WO2019164346A1 - L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법 - Google Patents

L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법 Download PDF

Info

Publication number
WO2019164346A1
WO2019164346A1 PCT/KR2019/002236 KR2019002236W WO2019164346A1 WO 2019164346 A1 WO2019164346 A1 WO 2019164346A1 KR 2019002236 W KR2019002236 W KR 2019002236W WO 2019164346 A1 WO2019164346 A1 WO 2019164346A1
Authority
WO
WIPO (PCT)
Prior art keywords
tryptophan
seq
microorganism
corynebacterium
amino acid
Prior art date
Application number
PCT/KR2019/002236
Other languages
English (en)
French (fr)
Other versions
WO2019164346A8 (ko
Inventor
서창일
김태연
김효진
정무영
김현아
손성광
정기용
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Publication of WO2019164346A1 publication Critical patent/WO2019164346A1/ko
Publication of WO2019164346A8 publication Critical patent/WO2019164346A8/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1022—Transferases (2.) transferring aldehyde or ketonic groups (2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C12P13/227—Tryptophan
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y202/00—Transferases transferring aldehyde or ketonic groups (2.2)
    • C12Y202/01—Transketolases and transaldolases (2.2.1)
    • C12Y202/01001—Transketolase (2.2.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/03—Oxo-acid-lyases (4.1.3)
    • C12Y401/03027—Anthranilate synthase (4.1.3.27)

