating half life of antibody-based fusion proteins
US20090088561A1 (en) * 1998-02-25 2009-04-02 Merck Patent Gmbh Enhancing the circulating half-life of antibody-based fusion proteins
KR100434729B1 (ko) * 1998-03-18 2004-11-03 주식회사 엘지생명과학 천연 추출물을 첨가하여 중국햄스터 난소 유래세포에서 에리스로포이에틴의 생산 증대방법
US20040180035A1 (en) * 1998-04-15 2004-09-16 Emd Lexigen Research Center Corp. IL-15 immunoconjugates and uses thereof
US20060172389A1 (en) * 1998-04-22 2006-08-03 Macleod James N Canine erythropoietin gene and recombinant protein
US6696411B1 (en) 1998-04-22 2004-02-24 Cornell Research Foundation, Inc. Canine erythropoietin gene and recombinant protein
US7067477B2 (en) 1998-04-22 2006-06-27 Cornell Research Foundation, Inc. Canine erythropoietin gene and recombinant protein
US20040138129A1 (en) * 1998-04-22 2004-07-15 Macleod James N. Canine erythropoietin gene and recombinant protein
USRE40911E1 (en) 1998-04-22 2009-09-08 Cornell Research Foundation, Inc. Canine erythropoietin gene and recombinant protein
US20090246194A1 (en) * 1998-06-15 2009-10-01 Gtc Biotherapeutics, Inc. ERYTHROPOIETIN ANALOG-IgG FUSION PROTEINS
US20020155998A1 (en) * 1998-06-15 2002-10-24 Genzyme Transgenics Corporation, A Massachusetts Corporation Erythropoietin analog-human serum albumin fusion
US7101971B2 (en) 1998-06-15 2006-09-05 Gtc Biotherapeutics, Inc. Erythropoietin analog-human serum albumin fusion
US20050158832A1 (en) * 1998-06-15 2005-07-21 Michael Young Erythropoietin analog-human serum albumin fusion
US6548653B1 (en) 1998-06-15 2003-04-15 Genzyme Transgenics Corporation Erythropoietin analog-human serum albumin fusion
US6541033B1 (en) 1998-06-30 2003-04-01 Amgen Inc. Thermosensitive biodegradable hydrogels for sustained delivery of leptin
US6420339B1 (en) 1998-10-14 2002-07-16 Amgen Inc. Site-directed dual pegylation of proteins for improved bioactivity and biocompatibility
US6245740B1 (en) 1998-12-23 2001-06-12 Amgen Inc. Polyol:oil suspensions for the sustained release of proteins
US20030099709A1 (en) * 1998-12-23 2003-05-29 Amgen Inc. Biodegradable pH/thermosensitive hydrogels for sustained delivery of biologically active agents
US6979674B1 (en) 1998-12-23 2005-12-27 Amgen Inc. Polyol/oil suspensions for the sustained release of proteins
US20050170463A1 (en) * 1999-04-15 2005-08-04 Abraham Bout Recombinant protein production in permanent amniocytic cells that comprise nucleic acid encoding adenovirus E1A and E1B proteins
US7470523B2 (en) 1999-04-15 2008-12-30 Crucell Holland B.V. Recombinant protein production in a human cell
US20030092160A1 (en) * 1999-04-15 2003-05-15 Abraham Bout Recombinant protein production in a human cell
US20080113409A1 (en) * 1999-04-15 2008-05-15 Guus Hateboer Transient protein expression methods
US20070298464A1 (en) * 1999-04-15 2007-12-27 Optelten Dirk J Methods of producing erythropoietin isoforms comprising Lewis-X structures and high sialic acid content and compositions of the same
US20080274497A1 (en) * 1999-04-15 2008-11-06 Abraham Bout Recombinant protein production in a human cell
US7833753B2 (en) 1999-04-15 2010-11-16 Crucell Holland B.V. Methods of producing erythropoietin isoforms comprising Lewis-X structures and high sialic acid content and compositions of the same
US20070231860A1 (en) * 1999-04-15 2007-10-04 Crucell Holland B.V. Over-expression of enzymes involved in post-translational protein modifications in human cells
US7491532B2 (en) 1999-04-15 2009-02-17 Crucell Holland, B.V. Recombinant protein production in a human cell
US20050106722A1 (en) * 1999-04-15 2005-05-19 Jones David H. Efficient production of IgA in recombinant mammalian cells
US20050181359A1 (en) * 1999-04-15 2005-08-18 Crucell Holland B.V. Compositions of erythropoietin isoforms comprising Lewis-X structures and high sialic acid content
US7132280B2 (en) 1999-04-15 2006-11-07 Crucell Holland, B.V. Recombinant protein production in a human cell
US7297680B2 (en) 1999-04-15 2007-11-20 Crucell Holland B.V. Compositions of erythropoietin isoforms comprising Lewis-X structures and high sialic acid content
US20050164386A1 (en) * 1999-04-15 2005-07-28 Uytdehaag Alphonsus G. Overexpression of enzymes involved in post-translational protein modifications in human cells
US7604960B2 (en) 1999-04-15 2009-10-20 Crucell Holland B.V. Transient protein expression methods
US8236561B2 (en) 1999-04-15 2012-08-07 Crucell Holland B.V. Efficient production of IgA in recombinant mammalian cells
US7955590B2 (en) 1999-07-21 2011-06-07 Merck Patent Gmbh Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens
US7067110B1 (en) 1999-07-21 2006-06-27 Emd Lexigen Research Center Corp. Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens
US8043608B2 (en) 1999-07-21 2011-10-25 Merck Patent Gmbh Methods of using Fc-cytokine fusion proteins
US20100068175A1 (en) * 1999-07-21 2010-03-18 Gillies Stephen D Methods of using Fc-Cytokine fusion proteins
US8106098B2 (en) 1999-08-09 2012-01-31 The General Hospital Corporation Protein conjugates with a water-soluble biocompatible, biodegradable polymer
US7141651B2 (en) 1999-08-09 2006-11-28 Emd Lexigen Research Center Corp. Multiple cytokine protein complexes
US7582288B2 (en) 1999-08-09 2009-09-01 Merck Patent Gmbh Methods of targeting multiple cytokines
US20070258944A1 (en) * 1999-08-09 2007-11-08 Emd Lexigen Research Center Corp. Multiple cytokine protein complexes
US20040072299A1 (en) * 1999-08-09 2004-04-15 Gillies Stephen D. Multiple cytokine protein complexes
US20080019940A1 (en) * 1999-08-09 2008-01-24 Papisov Mikhail I Protein conjugates with a water-soluble biocompatible, biodegradable polymer
US9441203B2 (en) 1999-09-28 2016-09-13 Baxalta Innovations Gmbh Medium for the protein-free and serum-free cultivation of cells
US8021881B2 (en) 1999-09-28 2011-09-20 Baxter Innovations Gmbh Medium for the protein-free and serum-free cultivation of cells
US9982286B2 (en) 1999-09-28 2018-05-29 Baxalta Incorporated Medium for the protein-free and serum-free cultivation of cells
US8722406B2 (en) 1999-09-28 2014-05-13 Baxter Innovations Gmbh Medium for the protein-free and serum-free cultivation of cells
US20050202538A1 (en) * 1999-11-12 2005-09-15 Merck Patent Gmbh Fc-erythropoietin fusion protein with improved pharmacokinetics
US7211253B1 (en) 1999-11-12 2007-05-01 Merck Patentgesellschaft Mit Beschrankter Haftung Erythropoietin forms with improved properties
US20090324645A1 (en) * 1999-11-26 2009-12-31 Crucell Holland B.V. Production of vaccines
