WO2022163934A1 - 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법 - Google Patents

신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법 Download PDF

Info

Publication number
WO2022163934A1
WO2022163934A1 PCT/KR2021/005153 KR2021005153W WO2022163934A1 WO 2022163934 A1 WO2022163934 A1 WO 2022163934A1 KR 2021005153 W KR2021005153 W KR 2021005153W WO 2022163934 A1 WO2022163934 A1 WO 2022163934A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
present application
strain
sequence
polynucleotide
Prior art date
Application number
PCT/KR2021/005153
Other languages
English (en)
French (fr)
Inventor
박고운
배지연
권나라
김효진
이진남
서창일
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Publication of WO2022163934A1 publication Critical patent/WO2022163934A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/14—Glutamic acid; Glutamine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/02—Acid—amino-acid ligases (peptide synthases)(6.3.2)
    • C12Y603/02004—D-Alanine-D-alanine ligase (6.3.2.4)

Definitions

  • the present application relates to a novel D-alanine-D-alanine ligase A variant, a Corynebacterium glutamicum strain comprising the variant, and a method for producing L-glutamic acid using the strain.
  • the present inventors provide a novel D-alanine-D-alanine ligase A (D-alanine-D-alanine ligase A) variant that increases L-glutamic acid production, a Corynebacterium glutamicum strain comprising the variant, and the The present application was completed by developing a method for producing L-glutamic acid using the strain.
  • D-alanine-D-alanine ligase A D-alanine-D-alanine ligase A variant that increases L-glutamic acid production
  • a Corynebacterium glutamicum strain comprising the variant
  • the present application was completed by developing a method for producing L-glutamic acid using the strain.
  • One object of the present application is, consisting of the amino acid sequence set forth in SEQ ID NO: 1, in which glycine, which is an amino acid corresponding to the 256th position of the amino acid sequence of SEQ ID NO: 3, is substituted with serine, D-alanine-D -Providing an alanine ligase A variant.
  • Another object of the present application is to provide a polynucleotide encoding the variant of the present application.
  • Another object of the present application is to provide a Corynebacterium glutamicum strain comprising the variant of the present application or a polynucleotide encoding the variant, and having L-glutamic acid-producing ability.
  • Another object of the present application is to include a variant or a polynucleotide encoding the variant, and having L-glutamic acid-producing ability, including the step of culturing a Corynebacterium glutamicum strain in a medium, L- To provide a method for producing glutamic acid.
  • FIG. 1 is a schematic diagram of a pDCM2 plasmid.
  • One aspect of the present application provides a variant, consisting of the amino acid sequence set forth in SEQ ID NO: 1, in which glycine, which is an amino acid corresponding to the 256th position of the amino acid sequence of SEQ ID NO: 3, is substituted with serine.
  • the variant of the present application may have or include the amino acid sequence set forth in SEQ ID NO: 1, or may consist essentially of the amino acid sequence.
  • the amino acid corresponding to position 256 based on the amino acid sequence of SEQ ID NO: 3 in the amino acid sequence set forth in SEQ ID NO: 1 is serine, and at least 70%, 75 with the amino acid sequence set forth in SEQ ID NO: 1 %, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or an amino acid sequence having at least 99.9% homology or identity.
  • variants having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added are also included within the scope of the present application. is self-evident
  • sequence additions or deletions naturally occurring mutations, silent mutations or conservation within the N-terminus, C-terminus and/or within the amino acid sequence that do not alter the function of the variants of the present application It is a case of having an enemy substitution.
  • conservative substitution means substituting an amino acid for another amino acid having similar structural and/or chemical properties. Such amino acid substitutions may generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.
  • variant means that one or more amino acids are conservatively substituted and/or modified so that they differ from the amino acid sequence before the mutation of the variant, but have functions or properties. refers to a polypeptide that is maintained. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. In addition, some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, have been removed.
  • variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein.
  • variant may be used interchangeably with terms such as mutant, modified, mutant polypeptide, mutated protein, mutant and mutant (in English, modified, modified polypeptide, modified protein, mutant, mutein, divergent, etc.) and, as long as it is a term used in a mutated sense, it is not limited thereto.
  • the variant may be a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1 in which glycine, which is an amino acid corresponding to position 256 of the amino acid sequence of SEQ ID NO: 3, is substituted with serine.
  • variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide.
  • a signal (or leader) sequence involved in protein translocation may be conjugated to the N-terminus of the mutant, either co-translationally or post-translationally.
  • the variants may also be conjugated with other sequences or linkers for identification, purification, or synthesis.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of a sequence under moderate or high stringent conditions. It is apparent that hybridization also includes hybridization with polynucleotides containing common codons or codons taking codon degeneracy into account in the polynucleotide.
  • a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap open penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • the variant of the present application may have D-alanine-D-alanine ligase A activity.
  • the mutant of the present application may have an activity to increase the ability to produce L-glutamic acid compared to the wild-type polypeptide having D-alanine-D-alanine ligase A activity.
  • D-alanine-D-alanine ligase A (D-alanine-D-alanine ligase A) is a polypeptide forming a cell wall.
  • D-alanine-D-alanine ligase A of the present application may be used interchangeably with D-Ala-D-Ala ligase A or D-alanylalanine synthetase A.
  • the sequence of the D-alanine-D-alanine ligase A can be obtained from GenBank of NCBI, a known database. Specifically, it may be a polypeptide having D-alanine-D-alanine ligase A activity encoded by ddlA , but is not limited thereto.
  • corresponding to refers to an amino acid residue at a listed position in a polypeptide, or to an amino acid residue that is similar, identical or homologous to a listed residue in a polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that refers to a specific sequence.
  • corresponding region generally refers to a similar or corresponding position in a related protein or reference protein.
  • any amino acid sequence is aligned with SEQ ID NO: 3, and based on this, each amino acid residue of the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 3 .
  • a sequence alignment algorithm such as that described in this application can identify the position of an amino acid, or a position at which modifications, such as substitutions, insertions, or deletions, occur compared to a query sequence (also referred to as a "reference sequence").
  • Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277), etc., but is not limited thereto, and a sequence alignment program known in the art, a pairwise sequence comparison algorithm, etc. may be appropriately used.
  • Another aspect of the present application is to provide a polynucleotide encoding the variant of the present application.
  • polynucleotide refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are linked in a long chain by covalent bonds, and more specifically, encoding the variant. polynucleotide fragments.
  • the polynucleotide encoding the variant of the present application may include a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 1.
  • the polynucleotide of the present application may have or include the sequence of SEQ ID NO: 2.
  • the polynucleotide of the present application may consist of, or consist essentially of, the sequence of SEQ ID NO: 2.
  • the polynucleotides of the present application are various in the coding region within the range that does not change the amino acid sequence of the variants of the present application. Deformation can be made.
  • the polynucleotide of the present application has 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% homology or identity to the sequence of SEQ ID NO: 2 Having or including a nucleotide sequence that is more than, 98% or more, and less than 100%, or homology or identity with the sequence of SEQ ID NO: 2 is 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% of the nucleotide sequence may consist of or consist essentially of, but is not limited thereto.
  • the codon encoding the amino acid corresponding to the 256th position of SEQ ID NO: 1 may be one of the codons encoding serine.
  • polynucleotide of the present application may be included without limitation as long as it can hybridize under stringent conditions with a probe that can be prepared from a known gene sequence, for example, a sequence complementary to all or part of the polynucleotide sequence of the present application.
  • stringent condition means a condition that enables specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • polynucleotides with high homology or identity 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or a condition in which polynucleotides having 99% or more homology or identity hybridize with each other and polynucleotides with lower homology or identity do not hybridize, or a washing condition of conventional Southern hybridization at 60°C, 1 ⁇ SSC, 0.1% SDS, specifically 60°C, 0.1 ⁇ SSC, 0.1% SDS, more specifically 68°C, 0.1 ⁇ SSC, 0.1% SDS at a salt concentration and temperature equivalent to once, specifically twice The conditions for washing to 3 times can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other.
  • adenine is complementary to thymine
  • cytosine is complementary to guanine.
  • the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the overall sequence.
  • a polynucleotide having homology or identity to the polynucleotide of the present application can be detected using the hybridization conditions including a hybridization step at a Tm value of 55°C and using the above-described conditions.
  • the Tm value may be 60 °C, 63 °C, or 65 °C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • the appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (eg, J. Sambrook et al., supra).
  • Another aspect of the present application is to provide a vector comprising the polynucleotide of the present application.
  • the vector may be an expression vector for expressing the polynucleotide in a host cell, but is not limited thereto.
  • the vector of the present application may include a DNA preparation comprising the nucleotide sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable expression control region (or expression control sequence) so that the target polypeptide can be expressed in a suitable host.
  • the expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the vector After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors may be used.
  • pBluescript II-based pGEM-based, pTZ-based, pCL-based, pET-based and the like
  • pDZ pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like
  • pC1BAC vectors and the like can be used.
  • a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion.
  • the insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted.
  • the selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. Markers to be given can be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
  • the term "transformation” refers to introducing a vector including a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell.
