WO2022055094A1 - L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법 - Google Patents

L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법 Download PDF

Info

Publication number
WO2022055094A1
WO2022055094A1 PCT/KR2021/008262 KR2021008262W WO2022055094A1 WO 2022055094 A1 WO2022055094 A1 WO 2022055094A1 KR 2021008262 W KR2021008262 W KR 2021008262W WO 2022055094 A1 WO2022055094 A1 WO 2022055094A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
glutamic acid
sequence
polypeptide
sbta
Prior art date
Application number
PCT/KR2021/008262
Other languages
English (en)
French (fr)
Inventor
권나라
송규현
이진남
봉현주
서창일
이아름
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to BR112023004335A priority Critical patent/BR112023004335A2/pt
Priority to CN202180070938.9A priority patent/CN116323951A/zh
Priority to AU2021341221A priority patent/AU2021341221A1/en
Priority to MX2023002783A priority patent/MX2023002783A/es
Priority to US18/025,050 priority patent/US20230323413A1/en
Priority to EP21866964.6A priority patent/EP4198132A4/en
Priority to JP2023514716A priority patent/JP2023540315A/ja
Priority to CA3191344A priority patent/CA3191344A1/en
Publication of WO2022055094A1 publication Critical patent/WO2022055094A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/14—Glutamic acid; Glutamine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • the present application relates to an L-glutamic acid-producing microorganism comprising SbtA protein or a polynucleotide encoding SbtA protein, and a method for producing L-glutamic acid using the same.
  • L-glutamic acid is a representative amino acid produced by fermentation, and has a unique taste, so it is one of the important amino acids widely used in the food field as well as in the pharmaceutical field and other animal feed fields.
  • L-glutamic acid is Corynebacterium ( Corynebacterium ) Genus, Escherichia coli , Bacillus subtilis ( Bacillus ), actinomycetes ( Streptomyces ), Penicillum genus, Klebsiella , Erwinia ( Erwinia ), or Pantoea , such as microorganisms of the genus
  • a method for producing using is known (US Pat. No. 3,220,929, US Pat. No. 6,682,912).
  • the present inventors have developed a microorganism of the genus Corynebacterium that produces L-glutamic acid at a high concentration by introducing a foreign protein, thereby completing the present application.
  • One object of the present application is to provide a recombinant microorganism of the genus of Corynebacterium for producing L-glutamic acid, including a polynucleotide encoding SbtA protein or SbtA protein. .
  • Another object of the present application is to provide a method for producing L-glutamic acid, comprising culturing in a medium a recombinant microorganism of the genus Corynebacterium that produces L-glutamic acid comprising a polynucleotide encoding SbtA protein or SbtA protein will be.
  • the recombinant microorganism of the genus Corynebacterium producing L-glutamic acid comprising the SbtA protein or the polynucleotide encoding the SbtA protein of the present application can produce L-glutamic acid in high yield, so that it can be usefully used for industrial production of L-glutamic acid. there is.
  • FIG. 1 is a schematic diagram of a pDCM2 plasmid.
  • One aspect of the present application for achieving the object of the present application is to provide a recombinant microorganism of the genus Corynebacterium for producing L-glutamic acid, including SbtA protein or a polynucleotide encoding the SbtA protein.
  • SbtA protein is one of the bicarbonate transporters, which promotes membrane impermeable bicarbonate, HCO 3 - , through the membrane to accelerate the treatment of carbon dioxide (CO 2 ) and contributes to carbon dioxide It is one of the proteins expressed for the capture and efficient use of Bicarbonate transporters include SbtA protein and BicA protein, which transport bicarbonate into the cell, resulting in the accumulation of bicarbonate in the cell.
  • the SbtA protein may be a protein derived from a microorganism different from the microorganism of the present application, or may be different from a protein inherently present in the microorganism of the present application.
  • the SbtA protein may be a cyanobacteria-derived protein, but is not limited thereto.
  • the SbtA protein may be a protein derived from a microorganism of the genus of Synechocystis , and more specifically, PCC 6803 of the genus of Synechocystis (Synechocystis sp. PCC 6803) or PCC 6714 of the genus of Synechocystis (Synechocystis).
  • sp. PCC 6714 may be a microorganism-derived protein.
  • the SbtA protein of the present application may include an amino acid sequence having 90% or more identity to the amino acid sequence of SEQ ID NO: 1.
  • the amino acid sequence of SEQ ID NO: 1 can be obtained from a known database, National Institutes of Health (NIH GenBank).
  • amino acid sequence having 90% or more identity with SEQ ID NO: 1 of the present application is 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 96.26% or more, 97% or more, 97.5% or more, 97.7% or more, 97.8% or more, 98% or more, 98.5% or more, 98.7% or more, 98.8% or more, 99% or more, 99.5% or more, 99.7% or more, 99.8% It may be an amino acid sequence with more or more, and less than 100% homology or identity.
  • amino acid sequence having 90% or more and less than 100% homology or identity to the amino acid sequence of SEQ ID NO: 1 may be the amino acid sequence of SEQ ID NO: 30.
  • amino acid sequence having such homology or identity and exhibiting the same or corresponding activity to the SbtA protein, or a bicarbonate transporter activity some sequence is deleted, modified, substituted, conservatively substituted or has an added amino acid sequence It is apparent that proteins are also included within the scope of the SbtA protein of the present application.
  • the SbtA protein of the present application may have an amino acid sequence having 90% or more identity to the amino acid sequence of SEQ ID NO: 1.
  • the SbtA protein of the present application may have an amino acid sequence having 90% or more identity to the amino acid sequence of SEQ ID NO: 1, consist of, or consist essentially of the amino acid sequence.
  • the SbtA protein of the present application contains nonsensical additions of sequences before and after the amino acid sequence of SEQ ID NO: 1 (i.e., addition of sequences that do not alter the function of the protein at the N-terminus and/or C-terminus of the amino acid sequence) or naturally occurring mutations, It does not exclude cases having a latent mutation or conservative substitution thereof.
  • the "conservative substitution” means substituting one amino acid with another amino acid having similar structural and/or chemical properties. Such amino acid substitutions may generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.
  • the polynucleotide encoding the SbtA protein may be an sbtA gene.
  • the polynucleotide encoding the SbtA protein may be derived from cyanobacteria.
  • the polynucleotide encoding the SbtA protein of the present application may include a nucleotide sequence encoding an amino acid sequence having 90% or more identity to the amino acid sequence of SEQ ID NO: 1.
  • the polynucleotide encoding the SbtA protein of the present application has a nucleotide sequence of SEQ ID NO: 2, a nucleotide sequence of SEQ ID NO: 31, or 90% or more identity with the amino acid sequence of SEQ ID NO: 1 or more. It may include a nucleotide sequence encoding an amino acid sequence having, but is not limited thereto.
  • the polynucleotide comprising a nucleotide sequence encoding an amino acid sequence having 90% or more identity to the amino acid sequence of SEQ ID NO: 1 is a polynucleotide having a nucleotide sequence encoding an amino acid sequence having 90% or more identity to the amino acid sequence of SEQ ID NO: 1 It may be a polynucleotide consisting of or consisting essentially of a nucleotide sequence encoding an amino acid sequence having at least 90% identity with the amino acid sequence of SEQ ID NO: 1.
  • polynucleotide refers to a DNA strand of a certain length or more as a polymer of nucleotides in which nucleotide monomers are connected in a long chain shape by covalent bonds.
  • the polynucleotide of the present application has a nucleotide sequence of SEQ ID NO: 2, a nucleotide sequence of SEQ ID NO: 3, a nucleotide sequence of SEQ ID NO: 31, or 90% or more identity with the amino acid sequence of SEQ ID NO: 1 while having at least 90% identity
  • a nucleotide sequence encoding an amino acid sequence it is obvious that a part of the nucleotide sequence is included within the scope of the present application even if it includes a polynucleotide with deletion, modification, substitution, conservative substitution or addition.
  • the term "conservative substitution” means substituting one base with another base having similar structural and/or chemical properties.
  • the polynucleotide of the present application various modifications may be made to the coding region within a range that does not change the polynucleotide sequence due to codon degeneracy or in consideration of codons preferred in the organism in which the polynucleotide is to be expressed.
  • the polynucleotide of the present application may be a polynucleotide including the nucleotide sequence of SEQ ID NO: 2.
  • polynucleotide of the present application is a probe that can be prepared from a known sbtA gene sequence, for example, hybridized with a sequence complementary to all or part of the nucleotide sequence under stringent conditions to be introduced naturally into the microorganism.
  • Any polynucleotide sequence capable of increasing L-glutamic acid production ability while not a sequence present as a sequence may be included without limitation.
  • the polynucleotide of the present application may be a probe that can be prepared from a known gene sequence, for example, a sequence capable of hybridizing under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application, without limitation. may be included.
  • the "stringent condition” means a condition that enables specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • polynucleotides with high homology or identity 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or a condition in which polynucleotides having 99% or more homology or identity hybridize with each other and polynucleotides with lower homology or identity do not hybridize, or 60 ° C., which is a washing condition of conventional Southern hybridization; 1 ⁇ SSC, 0.1% SDS, specifically at a salt concentration and temperature equivalent to 60° C., 0.1 ⁇ SSC, 0.1% SDS, more specifically 68° C., 0.1 ⁇ SSC, 0.1% SDS, washed once, specifically 2 to 3 times conditions can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other.
  • adenine is complementary to thymine
  • cytosine is complementary to guanine.
  • the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the overall sequence.
  • a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using the hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by those skilled in the art depending on the purpose.
  • the appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (eg, J. Sambrook et al., supra).
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of a sequence under moderate or high stringent conditions. It is apparent that hybridization also includes hybridization with a polynucleotide containing a common codon in a polynucleotide or a codon in consideration of codon degeneracy.
  • a GAP program can be defined as the total number of symbols in the shorter of two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • the SbtA protein contained in the recombinant microorganism of the present application may be expressed in the microorganism of the genus Corynebacterium by a conventional method known in the art.
  • expression used for a protein in the present application refers to a state in which a target protein is introduced into a microorganism or modified to be expressed in the microorganism.
  • the “protein of interest” may be the aforementioned SbtA protein.
  • introduction used for a protein in the present application means that the activity of the protein is introduced into a microorganism without a specific protein activity. This can also be expressed as enhancement of protein activity in microorganisms without specific protein activity.
  • Introduction of the protein may be performed by introducing a foreign polynucleotide encoding a protein exhibiting the same/similar activity as the protein, or a codon-optimized mutant polynucleotide thereof into a host cell.
  • the foreign polynucleotide may be used without limitation in origin or sequence as long as it exhibits the same/similar activity as the protein.
  • the introduced foreign polynucleotide can be introduced into the host cell by optimizing its codon so that the optimized transcription and translation are performed in the host cell.
  • the introduction can be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to generate a protein and enhance its activity.
  • the term “enhancement” of a polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity.
  • the reinforcement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.
  • activation, enhancement, upregulation, overexpression, and increase may include all of those exhibiting an activity that was not originally possessed, or exhibiting an improved activity compared to intrinsic activity or activity before modification.
  • intrinsic activity refers to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors.
  • the enrichment can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and/or concentration (expression amount) of an endogenous polypeptide. Whether or not the activity of the polypeptide is enhanced can be confirmed from the increase in the level of activity, expression level, or the amount of product excreted from the polypeptide.
  • the enhancement of the activity of the polypeptide can be applied by various methods well known in the art, and is not limited as long as it can enhance the activity of the target polypeptide compared to the microorganism before modification. Specifically, it may be one using genetic engineering and/or protein engineering well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (eg, Sitnicka et al. Functional Analysis of Genes. Advances in Cell). Biology 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • modification of the polynucleotide sequence encoding the polypeptide to enhance the polypeptide activity eg, modification of the polynucleotide sequence of the polypeptide gene to encode a polypeptide modified to enhance the activity of the polypeptide