US20090239287A1 (en) * 1999-11-26 2009-09-24 Crucell Holland B.V. Production of vaccines
US7527961B2 (en) 1999-11-26 2009-05-05 Crucell Holland B.V. Production of vaccines
US7550284B2 (en) 1999-11-26 2009-06-23 Crucell Holland B.V. Production of vaccines
US20070072207A1 (en) * 1999-11-26 2007-03-29 Crucell Holland B.V. Production of vaccines
US20060051747A1 (en) * 1999-11-26 2006-03-09 Crucell Holland B.V. Production of vaccines
US7192759B1 (en) 1999-11-26 2007-03-20 Crucell Holland B.V. Production of vaccines
US7521220B2 (en) 1999-11-26 2009-04-21 Crucell Holland B.V. Production of vaccines
US7964198B2 (en) 1999-11-26 2011-06-21 Crucell Holland B.V. Production of vaccines
US20060063261A1 (en) * 1999-11-26 2006-03-23 Crucell Holland B.V. Production of vaccines
US7833788B2 (en) 1999-11-26 2010-11-16 Crucell Holland B.V. Production of vaccines
US20060034836A1 (en) * 2000-02-11 2006-02-16 Emd Lexigen Research Center Corp. Enhancing the circulating half-life of antibody-based fusion proteins
US7091321B2 (en) 2000-02-11 2006-08-15 Emd Lexigen Research Center Corp. Enhancing the circulating half-life of antibody-based fusion proteins
US20020147311A1 (en) * 2000-02-11 2002-10-10 Gillies Stephen D. Enhancing the circulating half-life of antibody-based fusion proteins
US7790415B2 (en) 2000-02-11 2010-09-07 Merck Patent Gmbh Enhancing the circulating half-life of antibody-based fusion proteins
US7507406B2 (en) 2000-02-11 2009-03-24 Emd Serono Research Center, Inc. Enhancing the circulating half-life of antibody-based fusion proteins
US20100297060A1 (en) * 2000-06-29 2010-11-25 Merck Patent Gmbh Enhancement of antibody-cytokine fusion protein mediated immune responses by combined treatment with immunocytokine uptake enhancing agents
US20030049227A1 (en) * 2000-06-29 2003-03-13 Gillies Stephen D. Enhancement of antibody-cytokine fusion protein mediated immune responses by combined treatment with immunocytokine uptake enhancing agents
US7517526B2 (en) 2000-06-29 2009-04-14 Merck Patent Gmbh Enhancement of antibody-cytokine fusion protein mediated immune responses by combined treatment with immunocytokine uptake enhancing agents
US7919647B2 (en) 2000-08-24 2011-04-05 University Of Tennessee Research Foundation Selective androgen receptor modulators and methods of use thereof
US20060111441A1 (en) * 2000-08-24 2006-05-25 Dalton James T Treating wasting disorders with selective androgen receptor modulators
US7645898B2 (en) 2000-08-24 2010-01-12 University Of Tennessee Research Foundation Selective androgen receptor modulators and method of use thereof
US7855229B2 (en) 2000-08-24 2010-12-21 University Of Tennessee Research Foundation Treating wasting disorders with selective androgen receptor modulators
US20070123563A1 (en) * 2000-08-24 2007-05-31 Dalton James T Selective androgen receptor modulators and method of use thereof
US7622503B2 (en) 2000-08-24 2009-11-24 University Of Tennessee Research Foundation Selective androgen receptor modulators and methods of use thereof
US6780607B2 (en) * 2001-02-07 2004-08-24 Dreambiogen Co., Ltd. Method for cell-free protein complete post-translational modification
US20050084926A1 (en) * 2001-02-07 2005-04-21 Dreambiogen Co., Ltd. Method for cell-free protein complete post-translational modification
US8066994B2 (en) 2001-03-07 2011-11-29 Merck Patent Gmbh Proteins comprising an IgG2 domain
US7148321B2 (en) 2001-03-07 2006-12-12 Emd Lexigen Research Center Corp. Expression technology for proteins containing a hybrid isotype antibody moiety
US20030044423A1 (en) * 2001-03-07 2003-03-06 Lexigen Pharmaceuticals Corp. Expression technology for proteins containing a hybrid isotype antibody moiety
US7973150B2 (en) 2001-03-30 2011-07-05 Merck Patent Gmbh Reducing the immunogenicity of fusion proteins
US20060025573A1 (en) * 2001-03-30 2006-02-02 Merck Patent Gmbh Reducing the immunogenicity of fusion proteins
US20030166877A1 (en) * 2001-03-30 2003-09-04 Lexigen Pharmaceuticals Corp. Reducing the immunogenicity of fusion proteins
US7601814B2 (en) 2001-03-30 2009-10-13 Merck Patent Gmbh Reducing the immunogenicity of fusion proteins
US8926973B2 (en) 2001-03-30 2015-01-06 Merck Patent Gmbh Reducing the immunogenicity of fusion proteins
US6992174B2 (en) 2001-03-30 2006-01-31 Emd Lexigen Research Center Corp. Reducing the immunogenicity of fusion proteins
US7459538B2 (en) 2001-05-03 2008-12-02 Merck Patent Gmbh Recombinant tumor specific antibody and use thereof
US7803618B2 (en) 2001-05-03 2010-09-28 Merck Patent Gmbh Recombinant tumor specific antibody and use thereof
US6969517B2 (en) 2001-05-03 2005-11-29 Emd Lexigen Research Center Corp. Recombinant tumor specific antibody and use thereof
US20060121007A1 (en) * 2001-08-30 2006-06-08 Stem Cell Therapeutics Inc. Combined regulation of neural cell production
US20090274668A1 (en) * 2001-08-30 2009-11-05 Stem Cell Therapeutics Inc Combined Regulation of Neural Cell Production
US7604993B2 (en) 2001-08-30 2009-10-20 Stem Cell Therapeutics Inc. Combined regulation of neural cell production
US20030104996A1 (en) * 2001-08-30 2003-06-05 Tiansheng Li L-methionine as a stabilizer for NESP/EPO in HSA-free formulations
US7884072B2 (en) 2001-09-14 2011-02-08 Stem Cell Therapeutics Inc. Prolactin induced increase in neural stem cell numbers
US20080181873A1 (en) * 2001-09-14 2008-07-31 Stem Cell Therapeutics Inc. Prolactin induced increase in neural stem cell numbers
US8222212B2 (en) 2001-09-14 2012-07-17 Stem Cell Therapeutics Inc. Prolactin induced increase in neural stem cell numbers
US20060148084A1 (en) * 2001-09-18 2006-07-06 Stem Cell Therapeutics Inc. Effect of growth hormone and IGF-1 on neural stem cells
US20050069979A1 (en) * 2001-11-28 2005-03-31 Steffen Zeng Cell culture process
US20070036752A1 (en) * 2001-12-04 2007-02-15 Emd Lexigen Research Center Corp. IL-2 fusion proteins with modulated selectivity
US7462350B2 (en) 2001-12-04 2008-12-09 Emd Serono Research Center, Inc. Cancer treatments including administering IL-2 fusion proteins with modulated selectivity
US20030166163A1 (en) * 2001-12-04 2003-09-04 Emd Lexigen Research Center Corp. Immunocytokines with modulated selectivity
US7888071B2 (en) 2001-12-04 2011-02-15 Merck Patent Gmbh DNA encoding IL-2 fusion proteins with modulated selectivity
US7186804B2 (en) 2001-12-04 2007-03-06 Emd Lexigen Research Center Corp. IL-2 fusion proteins with modulated selectivity