Definitions

  • the present application relates to a genus of Corynebacterium producing recombinant L-tryptophan using genetic engineering techniques, and a method for producing L-tryptophan using the microorganism.
  • L-Tryptophan is one of the essential amino acids, and has been widely used as a raw material for pharmaceuticals such as feed additives or sap and health food materials.
  • microbial direct fermentation is mainly used for L-tryptophan production.
  • the microorganisms used to produce L-tryptophan have been used mainly for the selection of analog-resistant strains through chemical or physical mutations.However, due to the rapid development of genetic recombination technology and molecular-level regulatory mechanisms in the 1990s, genetic engineering techniques were used. Recombinant strains are mainly used.
  • L-tryptophan production using Escherichia coli has been conducted in various ways, including sugar influx, pentose phosphate pathway, serine biosynthesis, aromatic / tryptophan biosynthesis, and is now leading to industrial production.
  • Microorganisms of the genus Corynebacterium, a commonly recognized as safe (GRAS) strain have the same advantages as Endotoxin-free and are applied to the production of glutamic acid, lysine, and valine. Inadequately applied to industrial production.
  • One object of the present application is to provide a Corynebacterium microorganism that produces L-tryptophan, genetically recombined to overproduce L-tryptophan.
  • Another object of the present application the step of culturing the microorganism in the medium; And it provides a method for producing L- tryptophan, comprising the step of recovering L-tryptophan from the cultured microorganism or medium.
  • the L-tryptophan producing microorganism provided in the present application can enhance the expression of the genes encoding the feedback-released tryptophan operon and transketorase to improve L-tryptophan production in Corynebacterium spp. have.
  • the combination of the expression of E. coli-derived tryptophan operon in the Corynebacterium genus microorganisms can significantly improve the production of L-tryptophan.
  • it can be useful industrially, it is possible to provide a Corynebacterium genus microorganisms to enhance the fermentation stability to effectively produce L- tryptophan.
  • One aspect of the present application for achieving the above object is a gene encoding an ansranilic acid synthase whose N-terminus is composed of the amino acid sequence of SEQ ID 32 and the feedback inhibition is released, and tryptophan operon and transke comprising the same
  • ansranilic acid synthase whose N-terminus is composed of the amino acid sequence of SEQ ID 32 and the feedback inhibition is released, and tryptophan operon and transke comprising the same
  • Another embodiment of the present application is modified to express the E. coli-derived tryptophan operon containing a gene encoding a feedback released anthranilic acid synthase in addition to the microorganism consisting of the amino acid sequence of SEQ ID NO: 33 N-terminal To provide a microorganism of the genus Corynebacterium that produces L-tryptophan.
  • L-tryptophan is one of ⁇ -amino acids and refers to an aromatic amino acid that is an essential amino acid that is not synthesized in the body and has a chemical formula of C 11 H 12 N 2 O 2 .
  • tryptophan operon refers to a group of genes encoding enzymes involved in synthesizing tryptophan from chorismic acid (chorismate).
  • the tryptophan operon may be tryptophan operon derived from Corynebacterium spp., Or tryptophan operon derived from Escherichia spp.
  • the tryptophan operon derived from the microorganism of the genus Corynebacterium may be the nucleotide sequence of SEQ ID NO: 34, but is not limited thereto.
  • the tryptophan operon derived from the genus Escherichia may be the nucleotide sequence of SEQ ID NO: 43, but is not limited thereto.
  • the gene group of tryptophan operon is one or more genes selected from the group consisting of trpE, trpG, trpD, trpC, trpB, and trpA genes in Corynebacterium spp., TrpE, trpD, trpC, in Escherichia spp.
  • One or more genes selected from the group consisting of trpB and trpA genes are arranged under the promoter and effector to form the operon.
  • the trpE, trpG, trpD, trpC, trpB, trpA genes of the genus Corynebacterium are amino acids of SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, and SEQ ID NO: 40, respectively. It may be expressing the polypeptide of the sequence, but is not limited thereto.
  • the trpE, trpD, trpC, trpB, and trpA genes of the Escherichia microorganism express polypeptides of the amino acid sequences of SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48, respectively. It may be, but is not limited thereto.
  • the Corynebacterium microorganism may be Corynebacterium glutamicum
  • Escherichia microorganism may be Escherichia coli.
  • the tryptophan operon may have a known nucleotide sequence, and those skilled in the art can easily obtain the nucleotide sequence of tryptophan operon through a database such as NCBI or Kegg.
  • Ordinary tryptophan operon is actively transcribed to produce sufficient amount of tryptophan as required by the cell, but in the presence of sufficient intracellular tryptophan, a repressor binds to tryptophan, which inactivates the tryptophan operon, thereby inhibiting transcription. .
  • try to suppress the inhibitor of tryptophan operon and genetic manipulation is required so as not to receive feedback suppression by tryptophan.
  • Proteins encoded by the tryptophan operon include anthranilate synthase, anthranilate phosphoribosyltransferase, phosphoribosylanthranilate isomerase, and indole-3-glycerol phosphate Synthetic enzymes (indole-3-glycerol phosphate synthase) and tryptophan synthase are known. However, it is not limited thereto. Specifically, first, anthranilic acid synthase acts on the chorismic acid to synthesize anthranilic acid.
  • Ansranilic acid phosphoribosyl transferase then acts to synthesize phosphoribosyl anthranilic acid (N-(5'-phosphoribosyl) -anthranilate). Subsequently, phosphoribosyl anthranilic acid isomerase and indole-3-glycerol phosphatase act to synthesize indole-3-glycerol phosphate, and tryptophan synthase acts on L-tryptophan Complete the synthesis (Bonggaerts et al ., Metab Eng , 3, 289-300, 2001, Iris Brune et al ., J. Bacteriol., 189 (7): 2720-33, 2007).
  • anthranilate synthase refers to an enzyme that synthesizes anthranilic acid from corrismic acid.
  • the anthranilic acid synthase of the present application may be an anthranilic acid synthase derived from Corynebacterium spp., Or an ansranilic acid synthase derived from Escherichia spp.
  • coryneglutacum the proteins produced by the trpE and trpG genes in tryptophan operon are polymerized, and the proteins produced by the trpE and trpD genes in E. coli form polymers to form anthranilic acid synthase.
  • Ansranilic acid synthase of the present application unlike wild-type or natural-type protein having its activity, has the feature that the inhibition of feedback by the end product tryptophan, derivatives or analogs thereof is released or desensitized.
  • the term "feedback inhibition” means that an end product of an enzyme system inhibits or inhibits a reaction at an early stage of the enzyme system. Therefore, in the case of releasing or desensitizing feedback inhibition of anthranilic acid synthase, it is possible to increase the productivity of tryptophan in comparison with the other cases.
  • the anthranilic acid synthase in which the feedback inhibition is released is included in the present application as long as the feedback inhibition by tryptophan is released or desensitized.
  • the anthranilic acid synthase from which the feedback inhibition is released may be N-terminal of the amino acid sequence of SEQ ID NO: 32, or N-terminal of the amino acid sequence of SEQ ID NO: 33.
  • the amino acid sequence of SEQ ID NO: 32 is a sequence in which serine at position 38 is substituted with arginine
  • the amino acid sequence of SEQ ID NO: 33 is a sequence in which proline at position 21 is substituted with serine.
  • the polypeptide consisting of the amino acid sequence of SEQ ID NO: 32 or the amino acid sequence of SEQ ID NO: 33 is a polypeptide having the amino acid sequence of SEQ ID NO: 32 or SEQ ID NO: 33, a polypeptide consisting of the amino acid of SEQ ID NO: 32 or 33, or SEQ ID NO: 32 or 33 It can be used interchangeably with a polypeptide comprising an amino acid sequence of.
  • the anthranilic acid synthase may have a known amino acid sequence derived from Corynebacterium microorganisms or an amino acid sequence derived from Escherichia genus microorganisms, and those skilled in the art will appreciate that anslanylic acid synthase may be obtained through a database such as NCBI or Kegg. Amino acid sequences can be easily obtained. However, in the case of microorganisms of the genus Corynebacterium to eliminate feedback inhibition, as long as the N-terminus includes the amino acid of SEQ ID NO: 32 in the entire amino acid sequence, thereafter, it is a known amino acid sequence or other feedback inhibition. Amino acid sequence with release mutations.
  • the N-terminus from the entire amino acid sequence only includes the amino acid of SEQ ID NO: 33 from the entire amino acid sequence for feedback suppression, after which it may be a known amino acid sequence or an amino acid sequence containing other feedback suppression mutations. Can be.
  • anthranilic acid synthase in the present application is defined as a polypeptide comprising the amino acid of SEQ ID NO: 32 or SEQ ID NO: 33, the amino acid of SEQ ID NO: 32 or 21, except that the position 38 is arginine It does not exclude mutations that can occur naturally in the amino acid sequence of SEQ ID NO: 33, except for serine, or its latent mutations, and are identical to polypeptides comprising the amino acid sequence of SEQ ID NO: 32 or SEQ ID NO: 33. Or it is apparent to those skilled in the art that if the corresponding activity corresponds to the anthranilic acid synthetase of the present application.
  • an ansranilic acid synthase derived from the genus Corynebacterium microorganism of the present application includes that the position 38 is arginine, and the amino acid sequence of SEQ ID NO: 32 or 70%, 80%, 90%, 95 It may be a polypeptide consisting of an amino acid sequence having at least%, or 97% homology.
  • the anthranilic acid synthetase derived from the genus Escherichia microorganism of the present application includes that the position 21 is serine, and the amino acid sequence of SEQ ID NO: 33 or 70%, 80%, 90%, 95%, or 97% thereof. It may be a polypeptide consisting of an amino acid sequence having the above homology.
  • polypeptide having an amino acid sequence having such homology and exhibiting an efficacy corresponding to the polypeptide it is obvious that a polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted or added is also included within the scope of the present application.
  • the term 'homology' or 'identity' refers to the degree of correlation with two given amino acid sequences or nucleotide sequences and may be expressed as a percentage.
  • Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and the default gap penalty established by the program used may be used together. Substantially, homologous or identical sequences are generally at least about 50%, 60%, 70%, 80% full or full-length in medium or high stringent conditions. Or 90% or more. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in polynucleotides.
  • the homology, similarity, or identity of a polynucleotide or polypeptide is described, for example, in Smith and Waterman, Adv. Appl. As known from Math (1981) 2: 482, for example, Needleman et al. (1970), J Mol Biol. 48: 443, and can be determined by comparing the sequence information using a GAP computer program.
  • the GAP program defines the total number of symbols in the shorter of the two sequences, divided by the number of similarly arranged symbols (ie, nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or gap opening penalty 10, gap extension penalty 0.5); And (3) no penalty for the end gap.
  • the polynucleotide encoding the anthranilic acid synthase may be included without limitation so long as it is a sequence capable of encoding the anthranilic acid synthase.
  • polynucleotide encoding the anthranilic acid synthase is within a range that does not change the amino acid sequence of the polypeptide due to the degeneracy of the codon or in consideration of the codon preferred in the organism to express the polypeptide. In the coding region, various modifications may be made. Meanwhile, the polynucleotide encoding the polypeptide may be a polynucleotide comprising a polynucleotide sequence having at least 70%, 80%, 90%, 95%, or 97% homology or identity thereto.
  • polynucleotide sequence encodes a polypeptide having such homology or identity and exhibiting substantially the same or equivalent potency as the polypeptide
  • polynucleotide sequences in which some sequences have been deleted, modified, substituted or added are also within the scope of the present application. Inclusion is self-evident.
  • Probes that can be prepared from known gene sequences, such as the amino acid of SEQ ID NO: 32 or SEQ ID NO: 33, are hydrided under stringent conditions with complementary sequences to all or part of the polynucleotide sequence, for example. Any sequence encoding a polypeptide having the same or similar activity as the polypeptide consisting of the sequence can be included without limitation.
