WO2023209074A1

WO2023209074A1 - Methods of restoring erythropoiesis in patients suffering from a sf3b1 mutant myelodysplastic syndrome by correcting coasy mis-splicing

Info

Publication number: WO2023209074A1
Application number: PCT/EP2023/061081
Authority: WO
Inventors: Delphine Bernard; Céline PHILIPPE; Kevin ROUAULT-PIERRE
Original assignee: Institut National de la Santé et de la Recherche Médicale; Etablissement Français Du Sang (Efs); Université De Bretagne Occidentale; Queen Mary University Of London
Priority date: 2022-04-28
Filing date: 2023-04-27
Publication date: 2023-11-02

Abstract

Myelodysplastic syndromes (MDS) is a clonal stem cell disorder that increases markedly with age and has a high propensity to progress to acute myeloid leukaemia (AML). SF3B1 mutant low-risk MDS represents a distinct entity, mainly characterized by ineffective erythropoiesis and strongly associated with a ring sideroblast phenotype. More particularly, mutations in SF3B1 modify the recognition pattern of the branching point and the 3' splice site and lead to subsequent mis-splicing of its targets. Recently, the inventors have identified a mis-splicing in the 5'UTR of the coenzyme A synthase (COASY) as a major contributor to ineffective erythropoiesis in MDS-RS patients and revealed that the loss of COASY in healthy human primary cells impedes erythroid colony formation, delays erythroid differentiation and prevents heme accumulation. The inventors then identified morpholinos that could restore COASY normal splicing in K562 SF3B1K700E cells. The SSO of the present invention thus would thus be suitable for restoring erythropoiesis in MDS SF3B1mut patients.

Description

METHODS OF RESTORING ERYTHROPOIESIS IN PATIENTS SUFFERING

FROM A SF3B1 MUTANT MYELODYSPLASTIC SYNDROME BY CORRECTING

COASY MIS-SPLICING

FIELD OF THE INVENTION:

The present invention is in the field of medicine, in particular haematology.

BACKGROUND OF THE INVENTION:

Myelodysplastic syndromes (MDS) is a clonal stem cell disorder that increases markedly with age and has a high propensity to progress to acute myeloid leukaemia (AML)^1,2. Ineffective erythropoiesis and anaemia are hallmarks of MDS³. In low-risk MDS without del5q, (revised IPSS risk: very low/low/intermediate), erythropoiesis stimulating agents (ESAs), that stimulate red blood cell production, are the first line of treatment², with an initial response rate of approximately 50%. However responders to treatment will eventually become resistant with a median response duration of 18 to 24 months,⁴'⁸ further reduced in MDS-RS ⁷. The addition of hypomethylating agents or lenalidomide to the treatment regimen do not improve these patients’ overall survival ⁹. Hence, most patients eventually become dependent on red-blood- cell (RBC) transfusions, that contributes to iron overload associated with reduced quality of life and an increased risk of progression to AML ¹⁰. The failure of ESAs mainly limits second line therapeutic options to Luspatercept, a transforming growth factor- superfamily ligand trap. This agent promotes late-stage erythropoiesis and leads to transfusion independency ¹¹ in up to 38% of MDS-RS patients (NCT02631070) ^12,13. The incidence of splicing factor mutation is high in general in MDS ¹⁴, therefore making these patients ideal for spliceosome inhibitors, such as H3B-8800 or E7107. However, recent studies have shown low response rates and major toxicities in patients that received these inhibitors ¹⁵. Given that MDS is an age-related disease with an indolent clinical course, and that populations are aging, MDS cases cannot but increase in the future. Therefore, there is clearly an unmet need to develop new therapeutic approaches to treat this disease.

SF3B1 mutant low-risk MDS represents a distinct entity, mainly characterized by ineffective erythropoiesis and strongly associated with a ring sideroblast phenotype ¹⁶'¹⁹. In addition to being the most frequently mutated gene in MDS ¹⁴ and MDS-RS, SF3B1 is amongst the most altered splicing factor across all cancers ²⁰. All SF3B1 hotspot mutations cluster in the C- terminal HEAT repeat domain ²¹, creating a neomorphic activity that induces mis-splicing mainly through cryptic 3' splice site selection ²². Transcriptional profiling of SF3B1 mutant cells has revealed widespread mRNA splicing alterations ^23-26 Due to discrepancies in human and mice ribonucleic sequences, murine models of SF3Bl_mut have failed to recapitulate the common mis-splicing events identified in patient clinical samples ²⁷. Therefore, working on primary human samples is critical in order to dissect the role of aberrant splicing in MDS pathogenesis. To identify alternative splice variants, RNA splicing analysis is usually performed using BM CD34+ hematopoietic stem/progenitor cells (HSPCs) or mononuclear cells from MDS patients ^16,18’ ^{19,28, 29}. Since MDS-RS is characterized by differentiation block, we hypothesized that performing our splicing analysis on cells undergoing differentiation (i.e., colonies derived from 42 patients’ HSPCs) will reveal key splicing events involved in MDS SF3Blmut biology. Recently, we have identified a mis-splicing in the 5’UTR of the coenzyme A synthase (COASY) as a major contributor to ineffective erythropoiesis in MDS-RS patients and revealed that the loss of COASY in healthy human primary cells impedes erythroid colony formation, delays erythroid differentiation and prevents heme accumulation. Remarkably, loss of protein that results from COASY mis-splicing depletes coenzyme A (CoA) and succinyl-CoA in SF3Blmut cells. The results thus suggest that the COASY/CoA/Succinyl-CoA axis represents a new therapeutic target highly relevant for the treatment of ineffective erythropoiesis in MDS- RS patients.