  • the polynucleotide includes DNA and/or RNA encoding a target polypeptide.
  • the polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the target variant of the present application and the polynucleotide sequence are functionally linked.
  • Corynebacterium glutamicum Corynebacterium glutamicum It is to provide a strain comprising the mutant of the present application or the polynucleotide of the present application.
  • the strain of the present application may include a vector comprising the mutant polypeptide of the present application, a polynucleotide encoding the polypeptide, or the polynucleotide of the present application.
  • strain or microorganism
  • strain includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially.
  • a specific mechanism is weakened or enhanced as a microorganism, and may be a microorganism including genetic modification for the production of a desired polypeptide, protein or product.
  • the strain of the present application includes a strain comprising any one or more of a mutant of the present application, a polynucleotide of the present application, and a vector including the polynucleotide of the present application; a strain modified to express a variant of the present application or a polynucleotide of the present application; a variant of the present application, or a strain expressing the polynucleotide of the present application (eg, a recombinant strain); Or it may be a strain having the mutant activity of the present application (eg, a recombinant strain), but is not limited thereto.
  • the strain of the present application may be a strain having the ability to produce L-glutamic acid.
  • the strain of the present application is naturally present in a microorganism having D-alanine-D-alanine ligase A or L-glutamic acid producing ability, or a parent strain without D-alanine-D-alanine ligase A or L-glutamic acid producing ability.
  • the mutant of the application or a polynucleotide encoding the same (or a vector including the polynucleotide) may be introduced and/or a microorganism to which L-glutamic acid production ability is imparted, but is not limited thereto.
  • the strain of the present application is transformed with a vector containing the polynucleotide of the present application or a polynucleotide encoding the variant of the present application, and expresses the variant of the present application as a cell or microorganism
  • the strains of the application may include all microorganisms capable of producing L-glutamic acid, including the variants of the present application.
  • the D-alanine-D-alanine ligase A variant is expressed by introducing the polynucleotide encoding the variant of the present application into a natural wild-type microorganism or a microorganism producing L-glutamic acid, L - It may be a recombinant strain having an increased ability to produce glutamic acid.
  • the recombinant strain with increased L-glutamic acid production ability is a natural wild-type microorganism or D-alanine-D-alanine ligase A unmodified microorganism (ie, wild-type D-alanine-D-alanine ligase A (SEQ ID NO: 3) It may be a microorganism having an increased ability to produce L-glutamic acid compared to a microorganism that expresses it or a variant (SEQ ID NO: 1) that does not express the protein), but is not limited thereto.
  • the strain with increased L-glutamic acid production ability of the present application may be a microorganism having increased L-glutamic acid production ability compared to Corynebacterium glutamicum comprising the polypeptide of SEQ ID NO: 3 or a polynucleotide encoding the same. , but not limited thereto.
  • the target strain, D-alanine-D-alanine ligase A unmodified microorganism for comparing the increase in L-glutamic acid production ability is ATCC13869 strain or ATCC13869 ⁇ odhA strain (Appl Environ Microbiol. 2007 Feb; 73 (Appl Environ Microbiol. 2007 Feb; 73) 4):1308-19. Epub 2006 Dec 8.), but is not limited thereto.
  • the recombinant strain with increased production capacity is about 1% or more, specifically 1% or more, about 2.5% or more, about 5% or more, about 6 compared to the L-glutamic acid production capacity of the parent strain or unmodified microorganism before mutation.
  • the recombinant strain with increased production capacity has an L-glutamic acid production capacity of about 1.1 times or more, about 1.12 times or more, about 1.13 times or more, 1.15 times or more, 1.16 times or more, compared to the parent strain or unmodified microorganism before mutation. , 1.17 times or more, 1.18 times or more, 1.19 times or more, 1.2 times or more, or 1.21 times or more (the upper limit is not particularly limited, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less. Yes) may be increased, but is not limited thereto.
  • the term “about” is a range including all of ⁇ 0.5, ⁇ 0.4, ⁇ 0.3, ⁇ 0.2, ⁇ 0.1, etc. not limited
  • the term "unmodified microorganism” does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a wild-type strain or a natural-type strain itself, or a genetic variation caused by natural or artificial factors. It may mean the strain before being changed.
  • the unmodified microorganism may refer to a strain in which the D-alanine-D-alanine ligase A variant described herein is not introduced or before it is introduced.
  • the "unmodified microorganism” may be used interchangeably with "strain before modification", "microbe before modification”, “unmodified strain”, “unmodified strain”, "unmodified microorganism” or "reference microorganism”.
  • the microorganism of the present application is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ( Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Cory Nebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium callunae ), Corynebacterium stationis , Corynebacterium stationis ), Corynebacterium singulare ( Corynebacterium singulare ), Corynebacterium halo Tolerans ( Corynebacterium halotolerans ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Corynebacterium pollutisoli ( Corynebacterium pollutisoli ), Corynebacterium pol
  • the microorganism of the present application may be a microorganism in which the activity of the OdhA protein is further weakened or inactivated.
  • the term “attenuation” of polypeptide activity is a concept that includes both reduced or no activity compared to intrinsic activity.
  • the attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, attenuation, and the like.
  • the attenuation is when the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism due to mutation of the polynucleotide encoding the polypeptide, etc.
  • the overall polypeptide activity level and/or concentration (expression amount) in the cell is lower than that of the native strain due to (translation) inhibition, etc., when the expression of the polynucleotide is not made at all, and/or when the expression of the polynucleotide is Even if there is no activity of the polypeptide, it may also be included.
  • the "intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification”. "Inactivation, deficiency, reduction, downregulation, reduction, attenuation” of the activity of the polypeptide compared to the intrinsic activity means that the activity of the specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation is lowered.
  • Attenuation of the activity of such a polypeptide may be performed by any method known in the art, but is not limited thereto, and may be achieved by application of various methods well known in the art (eg, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
  • the attenuation of the polypeptide activity of the present application is
  • an antisense oligonucleotide eg, antisense RNA
  • an antisense oligonucleotide that complementarily binds to the transcript of said gene encoding the polypeptide
  • deletion of a part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide in which some nucleotides are deleted, or replacement with a marker gene.
  • the expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the base sequence modification encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a base encoding another start codon having a lower expression rate of the polypeptide compared to the intrinsic start codon It may be substituted with a sequence, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 3) and 4) above deletes, inserts, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide so as to weaken the activity of the polypeptide.
  • a combination thereof may result in a mutation in sequence, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto.
  • the expression of a gene may be inhibited or attenuated, but is not limited thereto.
  • antisense oligonucleotide eg, antisense RNA
  • antisense RNA an antisense oligonucleotide that complementarily binds to the transcript of the gene encoding the polypeptide
  • Weintraub, H. et al. Antisense-RNA as a molecular tool. for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
  • RTE reverse transcription engineering
  • the term "enhancement" of a polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity.
  • the reinforcement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.
  • activation, enhancement, up-regulation, overexpression, and increase may include all of those exhibiting an activity that was not originally possessed, or exhibiting an improved activity compared to an intrinsic activity or an activity prior to modification.
  • intrinsic activity refers to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors.
  • Enhance, "up-regulation”, “overexpression” or “increase” in the activity of a polypeptide compared to its intrinsic activity means the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation. And / or concentration (expression amount) means improved compared to.
  • the enrichment can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and/or concentration (expression amount) of the endogenous polypeptide. Whether or not the activity of the polypeptide is enhanced can be confirmed from the increase in the level of activity, expression level, or the amount of product excreted from the polypeptide.
  • the enhancement of the activity of the polypeptide can be applied by various methods well known in the art, and is not limited as long as it can enhance the activity of the target polypeptide compared to the microorganism before modification. Specifically, it may be one using genetic engineering and/or protein engineering well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (eg, Sitnicka et al. Functional Analysis of Genes. Advances in Cell). Biology 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • modification of the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide eg, modification of the polynucleotide sequence of the polypeptide gene to encode a polypeptide that has been modified to enhance the activity of the polypeptide;
  • the increase in the intracellular copy number of the polynucleotide encoding the polypeptide is achieved by introduction into the host cell of a vector to which the polynucleotide encoding the polypeptide is operably linked, which can replicate and function independently of the host it may be Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into a chromosome in a host cell.
  • the introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome in the host cell into the host cell, but is not limited thereto.
  • the vector is the same as described above.
  • Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence with strong activity is, for example, deletion, insertion, non-conservative or Conservative substitution or a combination thereof may result in a mutation in the sequence, or replacement with a sequence having a stronger activity.
  • the expression control region is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling the termination of transcription and translation.
  • the original promoter may be replaced with a strong promoter, but is not limited thereto.
  • Examples of known strong promoters include CJ1 to CJ7 promoters (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, etc., but is not limited thereto.
  • Modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a nucleotide sequence encoding another start codon having a higher expression rate of the polypeptide compared to the intrinsic start codon. It may be a substitution, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may include deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide;