  • the increase in the intracellular copy number of the polynucleotide encoding the polypeptide is achieved by introduction of a vector, to which the polynucleotide encoding the polypeptide is operably linked, which can replicate and function independently of the host, into a host cell.
  • a vector to which the polynucleotide encoding the polypeptide is operably linked, which can replicate and function independently of the host, into a host cell.
  • the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into a chromosome in a host cell.
  • the introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome in the host cell into the host cell, but is not limited thereto.
  • Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence with strong activity is, for example, deletion, insertion, non-conservative or Conservative substitution or a combination thereof may result in a mutation in the sequence, or replacement with a sequence having a stronger activity.
  • the expression control region is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence for regulating the termination of transcription and translation. As an example, it may be to replace the original promoter with a strong promoter, but is not limited thereto.
  • Examples of known strong promoters include CJ1 to CJ7 promoter (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, etc., but is not limited thereto.
  • the modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a nucleotide sequence encoding another start codon having a higher expression rate of the polypeptide compared to the intrinsic start codon. It may be a substitution, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may include deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance activity of the polypeptide; A combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto.
  • the replacement may be specifically performed by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
  • the vector used may further include a selection marker for confirming whether or not the chromosome is inserted. The selection marker is the same as described above.
  • the introduction of the foreign polynucleotide exhibiting the activity of the polypeptide may be introduction of the foreign polynucleotide encoding the polypeptide exhibiting the same/similar activity as the polypeptide into a host cell.
  • the foreign polynucleotide is not limited in origin or sequence as long as it exhibits the same/similar activity as the polypeptide.
  • the method used for the introduction can be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to generate a polypeptide and increase its activity.
  • Codon optimization of the polynucleotide encoding the polypeptide is codon-optimized so that the transcription or translation of the endogenous polynucleotide is increased in the host cell, or the transcription and translation of the foreign polynucleotide is optimized in the host cell. It may be that its codons are optimized so that the
  • Selecting an exposed site by analyzing the tertiary structure of the polypeptide and modifying or chemically modifying it for example, compares the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored to determine the degree of sequence similarity. Accordingly, it may be to determine a template protein candidate, check the structure based on this, and select an exposed site to be modified or chemically modified and modified or modified.
  • Such enhancement of polypeptide activity is to increase the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild-type or pre-modified microbial strain, or increase the amount of product produced from the polypeptide.
  • the present invention is not limited thereto.
  • Modification of some or all of the polynucleotide in the microorganism of the present application is (a) homologous recombination using a vector for chromosome insertion in the microorganism or genome correction using engineered nuclease (eg, CRISPR-Cas9) and/or (b) It may be induced by light and/or chemical treatments such as, but not limited to, ultraviolet and radiation.
  • the method for modifying part or all of the gene may include a method by DNA recombination technology.
  • a part or all of the gene may be deleted.
  • the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
  • the term “vector” refers to a DNA preparation containing a target polynucleotide sequence operably linked to a suitable regulatory sequence so that a target gene can be introduced in a suitable host.
  • the regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • a target polynucleotide in a chromosome may be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into a chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • the vector of the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as a phage vector or a cosmid vector
  • pBR-based, pUC-based, pBluescriptII-based plasmid vectors may be used as plasmid vectors.
  • pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.
  • pDZ pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like
  • the vector used in the present application may be pDCM2 (FIG. 1, SEQ ID NO: 32) produced for insertion and replacement of genes in the Corynebacterium chromosome, but is not particularly limited thereto, and a known expression vector may be used.
  • pDCM2 FIG. 1, SEQ ID NO: 32
  • the term “transformation” refers to introducing a vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located extrachromosomally, as long as they can be expressed in the host cell.
  • the polynucleotide includes DNA and RNA encoding a target protein. The polynucleotide may be introduced into a host cell and expressed in any form, as long as it can be expressed.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked in the present application means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a target protein of the present application.
  • the method for transforming the vector of the present application includes any method of introducing a nucleic acid into a cell, and may be performed by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method and the like, but is not limited thereto.
  • recombinant microorganism in the present application includes all microorganisms in which genetic modification has occurred artificially, and a specific mechanism is As a weakened or fortified microorganism, it may be a microorganism comprising genetic modification for the production of a desired protein or product.
  • the recombinant microorganism of the present application may include a microorganism genetically modified through any one or more of SbtA protein or a polynucleotide encoding the SbtA protein, and a vector including the polynucleotide; a microorganism modified to express the protein, or a polynucleotide encoding the same; a recombinant microorganism expressing the protein or a polynucleotide encoding the same; Or it may be a recombinant microorganism having the protein activity, but is not limited thereto.
  • the recombinant microorganism of the present application may be a microorganism in which the activity of a part of the protein in the L-glutamic acid biosynthesis pathway is further enhanced, or the activity of a part of the protein in the L-glutamic acid degradation pathway is further weakened, so that the L-glutamic acid production ability is enhanced.
  • the microorganism of the present application may be a microorganism in which the OdhA protein is further weakened. More specifically, the microorganism of the present application may be a microorganism in which the odhA gene is deleted.
  • the sequence of the OdhA protein can be obtained from GenBank of NCBI, which is a known database, for example, GenBank Accession No. It may be WP_060564343.1, but is not limited thereto, and may include, without limitation, those exhibiting the same activity.
  • OdhA protein weakening or odhA gene deletion is one example and not limited thereto, and the microorganism of the present application may be a microorganism in which the protein activity of various known L-glutamic acid biosynthetic pathways is enhanced or the protein activity of the degradation pathway is weakened. there is.
  • the recombinant microorganism of the present application may be a microorganism treated with a compound to enable the production of L-glutamic acid as a parent strain, and specifically, the compound is N-methyl-N'-nitro-N-nitrosoguanidine (N-Methyl-N'-nitro-N-nitrosoguanidine, NTG), but is not limited thereto.
  • the recombinant microorganism of the present application refers to a microorganism having an improved L-glutamic acid production ability than the parent strain or unmodified microorganism before transformation.
  • the 'unmodified microorganism' does not exclude strains containing mutations that can occur naturally in microorganisms, and the expression level of genes involved in the L-glutamic acid biosynthetic pathway is regulated, either the native microorganism itself, the wild type microorganism itself, or the L-glutamic acid biosynthesis pathway. It may be a microorganism before it becomes a microorganism, or it may be a microorganism before the sbtA gene, which does not exist intrinsically, is introduced.
  • the parent strain is wild-type Corynebacterium glutamicum ATCC13869, Corynebacterium glutamicum ATCC13869 in which OdhA is weakened Corynebacterium glutamicum, the Corynebacterium glutamicum ATCC13869 Corynebacterium glutamic acid obtained by treating a mutagenic agent such as N-methyl-N ⁇ -nitro-N-nitrosoguanidine (NTG) to a strain lacking odhA or Corynebacterium glutamicum KFCC 10656 strain It may be Kum BL2 (Accession No. KFCC-11074, Korean Patent No. 10-0292299), but is not limited thereto.
  • the term "weakening" of a polypeptide is a concept that includes both reduced or no activity compared to intrinsic activity.
  • the attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, attenuation, and the like.
  • the attenuation is when the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., inhibiting the expression of the gene encoding the polynucleotide or translation into a polypeptide
  • the overall polypeptide activity level and/or concentration (expression amount) in the cell is lower than that of the native strain due to (translation) inhibition, etc., when the expression of the polynucleotide is not made at all, and/or when the expression of the polynucleotide is Even if there is no activity of the polypeptide, it may also be included.
  • the "intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification”.
  • activity of a polypeptide is "weakened, inactivated, deficient, reduced, downregulated, lowered, attenuated” compared to the intrinsic activity, it means that the activity of the specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation is lowered. do.
  • Attenuation of the activity of the polypeptide may be performed by any method known in the art, but is not limited thereto, and may be achieved by application of various methods well known in the art (eg, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
  • the attenuation of the polypeptide of the present application is
  • an antisense oligonucleotide eg, antisense RNA
  • an antisense oligonucleotide that complementarily binds to the transcript of said gene encoding the polypeptide
  • deletion of a part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide in which some nucleotides are deleted, or replacement with a marker gene.
  • the above 2) modification of the expression control region is deletion, insertion, non-conservative or conservative substitution or a combination thereof, resulting in mutation in the expression control region (or expression control sequence), or weaker replacement with an active sequence.
  • the expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the base sequence modification encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a base encoding another start codon having a lower polypeptide expression rate than the intrinsic start codon It may be substituted with a sequence, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above deletes, inserts, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide. Or a combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto.
  • the expression of a gene may be inhibited or attenuated, but is not limited thereto.
  • antisense oligonucleotide eg, antisense RNA
  • antisense RNA an antisense oligonucleotide that complementarily binds to the transcript of the gene encoding the polypeptide
  • Weintraub, H. et al. Antisense-RNA as a molecular tool. for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
  • RTE reverse transcription engineering
  • Recombinant microorganisms of the present application are Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium pisiens ( Corynebacterium deserti ) Corynebacterium efficiens ), Corynebacterium callunae , Corynebacterium stationis , Corynebacterium singulare ), Corynebacterium halotolerans , Corynebacterium halotolerans Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Corynebacterium pollutisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans ( Corynebacterium imitans ), Corynebacter
  • the recombinant microorganism of the present application may have increased or improved L-glutamic acid production ability compared to the unmodified microorganism.
  • Another aspect of the present application is a method for producing L-glutamic acid, comprising the step of culturing a recombinant microorganism of the genus Corynebacterium for producing L-glutamic acid, comprising a polynucleotide encoding SbtA protein or SbtA protein, in a medium provides
  • SbtA protein polynucleotide encoding SbtA protein
  • recombinant microorganism are the same as described above.
  • the SbtA protein may be derived from cyanobacteria, but is not limited thereto, and this is the same as described above.
  • the SbtA protein may have at least 90% identity to SEQ ID NO: 1, but is not limited thereto, and this is the same as described above.
  • the recombinant microorganism of the genus Corynebacterium may be Corynebacterium glutamicum, but is not limited thereto, and this is the same as described above.
