WO2019147059A1 - L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법 - Google Patents

L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법 Download PDF

Info

Publication number
WO2019147059A1
WO2019147059A1 PCT/KR2019/001067 KR2019001067W WO2019147059A1 WO 2019147059 A1 WO2019147059 A1 WO 2019147059A1 KR 2019001067 W KR2019001067 W KR 2019001067W WO 2019147059 A1 WO2019147059 A1 WO 2019147059A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
microorganism
seq
strain
corynebacterium
Prior art date
Application number
PCT/KR2019/001067
Other languages
English (en)
French (fr)
Inventor
손승주
윤병훈
이광우
김선혜
변효정
장진숙
김형준
신용욱
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA3086227A priority Critical patent/CA3086227C/en
Priority to MX2020007037A priority patent/MX2020007037A/es
Priority to JP2020530305A priority patent/JP7090159B2/ja
Priority to PE2020000626A priority patent/PE20210105A1/es
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to CN202110317476.8A priority patent/CN113046288B/zh
Priority to US16/344,205 priority patent/US11180784B2/en
Priority to AU2019212400A priority patent/AU2019212400B8/en
Priority to BR112019019376-6A priority patent/BR112019019376B1/pt
Priority to EP19743512.6A priority patent/EP3567110A4/en
Priority to RU2019113219A priority patent/RU2754781C1/ru
Priority to CN201980000870.XA priority patent/CN110325642B/zh
Publication of WO2019147059A1 publication Critical patent/WO2019147059A1/ko
Priority to ZA2020/03315A priority patent/ZA202003315B/en
Priority to IL275641A priority patent/IL275641A/en
Priority to PH12020551045A priority patent/PH12020551045A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine

Definitions

  • the present application relates to a microorganism belonging to the genus Corynebacterium which produces L-amino acid and a method for producing L-amino acid using the microorganism.
  • L-amino acids are basic building blocks of proteins and are used as important raw materials for pharmaceutical raw materials, food additives, animal feed, nutrients, pesticides, and bactericides.
  • L-lysine is an essential amino acid which is not biosynthesized in vivo and is known to be necessary for promotion of growth, calcium metabolism, promotion of gastric juice secretion, and increase of resistance to diseases.
  • L-lysine is widely used in feeds, medicines, foods and the like.
  • L-valine is one of the essential amino acids and is known to have an antioxidative effect and an effect of directly promoting the protein synthesis of muscle cells. The L-valine is used as a health supplement, a medicine, a food, a feed, a fragrance, a conditioning agent for hair and skin.
  • Corynebacterium is a gram-positive microorganism widely used for the production of L-amino acids and other useful substances.
  • Various studies have been conducted to develop a high-efficiency production microorganism and a fermentation process technology for the production of the amino acid.
  • a specific material-specific approach such as increasing the expression of a gene encoding an enzyme involved in amino acid biosynthesis or removing a gene unnecessary for amino acid biosynthesis in Corynebacterium spp. Korean Patent Registration Nos. 10-0924065 and 1208480).
  • the present inventors have conducted intensive studies to develop a microorganism capable of producing L-amino acid with high efficiency, and as a result, confirmed that the production yield of L-amino acid increases when a specific gene is inactivated, and completed the present application.
  • One object of the present invention is to provide a microorganism of the genus Corynebacterium which produces an L-amino acid in which the activity of the protein consisting of the amino acid sequence of SEQ ID NO: 1 is inactivated.
  • Another object of the present application is to provide a use for increasing the L-amino acid production of the microorganism.
  • Another aspect of the present application provides a method for increasing L-amino acid production, comprising the step of inactivating a protein comprising SEQ ID NO: 1 of the present application in a microorganism of the genus Corynebacterium.
  • the microorganism producing L-amino acid of the present application can produce L-amino acid with high efficiency.
  • the produced L-amino acid can be applied not only to animal feeds or animal feed additives, but also to various products such as human food, food additives, medicines, and the like.
  • the present application provides, as one embodiment, a Corynebacterium sp. Microorganism producing an L-amino acid in which the activity of a protein consisting of the amino acid sequence of SEQ ID NO: 1 is inactivated.
  • L-amino acid in the present application includes all L-amino acids that can be produced by metabolism from various carbon sources.
  • L-lysine, L-arginine and L-histidine nonpolar amino acids such as L-valine, L-leucine, L-glycine, L- isoleucine, L-alanine, L-proline and L- Polar amino acids such as serine, L-threonine, L-cysteine, L-asparagine and L-glutamine, aromatic amino acids such as L-phenylalanine, L- tyrosine and L- tryptophan, acidic amino acids such as L-glutamic acid and L- , Aliphatic amino acids such as L-alanine, L-valine, L-isoleucine and L-serine, and branched chain amino acids such as L-valine, leucine and isoleucine.
  • the L-amino acid may be a basic amino acid, an aliphatic amino acid, or a branched chain amino acid. More specifically, but not limited to, L-lysine or L-valine.
  • the amino acid sequence of SEQ ID NO: 1 of the present application is not limited to amino acids whose productivity is increased when the activity of the protein is inactivated.
  • a protein consisting of the amino acid sequence of SEQ ID NO: 1 in the present application means a protein that is inherently present in a microorganism belonging to the genus Corynebacterium, which is encoded by the NCgl0275 gene. Specifically, 1 < / RTI > of the amino acid sequence of SEQ ID NO: 1.
  • the amino acid sequence of SEQ ID NO: 1 and the polynucleotide sequence of the gene encoding the protein can be obtained from a known database. Examples thereof include, but are not limited to, GenBank of NCBI.
  • the protein may be a protein comprising the amino acid sequence of SEQ ID NO: 1, a protein consisting essentially of the amino acid sequence of SEQ ID NO: 1, or a protein consisting of the amino acid sequence of SEQ ID NO: 1.
  • the protein of the present application may be composed of an amino acid sequence having at least 80% homology with SEQ ID NO: 1, as well as the amino acid sequence described in SEQ ID NO: 1.
  • a protein consisting of an amino acid sequence having 80% or more homology with the amino acid sequence of SEQ ID NO: 1 is at least 80%, more preferably 83% or more, 84% or more, 88% or more , 90% or more, 93% or more, 95% or more, or 97% or more homology or identity.
  • a sequence having homology or identity to the above sequence is substantially an amino acid sequence having the same or a corresponding biological activity as the above protein, even when a partial sequence has an amino acid sequence which is deleted, modified, substituted, conservatively substituted or added And is included in the scope of the present application.
  • &quot protein or polypeptide comprising the amino acid sequence of a specific sequence number " is described in the present application, if the polypeptide has the same or equivalent activity as the polypeptide consisting of the amino acid sequence of the corresponding sequence number, It is obvious that proteins having altered, substituted, conservatively substituted or added amino acid sequences can also be used in the present application. That is, it is obvious that a polypeptide including the amino acid sequence of the corresponding sequence number can also be used in the present application.
  • a probe that can be prepared from a known gene sequence, for example, a polypeptide encoded by a polynucleotide that is hybridized under stringent conditions with a complementary sequence to all or a portion of the base sequence encoding the polypeptide, The protein having the same activity as the protein consisting of the amino acid sequence of SEQ ID NO: 1.
  • the protein consisting of the amino acid sequence of SEQ ID NO: 1 may be a gene comprising the polynucleotide sequence of SEQ ID NO: Lt; / RTI >
  • the polynucleotide sequence of SEQ ID NO: 2 the polynucleotide sequence of SEQ ID NO: 2 or the polynucleotide sequence of SEQ ID NO: 2, but is not limited thereto.
  • polynucleotide sequence of SEQ ID NO: 2 may include not only the polynucleotide sequence of SEQ ID NO: 2, but also a polynucleotide sequence having at least 80% homology with SEQ ID NO: 2.
  • a polynucleotide sequence capable of encoding a protein comprising an amino acid sequence having at least 80% homology with the sequence of SEQ ID NO: 1 is included in the scope of the present application, and the sequence of the polynucleotide of SEQ ID NO: 2 is at least 80 Polynucleotide sequences having a homology or identity of at least 83%, at least 84%, at least 88%, at least 90%, at least 93%, at least 95%, or at least 97%.
  • polynucleotide sequence of SEQ ID NO: 2 may also include a polynucleotide that can be translated into a protein consisting of the amino acid sequence of SEQ ID NO: 1 or a protein having the same homology due to codon degeneracy It is obvious.
  • stringent conditions means conditions that allow specific hybridization between polynucleotides. These conditions are described in the literature (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology , John Wiley & Sons, Inc., New York).
  • Hybridization requires that two polynucleotides have a complementary sequence, although mismatches between bases are possible, depending on the severity of hybridization.
  • adenosine is complementary to thymine and cytosine is complementary to guanine.
  • the present application may also include substantially similar polynucleotide sequences as well as isolated polynucleotide fragments complementary to the entire sequence.
  • polynucleotides having homology can be detected using hybridization conditions including the hybridization step at a Tm value of 55 ° C and using the conditions described above.
  • the Tm value may be 60 ° C, 63 ° C, or 65 ° C, but is not limited thereto and may be suitably adjusted by those skilled in the art according to the purpose.
  • homology means the degree to which a given amino acid sequence or polynucleotide sequence corresponds and may be expressed as a percentage.
  • homology and identity are often used interchangeably.
  • a homologous sequence having the same or similar activity as a given amino acid sequence or polynucleotide sequence is indicated as "% homology ".
  • the activity of a protein consisting of the amino acid sequence of SEQ ID NO: 1 is inactivated means that the expression of the protein is a natural wild-type strain, a parent strain or a protein consisting of the amino acid sequence of SEQ ID NO: Means that the cells are not expressed at all or expressed, but the activity is not present or decreased.
  • the decrease may be caused by a case where the activity of the protein is reduced compared to the activity of a protein originally possessed by the mutation or deletion of the gene encoding the protein, and inhibition of expression or translation of the gene encoding the protein
  • a concept that includes the combination of the case where the degree of activity of the whole protein in the cell is lower than that of the wild-type strain or the strain before the transformation, is also included.
  • the inactivation may be accomplished by application of various methods well known in the art. Examples of such methods include 1) a method of deleting all or part of the gene encoding the protein; 2) modification of the expression control sequence so that the expression of the gene encoding the protein is reduced, 3) modification of the gene sequence encoding the protein so that the activity of the protein is eliminated or attenuated, 4) The introduction of an antisense oligonucleotide (e.g., an antisense RNA) that binds complementarily to a transcript of a cell; 5) A secondary structure is formed by adding a sequence complementary to a sine-dalgalno sequence to the front of the Sine-Dalgarno sequence of the gene encoding the protein, thereby making it impossible to attach the ribosome Way; 6) Reverse transcription engineering (RTE) is a method of adding a promoter transcribed in the opposite direction to the 3 'end of an ORF (open reading frame) of the polynucleotide sequence
  • RTE
  • a method for deleting a part or all of the gene encoding the protein is a method for inserting a polynucleotide encoding an intrinsic target protein in a chromosome through a vector for insertion of a chromosome in a microorganism, into a polynucleotide or marker gene in which some nucleotide sequences have been deleted . ≪ / RTI >
  • a method of deleting polynucleotides by homologous recombination can be used, but the present invention is not limited thereto.
  • a method of deficienting a part or whole of the gene may be carried out by causing a mutation using light or chemicals such as ultraviolet light, and selecting a strain in which the target gene is deleted from the obtained mutant.
  • the gene deletion method includes a method by a genetic recombination technique.
  • a polynucleotide sequence or a vector comprising a polynucleotide sequence homologous to the target gene may be introduced into the microorganism to cause homologous recombination.
  • the injected polynucleotide sequence or vector may include a dominant selectable marker.
  • the present invention is not limited thereto.
  • the method of modifying the expression control sequence can be achieved by application of various methods well known in the art. Examples of such methods include performing polynucleotide sequences by inducing mutations in the expression control sequence in a deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further weaken the activity of the expression control sequence, Polynucleotide < / RTI > sequence.
  • the expression control sequence includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosomal binding site, and a sequence regulating the termination of transcription and translation.
  • the method of modifying the gene sequence may be performed by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, so as to further weaken the activity of the enzyme, Or by replacing the gene sequence with an improved gene sequence or an improved gene sequence so that there is no activity.
  • microorganism producing L-amino acid in the present application may refer to a microorganism having the ability to produce L-amino acid naturally or a microorganism having the ability to produce L-amino acid in the parent strain without the ability to produce L- .
  • the microorganism producing the L-amino acid may be a microorganism in which the activity of the protein consisting of the amino acid sequence of SEQ ID NO: 1 is inactivated.
  • microorganism in which the activity of the protein consisting of the amino acid sequence of SEQ ID NO: 1 is inactivated in the parent strain in which the expression of the gene encoding the enzyme in the L-amino acid biosynthetic pathway is enhanced or the enzyme in the degradation pathway is inactivated.
  • the microorganism producing the above L-amino acid can be produced by applying various known methods.
  • microorganism belonging to the genus Corynebacterium may include microorganisms belonging to the genus Corynebacterium. Specifically, there can be mentioned Corynebacterium glutamicum , Corynebacterium crudilactis , Corynebacterium deserti , Corynebacterium efficiens , , Corynebacterium callunae , Corynebacterium stationis , Corynebacterium singulare , Corynebacterium halotolerans , Corynebacterium halotolerans , Solarium registry Atum (Corynebacterium striatum), Corynebacterium ammoniagenes to Ness (Corynebacterium ammoniagenes), Corynebacterium pole Ruti Solid (Corynebacterium pollutisoli), Corynebacterium already Tansu Cxorynebacterium imitans), Corynebacterium test-
  • Microorganism producing the L-amino acid in which the activity of the protein consisting of the amino acid sequence of SEQ ID NO: 1 of the present application is inactivated may be a microorganism having increased L-amino acid production capacity.
  • the microorganism may be a microorganism having an increased L-amino acid production ability as compared to a non-modified strain.
  • the unmodified strain may be a natural wild-type strain, a parent strain, or a protein consisting of the amino acid sequence of SEQ ID NO: 1.
  • the present application provides, in another aspect, a method for producing a microorganism, comprising culturing the microorganism according to the present application in a medium; And recovering the L-amino acid from the microorganism or culture medium.
  • microorganisms according to the present application are as described above.
  • culturing of microorganisms of the genus Corynebacterium may be carried out by any culture conditions and culture methods known in the art.
  • the term "cultivation" in the present application means cultivation of microorganisms under moderately artificially controlled environmental conditions.
  • a method of culturing L-amino acid using a microorganism producing L-amino acid can be carried out by a method well known in the art. Specifically, the culturing can be carried out continuously in a batch process, an injection batch, or a fed batch or repeated fed batch process, but is not limited thereto.
  • the culture medium used for the culture may be any one without any particular limitation.
  • a culture medium for the Corynebacterium strain is known (see, for example, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington DC, USA, 1981).
  • Sugars which can be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil and coconut oil, palmitic acid, , Fatty acids such as linoleic acid, glycerol, alcohols such as ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto.