  • a combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto.
  • the replacement may be specifically performed by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
  • the vector used may further include a selection marker for confirming whether or not the chromosome is inserted.
  • the selection marker is the same as described above.
  • the introduction of the foreign polynucleotide exhibiting the activity of the polypeptide may be the introduction of the foreign polynucleotide encoding the polypeptide exhibiting the same/similar activity as the polypeptide into a host cell.
  • the foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same/similar activity as the polypeptide.
  • the method used for the introduction can be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to generate a polypeptide and increase its activity.
  • Codon optimization of the polynucleotide encoding the polypeptide is codon-optimized so that the transcription or translation of the endogenous polynucleotide is increased in the host cell, or the transcription and translation of the foreign polynucleotide is optimized in the host cell. It may be that its codons are optimized so that the
  • Selecting an exposed site by analyzing the tertiary structure of the polypeptide and modifying or chemically modifying it is, for example, by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored to determine the degree of sequence similarity. Accordingly, it may be to determine a template protein candidate, check the structure based on this, and select an exposed site to be modified or chemically modified and modified or modified.
  • Such enhancement of polypeptide activity is to increase the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or pre-modified microbial strain, or increase the amount of product produced from the polypeptide.
  • the present invention is not limited thereto.
  • Corynebacterium glutamicum strain of the present application is a microorganism in which a polypeptide comprising SEQ ID NO: 17, a nucleotide encoding a polypeptide comprising SEQ ID NO: 17, or a nucleotide comprising SEQ ID NO: 18 is further deleted.
  • Part or all of the polynucleotide in the microorganism of the present application is modified by (a) homologous recombination using a vector for chromosome insertion in the microorganism or genome editing using engineered nuclease (e.g., CRISPR-Cas9) and/or (b) It may be induced by light and/or chemical treatments such as, but not limited to, ultraviolet and radiation.
  • the method for modifying part or all of the gene may include a method by DNA recombination technology.
  • a part or all of the gene may be deleted.
  • the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
  • Another aspect of the present application provides a method for producing L-glutamic acid, comprising the step of culturing a Corynebacterium glutamicum strain comprising the mutant of the present application or the polynucleotide of the present application in a medium.
  • the L-glutamic acid production method of the present application may include culturing a Corynebacterium glutamicum strain comprising the mutant of the present application or the polynucleotide of the present application or the vector of the present application in a medium.
  • the term "cultivation” means growing the Corynebacterium glutamicum strain of the present application under moderately controlled environmental conditions.
  • the culture process of the present application may be performed according to a suitable medium and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art according to the selected strain.
  • the culture may be a batch, continuous and/or fed-batch, but is not limited thereto.
  • the term "medium” refers to a material in which nutrients required for culturing the Corynebacterium glutamicum strain of the present application are mixed as a main component, and nutrients including water essential for survival and growth and growth factors.
  • any medium and other culture conditions used for culturing the Corynebacterium glutamicum strain of the present application may be used without particular limitation as long as it is a medium used for culturing conventional microorganisms, but Corynebacterium glutamicum of the present application Lium glutamicum strain can be cultured while controlling the temperature, pH, etc. under aerobic conditions in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid and / or vitamin and the like.
  • the culture medium for the Corynebacterium sp. strain can be found in the literature ["Manual of Methods for General Bacteriology” by the American Society for Bacteriology (Washington D.C., USA, 1981)].
  • the carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, and the like; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine
  • organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract
  • the phosphorus may include potassium first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto.
  • potassium first potassium phosphate potassium phosphate
  • second potassium phosphate or a sodium-containing salt corresponding thereto.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, the present invention is not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium.
  • an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without or without gas to maintain anaerobic and microaerobic conditions, it is not
  • the culture temperature may be maintained at 20 to 45 °C, specifically, 25 to 40 °C, and may be cultured for about 10 to 160 hours, but is not limited thereto.
  • L-glutamic acid produced by the culture of the present application may be secreted into the medium or remain in the cells.
  • the L- glutamic acid production method of the present application includes the steps of preparing the Corynebacterium glutamicum strain of the present application, preparing a medium for culturing the strain, or a combination thereof (regardless of the order, in any order) ), for example, prior to the culturing step, may further include.
  • the method for producing L- glutamic acid of the present application may further include recovering L- glutamic acid from the culture medium (the culture medium) or the Corynebacterium glutamicum strain.
  • the recovering step may be further included after the culturing step.
  • the recovery may be to collect the desired L-glutamic acid using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method. .
  • a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method.
  • centrifugation, filtration, treatment with a crystallized protein precipitating agent (salting out method) extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity
  • Various chromatography such as island chromatography, HPLC, or a combination thereof may be used, and a desired L-glutamic acid may be recovered from a medium or a microorganism using a suitable method known in the art.
  • the L-glutamic acid production method of the present application may additionally include a purification step.
  • the purification may be performed using a suitable method known in the art.
  • the recovery step and the purification step are performed continuously or discontinuously, regardless of the order, or integrated into one step. may be performed, but is not limited thereto.
  • variants, polynucleotides, vectors, strains, and the like are as described in the other aspects above.
  • Another aspect of the present application is a variant of the present application, a polynucleotide encoding the variant, a vector including the polynucleotide or a Corynebacterium glutamicum strain comprising the polynucleotide of the present application; the culture medium; Or to provide a composition for producing L- glutamic acid comprising a combination of two or more of them.
  • composition of the present application may further include any suitable excipients commonly used in compositions for the production of amino acids, and these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc.
  • excipients commonly used in compositions for the production of amino acids
  • these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc.
  • the present invention is not limited thereto.
  • composition of the present application variants, polynucleotides, vectors, strains, media and L-glutamic acid are the same as those described in the other aspects above.
  • a plasmid (pDCM2, FIG. 1, SEQ ID NO: 19) for the insertion and replacement of genes in the Corynebacterium chromosome was designed, and the plasmid was synthesized using the Gene-synthesis service of Bionics Co., Ltd.
  • a plasmid was designed to include a restriction enzyme that is easy to use for cloning with reference to a generally known sacB system related paper [Gene, 145 (1994) 69-73].
  • the thus synthesized pDCM2 plasmid has the following characteristics.
  • Example 2 D-alanine-D-alanine ligase A in microorganisms Vector construction for mutant expression
  • D-alanine-D-alanine ligase A variant (G256S; SEQ ID NO: 1) in which glycine at position 256 of the amino acid sequence (SEQ ID NO: 3) is substituted with serine (G256S; SEQ ID NO: 1) was produced to determine the effect on L-glutamic acid production.
  • a vector for was prepared as follows.
  • PCR was performed using the primer pair of the sequences of SEQ ID NOs: 5 and 6 and the primer pair of the sequences of SEQ ID NOs: 7 and 8, respectively, using gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13869 as a template.
  • gDNA genomic DNA
  • overlapping PCR was performed again using a pair of primers of SEQ ID NO: 5 and SEQ ID NO: 8 to obtain a fragment.
  • PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 vector was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting plasmid was named pDCM2-ddlA (G256S).
  • Example 3 Production of wild-type Corynebacterium glutamicum-derived L-glutamic acid production strain and D-alanine-D-alanine ligase A mutant introduction strain production
  • Example 3-1 Preparation of Corynebacterium glutamicum strain having L-glutamic acid-producing ability derived from wild-type Corynebacterium glutamicum
  • Corynebacterium glutamicum ATCC13869-derived odhA based on the prior literature (Appl Environ Microbiol. 2007 Feb; 73(4): 1308-19. Epub 2006 Dec 8.) to produce a strain having L-glutamic acid-producing ability derived from ATCC13869.
  • a strain of Corynebacterium glutamicum ATCC13869 ⁇ odhA in which the gene was deleted was prepared.
  • PCR was performed using the primer pairs of SEQ ID NO: 11 and SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14 using Corynebacterium glutamicum ATCC13869 chromosomal DNA as a template.
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 11 and SEQ ID NO: 14 to obtain a fragment.
  • PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 vector was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting plasmid was named pDCM2- ⁇ odhA.
  • Example 3-2 D-alanine-D-alanine ligase A Production of mutant expression strains
  • Example 2 The vector prepared in Example 2 was transformed into ATCC13869 ⁇ odhA prepared in Example 3-1.
  • the strain into which the mutant was introduced was selected using SEQ ID NOs: 9 and 10. Each selected strain was named ATCC13869 ⁇ odhA_ddlA_G256S.
  • Example 3-3 Comparison of L-glutamic acid production capacity of D-alanine-D-alanine ligase A mutant expression strain
  • the strain ATCC13869 ⁇ odhA was used as a control and cultured in the following manner.
  • Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium, and incubated at 30° C. for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium and cultured with shaking at 30° C. for 40 hours at 200 rpm. After completion of the culture, L-glutamic acid production capacity was measured using high performance liquid chromatography (HPLC), and the measurement results are shown in Table 2 below. The glutamic acid concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 2 below.
  • HPLC high performance liquid chromatography
  • the ATCC13869 ⁇ odhA_ddlA_G256S was named CA02-1613, and it was deposited with the Korea Microorganism Conservation Center, a trustee institution under the Budapest Treaty, on November 30, 2020, and was given an accession number KCCM12854P.