US20070161608A1 (en) * 2001-12-06 2007-07-12 Dalton James T Selective androgen receptor modulators for treating muscle wasting
US20070281906A1 (en) * 2001-12-06 2007-12-06 Dalton James T Selective androgen receptor modulators for treating diabetes
US8853266B2 (en) 2001-12-06 2014-10-07 University Of Tennessee Research Foundation Selective androgen receptor modulators for treating diabetes
US8802417B2 (en) 2001-12-07 2014-08-12 Crucell Holland B.V. Production of viruses, viral isolates and vaccines
US7504248B2 (en) 2001-12-07 2009-03-17 Crucell Holland B.V. Production of viruses viral isolates and vaccines
US20050123564A1 (en) * 2001-12-07 2005-06-09 Giuseppe Marzio Production of viruses viral isolates and vaccines
US20080050403A1 (en) * 2001-12-07 2008-02-28 Crucell Holland B.V. Production of viruses, viral isolates and vaccines
WO2003086444A1 (en) 2002-04-04 2003-10-23 Amgen Inc. Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins
EP2298331A2 (en) 2002-04-04 2011-03-23 Amgen, Inc Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins
US20040077086A1 (en) * 2002-07-09 2004-04-22 Manfred Reiter Animal protein free media for cultivation of cells
US20110217772A1 (en) * 2002-07-09 2011-09-08 Baxter International Inc. Animal protein free media for cultivation of cells
US8524497B2 (en) 2002-07-09 2013-09-03 Baxter International Inc. Animal protein free media for cultivation of cells
US7955833B2 (en) 2002-07-09 2011-06-07 Baxter International Inc. Animal protein free media for cultivation of cells
US9163211B2 (en) 2002-07-09 2015-10-20 Baxter International Inc. Animal protein free media for cultivation of cells
US20070179092A1 (en) * 2002-07-31 2007-08-02 Stem Cell Therapeutics Inc. Method of Enhancing Neural Stem Cell Proliferation, Differentiation, and Survival Using Pituitary Adenylate Cyclase Activating Polypeptide (PACAP)
US8114839B2 (en) 2002-09-09 2012-02-14 Hanall Biopharma Co., Ltd. Protease resistant modified erythropoietin polypeptides
US20070254838A1 (en) * 2002-09-09 2007-11-01 Rene Gantier Rational evolution of cytokines for higher stability, the cytokines and encoding nucleic acid molecules
US20090131318A1 (en) * 2002-09-09 2009-05-21 Rene Gantier Rational evolution of cytokines for higher stability, the cytokines and encoding nucleic acid molecules
US7169904B2 (en) 2002-12-17 2007-01-30 Emd Lexigen Research Center Corp. Immunocytokine sequences and uses thereof
US8470991B2 (en) 2002-12-17 2013-06-25 Merck Patent Gmbh Immunocytokine sequences and uses thereof
US20040203100A1 (en) * 2002-12-17 2004-10-14 Emd Lexigen Research Center Corp. Immunocytokine sequences and uses thereof
US20070059282A1 (en) * 2002-12-17 2007-03-15 Emd Lexigen Research Center Corp. Immunocytokine sequences and uses thereof
US20100210831A1 (en) * 2002-12-17 2010-08-19 Merck Patent Gmbh Immunocytokine Sequences and Uses Thereof
US7767405B2 (en) 2002-12-17 2010-08-03 Merck Patent Gmbh Immunocytokine sequences and uses thereof
US7459152B2 (en) 2003-04-23 2008-12-02 Rush University Medical Center Erythropoietin administration to improve graft survival
US20040259071A1 (en) * 2003-04-23 2004-12-23 Rush University Medical Center Erythropoietin administration to improve graft survival
US20070031932A1 (en) * 2003-05-09 2007-02-08 Crucell Holland B.V. Cultures of E1-immortalized cells and processes for culturing the same to increase product yields therefrom
US8008043B2 (en) 2003-05-09 2011-08-30 Crucell Holland B.V. Cultures of E1-immortalized cells and processes for culturing the same to increase product yields therefrom
US7608431B2 (en) 2003-05-09 2009-10-27 Crucell Holland B.V. Fed-batch process for production of erythropoietin in human embryonic retina cells that express adenovirus E1A
US20060240513A1 (en) * 2003-05-09 2006-10-26 Crucell Holland B.V. Cultures of E1-immortalized cells and processes for culturing the same to increase product yields therefrom
US7291484B2 (en) 2003-05-09 2007-11-06 Crucell Holland B.V. Processes for culturing E1-immortalized cells to increase product yields
US7919118B2 (en) 2003-05-12 2011-04-05 Affymax, Inc. Spacer moiety for poly (ethylene glycol) modified peptide based compounds
US20070027074A1 (en) * 2003-05-12 2007-02-01 Affymax, Inc. Novel peptides that bind to the erythropoietin receptor
US7084245B2 (en) 2003-05-12 2006-08-01 Affymax, Inc. Peptides that bind to the erythropoietin receptor
US20050107297A1 (en) * 2003-05-12 2005-05-19 Holmes Christopher P. Novel poly(ethylene glycol) modified compounds and uses thereof
US7414105B2 (en) 2003-05-12 2008-08-19 Affymax, Inc. Peptides that bind to the erythropoietin receptor
US7855175B2 (en) 2003-05-12 2010-12-21 Affymax, Inc. Peptides that bind to the erythropoietin receptor
US7528104B2 (en) 2003-05-12 2009-05-05 Affymax, Inc. Peptides that bind to the erythropoietin receptor
US20090048166A1 (en) * 2003-05-12 2009-02-19 Affymax, Inc. Novel peptides that bind to the erythropoietin receptor
US8592365B2 (en) 2003-05-12 2013-11-26 Affymax, Inc. Spacer moiety for poly(ethylene glycol) modified peptide based compounds
US20060040858A1 (en) * 2003-05-12 2006-02-23 Affymax, Inc. Novel peptides that bind to the erythropoietin receptor
US20050137329A1 (en) * 2003-05-12 2005-06-23 Affymax, Inc. Novel peptides that bind to the erythropoietin receptor
US8729030B2 (en) 2003-05-12 2014-05-20 Affymax, Inc. Peptides that bind to the erythropoietin receptor
US20070032408A1 (en) * 2003-05-12 2007-02-08 Holmes Christopher P Novel spacer moiety for poly (ethylene glycol) modified peptide based compounds
US8304391B2 (en) 2003-05-12 2012-11-06 Affymax, Inc. Peptides that bind to the erythropoietin receptor
US20090227508A1 (en) * 2003-05-12 2009-09-10 Affymax, Inc. Peptides that bind to the erythropoietin receptor
US20060063234A1 (en) * 2003-05-23 2006-03-23 Crucell Holland B.V. Efficient production of IgM in recombinant mammalian cells
EP2286791A1 (en) 2003-12-30 2011-02-23 Durect Corporation Polymeric implants, preferably containing a mixture of PEG and PLG, for controlled release of active agents, preferably a GnRH
US7465447B2 (en) 2003-12-31 2008-12-16 Merck Patent Gmbh Fc-erythropoietin fusion protein with improved pharmacokinetics
US20050192211A1 (en) * 2003-12-31 2005-09-01 Emd Lexigen Research Center Corp. Fc-erythropoietin fusion protein with improved pharmacokinetics
US20090092607A1 (en) * 2003-12-31 2009-04-09 Merck Patent Gmbh Fc-erythropoietin fusion protein with improved pharmacokinetics