  • stringent conditions refers to conditions that enable specific hybridization between polynucleotides. Such conditions are described specifically in the literature (eg, J. Sambrook et al., Homology). For example, genes with high homology, 70% or more, 80% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly specifically 99% or more Genes having homologous hybridization and hybridization with less homologous genes, or 60 ° C, 1 ⁇ SSC, 0.1% SDS, specifically 60 ° C, 0.1 At the salt concentration and temperature corresponding to x SSC, 0.1% SDS, and more specifically 68 ° C., 0.1 ⁇ SSC, and 0.1% SDS, the conditions for washing once, specifically, two to three times can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of the hybridization.
  • the term “complementary” is used to describe the relationship between bases of nucleotides that can hybridize with each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.
  • the present application may also include isolated nucleotide fragments that are complementary to the entire sequence as well as substantially similar nucleotide sequences.
  • polynucleotides having homology can be detected using hybridization conditions including hybridization steps at Tm values of 55 ° C. and using the conditions described above.
  • the Tm value may be 60 ° C, 63 ° C or 65 ° C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • Proper stringency for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides and variables are well known in the art (see Sambrook et al., Supra, 9.50-9.51, 11.7-11.8).
  • transketolase refers to xylulose-5-phosphate and erythrose 4-phosphate of fructose-6-phosphate and glyceraldehyde-3-phosphate (E4P, erythorse-4-). phosphate) (Kochetov, GA 1982, Transketolase from yeast, rat liver, and pig liver, Methods Enzymol., 90: 209-23). Tryptophan production originates from the aromatic amino acid metabolic cycle, which begins with the condensation reaction of phosphoenolpyruvate with erythrose 4-phosphate.
  • smooth supply of two precursors is essential for improving tryptophan productivity, and it is intended to enhance the expression of the tkt gene for smooth supply of erythrose 4-phosphate as a precursor of tryptophan, which is known to be relatively insufficient in the present application.
  • the transketorase of the present application has the above activity, those skilled in the art can obviously use the amino acid sequence having the activity regardless of the origin of the microorganism. Specifically, it may have a known amino acid sequence derived from Corynebacterium microorganisms or an amino acid sequence derived from Escherichia microorganisms, those skilled in the art can easily facilitate the amino acid sequence of transketorase through a database such as NCBI or Kegg Can be obtained. More specifically, the transketorase may be derived from Corynebacterium microorganisms, and even more specifically from Corynebacterium glutamicum. Specifically, Corynebacterium glutamicum-derived transketorase may use the nucleotide sequence of SEQ ID NO: 41 or the amino acid sequence of SEQ ID NO: 42.
  • the term "enhanced / enhanced" a gene means a state in which the synthesis of the gene of interest into a functioning protein is increased compared to intrinsic or prior to modification.
  • intrinsic refers to a state in which the parent strain originally had before the transformation, when the trait of the microorganism changes due to genetic variation caused by natural or artificial factors.
  • the expression enhancement of the present application is to increase the intracellular copy number of the gene encoding the protein of interest, to introduce a mutation in the expression control sequence of the chromosomal gene encoding the protein, gene expression on the chromosome encoding the protein
  • a method of replacing a regulatory sequence with a highly active sequence, a method of replacing a gene encoding the protein on a chromosome with a mutated gene to increase the protein activity, and a gene on the chromosome that encodes the protein to enhance the activity of the protein It may be made by any one or more methods selected from the group consisting of a method for introducing a mutation in. More specifically, the enhanced expression of the present application may be a substitution of a strong promoter for the promoter of the gene of interest.
  • the copy number increase of the gene in the above is not particularly limited, but may be performed in a form operably linked to a vector, or by inserting into a chromosome in a host cell.
  • a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the protein of the present application is operably linked may be introduced into the host cell.
  • a vector capable of inserting the polynucleotide into a chromosome in a host cell to which the polynucleotide is operably linked may be introduced into the chromosome of the host cell. Insertion of the polynucleotide into the chromosome can be by any method known in the art, for example by homologous recombination.
  • modifying the expression control sequence to increase the expression of the polynucleotide is not particularly limited, but deletion, insertion, non-conservative or conservative substitution or their nucleic acid sequence to further enhance the activity of the expression control sequence. It can be carried out by inducing a variation in sequence in combination or by replacing with a nucleic acid sequence having stronger activity.
  • the expression control sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosomal binding site, a sequence for controlling termination of transcription and translation, and the like.
  • a strong promoter may be linked to the top of the polynucleotide expression unit instead of the original promoter, but is not limited thereto.
  • Examples of known strong promoters include cj1 to cj7 promoters (Korean Patent No. 10-0620092), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, P L promoter, tet promoter, gapA promoter, SPL7 Promoter, SPL13 (sm3) promoter (Korean Patent No. 10-1783170), O2 promoter (Korean Patent No. 10-1632642), tkt promoter and yccA promoter and the like, but is not limited thereto.
  • modification of the polynucleotide sequence on the chromosome is not particularly limited, but the mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the polynucleotide sequence. Or by replacing with a polynucleotide sequence that has been modified to have stronger activity.
  • the term "introduction" of a gene refers to the activity of a specific protein as it is expressed in the microorganism, which is not originally possessed by the microorganism, or to enhanced activity compared to the intrinsic or pre-modification activity of the protein. It means to appear.
  • a polynucleotide encoding a specific protein may be introduced into a chromosome in a microorganism, or a vector containing a polynucleotide encoding a specific protein may be introduced into a microorganism to exhibit its activity.
  • the introduction and enrichment of such protein activity is generally at least 1%, 10%, 25%, 50%, based on the activity or concentration of the protein in the wild type or unmodified microbial strain. 75%, 100%, 150%, 200%, 300%, 400% or 500%, up to 1000% or 2000% may be increased, but is not limited thereto.
  • the term “microorganism that produces L-tryptophan” refers to a microorganism capable of producing an excess of L-tryptophan from a carbon source in the medium compared to wild-type or unmodified microorganisms.
  • the microorganism producing L-tryptophan may be a recombinant microorganism.
  • the type is not particularly limited, but the genus Enterbacter, Escherichia, Erwinia, Serratia, Providencia ( Providencia), Corynebacterium genus and Brevibacterium genus microorganisms. More specifically, it may be a microorganism belonging to the genus Escherichia or Corynebacterium.
  • the microorganism of the genus Corynebacterium may be corynebacterium glutamicum, but the expression of the gene encoding tryptophan operon and transketorase is enhanced to produce L-tryptophan.
  • Microorganisms belonging to this growing Corynebacterium genus can be included without limitation.
  • Another aspect of the present application for achieving the above object is a gene encoding an ansranilic acid synthase with an N-terminus consisting of the amino acid sequence of SEQ ID NO: 32 and the feedback inhibition is released, and a tryptophan operon comprising the same; Culturing Corynebacterium genus microorganisms producing L-tryptophan, in which the expression of the gene encoding the transketorase is enhanced, in a medium; And it provides a method for producing L- tryptophan, comprising the step of recovering L-tryptophan from the cultured microorganism or medium.
  • Ansranilate synthase, tryptophan operon, transketolase, L-tryptophan, and microorganisms having the N-terminus consisting of the amino acid sequence of SEQ ID NO: 32 or SEQ ID NO: 33 and whose feedback inhibition is released are as described above.
  • the term "culture” means growing the microorganisms under appropriately controlled environmental conditions. Cultivation process of the present application may be made according to suitable media and culture conditions known in the art. This culture process can be easily adjusted and used by those skilled in the art according to the strain selected. Specifically, the culture may be batch, continuous and fed-batch, but is not limited thereto.
  • the term "medium” means a substance mixed with nutrients necessary for culturing the microorganism as a main component, and supplies nutrients and growth factors, including water, which is indispensable for survival and development.
  • the medium and other culture conditions used for the culture of the microorganism of the present application can be used without any particular limitation as long as the medium is used for the culture of ordinary microorganisms, the microorganism of the present application is suitable carbon source, nitrogen source, personnel, inorganic It can be cultured in a conventional medium containing a compound, an amino acid and / or vitamins, etc. under aerobic conditions, adjusting the temperature, pH and the like.
  • the carbon source may include carbohydrates such as glucose, fructose, sucrose, maltose, mannitol, sorbitol, and the like; Alcohols such as sugar alcohols, glycerol, pyruvic acid, lactic acid, citric acid and the like; Amino acids such as organic acids, glutamic acid, methionine, lysine and the like.
  • natural organic nutrients such as starch hydrolyzate, molasses, blackstrap molasses, rice winters, cassava, sugarcane residue and corn steep liquor can be used, specifically glucose and sterilized pretreated molasses (ie, reducing sugars).
  • Carbohydrates, such as molasses), and other appropriate amounts of carbon sources can be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more thereof, but are not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptones, NZ-amines, meat extracts, yeast extracts, malt extracts, corn steep liquor, casein hydrolysates, fish or their degradation products, skim soy cakes or their degradation products Can be used. These nitrogen sources may be used alone or in combination of two or more thereof, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptones, NZ-amines
  • the personnel may include a first potassium phosphate, a second potassium phosphate, or a sodium-containing salt corresponding thereto.
  • a first potassium phosphate sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate and the like may be used, and other amino acids, vitamins and / or suitable precursors may be included. These components or precursors may be added batchwise or continuously to the medium. However, it is not limited to this.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, and the like can be added to the medium in an appropriate manner to adjust the pH of the medium.
  • antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble generation.
  • oxygen or oxygen-containing gas into the medium or to inject nitrogen, hydrogen or carbon dioxide gas without the injection of gas to maintain the anaerobic and unaerobic state, It is not.
  • the temperature of the medium may be 20 ° C to 50 ° C, specifically 30 ° C to 37 ° C, but is not limited thereto.
  • the incubation period may continue until the desired amount of useful material is obtained, specifically, may be 10 hours to 100 hours, but is not limited thereto.
  • the step of recovering tryptophan is to recover the desired L- tryptophan from the medium using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, batch, continuous or fed-batch culture method.
  • a suitable method known in the art for example, centrifugation, filtration, treatment with crystallized protein precipitation agent (salting method), extraction, ultrasonic crushing, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography
  • Various chromatography such as HPLC, HPLC and the like can be used in combination, but is not limited to these examples.
  • the recovery step may comprise an additional purification process.
  • the purification process may purify the recovered L-tryptophan using any suitable method known in the art.
  • the present application provides a gene encoding an anslanylic acid synthase, wherein the N-terminus is composed of the amino acid sequence of SEQ ID 32, and the feedback inhibition is released, and a tryptophan operon and transketorase comprising the same. It provides the use of L-tryptophan production of Corynebacterium microorganism with enhanced expression of the gene.
  • the present application provides a gene encoding a feedback released anthranilic acid synthetase having an N-terminus consisting of the amino acid sequence of SEQ ID NO: 33 and an E. coli-derived tryptophan operon in addition to the microorganism. It provides for the production of L-tryptophan of the Corynebacterium microorganism modified as possible.
  • the trpE promoter Upstream and trpE 38 Downsteam regions where chromosomal homologous recombination occurs were obtained. Specifically, the trpE promoter upstream region using the primers of SEQ ID NO: 1 and SEQ ID NO: 2, using Corynebacterium glutamicum ATCC13869 chromosomal DNA as a template, and trpE using the primers of SEQ ID NO: 3 and SEQ ID NO: 4 Gene fragments in the Downsteam region of mutation 38 were obtained by PCR.