Abstract

본 출원은 신규한 D-알라닌-D-알라닌 리가아제 A 변이체, 상기 변이체를 포함하는 코리네박테리움 글루타미쿰 균주 및 상기 균주를 이용한 L-글루탐산 생산 방법에 관한 것이다.

Description

신규한 D-알라닌-D-알라닌 리가아제 A 변이체 및 이를 이용한 L-글루탐산 생산 방법
본 출원은 신규한 D-알라닌-D-알라닌 리가아제 A 변이체, 상기 변이체를 포함하는 코리네박테리움 글루타미쿰 균주 및 상기 균주를 이용한 L-글루탐산 생산 방법에 관한 것이다.
L-아미노산 및 기타 유용물질을 생산하기 위하여, 고효율 생산 미생물 및 발효공정기술 개발을 위한 다양한 연구들이 수행되고 있다. 예를 들어, L-글루탐산 생합성에 관여하는 효소를 코딩하는 유전자의 발현을 증가시키거나 또는 생합성에 불필요한 유전자를 제거하는 것과 같은 목적 물질 특이적 접근 방법이 주로 이용되고 있다(US 8206954 B2).
다만, L-글루탐산의 수요 증가에 따라 효과적인 L-글루탐산의 생산능 증가를 위한 연구가 여전히 필요한 실정이다.
본 발명자들은 L-글루탐산 생산을 증대시키는 신규한 D-알라닌-D-알라닌 리가아제 A(D-alanine-D-alanine ligase A) 변이체, 상기 변이체를 포함하는 코리네박테리움 글루타미쿰 균주 및 상기 균주를 이용한 L-글루탐산 생산 방법을 개발하여 본 출원을 완성하였다.
본 출원의 하나의 목적은 서열번호 3의 아미노산 서열의 256번째 위치에 상응하는 아미노산인 글리신(glycine)이 세린(serine)으로 치환된, 서열번호 1로 기재된 아미노산 서열로 이루어진, D-알라닌-D-알라닌 리가아제 A 변이체를 제공하는 것이다.
본 출원의 다른 하나의 목적은 본 출원의 변이체를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 본 출원의 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하고, L-글루탐산 생산능을 가진, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 균주를 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하고, L-글루탐산 생산능을 가진, 코리네박테리움 글루타미쿰 균주를 배지에서 배양하는 단계를 포함하는, L-글루탐산 생산 방법을 제공하는 것이다.
본 출원의 D-알라닌-D-알라닌 리가아제 A의 변이체를 포함하는, 코리네박테리움 글루타미쿰 균주를 배양하는 경우, 기존 비변형 폴리펩티드를 갖는 미생물에 비해 고수율의 L-글루탐산 생산이 가능하다.
도 1은 pDCM2 플라스미드의 모식도이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 출원의 하나의 양태는 서열번호 3의 아미노산 서열의 256번째 위치에 상응하는 아미노산인 글리신(glycine)이 세린(serine)으로 치환된, 서열번호 1로 기재된 아미노산 서열로 이루어진, 변이체를 제공한다.
본 출원의 변이체는 서열번호 1로 기재된 아미노산 서열을 가지거나 포함하거나, 상기 아미노산 서열로 필수적으로 이루어질(essentially consisting of) 수 있다.
또한, 본 출원의 변이체는 상기 서열번호 1로 기재된 아미노산 서열에서 서열번호 3의 아미노산 서열을 기준으로 256번 위치에 상응하는 아미노산은 세린이고, 상기 서열번호 1로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 변이체에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 변이체도 본 출원의 범위 내에 포함됨은 자명하다.
예를 들어, 상기 아미노산 서열 N-말단, C-말단 그리고/또는 내부에 본 출원의 변이체의 기능을 변경하지 않는 서열 추가 또는 결실, 자연적으로 발생할 수 있는 돌연변이, 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다.
상기 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
본 출원에서 용어, "변이체(variant)"는 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)되어 상기 변이체의 변이 전 아미노산 서열과 상이하나 기능(functions) 또는 특성(properties)이 유지되는 폴리펩티드를 지칭한다. 이러한 변이체는 일반적으로 상기 폴리펩티드의 아미노산 서열 중 하나 이상의 아미노산을 변형하고, 상기 변형된 폴리펩티드의 특성을 평가하여 동정(identify)될 수 있다. 즉, 변이체의 능력은 변이 전 폴리펩티드에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 또한, 일부 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이체를 포함할 수 있다. 다른 변이체는 성숙 단백질(mature protein)의 N- 및/또는 C-말단으로부터 일부분이 제거된 변이체를 포함할 수 있다. 상기 용어 "변이체"는 변이형, 변형, 변이형 폴리펩티드, 변이된 단백질, 변이 및 변이체 등의 용어(영문 표현으로는 modification, modified polypeptide, modified protein, mutant, mutein, divergent 등)가 혼용되어 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다. 본 출원의 목적상 상기 변이체는 서열번호 3의 아미노산 서열의 256번째 위치에 상응하는 아미노산인 글리신이 세린으로 치환된, 서열번호 1로 기재된 아미노산 서열을 포함하는 폴리펩티드일 수 있다.
또한, 변이체는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 변이체의 N-말단에는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이동(translocation)에 관여하는 시그널(또는 리더) 서열이 컨쥬게이트 될 수 있다. 또한 상기 변이체는 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
본 출원에서 용어, '상동성 (homology)' 또는 '동일성 (identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
본 출원의 일 예로, 본 출원의 변이체는 D-알라닌-D-알라닌 리가아제 A 활성을 가질 수 있다. 또한, 본 출원의 변이체는 D-알라닌-D-알라닌 리가아제 A 활성을 갖는 야생형 폴리펩티드에 비해 L-글루탐산 생산능이 증가되도록 하는 활성을 가질 수 있다.
본 출원에서 용어, "D-알라닌-D-알라닌 리가아제 A(D-alanine-D-alanine ligase A)"는 세포벽을 형성 하는 폴리펩티드이다. 구체적으로, 본 출원의 D-알라닌-D-알라닌 리가아제 A는 D-Ala-D-Ala 리가아제 A 또는 D-알라닐알라닌 신테타아제 A로 혼용하여 사용될 수 있다. 본 출원에서 상기 D-알라닌-D-알라닌 리가아제 A는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있다. 구체적으로 ddlA에 의해 코딩되는 D-알라닌-D-알라닌 리가아제 A 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원에서, 용어 "상응하는(corresponding to)"은, 폴리펩티드에서 열거되는 위치의 아미노산 잔기이거나, 또는 폴리펩티드에서 열거되는 잔기와 유사하거나 동일하거나 상동한 아미노산 잔기를 지칭한다. 상응하는 위치의 아미노산을 확인하는 것은 특정 서열을 참조하는 서열의 특정 아미노산을 결정하는 것일 수 있다. 본 출원에 사용된 "상응 영역"은 일반적으로 관련 단백질 또는 참조 (reference) 단백질에서의 유사하거나 대응되는 위치를 지칭한다.
예를 들어, 임의의 아미노산 서열을 서열번호 3과 정렬(align)하고, 이를 토대로 상기 아미노산 서열의 각 아미노산 잔기는 서열번호 3의 아미노산 잔기와 상응하는 아미노산 잔기의 숫자 위치를 참조하여 넘버링 할 수 있다. 예를 들어, 본 출원에 기재된 것과 같은 서열 정렬 알고리즘은, 쿼리 시퀀스("참조 서열"이라고도 함)와 비교하여 아미노산의 위치, 또는 치환, 삽입 또는 결실 등의 변형이 발생하는 위치를 확인할 수 있다.
이러한 정렬에는 예를 들어 Needleman-Wunsch 알고리즘 (Needleman 및 Wunsch, 1970, J. Mol. Biol. 48: 443-453), EMBOSS 패키지의 Needleman 프로그램 (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) 등을 이용할 수 있으나, 이에 제한되지 않고 당업계에 알려진 서열 정렬 프로그램, 쌍 서열(pairwise sequence) 비교 알고리즘 등을 적절히 사용할 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 변이체를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이체를 코딩하는 폴리뉴클레오티드 단편을 의미한다.
본 출원의 변이체를 코딩하는 폴리뉴클레오티드는 서열번호 1으로 기재된 아미노산 서열을 코딩하는 염기서열을 포함할 수 있다. 본 출원의 일 예로, 본 출원의 폴리뉴클레오티드는 서열번호 2의 서열을 가지거나 포함할 수 있다. 또한, 본 출원의 폴리뉴클레오티드는 서열번호 2의 서열로 이루어지거나, 필수적으로 구성될 수 있다.
본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 출원의 변이체를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 본 출원의 변이체의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 출원의 폴리뉴클레오티드는 서열번호 2의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열을 가지거나 포함하거나, 또는 서열번호 2의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다. 이때, 상기 상동성 또는 동일성을 갖는 서열에서, 서열번호 1의 256번째 위치에 상응하는 아미노산을 코딩하는 코돈은, 세린을 코딩하는 코돈 중 하나일 수 있다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화할 수 있는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1×SSC, 0.1% SDS, 구체적으로 60℃, 0.1×SSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1×SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