  • nitrogen sources examples include peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate.
  • the nitrogen source can also be used individually or as a mixture, but is not limited thereto.
  • the number of people that can be used may include potassium dihydrogenphosphate or dipotassium hydrogenphosphate or a salt containing the corresponding sodium.
  • the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate necessary for growth.
  • essential growth materials such as amino acids and vitamins can be used in addition to the above materials.
  • suitable precursors may be used in the culture medium.
  • the above-mentioned raw materials can be added to the culture in a batch manner or in a continuous manner by an appropriate method. However, the present invention is not limited thereto.
  • the pH of the culture can be adjusted by using a basic compound such as sodium hydroxide, potassium hydroxide, ammonia or an acid compound such as phosphoric acid or sulfuric acid in a suitable manner.
  • bubble formation can be suppressed by using a defoaming agent such as a fatty acid polyglycol ester.
  • An oxygen or oxygen-containing gas e.g., air
  • the present invention is not limited thereto.
  • the temperature of the culture may be usually 20 ° C to 45 ° C, specifically 25 ° C to 40 ° C.
  • the incubation time may be continued until the desired amount of L-amino acid is produced, but may be 10 to 160 hours, but is not limited thereto. .
  • the recovery of the L-amino acid from the culture can be recovered by conventional methods known in the art.
  • methods such as centrifugation, filtration, chromatography and crystallization can be used.
  • the supernatant obtained by removing the biomass by low-speed centrifugation of the culture can be separated through ion exchange chromatography, but is not limited thereto.
  • the recovering step may further include a purification step.
  • Another aspect of the present application provides a use for increasing the L-amino acid production of a Corynebacterium sp.
  • Microorganism in which the activity of a protein consisting of the amino acid sequence of SEQ ID NO: 1 is inactivated.
  • Another aspect of the present application provides a method for increasing L-amino acid production, comprising the step of inactivating a protein comprising SEQ ID NO: 1 of the present application in a microorganism of the genus Corynebacterium.
  • Example 1 Construction of a random mutant library using a transposon
  • a vector library was prepared by the following method.
  • the plasmid obtained using the EZ-Tn5 TM ⁇ R6K ⁇ ori / KAN-2> Tnp Transposome TM kit was transformed into Corynebacterium glutamicum KCCM11016P (Korean Patent No. 10-0159812; the microorganism was disclosed as KFCC10881 52: 541-545, 1999), which was deposited with KCCM 11016P as a parent strain, and transformed into kanamycin (25 mg / L) to obtain about 20,000 colonies.
  • Example 1 Approximately 20,000 colonies obtained in Example 1 were inoculated into 300 ⁇ l of the following selective medium and cultured in 96-deep well plates at 32 ° C and 1000 rpm for about 24 hours.
  • Glucose 10 g 5.5 g ammonium sulfate (ammonium sulfate), MgSO 4 ⁇ 7H 2 O 1.2 g, KH 2 PO 4 0.8 g, K 2 HPO 4 16.4 g, biotin 100 ⁇ g, Thiamine HCl 1 mg, calcium pantothenate 2 mg , Nicotinamide 2 mg (based on 1 liter of distilled water)
  • the ninhydrin method was used to analyze the yield of L-lysine produced in the culture (Moore, S., Stein, WH, Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem. 1948, 176, 367-388).
  • the selected strains of 60 strains were cultured again in the same manner as above, and then the ninhydrin reaction was repeatedly carried out.
  • the top 10 strains having improved L-lysine production ability against the strain Corynebacterium glutamicum KCCM11016P
  • the mutant strains of the species were selected.
  • L-lysine production capacity of 10 mutant strains selected in Example 2 was cultured in the following manner. Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed culture and incubated at 30 DEG C for 20 hours with shaking at 200 rpm. A 250 ml corn-baffle flask containing 24 ml of the production medium was then inoculated with 1 ml of the seed culture and incubated at 32 ° C for 72 hours with shaking at 200 rpm.
  • the composition of the seed medium and the production medium are as follows. L-lysine concentration in the culture was analyzed using HPLC (Waters, 2478) after completion of cultivation, and the concentration of L-lysine production in each mutant strain is shown in Table 1 below.
  • KCCM11016P / mt-3 was finally selected as a strain having significantly improved L-lysine production capacity.
  • Example 3 the mutant strains finally selected from Example 3 were subjected to random insertion of the transposon to identify the defective gene.
  • the genomic DNA of KCCM11016P / mt-3 which has the best productivity of L-lysine, was extracted, cut and ligated to E. coli DH5 ⁇ and plated on LB solid medium containing kanamycin (25 mg / L). A plasmid containing part of an unknown gene was obtained after selection of 20 transformed colonies.
  • the polynucleotide sequence of SEQ ID NO: 2 encodes the amino acid sequence of SEQ ID NO: 1 and contains a regulatory protein whose function has not been clearly defined based on the nucleotide sequence reported by NIH Genbank, Respectively.
  • Primer 1 (SEQ ID NO: 3): ACCTACAACAAAGCTCTCATCAACC
  • Primer 2 (SEQ ID NO: 4): CTACCCTGTGGAACACCTACATCT
  • the gene when the activity of the protein was inactivated, the gene was selected as a candidate gene for the deletion in order to confirm whether or not the L-lysine producing ability was affected.
  • the chromosome of the microorganism producing Corynebacterium genus L- A recombinant plasmid was constructed to delete one gene.
  • primers 3 to 6 as shown in Table 2 below were synthesized.
  • Primers 3 to 6 for preparing fragments for gene deletion primer Base sequence Primer 3 (SEQ ID NO: 5) GAATTCGCGCCCCACTGGCCCTTC Primer 4 (SEQ ID NO: 6) ACCCCGGCGGCGCTGCTCTGGAATCAC Primer 5 (SEQ ID NO: 7) GAGCAGCGCCGCCGGGGTTTAATTAAT Primer 6 (SEQ ID NO: 8) GCAGGTCGACCTGGTTACCGGTCTGAATC
  • primer 3 SEQ ID NO: 5
  • primer 4 SEQ ID NO: 6
  • Table 2 primer 6
  • DNA fragments corresponding to the upper and lower ends of the gene were amplified by 500 bp, respectively.
  • denaturation was carried out at 95 DEG C for 30 seconds; Annealing at 50 ⁇ for 30 seconds; And the polymerization reaction was carried out by repeating 30 minutes at 72 ° C for 1 minute and then performing a polymerization reaction at 72 ° C for 7 minutes.
  • the pDZ vector (Korean Patent Registration No. 10-0924065), which can not be cloned in Corynebacterium glutamicum, and the PCR-amplified fragment were treated with chromosomal restriction enzymes EcoRI and SalI, And then transformed into E. coli DH5 ⁇ and plated on LB solid medium containing kanamycin (25 mg / L).
  • the colonies transformed with the plasmid into which the desired gene was inserted were selected by PCR, and plasmids were obtained using the plasmid extraction method.
  • the plasmid was named pDZ-? NCgl0275.
  • Example 6 Preparation of a strain lacking NCgl0275 gene in Corynebacterium glutamicum KCCM11016P and its ability to produce L-lysine
  • NCgl0275 gene-deficient strain was selected based on KCCM11016P strain, which is a representative L-lysine producing strain of Corynebacterium sp., And its L-lysine producing ability was evaluated.
  • the recombinant plasmid pDZ-? NCgl0275 prepared in Example 5 was transformed into L-lysine producing strain Corynebacterium glutamicum KCCM11016P by homologous recombination on the chromosome (van der Rest et al. Appl Microbiol Biotechnol 52: 541-545, 1999).
  • the second recombinant Corynebacterium glutamicum transformed strain was subjected to PCR using primer 3 and primer 6 to confirm a strain lacking the gene of SEQ ID NO: 2 on the chromosome.
  • the recombinant strain was named Corynebacterium glutamicum KCCM11016P-NCgl0275.
  • the strain was cultured with the parent strain Corynebacterium glutamicum KCCM11016P strain as follows.
  • the mother strain Corynebacterium glutamicum KCCM11016P and the strain Corynebacterium glutamicum KCCM11016P-NCgl0275 prepared in Example 6 were inoculated into a 250 ml corn-baffle flask containing 25 ml of the following seed medium, Lt; 0 > C for 20 hours at 200 rpm. Then, a 250 ml corn-baffle flask containing 24 ml of the production medium was inoculated with 1 ml of the seed culture medium and cultured at 30 DEG C for 72 hours with shaking at 200 rpm.
  • the composition of the seed medium and the production medium are as follows.
  • the L-lysine producing ability was improved by inactivating the protein consisting of the amino acid sequence of SEQ ID NO: 1 in the microorganism of the genus Corynebacterium.
  • strain KCCM11016P-NCgl0275 was named CA01-7512 and was deposited with KCCM 12153P as an international deposit to KCCM (Korean Microorganism Conservation Center), a depository under the Budapest Treaty, on November 7, 2017.
  • Example 7 Production of a strain lacking NCgl0275 gene in Corynebacterium glutamicum KCCM11347P and evaluation of L-lysine production ability
  • L-lysine was also tested in the same manner as in Example 6, in order to confirm whether or not the same strain had the same effect as the strain belonging to other Corynebacterium glutamicum producing L-lysine, Corynebacterium glutamicum KCCM11347P (Korean Patent No. 10-0073610), the microorganism was released as KFCC10750, was re-deposited to the international depository under the Budapest Treaty, and received KCCM11347P), a strain lacking the NCgl0275 gene was prepared, and KCCM11347P-NCgl0275 Respectively.
  • Example 6 it was confirmed that the L-lysine producing ability was improved by inactivating the protein consisting of the amino acid sequence of SEQ ID NO: 1 in the microorganism of the genus Corynebacterium as compared with the unmodified microorganism.
  • Example 8 Preparation of a strain lacking NCgl0275 gene in Corynebacterium glutamicum KCCM10770P and evaluation of L-lysine production ability
  • L-lysine producing strain Corynebacterium glutamicum KCCM10770P was used to produce a strain lacking the NCgl0275 gene and designated as KCCM10770P-NCgl0275.
  • Example 6 Thereafter, the culture was performed in the same manner as in Example 6, and the amount of L-lysine produced was measured using HPLC after completion of the culture.
  • concentrations of L-lysine analyzed are shown in Table 5 below.
  • Example 9 Preparation of a strain lacking NCgl0275 gene in Corynebacterium glutamicum CJ3P and evaluation of L-lysine production ability
  • Corynebacterium glutamicum CJ3P (Binder et al . Genome Biology 2012, 13: R40) was used to construct a strain lacking NCgl0275 gene and named CJ3P-NCgl0275.
  • Example 6 Thereafter, the culture was performed in the same manner as in Example 6, and the amount of L-lysine produced was measured using HPLC after completion of the culture.
  • concentrations of L-lysine analyzed are shown in Table 6 below.
  • Example 10 Production of a strain lacking NCgl0275 gene in Corynebacterium glutamicum KCCM11201P and evaluation of L-valine production ability
  • the present inventors evaluated whether or not the production of valine can be enhanced by the deletion of NCgl0275 gene in Corynebacterium glutamicum having L-valine producing ability.
  • the recombinant plasmid pDZ-? NCgl0275 prepared in Example 5 was transformed by homologous recombination on the chromosome into the L-valine producing strain, Corynebacterium glutamicum KCCM11201P (Korean Patent Registration No. 10-1117022) van der Rest et al., Appl. Microbiol Biotechnol 52: 541-545, 1999). Secondary recombination was then carried out in solid plate medium containing 4% sucrose. The second recombinant Corynebacterium glutamicum transformed strain was subjected to PCR using primer 3 and primer 6 to prepare a strain lacking NCgl0275 gene on the chromosome. The recombinant strain was named Corynebacterium glutamicum KCCM11201P-NCgl0275.
  • the culture solution components were analyzed by the following method. Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and cultured at 30 DEG C for 72 hours with shaking at 200 rpm. Then, the concentration of L-valine was analyzed using HPLC, and the concentration of L-valine analyzed was shown in Table 7 below.
  • glucose 100 g of glucose, 40 g of ammonium sulfate, 2.5 g of soybean protein, 5 g of corn steep solids, 3 g of urea, 1 g of dibasic potassium phosphate, 0.5 g of magnesium sulfate heptahydrate, 100 g of biotin, 1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, calcium carbonate 30 g (based on 1 liter of distilled water)
  • Example 11 Preparation of NCgl0275 gene-deficient strain using Corynebacterium glutamicum CJ7V and evaluation of L-valine production ability
  • genomic DNA of the Corynebacterium glutamicum wild-type strain ATCC 14067 was extracted using a G-spin Total DNA extraction mini kit (Intron, Cat. No. 17045) according to the protocol provided in the kit. PCR was performed using the above genomic DNA as a template. (SEQ ID NO: 9) and primer 8 (SEQ ID NO: 10), primer 9 (SEQ ID NO: 11) and primer 10 (SEQ ID NO: 12) primer pairs to construct a vector introducing the A42V mutation into the ilvN gene Gene fragments (A, B) were obtained.
  • the PCR conditions were: denaturation at 94 ° C for 5 minutes; 30 sec denaturation at 94 ⁇ , 30 sec annealing at 55 ⁇ , and 72 sec 60 sec polymerization were repeated 25 times; The polymerization reaction was carried out at 72 ° C for 7 minutes.
  • fragments A and B were able to obtain a polynucleotide of 537 bp.
  • the above two fragments were subjected to Overlapping PCR using primer 7 (SEQ ID NO: 9) and primer 10 (SEQ ID NO: 12) as a template to obtain a PCR product of 1044 bp (hereinafter referred to as "mutation introduction fragment").
  • the obtained mutated fragment was treated with a restriction enzyme XbaI (New England Biolabs, Beverly, Mass.) And then ligated with the same restriction enzyme-treated pDZ vector and T4 ligase (New England Biolabs, Beverly, MA) .
  • the thus-prepared gene was transformed into Escherichia coli DH5?, which was then screened on LB medium containing kanamycin and DNA was obtained with DNA-spin plasmid DNA purification kit (iNtRON).
  • the vector for the A42V mutation introduction of the ilvN gene was named pDZ-ilvN (A42V).
  • Primers 7 to 10 for producing fragments of the ilvN gene for A42V mutagenesis primer Base sequence Primer 7 (SEQ ID NO: 9) aatttctagaggcagaccctattctatgaagg Primer 8 (SEQ ID NO: 10) agtgtttcggtctttacagacacgagggac Primer 9 (SEQ ID NO: 11) gtccctcgtgtctgtaaagaccgaaacact Primer 10 (SEQ ID NO: 12) aatttctagacgtgggagtgtcactcgcttgggg
  • the recombinant plasmid pDZ-ilvN (A42V) prepared above was transformed into wild type Corynebacterium glutamicum ATCC14067 by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52: 541-545, 1999). Secondary recombination was then carried out in solid plate medium containing 4% sucrose. The second recombinant Corynebacterium glutamicum transformed strain was amplified by PCR using primer 7 and primer 10, and gene mutation was confirmed by gene sequencing. The recombinant strain was named Corynebacterium glutamicum CJ7V.
  • Corynebacterium glutamicum CJ7V having L-valine producing ability was prepared and a strain lacking NCgl0275 gene was prepared in the same manner as in Example 9, and designated as CJ7V-NCgl0275.
  • L-valine concentration was analyzed by the same method as in Example 9, and the concentration of L-valine analyzed is shown in Table 9 below.
  • Example 12 Production of a strain lacking NCgl0275 gene using Corynebacterium glutamicum CJ8V and evaluation of L-valine production ability
  • Corynebacterium glutamicum CJ8V having L-valine production ability was prepared and a strain lacking the NCgl0275 gene was prepared in the same manner as in Example 9, and designated as CJ8V-NCgl0275.
  • the concentration of L-valine was analyzed by the same method as in Example 9 to compare the L-valine production ability of the strain prepared above, and the concentration of L-valine analyzed is shown in Table 10 below.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 Ｌ-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용하여 L-아미노산을 생산하는 방법에 관한 것이다.