  • Solg TM Pfu-X DNA polymerase As polymerase, Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were denatured at 95 ° C. for 5 minutes, 95 ° C. 30 sec denaturation, 60 ° C. 30 sec annealing, and 72 ° C. 60 sec polymerization 30 times. The polymerization was carried out at 72 ° C. for 5 minutes.
  • PCR was performed using primers of SEQ ID NO: 6 and SEQ ID NO: 7 as a template using a synthetically produced promoter SPL7 (SEQ ID NO: 5, Korean Patent No. 10-1783170).
  • Solg TM Pfu-X DNA polymerase (SolGent co.) was used, and PCR amplification conditions were denatured at 95 ° C. for 5 minutes, 95 ° C. 30 seconds denaturation, 62 ° C. 30 seconds annealing, and 72 ° C. 30 seconds polymerization. After repeating 30 times, the polymerization was performed at 72 ° C. for 5 minutes.
  • PCR was performed using primers of SEQ ID NO: 8 and SEQ ID NO: 9 using Corynebacterium glutamicum genomic DNA as a template to obtain fragments before trpE 38 from Corynebacterium glutamicum. .
  • Solg TM Pfu-X DNA polymerase As polymerase, Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were denatured at 95 ° C. for 5 minutes, 95 ° C. 30 sec. Denaturation, 62 ° C. 30 sec. Annealing, and 72 ° C. 30 sec. Polymerization 30 times. The polymerization was carried out at 72 ° C. for 5 minutes.
  • the amplified trpE promoter upstream and trpE 38 mutation downstream region, the SPL7 promoter and trpE 38 frontal fragment, and the chromosome transformation vector pDZ (patented 10-0924065) cleaved with SmaI restriction enzyme were obtained from the Gibson assembly ( Recombinant plasmids were obtained by cloning using DG Gibson et al., NATURE METHODS, VOL. 6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) method and named pDZ-PSPL7-trpE (S38R). Cloning was performed by mixing Gibson assembly reagent and each of the gene fragments in the calculated moles and then preserving at 50 ° C. for 1 hour.
  • the produced pDZ-PSPL7-trpE (S38R) vector was transformed into wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation, followed by a second crossover process, and a stronger promoter of the SPL7 promoter, a promoter of trp operon, on the chromosome. And the amino acid No. 38 of TrpE was replaced with serine to arginine (SEQ ID NO: 32). This genetic manipulation was confirmed by PCR and genome sequencing using SEQ ID NO: 10 and SEQ ID NO: 11, which can amplify the external regions of the homologous recombination upstream and downstream regions where the gene was inserted, and named CA04-8325. It was.
  • the trpE (S38R) upstream region was sequenced using primers of SEQ ID NO: 1 and SEQ ID NO: 3 with Corynebacterium glutamicum ATCC13869 chromosomal DNA as a template. Using the primer of SEQ ID NO: 4, a gene fragment of the Downsteam region of the trpE 38 mutation was obtained through PCR.
  • Solg TM Pfu-X DNA polymerase As polymerase, Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were denatured at 95 ° C. for 5 minutes, 95 ° C. 30 sec denaturation, 60 ° C. 30 sec annealing, and 72 ° C. 60 sec polymerization 30 times. The polymerization was carried out at 72 ° C. for 5 minutes.
  • Recombinant plasmids were obtained by cloning the trpE (S38R) upstream and trpE (S38R) downstream fragments amplified by the above method, and the vector pDZ for chromosomal transformation cleaved with SmaI restriction enzyme using the Gibson assembly method, and the pDZ- Named trpE (S38R). Cloning was performed by mixing Gibson assembly reagent and each of the gene fragments in the calculated moles and then preserving at 50 ° C. for 1 hour.
  • PDZ-trpE (S38R) vector was transformed into wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation, followed by a crossover process, and amino acid 38 of TrpE was identified on serine on the chromosome. Strains were replaced with those obtained. The genetic manipulation was confirmed by PCR and genome sequencing using SEQ ID NO: 10 and SEQ ID NO: 11, which can amplify the external regions of the homologous upstream and downstream regions where the gene was inserted, and named CA04-8312. It was.
  • the trpE promoter upstream region was identified using primers of SEQ ID NO: 1 and SEQ ID NO: 2 using the Corynebacterium glutamicum ATCC13869 chromosomal DNA as a template. Using the primers of SEQ ID NO: 8 and SEQ ID NO: 4, gene fragments of the trpE promoter downstream (Downsteam) region were obtained through PCR.
  • PCR was performed using primers of SEQ ID NO: 6 and SEQ ID NO: 7 using the synthetic promoter SPL7 as a template.
  • Solg TM Pfu-X DNA polymerase As polymerase, Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were denatured at 95 ° C. for 5 minutes, 95 ° C. 30 sec denaturation, 60 ° C. 30 sec annealing, and 72 ° C. 60 sec polymerization 30 times. The polymerization was carried out at 72 ° C. for 5 minutes.
  • Recombinant plasmids were obtained by cloning the trpE promoter upstream, trpE promoter downstream and SPL7 promoter fragments amplified by the above method, and chromosome transformation vector pDZ digested with SmaI restriction enzymes using the Gibson assembly method, and pDZ-SPL7_trpE Named it. Cloning was performed by mixing Gibson assembly reagent and each of the gene fragments in the calculated moles and then preserving at 50 ° C. for 1 hour.
  • the pDZ-SPL7_trpE vector prepared by the above process was transformed into wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation, and then replaced by the SPL7 promoter, which is a trp operon strong promoter on the chromosome, through a second crossover process.
  • SPL7 promoter which is a trp operon strong promoter on the chromosome
  • This genetic manipulation was confirmed by PCR and genome sequencing using SEQ ID NO: 10 and SEQ ID NO: 11, which can amplify the external regions of the homologous upstream and downstream regions where the gene was inserted, and named CA04-8315. It was.
  • the sequence of the primer used in this Example is as follows.
  • SEQ ID NO: 1 (Pspl7-trpE (S38R) _L-1) TCGAGCTCGGTACCCAAACAACTGCGACGTGTGTC SEQ ID NO: 2 (Pspl7-trpE (S38R) _L-2) CATGAAGCGCCGGTACCTTAATCATTTTTGGGTTC SEQ ID NO: 3 (Pspl7-trpE (S38R) _R-1) GCCCTGTTGGAACGCGCTGATATCACCACCAAGAA SEQ ID NO: 4 (Pspl7-trpE (S38R) _R-2) CTCTAGAGGATCCCCAGATGTCACCGTTGTAAATG SEQ ID NO: 6 (Pspl7-1) CCCAAAAATGATTAAGGTACCGGCGCTTCATGTCA SEQ ID NO: 7 (Pspl7-2) GGGATTCGTGCTCATGATATCTGTTTTGATCTCCTCC SEQ ID NO: 8 (trpE (S
  • Corynebacterium glutamicum ATCC13869 chromosomal DNA was used as a template for the genetic manipulation, and the upstream region to additionally insert the tkt gene was identified using SEQ ID NO: 12 and SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15 Gene fragments in the Downsteam region where additional tkt genes were inserted were obtained by performing PCR.
  • Solg TM Pfu-X DNA polymerase As polymerase, Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were denatured at 95 ° C. for 2 minutes, 95 ° C. 20 seconds denaturation, 62 ° C. 40 seconds annealing, 72 ° C. 30 seconds polymerization, and repeated 27 times. The polymerization was carried out at 72 ° C. for 5 minutes.
  • PCR was performed on the tkt gene fragment containing the tkt promoter using SEQ ID NO: 16 and SEQ ID NO: 17 using the Corynebacterium glutamicum ATCC13869 chromosomal DNA of a wild species as a template. Obtained through.
  • Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were repeated for 2 minutes at 95 ° C., followed by 95 ° C. 20 seconds denaturation, 62 ° C. 40 seconds annealing, and 72 ° C. 1 minute 20 seconds polymerization. After that, the polymerization was carried out at 72 ° C. for 5 minutes.
  • the upstream to which the amplified tkt gene is to be inserted and the downstream region to which the tkt gene is to be inserted, the tkt gene including the tkt promoter, and the chromosome transformation vector pDZ cleaved with SmaI restriction enzyme were cloned using the Gibson assembly method. Recombinant plasmids were obtained and named pDZ-Pn-tkt. Cloning was performed by mixing Gibson assembly reagent and each of the gene fragments in the calculated moles and then preserving at 50 ° C. for 1 hour.
  • the produced pDZ-Pn-tkt vector was transformed into ATCC13869 and CJ04-8325 strains by electroporation, and a second crossover process was performed to obtain a strain in which a tkt gene including a tkt promoter was inserted on a chromosome.
  • the genetic manipulations were confirmed by PCR and genome sequencing using the SEQ ID NO: 18 and SEQ ID NO: 19 primers to amplify the external regions of the upstream and downstream regions of the homologous recombination where the gene was inserted. 8321 and CA04-8352.
  • the sequence of the primer used in this Example is as follows.
  • SEQ ID NO: 12 (Pn-tkt_L-1) TCGAGCTCGGTACCCAAACTTTGAGTGGGTGCGTG SEQ ID NO: 13 (Pn-tkt_L-2) TCGAGCTACGAGGGCGGTTCCCAGCCCTTCATTAG SEQ ID NO: 14 (Pn-tkt_R-1) ATTAACGGTTAATTGATTCTGGACGTCATGACTAC SEQ ID NO: 15 (Pn-tkt_R-2) CTCTAGAGGATCCCCGCCTCGATGATGCAGTCGTC SEQ ID NO: 16 (Pn-tkt-1) GAAGGGCTGGGAACCGCCCTCGTAGCTCGAGAGTT SEQ ID NO: 17 (Pn-tkt-2) CATGACGTCCAGAATCAATTAACCGTTAATGGAGTCC SEQ ID NO: 18 (Confirm_Pn-tkt-1) ACCCAGAACCCCAAATTTTC SEQ ID NO: 19 (Confirm_Pn-tkt-2) TTGAG
  • Glucose 30 g (NH 4 ) 2 SO 4 15 g, MgSO 4 7H 2 O 1.2 g, KH 2 PO 4 1 g, yeast extract 5 g, biotin 900 ⁇ g, thiamine hydrochloride 4500 ⁇ g, calcium-pantothenic acid 4500 ⁇ g, CaCO 3 30 g (based on 1 liter of distilled water).
  • Tryptophan production was not confirmed in CA04-8312, a strain that releases feedback in trpE of wild-type Corynebacterium, CA04-8315, which has enhanced expression of tryptophan operon, and CA04-8321, which has enhanced tkt.
  • CA04-8352 strain which combines these individual traits, produced about five times improved tryptophan compared to CA04-8325. This means that tryptophan operon enrichment with release of feedback to tryptophan and tkt expression enhancement should be combined to improve tryptophan production.
  • the wild type Corynebacterium microorganisms produce only a very small amount of tryptophan, even if they do not produce tryptophan.
  • the promoter upstream and trpDCBA Downsteam regions where chromosomal homologous recombination takes place were first obtained. Specifically, using the primers of SEQ ID NO: 20 and SEQ ID NO: 21 using the Corynebacterium glutamicum chromosomal DNA as a template, the promoter upstream region was used, and the primers of SEQ ID NO: 22 and SEQ ID NO: 23 were further downstream ( Gene fragments from the Downsteam region were obtained by PCR.
  • Solg TM Pfu-X DNA polymerase As polymerase, Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were denatured at 95 ° C. for 5 minutes, 95 ° C. 30 sec. Denaturation, 58 ° C. 30 sec. Annealing, and 72 ° C. 60 sec. Polymerization 30 times. The polymerization was carried out at 72 ° C. for 5 minutes.
  • PCR was performed using primers of SEQ ID NO: 24 and SEQ ID NO: 25 using the synthetically produced promoter SPL7 as a template.
  • Polymerase was used Solg TM Pfu-X DNA polymerase (SolGent co.), PCR amplification conditions were denatured at 95 °C for 5 minutes, 95 °C 30 seconds denaturation, 58 °C 30 seconds annealing, 72 °C 60 seconds polymerization After repeating 30 times, the polymerization was performed at 72 ° C. for 5 minutes.
  • PCR was performed using SEQ ID NO: 26 and SEQ ID NO: 27 using E. coli W3110 genomic DNA as a template.
  • Solg TM Pfu-X DNA polymerase As polymerase, Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were denatured at 95 ° C. for 5 minutes, 95 ° C. 30 sec. Denaturation, 58 ° C. 30 sec. Annealing, and 72 ° C. 30 sec. The polymerization was carried out at 72 ° C. for 5 minutes.
  • PCR was performed using E. coli W3110 genomic DNA as a template.
  • Solg TM Pfu-X DNA polymerase was used, and PCR amplification conditions were denatured at 95 ° C. for 5 minutes, 95 ° C. 30 sec. Denaturation, 58 ° C. 30 sec. Annealing, and 72 ° C. 7 min polymerization 30 times. The polymerization was carried out at 72 ° C. for 10 minutes.
  • Recombinant plasmids were obtained by cloning using the Gibson assembly method and named pDZ-PSPL7-trpE (P21S) DCBA.eco. Cloning was performed by mixing Gibson assembly reagent and each of the gene fragments in the calculated moles and then preserving at 50 ° C. for 1 hour.
  • the pDZ-PSPL7-trpE (P21S) DCBA.eco vector was transformed into wild-type Corynebacterium glutamicum ATCC13869, CJ04-8321 and CJ04-8352 strains by electroporation, followed by a second crossover process, followed by chromosomes.
  • the genetic manipulations were confirmed by PCR and genome sequencing using the SEQ ID NO: 30 and SEQ ID NO: 31 primers, which can amplify the external regions of the upstream and downstream regions of the homologous recombination where the gene was inserted. 8316, CA04-8330 and CA04-8357.
  • the sequence of the primer used in this Example is as follows.
  • CA04-8330 and CA04-8357 strains prepared in Example 4 and the CA04-8352 strain prepared in Example 2 was cultured in the following manner. Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and shaken at 200 rpm for 20 hours at 30 ° C. Thereafter, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and shake-cultured at 200 rpm for 24 hours. After the incubation, the production amount of L-tryptophan was measured by HPLC.
  • Glucose 30 g (NH 4 ) 2 SO 4 15 g, MgSO 4 7H 2 O 1.2 g, KH 2 PO 4 1 g, yeast extract 5 g, biotin 900 ⁇ g, thiamine hydrochloride 4500 ⁇ g, calcium-pantothenic acid 4500 ⁇ g, CaCO 3 30 g (based on 1 liter of distilled water).
  • Tryptophan operon expression-enhanced strain CA04-8316 containing E. coli-derived trpE released wild-type Corynebacterium produced L-tryptophan at 0.03 g / L
  • CA04-8321 enhanced with tkt only
  • the yield of tryptophan of the strain CA04-8330 enhanced with the release of E. coli-derived tryptophan operon was improved to 0.32 g / L.
  • tryptophan production was expected to be about 0.3-0.6 g / L, but it produced 2.72 g / L, which is about 10 times better than CA04-8352.
  • KCCM Korea Microorganism Conservation Center