SUMMARY OF THE INVENTION:

The present invention is defined by the claims. In particular, the present invention relates to a method of restoring erythropoiesis in a patient suffering from a SF3B1 mutant myelodysplastic syndrome comprising administering to the patient a therapeutically effective amount of at least one splice switching antisense oligonucleotide (SSO) capable of correcting COASY mis- splicing.

DETAILED DESCRIPTION OF THE INVENTION:

Main definitions:

As used herein, the term “myelodysplastic syndromes” or “MDS” refers to a group of clonal myeloid malignancies characterized by ineffective hematopoiesis leading to blood cytopenias. MDS have traditionally been considered to be synonymous with “preleukemia” because of the increased risk of transformation into acute myelogenous leukemia (AML).

As used herein, the term “SF3B1” refers to the splicing factor 3B subunit 1 that is a protein that in humans is encoded by the SF3B1 gene (Gene ID: 23451). SF3B1 is an essential component of the U2 small nuclear ribonucleoprotein particle (snRNP) that interacts with branch point sequences close to the 3’ splice site during pre - mRNA splicing. SF3B1 is the largest subunit of SF3b, a heptameric protein complex of U2 snRNP. Components of U2 snRNP include splicing factor 3b complex, splicing factor 3a complex and the non-coding snRNA U2, SF3B1 consists of an unstructured N-terminal domain, and a C-terminal HEAT (Huntingtin, Elongation factor 3, protein phosphatase 2A, and the yeast kinase TORI) domain composed of 20 tandem repeats structured as a superhelix, providing a scaffold together with other SF3b subunits within the U2 snRNP. SF3B1 is the most frequently mutated splicing factor gene in MDS. MDS patients with SF3B1 mutations have been reported to have better overall and event- free survival than their wildtype counterparts. Additionally, these mutations are highly associated with subtypes of MDS characterized by ringed sideroblasts, which are subdivided into a condition with single (erythroid) lineage dysplasia (MDS-RS-SLD) and a condition with multiple lineage dysplasia (MDS-RS-MLD). SF3B1 mutations are well known in the art (Papaemmanuil E, Cazzola M, Boultwood J, Malcovati L, Vyas P, Bowen D, Pellagatti A, Wainscoat IS, Hellstrom-Lindberg E, Gambacorti-Passerini C, Godfrey AL, Rapado I, Cvejic A, Rance R, McGee C, Ellis P, Mudie LJ, Stephens PJ, McLaren S, Massie CE, Tarpey PS, Varela I, Nik-Zainal S, Davies HR, Shlien A, Jones D, Raine K, Hinton J, Butler AP, Teague JW, Baxter EJ, Score J, Galli A, Della Porta MG, Travaglino E, Groves M, Tauro S, Munshi NC, Anderson KC, El-Naggar A, Fischer A, Mustonen V, Warren AJ, Cross NC, Green AR, Futreal PA, Stratton MR, Campbell PJ; Chronic Myeloid Disorders Working Group of the International Cancer Genome Consortium. Somatic SF3B1 mutation in myelodysplasia with ring sideroblasts. NEngl J Med. 2011 Oct 13;365(15): 1384-95; Darman RB, Seiler M, Agrawal AA, Lim KH, Peng S, Aird D, Bailey SL, Bhavsar EB, Chan B, Colla S, Corson L, Feala J, Fekkes P, Ichikawa K, Keaney GF, Lee L, Kumar P, Kunii K, MacKenzie C, Matijevic M, Mizui Y, Myint K, Park ES, Puyang X, Selvaraj A, Thomas MP, Tsai J, Wang JY, Warmuth M, Yang H, Zhu P, Garcia-Manero G, Furman RR, Yu L, Smith PG, Buonamici S. Cancer- Associated SF3B1 Hotspot Mutations Induce Cryptic 3' Splice Site Selection through Use of a Different Branch Point. Cell Rep. 2015 Nov 3;13(5): 1033-45. doi: 10.1016/j.celrep.2015.09.053. Epub 2015 Oct 22. PMID: 26565915). In particular, the mutations affecting SF3B1 are typically heterozygous, point mutations suspected to gain a noemorphic activity, with K700E described as a major mutation hotspot in MDS.