Description

L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 L-아미노산의 생산방법
본 출원은 Ｌ-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용하여 L-아미노산을 생산하는 방법에 관한 것이다.
L-아미노산은 단백질의 기본 구성단위로서, 약품 원료와 식품첨가제, 동물 사료, 영양제, 살충제, 살균제 등의 중요 소재로 사용된다. 그 중에서도, L-라이신은 생체 내에서 전혀 생합성되지 않는 필수 아미노산이며, 성장촉진, 칼슘 대사, 위액분비촉진, 병에 대한 저항력 증가에 필요하다고 알려져 있다. 상기 L-라이신은 사료, 의약품, 식품 등에 다양하게 쓰이고 있다. 또한, L-발린도 필수 아미노산 중 하나이며, 항산화 효과 및 근육세포의 단백질 합성작용을 직접적으로 촉진시키는 효과가 있는 것으로 알려져 있다. 상기 L-발린은 건강보조제, 의약품, 식품, 사료, 향료, 모발 및 피부의 컨디셔닝제 등으로 사용되고 있다.　
한편, 코리네박테리움 속 균주(Corynebacterium), 특히 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)은 L-아미노산 및 기타 유용물질 생산에 많이 이용되고 있는 그람 양성의 미생물이다. 상기 아미노산의 생산을 위해 고효율 생산 미생물 및 발효공정기술 개발을 위한 다양한 연구들이 수행되고 있다. 예를 들어, 코리네박테리움 속 균주에서 아미노산 생합성에 관여하는 효소를 암호화하는 유전자의 발현을 증가시키거나 또는 아미노산 생합성에 불필요한 유전자를 제거하는 것과 같은 목적 물질 특이적인 접근 방법이 주로 이용되고 있다(한국 등록특허공보 제10-0924065호, 제1208480호,). 또한, 이러한 방법 이외에 아미노산 생산에 관여하지 않는 유전자를 제거하는 방법, 아미노산 생산에 있어 구체적으로 기능이 알려지지 않은 유전자를 제거하는 방법 또한 활용되고 있다. 그러나, 여전히 효율적으로 고수율로 L-아미노산을 생산할 수 있는 방법에 대한 연구의 필요성이 대두되고 있다.
본 발명자들은 L-아미노산을 고효율로 생산할 수 있는 미생물을 개발하고자 예의 연구한 결과, 특정 유전자를 불활성화 하는 경우 L-아미노산의 생산 수율이 증가한다는 사실을 확인하여 본 출원을 완성하였다.
본 출원의 하나의 목적은 서열번호 1의 아미노산 서열로 구성되는 단백질의 활성이 불활성화된, Ｌ-아미노산을 생산하는 코리네박테리움 속 미생물을 제공하는 것이다.
본 출원의 또 하나의 목적은 상기 미생물을 이용한 Ｌ-아미노산의 생산방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은, 상기 미생물의 L-아미노산 생산 증가를 위한 용도를 제공한다.
본 출원의 또 다른 하나의 양태는, 본 출원의 서열번호 1을 포함하는 단백질을 코리네박테리움 속 미생물에서 불활성화시키는 단계를 포함하는, L-아미노산 생산 증가 방법을 제공한다.
본 출원의 L-아미노산을 생산하는 미생물은 L-아미노산을 높은 효율로 생산할 수 있다. 또한, 제조된 L-아미노산은 동물 사료 또는 동물 사료 첨가제뿐만 아니라 인간의 식품 또는 식품 첨가제, 의약품 등 다양한 제품에 응용될 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
상기와 같은 목적을 달성하기 위하여, 본 출원은 하나의 양태로서 서열번호 1의 아미노산 서열로 구성되는 단백질의 활성이 불활성화된, Ｌ-아미노산을 생산하는 코리네박테리움 속 미생물을 제공한다.
본 출원에서 용어, "L-아미노산"은 미생물이 각종 탄소원으로부터 대사과정을 거쳐 생산될 수 있는 모든 L-아미노산을 포함하며, 구체적으로는. L-라이신, L-아르기닌, L-히스티딘 등의 염기성 아미노산, L-발린, L-류신, L-글리신, L-이소류신, L-알라닌, L-프롤린, L-메티오닌 등의 비극성 아미노산, L-세린, L-트레오닌, L-시스테인, L-아스파라긴, L-글루타민 등의 극성 아미노산, L-페닐알라닌, L-티로신, L-트립토판 등의 방향족 아미노산, L-글루탐산, L-아스파르트산 등의 산성 아미노산, L-알라닌, L-발린, L-이소류신, L-세린 등의 지방족 아미노산, L-발린, 류신, 이소류신 등의 분지쇄아미노산일 수 있다. 보다 구체적으로 본 출원에서 L-아미노산은 염기성 아미노산, 지방족 아미노산, 분지쇄 아미노산일 수 있다. 보다 더욱 구체적으로는 L-라이신(L-lysine) 또는 L-발린(L-valine)일 수 있으나, 이에 제한되지 않는다. 본 출원의 서열번호 1의 아미노산 서열로 구성되는 단백질의 활성이 불활성화된 경우 생산능이 증가하는 아미노산은 제한 없이 포함된다.
본 출원에서 용어, "서열번호 1의 아미노산 서열로 구성되는 단백질"은 NCgl0275 유전자에 의해 암호화되는 코리네박테리움 속 미생물에 내재적으로 존재하는 단백질을 의미하며, 구체적으로 코리네박테리움 속 미생물에 내재적으로 존재하는 서열번호 1의 아미노산 서열로 구성되는 조절 단백질(regulatory protein)을 의미한다. 상기 서열번호 1의 아미노산 서열 및 상기 단백질을 암호화하는 유전자의 폴리뉴클레오티드 서열은 공지의 데이터 베이스에서 얻을 수 있으며, 그 예로 NCBI의 GenBank 등이 있으나, 이에 제한되지 않는다. 또한, 상기 단백질은 서열번호 1의 아미노산 서열을 포함하는 단백질, 서열번호 1의 아미노산 서열로 필수적으로 구성되는 단백질, 서열번호 1의 아미노산 서열로 이루어지는 단백질일 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 상기 단백질은 상기 서열번호 1로 기재한 아미노산 서열뿐만 아니라, 서열번호 1과 적어도 80% 상동성을 갖는 아미노산 서열로 구성될 수 있다. 상기 서열번호 1의 아미노산 서열과 80% 이상의 상동성을 갖는 아미노산서열로 구성되는 단백질은 상기 서열번호 1의 아미노산 서열과 적어도 80% 이상, 구체적으로는, 83% 이상, 84% 이상, 88% 이상, 90% 이상, 93% 이상, 95% 이상, 또는 97% 이상의 상동성 또는 동일성을 가지는 아미노산 서열로 구성되는 단백질을 포함할 수 있다. 상기 서열과 상동성 또는 동일성을 갖는 서열로서 실질적으로 상기 단백질과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 경우도 역시 본 출원의 범주에 포함됨은 자명하다.
본 출원에서 '특정 서열번호로 기재된 아미노산 서열을 구성되는 단백질 또는 폴리펩타이드'라고 기재되어 있더라도, 해당 서열번호의 아미노산 서열로 이루어진 폴리펩타이드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원에서 사용될 수 있음은 자명하다. 즉, 해당 서열번호의 아미노산 서열을 포함하는 폴리펩타이드도 본 출원에서 사용될 수 있음은 자명하다.
더불어, 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 폴리펩티드를 암호화하는 염기서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화되는 폴리뉴클레오티드에 의해 암호화되는 폴리펩티드로서, 상기 서열번호 1의 아미노산 서열로 구성되는 단백질과 동일한 활성을 가지는 폴리펩티드도 제한 없이 포함될 수 있다.예를 들어, 상기 서열번호 1의 아미노산 서열로 구성되는 단백질은 서열번호 2의 폴리뉴클레오티드 서열을 포함하는 유전자에 의해 암호화되는 것일 수 있다. 또한, 서열번호 2의 폴리뉴클레오티드 서열을 포함하거나, 서열번호 2의 폴리뉴클레오티드 서열로 필수적으로 구성되거나, 서열번호 2의 폴리뉴클레오티드 서열로 이루어지는 유전자에 의해 암호화되는 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 서열번호 2의 폴리뉴클레오티드 서열은, 서열번호 2의 폴리뉴클레오티드 서열뿐만 아니라, 서열번호 2와 적어도 80% 상동성을 갖는 폴리뉴클레오티드 서열도 포함하는 것일 수 있다.
구체적으로, 상기 서열번호 1과 적어도 80% 상동성을 갖는 아미노산 서열을 포함하는 단백질을 암호화할 수 있는 폴리뉴클레오티드 서열이면 본 출원의 범주에 포함되며, 상기 서열번호 2의 폴리뉴클레오티드 서열에 대하여 적어도 80% 이상, 구체적으로는 83% 이상, 84% 이상, 88% 이상, 90% 이상, 93% 이상, 95% 이상, 또는 97% 이상의 상동성 또는 동일성을 가지는 폴리뉴클레오티드 서열도 포함하는 것일 수 있다.
또한, 상기 서열번호 2의 폴리뉴클레오티드 서열은, 코돈 축퇴성(codon degeneracy)에 의해 상기 서열번호 1의 아미노산 서열로 이루어진 단백질 또는 이와 상동성을 가지는 단백질로 번역될 수 있는 폴리뉴클레오티드 역시 포함될 수 있음은 자명하다. 또한 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, 서열번호 1의 아미노산 서열로 이루어진 단백질의 활성을 가지는 단백질을 암호화하는 서열이라면 제한 없이 포함될 수 있다.
상기 "엄격한 조건"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)에 구체적으로 기재되어 있다. 예를 들어, 상동성이 높은 유전자끼리, 40% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화의 세척 조건인 60℃, 1×SSC, 0.1% SDS, 구체적으로는 60℃, 0.1×SSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1×SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다. 혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 폴리뉴클레오티드가 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 폴리뉴클레오티드 서열뿐만 아니라 전체 서열에 상보적인 단리된 폴리뉴클레오티드 단편을 포함할 수 있다.
구체적으로, 상동성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
본 출원에서 용어 "상동성" 또는 “동일성”은 주어진 아미노산 서열 또는 폴리뉴클레오티드 서열과 일치하는 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다. 본 명세서에서, 주어진 아미노산 서열 또는 폴리뉴클레오티드 서열과 동일하거나 유사한 활성을 갖는 그의 상동성 서열이 "% 상동성"으로 표시된다.
상기 아미노산 또는 폴리뉴클레오티드 서열에 대한 상동성 또는 동일성은 예를 들면, 문헌에 의한 알고리즘 BLAST[참조: Karlin 및 Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873(1993)]나 Pearson에 의한 FASTA(참조: Methods Enzymol., 183, 63, 1990)을 사용하여 결정할 수 있다. 이러한 알고리즘 BLAST에 기초하여, BLASTN이나 BLASTX라고 불리는 프로그램이 개발되어 있다(참조: http://www.ncbi.nlm.nih.gov).
또한, 임의의 아미노산 또는 폴리뉴클레오티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다
본 출원에서 용어 "서열번호 1의 아미노산 서열로 구성되는 단백질의 활성이 불활성화된"은 상기 단백질의 발현이 천연의 야생형 균주, 모균주 또는 서열번호 1의 아미노산 서열로 구성되는 단백질이 비변형된 균주에 비하여 전혀 발현이 되지 않거나 또는 발현이 되더라도 그 활성이 없거나 감소된 것을 의미한다. 이때, 상기 감소는 상기 단백질을 암호화하는 유전자의 변이, 결손 등으로 단백질의 활성이 본래 미생물이 가지고 있는 단백질의 활성에 비해 감소한 경우와, 이를 암호화하는 유전자의 발현 저해 또는 번역(translation) 저해 등으로 세포 내에서 전체적인 단백질의 활성 정도가 천연형 균주 또는 변형전의 균주에 비하여 낮은 경우, 이들의 조합 역시 포함하는 개념이다.
본 출원에 있어서, 상기 불활성화는 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다. 상기 방법의 예로, 1) 상기 단백질을 암호화하는 상기 유전자의 전체 또는 일부를 결실시키는 방법; 2) 상기 단백질을 암호화하는 상기 유전자의 발현이 감소하도록 발현 조절 서열의 변형, 3) 상기 단백질의 활성이 제거 또는 약화되도록 단백질을 암호화하는 상기 유전자 서열의 변형, 4) 상기 단백질을 암호화하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입; 5) 상기 단백질을 암호화하는 상기 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열을 부가하여 2차 구조물을 형성시켜 리보솜(ribosome)의 부착을 불가능하게 만드는 방법; 6) 상기 단백질을 암호화하는 상기 유전자의 폴리뉴클레오티드 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터를 부가하는 방법(Reverse transcription engineering, RTE) 등이 있으며, 이들의 조합으로도 달성할 수 있으나, 이에, 특별히 제한되는 것은 아니다.
구체적으로, 상기 단백질을 암호화하는 상기 유전자의 일부 또는 전체를 결실하는 방법은, 미생물 내 염색체 삽입용 벡터를 통해 염색체 내 내재적 목적 단백질을 암호화하는 폴리뉴클레오티드를 일부 뉴클레오티드 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체함으로써 수행될 수 있다. 이러한 폴리뉴클레오티드의 일부 또는 전체를 결실하는 방법의 일례로 상동 재조합에 의하여 폴리뉴클레오티드를 결실시키는 방법을 사용할 수 있으나, 이에 한정되지는 않는다. 또 다른 예로, 상기 유전자의 일부 또는 전체를 결손시키는 방법은 자외선과 같은 빛 또는 화학물질을 이용하여 돌연변이를 유발하고, 얻어진 돌연변이체로부터 목적 유전자가 결손된 균주를 선별하여 수행될 수 있다.
상기 유전자 결손 방법에는 유전자 재조합 기술(Genetic recombination technique)에 의한 방법이 포함된다. 예를 들면, 목적 유전자와 상동성이 있는 폴리뉴클레오티드 서열을 포함하는 폴리뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 이루어질 수 있다. 또한, 상기 주입되는 폴리뉴클레오티드 서열 또는 벡터에는 우성 선별 마커를 포함할 수 있다. 그러나 이에 제한되는 것은 아니다.
또한, 상기 발현 조절 서열을 변형하는 방법은 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다. 상기 방법의 예로, 상기 발현 조절 서열의 활성을 더욱 약화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖는 폴리뉴클레오티드 서열로 교체함으로써 수행할 수 있다. 상기 발현 조절서열에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 암호화하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 유전자 서열을 변형하는 방법은 상기 효소의 활성을 더욱 약화하도록 유전자 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖도록 개량된 유전자 서열 또는 활성이 없도록 개량된 유전자 서열로 교체함으로써 수행할 수 있으나, 이에 한정되는 것은 아니다.
본 출원에서 용어 "L-아미노산을 생산하는 미생물"은 자연적으로 L-아미노산 생산능을 가지고 있는 미생물 또는 L-아미노산의 생산능이 없는 모균주에 L-아미노산의 생산능이 부여된 미생물을 의미할 수 있다. 예를 들어, 상기 L-아미노산을 생산하는 미생물은 서열번호 1의 아미노산 서열로 구성되는 단백질의 활성이 불활성화된 미생물일 수 있다. 또는 이에 추가로 L-아미노산 생합성경로의 효소를 암호화하는 유전자의 발현을 증진시키거나 분해경로의 효소를 불활성화시킨 미생물일 수 있다. 또는 L-아미노산 생합성경로의 효소를 암호화하는 유전자의 발현을 증진시키거나 분해경로의 효소를 불활성화시킨 모균주에 서열번호 1의 아미노산 서열로 구성되는 단백질의 활성이 불활성화된 미생물일 수 있다. 상기의 L-아미노산을 생산하는 미생물은 이는 공지의 다양한 방법을 적용하여 제조될 수 있다.