US20050245436A1 (en) * 2004-02-13 2005-11-03 Stem Cell Therapeutics Corp. Pheromones and the luteinizing hormone for inducing proliferation of neural stem cells and neurogenesis
US8435949B2 (en) 2004-02-13 2013-05-07 Stem Cell Therapeutics Corp. Pheromones and the luteinizing hormone for inducing proliferation of neural stem cells and neurogenesis
US8217002B2 (en) 2004-02-13 2012-07-10 Stem Cell Therapeutics Corp. Pheromones and the luteinizing hormone for inducing proliferation of neural stem cells and neurogenesis
US20110178009A1 (en) * 2004-02-13 2011-07-21 Stem Cell Therapeutics Corp. Pheromones and the Luteinizing Hormone for Inducing Proliferation of Neural Stem Cells and Neurogenesis
US7846898B2 (en) 2004-02-13 2010-12-07 Stem Cell Therapeutics Corp. Pheromones and the luteinizing hormone for inducing proliferation of neural stem cells and neurogenesis
US20050194459A1 (en) * 2004-03-08 2005-09-08 Chan Wan S. Aroma therapy for fountain
US20090324478A1 (en) * 2004-04-13 2009-12-31 Hinman Norman D Method for Making Silicon-Containing Products
US9889110B2 (en) 2004-06-07 2018-02-13 University Of Tennessee Research Foundation Selective androgen receptor modulator for treating hormone-related conditions
US20110237664A1 (en) * 2004-06-07 2011-09-29 Dalton James T Selective androgen receptor modulators for treating diabetes
US10662148B2 (en) 2004-06-07 2020-05-26 University Of Tennessee Research Foundation Selective androgen receptor modulator and methods of use thereof
US9884038B2 (en) 2004-06-07 2018-02-06 University Of Tennessee Research Foundation Selective androgen receptor modulator and methods of use thereof
US10053418B2 (en) 2004-06-07 2018-08-21 University Of Tennessee Research Foundation Selective androgen receptor modulator and methods of use thereof
US9809796B2 (en) 2004-10-29 2017-11-07 Baxalta GmbH Animal protein-free media for cultivation of cells
US9222075B2 (en) 2004-10-29 2015-12-29 Baxalta Incorporated Animal protein-free media for cultivation of cells
US9714411B2 (en) 2004-10-29 2017-07-25 Baxalta GmbH Animal protein-free media for cultivation of cells
US8440408B2 (en) 2004-10-29 2013-05-14 Baxter International Inc. Animal protein-free media for cultivation of cells
US10138461B2 (en) 2004-10-29 2018-11-27 Baxalta GmbH Animal protein-free media for cultivation of cells
US20080064105A1 (en) * 2004-10-29 2008-03-13 Baxter Healthcare Corporation Animal protein-free media for cultivation of cells
US8748156B2 (en) 2004-10-29 2014-06-10 Baxter International Inc. Animal protein-free media for cultivation of cells
US20080064080A1 (en) * 2004-10-29 2008-03-13 Baxter Healthcare Corporation Animal protein-free media for cultivation of cells
US10655099B2 (en) 2004-10-29 2020-05-19 Baxalta Incorporated Animal protein-free media for cultivation of cells
US20080009040A1 (en) * 2004-10-29 2008-01-10 Baxter Healthcare Corporation Animal protein-free media for cultivation of cells
US20060094104A1 (en) * 2004-10-29 2006-05-04 Leopold Grillberger Animal protein-free media for cultivation of cells
US20080108564A1 (en) * 2004-11-11 2008-05-08 Affymax, Inc. Novel peptides that bind to the erythropoietin receptor
US20090005292A1 (en) * 2004-11-11 2009-01-01 Affymax, Inc. Novel Peptides that Bind to the Erythropoietin Receptor
EP2402450A1 (en) 2004-12-30 2012-01-04 Crucell Holland B.V. Methods to obtain recombinant proteins with decreased LacdiNac structures
US20070104704A1 (en) * 2005-06-03 2007-05-10 Affymax, Inc. Erythropoietin receptor peptide formulations and uses
US7919461B2 (en) 2005-06-03 2011-04-05 Affymax, Inc. Erythropoietin receptor peptide formulations and uses
US7906485B2 (en) 2005-06-03 2011-03-15 Affymax, Inc. Erythropoietin receptor peptide formulations and uses
US20090136442A1 (en) * 2005-06-03 2009-05-28 Affymax, Inc. Erythropoietin receptor peptide formulations and uses
US7550433B2 (en) 2005-06-03 2009-06-23 Affymax, Inc. Erythropoietin receptor peptide formulations and uses
US20090118183A1 (en) * 2005-06-03 2009-05-07 Affymax, Inc. Erythropoietin receptor peptide formulations and uses
US8324159B2 (en) 2005-06-03 2012-12-04 Affymax, Inc. Erythropoietin receptor peptide formulations and uses
EP2425715A1 (en) 2005-08-31 2012-03-07 The University of Tennessee Research Foundation Treating symptoms of renal disease with selective androgen receptor modulators (SARM)
US20070098698A1 (en) * 2005-09-27 2007-05-03 Stem Cell Therapeutics Corp. Pregnancy-induced Oligodendrocyte Precursor Cell Proliferation Regulated by Prolactin
US7964563B2 (en) 2005-09-27 2011-06-21 Stem Cell Therapeutics Corp. Oligodendrocyte precursor cell proliferation regulated by prolactin
US7534765B2 (en) 2005-09-27 2009-05-19 Stem Cell Therapeutics Corp. Pregnancy-induced oligodendrocyte precursor cell proliferation regulated by prolactin
US8470777B2 (en) 2005-09-27 2013-06-25 Stem Cell Therapeutics Corp. Pregnancy-induced oligodendrocyte precursor cell proliferation regulated by prolactin
WO2007060213A3 (en) * 2005-11-24 2008-08-14 Serono Lab Erythropoietin polypeptides and uses thereof
US20080260746A1 (en) * 2005-11-24 2008-10-23 Laboratoires Serono Sa Erythropoietin Polypeptides and Uses Thereof
US9758568B2 (en) 2006-01-04 2017-09-12 Baxalta GmbH Oligopeptide-free cell culture media
US20110151512A1 (en) * 2006-01-04 2011-06-23 Baxter International Inc. Oligopeptide-free cell culture media
US10696731B2 (en) 2006-01-04 2020-06-30 Baxalta GmbH Oligopeptide-free cell culture media
US20110112018A1 (en) * 2006-01-27 2011-05-12 Hannelore Ehrenreich Method for the Treatment and/or Prophylaxis of Multiple Sclerosis, and Use of Erythropoietin for the Manufacture of a Medicament for the Intermittent and/or Intermittent Prophylaxis of Multiple Sclerosis
US9254312B2 (en) 2006-01-27 2016-02-09 Hannelore Ehrenreich Method for the treatment and/or prophylaxis of multiple sclerosis, and use of erythropoietin for the manufacture of a medicament for the intermittent treatment and/or intermittent prophylaxis of multiple sclerosis
US20080039389A1 (en) * 2006-03-17 2008-02-14 Stem Cell Therapeutics Corp. Dosing regimens for neural stem cell proliferating agents and differentiating agents for the treatment of neurological disorders
US8333974B2 (en) 2006-03-17 2012-12-18 Stem Cell Therapeutics Corp. Continuous dosing regimens for neural stem cell proliferating agents and neural stem cell differentiating agents