  • the recombinant microorganism may be one in which OdhA is further weakened or odhA is deficient.
  • the OdhA may include the amino acid sequence of SEQ ID NO: 29, but is not limited thereto, and this is the same as described above.
  • the recombinant microorganism may be the NTG-treated microorganism as the parent strain, but is not limited thereto, and this is the same as described above.
  • the term "cultivation” means growing the microorganism in an appropriately controlled environmental condition.
  • the culture process of the present application may be made according to a suitable medium and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art according to the selected strain. Specifically, the culture may be batch, continuous, and fed-batch, but is not limited thereto.
  • the term "medium” refers to a material mixed with nutrients required for culturing the microorganism as a main component, and supplies nutrients and growth factors, including water, which are essential for survival and growth.
  • any medium and other culture conditions used for culturing the microorganisms of the present application may be used without any particular limitation as long as they are conventional media used for culturing microorganisms. It can be cultured while controlling temperature, pH, etc. under aerobic conditions in a conventional medium containing compounds, amino acids and/or vitamins.
  • the culture medium for the Corynebacterium sp. strain can be found in the literature ["Manual of Methods for General Bacteriology” by the American Society for Bacteriology (Washington D.C., USA, 1981)].
  • carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other suitable carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine
  • organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract
  • the phosphorus may include potassium monobasic phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto.
  • potassium monobasic phosphate dipotassium phosphate
  • sodium-containing salt corresponding thereto.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, the present invention is not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium.
  • an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without or without gas to maintain anaerobic and microaerobic conditions, and the present invention is limited thereto. it is not
  • the temperature of the medium may be 20 °C to 45 °C, specifically 25 °C to 40 °C, but is not limited thereto.
  • the incubation period may be continued until a desired production amount of the useful substance is obtained, and specifically, it may be 10 hours to 160 hours, but is not limited thereto.
  • the L-glutamic acid produced by the culture may be discharged into the medium or may remain in the cell without being discharged.
  • the method for producing L-glutamic acid of the present application may further include the step of preparing a recombinant microorganism of the genus Corynebacterium that produces the L-glutamic acid before the culturing step or preparing a medium for culturing the recombinant microorganism. there is.
  • the method for producing L-glutamic acid of the present application may further include the step of recovering L-glutamic acid from the recombinant microorganism or medium after the step of culturing.
  • the method of recovering the L-glutamic acid is to collect the desired L-glutamic acid using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method. collect) may be.
  • a suitable method known in the art for example, centrifugation, filtration, anion exchange chromatography, crystallization, HPLC, etc. may be used, and the desired L-glutamic acid may be recovered from the medium or microorganism using a suitable method known in the art.
  • the recovery step may include a purification process, and may be performed using a suitable method known in the art.
  • the recovered L-glutamic acid may be in a purified form or a microbial fermentation broth containing L-glutamic acid, but is not limited thereto.
  • Another aspect of the present application is a recombinant microorganism of the genus Corynebacterium for producing L-glutamic acid, comprising a polynucleotide encoding SbtA protein or SbtA protein; Or a medium culturing the recombinant microorganism; provides a composition for the production of L- glutamic acid comprising.
  • SbtA protein polynucleotide encoding SbtA protein
  • recombinant microorganism and “medium” are as described above.
  • composition of the present application may further include any suitable excipients commonly used in compositions for the production of L-glutamic acid, and these excipients include, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents. and the like, but is not limited thereto.
  • a plasmid (pDCM2, FIG. 1, SEQ ID NO: 32) for the insertion and replacement of genes in the Corynebacterium chromosome was designed, and the plasmid was synthesized using the gene-synthesis service of Binix Co., Ltd.
  • a plasmid was designed to include a restriction enzyme that is easy to use for cloning by referring to the generally known sacB system related paper [Gene, 145 (1994) 69-73].
  • the thus synthesized pDCM2 plasmid has the following characteristics.
  • Cyanobacteria specifically, Synechocystis sp.
  • sbtA and bicA genes encoding the bicarbonate (HCO 3 - ) transporter derived from PCC6803, Synechocystis sp.
  • HCO 3 - bicarbonate transporter
  • sbtA (SEQ ID NO: 3) from Synechocystis genus PCC6803 was codon-optimized for Corynebacterium glutamicum (SEQ ID NO: 2) and PCC6803 derived bicA (SEQ ID NO: 6) was synthesized and codon-optimized for Corynebacterium glutamicum (SEQ ID NO: 5).
  • pDCM2 vector was used for the insertion of the two genes, and the CJ7 synthesis promoter (Korean Patent Registration No. 10-0620092 and International Patent Publication No. 2006-065095) was used as the expression promoter.
  • BBD29_01410 (hereinafter referred to as CglE0286) and BBD29_00440 ( Hereafter, the pDCM2- ⁇ CglE0286::CJ7-sbtA vector and the pDCM2- ⁇ CglE0085::CJ7-bicA vector were constructed using the CglE0085) location.
  • CglE0286 in which homologous recombination occurs using primer sets of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 using Corynebacterium glutamicum ATCC13869 chromosomal DNA as a template Gene fragments of the upstream region and the downstream region were obtained through PCR.
  • Solg TM Pfu-X DNA polymerase was used as the polymerase, and PCR amplification conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 60 seconds. , the polymerization was carried out at 72 °C for 5 minutes.
  • the amplified CglE0286 upstream and downstream regions, and the vector pDCM2 for chromosomal transformation digested with EcoRI and SalI restriction enzymes were prepared by Gibson assembly (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA).
  • a recombinant plasmid was obtained by cloning using the Assembly Master Mix) method, and was named pDCM2- ⁇ CglE0286. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment with the calculated mole number and then storing at 50° C. for 1 hour.
  • PCR was performed using the synthesized CJ7-sbtA of SEQ ID NO: 11 as a template and primers of SEQ ID NO: 12 and SEQ ID NO: 13, and the CJ7-sbtA gene fragment was obtained through PCR.
  • Solg TM Pfu-X DNA polymerase was used as the polymerase, and PCR amplification conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 60 seconds. , the polymerization was carried out at 72 °C for 5 minutes.
  • a recombinant plasmid was obtained by cloning the amplified CJ7-sbtA and the vector pDCM2- ⁇ CglE0286 for chromosomal transformation cut with ScaI restriction enzyme using the Gibson assembly method, and it was named pDCM2- ⁇ CglE0286::CJ7-sbtA. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment with the calculated mole number and then storing at 50° C. for 1 hour.
  • CglE0085 upstream region and downstream in which chromosomal homologous recombination occurs using primer sets of SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 16 and SEQ ID NO: 17 using Corynebacterium glutamicum ATCC13869 chromosomal DNA as a template Local gene fragments were obtained through PCR.
  • Solg TM Pfu-X DNA polymerase was used as the polymerase, and PCR amplification conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 60 seconds. , the polymerization was carried out at 72 °C for 5 minutes.
  • a recombinant plasmid was obtained by cloning the amplified CglE0085 upstream and downstream regions, and the vector pDCM2 for chromosomal transformation cut with EcoRI and SalI restriction enzymes using the Gibson assembly method, and was named pDCM2- ⁇ CglE0085. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment with the calculated mole number and then storing at 50° C. for 1 hour.
  • PCR was performed using the synthesized CJ7-bicA of SEQ ID NO: 18 as a template and primers of SEQ ID NO: 12 and SEQ ID NO: 13 to obtain a CJ7-bicA gene fragment.
  • Solg TM Pfu-X DNA polymerase was used as the polymerase, and PCR amplification conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 60 seconds. , the polymerization was carried out at 72 °C for 5 minutes.
  • Recombinant plasmid was obtained by cloning the amplified CJ7-bicA and the vector pDCM2- ⁇ CglE0085 for chromosomal transformation cut with ScaI restriction enzyme using the Gibson assembly method, and it was named pDCM2- ⁇ CglE0085::CJ7-bicA. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment with the calculated mole number and then storing at 50° C. for 1 hour.
  • Example 3 Wild-type Corynebacterium glutamicum-derived L-glutamic acid production strain production and bicarbonate transporter introduction strain production
  • Example 3-1 Preparation of Corynebacterium glutamicum strain having L-glutamic acid-producing ability derived from wild-type Corynebacterium glutamicum
  • Corynebacterium glutamicum ATCC13869 odhA based on the prior literature (Appl Environ Microbiol. 2007 Feb; 73(4): 1308-19. Epub 2006 Dec 8.) to produce a strain having L-glutamic acid-producing ability derived from ATCC13869 A strain of Corynebacterium glutamicum ATCC13869 ⁇ odhA in which the gene was deleted was prepared.
  • the upstream region and downstream region of the odhA gene using the primer sets of SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22 using Corynebacterium glutamicum ATCC13869 chromosomal DNA as a template was obtained through PCR.
  • Solg TM Pfu-X DNA polymerase was used as the polymerase, and PCR amplification conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 60 seconds. , the polymerization was carried out at 72 °C for 5 minutes.
  • a recombinant plasmid was obtained by cloning the amplified odhA upstream and downstream regions, and the vector pDCM2 for chromosomal transformation cut with SmaI restriction enzyme using the Gibson assembly method, and was named pDCM2- ⁇ odhA. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment with the calculated mole number and then storing at 50° C. for 1 hour.
  • the prepared pDCM2- ⁇ odhA vector was transformed into a Corynebacterium glutamicum ATCC13869 strain by electroporation, and then a strain in which the odhA gene was deleted was obtained through a secondary crossover process.
  • the gene deletion was confirmed through PCR and genome sequencing using SEQ ID NO: 23 and SEQ ID NO: 24, and the prepared strain was named ATCC13869 ⁇ odhA.
  • Example 3-2 Preparation of strains having L-glutamic acid-producing ability derived from wild-type Corynebacterium glutamicum introduced with a bicarbonate transporter
  • the genetic manipulation was confirmed through PCR and genome sequencing using SEQ ID NO: 25 and SEQ ID NO: 26 that can amplify the external regions of the upstream region and the downstream region of the homologous recombination into which the CJ7-sbtA gene was introduced, respectively. was named CA02-1474.
  • the pDCM2- ⁇ CglE0085::CJ7-bicA vector of Example 2 was transformed into the Corynebacterium glutamicum ATCC13869 ⁇ odhA strain by electroporation, and then CJ7 at the CglE0085 position on the chromosome through a secondary crossover process. A strain into which the -bicA gene was inserted was obtained.
  • the genetic manipulation was confirmed through PCR and genome sequencing using SEQ ID NO: 27 and SEQ ID NO: 28, which can amplify the external regions of the upstream region and the downstream region of the homologous recombination into which the CJ7-bicA gene was introduced, respectively. was named CA02-1475.
  • CA02-1474 strain and CA02-1475 strain prepared above were cultured using the ATCC13869 ⁇ odhA strain as a control to check the L-glutamic acid production ability as follows.
  • the strains were inoculated on a plate medium consisting of a seed medium and incubated at 30° C. for 20 hours. Then, the strain was inoculated with 1 platinum in a 250 ml corner-baffle flask containing 25 ml of the following production medium, and cultured with shaking at 30° C. for 40 hours at 200 rpm. After completion of the culture, the production of L-glutamic acid was measured using high performance liquid chromatography (HPLC), and the measurement results are shown in Table 4 below.
  • HPLC high performance liquid chromatography
  • CA02-1474 was deposited with the Korea Microorganism Conservation Center, a trustee institution under the Budapest Treaty on July 28, 2020, and was given an accession number KCCM12775P.
  • Example 4 Bicarbonate transporter-introduced N-methyl-N'-nitro-N-nitrosoguanidine (N-Methyl-N'-nitro-N-nitrosoguanidine, NTG) mutant-derived L-glutamic acid-producing ability Corynebacterium glutamicum strain production
  • the KFCC11074 strain known as the L-glutamic acid-producing NTG mutant strain in order to confirm whether the gene exhibits the same effect in the NTG mutant Corynebacterium genus-derived strain with increased L-glutamic acid production ability.
  • the gene was introduced into (Korea Patent Registration No. 10-0292299).
  • the strains were inoculated on a plate medium consisting of a seed medium and incubated at 30° C. for 20 hours. Then, the strain was inoculated with 1 platinum in a 250 ml corner-baffle flask containing 25 ml of the following production medium, and cultured with shaking at 30° C. for 40 hours at 200 rpm. After completion of the culture, the production of L-glutamic acid was measured using high performance liquid chromatography (HPLC), and the measurement results are shown in Table 5 below.
  • HPLC high performance liquid chromatography