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 유전자 조작기법을 이용한 재조합 L-트립토판을 생산하는 코리네박테리움속 미생물, 및 상기 미생물을 이용하여 L-트립토판을 생산하는 방법에 관한 것이다.

Description

L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 L-트립토판을 생산하는 방법
본 출원은 유전자 조작기법을 이용한 재조합 L-트립토판을 생산하는 코리네박테리움속 미생물, 및 상기 미생물을 이용하여 L-트립토판을 생산하는 방법에 관한 것이다.
L-트립토판은 필수 아미노산의 하나로 사료 첨가제, 또는 수액제 등의 의약품 원료 및 건강식품소재 등으로 널리 사용되어 왔다. 현재에는 미생물을 이용한 직접 발효법이 L-트립토판 생산에 주로 이용되고 있다.
L-트립토판 생산에 사용되는 미생물들은 초기에 화학적 또는 물리적 돌연변이를 통한 유사체 내성 선별 균주들이 주로 사용되어 왔으나, 1990년대 유전자 재조합 기술의 급격한 발전과 분자수준의 조절 기작들이 규명됨에 따라 유전자 조작 기법을 이용한 재조합 균주들이 주로 사용되고 있다.
한편, 대장균을 이용한 L-트립토판 생산 연구는 당유입, pentose phosphate pathway, 세린 생합성, aromatic/tryptophan 생합성에 걸쳐 다양한 연구가 진행되었고 현재 산업적 생산까지 이어지고 있다. GRAS(Generally Recognized as Safe) 균주인 코리네박테리움속 미생물은 Endotoxin-free와 같은 장점이 있어 글루탐산, 라이신, 발린 생산에 적용되고 있음에도 불구하고, 트립토판 경우 유전자 regulation에 대한 연구가 대장균에 비해 진행이 미비하여 산업적 생산까지는 적용되지 않은 실정이다.
본 출원에서는 대사공학적 관점에서 코리네박테리움속 미생물에 유전자 조작을 통하여 트립토판 생합성 경로를 강화시킴과 동시에 트립토판 생합성의 첫 기질인 에리스로즈 4-포스페이트가 증가되도록 함으로써, 트립토판 생산능이 획기적으로 향상됨을 확인하여 본 출원을 완성하였다.
본 출원의 하나의 목적은, L-트립토판을 과생산할 수 있도록 유전자 재조합된, L-트립토판을 생산하는 코리네박테리움속 미생물을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은, 상기 미생물을 배지에서 배양하는 단계; 및 상기 배양된 미생물 또는 배지로부터 L-트립토판을 회수하는 단계를 포함하는, L-트립토판 생산 방법을 제공하는 것이다.
본 출원에서 제공되는 L-트립토판 생산 미생물은 피드백 해제된 트립토판 오페론과 트랜스케토라제를 코딩하는 유전자의 발현을 강화함으로써 발효 안정성이 뛰어난 코리네박테리움속 미생물에서 L-트립토판의 생산량을 향상시킬 수 있다. 추가로, 상기 코리네박테리움 속 미생물에 대장균 유래의 피드백 해제된 트립토판 오페론의 발현이 조합되면 L-트립토판의 생산량을 획기적으로 향상시킬 수 있다. 이에, 산업적으로 유용하게 사용할 수 있고, 발효 안정성이 강화되어 L-트립토판을 효과적으로 생산하는 코리네박테리움속 미생물을 제공할 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
상기 목적을 달성하기 위한 본 출원의 하나의 양태는, N-말단이 서열번호 32의 아미노산 서열로 구성되고 피드백 저해가 해제된 안스라닐산 합성효소를 코딩하는 유전자와 이를 포함하는 트립토판 오페론 및 트랜스케토라제를 코딩하는 유전자의 발현이 강화된, L-트립토판을 생산하는 코리네박테리움속 미생물을 제공하는 것이다.
본 출원의 다른 하나의 양태는, 상기 미생물에 추가적으로 N-말단이 서열번호 33의 아미노산 서열로 구성된 피드백 해제된 안스라닐산 합성효소를 코딩하는 유전자와 이를 포함하는 대장균 유래 트립토판 오페론이 발현되도록 변형된, L-트립토판을 생산하는 코리네박테리움속 미생물을 제공하는 것이다.
본 출원에서 용어, " L-트립토판(L-tryptophan)"은 α-아미노산의 하나로, 체내에서 합성되지 않는 필수 아미노산이며 화학식이 C11H12N2O2인 방향족 아미노산을 말한다.
본 출원에서 용어, “트립토판 오페론(tryptophan operon; Trp operon)”은 코리스민산(chorismic acid; chorismate)로부터 트립토판을 합성하는데 관여하는 효소를 암호화 하고 있는 유전자군을 의미한다. 구체적으로, 트립토판 오페론은 코리네박테리움 속 미생물 유래의 트립토판 오페론, 또는 에스케리키아 속 미생물 유래의 트립토판 오페론일 수 있다. 구체적으로, 상기 코리네박테리움 속 미생물 유래의 트립토판 오페론은 서열번호 34의 뉴클레오티드 서열일 수 있으나, 이에 제한되는 것은 아니다. 또한, 상기 에스케리키아 속 미생물 유래의 트립토판 오페론은 서열번호 43의 뉴클레오티드 서열일 수 있으나, 이에 제한되는 것은 아니다. 상기 트립토판 오페론의 유전자군은 코리네박테리움 속 미생물에서는 trpE, trpG, trpD, trpC, trpB, 및 trpA 유전자로 구성되는 군에서 선택되는 하나 이상의 유전자, 에스케리키아속 미생물에서는 trpE, trpD, trpC, trpB, 및 trpA 유전자로 구성되는 군에서 선택되는 하나 이상의 유전자가 촉진자와 작동인자 하부에 배열되어 오페론을 구성한다. 구체적으로, 코리네박테리움 속 미생물의 상기 trpE, trpG, trpD, trpC, trpB, trpA 유전자는 각각 서열번호 35, 서열번호 36, 서열번호 37, 서열번호 38, 서열번호 39, 서열번호 40의 아미노산 서열의 폴리펩티드를 발현하는 것일 수 있으나 이에 제한되는 것은 아니다. 또한, 구체적으로 에스케리키아속 미생물의 상기 trpE, trpD, trpC, trpB, trpA 유전자는 각각 서열번호 44, 서열번호 45, 서열번호 46, 서열번호 47, 서열번호 48의 아미노산 서열의 폴리펩티드를 발현하는 것일 수 있으나 이에 제한되는 것은 아니다. 구체적으로 상기 코리네박테리움속 미생물은 코리네박테리움 글루타미쿰일 수 있고, 에스케리키아속 미생물은 대장균일 수 있다. 상기 트립토판 오페론은 공지된 뉴클레오티드 서열을 가질 수 있으며, 당업자는 NCBI 또는 Kegg 등의 데이터베이스를 통해 트립토판 오페론의 뉴클레오티드 서열을 용이하게 수득할 수 있다. 통상의 트립토판 오페론은 세포가 요구하는 충분한 양의 트립토판을 생산할 수 있도록 활발히 전사하지만, 세포내 트립토판이 충분히 존재하는 경우에 억제인자(repressor)가 트립토판과 결합하여 트립토판 오페론이 불활성화되므로 전사가 억제된다. 이에 트립토판을 미생물에서 과량으로 생산하기 위해서는 트립토판 오페론의 억제인자가 작동하지 않도록 해야 하며, 트립토판에 의해 피드백 억제를 받지 않도록 유전자 조작이 필요하다.
상기 트립토판 오페론에 의해 코딩되는 단백질은 안스라닐산 합성효소(anthranilate synthase), 안스라닐산 포스포리보실 전이효소(anthranilate phosphoribosyltransferase), 포스포리보실 안트라닐산 이성화효소(phosphoribosylanthranilate isomerase), 인돌-3-글리세롤 인산합성 효소(indole-3-glycerol phosphate synthase) 및 트립토판 합성효소(tryptophan synthase)로 공지되어 있다. 그러나 이에 제한되는 것은 아니다. 구체적으로, 먼저 안스라닐산 합성효소가 코리스믹산에 작용하여 안스라닐산(anthranilic acid)을 합성한다. 이어서 안스라닐산 포스포리보실 전이효소가 작용하여 포스포리보실 안트라닐산 (N -(5'-phosphoribosyl)-anthranilate)을 합성한다. 이어서 포스포리보실 안트라닐산 이성화효소 와 인돌-3-글리세롤 인산합성 효소가 작용하여 인돌-3-글리세롤 인산 (indole-3-glycerol-phosphate)을 합성하고, 여기에 트립토판 합성효소가 작용하여 L-트립토판 합성을 완성한다(Bonggaerts　et al.,　Metab　Eng,　3, 289-300, 2001, Iris Brune et al., J.Bacteriol., 189(7):2720-33, 2007).
본 출원에서 상기 "안스라닐산 합성효소 (anthranilate synthase)"는 코리스믹산으로 부터 안스라닐산을 합성하는 효소를 의미한다. 본 출원의 상기 안스라닐산 합성효소는 코리네박테리움 속 미생물 유래의 안스라닐산 합성효소, 또는 에스케리키아 속 미생물 유래의 안스라닐산 합성효소일 수 있다. 코리네글루타미쿰의 경우 트립토판 오페론 내의 trpE와 trpG 유전자가 생성하는 단백질이, 대장균의 경우 trpE와 trpD 유전자가 생성하는 단백질이 중합체를 이뤄 안트라닐산 합성효소를 형성한다.
본 출원의 안스라닐산 합성효소는 이의 활성을 갖는 야생형 또는 천연형 단백질과 달리, 최종 산물인 트립토판, 이의 유도체 또는 유사체에 의한 피드백 저해가 해제되거나 탈감작된 특징을 가진다. 본 출원에서 용어, “피드백 저해 (feedback inhibition)”는 효소계의 종산물이 그 효소계의 초기 단계에 있는 반응을 저해하거나 억제하는 것을 의미한다. 따라서, 안스라닐산 합성효소의 피드백 저해를 해제하거나 탈감작하는 경우, 그렇지 않은 경우에 비하여 트립토판의 생산성을 높일 수 있다.
상기 피드백 저해가 해제된 안스라닐산 합성효소는 트립토판에 의한 피드백 저해가 해제되거나 탈감작되기만 하면 본 출원에 포함되는 것은 자명하다. 구체적으로, 상기 피드백 저해가 해제된 안스라닐산 합성효소는 N-말단이 서열번호 32의 아미노산 서열로 구성된 것이거나, N-말단이 서열번호 33의 아미노산 서열로 구성된 것일 수 있다. 상기 서열번호 32의 아미노산 서열은 38번 위치의 세린이 알지닌으로 치환된 서열이며, 상기 서열번호 33의 아미노산 서열은 21번 위치의 프롤린이 세린으로 치환된 서열이다. 상기 서열번호 32의 아미노산 서열 또는 서열번호 33의 아미노산 서열로 구성되는 폴리펩티드는 서열번호 32 또는 서열번호 33의 아미노산 서열을 가지는 폴리펩티드, 서열번호 32 또는 33의 아미노산으로 이루어진 폴리펩티드, 또는 서열번호 32 또는 33의 아미노산 서열을 포함하는 폴리펩티드와 혼용되어 사용될 수 있다.
상기 안스라닐산 합성효소는 코리네박테리움속 미생물 유래의 공지된 아미노산 서열이나 에스케리키아속 미생물 유래의 아미노산 서열을 가질 수 있으며, 당업자는 NCBI 또는 Kegg 등의 데이터베이스를 통해 안스라닐산 합성효소의 아미노산 서열을 용이하게 수득할 수 있다. 다만, 피드백 저해 (feedback inhibition) 해소를 위해 코리네박테리움 속 미생물 유래의 경우 전체 아미노산 서열에서 N-말단이 서열번호 32의 아미노산을 포함하기만 하면, 그 이후는 공지된 아미노산 서열이거나 다른 피드백 저해 해제 변이를 포함한 아미노산 서열일 수 있다. 에스케리키아속 미생물 유래의 경우 피드백 저해 해소를 위해 전체 아미노산 서열로부터 N-말단이 서열번호 33의 아미노산을 포함하기만 하면, 그 이후는 공지된 아미노산 서열이거나 다른 피드백 저해 해제 변이를 포함한 아미노산 서열일 수 있다.
본 출원에서의 안스라닐산 합성효소는 비록 N-말단이 서열번호 32 또는 서열번호 33의 아미노산을 포함하는 폴리펩티드라고 정의하였지만, 38번 위치가 알지닌인 것을 제외한 서열번호 32, 또는 21번 아미노산이 세린인 것을 제외한 서열번호 33의 아미노산 서열 내에 자연적으로 발생할 수 있는 돌연변이, 혹은 이의 잠재성 돌연변이 (silent mutation)를 제외하는 것이 아니며, 서열번호 32 또는 서열번호 33의 아미노산 서열을 포함하는 폴리펩티드와 서로 동일 또는 상응하는 활성을 가지는 경우라면 본원의 안스라닐산 합성효소에 해당됨은 당업자에게 자명하다. 구체적인 예를 들어, 본원의 코리네박테리움속 미생물 유래의 안스라닐산 합성효소는 38번 위치가 알지닌인 것을 포함하고, 서열번호 32의 아미노산 서열 또는 이와 70%, 80%, 90%, 95%, 또는 97% 이상의 상동성을 갖는 아미노산 서열로 구성되는 폴리펩티드일 수 있다. 또한, 본원의 에스케리키아속 미생물 유래의 안스라닐산 합성효소는 21번 위치가 세린인 것을 포함하고, 서열번호 33의 아미노산 서열 또는 이와 70%, 80%, 90%, 95%, 또는 97% 이상의 상동성을 갖는 아미노산 서열로 구성되는 폴리펩티드일 수 있다. 이러한 상동성을 가지며 상기 폴리펩티드에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 폴리펩티드도 본 출원의 범위 내에 포함됨은 자명하다.
본 출원에서 용어, '상동성(homology)' 또는 '동일성(identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열과 서로 관련된 정도를 의미하며 백분율로 표시될 수 있다.
용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된 (conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나 (homologous) 또는 동일한 (identical) 서열은 중간 또는 높은 엄격한 조건(stringent conditions)에서 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90% 이상으로 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다 (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48: 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 일진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다. 또한, 임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다.
상기 안스라닐산 합성효소를 코딩하는 폴리뉴클레오티드는 상기 안스라닐산 합성효소를 코딩할 수 있는 서열이라면 제한 없이 포함될 수 있다.
또한, 상기 안스라닐산 합성효소를 코딩하는 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리펩티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩티드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 한편, 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드는 이와 70%, 80%, 90%, 95%, 또는 97% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드 서열을 포함하는 폴리뉴클레오티드일 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 실질적으로 상기 폴리펩티드와 동일하거나 상응하는 효능을 나타내는 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 폴리뉴클레오티드 서열도 본 출원의 범위 내에 포함됨은 자명하다. 또한 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, N-말단이 서열번호 32 또는 서열번호 33의 아미노산 서열로 이루어진 폴리펩티드와 동등 또는 유사한 활성을 가지는 폴리펩티드를 암호화하는 서열이라면 제한없이 포함될 수 있다. 상기 “엄격한 조건”이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌 (예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성이 높은 유전자끼리, 70% 이상, 80% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화의 세척 조건인 60℃, 1×SSC, 0.1% SDS, 구체적으로는 60℃, 0.1×SSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1×SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다. 그러나 이에 제한되는 것은 아니며, 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다. 혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, “상보적”은 서로 혼성화가 가능한 뉴클레오티드의 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 뉴클레오티드 서열뿐만 아니라 전체 서열에 상보적인 단리된 뉴클레오티드 단편을 포함할 수 있다. 구체적으로, 상동성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다. 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
본 출원에서 용어, “트랜스케토라제(transketolase)”는 프럭토스-6-포스페이트 및 글리세르알데하이드-3-포스페이트의 자일룰로즈-5-포스페이트 및 에리스로즈 4-포스페이트(E4P, erythorse-4-phosphate)로의 전환을 촉진시키는 효소를 의미한다 (Kochetov, G. A. 1982, Transketolase from yeast, rat liver, and pig liver, Methods Enzymol., 90:209-23). 트립토판 생산은 방향족 아미노산 대사회로로부터 기인하며, 이 대사회로는 포스포엔올피루베이트 (Phosphoenolpyruvate)와 에리스로즈 4-포스페이트 (Erythrose 4-phosphate)의 축합 반응으로 시작된다. 따라서 두 가지 전구체의 원활한 공급은 트립토판 생산성 향상에 필수적이며 본 출원에서는 상대적으로 부족하다고 알려진 트립토판의 전구체로서 에리스로즈 4-포스페이트의 원활한 공급을 위해 tkt 유전자의 발현을 강화시키고자 한다.