본 출원에서 "코리네박테리움 속 미생물"은 모든 코리네박테리움 속 미생물을 포함할 수 있다. 구체적으로, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스Cxorynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있고, 더욱 구체적으로 코리네박테리움 글루타미쿰일 수 있다.
본 출원의 서열번호 1의 아미노산 서열로 구성되는 단백질의 활성이 불활성화된, L-아미노산을 생산하는 코리네박테리움속 미생물은 L-아미노산 생산능이 증가된 미생물일 수 있다. 구체적으로, 상기 미생물은 비변형된 균주에 비하여 L-아미노산 생산능이 증가된 미생물일 수 있다. 상기 비변형된 균주는 천연의 야생형 균주, 모균주 또는 서열번호 1의 아미노산 서열로 구성되는 단백질일 수 있다.본 출원은 다른 하나의 양태로서, 본 출원에 따른 상기 미생물을 배지에서 배양하는 단계; 및 상기 미생물 또는 배지로부터 L-아미노산을 회수하는 단계를 포함하는, L-아미노산 생산방법을 제공한다.
본 출원에 따른 상기 미생물은 앞서 설명한 바와 같다.
본 출원의 방법에 있어서, 코리네박테리움 속 미생물의 배양은 당업계에 알려진 임의의 배양 조건 및 배양 방법이 사용될 수 있다.
본 출원에서 용어 "배양"은 미생물을 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다. 본 출원에서 L-아미노산을 생산하는 미생물을 이용하여 L-아미노산을 배양하는 방법은 당업계에 널리 알려져 있는 방법을 이용하여 수행할 수 있다. 구체적으로, 상기 배양은 배치 공정, 주입 배치 또는 반복 주입 배치 공정(fed batch or repeated fed batch process)에서 연속식으로 배양할 수 있으나, 이에 제한되는 것은 아니다. 배양에 사용되는 배지는 특별한 제한 없이 어느 것이나 사용할 수 있으며, 이의 예로, 코리네박테리움 균주에 대한 배양 배지는 공지되어 있다(예를 들면, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).
배지 중에서 사용될 수 있는 당원으로는 포도당, 사카로즈, 유당, 과당, 말토즈, 전분, 셀룰로즈와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있으며, 이에 한정되는 것은 아니다.
사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함될 수 있다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있으며, 이에 한정되는 것은 아니다.
사용될 수 있는 인원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨을 함유하는 염이 포함될 수 있다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있다. 또한, 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장 물질이 사용될 수 있다. 또한, 배양 배지에 적절한 전구체들이 사용될 수 있다. 그러나 이에 제한되는 것은 아니다. 상기된 원료들은 배양과정에서 배양물에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있다. 그러나 이에 제한되는 것은 아니다.
상기 미생물의 배양 중 수산화나트륨, 수산화칼륨, 암모니아와 같은 기초 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다. 또한, 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 호기 상태를 유지하기 위해 배양물 내로 산소 또는 산소-함유 기체(예, 공기)를 주입할 수 있다. 그러나 이에 제한되는 것은 아니다.
배양물의 온도는 보통 20℃ 내지 45℃, 구체적으로는 25℃ 내지 40℃일 수 있다. 배양 시간은 원하는 L-아미노산의 생성량이 얻어질 때까지 계속할 수 있으나, 구체적으로는, 10 내지 160시간일 수 있으나, 이에 제한되는 것은 아니다. .
배양물로부터의 L-아미노산의 회수는 당업계에 알려진 통상적인 방법에 의하여 회수될 수 있다. 이러한 회수방법에는, 원심분리, 여과, 크로마토그래피 및 결정화 등의 방법이 이용될 수 있다. 예를 들면, 배양물을 저속 원심분리하여 바이오매스를 제거하고 얻어진 상등액을, 이온교환 크로마토그래피를 통하여 분리할 수 있으나, 이에 한정되는 것은 아니다.
상기 회수 단계는 정제 공정을 추가로 포함할 수 있다.
본 출원의 또 다른 하나의 양태는, 서열번호 1의 아미노산 서열로 구성되는 단백질의 활성이 불활성화된, 코리네박테리움속 미생물의 L-아미노산 생산 증가를 위한 용도를 제공한다.
본 출원의 또 다른 하나의 양태는, 본 출원의 서열번호 1을 포함하는 단백질을 코리네박테리움 속 미생물에서 불활성화시키는 단계를 포함하는, L-아미노산 생산 증가 방법을 제공한다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로, 본 출원의 범위가 이들 실시예에 의해 제한되는 것은 아니다.
실시예 1: 트랜스포존을 이용한 무작위적 돌연변이 라이브러리 제작
라이신 생산능이 증가된 균주를 얻기 위하여, 하기의 방법으로 벡터 라이브러리를 제작하였다.
먼저 EZ-Tn5™ <R6Kγori/KAN-2>Tnp Transposome™ 키트(Epicentre)를 사용하여 얻은 플라스미드를 코리네박테리움 글루타미쿰 KCCM11016P(대한민국 등록특허번호 제10-0159812호; 상기 미생물은 KFCC10881로 공개되었다가, 부다페스트 조약하인 국제기탁기관에 재기탁되어 KCCM11016P로 기탁번호를 부여 받음)를 모균주로 하여 전기펄스법(Appl. Microbiol. Biothcenol. 52:541-545, 1999)으로 형질전환하고, 카나마이신(25 ㎎/ℓ)이 포함된 복합평판배지에 도말하여 약 20,000 개의 콜로니를 확보하였다.
<복합평판배지 (pH 7.0)>
포도당 10 g, 펩톤 10 g, 쇠고기 추출물 5 g, 효모 추출물 5 g, 뇌심장 침출액(Brain Heart Infusion) 18.5 g, NaCl 2.5 g, 요소 2 g, 소르비톨 91 g, 한천 20 g (증류수 1 리터 기준)
실시예 2: 트랜스포존을 이용한 무작위적 돌연변이 라이브러리 스크리닝
상기 실시예 1에서 확보된 약 20,000개의 콜로니를 각각 300 ㎕의 하기의 선별배지에 접종하여 96 딥 웰 플레이트(96-deep well plate) 에서 32℃, 1000 rpm 으로 약 24시간 동안 배양하였다.
<선별배지 (pH 8.0)>
포도당 10 g, 5.5 g 암모늄 설페이트(ammonium sulfate), MgSO4·7H2O 1.2 g, KH2PO4 0.8 g, K2HPO4 16.4 g, 바이오틴 100 ㎍, 티아민 HCl 1 ㎎, 칼슘-판토텐산 2 ㎎, 니코틴아미드 2 ㎎ (증류수 1 리터 기준)
배양액에 생산된 L-라이신의 생산량을 분석하기 위하여 닌하이드린 방법을 이용하였다(Moore, S., Stein, W.H., Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem.1948, 176, 367-388).
배양이 완료된 후 배양 상층액 10 ㎕와 닌하이드린 반응용액 190 ㎕를 65℃에서 30분간 반응시킨 후, 파장 570nm에서 분광 광도계(spectrophotometer)로 흡광도를 측정하고, 대조군인 코리네박테리움 글루타미쿰 KCCM11016P 균주와 비교하여 높은 흡광도를 보이는 약 60여 종의 콜로니를 선별하였다. 그 외 콜로니들은 대조군로 이용된 코리네박테리움 글루타미쿰 KCCM11016P 균주와 유사하거나 감소한 흡광도를 보임을 확인하였다.
상기 선별된 60여 종의 균주들을 상기와 동일한 방법으로 다시 배양한 후 닌하이드린 반응을 반복 수행하여, 결과적으로 모균주인 코리네박테리움 글루타미쿰 KCCM11016P 균주 대비 L-라이신 생산능이 향상된 상위 10종의 돌연변이주를 선별하였다.
실시예 3: 선별된 무작위적 돌연변이주들의 L-라이신 생산능 분석
상기 실시예 2에서 선발한 10종의 돌연변이주들을 대상으로 L-라이신 생산능이 재현성 있게 증가된 균주들을 최종 선별하기 위하여, 다음과 같은 방법으로 배양을 실시하였다. 종 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 32℃에서 72 시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종 배지와 생산 배지의 조성은 각각 하기와 같다. 배양이 완료된 후 HPLC(Waters 社, 2478)를 이용하여 배양액 내 L-라이신 농도를 분석하였고, 각 돌연변이주들의 L-라이신 생산 농도를 하기 표 1에 나타내었다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1 ㎎, 칼슘-판토텐산 2 ㎎, 니코틴아미드 2 ㎎ (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1 ㎎, 칼슘-판토텐산 2 ㎎, 니코틴아미드 3 ㎎, CaCO3 30 g (증류수 1리터 기준)
선별된 무작위적 돌연변이주 10종의 L-라이신 생산 농도
균주 L-라이신 (g/L)
배치 1 배치 2 배치 3 평균
대조군 KCCM11016P 41.1 40.9 41.5 41.2
1 KCCM11016P/mt-1 40.2 39.9 40.5 40.2
2 KCCM11016P/mt-2 41.8 41.5 41.7 41.7
3 KCCM11016P/mt-3 47.1 46.8 47 47.0
4 KCCM11016P/mt-4 42.3 42.1 42.6 42.3
5 KCCM11016P/mt-5 42.7 42.7 42.9 42.8
6 KCCM11016P/mt-6 41.0 40.7 41.2 41.0
7 KCCM11016P/mt-7 41.7 41.2 41.8 41.6
8 KCCM11016P/mt-8 42.5 42.9 42.9 42.8
9 KCCM11016P/mt-9 43.3 43.5 43.8 43.5
10 KCCM11016P/mt-10 42.0 42.3 42.5 42.3
상기 선별된 10종의 돌연변이주들 중 L-라이신 생산능이 의미있게 향상된 균주로서 KCCM11016P/mt-3을 최종 선별하였다.
실시예 4: 최종 선별주들에서의 L-라이신 생산능 증가 원인 규명
본 실시예에서는 상기 실시예 3으로부터 최종 선별된 돌연변이주를 대상으로 트랜스포존의 무작위적인 삽입에 의해 결손된 유전자를 동정하고자 하였다.
L-라이신의 생산능이 가장 우수한 KCCM11016P/mt-3의 게놈 DNA를 추출하여 절단한 후 연결하여 대장균 DH5α에 형질전환하고, 카나마이신(25 ㎎/ℓ)이 포함된 LB 고체배지에 도말하였다. 형질전환된 콜로니 20종을 선별한 후, 미지의 유전자 일부가 포함된 플라스미드를 획득하였고, EZ-Tn5™<R6Kγori/KAN-2>Tnp Transposome™ 키트의 프라이머 1(서열번호 3) 및 프라이머 2(서열번호 4)를 사용하여 염기서열을 분석하였다.
그 결과, 서열번호 2의 폴리뉴클레오티드 서열이 결손되어 있음을 확인하였다. 상기 서열번호 2의 폴리뉴클레오티드 서열은 서열번호 1의 아미노산 서열을 암호화하고, 미국 국립보건원의 유전자은행(NIH Genbank)에 보고된 염기서열에 근거하여 기능이 명확하게 규명되지 않은 조절 단백질(Regulatory protein)임을 확인하였다.
프라이머 1(서열번호 3): ACCTACAACAAAGCTCTCATCAACC
프라이머 2(서열번호 4): CTACCCTGTGGAACACCTACATCT
이에 따라, 상기 단백질의 활성이 불활성화되는 경우, L-라이신 생산능에 영향이 있는지 확인하기 위하여, 상기 유전자를 결손 후보 유전자로 선별하였다.
실시예 5: 유전자 결손을 위한 재조합 벡터 제작
본 실시예에서는 서열번호 1의 아미노산 서열로 구성되는 단백질의 불활성화와 L-라이신 생산의 영향을 확인하기 위해서, 코리네박테리움속 L-라이신을 생산하는 미생물의 염색체 상에서 상기 실시예 4에서 선별한 유전자를 결손시키기 위한 재조합 플라스미드를 제작하였다. 이를 위하여, 하기 표 2에 나타낸 바와 같은 프라이머 3 내지 6을 합성하였다.
유전자의 결손을 위한 단편을 제작하기 위한 프라이머 3 내지 6
프라이머 염기 서열
프라이머 3 (서열번호 5) GAATTCGCGCCCCACTGGCCCTTC
프라이머 4 (서열번호 6) ACCCCGGCGGCGCTGCTCTGGAATCAC
프라이머 5 (서열번호 7) GAGCAGCGCCGCCGGGGTTTAATTAAT
프라이머 6 (서열번호 8) GCAGGTCGACCTGGTTACCGGTCTGAATC
구체적으로, NCgl0275 유전자 ORF 부위(서열번호 2)를 결손하기 위하여, 5' 말단에 EcoRI과 3' 말단에 SalI 제한효소 부위를 가지도록 프라이머 3(서열번호 5), 프라이머 4(서열번호 6), 프라이머 5(서열번호 7), 프라이머 6(서열번호 8)(표 2)를 합성하고 야생형 코리네박테리움 글루타미쿰 ATCC 13032의 게노믹 DNA를 주형으로 하여 PCR(Sambrook et al, Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratories, 1989)을 수행하였다.
그 결과, 상기 유전자 상단 및 하단에 해당하는 DNA 단편들이 각각 500bp씩 증폭됨을 확인하였다. 이때, PCR 조건으로서 변성은 95℃에서 30초; 어닐링은 50℃에서 30초; 및 중합반응은 72℃에서 1분을 30회 반복한 후, 72℃에서 7분간 중합반응을 시켜서 수행하였다. 코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDZ 벡터(대한민국 특허 등록번호 제10-0924065호)와 PCR로 증폭된 상기 단편을 염색체 도입용 제한효소 EcoRI과 SalI으로 처리한 뒤, DNA 접합 효소를 이용하여 연결한 후, 대장균 DH5α에 형질전환하고 카나마이신(25 ㎎/ℓ)이 포함된 LB 고체배지에 도말하였다.
PCR을 통해 상기 목적한 유전자가 삽입된 플라스미드로 형질전환된 콜로니를 선별한 후, 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 이 플라스미드를 pDZ-△NCgl0275라 명명하였다.
실시예 6: 코리네박테리움 글루타미쿰 KCCM11016P에서 NCgl0275 유전자가 결손된 균주의 제작 및 이의 L-라이신 생산능 평가
대표적인 L-라이신 생산 코리네박테리움 속 균주인 KCCM11016P 균주를 기반으로 상기에서 선별한 NCgl0275 유전자가 결손된 균주를 제작하였고, 이의 L-라이신 생산능을 평가하고자 하였다.
구체적으로, 상기 실시예 5에서 제작된 재조합 플라스미드 pDZ-△NCgl0275를 염색체 상에서의 상동 재조합에 의해 L-라이신 생산균주인 코리네박테리움 글루타미쿰 KCCM11016P에 형질전환시켰다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).
그 후, 4%의 수크로오스를 포함하는 고체평판배지에서 2차 재조합을 수행하였다. 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질전환주를 대상으로 프라이머 3과 프라이머 6을 이용하여 PCR을 통하여 염색체상에서 서열번호 2의 유전자가 결손된 균주를 확인하였다. 상기 재조합 균주를 코리네박테리움 글루타미쿰 KCCM11016P-NCgl0275라 명명하였다.
상기 제작된 코리네박테리움 글루타미쿰 KCCM11016P-NCgl0275 균주의 L-라이신 생산능을 분석하기 위해 모균주인 코리네박테리움 글루타미쿰 KCCM11016P 균주와 함께 아래와 같은 방법으로 배양하였다.