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 출원은 SbtA 단백질 또는 SbtA 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 L-글루탐산 생산 재조합 미생물 및 이를 이용한 L-글루탐산 생산방법에 관한 것이다.

Description

L-글루탐산 생산 재조합 미생물 및 이를 이용한 L-글루탐산의 제조방법
본 출원은 SbtA 단백질 또는 SbtA 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 L-글루탐산 생산 미생물 및 이를 이용한 L-글루탐산 제조방법에 관한 것이다.
L-글루탐산(L-glutamic acid)은 발효에 의하여 생산되는 대표적인 아미노산으로, 특유의 독특한 맛을 지니고 있어 식품 분야에서는 물론 의약품 분야, 기타 동물 사료 분야 등에 널리 이용되고 있는 중요한 아미노산 중의 하나이다. L-글루탐산은 코리네박테리움(Corynebacterium) 속, 대장균(Escherichia coli), 고초균(Bacillus), 방선균(Streptomyces), 페니실리움(Penicillum) 속, 크렙시엘라(Klebsiella), 어위니아(Erwinia), 또는 판토에아(Pantoea) 속 등의 미생물을 이용하여 생산하는 방법이 알려져 있다(미국 특허 제3,220,929호, 미국 특허 제6,682,912호).
현재 L-글루탐산을 고효율로 생산하는 미생물 및 발효공정 기술 개발을 위한 다양한 연구들이 수행되고 있다. 예를 들어, 코리네박테리움 속 미생물에서 아미노산 생합성에 관여하는 효소를 암호화하는 유전자의 발현을 증가시키거나 또는 아미노산 생합성에 불필요한 유전자를 제거하는 것과 같은 목적 물질 특이적인 접근 방법이 L-글루탐산 생산 수율 향상을 위하여 주로 이용되고 있다(미국등록공보 US 9109242 B2, 미국등록공보 US 8030036 B2).
본 발명자들은 고농도 L-글루탐산을 생산해내고자 예의 노력한 결과, 외래 단백질을 도입하여 L-글루탐산을 고농도로 생산하는 코리네박테리움 속 미생물을 개발하여 본 출원을 완성하였다.
본 출원의 하나의 목적은 SbtA 단백질 또는 SbtA 단백질을 코딩하는 폴리뉴클레오티드를 포함하는, L-글루탐산(L-glutamic acid)을 생산하는 코리네박테리움 속(the genus of Corynebacterium) 재조합 미생물을 제공하는 것이다.
본 출원의 다른 목적은 SbtA 단백질 또는 SbtA 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 L-글루탐산을 생산하는 코리네박테리움 속 재조합 미생물을 배지에서 배양하는 단계를 포함하는, L-글루탐산 제조방법을 제공하는 것이다.
본 출원의 SbtA 단백질 또는 SbtA 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 L-글루탐산 생산 코리네박테리움 속 재조합 미생물은 고수율로 L-글루탐산을 생산할 수 있어 L-글루탐산의 산업적 생산에 유용하게 이용될 수 있다.
도 1은 pDCM2 플라스미드의 모식도이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
본 출원의 목적을 달성하기 위한 본 출원의 하나의 양태는 SbtA 단백질 또는 SbtA 단백질을 코딩하는 폴리뉴클레오티드를 포함하는, L-글루탐산을 생산하는 코리네박테리움 속 재조합 미생물을 제공하는 것이다.
본 출원에서 용어, "SbtA 단백질"은 바이카보네이트 트랜스포터(Bicarbonate transporter) 중 하나로, 막 불투과성 바이카보네이트인 HCO3 -의 막 통과를 촉진하여 탄산가스(CO2)의 처리를 가속화하는데 기여하며 이산화탄소의 포획 및 효율적 이용을 위해 발현되는 단백질 중 하나이다. 바이카보네이트 트랜스포터에는 SbtA 단백질과 BicA 단백질 등이 있으며, 이들은 세포 내로 바이카보네이트를 수송하여 그 결과 세포 내에 바이카보네이트가 축적된다.
본 출원에 있어서, 상기 SbtA 단백질은 본 출원의 미생물과 상이한 미생물 유래의 단백질이거나, 또는 본 출원의 미생물에 내재적으로 존재하는 단백질과 상이한 것일 수 있다.
본 출원에 있어서, 상기 SbtA 단백질은 시아노박테리아(Cyanobacteria) 유래 단백질일 수 있으나, 이에 제한되지 않는다. 구체적으로, 상기 SbtA 단백질은 시네코시스티스 속(the genus of Synechocystis) 미생물 유래 단백질일 수 있으며, 보다 구체적으로, 시네코시스티스 속 PCC 6803(Synechocystis sp. PCC 6803) 또는 시네코시스티스 속 PCC 6714(Synechocystis sp. PCC 6714) 미생물 유래 단백질일 수 있다.
본 출원의 SbtA 단백질은 서열번호 1의 아미노산 서열과 90% 이상의 동일성을 갖는 아미노산 서열을 포함할 수 있다. 상기 서열번호 1의 아미노산 서열은 공지의 데이터 베이스인 미국국립보건원 진뱅크(NIH GenBank)에서 얻을 수 있다. 구체적으로, 본 출원의 서열번호 1과 90% 이상의 동일성을 갖는 아미노산 서열은 본 출원의 서열번호 1과 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 96.26% 이상, 97% 이상, 97.5% 이상, 97.7% 이상, 97.8% 이상, 98% 이상, 98.5% 이상, 98.7% 이상, 98.8% 이상, 99% 이상, 99.5% 이상, 99.7% 이상, 99.8% 이상 또는 그 이상, 및 100% 미만의 상동성 또는 동일성을 갖는 아미노산 서열일 수 있다. 일 예로 서열번호 1의 아미노산 서열과 90% 이상 및 100% 미만의 상동성 또는 동일성을 갖는 아미노산 서열은 서열번호 30의 아미노산 서열일 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 SbtA 단백질에 동일 또는 상응하는 활성, 또는 바이카보네이트 트랜스포터 활성을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 SbtA 단백질의 범위 내에 포함됨은 자명하다.
본 출원의 SbtA 단백질은 서열번호 1의 아미노산 서열과 90% 이상의 동일성을 갖는 아미노산 서열을 가질 수 있다. 또한, 본 출원의 SbtA 단백질은 서열번호 1의 아미노산 서열과 90% 이상의 동일성을 갖는 아미노산 서열을 가지거나, 상기 아미노산 서열로 이루어지거나, 또는 상기 아미노산 서열로 필수적으로 이루어질(consisting essentially of) 수 있다. 본 출원의 SbtA 단백질은 서열번호 1의 아미노산 서열 앞뒤로의 무의미한 서열 추가(즉, 아미노산 서열 N-말단 그리고/또는 C-말단에 단백질의 기능을 변경하지 않는 서열 추가) 또는 자연적으로 발생할 수 있는 돌연변이, 이의 잠재성 돌연변이(silent mutation) 또는 보존적 치환을 가지는 경우를 제외하는 것이 아니다.
본 출원의 SbtA 단백질에 있어, 상기 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
본 출원에서 상기 SbtA 단백질을 코딩하는 폴리뉴클레오티드는 sbtA 유전자일 수 있다. 또한, SbtA 단백질을 코딩하는 폴리뉴클레오티드는 시아노박테리아 유래일 수 있다. 구체적으로, 본 출원의 SbtA 단백질을 코딩하는 폴리뉴클레오티드는 상기 서열번호 1의 아미노산 서열과 90% 이상의 동일성을 갖는 아미노산 서열을 코딩하는 염기서열을 포함할 수 있다. 구체적으로, 본 출원의 SbtA 단백질을 코딩하는 폴리뉴클레오티드는 서열번호 2의 염기서열, 서열번호 31의 염기서열, 또는 이들과 90% 이상의 동일성을 가지면서 서열번호 1의 아미노산 서열과 90% 이상의 동일성을 갖는 아미노산 서열을 코딩하는 염기서열을 포함할 수 있으나, 이에 제한되지 않는다. 상기 서열번호 1의 아미노산 서열과 90% 이상의 동일성을 갖는 아미노산 서열을 코딩하는 염기서열을 포함하는 폴리뉴클레오티드는 서열번호 1의 아미노산 서열과 90% 이상의 동일성을 갖는 아미노산 서열을 코딩하는 염기서열을 가지는 폴리뉴클레오티드, 서열번호 1의 아미노산 서열과 90% 이상의 동일성을 갖는 아미노산 서열을 코딩하는 염기서열로 이루어진 또는 필수적으로 이루어진 폴리뉴클레오티드일 수 있다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 가닥이다.
본 출원의 폴리뉴클레오티드는 서열번호 2의 염기서열, 서열번호 3의 염기서열, 서열번호 31의 염기서열, 또는 이들과 90% 이상의 동일성을 가지면서 서열번호 1의 아미노산 서열과 90% 이상의 동일성을 갖는 아미노산 서열을 코딩하는 염기서열을 포함하는 경우라면, 상기 염기서열의 일부가 결실, 변형, 치환, 보존적 치환 또는 부가된 폴리뉴클레오티드를 포함하더라도 본 출원의 범위 내에 포함됨은 자명하다. 본 출원의 폴리뉴클레오티드에 있어서, 용어 "보존적 치환(conservative substitution)"은 한 염기를 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 염기로 치환시키는 것을 의미한다.
본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리뉴클레오티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리뉴클레오티드 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 출원의 폴리뉴클레오티드는 서열번호 2의 염기서열을 포함하는 폴리뉴클레오티드일 수 있다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 sbtA 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, 도입하고자 하는 미생물 내에 자연적으로 존재하는 서열이 아니면서 L-글루탐산 생산능을 증가시킬 수 있는 폴리뉴클레오티드 서열이라면 제한 없이 포함할 수 있다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화할 수 있는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 76% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1ХSSC, 0.1% SDS, 구체적으로 60℃, 0.1ХSSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1ХSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
본 출원에서 용어, '상동성(homology)' 또는 '동일성(identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
본 출원의 재조합 미생물에 포함되는 SbtA 단백질은 당업계에 알려진 통상적인 방법에 의하여 코리네박테리움 속 미생물 내에서 발현될 수 있다.
본 출원에서 단백질에 대하여 사용되는 용어, "발현"은 목적 단백질이 미생물 내에 도입되거나, 미생물 내에서 발현되도록 변형된 상태를 의미한다. 본 출원의 목적상 "목적 단백질"은 전술한 SbtA 단백질일 수 있다.
본 출원에서 단백질에 대하여 사용되는 용어 "도입"은 특정 단백질 활성이 없는 미생물에 단백질의 활성이 도입되는 것을 의미한다. 이는 특정 단백질 활성이 없는 미생물에서의 단백질의 활성 강화로도 표현할 수 있다.
상기 단백질의 도입은, 상기 단백질과 동일/유사한 활성을 나타내는 단백질을 암호화하는 외래 폴리뉴클레오티드, 또는 이의 코돈 최적화된 변이형 폴리뉴클레오티드를 숙주세포 내로 도입하여 수행될 수 있다. 상기 외래 폴리뉴클레오티드는 상기 단백질과 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한 없이 사용될 수 있다. 또한 도입된 상기 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화하여 숙주세포 내로 도입할 수 있다. 상기 도입은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 단백질이 생성되어 그 활성이 강화될 수 있다.
본 출원에서 용어, 폴리펩티드 활성의 "강화"는, 폴리펩티드의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 활성화(activation), 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 활성화, 강화, 상향조절, 과발현, 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 “내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "강화", "상향조절", "과발현" 또는 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성 및/또는 농도(발현량)에 비하여 향상된 것을 의미한다.
상기 강화는 외래의 폴리펩티드를 도입하거나, 내재적인 폴리펩티드의 활성 강화 및/또는 농도(발현량)를 통해 달성할 수 있다. 상기 폴리펩티드의 활성의 강화 여부는 해당 폴리펩티드의 활성 정도, 발현량 또는 해당 폴리펩티드로부터 배출되는 산물의 양의 증가로부터 확인할 수 있다.
상기 폴리펩티드의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 폴리펩티드의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드의 강화는
1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가;
2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역을 활성이 강력한 서열로 교체;
3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
4) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드의 아미노산 서열의 변형;
5) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열의 변형(예를 들어, 폴리펩티드의 활성이 강화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 폴리뉴클레오티드 서열의 변형);
6) 폴리펩티드의 활성을 나타내는 외래 폴리펩티드 또는 이를 코딩하는 외래 폴리뉴클레오티드의 도입;
7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
보다 구체적으로,
상기 1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터의 숙주세포 내로의 도입에 의해 달성되는 것일 수 있다. 또는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 숙주세포 내의 염색체 내에 1 카피 또는 2 카피 이상 도입에 의해 달성되는 것일 수 있다. 상기 염색체 내에 도입은 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다.
상기 2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역(또는 발현조절서열)을 활성이 강력한 서열로 교체는, 예를 들면, 상기 발현조절영역의 활성을 더욱 강화하도록 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 가지는 서열로의 교체일 수 있다. 상기 발현조절영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 그리고 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 일 예로, 본래의 프로모터를 강력한 프로모터로 교체시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터, yccA 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 높은 다른 개시코돈을 코딩하는 염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 폴리펩티드의 활성을 강화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 증가하도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 상기 교체는 구체적으로 상동재조합에 의하여 폴리뉴클레오티드를 염색체내로 삽입함으로써 수행될 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 전술한 바와 같다.