본 출원의 트랜스케토라제는 상기 활성을 가지고 있으면 미생물의 유래에 관계없이 당업자가 이의 활성을 가지는 아미노산 서열을 자명하게 이용할 수 있다. 구체적으로, 코리네박테리움속 미생물 유래의 공지된 아미노산 서열이나 에스케리키아속 미생물 유래의 아미노산 서열을 가질 수 있으며, 당업자는 NCBI 또는 Kegg 등의 데이터베이스를 통해 트랜스케토라제의 아미노산 서열을 용이하게 수득할 수 있다. 더욱 구체적으로, 트랜스케토라제는 코리네박테리움속 미생물 유래일 수 있으며, 더욱 더 구체적으로 코리네박테리움 글루타미쿰 유래일 수 있다. 구체적으로, 코리네박테리움 글루타미쿰 유래 트랜스케토라제는 서열번호 41의 뉴클레오티드 서열 또는 서열번호 42의 아미노산 서열을 이용할 수 있다.
본 출원에서 용어, 유전자의 “발현이 강화된/되도록”은 목적 유전자가 기능을 가진 단백질로의 합성이 내재적 또는 변형 전에 비하여 증가된 상태를 의미한다. 상기에서 “내재적”은 자연적, 또는 인위적 요인에 의한 유전적 변이로 미생물의 형질이 변화하는 경우, 형질 변화 전 모균주가 본래 가지고 있던 상태를 의미한다.
구체적으로, 본 출원의 발현 강화는 목적 단백질을 코딩하는 유전자의 세포 내 카피수 증가, 상기 단백질을 암호화하는 염색체상 유전자의 발현 조절 서열에 변이를 도입하는 방법, 상기 단백질을 암호화하는 염색체상의 유전자 발현 조절 서열을 활성이 강력한 서열로 교체하는 방법, 상기 단백질 활성이 증가되도록 돌연변이된 유전자로 염색체상의 상기 단백질을 암호화하는 유전자를 대체하는 방법 및 상기 단백질의 활성이 강화되도록 상기 단백질을 암호화하는 염색체상의 유전자에 변이를 도입시키는 방법으로 이루어진 군으로부터 선택되는 어느 하나 이상의 방법으로 이루어질 수 있다. 더욱 구체적으로, 본 출원의 발현 강화는 목적 유전자의 프로모터를 강력한 프로모터로 치환한 것일 수 있다.
상기에서 유전자의 카피수 증가는, 특별히 이에 제한되지 않으나, 벡터에 작동 가능하게 연결된 형태로 수행되거나, 숙주세포 내의 염색체 내로 삽입됨으로써 수행될 수 있다. 구체적으로, 본 출원의 단백질을 코딩하는 폴리뉴클레오티드가 작동 가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터가 숙주세포 내에 도입되는 것일 수 있다. 또는, 상기 폴리뉴클레오티드가 작동 가능하게 연결된, 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포의 염색체 내에 도입되는 것일 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있다.
다음으로, 폴리뉴클레오티드의 발현이 증가하도록 발현 조절서열을 변형하는 것은, 특별히 이에 제한되지 않으나, 상기 발현 조절서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖는 핵산 서열로 교체함에 의하여 수행될 수 있다. 상기 발현 조절서열은, 특별히 이에 제한되지 않으나, 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다.
상기 폴리뉴클레오티드 발현 단위의 상부에는 본래의 프로모터 대신 강력한 프로모터가 연결될 수 있으며 이에 한정되는 것은 아니다. 공지된 강력한 프로모터의 예에는 cj1 내지 cj7 프로모터(대한민국 등록특허 제10-0620092호), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터 (대한민국 등록특허 제10-1783170호), O2 프로모터(대한민국 등록특허 제10-1632642), tkt 프로모터 및 yccA 프로모터 등이 있으나 이에 한정되는 것은 아니다.
아울러, 염색체상의 폴리뉴클레오티드 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다.
본 출원에서 용어, 유전자의 “도입”은, 미생물이 본래 가지고 있지 않았던 유전자가 그 미생물내에서 발현됨에 따라 특정 단백질의 활성을 나타나게 되는 것 또는 해당 단백질의 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타나게 되는 것을 의미한다. 예를 들어, 특정 단백질을 코딩하는 폴리뉴클레오티드가 미생물 내 염색체로 도입되거나, 특정 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터가 미생물 내로 도입되어 이의 활성이 나타나는 것일 수 있다.
이와 같은 단백질 활성의 도입 및 강화는, 상응하는 단백질의 활성 또는 농도가 야생형이나 비변형 미생물 균주에서의 단백질의 활성 또는 농도를 기준으로 하여 일반적으로 최소 1%, 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% 또는 500%, 최대 1000% 또는 2000%까지 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, “L-트립토판을 생산하는 미생물”은 배지 중의 탄소원으로부터 L-트립토판을 야생형이나 비변형 미생물과 비교하여 과량으로 생산할 수 있는 미생물을 의미한다. 또한, 상기 L-트립토판을 생산하는 미생물은 재조합 미생물일 수 있다. 구체적으로 L-트립토판을 생산할 수 있다면 그 종류가 특별히 제한되지 않으나, 엔테로박터(Enterbacter) 속, 에스케리키아(Escherichia) 속, 어위니아(Erwinia) 속, 세라티아(Serratia) 속, 프로비덴시아(Providencia) 속, 코리네박테리움(Corynebacterium) 속 및 브레비박테리움(Brevibacterium) 속에 속하는 미생물 일 수 있다. 보다 구체적으로는 에스케리키아(Escherichia) 속 또는 코리네박테리움(Corynebacterium) 속에 속하는 미생물일 수 있다.
보다 더욱 구체적으로는 코리네박테리움(Corynebacterium) 속 미생물은 코리네박테리움 글루타미쿰 (corynebacterium glutamicum)일 수 있으나, 트립토판 오페론 및 트랜스케토라제를 코딩하는 유전자의 발현이 강화되어 L-트립토판 생산량이 증가될 수 있는 코리네박테리움 속에 속하는 미생물은 제한 없이 포함될 수 있다.
상기 목적을 달성하기 위한 본 출원의 또 다른 하나의 양태는, N-말단이 서열번호 32의 아미노산 서열로 구성되고 피드백 저해가 해제된 안스라닐산 합성효소를 코딩하는 유전자와 이를 포함하는 트립토판 오페론 및 트랜스케토라제를 코딩하는 유전자의 발현이 강화된, L-트립토판을 생산하는 코리네박테리움속 미생물을 배지에서 배양하는 단계; 및 상기 배양된 미생물 또는 배지로부터 L-트립토판을 회수하는 단계를 포함하는, L-트립토판 생산 방법을 제공하는 것이다.
상기 N-말단이 서열번호 32 또는 서열번호 33의 아미노산 서열로 구성되고 피드백 저해가 해제된 안스라닐산 합성효소, 트립토판 오페론, 트랜스케톨라제, L-트립토판, 및 미생물에 대해서는 상기에서 설명한 바와 같다.
본 출원에서 용어, "배양"은 상기 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, “배지”는 상기 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 프룩토오스, 수크로오스, 말토오스, 만니톨, 소르비톨 등과 같은 탄수화물; 당 알코올, 글리세롤, 피루브산, 락트산, 시트르산 등과 같은 알코올; 유기산, 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
본 출원에서, 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
배지의 온도는 20 ℃ 내지 50 ℃, 구체적으로는 30 ℃ 내지 37 ℃일 수 있으나 이에 제한되지 않는다. 배양 기간은 유용 물질의 원하는 생성량이 수득될 때까지 계속될 수 있으며, 구체적으로는 10 시간 내지 100 시간일 수 있으나 이에 제한되지 않는다.
상기 트립토판을 회수하는 단계는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 배지로부터 목적하는 L-트립토판을 회수할 수 있다. 예컨대 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 및 이들의 방법을 조합하여 사용될 수 있으나, 이들 예에 한정되는 것은 아니다.
상기 회수 단계는 추가적인 정제 공정을 포함할 수 있다. 상기 정제공정은 당해 기술분야에 공지된 적합한 방법을 이용하여, 회수된 L-트립토판을 정제할 수 있다.
본 출원은 또 다른 하나의 양태로서, N-말단이 서열번호 32의 아미노산 서열로 구성되고 피드백 저해가 해제된 안스라닐산 합성효소를 코딩하는 유전자와 이를 포함하는 트립토판 오페론 및 트랜스케토라제를 코딩하는 유전자의 발현이 강화된 코리네박테리움속 미생물의 L-트립토판 생산용도를 제공한다.
또한, 본 출원은 또 다른 하나의 양태로서, 상기 미생물에 추가적으로 N-말단이 서열번호 33의 아미노산 서열로 구성된 피드백 해제된 안스라닐산 합성효소를 코딩하는 유전자와 이를 포함하는 대장균 유래 트립토판 오페론이 발현되도록 변형된 코리네박테리움속 미생물의 L-트립토판 생산용도를 제공한다.
상기 용어, "안스라닐산 합성효소", "트립토판 오페론", "트랜스케토라제", "발현이 강화된", "도입", "L-트립토판"은 전술한 바와 같다.
이하 본 출원을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1 : Trp 오페론 발현강화 및 피드백 저항성(Feedback-resistant) trpE 변이 적용
야생형의 코리네박테리움 글루타미쿰은 L-트립토판을 생산하지 못하거나 생산하더라도 극미량으로 생산할 뿐이므로, 생산에 필수적인 생합성 경로를 야생형 코리네박테리움 글루타미쿰에서 강화하고자 하였다.
코리네박테리움 글루타미쿰 ATCC13869에서, L-트립토판 생합성 유전자의 오페론(operon)을 프로모터 강화를 통해 발현을 향상시켰다. 또한 추가적으로 L-트립토판 생산 향상에 따른 TrpE 폴리펩티드의 피드백 제한 (feedback inhibition) 해소를 위해 TrpE의 N-말단으로부터 38번 아미노산인 세린 (Serine)을 알지닌 (Arginine)으로 치환하였다 (서열번호 32) (JOURNAL OF BACTERIOLOGY, Nov. 1987, p. 5330-5332).
이러한 유전자 조작을 위해 우선 염색체상 상동재조합 (Homologous recombination)이 발생하는 trpE 프로모터 업스트림 (Upstream) 과 trpE 38번 변이 다운스트림 (Downsteam) 지역을 수득하였다. 구체적으로 코리네박테리움 글루타미쿰 ATCC13869 염색체 DNA를 주형으로 하여 서열번호 1과 서열번호 2의 프라이머를 이용하여 trpE 프로모터 업스트림 (Upstream) 지역을, 서열번호 3와 서열번호 4의 프라이머를 이용하여 trpE 38번 변이 다운스트림 (Downsteam) 지역의 유전자 단편을 PCR을 수행을 통해 수득하였다.
중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 60℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
합성 제작한 프로모터 SPL7(서열번호 5, 대한민국 등록특허 제 10-1783170호)을 주형으로 서열번호 6과 서열번호 7 의 프라이머를 이용하여 PCR을 수행하였다.
서열번호 5 (SPL7 promoter seq.)
GGCGCTTCATGTCAACAATCTTTAACGTTTTCAAGTTCACAAGTCGTGTTCAAATGGTGACAAGATTGGACACTGTGCTGAATTGGCACCAAGCCCTCATAAATGATAGATCTAAATCGAATATCAATATATGGTCTGTTTATTGGAACGCGTCCCAGTGGCTGAGACGCATCCGCTAAAGCCCCAGGAACCCTGTGCAGAAAGAACAAATAATCGTGAATTTTGGCAGCAACAGCAATTCCTGCTACAATTGAAAACGTGCAAAAGCATAGATTATTGGAGGAGATCAAAACA
중합효소는 SolgTM Pfu-X DNA 폴리머라제 (SolGent co.)를 사용하였으며, PCR증폭 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 62℃ 30초 어닐링, 72℃ 30초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
코리네박테리움 글루타미쿰 유래의 trpE 38번 변이 앞 부분 단편을 확보하기 위하여, 코리네박테리움 글루타미쿰 게놈 DNA를 주형으로 하여 서열번호 8과 서열번호 9의 프라이머를 이용하여 PCR을 수행하였다.
중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR증폭 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 62℃ 30초 어닐링, 72℃ 30초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
증폭된 trpE 프로모터 업스트림과 trpE 38번 변이 다운스트림 지역, SPL7 프로모터와 trpE 38번 앞 부분 단편, 그리고 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDZ(특허등록 제10-0924065호) 는 깁슨 어셈블리 (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDZ-PSPL7-trpE (S38R)로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
제작된 pDZ-PSPL7-trpE (S38R) 벡터를 야생형 코리네박테리움 글루타미쿰 ATCC13869 균주에 전기천공법으로 형질 전환 후, 2차 교차 과정을 거쳐 염색체 상에서 trp 오페론의 프로모터를 보다 강한 프로모터인 SPL7 프로모터로 교체하고, TrpE의 38번 아미노산이 세린에서 알지닌으로 교체(서열번호 32)된 균주를 얻었다. 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 10과 서열번호 11를 이용한 PCR 법과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였으며, 이를 CA04-8325 로 명명하였다.
추가적으로 trpE S38R 변이만을 도입하기 위해, 코리네박테리움 글루타미쿰 ATCC13869 염색체 DNA를 주형으로 하여 서열번호 1과 서열번호 9의 프라이머를 이용하여 trpE(S38R) 업스트림 (Upstream) 지역을, 서열번호 3과 서열번호 4의 프라이머를 이용하여 trpE 38번 변이 다운스트림 (Downsteam) 지역의 유전자 단편을 PCR을 수행을 통해 수득하였다.
중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 60℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
상기의 방법으로 증폭된 trpE(S38R) 업스트림과 trpE(S38R) 다운스트림 단편, 그리고 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDZ를 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDZ-trpE (S38R)로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
상기의 과정으로 제작된 pDZ-trpE (S38R) 벡터를 야생형 코리네박테리움 글루타미쿰 ATCC13869 균주에 전기천공법으로 형질 전환 후, 2차 교차 과정을 거쳐 염색체 상에서 TrpE의 38번 아미노산이 세린에서 알지닌으로 교체된 균주를 얻었다. 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 10과 서열번호 11를 이용한 PCR 법과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였으며, 이를 CA04-8312 로 명명하였다.
그리고 trp 오페론의 프로모터를 보다 강한 프로모터인 SPL7 프로모터로 교체하기 위하여 코리네박테리움 글루타미쿰 ATCC13869 염색체 DNA를 주형으로 하여 서열번호 1와 서열번호 2의 프라이머를 이용하여 trpE 프로모터 업스트림 (Upstream) 지역을, 서열번호 8과 서열번호 4의 프라이머를 이용하여 trpE 프로모터 다운스트림 (Downsteam) 지역의 유전자 단편을 PCR을 수행을 통해 수득하였다.
합성 제작한 프로모터 SPL7을 주형으로 서열번호 6과 서열번호 7의 프라이머를 이용하여 PCR을 수행하였다.
중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 60℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