하기의 종배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 모균주인 코리네박테리움 글루타미쿰 KCCM11016P와 실시예 6에서 제작된 균주 코리네박테리움 글루타미쿰 KCCM11016P-NCgl0275를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종배양액을 접종하고 30℃에서 72시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종 배지와 생산 배지의 조성은 각각 하기와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1 ㎎, 칼슘-판토텐산 2 ㎎, 니코틴아미드 2 ㎎ (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1 ㎎, 칼슘-판토텐산 2 ㎎, 니코틴아미드 3 ㎎, CaCO3 30 g (증류수 1리터 기준)
배양 종료 후 HPLC를 이용하여 L-라이신의 생산량을 측정하였고, 분석한 L-라이신의 농도를 하기 표 3에 나타내었다.
KCCM11016P 및 KCCM11016P-NCgl0275의 L-라이신 생산능 분석
균주 L-라이신 (g/L)
배치 1 배치 2 배치 3 평균
대조군 KCCM1106P 40.3 40.0 40.4 40.2
실험군 KCCM1106P-NCgl0275 46.8 47.3 47.1 47.1
상기 결과와 같이, L-라이신 생산균주인 코리네박테리움 글루타미쿰 KCCM11016P으로부터 NCgl0275를 결손시키는 경우, 모균주 대비 L-라이신 생산능이 평균 17.2% 증가함을 확인하였다.
따라서, 코리네박테리움 속 미생물에서 서열번호 1의 아미노산 서열로 구성되는 단백질을 불활성화함으로써 L-라이신 생산능이 향상됨을 확인하였다.
또한, 상기 균주 KCCM11016P-NCgl0275를 CA01-7512로 명명하고 2017년 11월 7일자로 부다페스트 조약 하의 기탁기관인 한국미생물보존센터(KCCM)에 국제 기탁하여 KCCM12153P로 기탁번호를 부여받았다.
실시예 7: 코리네박테리움 글루타미쿰 KCCM11347P에서 NCgl0275 유전자가 결손된 균주의 제작 및 L-라이신 생산능 평가
L-라이신을 생산하는 다른 코리네박테리움 글루타미쿰에 속하는 균주들에서도 상기와 동일한 효과가 있는지 확인하기 위하여, 상기 실시예 6과 같은 방법으로 L-라이신 생산균주인 코리네박테리움 글루타미쿰 KCCM11347P(한국 등록특허 제10-0073610호. 상기 미생물은 KFCC10750으로 공개되었다가 부다페스트 조약 하의 국제기탁기관에 재기탁되어, KCCM11347P를 부여받았음)를 대상으로 NCgl0275 유전자가 결손된 균주를 제작하고 KCCM11347P-NCgl0275로 명명하였다.
이후, 상기 실시예 6과 동일한 방법으로 배양하고, 배양 종료 후 HPLC를 이용하여 L-라이신의 생산량을 측정하였고, 분석한 L-라이신의 농도를 하기 표 4에 나타내었다.
KCCM11347P 및 KCCM11347P-NCgl0275의 L-라이신 생산능 분석
균주 L-라이신 (g/L)
배치 1 배치 2 배치 3 평균
대조군 KCCM11347P 38.8 39.1 38.7 38.9
실험군 KCCM11347P-NCgl0275 44.1 44.4 44.2 44.2
상기 결과와 같이, L-라이신 생산균주인 코리네박테리움 글루타미쿰 KCCM11347P를 기반으로 NCgl0275 유전자를 결손시키는 경우, L-라이신 생산능이 평균 13.6% 증가함을 확인하였다.
따라서, 실시예 6의 결과와 마찬가지로, 코리네박테리움 속 미생물에서 서열번호 1의 아미노산 서열로 구성되는 단백질을 불활성화함으로써 비변형 미생물에 비해 L-라이신 생산능이 향상됨을 확인하였다.
실시예 8: 코리네박테리움 글루타미쿰 KCCM10770P에서 NCgl0275 유전자가 결손된 균주의 제작 및 L-라이신 생산능 평가
L-라이신을 생산하는 다른 코리네박테리움 글루타미쿰에 속하는 균주들에서도 상기와 동일한 효과가 있는지를 확인하기 위하여, 상기 실시예 6과 같은 방법으로 L-라이신 생산균주인 코리네박테리움 글루타미쿰 KCCM10770P(한국등록특허 제 10-0924065호)를 대상으로 NCgl0275 유전자가 결손된 균주를 제작하고 KCCM10770P-NCgl0275로 명명하였다.
이후, 상기 실시예 6과 동일한 방법으로 배양하고, 배양 종료 후 HPLC를 이용하여 L-라이신의 생산량을 측정하였고, 분석한 L-라이신의 농도를 하기 표 5에 나타내었다.
KCCM10770P 및 KCCM10770P-NCgl0275의 L-라이신 생산능 분석
균주 L-라이신 (g/L)
배치 1 배치 2 배치 3 평균
대조군 KCCM10770P 45.1 44.9 45.5 45.2
실험군 KCCM10770P-NCgl0275 51.5 52.0 51.9 51.8
상기 결과와 같이, L-라이신 생산균주인 코리네박테리움 글루타미쿰 KCCM10770P를 기반으로 NCgl0275 유전자를 결손시키는 경우, L-라이신 생산능이 평균 14.6% 증가함을 확인하였다.
따라서, 실시예 7의 결과와 마찬가지로, L-라이신 생산능을 갖는 다양한 코리네박테리움 속 미생물에서 서열번호 1의 아미노산 서열로 구성되는 단백질을 불활성화함으로써 이의 모균주에 비해 L-라이신 생산능을 향상시킬 수 있음을 확인하였다.
실시예 9: 코리네박테리움 글루타미쿰 CJ3P에서 NCgl0275 유전자가 결손된 균주의 제작 및 L-라이신 생산능 평가
L-라이신을 생산하는 다른 코리네박테리움 글루타미쿰에 속하는 균주들에서도 상기와 동일한 효과가 있는지를 확인하기 위하여, 상기 실시예 6과 같은 방법으로 코리네박테리움 글루타미쿰 CJ3P(Binder et al. Genome Biology 2012, 13:R40)를 대상으로 NCgl0275 유전자가 결손된 균주를 제작하고 CJ3P-NCgl0275로 명명하였다.
이후, 상기 실시예 6과 동일한 방법으로 배양하고, 배양 종료 후 HPLC를 이용하여 L-라이신의 생산량을 측정하였고, 분석한 L-라이신의 농도를 하기 표 6에 나타내었다.
CJ3P 및 CJ3P-Ncgl0275의 L-라이신 생산능 분석
균주 L-라이신 (g/L)
배치 1 배치 2 배치 3 평균
대조군 CJ3P 7.6 7.4 7.9 7.6
실험군 CJ3P-NCgl0275 8.7 8.9 8.7 8.8
상기 결과와 같이, L-라이신 생산균주인 코리네박테리움 글루타미쿰 CJ3P를 대상으로 NCgl0275 유전자를 결손시키는 경우, L-라이신 생산능이 평균 15.8% 증가함을 확인하였다.
따라서, 실시예 6 내지 실시예 8의 결과와 마찬가지로, L-라이신 생산능을 갖는 다양한 코리네박테리움 속 미생물에서 서열번호 1의 아미노산 서열로 구성되는 단백질을 불활성화함으로써 L-라이신 생산능을 향상시킬 수 있음을 확인하였다.
실시예 10: 코리네박테리움 글루타미쿰 KCCM11201P에서 NCgl0275 유전자가 결손된 균주의 제작 및 L-발린 생산능 평가
상기의 L-라이신 외에, L-발린 생산능을 갖는 코리네박테리움 글루타미쿰에서도 NCgl0275 유전자 결손을 통해 발린 생산능이 향상되는지에 대해 평가하고자 하였다.
상기 실시예 5에서 제작한 재조합 플라스미드 pDZ-△NCgl0275를 염색체 상에서의 상동 재조합에 의해 L-발린 생산균주인 코리네박테리움 글루타미쿰 KCCM11201P(대한민국 등록특허 제10-1117022호)에 형질전환시켰다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). 그 후, 4%의 수크로오스를 포함하는 고체평판배지에서 2차 재조합을 수행하였다. 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질 전환주를 대상으로 프라이머 3과 프라이머 6을 이용한 PCR을 통하여 염색체상에서 NCgl0275 유전자가 결손된 균주를 제조하였다. 상기 재조합 균주를 코리네박테리움 글루타미쿰 KCCM11201P-NCgl0275라 명명하였다.
상기에서 제작된 균주의 L-발린 생산능을 비교하고자 아래와 같은 방법으로 배양하여 배양액 성분을 분석하였다. 생산 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 72시간 동안, 200rpm에서 진탕 배양하였다. 이후, HPLC를 이용하여 L-발린의 농도를 분석하였고, 분석한 L-발린의 농도를 하기 표 7에 나타내었다.
<생산배지 (pH 7.0)>
포도당 100 g, 황산암모늄 40 g, 대두단백질 2.5 g, 옥수수침지고형분(Corn Steep Solids) 5 g, 요소 3 g, 제2인산칼륨 1 g, 황산마그네슘7수염 0.5 g, 바이오틴 100 ㎍, 티아민-HCl 1 ㎎, 판토텐산칼슘 2 ㎎, 니코틴아마이드 3 ㎎, 탄산칼슘 30 g (증류수 1리터 기준)
KCCM11201P 및 KCCM11201P-NCgl0275의 L-발린 생산능
균주 L-발린 (g/L)
배치 1 배치 2 배치 3 평균
대조군 KCCM11201P 2.8 2.7 2.9 2.8
실험군 KCCM11201P-NCgl0275 3.3 3.8 3.4 3.5
상기 결과와 같이, KCCM11201P-NCgl0275 균주의 L-발린 생산능은 대조군 대비 25.0% 증가함을 확인하였다. 즉, 코리네박테리움 속 미생물에서 서열 NCgl0275 유전자를 결손시킴으로써 L-발린의 생산능을 향상시킬 수 있음을 확인하였다.
또한, 코리네박테리움 속 미생물에서 서열번호 1의 아미노산 서열로 구성되는 단백질을 불활성화함으로써 다양한 L-아미노산 생산능을 향상시킬 수 있음을 확인하였다.
실시예 11: 코리네박테리움 글루타미쿰 CJ7V를 이용한 NCgl0275 유전자가 결손된 균주의 제작 및 L-발린 생산능 평가
L-발린을 생산하는 다른 코리네박테리움 글루타미쿰에 속하는 균주들에서도 상기와 동일한 효과가 있는지를 확인하기 위하여, 야생주 코리네박테리움 글루타미쿰 ATCC14067에 1종의 변이[ilvN(A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467]를 도입하여 L-발린 생산능이 향상된 균주를 제작하였다.
구체적으로, 코리네박테리움 글루타미쿰 야생형인 ATCC14067 균주의 게노믹 DNA를 G-spin Total DNA 추출 미니 키트(Intron사, Cat. No 17045)를 이용하여 키트에 제공된 프로토콜에 따라 추출하였다. 상기 게노믹 DNA를 주형으로 PCR을 실시하였다. ilvN 유전자에 A42V 변이를 도입하는 벡터를 제작하기 위해서, 프라이머 7(서열번호 9)과 프라이머 8(서열번호 10)의 프라이머 쌍 및 프라이머 9(서열번호 11)과 프라이머 10(서열번호 12)의 프라이머 쌍을 이용하여 유전자 단편(A, B)을 각각 얻었다. PCR의 조건은 94℃에서 5분간 변성한 후; 94℃에서 30초 변성, 55℃에서 30초 어닐링, 및 72℃ 60초 중합을 25회 반복한 후; 72℃에서 7분간 중합반응을 수행하였다.
그 결과, 단편 A, B 모두 537bp의 폴리뉴클레오티드를 획득할 수 있었다. 상기 두 단편을 주형으로 프라이머 7(서열번호 9)과 프라이머 10(서열번호 12)을 이용하여 Overlapping PCR을 실시하여 1044bp의 PCR 결과물 (이하, "변이 도입 단편"이라 명명함)을 얻었다.
상기 얻어진 변이 도입 단편을 제한효소 XbaI(New England Biolabs, Beverly, MA)로 처리한 후, 동일한 제한효소로 처리된 pDZ벡터와 T4 리가아제(New England Biolabs, Beverly, MA)를 이용하여 라이게이션하였다. 상기 제작한 유전자를 대장균 DH5α에 형질전환시킨 후, 이를 카나마이신 함유 LB배지에서 선별하고, DNA-spin 플라스미드 DNA 정제 키트(iNtRON 사)로 DNA를 획득하였다. 상기 ilvN 유전자의 A42V 변이 도입을 목적으로 하는 벡터를 pDZ-ilvN(A42V)라 명명하였다.
ilvN 유전자의 A42V 변이 도입 목적의 단편을 제작하기 위한 프라이머 7 내지 10
프라이머 염기 서열
프라이머 7 (서열번호 9) aatttctagaggcagaccctattctatgaagg
프라이머 8 (서열번호 10) agtgtttcggtctttacagacacgagggac
프라이머 9 (서열번호 11) gtccctcgtgtctgtaaagaccgaaacact
프라이머 10(서열번호 12) aatttctagacgtgggagtgtcactcgcttgg
이후, 상기에서 제작된 재조합 플라스미드 pDZ-ilvN(A42V)를 염색체 상에서의 상동 재조합에 의해 야생형인 코리네박테리움 글루타미쿰 ATCC14067에 형질전환시켰다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). 그 후, 4%의 수크로오스를 포함하는 고체평판배지에서 2차 재조합을 수행하였다. 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질 전환주를 대상으로 프라이머 7과 프라이머 10을 이용한 PCR을 통하여 유전자 단편을 증폭한 뒤, 유전자 서열 분석을 통하여 변이 도입 균주를 확인하였다. 상기 재조합 균주를 코리네박테리움 글루타미쿰 CJ7V라 명명하였다.
마지막으로, L-발린 생산능을 갖게된 코리네박테리움 글루타미쿰 CJ7V를 대상으로 상기 실시예 9와 같은 방법으로 NCgl0275 유전자가 결손된 균주를 제작하고 CJ7V-NCgl0275로 명명하였다. 제작된 균주의 L-발린 생산능을 비교하고자 상기 실시예 9과 동일한 방법으로 배양하여 L-발린의 농도를 분석하였고, 분석한 L-발린의 농도를 하기 표 9에 나타내었다.
CJ7V 및 CJ7V-NCgl0275의 L-발린 생산능
균주 L-발린 (g/L)
배치 1 배치 2 배치 3 평균
대조군 CJ7V 3.2 3.7 3.3 3.4
실험군 CJ7V-NCgl0275 3.9 4.2 3.9 4.0
상기 결과와 같이, CJ7V-NCgl0275 균주의 L-발린 생성능은 대조군 대비 17.6% 증가함을 확인하였다. 즉, L-발린 생산능을 갖는 다양한 코리네박테리움 속 미생물에서 NCgl0275 유전자를 결손시킴으로써 L-발린의 생산능을 향상시킬 수 있음을 확인하였다.
따라서, 실시예 6 내지 10과 마찬가지로, 코리네박테리움 속 미생물에서 서열번호 1의 아미노산 서열로 구성되는 단백질을 불활성화함으로써 다양한 L-아미노산 생산능을 향상시킬 수 있음을 확인하였다.
실시예 12: 코리네박테리움 글루타미쿰 CJ8V를 이용한 NCgl0275 유전자가 결손된 균주의 제작 및 L-발린 생산능 평가
L-발린을 생산하는 다른 코리네박테리움 글루타미쿰에 속하는 균주들에서도 상기와 동일한 효과가 있는지를 확인하기 위하여, 상기 실시예 10와 같은 방법으로 야생주 코리네박테리움 글루타미쿰 ATCC13869에 1종의 변이[ilvN(A42V)]를 도입하여 L-발린 생산능을 갖게된 변이주를 제작하고, 상기 재조합 균주를 코리네박테리움 글루타미쿰 CJ8V라 명명하였다.
L-발린 생산능을 갖게된 코리네박테리움 글루타미쿰 CJ8V를 대상으로 상기 실시예 9와 같은 방법으로 NCgl0275 유전자가 결손된 균주를 제작하였고, 이를 CJ8V-NCgl0275로 명명하였다.
제작한 상기 균주의 L-발린 생산능을 비교하고자 상기 실시예 9과 동일한 방법으로 배양하여 L-발린의 농도를 분석하였고, 분석한 L-발린의 농도를 하기 표 10에 나타내었다.
CJ8V 유래 CJ8V-NCgl0275의 L-발린 생산능
균주 L-발린 (g/L)
배치 1 배치 2 배치 3 평균
대조군 CJ8V 2.5 2.8 2.8 2.7
실험군 CJ8V-NCgl0275 3.2 3.6 3.4 3.4
상기 결과와 같이, CJ8V-NCgl0275 균주의 L-발린 생성능은 대조군 대비 25.9% 증가함을 확인하였다. 즉, 상기 실시예 10 내지 11의 결과와 마찬가지로, L-발린 생산능을 갖는 다양한 코리네박테리움 속 미생물에서 NCgl0275 유전자를 결손시킴으로써 L-발린의 생산능을 향상시킬 수 있음을 확인하였다.
따라서, 실시예 6 내지 11과 마찬가지로, 코리네박테리움 속 미생물에서 서열번호 1의 아미노산 서열로 구성되는 단백질을 불활성화함으로써 다양한 L-아미노산 생산능을 향상시킬 수 있음을 확인하였다.
이상의 설명으로부터, 본원이 속하는 기술분야의 당업자는 본원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2019001067-appb-I000001