상기 6) 폴리펩티드의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 상기 폴리펩티드와 동일/유사한 활성을 나타내는 폴리펩티드를 코딩하는 외래 폴리뉴클레오티드의 숙주세포 내 도입일 수 있다. 상기 외래 폴리뉴클레오티드는 상기 폴리펩티드와 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한이 없다. 상기 도입에 이용되는 방법은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 폴리펩티드가 생성되어 그 활성이 증가될 수 있다.
상기 7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩티드의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 폴리펩티드 활성의 강화는, 상응하는 폴리펩티드의 활성 또는 농도 발현량이 야생형이나 변형 전 미생물 균주에서 발현된 폴리펩티드의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩티드로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 미생물에서 폴리뉴클레오티드의 일부 또는 전체의 변형은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위(engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오티드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 용어 "벡터"는 적합한 숙주 내에서 목적 유전자를 도입할 수 있도록, 적합한 조절 서열에 작동 가능하게 연결된 목적 폴리뉴클레오티드 서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다. 일례로 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다.
본 출원의 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다. 보다 구체적으로, 본 출원에서 사용한 벡터는 코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위해 제작된 pDCM2(도 1, 서열번호 32)일 수 있으나, 이에 특별히 제한되는 것이 아니며, 공지된 발현 벡터를 사용할 수 있다.
본 출원의 용어 "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다.
또한, 본 출원의 용어 "작동 가능하게 연결"된 것이란 본원의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 벡터를 형질전환 시키는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법(electroporation), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌 글리콜 (PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
본 출원의 용어 "재조합 미생물"은, 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 단백질이 발현되도록 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 약화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
예컨대, 본 출원의 재조합 미생물은 SbtA 단백질 또는 SbtA 단백질을 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 통해 유전적으로 변형된 미생물; 상기 단백질, 또는 이를 코딩하는 폴리뉴클레오티드를 발현하도록 변형된 미생물; 상기 단백질, 또는 이를 코딩하는 폴리뉴클레오티드를 발현하는 재조합 미생물; 또는 상기 단백질 활성을 갖는 재조합 미생물일 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 재조합 미생물은, L-글루탐산 생합성 경로 내 단백질 일부의 활성이 추가적으로 강화되거나, L-글루탐산 분해 경로 내 단백질 일부의 활성이 추가적으로 약화되어 L-글루탐산 생산능이 강화된 미생물일 수 있다.
구체적으로, 본 출원의 미생물은 OdhA 단백질이 추가적으로 약화된 미생물일 수 있다. 보다 구체적으로, 본 출원의 미생물은 odhA 유전자가 결손된 미생물일 수 있다. 상기 OdhA 단백질은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. WP_060564343.1일 수 있으나, 이에 제한되지 않고, 이와 동일한 활성을 나타내는 것을 제한없이 포함할 수 있다.
다만, 상기 OdhA 단백질 약화 또는 odhA 유전자 결손은 한 가지 예이며 이에 제한되지 않고, 본 출원의 미생물은 다양한 공지의 L-글루탐산 생합성 경로의 단백질 활성이 강화되거나 분해 경로의 단백질 활성이 약화된 미생물일 수 있다.
또 다른 예로, 본 출원의 재조합 미생물은, L-글루탐산 생산이 가능하도록 화합물 처리된 미생물을 모균주로 하는 것일 수 있으며, 구체적으로 상기 화합물은 N-메틸-N'-니트로-N-니트로소구아니딘(N-Methyl-N'-nitro-N-nitrosoguanidine, NTG)일 수 있으나, 이에 제한되지 않는다.
본 출원의 목적상, 본 출원의 재조합 미생물은, 형질 변화 전 모균주 또는 비변형 미생물보다 L-글루탐산 생산능이 향상된 미생물을 의미한다. 상기 '비변형 미생물'은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 천연형 미생물 자체이거나, 야생형 미생물 자체이거나, 또는 L-글루탐산 생합성 경로에 관여하는 유전자의 발현량이 조절되기 전의 미생물일 수 있으며, 또는, 내재적으로 존재하지 않는 sbtA 유전자가 도입되기 전의 미생물일 수 있다.
본 출원에 있어서, 상기 모균주는 야생형 코리네박테리움 글루타미쿰 ATCC13869, 상기 코리네박테리움 글루타미쿰 ATCC13869에서 OdhA가 약화된 코리네박테리움 글루타미쿰, 상기 코리네박테리움 글루타미쿰 ATCC13869에서 odhA가 결손된 균주 또는 코리네박테리움 글루타미쿰 KFCC 10656 균주에 N-메틸-N`-니트로-N-니트로소구아니딘(NTG) 등의 변이 유발제를 처리하여 수득한 코리네박테리움 글루타미쿰 BL2(기탁번호 KFCC-11074, 대한민국 등록특허 제10-0292299호)일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, 폴리펩티드의 "약화"는 내재적 활성에 비하여 활성이 감소되거나 또는 활성이 없는 것을 모두 포함하는 개념이다. 상기 약화는 불활성화(inactivation), 결핍(deficiency), 하향조절(down-regulation), 감소(decrease), 저하(reduce), 감쇠(attenuation) 등의 용어와 혼용될 수 있다.
상기 약화는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드의 변이 등으로 폴리펩티드 자체의 활성이 본래 미생물이 가지고 있는 폴리펩티드의 활성에 비해 감소 또는 제거된 경우, 이를 코딩하는 폴리뉴클레오티드의 유전자의 발현 저해 또는 폴리펩티드로의 번역(translation) 저해 등으로 세포 내에서 전체적인 폴리펩티드 활성 정도 및/또는 농도(발현량)가 천연형 균주에 비하여 낮은 경우, 상기 폴리뉴클레오티드의 발현이 전혀 이루어지지 않은 경우, 및/또는 폴리뉴클레오티드의 발현이 되더라도 폴리펩티드의 활성이 없는 경우 역시 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주, 야생형 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "약화, 불활성화, 결핍, 감소, 하향조절, 저하, 감쇠"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성에 비하여 낮아진 것을 의미한다.
이러한 폴리펩티드의 활성의 약화는, 당업계에 알려진 임의의 방법에 의하여 수행될 수 있으나 이로 제한되는 것은 아니며, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다(예컨대, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드의 약화는
1) 폴리펩티드를 코딩하는 유전자 전체 또는 일부의 결손;
2) 폴리펩티드를 코딩하는 유전자의 발현이 감소하도록 발현조절영역(또는 발현조절서열)의 변형;
3) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 구성하는 아미노산 서열의 변형(예컨대, 아미노산 서열 상의 1 이상의 아미노산의 삭제/치환/부가);
4) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 코딩하는 유전자 서열의 변형(예를 들어, 폴리펩티드의 활성이 제거 또는 약화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 핵산염기 서열 상의 1 이상의 핵산염기의 삭제/치환/부가);
5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입;
7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가;
8) 폴리펩티드를 코딩하는 유전자 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE); 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
예컨대,
상기 1) 폴리펩티드를 코딩하는 상기 유전자 일부 또는 전체의 결손은, 염색체 내 내재적 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드 전체의 제거, 일부 뉴클레오티드가 결실된 폴리뉴클레오티드로의 교체 또는 마커 유전자로 교체일 수 있다.
또한, 상기 2) 발현조절영역(또는 발현조절서열)의 변형은, 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절영역(또는 발현조절서열) 상의 변이 발생, 또는 더욱 약한 활성을 갖는 서열로의 교체일 수 있다. 상기 발현조절영역에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 낮은 다른 개시코돈을 코딩하는 염기서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은 폴리펩티드의 활성을 약화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 약한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 없도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 예를 들면, 폴리뉴클레오티드 서열 내 변이를 도입하여 종결 코돈을 형성시킴으로써, 유전자의 발현을 저해하거나 약화시킬 수 있으나, 이에 제한되지 않는다.
상기 6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입은 예를 들어 문헌 [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986]을 참고할 수 있다.
상기 7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가는 mRNA 번역을 불가능하게 하거나 속도를 저하시키는 것일 수 있다.
상기 8) 폴리펩티드를 코딩하는 유전자서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE)는 상기 폴리펩티드를 코딩하는 유전자의 전사체에 상보적인 안티센스 뉴클레오티드를 만들어 활성을 약화하는 것일 수 있다.
본 출원의 재조합 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있고, 더욱 구체적으로 코리네박테리움 글루타미쿰일 수 있으나, 이에 제한되지 않는다.
본 출원의 재조합 미생물은 비변형 미생물에 비하여 L-글루탐산 생산능이 증대 또는 향상된 것일 수 있다.
본 출원의 다른 하나의 양태는 SbtA 단백질 또는 SbtA 단백질을 코딩하는 폴리뉴클레오티드를 포함하는, L-글루탐산을 생산하는 코리네박테리움 속 재조합 미생물을 배지에서 배양하는 단계를 포함하는, L-글루탐산 제조방법을 제공한다.
상기 "SbtA 단백질", "SbtA 단백질을 코딩하는 폴리뉴클레오티드" 및 "재조합 미생물"에 대해서는 전술한 바와 같다.
상기 SbtA 단백질은 시아노박테리아 유래일 수 있으나, 이에 제한되지 않으며, 이에 대해서는 전술한 바와 같다.
상기 SbtA 단백질은 서열번호 1과 90% 이상의 동일성을 갖는 것일 수 있으나, 이에 제한되지 않으며, 이에 대해서는 전술한 바와 같다.
상기 코리네박테리움 속 재조합 미생물은 코리네박테리움 글루타미쿰일 수 있으나, 이에 제한되지 않으며, 이에 대해서는 전술한 바와 같다.
상기 재조합 미생물은 OdhA가 추가로 약화되거나, odhA가 결손된 것일 수 있다. 또한, 상기 OdhA는 서열번호 29의 아미노산 서열을 포함할 수 있으나, 이에 제한되지 않으며, 이에 대해서는 전술한 바와 같다.
또한, 상기 재조합 미생물은 NTG 처리된 미생물을 모균주로 하는 것일 수 있으나, 이에 제한되지 않으며, 이에 대해서는 전술한 바와 같다.
본 출원에서, 용어 "배양"은 상기 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양 과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 상기 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다. 구체적으로, 코리네박테리움 속 균주에 대한 배양 배지는 문헌["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)]에서 찾아 볼 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 상기 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
배지의 온도는 20℃ 내지 45℃, 구체적으로는 25℃ 내지 40℃일 수 있으나 이에 제한되지 않는다. 배양 기간은 유용 물질의 원하는 생성량이 수득될 때까지 계속될 수 있으며, 구체적으로는 10 시간 내지 160 시간일 수 있으나 이에 제한되지 않는다.
상기 배양에 의하여 생산된 L-글루탐산은 배지 중으로 배출되거나 미처 배출되지 못하고 세포 내에 잔류할 수 있다.
본 출원의 L-글루탐산 제조방법은 상기 배양하는 단계 이전 상기 L-글루탐산을 생산하는 코리네박테리움 속 재조합 미생물을 준비하는 단계 또는 상기 재조합 미생물을 배양하기 위한 배지를 준비하는 단계를 추가적으로 포함할 수 있다.
또한, 본 출원의 L-글루탐산 제조방법은 상기 배양하는 단계 이후 상기 재조합 미생물 또는 배지로부터 L-글루탐산을 회수하는 단계를 추가적으로 포함할 수 있다.
상기 L-글루탐산을 회수하는 방법은 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 L-글루탐산을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-글루탐산을 회수할 수 있다.
또한, 상기 회수 단계는 정제 공정을 포함할 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 수행될 수 있다.
상기의 회수되는 L-글루탐산은 정제된 형태 또는 L-글루탐산을 함유한 미생물 발효액일 수 있으나, 이에 제한되지 않는다.
본 출원의 또 하나의 양태는 SbtA 단백질 또는 SbtA 단백질을 코딩하는 폴리뉴클레오티드를 포함하는, L-글루탐산을 생산하는 코리네박테리움 속 재조합 미생물; 또는 상기 재조합 미생물을 배양한 배지;를 포함하는 L-글루탐산 생산용 조성물을 제공한다.
상기 "SbtA 단백질", "SbtA 단백질을 코딩하는 폴리뉴클레오티드", "재조합 미생물" 및 "배지"에 대해서는 전술한 바와 같다.
본 출원의 조성물은 L-글루탐산 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 제한되지 않는다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 하기 실시예는 본 출원을 예시하기 위한 바람직한 실시양태에 불과한 것이며 따라서, 본 출원의 권리범위를 이에 한정하는 것으로 의도되지는 않는다. 한편, 본 명세서에 기재되지 않은 기술적인 사항들은 본 출원의 기술 분야 또는 유사 기술 분야에서 숙련된 통상의 기술자이면 충분히 이해하고 용이하게 실시할 수 있다.