본 출원의 또 다른 하나의 양태는 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 제공하는 것이다. 상기 벡터는 상기 폴리뉴클레오티드를 숙주세포에서 발현시키기 위한 발현 벡터일 수 있으나, 이에 제한되지 않는다.
본 출원의 벡터는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 포함하는 DNA 제조물을 포함할 수 있다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 표적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 폴리펩티드가 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 변이체를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드를 포함하는, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 균주를 제공하는 것이다.
본 출원의 균주는 본 출원의 변이형 폴리펩티드, 상기 폴리펩티드를 암호화하는 폴리뉴클레오티드, 또는 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 포함할 수 있다.
본 출원에서 용어, "균주(또는, 미생물)"는 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 폴리펩티드, 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
본 출원의 균주는 본 출원의 변이체, 본 출원의 폴리뉴클레오티드 및 본 출원의 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하는 균주; 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드를 발현하도록 변형된 균주; 본 출원의 변이체, 또는 본 출원의 폴리뉴클레오티드를 발현하는 균주 (예컨대, 재조합 균주); 또는 본 출원의 변이체 활성을 갖는 균주 (예컨대, 재조합 균주)일 수 있으나, 이에 제한되지 않는다.
본 출원의 균주는 L-글루탐산 생산능을 가진 균주일 수 있다.
본 출원의 균주는 자연적으로 D-알라닌-D-알라닌 리가아제 A 또는 L-글루탐산 생산능을 가지고 있는 미생물, 또는 D-알라닌-D-알라닌 리가아제 A 또는 L-글루탐산 생산능이 없는 모균주에 본 출원의 변이체 또는 이를 코딩하는 폴리뉴클레오티드 (또는 상기 폴리뉴클레오티드를 포함하는 벡터)가 도입되거나 및/또는 L-글루탐산 생산능이 부여된 미생물일 수 있으나 이에 제한되지 않는다.
일 예로, 본 출원의 균주는 본 출원의 폴리뉴클레오티드 또는 본 출원의 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환되어, 본 출원의 변이체를 발현하는 세포 또는 미생물로서, 본 출원의 목적상 본 출원의 균주는 본 출원의 변이체를 포함하여 L-글루탐산을 생산할 수 있는 미생물을 모두 포함할 수 있다. 예를 들어, 본 출원의 균주는 천연의 야생형 미생물 또는 L-글루탐산을 생산하는 미생물에 본 출원의 변이체를 코딩하는 폴리뉴클레오티드가 도입됨으로써 D-알라닌-D-알라닌 리가아제 A 변이체가 발현되어, L-글루탐산 생산능이 증가된 재조합 균주일 수 있다. 상기 L-글루탐산 생산능이 증가된 재조합 균주는, 천연의 야생형 미생물 또는 D-알라닌-D-알라닌 리가아제 A 비변형 미생물 (즉, 야생형 D-알라닌-D-알라닌 리가아제 A(서열번호 3)를 발현하는 미생물 또는 변이형(서열번호 1)단백질을 발현하지 않는 미생물)에 비하여 L-글루탐산 생산능이 증가된 미생물일 수 있으나, 이에 제한되는 것은 아니다. 일 예로, 본 출원의 L-글루탐산 생산능이 증가된 균주는 서열번호 3의 폴리펩티드 또는 이를 코딩하는 폴리뉴클레오티드를 포함하는 코리네박테리움 글루타미쿰과 비교하여 L-글루탐산 생산능이 증가된 미생물일 수 있으나, 이에 제한되지 않는다. 그 예로, 상기 L-글루탐산 생산능의 증가 여부를 비교하는 대상 균주인, D-알라닌-D-알라닌 리가아제 A 비변형 미생물은 ATCC13869 균주 또는 ATCC13869 △odhA 균주(Appl Environ Microbiol. 2007 Feb;73(4):1308-19. Epub 2006 Dec 8.) 일 수 있으나, 이에 제한되지 않는다.
일 예로, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물의 L-글루탐산 생산능에 비하여 약 1% 이상, 구체적으로는 1% 이상, 약 2.5% 이상, 약 5% 이상, 약 6% 이상, 약 7% 이상, 약 8% 이상, 약 9% 이상, 약 10% 이상, 약 10.5% 이상, 약 11% 이상, 약 11.5%이상, 약 12% 이상, 약 12.5% 이상, 약 13% 이상, 약 13.5% 이상, 약 14% 이상, 약 14.5% 이상, 약 15% 이상, 약 15.5% 이상, 약 16% 이상, 약 16.5% 이상, 약 17% 이상, 약 17.5% 이상, 약 18% 이상, 약 18.5% 이상, 약 19% 이상, 약 19.5% 이상, 약 20% 이상, 약 20.5% 이상, 약 21% 이상 또는 약 21.5% 이상 (상한값은 특별한 제한은 없으며, 예컨대, 약 200% 이하, 약 150% 이하, 약 100% 이하, 약 50% 이하, 약 45% 이하, 약 40% 이하, 약 35% 이하, 약 30% 이하, 약 25% 이하 또는 약 22% 이하 일 수 있음)증가된 것일 수 있으나, 변이 전 모균주 또는 비변형 미생물의 생산능에 비해 +값의 증가량을 갖는 한, 이에 제한되지 않는다. 다른 예에서, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물에 비하여, L-글루탐산 생산능이 약 1.1배 이상, 약 1.12배 이상, 약 1.13배 이상, 1.15배 이상, 1.16배 이상, 1.17배 이상, 1.18배 이상, 1.19배 이상, 1.2배 이상 또는 1.21배 이상 (상한값은 특별한 제한은 없으며, 예컨대, 약 10배 이하, 약 5배 이하, 약 3배 이하 또는 약 2배 이하일 수 있음) 증가된 것일 수 있으나, 이에 제한되지 않는다. 상기 용어 “약(about)”은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
본 출원에서 용어, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 본 명세서에 기재된 D-알라닌-D-알라닌 리가아제 A 변이체가 도입되지 않거나 도입되기 전의 균주를 의미할 수 있다. 상기 "비변형 미생물"은 "변형 전 균주", "변형 전 미생물", "비변이 균주", "비변형 균주", "비변이 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
본 출원의 또 다른 일 예로, 본 출원의 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있다.
본 출원의 미생물은 OdhA 단백질의 활성이 추가적으로 약화 또는 불활성화된 미생물일 수 있다.
본 출원에서 용어, 폴리펩티드 활성의 "약화"는 내재적 활성에 비하여 활성이 감소되거나 또는 활성이 없는 것을 모두 포함하는 개념이다. 상기 약화는 불활성화(inactivation), 결핍(deficiency), 하향조절(down-regulation), 감소(decrease), 저하(reduce), 감쇠(attenuation) 등의 용어와 혼용될 수 있다.
상기 약화는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드의 변이 등으로 폴리펩티드 자체의 활성이 본래 미생물이 가지고 있는 폴리펩티드의 활성에 비해 감소 또는 제거된 경우, 이를 코딩하는 폴리뉴클레오티드의 유전자의 발현 저해 또는 폴리펩티드로의 번역(translation) 저해 등으로 세포 내에서 전체적인 폴리펩티드 활성 정도 및/또는 농도(발현량)가 천연형 균주에 비하여 낮은 경우, 상기 폴리뉴클레오티드의 발현이 전혀 이루어지지 않은 경우, 및/또는 폴리뉴클레오티드의 발현이 되더라도 폴리펩티드의 활성이 없는 경우 역시 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주, 야생형 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "불활성화, 결핍, 감소, 하향조절, 저하, 감쇠"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성에 비하여 낮아진 것을 의미한다.
이러한 폴리펩티드의 활성의 약화는, 당업계에 알려진 임의의 방법에 의하여 수행될 수 있으나 이로 제한되는 것은 아니며, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다(예컨대, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드 활성의 약화는
1) 폴리펩티드를 코딩하는 유전자 전체 또는 일부의 결손;
2) 폴리펩티드를 코딩하는 유전자의 발현이 감소하도록 발현조절영역(또는 발현조절서열)의 변형;
3) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 구성하는 아미노산 서열의 변형(예컨대, 아미노산 서열 상의 1 이상의 아미노산의 삭제/치환/부가);
4) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 코딩하는 유전자 서열의 변형 (예를 들어, 폴리펩티드의 활성이 제거 또는 약화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 핵산염기 서열 상의 1 이상의 핵산염기의 삭제/치환/부가);