US20090081205A1 (en) * 2006-03-17 2009-03-26 Stem Cell Therapreutics Corp Continuous dosing regimens for neural stem cell proliferating agents and neural stem cell differentiating agents
US8143220B2 (en) 2006-03-17 2012-03-27 Stem Cell Therapeutics Corp. Dosing regimens for neural stem cell proliferating agents and differentiating agents for the treatment of neurological disorders
WO2008008433A2 (en) 2006-07-12 2008-01-17 University Of Tennessee Research Foundation Substituted acylanilides and methods of use thereof
EP3147278A1 (en) 2006-07-12 2017-03-29 University of Tennessee Research Foundation Compound for treating breast cancer and progestin-dependent conditions
US8765924B2 (en) 2006-08-04 2014-07-01 Prolong Pharmaceuticals, Inc. Modified erythropoietin
US20100184655A1 (en) * 2006-08-04 2010-07-22 Prolong Pharmaceuticals, Inc. Modified erythropoietin
US8426465B2 (en) 2006-08-24 2013-04-23 University Of Tennesse Research Foundation Substituted acylanilides and methods of use thereof
US8846756B2 (en) 2006-08-24 2014-09-30 University Of Tennessee Research Foundation Substituted acylanilides and methods of use thereof
US8586024B2 (en) 2006-09-14 2013-11-19 Medgenics Medical Israel Ltd. Long lasting drug formulations
US20080090777A1 (en) * 2006-09-14 2008-04-17 Pearlman Andrew L Long lasting drug formulations
US8877175B2 (en) 2006-09-14 2014-11-04 Medgenics Medical Israel Ltd. Long lasting drug formulations
US9127084B2 (en) 2006-09-14 2015-09-08 Medgenics Medical Israel Ltd. Long lasting drug formulations
US9687564B2 (en) 2006-09-14 2017-06-27 Medgenics Medical Israel Ltd. Long lasting drug formulations
US8454948B2 (en) 2006-09-14 2013-06-04 Medgenics Medical Israel Ltd. Long lasting drug formulations
US9155749B2 (en) 2006-09-14 2015-10-13 Medgenics Medical Israel Ltd. Long lasting drug formulations
US8252743B2 (en) 2006-11-28 2012-08-28 Hanall Biopharma Co., Ltd. Modified erythropoietin polypeptides and uses thereof for treatment
US8629250B2 (en) 2007-02-02 2014-01-14 Amgen Inc. Hepcidin, hepcidin antagonists and methods of use
US20080213277A1 (en) * 2007-02-02 2008-09-04 Amgen Inc. Hepcidin, hepcidin antagonists and methods of use
EP2732820A1 (en) 2007-04-13 2014-05-21 University of Tennessee Research Foundation Selective androgen receptor modulators for treating cancer
US9180165B2 (en) 2007-07-19 2015-11-10 Hannelore Ehrenreich Use of EPO receptor activation or stimulation for the improvement of the EDSS score in patients with multiple sclerosis
US20090022734A1 (en) * 2007-07-19 2009-01-22 Hannelore Ehrenreich Use of epo receptor activation or stimulation for the improvement of the edss score in patients with multiple sclerosis
US11090283B2 (en) 2007-09-11 2021-08-17 University Of Tennessee Research Foundation Solid forms of selective androgen receptor modulators
US9150501B2 (en) 2007-09-11 2015-10-06 Gtx, Inc. Solid forms of selective androgen receptor modulators
US12053448B2 (en) 2007-09-11 2024-08-06 University Of Tennessee Research Foundation Solid forms of selective androgen receptor modulators
US8383114B2 (en) 2007-09-27 2013-02-26 Amgen Inc. Pharmaceutical formulations
US20100297106A1 (en) * 2007-09-27 2010-11-25 Christopher James Sloey Pharmaceutical Formulations
US10653781B2 (en) 2007-09-27 2020-05-19 Amgen Inc. Pharmaceutical formulations
US9320797B2 (en) 2007-09-27 2016-04-26 Amgen Inc. Pharmaceutical formulations
EP3381445A2 (en) 2007-11-15 2018-10-03 Amgen Inc. Aqueous formulation of antibody stablised by antioxidants for parenteral administration
EP2803675A2 (en) 2008-01-25 2014-11-19 Amgen, Inc Ferroportin antibodies and methods of use
US9175078B2 (en) 2008-01-25 2015-11-03 Amgen Inc. Ferroportin antibodies and methods of use
US9688759B2 (en) 2008-01-25 2017-06-27 Amgen, Inc. Ferroportin antibodies and methods of use
WO2009094551A1 (en) 2008-01-25 2009-07-30 Amgen Inc. Ferroportin antibodies and methods of use
EP2574628A1 (en) 2008-01-25 2013-04-03 Amgen Inc. Ferroportin antibodies and methods of use
EP3103880A1 (en) 2008-02-08 2016-12-14 Ambrx, Inc. Modified leptin polypeptides and their uses
US8653249B2 (en) 2008-02-27 2014-02-18 Fuso Pharmaceutical Industries, Ltd. Expression vector for mass production of foreign gene-derived protein using animal cell and use thereof
US20110123993A1 (en) * 2008-02-27 2011-05-26 Yasuhiko Suzuki Expression vector for mass production of foreign gene-derived protein using animal cell and use thereof
EP2620448A1 (en) 2008-05-01 2013-07-31 Amgen Inc. Anti-hepcidin antibodies and methods of use
EP2816059A1 (en) 2008-05-01 2014-12-24 Amgen, Inc Anti-hepcidin antibodies and methods of use
US20110189732A1 (en) * 2008-06-04 2011-08-04 Evonik Degussa Gmbh Process for the Fermentative Production of Erythropoietin
US20100004326A1 (en) * 2008-06-20 2010-01-07 Veverka Karen A Metabolites of selective androgen receptor modulators and methods of use thereof
US8003689B2 (en) 2008-06-20 2011-08-23 Gtx, Inc. Metabolites of selective androgen receptor modulators and methods of use thereof
US9156899B2 (en) 2008-09-26 2015-10-13 Eli Lilly And Company Modified animal erythropoietin polypeptides and their uses
US8569233B2 (en) 2008-09-26 2013-10-29 Eli Lilly And Company Modified animal erythropoietin polypeptides and their uses
US20100093608A1 (en) * 2008-09-26 2010-04-15 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
US9644014B2 (en) 2008-09-26 2017-05-09 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
US8278418B2 (en) 2008-09-26 2012-10-02 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
EP3216800A1 (en) 2008-09-26 2017-09-13 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
EP3693014A1 (en) 2008-11-13 2020-08-12 The General Hospital Corporation Methods and compositions for regulating iron homeostasis by modulation bmp-6
WO2010056981A2 (en) 2008-11-13 2010-05-20 Massachusetts General Hospital Methods and compositions for regulating iron homeostasis by modulation bmp-6
WO2011050333A1 (en) 2009-10-23 2011-04-28 Amgen Inc. Vial adapter and system
WO2011156373A1 (en) 2010-06-07 2011-12-15 Amgen Inc. Drug delivery device
US11535659B2 (en) 2010-09-28 2022-12-27 Amryt Pharmaceuticals Inc. Engineered polypeptides having enhanced duration of action
WO2012135315A1 (en) 2011-03-31 2012-10-04 Amgen Inc. Vial adapter and system
EP3498323A2 (en) 2011-04-20 2019-06-19 Amgen Inc. Autoinjector apparatus