As used herein, “SF3B1 mutant myelodysplastic syndrome” or “SF3B1 mutant MDS” or “MDS SF3Bl^mut” refers to a myelodysplastic syndrome characterized by at least one SF3B1 mutation.

As used herein, the term “erythropoiesis” has its general meaning in the art and refers to the tightly-regulated and complex process originating in the bone marrow from a multipotent stem cell and terminating in a mature, enucleated erythrocyte.

As used herein, the term “COASY” refers to the coenzyme A (CoA) synthase. COASY catalyzes the last steps of the biosynthesis of CoA, a cofactor for 4% of all cellular enzymes. CoA is necessary for the production of acetyl-CoA for carbon entry into the TCA cycle and for the generation of succinyl-CoA, an essential substrate of aminolevulinic acid (ALA) synthase (ALAS2), the rate-limiting enzyme in heme biosynthesis.

As used herein, the term “COASY mis-splicing” refers to the mis-splicing that occurs in presence of SF3B1 mutation and that leads to switch of alternative transcripts that sees the transcript NM_001042532.4 (COASY beta) becoming the dominant isoform in MDS SF3Bl^mut patients.

As used herein, the expression “correcting COASY mis-splicing” denotes that the expression of the transcript NM_001042529 3 (COASY a) is restored over the expression of the transcript NM_001042532.4 (COASY beta). Thus, correcting COASY mis-splicing leads to a decreased accumulation of the transcript NM_001042532.4 (COASY beta).

As used herein, the term “pre-mRNA”, “precursor mRNA” or “primary RNA transcript” refers to a strand of messenger ribonucleic acid (mRNA), synthesized from a DNA template in the nucleus of a cell by transcription, prior or concomitantly to processing events such as splicing. Generally, eukaryotic pre-mRNA exists only briefly before it is fully processed into mature mRNA. Pre-mRNA includes two different types of segments, exons and introns. Exons are pre-mRNA segments that are conserved in mature mRNA, while introns are usually excised, by a process known as “splicing”.

As used herein, the term “exon” refers to a nucleic acid sequence that is included in the mature form of an RNA molecule after either portions of a pre-processed (or precursor) RNA have been removed by splicing. The mature RNA molecule can be a messenger RNA (mRNA) or a functional form of a non-coding RNA, such as IncRNA.

As used herein, the term “intron” refers to a nucleic acid region (within a gene) that is not included in the mature RNA. An intron is a non-coding section that is transcribed into a precursor mRNA (pre-mRNA), and subsequently removed by splicing during formation of the mature RNA.

As used herein, the term “splice site” in the context of a pre-mRNA molecule, refers to the short conserved sequence at the 5’ end (donor site) or 3’ end (acceptor site) of an intron to which a spliceosome binds and catalyses the splicing of the intron from the pre-mRNA.

As used herein, the term “exon skipping” refers generally to both process by which an entire exon, or a portion thereof, is removed or conserved from a given pre-processed RNA, and is thereby excluded or included from being present in the mature RNA.

As used herein, the term “antisense oligonucleotide” or “ASO” refers to a single strand of DNA, RNA, or modified nucleic acids that is complementary to a chosen sequence. Antisense RNA can be used to prevent protein translation of certain mRNA strands by binding to them. Antisense DNA can be used to target a specific, complementary (coding or non-coding) RNA. Such an antisense oligomer can be designed to block or inhibit translation of mRNA or to inhibit natural pre-mRNA splice processing, and may be said to be “directed to” or “targeted against” a target sequence with which it hybridizes. According to the present invention, the target sequence is a splice site of a pre-processed mRNA. In said embodiments, the ASO is named as a “splice switching antisense oligonucleotide” or“SSO”. For instance, the target sequence for a splice site may include an mRNA sequence having its 5' end 1 to about 25 base pairs downstream of a normal splice acceptor junction in a preprocessed mRNA. A preferred target sequence is any region of a precursor mRNA that includes a splice site or is contained entirely within an exon coding sequence or spans a splice acceptor or donor site or exon/intron regulatory sequences (ESE, ISE).

As used herein, the term "complementary" as used herein includes "fully complementary" and "substantially complementary", meaning there will usually be a degree of complementarity between the oligonucleotide and its corresponding target sequence of more than 80%, preferably more than 85%, still more preferably more than 90%, most preferably more than 95%. For example, for an oligonucleotide of 20 nucleotides in length with one mismatch between its sequence and its target sequence, the degree of complementarity is 95%.