5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입;
7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가;
8) 폴리펩티드를 코딩하는 유전자 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE); 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
예컨대,
상기 1) 폴리펩티드를 코딩하는 상기 유전자 일부 또는 전체의 결손은, 염색체 내 내재적 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드 전체의 제거, 일부 뉴클레오티드가 결실된 폴리뉴클레오티드로의 교체 또는 마커 유전자로 교체일 수 있다.
또한, 상기 2) 발현조절영역(또는 발현조절서열)의 변형은, 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절영역(또는 발현조절서열) 상의 변이 발생, 또는 더욱 약한 활성을 갖는 서열로의 교체일 수 있다. 상기 발현조절영역에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 낮은 다른 개시코돈을 코딩하는 염기서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 3) 및 4)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은 폴리펩티드의 활성을 약화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 약한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 없도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 예를 들면, 폴리뉴클레오티드 서열 내 변이를 도입하여 종결 코돈을 형성시킴으로써, 유전자의 발현을 저해하거나 약화시킬 수 있으나, 이에 제한되지 않는다.
상기 6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입은 예를 들어 문헌 [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986]을 참고할 수 있다.
상기 7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가는 mRNA 번역을 불가능하게 하거나 속도를 저하시키는 것일 수 있다.
상기 8) 폴리펩티드를 코딩하는 유전자서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE)는 상기 폴리펩티드를 코딩하는 유전자의 전사체에 상보적인 안티센스 뉴클레오티드를 만들어 활성을 약화하는 것일 수 있다.
본 출원에서 용어, 폴리펩티드 활성의 "강화"는, 폴리펩티드의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 활성화(activation), 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 활성화, 강화, 상향조절, 과발현, 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 “내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "강화", "상향조절", "과발현" 또는 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성 및/또는 농도(발현량)에 비하여 향상된 것을 의미한다.
상기 강화는 외래의 폴리펩티드를 도입하거나, 내재적인 폴리펩티드의 활성 강화 및/또는 농도(발현량)를 통해 달성할 수 있다. 상기 폴리펩티드의 활성의 강화 여부는 해당 폴리펩티드의 활성 정도, 발현량 또는 해당 폴리펩티드로부터 배출되는 산물의 양의 증가로부터 확인할 수 있다.
상기 폴리펩티드의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 폴리펩티드의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드 활성의 강화는
1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가;
2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역을 활성이 강력한 서열로 교체;
3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
4) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드의 아미노산 서열의 변형;
5) 폴리펩티드 활성이 강화도록 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열의 변형 (예를 들어, 폴리펩티드의 활성이 강화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 폴리뉴클레오티드 서열의 변형);
6) 폴리펩티드의 활성을 나타내는 외래 폴리펩티드 또는 이를 코딩하는 외래 폴리뉴클레오티드의 도입;
7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
보다 구체적으로,
상기 1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터의 숙주세포 내로의 도입에 의해 달성되는 것일 수 있다. 또는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 숙주세포 내의 염색체 내에 1 카피 또는 2 카피 이상 도입에 의해 달성되는 것일 수 있다. 상기 염색체 내에 도입은 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다. 상기 벡터는 전술한 바와 같다.
상기 2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역(또는 발현조절서열)을 활성이 강력한 서열로 교체는, 예를 들면, 상기 발현조절영역의 활성을 더욱 강화하도록 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 가지는 서열로의 교체일 수 있다. 상기 발현조절영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 그리고 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 일 예로, 본래의 프로모터를 강력한 프로모터로 교체시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터, yccA 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 높은 다른 개시코돈을 코딩하는 염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 폴리펩티드의 활성을 강화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 증가하도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 상기 교체는 구체적으로 상동재조합에 의하여 폴리뉴클레오티드를 염색체내로 삽입함으로써 수행될 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 전술한 바와 같다.
상기 6) 폴리펩티드의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 상기 폴리펩티드와 동일/유사한 활성을 나타내는 폴리펩티드를 코딩하는 외래 폴리뉴클레오티드의 숙주세포 내 도입일 수 있다. 상기 외래 폴리뉴클레오티드는 상기 폴리펩티드와 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한이 없다. 상기 도입에 이용되는 방법은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 폴리펩티드가 생성되어 그 활성이 증가될 수 있다.
상기 7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩티드의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 폴리펩티드 활성의 강화는, 상응하는 폴리펩티드의 활성 또는 농도 발현량이 야생형이나 변형 전 미생물 균주에서 발현된 폴리펩티드의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩티드로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
보다 구체적으로, 본 출원의 코리네박테리움 글루타미쿰 균주는 서열번호 17을 포함하는 폴리펩티드, 서열번호 17을 포함하는 폴리펩티드를 코딩하는 뉴클레오티드 또는 서열번호 18을 포함하는 뉴클레오티드가 추가로 결실된 미생물일 수 있다.
본 출원의 미생물에서 폴리뉴클레오티드의 일부 또는 전체의 변형은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위 (engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오티드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 미생물에서, 변이체, 폴리뉴클레오티드 및 L-글루탐산 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드를 포함하는 코리네박테리움 글루타미쿰 균주를 배지에서 배양하는 단계를 포함하는, L-글루탐산 생산방법을 제공한다.
본 출원의 L-글루탐산 생산방법은 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드 또는 본 출원의 벡터를 포함하는 코리네박테리움 글루타미쿰 균주를 배지에서 배양하는 단계를 포함할 수 있다.