EP4074355A1 (en) 2011-04-20 2022-10-19 Amgen Inc. Autoinjector apparatus
EP3045187A1 (en) 2011-10-14 2016-07-20 Amgen, Inc Injector and method of assembly
EP3045190A1 (en) 2011-10-14 2016-07-20 Amgen, Inc Injector and method of assembly
WO2013055873A1 (en) 2011-10-14 2013-04-18 Amgen Inc. Injector and method of assembly
EP3744371A1 (en) 2011-10-14 2020-12-02 Amgen, Inc Injector and method of assembly
EP3045189A1 (en) 2011-10-14 2016-07-20 Amgen, Inc Injector and method of assembly
EP3269413A1 (en) 2011-10-14 2018-01-17 Amgen, Inc Injector and method of assembly
EP3335747A1 (en) 2011-10-14 2018-06-20 Amgen Inc. Injector and method of assembly
EP3045188A1 (en) 2011-10-14 2016-07-20 Amgen, Inc Injector and method of assembly
US9604916B2 (en) 2012-07-13 2017-03-28 Gtx, Inc. Method of treating androgen receptor (AR)-positive breast cancers with selective androgen receptor modulator (SARMs)
US12115146B2 (en) 2012-07-13 2024-10-15 University Of Tennessee Research Foundation Treatment of skeletal-related events for breast cancer patients
US9744149B2 (en) 2012-07-13 2017-08-29 Gtx, Inc. Method of treating androgen receptor (AR)-positive breast cancers with selective androgen receptor modulator (SARMs)
US10849873B2 (en) 2012-07-13 2020-12-01 Oncternal Therapeutics, Inc Non-invasive method of evaluating breast cancers for selective androgen receptor modulator (SARM) therapy
US10314807B2 (en) 2012-07-13 2019-06-11 Gtx, Inc. Method of treating HER2-positive breast cancers with selective androgen receptor modulators (SARMS)
US9969683B2 (en) 2012-07-13 2018-05-15 Gtx, Inc. Method of treating estrogen receptor (ER)-positive breast cancers with selective androgen receptor modulator (SARMS)
US10258596B2 (en) 2012-07-13 2019-04-16 Gtx, Inc. Method of treating HER2-positive breast cancers with selective androgen receptor modulators (SARMS)
US9622992B2 (en) 2012-07-13 2017-04-18 Gtx, Inc. Method of treating androgen receptor (AR)-positive breast cancers with selective androgen receptor modulator (SARMs)
US10987334B2 (en) 2012-07-13 2021-04-27 University Of Tennessee Research Foundation Method of treating ER mutant expressing breast cancers with selective androgen receptor modulators (SARMs)
US11439745B2 (en) 2012-11-21 2022-09-13 Amgen Inc. Drug delivery device
EP3656426A1 (en) 2012-11-21 2020-05-27 Amgen, Inc Drug delivery device
US11458247B2 (en) 2012-11-21 2022-10-04 Amgen Inc. Drug delivery device
US12370304B2 (en) 2012-11-21 2025-07-29 Amgen Inc. Drug delivery device
US10682474B2 (en) 2012-11-21 2020-06-16 Amgen Inc. Drug delivery device
WO2014081780A1 (en) 2012-11-21 2014-05-30 Amgen Inc. Drug delivery device
US11344681B2 (en) 2012-11-21 2022-05-31 Amgen Inc. Drug delivery device
EP3081249A1 (en) 2012-11-21 2016-10-19 Amgen, Inc Drug delivery device
EP3072548A1 (en) 2012-11-21 2016-09-28 Amgen, Inc Drug delivery device
EP4234694A2 (en) 2012-11-21 2023-08-30 Amgen Inc. Drug delivery device
US12115341B2 (en) 2012-11-21 2024-10-15 Amgen Inc. Drug delivery device
AU2018203985B2 (en) * 2013-03-14 2019-09-19 Shire Human Genetic Therapies, Inc. RIBONUCLEIC ACIDs WITH 4'-THIO-MODIFIED NUCLEOTIDES AND RELATED METHODS
US20160031928A1 (en) * 2013-03-14 2016-02-04 Shire Human Genetic Therapies, Inc. RIBONUCLEIC ACIDs WITH 4'-THIO-MODIFIED NUCLEOTIDES AND RELATED METHODS
US11447520B2 (en) 2013-03-14 2022-09-20 Translate Bio, Inc. Ribonucleic acids with 4′-thio-modified nucleotides and related methods
US10822368B2 (en) 2013-03-14 2020-11-03 Translate Bio, Inc. Ribonucleic acids with 4′-thio-modified nucleotides and related methods
US10266559B2 (en) * 2013-03-14 2019-04-23 Translate Bio, Inc. Ribonucleic acids with 4′-thio-modified nucleotides and related methods
AU2014239562B2 (en) * 2013-03-14 2018-07-05 Translate Bio, Inc. Ribonucleic acids with 4'-thio-modified nucleotides and related methods
CN105026411A (zh) * 2013-03-14 2015-11-04 夏尔人类遗传性治疗公司 含4’-硫代修饰的核苷酸的核糖核酸及相关方法
US12247046B2 (en) 2013-03-14 2025-03-11 Translate Bio, Inc. Ribonucleic acids with 4′-thio-modified nucleotides and related methods
WO2014143770A1 (en) 2013-03-15 2014-09-18 Amgen Inc. Body contour adaptable autoinjector device
EP3593839A1 (en) 2013-03-15 2020-01-15 Amgen Inc. Drug cassette
WO2014144096A1 (en) 2013-03-15 2014-09-18 Amgen Inc. Drug cassette, autoinjector, and autoinjector system
US10239941B2 (en) 2013-03-15 2019-03-26 Intrinsic Lifesciences Llc Anti-hepcidin antibodies and uses thereof
US9657098B2 (en) 2013-03-15 2017-05-23 Intrinsic Lifesciences, Llc Anti-hepcidin antibodies and uses thereof
US9803011B2 (en) 2013-03-15 2017-10-31 Intrinsic Lifesciences Llc Anti-hepcidin antibodies and uses thereof
WO2014149357A1 (en) 2013-03-22 2014-09-25 Amgen Inc. Injector and method of assembly
EP3831427A1 (en) 2013-03-22 2021-06-09 Amgen Inc. Injector and method of assembly
EP3501575A1 (en) 2013-10-24 2019-06-26 Amgen, Inc Drug delivery system with temperature-sensitive-control
EP3957345A1 (en) 2013-10-24 2022-02-23 Amgen, Inc Drug delivery system with temperature-sensitive control
WO2015059701A1 (en) 2013-10-24 2015-04-30 Medgenics Medical Israel Ltd. Micro-organs providing sustained delivery of a therapeutic polypeptide and methods of use thereof
WO2015061386A1 (en) 2013-10-24 2015-04-30 Amgen Inc. Injector and method of assembly
EP3789064A1 (en) 2013-10-24 2021-03-10 Amgen, Inc Injector and method of assembly
EP3421066A1 (en) 2013-10-24 2019-01-02 Amgen, Inc Injector and method of assembly
WO2015061389A1 (en) 2013-10-24 2015-04-30 Amgen Inc. Drug delivery system with temperature-sensitive control
WO2015119906A1 (en) 2014-02-05 2015-08-13 Amgen Inc. Drug delivery system with electromagnetic field generator
EP3785749A1 (en) 2014-05-07 2021-03-03 Amgen Inc. Autoinjector with shock reducing elements
WO2015171777A1 (en) 2014-05-07 2015-11-12 Amgen Inc. Autoinjector with shock reducing elements
US10328082B2 (en) 2014-05-30 2019-06-25 Pfizer Inc. Methods of use and combinations
WO2015181676A1 (en) 2014-05-30 2015-12-03 Pfizer Inc. Carbonitrile derivatives as selective androgen receptor modulators
EP4036924A1 (en) 2014-06-03 2022-08-03 Amgen, Inc Devices and methods for assisting a user of a drug delivery device
US11738146B2 (en) 2014-06-03 2023-08-29 Amgen Inc. Drug delivery system and method of use
WO2015187797A1 (en) 2014-06-03 2015-12-10 Amgen Inc. Controllable drug delivery system and method of use
EP4362039A2 (en) 2014-06-03 2024-05-01 Amgen Inc. Controllable drug delivery system and method of use