As used herein, the term “isolated” means material that is substantially or essentially free from components that normally accompany it in its native state. For example, an “isolated polynucleotide,” as used herein, may refer to a polynucleotide that has been purified or removed from the sequences that flank it in a naturally-occurring state, e.g., a DNA fragment that has been removed from the sequences that are normally adjacent to the fragment.

As used herein, the term “stabilized SSO” refers to a SSO that is relatively resistant to in vivo degradation (e.g. via an exo- or endo-nuclease).

As used herein, the term "treatment" or "treat" refer to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of patient at risk of contracting the disease or suspected to have contracted the disease as well as patients who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a patient having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a patient beyond that expected in the absence of such treatment. By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a patient during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a patient during treatment of an illness, e.g., to keep the patient in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e g., administering a drug at a regular interval, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., pain, disease manifestation, etc.]).

As used herein, the term “therapeutically effective amount” is intended for a minimal amount of the active agent (i.e the SSO of the present invention) which is necessary to impart therapeutic benefit to a subject. For example, a "therapeutically effective amount" to a subject is such an amount that induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression or physiological conditions associated with or resistance to succumbing to a disorder.

Method of the present invention;

The first object of the present invention relates to a method of restoring erythropoiesis in a patient suffering from a SF3B1 mutant myelodysplastic syndrome comprising administering to the patient a therapeutically effective amount of at least one splice switching antisense oligonucleotide (SSO) capable of correcting COASY mis-splicing.

In some embodiments, the SSO of the present invention induces the exon skipping of exon 2. More particularly, the SSO of the present invention is designed to target the 5’ or 3’ splice site of exon 2 to alter splicing by blocking the recognition of said splice site by splicing machinery in order to modulate the splicing at the junction of interest and thus inducing the exon 2 skipping. Typically, the SSO of the present invention is designed according to the method disclosed in the EXAMPLE and as depicted in Figure 1.

In some embodiments, the splice switching antisense oligonucleotide of the present invention is an antisense RNA. In some embodiments, the splice switching antisense oligonucleotide of the present invention is an antisense DNA.

The length of the splice switching antisense oligonucleotide may vary so long as it is capable of binding selectively to the intended location within the pre-mRNA molecule. The length of such sequences can be determined in accordance with selection procedures described herein. Generally, the antisense molecule will be from about 10 nucleotides in length up to about 50 nucleotides in length. It will be appreciated however that any length of nucleotides within this range may be used in the method. Preferably, the length of the antisense molecule is between 10-30 nucleotides in length. In some embodiments, the splice switching antisense oligonucleotide of the present invention has a sufficient length. As used herein, “sufficient length” refers to an antisense oligonucleotide that is complementary to at least 8, more typically 8-30, contiguous nucleobases in the target pre-mRNA. In some embodiments, an antisense of sufficient length includes at least 8, 9, 10, 11, 12, 13, 14, 15, 17, 20 or more contiguous nucleobases in the target pre-mRNA. In some embodiments an antisense of sufficient length includes at least 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleobases in the target pre-mRNA.

In some embodiments, the splice switching antisense oligonucleotide of the present invention is complementary to the nucleic acid sequence as shown in SEQ ID NO:1 GACAAGGGTTCCTGTCCAGTTTCCC, SEQ ID NO:2 CGGCTCCTGTCGGTCAGCACTGAAA or SEQ ID NOG GCTCCTGTCGGTCaGCACTGAAACC. In some embodiments, the splice switching antisense oligonucleotide of the present invention targets the 5’ exon 2 splice site and comprises the sequences as set forth in SEQ ID NO:4 (“COASY-1”). In some embodiments, the splice switching antisense oligonucleotide of the present invention targets the 3’ exon 2 splice site and comprises the sequences as set forth in SEQ ID NO:5 (“COASY-2”). In some embodiments, the splice switching antisense oligonucleotide of the present invention targets the 3’ exon 2 splice site and comprises the sequences as set forth in SEQ ID NO:6 (“COASY- 2”).