실시예 1: 플라스미드의 제작
코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드(pDCM2, 도 1, 서열번호 32)를 디자인하였고, 바이닉스(주)의 유전자 합성(Gene-synthesis) 서비스를 이용하여 플라스미드를 합성하였다. 일반적으로 알려진 sacB 시스템 관련 논문[Gene, 145 (1994) 69-73]을 참고로 하여 클로닝에 활용하기 용이한 제한효소(restriction enzyme)를 포함하도록 플라스미드를 설계하였다. 이렇게 합성된 pDCM2 플라스미드는 다음과 같은 특성을 갖는다.
1) 대장균에서만 작용하는 복제 기점(replication origin)을 가지고 있어 대장균 내에서는 자가 복제(self-replication)가 가능하나 코리네박테리움에서는 자가 복제가 불가능한 특성을 갖는다.
2) 선별 마커로 카나마이신 내성 유전자를 갖는다.
3) 2차 양성 선별(positive-selection) 마커로 레반 수크라제(Levan sucrose) 유전자(sacB)를 갖는다.
4) 최종 제작된 균주에는 pDCM2 플라스미드로부터 유래한 어떠한 유전자 정보도 남지 않는다.
실시예 2: 시아노박테리아 유래 바이카보네이트 트랜스포터 발현 벡터 제작
시아노박테리아, 구체적으로 시네코시스티스 속(Synechocystis sp.) PCC6803 유래 바이카보네이트(HCO3 -) 트랜스포터를 코딩하는 sbtA 및 bicA 유전자를 균주에 도입할 경우 L-글루탐산의 생산능이 향상되는지 확인하기 위하여 먼저 sbtA 또는 bicA에 대한 발현 벡터를 제작하였다.
상기 두 유전자를 코리네박테리움 글루타미쿰으로 삽입하기 위해, 시네코시스티스 속 PCC6803 유래 sbtA(서열번호 3)을 코리네박테리움 글루타미쿰에 대해 코돈 최적화한 서열(서열번호 2) 및 PCC6803 유래 bicA(서열번호 6)을 코리네박테리움 글루타미쿰에 대해 코돈 최적화한 서열(서열번호 5)을 합성 제작하였다.
또한, 상기 두 유전자의 삽입을 위하여 pDCM2벡터를 사용하였고, 발현 프로모터는 CJ7 합성프로모터(대한민국 등록특허 제10-0620092호 및 국제 공개특허 제 2006-065095호)를 사용하였다.
구체적으로, 염색체상 상동재조합(Homologous recombination)이 발생하는 위치로 코리네박테리움 글루타미쿰의 트렌스포사제(Transposase) 혹은 인테그레이즈(integrase)들 중 BBD29_01410(이후 CglE0286이라 명명함)와 BBD29_00440(이후 CglE0085 이라 명명함) 위치를 사용하여 pDCM2-△CglE0286::CJ7-sbtA 벡터와 pDCM2-△CglE0085::CJ7-bicA 벡터를 각각 제작하였다.
구체적으로, 코리네박테리움 글루타미쿰 ATCC13869 염색체 DNA를 주형으로 하여 서열번호 7과 서열번호 8, 서열번호 9와 서열번호10의 프라이머 세트를 이용하여 염색체상 상동재조합(Homologous recombination)이 발생하는 CglE0286 업스트림(Upstream) 지역과 다운스트림(Downstream) 지역의 유전자 단편을 PCR 수행을 통해 수득하였다. 중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 58℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
증폭된 CglE0286 업스트림과 다운스트림 지역, 그리고 EcoRI, SalI 제한효소로 절단된 염색체 형질전환용 벡터 pDCM2는 깁슨 어셈블리(DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDCM2-△CglE0286으로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
합성 제작한 서열번호 11의 CJ7-sbtA을 주형으로 서열번호 12와 서열번호 13의 프라이머를 이용하여 PCR을 수행하였고, CJ7-sbtA 유전자 단편을 PCR을 통하여 수득 하였다. 중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 58℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
증폭된 CJ7-sbtA, 그리고 ScaI 제한효소로 절단된 염색체 형질전환용 벡터 pDCM2-△CglE0286는 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDCM2-△CglE0286::CJ7-sbtA로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
또한, 코리네박테리움 글루타미쿰 ATCC13869 염색체 DNA를 주형으로 하여 서열번호 14와 서열번호 15, 서열번호 16과 서열번호 17의 프라이머 세트를 이용하여 염색체상 상동재조합이 발생하는 CglE0085 업스트림 지역과 다운스트림 지역의 유전자 단편을 PCR수행을 통해 수득하였다. 중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 58℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
증폭된 CglE0085 업스트림과 다운스트림 지역, 그리고 EcoRI, SalI 제한효소로 절단된 염색체 형질전환용 벡터 pDCM2는 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDCM2-△CglE0085로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
합성 제작한 서열번호 18의 CJ7-bicA을 주형으로 서열번호 12와 서열번호 13의 프라이머를 이용하여 PCR을 수행하였고, CJ7-bicA 유전자 단편을 수득 하였다. 중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 58℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
증폭된 CJ7-bicA, 그리고 ScaI 제한효소로 절단된 염색체 형질전환용 벡터 pDCM2-△CglE0085는 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDCM2-△CglE0085::CJ7-bicA로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
여기에서 사용된 프라이머 서열은 하기 표 1과 같다.
서열번호 명칭 서열
7 CglE0286_up_F aacgacggccagtgaattcCGGACGTTTACGCTGAT
8 CglE0286_up_R AGTACTaaaccggaagggccTGTAAAGGCC
9 CglE0286_down_F ccttccggtttAGTACTaaacaggaagagccCCTTTA
10 CglE0286_down_R tgcatgcctgcaggtcgacCGCATGTGGTGGCAAAA
12 CJ7-sbtA_F ggcccttccggtttagt
13 CJ7-sbtA_R GGCTCTTCCTGTTTAGT
14 CglE0085_up_F aacgacggccagtgaattcGCTCGAATGCCTGACTGACA
15 CglE0085_up_R gtttAGTACTaaaccggaagggccAAAGGACGACTTCACGGTTA
16 CglE0085_down_F ccggtttAGTACTaaacaggaagagccATTGAGGATGCGAAACTGT
17 CglE0085_down_R tgcatgcctgcaggtcgacGTAATCGAATCACCGGCCAG
이와 같이 제작된 pDCM2-△CglE0286::CJ7-sbtA 벡터와 pDCM2-△CglE0085::CJ7-bicA 벡터를 하기 실시예에서 균주에 도입하였다.
실시예 3: 야생형 코리네박테리움 글루타미쿰 유래 L-글루탐산 생산주 제작 및 바이카보네이트 트랜스포터 도입 균주 제작
실시예 3-1: 야생형 코리네박테리움 글루타미쿰 유래 L-글루탐산 생산능을 갖는 코리네박테리움 글루타미쿰 균주 제작
코리네박테리움 글루타미쿰 ATCC13869 유래 L-글루탐산 생산능을 갖는 균주를 제작하기 위해 선행문헌(Appl Environ Microbiol. 2007 Feb;73(4):1308-19. Epub 2006 Dec 8.)을 바탕으로 odhA 유전자를 결손한 코리네박테리움 글루타미쿰 ATCC13869△odhA 균주를 제작하였다.
구체적으로 odhA 결손을 위하여 코리네박테리움 글루타미쿰 ATCC13869 염색체 DNA를 주형으로 하여 서열번호 19와 서열번호 20, 서열번호 21과 서열번호 22의 프라이머 세트를 이용하여 odhA 유전자의 업스트림 지역과 다운스트림 지역을 PCR 수행을 통해 수득하였다. 중합효소는 SolgTM Pfu-X DNA 폴리머라제를 사용하였으며, PCR 증폭 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 58℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
증폭된 odhA 업스트림과 다운스트림 지역, 그리고 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDCM2를 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDCM2-△odhA로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50℃에 1시간 보존함으로써 수행하였다.
제작된 pDCM2-△odhA 벡터를 코리네박테리움 글루타미쿰 ATCC13869 균주에 전기천공법으로 형질 전환 후, 2차 교차 과정을 거쳐 염색체 상에서 odhA 유전자가 결손된 균주를 수득하였다. 유전자 결손 여부는 서열번호 23과 서열번호 24를 이용한 PCR 과 게놈 시퀀싱을 통해 확인하였으며, 제작된 균주를 ATCC13869△odhA로 명명하였다.
여기에서 사용된 프라이머 서열은 하기 표 2와 같다.
서열번호 명칭 서열
19 odhA_up_F TGAATTCGAGCTCGGTACCCTTGAACGGAATTGGGTGG
20 odhA_up_R CCCAGGTGGCATCGGTACCTTCACCCAGCGCCACGCAG
21 odhA_down_F CGCTGGGTGAAGGTACCGATGCCACCTGGGTTGGTCAAG
22 odhA_down_R GTCGACTCTAGAGGATCCCCGGACAAGGAATGGAGAGA
23 odhA_del_F CTTACCGTTGTTGCCCTT
24 odhA_del_R CTCCTTCACCCACATCATT
실시예 3-2: 바이카보네이트 트랜스포터가 도입된 야생형 코리네박테리움 글루타미쿰 유래 L-글루탐산 생산능을 갖는 균주 제작
상기 실시예 3-1에서 제작된 ATCC13869△odhA 균주에 실시예 2에서 제작된 pDCM2-△CglE0286CJ7-sbtA 벡터와 pDCM2-△CglE0085::CJ7-bicA 벡터를 도입하여 바이카보네이트 트랜스포터 도입이 L-글루탐산 생산능에 미치는 효과를 확인하였다.
구체적으로, 실시예 2의 pDCM2-△CglE0286::CJ7-sbtA 벡터를 코리네박테리움 글루타미쿰 ATCC13869△odhA 균주에 전기천공법으로 형질 전환 한 후, 2차 교차 과정을 거쳐 염색체 상에서 CglE0286 위치에 CJ7-sbtA 유전자가 삽입된 균주를 수득하였다.
CJ7-sbtA 유전자가 도입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 25와 서열번호 26을 이용한 PCR과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였으며, 제작된 균주를 CA02-1474 로 명명하였다.
또한, 실시예 2의 pDCM2-△CglE0085::CJ7-bicA 벡터를 코리네박테리움 글루타미쿰 ATCC13869△odhA 균주에 전기천공법으로 형질 전환 한 후, 2차 교차 과정을 거쳐 염색체 상에서 CglE0085 위치에 CJ7-bicA 유전자가 삽입된 균주를 수득하였다.
CJ7-bicA 유전자가 도입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 27과 서열번호 28을 이용한 PCR과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였으며, 제작된 균주를 CA02-1475 로 명명하였다.
여기에서 사용된 프라이머 서열은 하기 표 3과 같다.
서열번호 명칭 서열
25 CJ7-sbtA_confirm_F CAAGCAGCAAGTGCCACAC
26 CJ7-sbtA_confirm_R CCAACTGCTCCGACGAAG
27 CJ7-bicA_confirm_F ATTCCCAAAGGTGCCAGC
28 CJ7-bicA_confirm_R CAGTGCGCAAAAGGCCTC
상기에서 제작된 CA02-1474 균주와 CA02-1475 균주를 ATCC13869△odhA 균주를 대조군으로 하여 L-글루탐산 생산능을 확인하고자 아래와 같은 방법으로 배양하였다.
종배지로 이루어진 평판배지에 상기 균주들을 접종하여 30℃에서 20시간 동안 배양하였다. 그런다음 하기의 생산 배지 25㎖을 함유하는 250㎖ 코너-바플 플라스크에 균주를 1백금이 접종하고, 30℃에서 40시간 동안, 200rpm에서 진탕 배양하였다. 배양 종료 후, 고성능 액체 크로마토그래피(HPLC)를 이용하여 L-글루탐산 생산량을 측정하였으며, 측정 결과는 하기 표 4 에 나타내었다.
<종배지>
포도당 1%, 육즙 0.5%, 폴리펩톤 1%, 염화나트륨 0.25%, 효모엑기스 0.5%, 한천 2%, 유레아 0.2%, pH 7.2
<생산배지>
원당 6%, 탄산칼슘 5%, 황산암모늄 2.25%, 일인산칼륨 0.1%, 황산마그네슘 0.04%, 황산철 10 mg/L, 티아민 염산염 0.2 mg/L, 비오틴 50㎍/L
균주명 L-글루탐산 농도(g/L) L-글루탐산 농도 증가율(%)
ATCC13869△odhA 1.9 -
CA02-1474 2.9 52.6%
CA02-1475 2.1 10.5%
상기 표 4에서 나타난 바와 같이 ATCC13869△odhA 균주 또는 bicA 유전자가 도입된 CA02-1475 균주에 비하여 sbtA 유전자가 도입된 CA02-1474 에서 L-글루탐산의 농도가 현저히 증가함을 확인하였다. CA02-1474는 부다페스트조약 하의 수탁기관인 한국미생물보존센터에 2020년 7월 28일자로 기탁하여 수탁번호 KCCM12775P를 부여받았다.
실시예 4: 바이카보네이트 트랜스포터가 도입된 N-메틸-N'-니트로-N-니트로소구아니딘(N-Methyl-N'-nitro-N-nitrosoguanidine, NTG) 변이주 유래 L-글루탐산 생산능을 갖는 코리네박테리움 글루타미쿰 균주 제작
야생형 코리네박테리움 속 유래 균주 이외에, L-글루탐산 생산능이 증가된 NTG 변이 코리네박테리움 속 유래 균주에서도 상기 유전자가 동일한 효과를 나타내는지 확인하기 위하여, L-글루탐산 생산 NTG 변이 균주로 알려진 KFCC11074 균주(한국 등록특허 제10-0292299호)에 상기 유전자를 도입하였다.
실시예 2의 pDCM2-△CglE0286::CJ7-sbtA 벡터를 KFCC11074 균주에 전기천공법으로 형질 전환 후, 2차 교차 과정을 거쳐 염색체 상에서 상기 유전자가 삽입된 균주를 얻었다. 서열번호 25와 서열번호 26을 이용한 PCR과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였으며, 이를 CA02-1476로 명명하였다.
제작한 CA02-1476과 코리네박테리움 글루타미쿰 KFCC11074 균주를 대상으로 아래의 방법에 따라 발효 역가 실험을 진행하였다.
종배지로 이루어진 평판배지에 상기 균주들을 접종하여 30℃에서 20시간 동안 배양하였다. 그런다음 하기의 생산 배지 25㎖을 함유하는 250㎖ 코너-바플 플라스크에 균주를 1백금이 접종하고, 30℃에서 40시간 동안, 200rpm에서 진탕 배양하였다. 배양 종료 후, 고성능 액체 크로마토그래피(HPLC)를 이용하여 L-글루탐산 생산량을 측정하였으며, 측정 결과는 하기 표 5에 나타내었다.
<종배지>
포도당 1%, 육즙 0.5%, 폴리펩톤 1%, 염화나트륨 0.25%, 효모엑기스 0.5%, 한천 2%, 유레아 0.2%, pH 7.2
<생산배지>
원당 6%, 탄산칼슘 5%, 황산암모늄 2.25%, 일인산칼륨 0.1%, 황산마그네슘 0.04%, 황산철 10 mg/L, 티아민 염산염 0.2 mg/L, 비오틴 500㎍/L
균주명 L-글루탐산 농도(g/L) L-글루탐산 농도 증가율(%)
KFCC11074 6.9 -
CA02-1476 9.3 34.8%
상기 표 5에서 나타난 바와 같이 CA02-1476 균주가 KFCC11074 균주에 에 비하여 L-글루탐산의 농도가 34.8% 증가하는 것을 확인하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2021008262-appb-I000001