Claims (7)

  1. 서열번호 1의 아미노산 서열로 구성되는 단백질의 활성이 불활성화된, L-아미노산을 생산하는 코리네박테리움속 미생물.
  2. 제1항에 있어서, 상기 L-아미노산은 염기성 아미노산, 지방족 아미노산 또는 분지쇄 아미노산인, 코리네박테리움속 미생물.
  3. 제1항에 있어서, 상기 L-아미노산은 L-라이신(L-lysine) 또는 L-발린(L-valine)인, 코리네박테리움속 미생물.
  4. 제1항에 있어서, 상기 코리네박테리움속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)인, 코리네박테리움속 미생물.
  5. 제1항 내지 제4항 중 어느 한 항에 따른 미생물을 배지에서 배양하는 단계; 및
    상기 미생물 또는 배지로부터 L-아미노산을 회수하는 단계를 포함하는, L-아미노산의 생산방법.
  6. 제5항에 있어서, 상기 L-아미노산은 염기성 아미노산, 지방족 아미노산 또는 분지쇄 아미노산인, L-아미노산의 생산방법.
  7. 제5항에 있어서, 상기 L-아미노산은 L-라이신(L-lysine) 또는 L-발린(L-valine)인, L-아미노산의 생산방법.
PCT/KR2019/001067 2018-01-25 2019-01-25 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법 WO2019147059A1 (ko)

Priority Applications (14)

Application Number Priority Date Filing Date Title
US16/344,205 US11180784B2 (en) 2018-01-25 2019-01-25 Microorganism of the genus Corynebacterium producing L-amino acids and a method for producing L-amino acids using the same
JP2020530305A JP7090159B2 (ja) 2018-01-25 2019-01-25 Ｌ－アミノ酸を生産するコリネバクテリウム属微生物及びそれを用いたｌ－アミノ酸の生産方法
PE2020000626A PE20210105A1 (es) 2018-01-25 2019-01-25 Microorganismo del genero corynebacterium que produce l-aminoacidos y metodo para producir l-aminoacidos usando el mismo
BR112019019376-6A BR112019019376B1 (pt) 2018-01-25 2019-01-25 microorganismo do gênero corynebacterium que produz l-aminoácidos e método para produzir l-aminoácidos com o uso do mesmo
CN202110317476.8A CN113046288B (zh) 2018-01-25 2019-01-25 产生l-氨基酸的棒状杆菌属微生物和使用其生产l-氨基酸的方法
MX2020007037A MX2020007037A (es) 2018-01-25 2019-01-25 Un microorganismo del genero corynebacterium que produce l-aminoacidos y un procedimiento para producir l-aminoacidos mediante el uso del mismo.
AU2019212400A AU2019212400B8 (en) 2018-01-25 2019-01-25 Microorganism Of Genus Corynebacterium For Producing L-Amino Acid And Method For Producing L-Amino Acid By Using Same
CA3086227A CA3086227C (en) 2018-01-25 2019-01-25 A microorganism of the genus corynebacterium producing l-amino acids and a method for producing l-amino acids using the same
EP19743512.6A EP3567110A4 (en) 2018-01-25 2019-01-25 CORYNEBACTERIUM-LIKE MICROORGANISM FOR THE PRODUCTION OF L-AMINO ACID AND METHOD FOR PRODUCING L-AMINO ACID USING THE SAME
RU2019113219A RU2754781C1 (ru) 2018-01-25 2019-01-25 Микроорганизм рода Corynebacterium, продуцирующий L-аминокислоты, и способ получения L-аминокислот с использованием этого микроорганизма
CN201980000870.XA CN110325642B (zh) 2018-01-25 2019-01-25 产生l-氨基酸的棒状杆菌属微生物和使用其生产l-氨基酸的方法
ZA2020/03315A ZA202003315B (en) 2018-01-25 2020-06-03 Microorganism of genus corynebacterium for producing l-amino acid and method for producing l-amino acid by using same
IL275641A IL275641A (en) 2018-01-25 2020-06-24 A Corynebacterium microorganism that produces L-form amino acids and a method for producing L-form amino acids using the same
PH12020551045A PH12020551045A1 (en) 2018-01-25 2020-07-06 A microorganism of the genus corynebacterium producing l-amino acids and method for producing l-amino acids using the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2018-0009633 2018-01-25
KR1020180009633A KR101947945B1 (ko) 2018-01-25 2018-01-25 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법