본 출원에서, 용어 "배양"은 본 출원의 코리네박테리움 글루타미쿰 균주를 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및/또는 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 본 출원의 코리네박테리움 글루타미쿰 균주를 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 코리네박테리움 글루타미쿰 균주의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 코리네박테리움 글루타미쿰 균주를 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
구체적으로, 코리네박테리움 속 균주에 대한 배양 배지는 문헌["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)]에서 찾아 볼 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 본 출원의 코리네박테리움 글루타미쿰 균주의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
본 출원의 배양에서 배양온도는 20 내지 45℃구체적으로는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 배양에 의하여 생산된 L-글루탐산은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 L- 글루탐산 생산방법은, 본 출원의 코리네박테리움 글루타미쿰 균주를 준비하는 단계, 상기 균주를 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 L- 글루탐산 생산방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 코리네박테리움 글루타미쿰 균주로부터 L- 글루탐산을 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 L- 글루탐산을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-글루탐산을 회수할 수 있다.
또한, 본 출원의 L-글루탐산 생산방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 L-글루탐산 생산방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 연속적 또는 비연속적으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 방법에서, 변이체, 폴리뉴클레오티드, 벡터 및 균주 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이체, 상기 변이체를 코딩하는 폴리뉴클레오타이드, 상기 폴리뉴클레오타이드를 포함하는 벡터 또는 본 출원의 폴리뉴클레오티드를 포함하는 코리네박테리움 글루타미쿰 균주; 이를 배양한 배지; 또는 이들 중 2 이상의 조합을 포함하는 L-글루탐산 생산용 조성물을 제공하는 것이다.
본 출원의 조성물은 아미노산 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 조성물에서, 변이체, 폴리뉴클레오티드, 벡터, 균주, 배지 및 L- 글루탐산 등은 상기 다른 양태에서 기재한 바와 같다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 하기 실시예는 본 출원을 예시하기 위한 바람직한 실시양태에 불과한 것이며 따라서, 본 출원의 권리범위를 이에 한정하는 것으로 의도되지는 않는다. 한편, 본 명세서에 기재되지 않은 기술적인 사항들은 본 출원의 기술 분야 또는 유사 기술 분야에서 숙련된 통상의 기술자이면 충분히 이해하고 용이하게 실시할 수 있다.
실시예 1: 플라스미드의 제작
코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드(pDCM2, 도 1, 서열번호 19)를 디자인하였고, 바이오닉스(주)의 유전자 합성(Gene-synthesis) 서비스를 이용하여 플라스미드를 합성하였다. 일반적으로 알려진 sacB 시스템 관련 논문[Gene, 145 (1994) 69-73]을 참고로 하여 클로닝에 활용하기 용이한 제한효소(restriction enzyme)를 포함하도록 플라스미드를 설계하였다. 이렇게 합성된 pDCM2 플라스미드는 다음과 같은 특성을 갖는다.
1) 대장균에서만 작용하는 복제 기점(replication origin)을 가지고 있어 대장균 내에서는 자가 복제(self-replication)가 가능하나 코리네박테리움에서는 자가 복제가 불가능한 특성을 갖는다.
2) 선별 마커로 카나마이신 내성 유전자를 갖는다.
3) 2차 양성 선별(positive-selection) 마커로 레반 수크라제(Levan sucrose) 유전자(sacB)를 갖는다.
4) 최종 제작된 균주에는 pDCM2 플라스미드로부터 유래한 어떠한 유전자 정보도 남지 않는다.
실시예 2: 미생물내 D-알라닌-D-알라닌 리가아제 A 변이체 발현을 위한 벡터 제작
D-알라닌-D-알라닌 리가아제 A 아미노산 서열(서열번호 3)의 256번째 위치 글리신이 세린으로 치환된 변이체(G256S; 서열번호 1)가 L-글루탐산 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13869의 gDNA(genomic DNA)를 주형으로 서열번호 5 및 6의 서열의 프라이머 쌍과 서열번호 7 및 8의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 5 및 서열번호 8의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 벡터는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 플라스미드를 pDCM2-ddlA(G256S)라 명명하였다.
실시예 3: 야생형 코리네박테리움 글루타미쿰 유래 L-글루탐산 생산주 제작 및 D-알라닌-D-알라닌 리가아제 A 변이체 도입 균주 제작
실시예 3-1: 야생형 코리네박테리움 글루타미쿰 유래 L-글루탐산 생산능을 갖는 코리네박테리움 글루타미쿰 균주 제작
코리네박테리움 글루타미쿰 ATCC13869 유래 L-글루탐산 생산능을 갖는 균주를 제작하기 위해 선행문헌(Appl Environ Microbiol. 2007 Feb;73(4):1308-19. Epub 2006 Dec 8.)을 바탕으로 odhA 유전자를 결손한 코리네박테리움 글루타미쿰 ATCC13869 △odhA 균주를 제작하였다.
구체적으로 odhA 결손을 위하여 코리네박테리움 글루타미쿰 ATCC13869 염색체 DNA를 주형으로 하여 서열번호 11과 서열번호 12, 서열번호 13과 서열번호 14의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 11 및 서열번호 14의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 벡터는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 플라스미드를 pDCM2-△odhA라 명명하였다.
제작된 pDCM2-△odhA 벡터를 코리네박테리움 글루타미쿰 ATCC13869 균주에 전기천공법으로 형질 전환 후, 2차 교차 과정을 거쳐 염색체 상에서 odhA 유전자가 결손된 균주를 수득하였다. 유전자 결손 여부는 서열번호 15와 서열번호 16을 이용한 PCR 과 게놈 시퀀싱을 통해 확인하였으며, 제작된 균주를 ATCC13869 △odhA로 명명하였다.
여기에서 사용된 프라이머 서열은 하기 표 1과 같다.
서열번호 명칭 서열
11 odhA_up_F TGAATTCGAGCTCGGTACCCTTGAACGGAATTGGGTGG
12 odhA_up_R CCCAGGTGGCATCGGTACCTTCACCCAGCGCCACGCAG
13 odhA_down_F CGCTGGGTGAAGGTACCGATGCCACCTGGGTTGGTCAAG
14 odhA_down_R GTCGACTCTAGAGGATCCCCGGACAAGGAATGGAGAGA
15 odhA_del_F CTTACCGTTGTTGCCCTT
16 odhA_del_R CTCCTTCACCCACATCATT
실시예 3-2: D-알라닌-D-알라닌 리가아제 A 변이체 발현 균주 제작
상기 실시예 2에서 제작한 벡터를 상기 실시예 3-1에서 제작한 ATCC13869 △odhA에 형질전환 하였다.
상동성 재조합이 일어난 균주에서 서열번호 9와 10을 이용하여 변이체가 도입된 균주를 선별하였다. 각 선별된 균주를 ATCC13869 △odhA_ddlA_G256S로 명명하였다.
실시예 3-3: D-알라닌-D-알라닌 리가아제 A 변이체 발현 균주의 L-글루탐산 생산능 비교
상기 실시예 3-1에서 제작된 균주를 L-글루탐산 생산능을 확인하고자 ATCC13869 △odhA 균주를 대조군으로 하여 아래와 같은 방법으로 배양하였다.
종 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 40시간 동안, 200 rpm에서 진탕 배양하였다. 배양 종료 후, 고성능 액체 크로마토그래피(HPLC)를 이용하여 L-글루탐산 생산능을 측정하였으며, 측정 결과는 하기 표 2에 나타내었다. 실험한 각 균주에 대한 배양액 중의 글루탐산 농도 및 농도 증가율은 하기 표 2와 같다
<종배지>
포도당 1%, 육즙 0.5%, 폴리펩톤 1%, 염화나트륨 0.25%, 효모엑기스 0.5%, 한천 2%, 유레아 0.2%, pH 7.2
<생산배지>
원당 6%, 탄산칼슘 5%, 황산암모늄 2.25%, 일인산칼륨 0.1%, 황산마그네슘 0.04%, 황산철 10 mg/L, 티아민 염산염 0.2 mg/L, 비오틴 50㎍/L
균주명 L-글루탐산 농도(g/L) L-글루탐산 농도 증가율(%)
ATCC13869 △odhA 1.9 -
ATCC13869 △odhA_ddlA_G256S 2.31 21.6
상기 표 2에서 나타난 바와 같이 ATCC13869 △odhA 균주에 비하여 ddlA(G256S) 유전자가 도입된 ATCC13869 △odhA_ddlA_G256S에서 L-글루탐산의 농도가 현저히 증가함을 확인하였다.
상기 ATCC13869 △odhA_ddlA_G256S는 CA02-1613로 명명하였으며, 부다페스트조약 하의 수탁기관인 한국미생물보존센터에 2020년 11월 30일자로 기탁하여 수탁번호 KCCM12854P를 부여받았다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2021005153-appb-I000001