In some embodiments, the splice switching antisense oligonucleotide of the present invention is stabilized. Stabilization can be a function of length or secondary structure. Alternatively, SSO stabilization can be accomplished via phosphate backbone modifications. Preferred stabilized SSOs of the present invention have a modified backbone, e.g. have phosphorothioate linkages to provide maximal activity and protect the SSO from degradation by intracellular exo- and endo-nucleases. Other possible stabilizing modifications include phosphodiester modifications, combinations of phosphodiester and phosphorothioate modifications, methylphosphonate, methylphosphorothioate, phosphorodithioate, p-ethoxy, and combinations thereof. Chemically stabilized, modified versions of the SSO’s also include “Morpholinos” (phosphorodiamidate morpholino oligomers, PMOs), 2'-0-Met oligomers, 2 ’Methoxy-ethyl oligomers, 2’ -Fluoro (2’-F) oligomers, tri cyclo (tc)-DNAs, U7 short nuclear (sn) RNAs, tricyclo-DNA- oligoanti sense molecules (U.S. Provisional Patent Application Serial No. 61/212,384 For: Tricyclo-DNA Antisense Oligonucleotides, Compositions and Methods for the Treatment of Disease, filed April 10, 2009, the complete contents of which is hereby incorporated by reference, unlocked nucleic acid (UNA), locked nucleic acid (LNA), peptide nucleic acid (PNA), serinol nucleic acid (SNA), twisted intercalating nucleic acid (TINA), anhydrohexitol nucleic acid (HNA), cyclohexenyl nucleic acid (CeNA), D-altritol nucleic acid (ANA) and morpholino nucleic acid (MNA) have also been investigated in splice modulation. Recently, nucleobase-modified AOs containing 2-thioribothymidine, and 5-(phenyltriazol)-2- deoxyuridine nucleotides have been reported to induce exon skipping (Chen S, Le BT, Chakravarthy M, Kosbar TR, Veedu RN. Systematic evaluation of 2'-Fluoro modified chimeric antisense oligonucleotide-mediated exon skipping in vitro. Sci Rep. 2019 Apr 15;9(l):6078.). In some embodiments, the antisense oligonucleotides of the invention may be 2'-O-Me RNA/ENA chimera oligonucleotides (Takagi M, Yagi M, Ishibashi K, Takeshima Y, Surono A, Matsuo M, Koizumi M.Design of 2'-O-Me RNA/ENA chimera oligonucleotides to induce exon skipping in dystrophin pre-mRNA. Nucleic Acids Symp Ser (Oxf). 2004;(48):297-8). Other forms of SSOs that may be used to this effect are SSO sequences coupled to small nuclear RNA molecules such as U1 or U7 in combination with a viral transfer method based on, but not limited to, lentivirus or adeno-associated virus (Denti, MA, et al, 2008; Goyenvalle, A, et al, 2004). In some embodiments, the antisense oligonucleotides of the invention are 2’-O- m ethyl -phosphorothi oate nucl eoti des . The SSOs of the invention can be synthesized de novo using any of a number of procedures well known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage et al., 1981); nucleoside H-phosphonate method (Garegg et al., 1986; Froehler et al., 1986, Garegg et al., 1986, Gaffney et al., 1988). These chemistries can be performed by a variety of automated nucleic acid synthesizers available in the market. These nucleic acids may be referred to as synthetic nucleic acids. Alternatively, SSOs can be produced on a large scale in plasmids (see Sambrook, et al., 1989). SSOs can be prepared from existing nucleic acid sequences using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases. SSOs prepared in this manner may be referred to as isolated nucleic acids.

In some embodiments, the splice switching antisense oligonucleotide of the present invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the splice switching antisense oligonucleotide of the present invention to the cells. Preferably, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, naked plasmids, non-viral delivery systems (electroporation, sonoporation, cationic transfection agents, liposomes, nanoparticules, peptide-bound SSO, etc...), phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense oligonucleotide nucleic acid sequences. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: RNA viruses such as a retrovirus (as for example moloney murine leukemia virus and lentiviral derived vectors), harvey murine sarcoma virus, murine mammary tumor virus, and rous sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus. One can readily employ other vectors not named but known to the art. Typically, viral vectors according to the invention include adenoviruses and adeno-associated (AAV) viruses, which are DNA viruses that have already been approved for human use in gene therapy. Actually 12 different AAV serotypes (AAV1 to 12) are known, each with different tissue tropisms (Wu, Z Mol Ther 2006; 14:316-27). Recombinant AAV are derived from the dependent parvovirus AAV (Choi, VW J Virol 2005; 79:6801-07). The adeno-associated virus type 1 to 12 can be engineered to be replication deficient and is capable of infecting a wide range of cell types and species (Wu, Z Mol Ther 2006; 14:316-27). It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hematopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion. Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art. See e.g. Sambrook et al., 1989. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigen-encoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA. Plasmids may be delivered by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid can be injected by intramuscular, intradermal, subcutaneous, or other routes. It may also be administered by, intranasal sprays or drops, rectal suppository and orally. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and microencapsulation. In some embodiments, the antisense oligonucleotide nucleic acid sequence is under the control of a heterologous regulatory region, e.g., a heterologous promoter. The promoter can also be, e.g., a viral promoter, such as CMV promoter or any synthetic promoters.

It will be understood that the total daily usage of the SSO of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidential with the specific compound employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Typically, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated. A medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.