상기의 방법으로 증폭된 trpE 프로모터 업스트림, trpE 프로모터 다운스트림과 SPL7 프로모터 단편, 그리고 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDZ를 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDZ-SPL7_trpE 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
상기의 과정으로 제작된 pDZ-SPL7_trpE 벡터를 야생형 코리네박테리움 글루타미쿰 ATCC13869 균주에 전기천공법으로 형질 전환 후, 2차 교차 과정을 거쳐 염색체 상에서 trp 오페론이 강한 프로모터인 SPL7 프로모터로 교체된 균주를 얻었다. 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 10과 서열번호 11를 이용한 PCR 법과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였으며, 이를 CA04-8315 로 명명하였다.
본 실시예서 사용한 프라이머의 서열은 다음과 같다.
서열번호 1 (Pspl7-trpE(S38R)_L-1) TCGAGCTCGGTACCCAAACAACTGCGACGTGTGTC
서열번호 2 (Pspl7-trpE(S38R)_L-2) CATGAAGCGCCGGTACCTTAATCATTTTTGGGTTC
서열번호 3 (Pspl7-trpE(S38R)_R-1) GCCCTGTTGGAACGCGCTGATATCACCACCAAGAA
서열번호 4 (Pspl7-trpE(S38R)_R-2) CTCTAGAGGATCCCCAGATGTCACCGTTGTAAATG
서열번호 6 (Pspl7 - 1) CCCAAAAATGATTAAGGTACCGGCGCTTCATGTCA
서열번호 7 (Pspl7 - 2) GGGATTCGTGCTCATGATATCTGTTTTGATCTCCTCC
서열번호 8 (trpE (S38R) - 1) ATCAAAACAGATATCATGAGCACGAATCCCCATGT
서열번호 9 (trpE (S38R) - 2) GTGGTGATATCAGCGCGTTCCAACAGGGCTGCATC
서열번호 10(Confirm_Pspl7-trpE(S38R) - 1) GAAGAAGAGGCTGCAGATG
서열번호 11 (Confirm_Pspl7-trpE(S38R) - 2) GATCAGCGCCATCATGTT
실시예 2 : tkt 유전자 발현 강화 (트랜스케토라제 발현 강화)
트립토판의 전구체로서 에리스로즈 4-포스페이트의 원활한 공급을 위해 tkt 유전자의 과발현을 진행하고자 하였다.
이러한 유전자 조작을 위해 코리네박테리움 글루타미쿰 ATCC13869 염색체 DNA를 주형으로 하여 프라이머 서열번호 12와 서열번호 13를 이용하여 tkt 유전자를 추가 삽입할 업스트림 (Upstream) 지역을, 서열번호 14와 서열번호 15를 이용하여 tkt 유전자를 추가 삽입할 다운스트림 (Downsteam) 지역의 유전자 단편을 PCR을 수행을 통해 수득하였다.
중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭 조건은 95 ℃에서 2분간 변성 후, 95℃ 20초 변성, 62℃ 40초 어닐링, 72℃ 30초 중합을 27회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
또한, tkt 유전자와 프로모터를 확보하기 위하여, 야생종의 코리네박테리움 글루타미쿰 ATCC13869 염색체 DNA를 주형으로 하여 서열번호 16과 서열번호 17를 이용하여 tkt 프로모터를 포함하는 tkt 유전자 단편을 PCR을 수행을 통해 수득하였다.
중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR증폭 조건은 95 ℃에서 2분간 변성 후, 95℃ 20초 변성, 62℃ 40초 어닐링, 72℃ 1분 20초 중합을 27회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
증폭된 tkt 유전자를 추가 삽입할 업스트림과 tkt 유전자를 추가 삽입할 다운스트림 지역, tkt 프로모터를 포함하는 tkt 유전자, 그리고 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDZ는 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDZ-Pn-tkt 로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
제작된 pDZ-Pn-tkt 벡터를 각각 ATCC13869와 CJ04-8325 균주에 전기천공법으로 형질 전환 후, 2차 교차 과정을 거쳐 염색체 상에 tkt 프로모터를 포함하는 tkt 유전자가 삽입된 균주를 얻었다. 해당 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 18과 서열번호 19 프라이머를 이용한 PCR 법과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였으며, 이를 각각 CA04-8321과 CA04-8352 로 명명하였다.
본 실시예서 사용한 프라이머의 서열은 다음과 같다.
서열번호 12 (Pn-tkt_L - 1) TCGAGCTCGGTACCCAAACTTTGAGTGGGTGCGTG
서열번호 13 (Pn-tkt_L - 2) TCGAGCTACGAGGGCGGTTCCCAGCCCTTCATTAG
서열번호 14 (Pn-tkt_R - 1) ATTAACGGTTAATTGATTCTGGACGTCATGACTAC
서열번호 15 (Pn-tkt_R - 2) CTCTAGAGGATCCCCGCCTCGATGATGCAGTCGTC
서열번호 16 (Pn-tkt - 1) GAAGGGCTGGGAACCGCCCTCGTAGCTCGAGAGTT
서열번호 17 (Pn-tkt - 2) CATGACGTCCAGAATCAATTAACCGTTAATGGAGTCC
서열번호 18 (Confirm_Pn-tkt - 1) ACCCAGAACCCCAAATTTTC
서열번호 19 (Confirm_Pn-tkt - 2) TTGAGTTCGACAACTTTGG
실시예 3: 코리네박테리움속 미생물의 트립토판 생산
상기 실시예 1 및 2에서 제작된 균주들의 트립토판 생산량을 확인하고자 아래와 같은 방법으로 배양하였다. 종 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 24시간 동안, 200 rpm에서 진탕 배양하였다. 배양 종료 후 HPLC에 의해 L-트립토판의 생산량을 측정하였다.
종배지 (pH 7.0)
포도당 20g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)
생산배지 (pH 7.0)
포도당 30g, (NH4)2SO4 15 g, MgSO4 7H2O 1.2 g, KH2PO4 1 g, 효모추출물 5 g, 바이오틴 900 ㎍, 티아민 염산염 4500 ㎍, 칼슘-판토텐산 4500 ㎍, CaCO3 30 g (증류수 1리터 기준).
코리네박테리움 글루타미쿰 유래 L-트립토판 생산균주의 생산량 확인
　 형질 사용한 포도당(g/L) 트립토판 생산량 (g/L) 트립토판 수율 (*100 g/g, %)
ATCC13869 30 0.00 0.00
CA04-8312 trpE::trpE(S38R) 30 0.00 0.00
CA04-8315 Pn::SPL7_trpE 30 0.00 0.00
CA04-8321 ::Pn_tkt 30 0.00 0.00
CA04-8325 Pn::SPL7_trpE(S38R) 30 0.05 0.16
CA04-8352 SPL7_trpE(S38R), ::Pn_tkt 30 0.27 0.90
야생형 코리네박테리움, CA04-8312, CA04-8315, CA04-8321, CA04-8325, CA04-8352에 대한 배양물 중의 L-트립토판 생산에 대한 결과는 상기 표 3과 같다.
야생형 코리네박테리움의 trpE에 피드백이 해제된 변이가 도입된 CA04-8312와 트립토판 오페론(operon)이 발현 강화된 CA04-8315, 그리고 tkt가 강화된 CA04-8321 균주는 트립토판 생산이 확인되지 않았다. 하지만 이들 개별 형질들이 조합된 CA04-8352 균주의 경우, CA04-8325에 비해 약 5배나 향상된 트립토판을 생산하였다. 이는 트립토판에 대한 피드백이 해제된 트립토판 오페론 강화와 tkt 발현 강화가 조합되어야 트립토판 생산을 향상시킴을 의미한다. 야생형의 코리네박테리움속 미생물은 트립토판을 생산하지 않거나 생산하더라도 극미량의 트립토판만 생산할 뿐이므로 이러한 생산량 증가는 매우 의미 있는 효과로 해석된다.
실시예 4 : 대장균 유래 트립토판 오페론 발현 강화
트립토판의 생산을 더 향상시키기 위하여, 추가적인 대장균 유래 트립토판 오페론을 도입 및 발현 강화시키고자 하였다. 대장균 유래 트립토판 오페론을 강화시키기 위해서 강한 프로모터로 알려진 SPL7 프로모터와 대장균 TrpE 단백질의 피드백 제한이 해소된 trpE의 21번 아미노산인 프롤린(Proline)이 세린(Serine)으로 치환된 trpE (서열번호 33) 및 대장균 trpDCBA 형태로 강화를 진행하였다(J. Biochem. Mol. Biol. 32, 20-24 (1999)).
이러한 유전자 조작을 위해 우선 염색체상 상동재조합 (Homologous recombination)이 발생하는 프로모터 업스트림 (Upstream)과 trpDCBA 다운스트림 (Downsteam) 지역을 수득하였다. 구체적으로 코리네박테리움 글루타미쿰 염색체 DNA를 주형으로 하여 서열번호 20와 서열번호 21의 프라이머를 이용하여 프로모터 업스트림 (Upstream) 지역을, 서열번호 22와 서열번호 23의 프라이머를 이용하여 다운스트림 (Downsteam) 지역의 유전자 단편을 PCR을 수행을 통해 수득하였다.
중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 58℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
합성 제작한 프로모터 SPL7을 주형으로 서열번호 24과 서열번호 25 의 프라이머를 이용하여 PCR을 수행하였다.
중합효소는 SolgTM Pfu-X DNA 폴리머라제 (SolGent co.)를 사용하였으며, PCR증폭 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 58℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
대장균 trpE 유전자의 아미노산 1부터 변이형 21번까지를 코딩하는 뉴클레오타이드를 확보하기 위하여, 대장균 W3110 게놈 DNA를 주형으로 하여 서열번호 26과 서열번호 27을 이용하여 PCR을 수행하였다.
중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR증폭 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 58℃ 30초 어닐링, 72℃ 30초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
대장균 trpE 유전자의 변이형 아미노산 21번부터 말단을 포함한 trpE 및 trpDCBA 까지를 코딩하는 뉴클레오타이드를 확보하기 위하여, 대장균 W3110 게놈 DNA를 주형으로 하여 서열번호 28과 서열번호 29를 이용하여 PCR을 수행하였다.
중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR증폭 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 58℃ 30초 어닐링, 72℃ 7분 중합을 30회 반복한 후, 72℃에서 10분간 중합반응을 수행하였다.
염색체상 상동재조합이 발생하기 위해서 증폭된 업스트림 지역과 다운스트림 지역, SPL7 프로모터, 대장균 trpE P21S 앞 단편, 대장균 trpE P21S 을 포함한 말단 및 trpDCBA 유전자, 그리고 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDZ는 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDZ-PSPL7-trpE(P21S)DCBA.eco 로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
제작된 pDZ-PSPL7-trpE(P21S)DCBA.eco 벡터를 각각 야생형 코리네박테리움 글루타미쿰 ATCC13869, CJ04-8321과 CJ04-8352 균주에 전기천공법으로 형질 전환 후, 2차 교차 과정을 거쳐 염색체 상에 강한 프로모터인 SPL7 형태로 대장균 trpE(P21S)DCBA 오페론이 삽입된 균주를 얻었다. 해당 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 30과 서열번호 31 프라이머를 이용한 PCR 법과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였으며, 이를 각각 CA04-8316, CA04-8330와 CA04-8357 로 명명하였다.
본 실시예서 사용한 프라이머의 서열은 다음과 같다.
서열번호 20 (TY384) ttcgagctcggtacccGATCGAGGCTAACAAGGCA
서열번호 21 (HR-sp R) GGTACCACTAAACCGGAAGGGCCCTCCTGCTGTACTTTCGACA
서열번호 22 (trpA-HR F) AGTTAAACTAAACAGGAAGAGCCAGTTAAGGGAC
서열번호 23 (HR-vector R) gactctagaggatccccATCATGGGAATCCGGCCAT
서열번호 24 (HR-sp F) GGCCCTTCCGGTTTAGTGGTACCGGCGCTTCATGTCAACAATC
서열번호 25 (spl7-trpE R) TTTGCATGATATCTGTTTTGATCTCCTCCAATA
서열번호 26 (spl7-trpE F) CAAAACAGATATCATGCAAACACAAAAACCGAC
서열번호 27 (trpE P21S R) GAAAAAGCGCGGTGGAATTGTCGCGATAAGCGC
서열번호 28 (trpE P21S F) CAAAACAGATATCATGCAAACACAAAAACCGAC
서열번호 29 (trpA-HR R) TCTTCCTGTTTAGTTTAACTGCGCGTCGCCGCTT
서열번호 30 (Nested 1F) CGTTGACCCAAACATGCTG
서열번호 31 (Nested 1R) CTTCTTCATTTCGGCTATCG
실시예 5 : 대장균 트립토판 오페론이 강화된 균주 평가
상기 실시예 4에서 제작된 CA04-8316, CA04-8330 및 CA04-8357 균주들과 실시예 2에서 제작된 CA04-8352 균주의 트립토판 생산량을 확인하고자 아래와 같은 방법으로 배양하였다. 종 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 24시간 동안, 200 rpm에서 진탕 배양하였다. 배양 종료 후 HPLC에 의해 L-트립토판의 생산량을 측정하였다.
종배지 (pH 7.0)
포도당 20g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)
생산배지 (pH 7.0)
포도당 30g, (NH4)2SO4 15 g, MgSO4 7H2O 1.2 g, KH2PO4 1 g, 효모추출물 5 g, 바이오틴 900 ㎍, 티아민 염산염 4500 ㎍, 칼슘-판토텐산 4500 ㎍, CaCO3 30 g (증류수 1리터 기준).
대장균 트립토판 오페론이 강화된 균주의 트립토판 생산량 확인
　 형질 사용한 포도당(g/L) 트립토판 생산량 (g/L) 트립토판 수율 (*100 g/g, %)
ATCC13869 30 0.00 0.00
CA04-8316 ::SPL7_trpE(P21S)DCBA.eco 30 0.03 0.10
CA04-8330 ::Pn_tkt, ::SPL7_trpE(P21S)DCBA.eco 30 0.32 1.06
CA04-8352 SPL7_trpE(S38R), ::Pn_tkt 30 0.27 0.90
CA04-8357 SPL7_trpE(S38R), ::Pn_tkt, ::SPL7_trpE(P21S)DCBA.eco 30 2.72 9.06
야생형 코리네박테리움, CA04-8316, CA04-8330, CA04-8352, CA04-8357에 대한 배양물 중의 L-트립토판 생산에 대한 결과는 상기 표 5와 같다.
야생형 코리네박테리움에 대장균 유래의 피드백이 해제된 trpE를 포함하는 트립토판 오페론(operon)이 발현 강화된 CA04-8316 균주는 0.03 g/L로 L-트립토판을 생산하였고, tkt만 강화된 CA04-8321 균주에 상기의 대장균 유래의 피드백이 해제된 트립토판 오페론이 강화된 CA04-8330 균주의 트립토판 생산량은 0.32 g/L로 향상되었다. 모든 유전자 조작을 종합한 CA04-8357 균주의 경우, 약 0.3~0.6 g/L 정도의 트립토판 생산량이 예상되었으나, CA04-8352 에 비해 약 10배나 향상된 2.72 g/L를 생산하였다.
상기 결과로부터 대장균 유래 피드백 해제된 트립토판 오페론과 모균주인 코리네박테리움형의 TKT (트랜스케토라제) 및 피드백 해제된 트립토판 오페론 강화가 조합되는 경우 예상치 못한 수준으로 생산량이 대폭 증가됨을 확인하였다. 즉, 대장균 유래의 피드백 해제된 트립토판 오페론과 코리네박테리움 유래의 피드백 해제된 트립토판 오페론과 전구체 향상이 함께 할 때 트립토판 생산에 시너지 효과가 크다는 것을 알 수 있다.
상기 균주, CA04-8352는 2018년 2월 2일자로 부다페스트 조약하의 국제기탁기관인 한국미생물보존센터(KCCM)에 국제기탁하여 KCCM12218P로 기탁번호를 부여 받았다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2019002236-appb-I000001