WO2015187793A1 (en) 2014-06-03 2015-12-10 Amgen Inc. Drug delivery system and method of use
US11992659B2 (en) 2014-06-03 2024-05-28 Amgen Inc. Controllable drug delivery system and method of use
US11213624B2 (en) 2014-06-03 2022-01-04 Amgen Inc. Controllable drug delivery system and method of use
WO2015187799A1 (en) 2014-06-03 2015-12-10 Amgen Inc. Systems and methods for remotely processing data collected by a drug delivery device
US10323088B2 (en) 2014-09-22 2019-06-18 Intrinsic Lifesciences Llc Humanized anti-hepcidin antibodies and uses thereof
WO2016049036A1 (en) 2014-09-22 2016-03-31 Intrinsic Lifesciences Llc Humanized anti-hepcidin antibodies and uses thereof
EP3943135A2 (en) 2014-10-14 2022-01-26 Amgen Inc. Drug injection device with visual and audible indicators
WO2016061220A2 (en) 2014-10-14 2016-04-21 Amgen Inc. Drug injection device with visual and audio indicators
US11944794B2 (en) 2014-12-19 2024-04-02 Amgen Inc. Drug delivery device with proximity sensor
US10765801B2 (en) 2014-12-19 2020-09-08 Amgen Inc. Drug delivery device with proximity sensor
WO2016100055A1 (en) 2014-12-19 2016-06-23 Amgen Inc. Drug delivery device with live button or user interface field
US11357916B2 (en) 2014-12-19 2022-06-14 Amgen Inc. Drug delivery device with live button or user interface field
WO2016100781A1 (en) 2014-12-19 2016-06-23 Amgen Inc. Drug delivery device with proximity sensor
EP3848072A1 (en) 2014-12-19 2021-07-14 Amgen Inc. Drug delivery device with proximity sensor
US10799630B2 (en) 2014-12-19 2020-10-13 Amgen Inc. Drug delivery device with proximity sensor
US12415039B2 (en) 2014-12-19 2025-09-16 Amgen Inc. Drug delivery device with proximity sensor
EP3689394A1 (en) 2014-12-19 2020-08-05 Amgen Inc. Drug delivery device with live button or user interface field
EP3556411A1 (en) 2015-02-17 2019-10-23 Amgen Inc. Drug delivery device with vacuum assisted securement and/or feedback
EP3981450A1 (en) 2015-02-27 2022-04-13 Amgen, Inc Drug delivery device having a needle guard mechanism with a tunable threshold of resistance to needle guard movement
WO2017039786A1 (en) 2015-09-02 2017-03-09 Amgen Inc. Syringe assembly adapter for a syringe
WO2017100501A1 (en) 2015-12-09 2017-06-15 Amgen Inc. Auto-injector with signaling cap
WO2017120178A1 (en) 2016-01-06 2017-07-13 Amgen Inc. Auto-injector with signaling electronics
EP4035711A1 (en) 2016-03-15 2022-08-03 Amgen Inc. Reducing probability of glass breakage in drug delivery devices
WO2017160799A1 (en) 2016-03-15 2017-09-21 Amgen Inc. Reducing probability of glass breakage in drug delivery devices
EP3721922A1 (en) 2016-03-15 2020-10-14 Amgen Inc. Reducing probability of glass breakage in drug delivery devices
WO2017189089A1 (en) 2016-04-29 2017-11-02 Amgen Inc. Drug delivery device with messaging label
WO2017192287A1 (en) 2016-05-02 2017-11-09 Amgen Inc. Syringe adapter and guide for filling an on-body injector
WO2017197222A1 (en) 2016-05-13 2017-11-16 Amgen Inc. Vial sleeve assembly
WO2017200989A1 (en) 2016-05-16 2017-11-23 Amgen Inc. Data encryption in medical devices with limited computational capability
WO2017209899A1 (en) 2016-06-03 2017-12-07 Amgen Inc. Impact testing apparatuses and methods for drug delivery devices
WO2018004842A1 (en) 2016-07-01 2018-01-04 Amgen Inc. Drug delivery device having minimized risk of component fracture upon impact events
WO2018034784A1 (en) 2016-08-17 2018-02-22 Amgen Inc. Drug delivery device with placement detection
WO2018081234A1 (en) 2016-10-25 2018-05-03 Amgen Inc. On-body injector
WO2018136398A1 (en) 2017-01-17 2018-07-26 Amgen Inc. Injection devices and related methods of use and assembly
WO2018151890A1 (en) 2017-02-17 2018-08-23 Amgen Inc. Drug delivery device with sterile fluid flowpath and related method of assembly
WO2018152073A1 (en) 2017-02-17 2018-08-23 Amgen Inc. Insertion mechanism for drug delivery device
WO2018165143A1 (en) 2017-03-06 2018-09-13 Amgen Inc. Drug delivery device with activation prevention feature
WO2018164829A1 (en) 2017-03-07 2018-09-13 Amgen Inc. Needle insertion by overpressure
WO2018165499A1 (en) 2017-03-09 2018-09-13 Amgen Inc. Insertion mechanism for drug delivery device
WO2018172219A1 (en) 2017-03-20 2018-09-27 F. Hoffmann-La Roche Ag Method for in vitro glycoengineering of an erythropoiesis stimulating protein
EP4241807A2 (en) 2017-03-28 2023-09-13 Amgen Inc. Plunger rod and syringe assembly system and method
WO2018183039A1 (en) 2017-03-28 2018-10-04 Amgen Inc. Plunger rod and syringe assembly system and method
EP4512445A2 (en) 2017-03-28 2025-02-26 Amgen Inc. Plunger rod and syringe assembly system
WO2018226515A1 (en) 2017-06-08 2018-12-13 Amgen Inc. Syringe assembly for a drug delivery device and method of assembly
WO2018226565A1 (en) 2017-06-08 2018-12-13 Amgen Inc. Torque driven drug delivery device
WO2018236619A1 (en) 2017-06-22 2018-12-27 Amgen Inc. Device activation impact/shock reduction
WO2018237225A1 (en) 2017-06-23 2018-12-27 Amgen Inc. Electronic drug delivery device comprising a cap activated by a switch assembly
WO2019014014A1 (en) 2017-07-14 2019-01-17 Amgen Inc. NEEDLE INSERTION-RETRACTING SYSTEM HAVING DOUBLE TORSION SPRING SYSTEM
EP4292576A2 (en) 2017-07-21 2023-12-20 Amgen Inc. Gas permeable sealing member for drug container and methods of assembly
WO2019018169A1 (en) 2017-07-21 2019-01-24 Amgen Inc. PERMEABLE GAS SEALING ELEMENT FOR MEDICINE CONTAINER AND METHODS OF ASSEMBLY
EP4085942A1 (en) 2017-07-25 2022-11-09 Amgen Inc. Drug delivery device with gear module and related method of assembly
WO2019022950A1 (en) 2017-07-25 2019-01-31 Amgen Inc. DRUG DELIVERY DEVICE WITH CONTAINER ACCESS SYSTEM AND ASSEMBLY METHOD THEREOF
WO2019022951A1 (en) 2017-07-25 2019-01-31 Amgen Inc. DRUG DELIVERY DEVICE WITH GEAR MODULE AND ASSEMBLY METHOD THEREOF
WO2019032482A2 (en) 2017-08-09 2019-02-14 Amgen Inc. HYDRAULIC-PNEUMATIC PRESSURE CHAMBER DELIVERY SYSTEM
WO2019036181A1 (en) 2017-08-18 2019-02-21 Amgen Inc. BODY INJECTOR WITH STERILE ADHESIVE PATCH
WO2019040548A1 (en) 2017-08-22 2019-02-28 Amgen Inc. NEEDLE INSERTION MECHANISM FOR DRUG DELIVERY DEVICE
WO2019070472A1 (en) 2017-10-04 2019-04-11 Amgen Inc. FLOW ADAPTER FOR MEDICATION DELIVERY DEVICE
WO2019070552A1 (en) 2017-10-06 2019-04-11 Amgen Inc. DRUG DELIVERY DEVICE COMPRISING A LOCKOUT ASSEMBLY AND ASSOCIATED ASSEMBLY METHOD
EP4257164A2 (en) 2017-10-06 2023-10-11 Amgen Inc. Drug delivery device with interlock assembly and related method of assembly