In some embodiments, the SSO of the present invention is administered in combination with an erythropoiesis stimulating agent (ESA). Typically the ESA is any molecule that stimulates erythropoiesis, such as Epogen® (epoetin alfa), Aranesp® (darbepoetin alfa), Dynepo® (epoetin delta), Mircera® (methyoxy polyethylene glycol-epoetin beta), Hematide®, MRK- 2578, INS-22, Retacrit® (epoetin zeta), Neorecormon® (epoetin beta), Silapo® (epoetin zeta), Binocrit® (epoetin alfa), epoetin alfa Hexal, Abseamed® (epoetin alfa), Ratioepo® (epoetin theta), Eporatio® (epoetin theta), Biopoin® (epoetin theta), epoetin alfa, epoetin beta, epoetin zeta, epoetin theta, and epoetin delta, as well as the molecules or variants or analogs thereof as disclosed in the following patents or patent applications, each of which is herein incorporated by reference in its entirety: U.S. Patent Nos. 4,703,008; 5,441,868; 5,547,933; 5,618,698; 5,621,080; 5,756,349; 5,767,078; 5,773,569; 5,955,422; 5,986,047; 6,583,272; 7,084,245; and 7,271,689; and PCT Publication Nos. WO 91/05867; WO 95/05465; WO 96/40772; WO 00/24893; WO 01/81405; and WO 2007/136752.

Typically, the splice switching antisense oligonucleotide of the present invention is administered in the form of a pharmaceutical composition. Pharmaceutical compositions of the present invention may also include a pharmaceutically or physiologically acceptable carrier such as saline, sodium phosphate, etc. The compositions will generally be in the form of a liquid, although this need not always be the case. Suitable carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphates, alginate, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, celluose, water syrup, methyl cellulose, methyl and propylhydroxybenzoates, mineral oil, etc. The formulations can also include lubricating agents, wetting agents, emulsifying agents, preservatives, buffering agents, etc. Those of skill in the art will also recognize that nucleic acids are often delivered in conjunction with lipids (e.g. cationic lipids or neutral lipids, or mixtures of these), frequently in the form of liposomes or other suitable micro- or nanostructured material (e.g. micelles, lipocomplexes, dendrimers, emulsions, cubic phases, nanoparticules, etc.).

A further object of the present invention relates to a splice switching antisense oligonucleotide as described above. In some embodiments, the splice switching antisense oligonucleotide comprises the sequence as set forth in SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

A further object of the present invention relates to a pharmaceutical composition comprising a splice switching antisense oligonucleotide that comprises the sequence as set forth in SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

FIGURES:

Figure 1: COASY transcripts and position of morpholino sequences designed to modulate COASY splicing to promote exon 2 skipping.

Figure 2 Switch of COASY alternative splicing in K562 cells upon expression of SF3Bl^K700E variant. A. RT-PCR allowing the detection of 4 COASY alternative transcripts in K562 stable cells expressing SF3Bl^WTor SF3B1^K7OOE for 2 days upon induction by doxycycline (2 ug/mL). B. Quantification of each isoform by quantitative RT-PCR using ACTB as a reference gene. C. Steady state level of COASY proteins revealed by Western-Blot (25ug/ lane) in the same cells as A.

Figure 3. Modulation of COASY splicing by splice switching oligonucleotides in K562 inducible cell lines. Cells were treated with doxycycline (2 pg/mL - 24h) to induce expression of SF3Bl^wt or SF3Bl^K700E and were transfected by 10pM morpholino using EndoPorter (6 nM). Detection of COASY alternative transcripts was established at 2 days post-transfection by RT- PCR (A) and was quantified by qRT-PCR using primers specific to each isoform and ACTB as reference gene (B).

Figure 4. Effect of COASY morpholinos on COASY splicing in knock-in K562 cell lines. Control and SF3B1^K7OOE knock-in cells were transfected by lOpM morpholino using EndoPorter (6 nM). (A) RT-PCR allowing the detection of 4 COASY alternative transcripts. (B) Quantification of COASY alternative transcripts was established at 5 days post-transfection by quantitative RT-PCR using primers specific to each isoform and ACTB as reference gene (n=2 for SF3B 1^WT, n=4 for SF3Bl^K700E).

EXAMPLE:

SF3B1 mutations induce mis-splicing of COASY isoforms in patients with MDS-RS

Mutations in SF3B1 modify the recognition pattern of the branching point and the 3’ splice site and lead to subsequent mis-splicing of its targets. To identify critical mis-splicing events involved in the erythroid differentiation blockage, we performed splicing analysis on RNA sequencing generated from hematopoietic stem/progenitor cells undergoing differentiation Three MDS primary samples harboring SF3B1 mutations and three age-matched healthy donors cultured under normoxia and hypoxia conditions were initially used for the analysis. High depth RNA-seq and differential splicing analyses using rMATS identified 2,845 mis-spliced events including 200 shared between hypoxia and normoxia conditions. Here, using a cohort of 42 MDS samples, we report the mis-splicing of the coenzyme A synthase (COASY) transcript. Heme synthesis relies on succinyl-CoA synthesis, and its production itself depends on the availability of cellular CoA. COASY’ s mis-splicing is thus a key driver of ineffective erythropoiesis in MDS-RS patients.