Claims (11)

  1. SbtA 단백질 또는 SbtA 단백질을 코딩하는 폴리뉴클레오티드를 포함하는, L-글루탐산(L-glutamic acid)을 생산하는 코리네박테리움 속(the genus of Corynebacterium) 재조합 미생물.
  2. 제1항에 있어서, 상기 단백질은 시아노박테리아(Cyanobacteria) 유래인, 재조합 미생물.
  3. 제1항에 있어서, 상기 단백질은 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 아미노산 서열을 포함하는, 재조합 미생물.
  4. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)인, 재조합 미생물.
  5. 제1항에 있어서, 상기 재조합 미생물은 OdhA 단백질이 추가로 약화된, 재조합 미생물.
  6. SbtA 단백질 또는 SbtA 단백질을 코딩하는 폴리뉴클레오티드를 포함하는, L-글루탐산을 생산하는 코리네박테리움 속 재조합 미생물을 배지에서 배양하는 단계를 포함하는, L-글루탐산 제조방법.
  7. 제6항에 있어서, 상기 단백질은 시아노박테리아 유래인, 제조방법.
  8. 제6항에 있어서, 상기 단백질은 서열번호 1 또는 이와 90% 이상의 서열 동일성을 갖는 아미노산 서열을 포함하는, 제조방법.
  9. 제6항에 있어서, 상기 코리네박테리움 속 재조합 미생물은 코리네박테리움 글루타미쿰인, 제조방법.
  10. 제6항에 있어서, 상기 제조방법은 상기 재조합 미생물 또는 배지로부터 L-글루탐산을 회수하는 단계를 추가적으로 포함하는, 제조방법.
  11. 제6항에 있어서, 상기 재조합 미생물은 OdhA 단백질이 추가로 약화된, 제조방법.
PCT/KR2021/008262 2020-09-09 2021-06-30 L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법 WO2022055094A1 (ko)