Publications (1)

Publication Number Publication Date
WO2019147059A1 true WO2019147059A1 (ko) 2019-08-01

Family

ID=65366304

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/001067 WO2019147059A1 (ko) 2018-01-25 2019-01-25 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법

Country Status (18)

Country Link
US (1) US11180784B2 (ko)
EP (1) EP3567110A4 (ko)
JP (1) JP7090159B2 (ko)
KR (1) KR101947945B1 (ko)
CN (2) CN113046288B (ko)
AR (1) AR114088A1 (ko)
AU (1) AU2019212400B8 (ko)
BR (1) BR112019019376B1 (ko)
CA (1) CA3086227C (ko)
CL (1) CL2020001740A1 (ko)
IL (1) IL275641A (ko)
MX (1) MX2020007037A (ko)
PE (1) PE20210105A1 (ko)
PH (1) PH12020551045A1 (ko)
RU (1) RU2754781C1 (ko)
TW (1) TWI771557B (ko)
WO (1) WO2019147059A1 (ko)
ZA (1) ZA202003315B (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7462776B2 (ja) 2020-05-21 2024-04-05 シージェイ チェイルジェダン コーポレーション Ｌ－分岐鎖アミノ酸の生産能が強化された微生物及びそれを用いたｌ－分岐鎖アミノ酸の生産方法
RU2819442C1 (ru) * 2020-05-21 2024-05-21 СиДжей ЧеилДжеданг Корпорейшн Микроорганизм, обладающий усиленной способностью продуцировать L-аминокислоту с разветвленной цепью, и способ получения L-аминокислоты с разветвленной цепью с его использованием

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101793328B1 (ko) * 2015-07-03 2017-11-03 씨제이제일제당 (주) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
PE20220018A1 (es) * 2019-06-14 2022-01-11 Cj Cheiljedang Corp Composicion para prevenir, tratar o mejorar enfermedades gastrointestinales que comprende una cepa del genero corynebacterium y cultivo de la misma
KR102311391B1 (ko) * 2020-05-21 2021-10-12 씨제이제일제당 주식회사 L- 분지쇄 아미노산 생산능이 강화된 미생물 및 이를 이용하여 l-분지쇄 아미노산을 생산하는 방법
KR102281361B1 (ko) * 2021-01-26 2021-07-22 씨제이제일제당 (주) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
KR102306009B1 (ko) 2021-04-07 2021-09-27 씨제이제일제당 (주) 신규한 WhiB 계열 전사 조절자 WhcA 변이체 및 이를 이용한 L-발린 생산 방법
KR20230031624A (ko) * 2021-08-27 2023-03-07 씨제이제일제당 (주) 신규한 초산 대사 조절자 a 변이체 및 이를 이용한 l-분지쇄 아미노산 생산 방법

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR0159812B1 (ko) 1995-12-20 1998-11-16 손경식 코리네박테리움 글루타미컴 씨에이치 77 및 이 균주를 이용한 l-라이신의 제조 방법
KR20030013521A (ko) * 2000-07-04 2003-02-14 데구사 아게 코리네박테리움 글루타미쿰으로부터 ｍｄｈＡ 유전자를암호화하는 뉴클레오타이드 서열
KR20070091303A (ko) * 2004-11-25 2007-09-10 아지노모토 가부시키가이샤 Ｌ-아미노산 생산 세균 및 ｌ-아미노산의 생산 방법
KR20080007263A (ko) * 2005-04-29 2008-01-17 포르슝스젠트룸 율리히 게엠베하 발효에 의한 ｌ-아미노산의 제조방법
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
KR101117022B1 (ko) 2011-08-16 2012-03-16 씨제이제일제당 (주) Ｌ-발린 생산능이 향상된 미생물 및 이를 이용한 ｌ-발린 제조방법
KR20150133091A (ko) * 2014-05-19 2015-11-27 삼성전자주식회사 유전적으로 조작된 박테리아 세포 및 그를 이용하여 숙신산을 생산하는 방법

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3966583B2 (ja) * 1997-06-23 2007-08-29 協和醗酵工業株式会社 発酵法によるｌ−アミノ酸の製造法
US20050153402A1 (en) * 1999-06-25 2005-07-14 Basf Ag Corynebacterium glutamicum genes encoding regulatory proteins
JP4623825B2 (ja) * 1999-12-16 2011-02-02 協和発酵バイオ株式会社 新規ポリヌクレオチド
DE10154245A1 (de) 2001-11-05 2003-06-05 Basf Ag Gene die für regulatorische Proteine codieren
JP4665451B2 (ja) 2003-07-29 2011-04-06 味の素株式会社 Ｌ−リジンまたはｌ−スレオニンの製造法
JP5592059B2 (ja) * 2005-12-27 2014-09-17 協和発酵バイオ株式会社 Ｌ−グルタミンの製造法
EP2582815B1 (en) * 2010-06-15 2016-08-10 Daesang Corp. Production process for amino acids of the aspartate family using microorganisms
KR101261147B1 (ko) * 2011-01-18 2013-05-06 씨제이제일제당 (주) Ｌ-아미노산의 생산능이 향상된 미생물 및 이를 이용하여 ｌ-아미노산을 생산하는 방법
KR101498630B1 (ko) * 2013-10-28 2015-03-04 씨제이제일제당 주식회사 Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
KR101530819B1 (ko) * 2014-05-08 2015-06-22 씨제이제일제당 (주) L-라이신 생산능이 향상된 미생물 및 이를 이용한 l-라이신 생산방법
KR101539370B1 (ko) * 2014-05-14 2015-07-24 씨제이제일제당 주식회사 L-라이신을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신의 생산방법
KR101835935B1 (ko) * 2014-10-13 2018-03-12 씨제이제일제당 (주) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌의 제조 방법
KR101776375B1 (ko) * 2015-03-18 2017-09-08 씨제이제일제당 (주) 피루브산 디하이드로게나아제 변이체, 이를 포함하는 미생물 및 이를 이용한 l-아미노산 생산 방법
KR101793328B1 (ko) 2015-07-03 2017-11-03 씨제이제일제당 (주) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR0159812B1 (ko) 1995-12-20 1998-11-16 손경식 코리네박테리움 글루타미컴 씨에이치 77 및 이 균주를 이용한 l-라이신의 제조 방법
KR20030013521A (ko) * 2000-07-04 2003-02-14 데구사 아게 코리네박테리움 글루타미쿰으로부터 ｍｄｈＡ 유전자를암호화하는 뉴클레오타이드 서열
KR20070091303A (ko) * 2004-11-25 2007-09-10 아지노모토 가부시키가이샤 Ｌ-아미노산 생산 세균 및 ｌ-아미노산의 생산 방법
KR20080007263A (ko) * 2005-04-29 2008-01-17 포르슝스젠트룸 율리히 게엠베하 발효에 의한 ｌ-아미노산의 제조방법
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
KR101117022B1 (ko) 2011-08-16 2012-03-16 씨제이제일제당 (주) Ｌ-발린 생산능이 향상된 미생물 및 이를 이용한 ｌ-발린 제조방법
KR20150133091A (ko) * 2014-05-19 2015-11-27 삼성전자주식회사 유전적으로 조작된 박테리아 세포 및 그를 이용하여 숙신산을 생산하는 방법

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
"Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
APPL. MICROBIOL. BIOTHCENOL., vol. 52, 1999, pages 541 - 545
BINDER ET AL., GENOME BIOLOGY, vol. 13, 2012, pages R40
BIOTECHNOLOGY AND BIOPROCESS ENGINEERING, vol. 19, no. 3, June 2014 (2014-06-01), pages 456 - 467
DATABASE NCBI 27 August 2016 (2016-08-27), retrieved from Genbank Database accession no. WP_003863319.1 *
J. SAMBROOK ET AL.: "Molecular Cloning, a Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
KARLINALTSCHUL, PRO. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873
METHODS ENZYMOL., vol. 183, 1990, pages 63
MOORE, S.STEIN, W.H.: "Photometric ninhydrin method for use in the chromatography of amino acids", J. BIOL. CHEM., vol. 176, 1948, pages 367 - 388
VAN DER REST ET AL., APPL MICROBIOL BIOTECHNOL, vol. 52, 1999, pages 541 - 545

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7462776B2 (ja) 2020-05-21 2024-04-05 シージェイ チェイルジェダン コーポレーション Ｌ－分岐鎖アミノ酸の生産能が強化された微生物及びそれを用いたｌ－分岐鎖アミノ酸の生産方法
RU2819442C1 (ru) * 2020-05-21 2024-05-21 СиДжей ЧеилДжеданг Корпорейшн Микроорганизм, обладающий усиленной способностью продуцировать L-аминокислоту с разветвленной цепью, и способ получения L-аминокислоты с разветвленной цепью с его использованием

Also Published As

Publication number Publication date
EP3567110A1 (en) 2019-11-13
CA3086227A1 (en) 2019-08-01
CN110325642A (zh) 2019-10-11
CN110325642B (zh) 2021-04-13
ZA202003315B (en) 2021-09-29
RU2754781C1 (ru) 2021-09-07
AU2019212400B8 (en) 2022-05-12
JP7090159B2 (ja) 2022-06-23
TWI771557B (zh) 2022-07-21
AR114088A1 (es) 2020-07-22
US20200362374A1 (en) 2020-11-19
BR112019019376B1 (pt) 2021-05-25
CL2020001740A1 (es) 2020-11-13
AU2019212400A1 (en) 2020-06-25
KR101947945B1 (ko) 2019-02-13
MX2020007037A (es) 2020-09-07
CN113046288A (zh) 2021-06-29
CA3086227C (en) 2023-11-28
JP2021511009A (ja) 2021-05-06
US11180784B2 (en) 2021-11-23
PH12020551045A1 (en) 2021-04-26
AU2019212400B2 (en) 2022-04-14
TW201942129A (zh) 2019-11-01
EP3567110A4 (en) 2020-07-08
CN113046288B (zh) 2023-11-07
PE20210105A1 (es) 2021-01-19
BR112019019376A2 (pt) 2020-09-01
IL275641A (en) 2020-08-31

Similar Documents

Publication Publication Date Title
WO2019147059A1 (ko) L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법
WO2019147078A1 (ko) 퓨린 뉴클레오티드를 생산하는 코리네박테리움 속 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2019160301A1 (ko) 시트레이트 신타아제의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 l-아미노산 생산방법
WO2019231159A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2019190192A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2014148743A1 (ko) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법
WO2020130236A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2016148490A1 (ko) 피루브산 디하이드로게나아제 변이체, 이를 포함하는 미생물 및 이를 이용한 l-아미노산 생산 방법
WO2019164346A1 (ko) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
WO2020218736A1 (ko) L-히스티딘 생산능이 강화된 미생물 및 이를 이용한 히스티딘 생산방법
WO2019172702A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2019135445A1 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2017007159A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2019013532A2 (ko) 아세토하이드록시산 신타아제 변이체, 이를 포함하는 미생물 또는 이를 이용하는 l-분지쇄 아미노산 생산 방법
WO2021177731A1 (ko) 글루타민 신테타아제 변이형 폴리펩티드 및 이를 이용한 l-글루타민 생산 방법
WO2018093033A1 (ko) L-라이신을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신의 생산방법
WO2020067618A1 (ko) 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법
WO2021045472A1 (ko) 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법
WO2022239953A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2022124708A1 (ko) 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법
WO2022050671A1 (ko) L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
WO2021153866A1 (ko) 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법
WO2020256415A1 (ko) L-타이로신을 생산하는 미생물 및 이를 이용한 l-타이로신 생산 방법

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2019743512

Country of ref document: EP

Effective date: 20190808

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19743512

Country of ref document: EP

Kind code of ref document: A1

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019019376

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2020530305

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3086227

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019212400

Country of ref document: AU

Date of ref document: 20190125

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 112019019376

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190917