COASY transcript mis-splicing induces protein loss and CoA synthesis deficiency in SF3Bl^mut cells

COASY mis-splicing occurs within the 5’UTR and is categorized as alternative 3’ splice site (A3SS) with an inclusion level of 38.7%. Remarkably, this mis-splicing event induces a switch of alternative transcripts that sees the transcript NM_001042532.4 (COASY beta) and XM_011525300.2 becoming the dominant isoform in MDS SF3Blmut patients (data not shown). RT-qPCR performed on a 110 discovery cohort of 25 patient samples (3 HD, 5 MDS SF3B1 WT and 17 MDS SF3Bl^mut) demonstrated that the beta isoform is exclusively seen in patients harboring mutation in SF3B1 (data not shown) and these results were confirmed in an independent validation cohort (10 MDS SF3B1 WT and 8 MDS SF3Bl^mut). Using the CRISPR/Cas9 system, we introduced the most common SF3B1 heterozygous mutation (i.e., 115 K700E) into the K562 cell line (not shown). This resulted in 5’UTR mis-splicing of COASY that exactly replicated the profile observed in MDS-RS patients and recapitulates other previously reported mis-splicing events (Figure 1). This isoform switch resulted in 60% loss of COASY protein expression (data not shown).

COASY deficiency impairs erythroid differentiation in human primary cells

Next, to assess whether COASY mis-splicing leads to measurable defects in the TCA cycle and metabolites essential for heme biosynthesis, we performed LC/MS metabolic analysis, demonstrated impairment of the TCA cycle with a significant decrease in CoA, succinyl-CoA, and, surprisingly in glycine, a co-substrate of ALAS2 with succinyl-CoA (data not shown). Furthermore, we demonstrated that COASY deficiency impairs erythroid differentiation in human primary cells.

Splice switching oligonucleotides (SSO) correct COASY mis-splicing

Our aim was then to understand whether these aberrant events could be exploited to target malignant clones in SF3B1 mutated patients. Based on COASY mis-splicing event described above, we designed splice switching oligonucleotides (SSO) to correct COASY mis-splicing in K562 cells with the ultimate objective of studying the ability of these SSOs to suppress, at least partially, the erythropoiesis defect observed in MDS.

Morpholino antisense oligonucleotides were chosen due to their efficacity in K562 erythroleukemia cells and their use in a recent study targeting the splicing of BRD9, a core component of chromatin remodeling complex in the context of SF3Bl^mut induced melanomagenesis (Inoue et al, 2019).

Inducible expression of SF3B1K700E in K562 cells was sufficient to promote the switch of COASY alternative splicing observed in MDS patients, with an increased exon retention especially illustrated by increased COASY-211-beta alternative transcripts (Figures 2 A to 2C). COASY-1 and COASY-2 morpholinos were designed to target 5’ and 3’ of exon 2, respectively, in order to modulate the splicing at the junction of interest, promoting exon 2 skipping (Figure 1). A slightly modified version of COASY-2 oligonucleotide was also designed (named COASY-3) (Figure 1) The effect of these morpholinos was stronger in K562 SF3Bl^K700E knock-in model than in inducible K562 cell lines (Figures 3A-3B and figures 4A- 4B) As expected due to the design, introduction of COASY-1 morpholino in SF3Bl^K700Eled to a decreased accumulation of both COASY-211 beta and XM_011525300.2, at a level similar to the one observed in wild type isogenic cell line. In contrast, COASY-2 or COASY-3 was able to decrease production of COASY-211 beta only, to reach a level similar to wild type isogenic cell line.

In conclusion, we identified morpholinos that could restore COASY normal splicing in K562 SF3Bl^K700E cells. The SSO of the present invention thus would thus be suitable for restoring erythropoiesis in MDS SF3Bl^mut patients.

Discussion;

Acquisition of mutation in the splicing factor SF3B1 is a key event in the establishment and progression of MDS and other cancers. Some progress has been made in dissecting the downstream effects of SF3B1 mutations on dysregulated RNA splicing (17, 42-44). However, determining the mechanism(s) driving ineffective erythropoiesis in SF3B 1 mutant HSPC clones remains a major challenge and contributes to the slow progress toward developing an effective therapy.