WO2019074579A1 (en) 2017-10-09 2019-04-18 Amgen Inc. DRUG DELIVERY DEVICE COMPRISING A DRIVE ASSEMBLY AND ASSEMBLY METHOD THEREOF
WO2019090086A1 (en) 2017-11-03 2019-05-09 Amgen Inc. Systems and approaches for sterilizing a drug delivery device
WO2019090079A1 (en) 2017-11-03 2019-05-09 Amgen Inc. System and approaches for sterilizing a drug delivery device
WO2019090303A1 (en) 2017-11-06 2019-05-09 Amgen Inc. Fill-finish assemblies and related methods
WO2019089178A1 (en) 2017-11-06 2019-05-09 Amgen Inc. Drug delivery device with placement and flow sensing
WO2019094138A1 (en) 2017-11-10 2019-05-16 Amgen Inc. Plungers for drug delivery devices
WO2019099324A1 (en) 2017-11-16 2019-05-23 Amgen Inc. Door latch mechanism for drug delivery device
WO2019099322A1 (en) 2017-11-16 2019-05-23 Amgen Inc. Autoinjector with stall and end point detection
WO2019231582A1 (en) 2018-05-30 2019-12-05 Amgen Inc. Thermal spring release mechanism for a drug delivery device
WO2019231618A1 (en) 2018-06-01 2019-12-05 Amgen Inc. Modular fluid path assemblies for drug delivery devices
WO2020023451A1 (en) 2018-07-24 2020-01-30 Amgen Inc. Delivery devices for administering drugs
WO2020023220A1 (en) 2018-07-24 2020-01-30 Amgen Inc. Hybrid drug delivery devices with tacky skin attachment portion and related method of preparation
WO2020023336A1 (en) 2018-07-24 2020-01-30 Amgen Inc. Hybrid drug delivery devices with grip portion
WO2020023444A1 (en) 2018-07-24 2020-01-30 Amgen Inc. Delivery devices for administering drugs
WO2020028009A1 (en) 2018-07-31 2020-02-06 Amgen Inc. Fluid path assembly for a drug delivery device
WO2020068623A1 (en) 2018-09-24 2020-04-02 Amgen Inc. Interventional dosing systems and methods
WO2020068476A1 (en) 2018-09-28 2020-04-02 Amgen Inc. Muscle wire escapement activation assembly for a drug delivery device
WO2020072577A1 (en) 2018-10-02 2020-04-09 Amgen Inc. Injection systems for drug delivery with internal force transmission
WO2020072846A1 (en) 2018-10-05 2020-04-09 Amgen Inc. Drug delivery device having dose indicator
WO2020081479A1 (en) 2018-10-15 2020-04-23 Amgen Inc. Drug delivery device having damping mechanism
WO2020081480A1 (en) 2018-10-15 2020-04-23 Amgen Inc. Platform assembly process for drug delivery device
WO2020092056A1 (en) 2018-11-01 2020-05-07 Amgen Inc. Drug delivery devices with partial needle retraction
WO2020091981A1 (en) 2018-11-01 2020-05-07 Amgen Inc. Drug delivery devices with partial drug delivery member retraction
WO2020091956A1 (en) 2018-11-01 2020-05-07 Amgen Inc. Drug delivery devices with partial drug delivery member retraction
WO2020219482A1 (en) 2019-04-24 2020-10-29 Amgen Inc. Syringe sterilization verification assemblies and methods
WO2021041067A2 (en) 2019-08-23 2021-03-04 Amgen Inc. Drug delivery device with configurable needle shield engagement components and related methods
WO2022159414A1 (en) 2021-01-22 2022-07-28 University Of Rochester Erythropoietin for gastroinfestinal dysfunction
WO2022246055A1 (en) 2021-05-21 2022-11-24 Amgen Inc. Method of optimizing a filling recipe for a drug container
WO2023275715A1 (en) 2021-06-30 2023-01-05 Pfizer Inc. Metabolites of selective androgen receptor modulators
WO2023209074A1 (en) 2022-04-28 2023-11-02 Institut National de la Santé et de la Recherche Médicale Methods of restoring erythropoiesis in patients suffering from a sf3b1 mutant myelodysplastic syndrome by correcting coasy mis-splicing
WO2024094457A1 (en) 2022-11-02 2024-05-10 F. Hoffmann-La Roche Ag Method for producing glycoprotein compositions

Also Published As

Publication number Publication date
IL73785A0 (en) 1985-03-31
MX9203598A (es) 1992-09-01
JPH03259098A (ja) 1991-11-19
EP0148605B1 (en) 1990-07-25
ES8802329A1 (es) 1988-05-01
JP2708099B2 (ja) 1998-02-04
AU2042192A (en) 1992-10-08
JP3375614B2 (ja) 2003-02-10
AU600650B2 (en) 1990-08-23
NL930128I1 (nl) 1993-11-01
JP2002045191A (ja) 2002-02-12
AU657555B2 (en) 1995-03-16
JPH0693000A (ja) 1994-04-05
JP2655750B2 (ja) 1997-09-24
US5618698A (en) 1997-04-08
AU3612597A (en) 1997-12-18
HK20093A (en) 1993-03-19
WO1985002610A1 (en) 1985-06-20
EP0148605B2 (en) 1998-12-23
AU1007495A (en) 1995-04-06
JPH0776239B2 (ja) 1995-08-16
CY1643A (en) 1993-05-14
AU5272293A (en) 1994-03-24
JP3276933B2 (ja) 2002-04-22
AU5750490A (en) 1990-10-04
AU3746785A (en) 1985-06-26
EP0148605A2 (en) 1985-07-17
JPH03198792A (ja) 1991-08-29
JP3017962B2 (ja) 2000-03-13
JPH08269096A (ja) 1996-10-15
CA1339047C (en) 1997-05-27
JPH11253188A (ja) 1999-09-21
EP0148605A3 (en) 1987-06-03
JPH0655136B2 (ja) 1994-07-27
ES538519A0 (es) 1988-05-01
JPH0435159B2 (enExample) 1992-06-10
DE3482828D1 (de) 1990-08-30
SG92891G (en) 1992-02-14
IL73785A (en) 1992-11-15
JP2957974B2 (ja) 1999-10-06
JPH1072366A (ja) 1998-03-17
US5756349A (en) 1998-05-26
JPS6455190A (en) 1989-03-02
JPH1095799A (ja) 1998-04-14
NZ210501A (en) 1991-08-27

Similar Documents

Publication Publication Date Title
US5441868A (en) Production of recombinant erythropoietin
US5955422A (en) Production of erthropoietin
US4703008A (en) DNA sequences encoding erythropoietin
RU2261276C2 (ru) Выделенная молекула днк, кодирующая эритропоэтин человека, (варианты), экспрессирующий плазмидный или вирусный днк-вектор, гликопротеид эритропоэтин (варианты) и способ его получения, фармацевтическая композиция (варианты), линия клеток млекопитающего (варианты)
CA1341607C (en) Production of erythropoietin
AU4252400A (en) Production of erythropoietin
AU1974001A (en) Production of erythropoietin
CZ281542B6 (cs) Řetězec DNA pro použití k zajištění exprese polypeptidového produktu
DK172611B1 (da) DNA-sekvens kodende for erythropoietin, vektor inkluderende sekvensen, vært transformeret eller transficeret med sekvensen,
DD251786A5 (de) Verfahren zur Herstellung eines Polypeptids
CA2111656A1 (en) Variants of corticosteroid binding globulin
LT4012B (en) Process for the preparation of polipeptides
MXPA99010042A (en) Recombinant human erythropoyetine productive cellular line and the recombinant human erythropoyetine produced by this cell

Legal Events

Date Code Title Description
STCF Information on status: patent grant

Free format text: PATENTED CASE

AS Assignment

Owner name: AMGEN INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KIRIN-AMGEN INC.;REEL/FRAME:008461/0901

Effective date: 19970409

CC Certificate of correction
FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12