Claims (8)

  1. N-말단이 서열번호 32의 아미노산 서열로 구성되고 피드백 저해가 해제된 안스라닐산 합성효소를 코딩하는 유전자와 이를 포함하는 트립토판 오페론 및 트랜스케토라제를 코딩하는 유전자의 발현이 강화된, L-트립토판을 생산하는 코리네박테리움속 미생물.
  2. 제1항에 있어서, 상기 트립토판 오페론 발현의 강화는 트립토판 오페론의 프로모터가 강한 프로모터로 치환된, L-트립토판을 생산하는 코리네박테리움속 미생물.
  3. 제1항에 있어서, 상기 미생물은 추가적으로 N-말단이 서열번호 33의 아미노산 서열로 구성된 피드백 해제된 안스라닐산 합성효소를 코딩하는 유전자와 이를 포함하는 대장균 유래 트립토판 오페론이 발현되도록 변형된, L-트립토판을 생산하는 코리네박테리움속 미생물.
  4. 제3항에 있어서, 상기 대장균 유래 트립토판 오페론은 트립토판 오페론의 프로모터가 강한 프로모터로 치환된, L-트립토판을 생산하는 코리네박테리움속 미생물.
  5. 제1항에 있어서, 상기 미생물은 코리네박테리움 글루타미쿰인, L-트립토판을 생산하는 코리네박테리움속 미생물.
  6. N-말단이 서열번호 32의 아미노산 서열로 구성되고 피드백 저해가 해제된 안스라닐산 합성효소를 코딩하는 유전자와 이를 포함하는 트립토판 오페론 및 트랜스케토라제를 코딩하는 유전자의 발현이 강화된 L-트립토판을 생산하는 코리네박테리움속 미생물을 배지에서 배양하는 단계; 및 상기 배양된 미생물 또는 배지로부터 L-트립토판을 회수하는 단계를 포함하는, L-트립토판 생산 방법.
  7. 제6항에 있어서, 상기 미생물은 추가적으로 N-말단이 서열번호 33의 아미노산 서열로 구성된 피드백 해제된 안스라닐산 합성효소를 코딩하는 유전자와 이를 포함하는 대장균 유래 트립토판 오페론이 발현되도록 변형된, L-트립토판 생산 방법.
  8. 제6항에 있어서, 상기 미생물은 코리네박테리움 글루타미쿰인, L-트립토판 생산 방법.
PCT/KR2019/002236 2018-02-23 2019-02-22 L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법 WO2019164346A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020180022057A KR102035844B1 (ko) 2018-02-23 2018-02-23 L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
KR10-2018-0022057 2018-02-23

Publications (2)

Publication Number Publication Date
WO2019164346A1 true WO2019164346A1 (ko) 2019-08-29
WO2019164346A8 WO2019164346A8 (ko) 2020-09-24

Family

ID=63230232

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/002236 WO2019164346A1 (ko) 2018-02-23 2019-02-22 L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법

Country Status (2)

Country Link
KR (1) KR102035844B1 (ko)
WO (1) WO2019164346A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023133484A1 (en) * 2022-01-07 2023-07-13 Ginkgo Bioworks, Inc. Skin commensal bacteria engineered to produce anthranilate or derivatives thereof

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102035844B1 (ko) * 2018-02-23 2019-10-23 씨제이제일제당 주식회사 L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
KR102205717B1 (ko) 2019-04-05 2021-01-22 씨제이제일제당 주식회사 신규 l-트립토판 배출 단백질 변이체 및 이를 이용한 l-트립토판을 생산하는 방법
KR102221040B1 (ko) 2019-05-09 2021-03-03 씨제이제일제당 주식회사 L-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산을 생산하는 방법
KR102278000B1 (ko) * 2020-03-17 2021-07-15 씨제이제일제당 주식회사 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법
KR102284726B1 (ko) * 2021-01-25 2021-08-02 씨제이제일제당 주식회사 신규한 타우토머레이즈 pptA 변이체 및 이를 이용한 L-트립토판 생산 방법
KR102649245B1 (ko) 2021-03-08 2024-03-21 씨제이제일제당 주식회사 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100028956A1 (en) * 2006-12-29 2010-02-04 Cj Cheiljedang Corporation Genetically engineered recombinant escherichia coli producing l-tryptophan having originally l-phenylalanine productivity, and method for producing l-tryptophan using the microorganism
US20100159523A1 (en) * 2001-08-06 2010-06-24 Evonik Degussa Gmbh Coryneform Bacteria Which Produce Chemical Compounds I
KR101629159B1 (ko) * 2012-01-10 2016-06-09 씨제이제일제당 (주) L-트립토판 생산능이 강화된 에스케리키아속 미생물 및 이를 이용하여 l-트립토판을 생산하는 방법
KR101783170B1 (ko) * 2016-08-31 2017-09-29 씨제이제일제당 (주) 신규 프로모터 및 이의 용도
KR20180089329A (ko) * 2018-02-23 2018-08-08 씨제이제일제당 (주) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS60176593A (ja) 1984-02-22 1985-09-10 Kyowa Hakko Kogyo Co Ltd Ｌ−トリプトフアンの製造法

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100159523A1 (en) * 2001-08-06 2010-06-24 Evonik Degussa Gmbh Coryneform Bacteria Which Produce Chemical Compounds I
US20100028956A1 (en) * 2006-12-29 2010-02-04 Cj Cheiljedang Corporation Genetically engineered recombinant escherichia coli producing l-tryptophan having originally l-phenylalanine productivity, and method for producing l-tryptophan using the microorganism
KR101629159B1 (ko) * 2012-01-10 2016-06-09 씨제이제일제당 (주) L-트립토판 생산능이 강화된 에스케리키아속 미생물 및 이를 이용하여 l-트립토판을 생산하는 방법
KR101783170B1 (ko) * 2016-08-31 2017-09-29 씨제이제일제당 (주) 신규 프로모터 및 이의 용도
KR20180089329A (ko) * 2018-02-23 2018-08-08 씨제이제일제당 (주) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI 28 July 2016 (2016-07-28), XP055633204, Database accession no. AAA83989.1 *
HERRY, D. M. ET AL.: "Cloning of the trp gene cluster from a tryptophan-hyperproducing strain of Corynebacterium glutamicum: identification of a mutation in the trp leader sequence", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 59, no. 3, March 1993 (1993-03-01), pages 791 - 799, XP055633211 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023133484A1 (en) * 2022-01-07 2023-07-13 Ginkgo Bioworks, Inc. Skin commensal bacteria engineered to produce anthranilate or derivatives thereof

Also Published As

Publication number Publication date
WO2019164346A8 (ko) 2020-09-24
KR20180089329A (ko) 2018-08-08
KR102035844B1 (ko) 2019-10-23

Similar Documents

Publication Publication Date Title
WO2019160301A1 (ko) 시트레이트 신타아제의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 l-아미노산 생산방법
WO2019164346A1 (ko) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
WO2019147078A1 (ko) 퓨린 뉴클레오티드를 생산하는 코리네박테리움 속 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2013095071A2 (ko) Ｌ-라이신 생산능을 갖는 미생물을 이용하여 ｌ-라이신을 생산하는 방법
WO2013105802A2 (ko) 자일로즈 이용능이 부여된 코리네박테리움 속 미생물 및 이를 이용한 ｌ-라이신의 생산방법
WO2020218736A1 (ko) L-히스티딘 생산능이 강화된 미생물 및 이를 이용한 히스티딘 생산방법
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2017007159A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2020067618A1 (ko) 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163923A1 (ko) 신규한 atp 포스포리보실트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022149865A2 (ko) GlxR 단백질 변이체 또는 이를 이용한 쓰레오닌 생산방법
WO2022225319A1 (ko) 신규한 l-세린 암모니아 분해 효소 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163937A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163940A1 (ko) 신규한 갈락토사이드 o-아세틸트랜스퍼라제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154173A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022163938A1 (ko) 신규한 리보뉴클레아제 p 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163930A1 (ko) 신규한 2-숙시닐-5-엔도피루빌-6-하이드록시-3-사이클로헥센-1-카복실레이트 신타아제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163941A1 (ko) 신규한 스퍼미딘 신타아제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163909A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022163929A1 (ko) 신규한 펩티딜-디펩티다제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19756978

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19756978

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 12/04/2021)

122 Ep: pct application non-entry in european phase

Ref document number: 19756978

Country of ref document: EP

Kind code of ref document: A1