Claims (5)

  1. 서열번호 3의 256번째 위치에 상응하는 아미노산인 글리신이 세린으로 치환된, 서열번호 1로 기재된 아미노산 서열로 이루어진 D-알라닌-D-알라닌 리가아제 A 변이체.
  2. 제1항의 변이체를 코딩하는 폴리뉴클레오티드.
  3. 제1항의 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하는, 코리네박테리움 글루타미쿰 균주.
  4. 제3항에 있어서, 상기 균주는 서열번호 3의 폴리펩티드 또는 이를 코딩하는 폴리뉴클레오티드를 포함하는 코리네박테리움 글루타미쿰과 비교하여 L-글루탐산 생산능이 증가된, 균주.
  5. 제1항의 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 코리네박테리움 글루타미쿰 균주를 배지에서 배양하는 단계를 포함하는, L- 글루탐산 생산 방법.
PCT/KR2021/005153 2021-01-27 2021-04-23 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법 WO2022163934A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0011241 2021-01-27
KR1020210011241A KR102257842B1 (ko) 2021-01-27 2021-01-27 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법

Publications (1)

Publication Number Publication Date
WO2022163934A1 true WO2022163934A1 (ko) 2022-08-04

Family

ID=76140206

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/005153 WO2022163934A1 (ko) 2021-01-27 2021-04-23 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법

Country Status (2)

Country Link
KR (1) KR102257842B1 (ko)
WO (1) WO2022163934A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022231036A1 (ko) * 2021-04-29 2022-11-03 씨제이제일제당 (주) 신규한 변이체 및 이를 이용한 l-글루탐산 생산 방법
KR102546734B1 (ko) * 2022-10-31 2023-06-23 대상 주식회사 L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070218525A1 (en) * 2004-03-29 2007-09-20 Kyowa Hakko Kogyo Co., Ltd. Process for Producing Dipeptides
KR20070097557A (ko) * 2004-12-28 2007-10-04 아지노모토 가부시키가이샤 Ｌ-글루탐산 생산 미생물 및 ｌ-글루탐산의 제조방법
KR100837844B1 (ko) * 2006-12-14 2008-06-13 씨제이제일제당 (주) Ｌ-글루탐산 생산능이 향상된 코리네박테리움 속 미생물 및이를 이용한 ｌ-글루탐산 생산 방법
JP2020531007A (ja) * 2017-08-16 2020-11-05 シージェイ チェイルジェダング コーポレイション マイコスポリン様アミノ酸を生産する微生物及びそれを用いたマイコスポリン様アミノ酸の生産方法

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5598329B2 (ja) * 2008-09-08 2014-10-01 味の素株式会社 Ｌ−アミノ酸を生産する微生物及びｌ−アミノ酸の製造法

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070218525A1 (en) * 2004-03-29 2007-09-20 Kyowa Hakko Kogyo Co., Ltd. Process for Producing Dipeptides
KR20070097557A (ko) * 2004-12-28 2007-10-04 아지노모토 가부시키가이샤 Ｌ-글루탐산 생산 미생물 및 ｌ-글루탐산의 제조방법
KR100837844B1 (ko) * 2006-12-14 2008-06-13 씨제이제일제당 (주) Ｌ-글루탐산 생산능이 향상된 코리네박테리움 속 미생물 및이를 이용한 ｌ-글루탐산 생산 방법
JP2020531007A (ja) * 2017-08-16 2020-11-05 シージェイ チェイルジェダング コーポレイション マイコスポリン様アミノ酸を生産する微生物及びそれを用いたマイコスポリン様アミノ酸の生産方法

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN 7 November 2018 (2018-11-07), ANONYMOUS : "MULTISPECIES: D-alanine--D-alanine ligase [Corynebacterium] ", XP055955051, retrieved from NCBI Database accession no. WP_060564468 *

Also Published As

Publication number Publication date
KR102257842B1 (ko) 2021-05-28

Similar Documents

Publication Publication Date Title
WO2022231368A1 (ko) 신규한 글루타메이트 합성 효소 서브 유니트 알파 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163920A1 (ko) 신규한 시스테인 설피네이트 디설피나제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163923A1 (ko) 신규한 atp 포스포리보실트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163922A1 (ko) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154181A1 (ko) 신규한 1,4-알파-글루칸-분지 효소 변이체 및 이를 이용한 imp 생산 방법
WO2022154178A1 (ko) 신규한 혐기성 코프로포르피리노겐 iii 옥시다제 변이체 및 이를 이용한 imp 생산 방법
WO2022154177A1 (ko) 신규한 3d-(3,5/4)-트리하이드록시사이클로헥세인-1,2-다이온 아실하이드롤라아제 변이체 및 이를 이용한 imp 생산 방법
WO2022231369A1 (ko) 신규한 포르메이트 의존성 포스포리보실글리신아미드 포밀 전이효소 변이체 및 이를 이용한 imp 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163941A1 (ko) 신규한 스퍼미딘 신타아제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163938A1 (ko) 신규한 리보뉴클레아제 p 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163937A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163940A1 (ko) 신규한 갈락토사이드 o-아세틸트랜스퍼라제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163939A1 (ko) 신규한 mfs 트랜스포터 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163909A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022163925A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163921A1 (ko) 신규한 스퍼미딘 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163926A1 (ko) 신규한 프롤린 탈수소효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163924A1 (ko) 신규한 5,10-메틸렌테트라하이드로폴레이트 리덕타제 변이체 및 이를 이용한 l-발린 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21923347

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21923347

Country of ref document: EP

Kind code of ref document: A1