Here, we have identified a mis-splicing in the transcript encoding COASY, a core bifunctional enzyme that catalyzes the fourth and fifth sequential steps of the CoA biosynthetic pathway, in SF3B1 mutant patients with MDS-RS. Germline mutations of COASY have been reported in an autosomal recessive neurodegenerative disorder called NBIA. Modeling of the human COASY mutation in yeast revealed defects in mitochondrial function and iron metabolism that resemble the MDS phenotype (45). Using a variety of omics and functional assays, including splicing analysis, translation reporters, metabolomics, silencing in primary human cells, colonies, and differentiation assays, we revealed a critical role of COASY in regulating normal BM erythropoiesis through control of succinyl-coA availability during erythroid differentiation. Silencing of COASY in human primary HSPCs impaired erythroid clonogenic capacities and delayed erythroid differentiation. The peak of COASY transcription during erythroid maturation preceded the accumulation of heme, suggesting that the increase in COASY expression is necessary to supply succinyl-CoA in sufficient quantity for heme synthesis. Although all cells synthesize heme, we observed a mild effect on granulocytic and monocytic colony formation upon COASY knockdown. Although COASY silencing alone is capable of disrupting erythroid differentiation in healthy HSPCs, its role in other hematopoietic lineages, in stem and progenitor cells, and its potential impact on wider cytopenia need to be further investigated.

Alternative splicing of coding and noncoding regions (including UTRs) is a fundamental regulatory mechanism at the crossroads between transcription and translation that governs mRNA stability, localization, or translation (46, 47); it may be noted in passing that >95% of human genes’ pre-mRNA are spliced (48-51). The importance of such a mechanism is well illustrated by the fact that at least 15% of mutations that cause genetic disease affect pre-mRNA splicing (52). In line with these studies, we have demonstrated that missplicing of the 5' UTR of COASY by SF3Bl^mut impedes its translation. The analysis of 42 MDS primary patient samples, including 25 samples harboring mutations in SF3B1, showed a systematic increase in the alternative splice isoform of COASY NM_001042532.4 that encodes COASY , although COASY total gene expression remained unchanged. Analysis of our patient RNA-seq data revealed a profound disruption of heme metabolism and TCA cycle pathways. In vitro modeling of SF3Bl-mutated cells and metabolomic analysis confirmed that COASY’s switch of alternative isoform causes a depletion of CoA and succinyl-CoA. Furthermore, COASY knockdown in HD HSPCs dampened heme synthesis during erythroid differentiation. Our results demonstrate that the partial loss of the COASY in patients with MDS-RS leads to a substantial disruption in the production of heme synthesis in progenitors undergoing erythroid differentiation and thus contributes to the accumulation of undifferentiated erythroblasts in these patients.

The Splice switching oligonucleotides (SSO) of the present invention thus would thus be suitable for restoring erythropoiesis in MDS SF3Bl^mut patients.

REFERENCES: Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

Claims

CLAIMS:

1. A method of restoring erythropoiesis in a patient suffering from a SF3B1 mutant myelodysplastic syndrome comprising administering to the patient a therapeutically effective amount of at least one splice switching antisense oligonucleotide (SSO) capable of correcting COASY mis-splicing.

2. The method of claim 1 wherein the SSO induces the exon skipping of exon 2.

3. The method of claim 1 wherein the SSO of the present invention is designed to target the 5’ or 3’ splice site of exon 2 to alter splicing by blocking the recognition of said splice site by splicing machinery in order to modulate the splicing at the junction of interest and thus inducing the exon 2 skipping.

4. The method of claim 1 wherein the SSO is an antisense RNA or an antisense DNA.

5. The method of claim 1 wherein the SSO is complementary to the nucleic acid sequence as shown in SEQ ID NO:1 GACAAGGGTTCCTGTCCAGTTTCCC, SEQ ID NO:2 CGGCTCCTGTCGGTCAGCACTGAAA or SEQ ID NO:3 GCTCCTGTCGGTCaGCACTGAAACC.

6. The method of claim 1 wherein the SSO targets the 5’ exon 2 splice site and comprises the sequences as set forth in SEQ ID NO:4 (“COASY-1”).

7. The method of claim 1 wherein the SSO targets the 3’ exon 2 splice site and comprises the sequences as set forth in SEQ ID NO:5 (“COASY-2”).

8. The method of claim 1 wherein the SSO targets the 3’ exon 2 splice site and comprises the sequences as set forth in SEQ ID NO:6 (“COASY-2”).

9. The method of claim 1 wherein the SSO is stabilized.

10. The method of claim 1 wherein the SSO is administered in combination with an erythropoiesis stimulating agent (ESA).

11. A splice switching antisense oligonucleotide that comprises the sequence as set forth in SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6. A pharmaceutical composition comprising the splice switching antisense oligonucleotide that comprises the sequence as set forth in SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.