Priority Applications (8)

Application Number Priority Date Filing Date Title
BR112023004335A BR112023004335A2 (pt) 2020-09-09 2021-06-30 Microrganismo recombinante para produzir ácido l-glutâmico e um método para produzir ácido l-glutâmico usando o mesmo
CN202180070938.9A CN116323951A (zh) 2020-09-09 2021-06-30 生产l-谷氨酸的重组微生物及利用其生产l-谷氨酸的方法
AU2021341221A AU2021341221A1 (en) 2020-09-09 2021-06-30 A recombinant microorganism for producing L-glutamic acid and a method for producing L-glutamic acid using the same
MX2023002783A MX2023002783A (es) 2020-09-09 2021-06-30 Un microorganismo recombinante para producir acido l-glutamico y un metodo para producir acido l-glutamico utilizando el mismo.
US18/025,050 US20230323413A1 (en) 2020-09-09 2021-06-30 A recombinant microorganism for producing l-glutamic acid and a method for producing l-glutamic acid using the same
EP21866964.6A EP4198132A4 (en) 2020-09-09 2021-06-30 RECOMBINANT MICROORGANISM FOR THE PRODUCTION OF L-GLUTAMIC ACID AND METHOD FOR THE PRODUCTION OF L-GLUTAMIC ACID THEREOF
JP2023514716A JP2023540315A (ja) 2020-09-09 2021-06-30 Ｌ－グルタミン酸生産組換え微生物及びそれを用いたｌ－グルタミン酸製造方法
CA3191344A CA3191344A1 (en) 2020-09-09 2021-06-30 A recombinant microorganism for producing l-glutamic acid and a method for producing l-glutamic acid using the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200115570 2020-09-09
KR10-2020-0115570 2020-09-09

Publications (1)

Publication Number Publication Date
WO2022055094A1 true WO2022055094A1 (ko) 2022-03-17

Family

ID=80631917

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/008262 WO2022055094A1 (ko) 2020-09-09 2021-06-30 L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법

Country Status (10)

Country Link
US (1) US20230323413A1 (ko)
EP (1) EP4198132A4 (ko)
JP (1) JP2023540315A (ko)
CN (1) CN116323951A (ko)
AR (1) AR123450A1 (ko)
AU (1) AU2021341221A1 (ko)
BR (1) BR112023004335A2 (ko)
CA (1) CA3191344A1 (ko)
MX (1) MX2023002783A (ko)
WO (1) WO2022055094A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024014700A1 (ko) * 2022-07-11 2024-01-18 대상 주식회사 L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법
WO2024096219A1 (ko) * 2022-10-31 2024-05-10 대상 주식회사 L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3220929A (en) 1964-02-10 1965-11-30 Kyowa Hakko Kogyo Kk Microbiological production of amino acid by reductive amination
KR100292299B1 (ko) 1999-03-22 2001-06-01 손경식 글루탐산 생산 미생물 및 이를 이용한 글루탐산 생산방법
US6682912B2 (en) 1998-03-18 2004-01-27 Ajinomoto Co., Inc. L-glutamic acid-producing bacterium and method for producing L-glutamic acid
US20040024182A1 (en) * 2001-07-03 2004-02-05 Henry Yue Gtp-binding proteins
WO2006065095A1 (en) 2004-12-16 2006-06-22 Cj Corporation Novel promoter nucleic acid derived from corynebacterium genus bacteria, expression cassette comprising the promoter and vector comprising the cassette, host cell comprising the vector and method for expressing a gene using the cell
KR20080034334A (ko) * 2006-10-16 2008-04-21 씨제이제일제당 (주) 고농도의 글루탐산을 생산하는 미생물 및 이를 이용한글루탐산의 제조 방법
KR20100017581A (ko) * 2004-12-28 2010-02-16 아지노모토 가부시키가이샤 Ｌ-글루탐산 생산 미생물 및 ｌ-글루탐산의 제조방법
US8030036B2 (en) 2003-07-29 2011-10-04 Ajinomoto Co., Inc. Method for producing L-lysine or L-threonine
WO2012040361A2 (en) * 2010-09-21 2012-03-29 Joule Unlimited Technologies, Inc. Methods and compositions for limiting viability of a modified host cell outside of designated process conditions
US9109242B2 (en) 2006-09-15 2015-08-18 Cj Cheiljedang Corporation Corynebacteria having enhanced L-lysine productivity and a method of producing L-lysine using the same
KR20160145827A (ko) * 2014-04-30 2016-12-20 에보닉 데구사 게엠베하 호알칼리성 박테리아를 사용하는 l-아미노산 생산 방법
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101315068B1 (ko) * 2011-02-07 2013-10-08 한국생명공학연구원 시네코시스티스 속 ＰＣＣ6803 유래 ＳｂｔＡ 유전자 및 이의 용도

Patent Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3220929A (en) 1964-02-10 1965-11-30 Kyowa Hakko Kogyo Kk Microbiological production of amino acid by reductive amination
US6682912B2 (en) 1998-03-18 2004-01-27 Ajinomoto Co., Inc. L-glutamic acid-producing bacterium and method for producing L-glutamic acid
KR100292299B1 (ko) 1999-03-22 2001-06-01 손경식 글루탐산 생산 미생물 및 이를 이용한 글루탐산 생산방법
US20040024182A1 (en) * 2001-07-03 2004-02-05 Henry Yue Gtp-binding proteins
US8030036B2 (en) 2003-07-29 2011-10-04 Ajinomoto Co., Inc. Method for producing L-lysine or L-threonine
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
WO2006065095A1 (en) 2004-12-16 2006-06-22 Cj Corporation Novel promoter nucleic acid derived from corynebacterium genus bacteria, expression cassette comprising the promoter and vector comprising the cassette, host cell comprising the vector and method for expressing a gene using the cell
KR20100017581A (ko) * 2004-12-28 2010-02-16 아지노모토 가부시키가이샤 Ｌ-글루탐산 생산 미생물 및 ｌ-글루탐산의 제조방법
US9109242B2 (en) 2006-09-15 2015-08-18 Cj Cheiljedang Corporation Corynebacteria having enhanced L-lysine productivity and a method of producing L-lysine using the same
KR20080034334A (ko) * 2006-10-16 2008-04-21 씨제이제일제당 (주) 고농도의 글루탐산을 생산하는 미생물 및 이를 이용한글루탐산의 제조 방법
WO2012040361A2 (en) * 2010-09-21 2012-03-29 Joule Unlimited Technologies, Inc. Methods and compositions for limiting viability of a modified host cell outside of designated process conditions
KR20160145827A (ko) * 2014-04-30 2016-12-20 에보닉 데구사 게엠베하 호알칼리성 박테리아를 사용하는 l-아미노산 생산 방법
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure,", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"GenBank", Database accession no. WP_060564343.1
"Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
APPL ENVIRON MICROBIOL, vol. 73, no. 4, February 2007 (2007-02-01), pages 1308 - 19
ATSCHUL, S. F. ET AL., J MOLEC BIOL, vol. 215, 1990, pages 403
CARILLO ET AL., SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
DG GIBSON ET AL.: "NEBuilder HiFi DNA Assembly Master Mix", NATURE METHODS, vol. 6, no. 5, May 2009 (2009-05-01)
GENE, vol. 145, 1994, pages 69 - 73
GRIBSKOV ET AL., NUCL. ACIDS RES, vol. 14, 1986, pages 6745
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual,", 1989, COLD SPRING HARBOR LABORATORY PRESS
NAKASHIMA N ET AL.: "Bacterial cellular engineering by genome editing and gene silencing", INT J MOL SCI, vol. 15, no. 2, 2014, pages 2773 - 2793, XP055376889, DOI: 10.3390/ijms15022773
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 50-51, 1988, pages 2444 - 8
RICE ET AL., TRENDS GENET., vol. 16, 2000, pages 276 - 277
SAMBROOK ET AL., MOLECULAR CLONING, 2012
See also references of EP4198132A4
SITNICKA ET AL.: "Functional Analysis of Genes", ADVANCES IN CELL BIOLOGY, vol. 2, 2010, pages 1 - 16
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482
WEINTRAUB, H. ET AL., ANTISENSE-RNA AS A GENETICS,, vol. 1, no. 1, 1986

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024014700A1 (ko) * 2022-07-11 2024-01-18 대상 주식회사 L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법
WO2024096219A1 (ko) * 2022-10-31 2024-05-10 대상 주식회사 L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법

Also Published As

Publication number Publication date
CA3191344A1 (en) 2022-03-17
AU2021341221A1 (en) 2023-04-06
EP4198132A1 (en) 2023-06-21
JP2023540315A (ja) 2023-09-22
TW202210629A (zh) 2022-03-16
EP4198132A4 (en) 2024-04-24
CN116323951A (zh) 2023-06-23
BR112023004335A2 (pt) 2023-04-04
AR123450A1 (es) 2022-11-30
MX2023002783A (es) 2023-03-15
US20230323413A1 (en) 2023-10-12

Similar Documents

Publication Publication Date Title
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2022231368A1 (ko) 신규한 글루타메이트 합성 효소 서브 유니트 알파 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154181A1 (ko) 신규한 1,4-알파-글루칸-분지 효소 변이체 및 이를 이용한 imp 생산 방법
WO2022154177A1 (ko) 신규한 3d-(3,5/4)-트리하이드록시사이클로헥세인-1,2-다이온 아실하이드롤라아제 변이체 및 이를 이용한 imp 생산 방법
WO2022163923A1 (ko) 신규한 atp 포스포리보실트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163920A1 (ko) 신규한 시스테인 설피네이트 디설피나제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022005022A1 (ko) L-이소류신 생산능이 강화된 미생물 및 이를 이용한 l-이소류신 생산방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163938A1 (ko) 신규한 리보뉴클레아제 p 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163937A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163940A1 (ko) 신규한 갈락토사이드 o-아세틸트랜스퍼라제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163941A1 (ko) 신규한 스퍼미딘 신타아제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163939A1 (ko) 신규한 mfs 트랜스포터 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154189A1 (ko) 신규한 피토엔 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154188A1 (ko) 신규한 폴리케타이드 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154179A1 (ko) 신규한 d-알라닌--d-알라닌 리가아제 변이체 및 이를 이용한 imp 생산 방법
WO2022163929A1 (ko) 신규한 펩티딜-디펩티다제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163924A1 (ko) 신규한 5,10-메틸렌테트라하이드로폴레이트 리덕타제 변이체 및 이를 이용한 l-발린 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21866964

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3191344

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2023514716

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023004335

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2021866964

Country of ref document: EP

Effective date: 20230317

ENP Entry into the national phase

Ref document number: 112023004335

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230308

ENP Entry into the national phase

Ref document number: 2021341221

Country of ref document: AU

Date of ref document: 20210630

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE