WO2022005022A1 - L-이소류신 생산능이 강화된 미생물 및 이를 이용한 l-이소류신 생산방법 - Google Patents

L-이소류신 생산능이 강화된 미생물 및 이를 이용한 l-이소류신 생산방법 Download PDF

Info

Publication number
WO2022005022A1
WO2022005022A1 PCT/KR2021/006536 KR2021006536W WO2022005022A1 WO 2022005022 A1 WO2022005022 A1 WO 2022005022A1 KR 2021006536 W KR2021006536 W KR 2021006536W WO 2022005022 A1 WO2022005022 A1 WO 2022005022A1
Authority
WO
WIPO (PCT)
Prior art keywords
isoleucine
microorganism
protein
corynebacterium
seq
Prior art date
Application number
PCT/KR2021/006536
Other languages
English (en)
French (fr)
Inventor
김희영
김경림
이광우
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Publication of WO2022005022A1 publication Critical patent/WO2022005022A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine

Definitions

  • the present application relates to a microorganism having enhanced L-isoleucine-producing ability and a method for producing L-isoleucine using the same.
  • Branched-chain amino acid refers to three types of L-valine, L-leucine and L-isoleucine, and is industrially used for food additives, pharmaceuticals, and the like.
  • L-isoleucine is metabolized in the muscle to generate energy, and is involved in the production of hemoglobin to relieve fatigue and promote growth. Accordingly, it is used in various ways, such as infusion preparations and nutritional supplements, and its use is also increasing in sports nutrition food.
  • the present inventors have completed the present invention by confirming that by enhancing the glycine transporter activity in the microorganism of the genus Corynebacterium, the isoleucine production ability is increased.
  • Another object of the present application is to provide a composition for producing L-isoleucine comprising the microorganism of the present application.
  • Another object of the present application is to provide a method for preparing L-isoleucine, comprising the step of culturing the microorganism of the present application.
  • the microorganism having enhanced glycine transporter activity of the present application has excellent L-isoleucine production ability, and thus can be utilized for efficient mass production of L-isoleucine.
  • One aspect of the present application provides an L-isoleucine-producing microorganism of the genus Corynebacterium having enhanced glycine transporter activity.
  • glycine transporter is included without limitation as long as it is a protein having a function of introducing glycine into cells, specifically, D-serine/D-alanine/glycine transporter (D-serine/D -alanine/glycine transporter).
  • the glycine transporter may be used in combination with a D-serine/D-alanine/glycine transporter or a glycine import protein.
  • the "D-serine / D-alanine / glycine transporter (D-serine / D-alanine / glycine transporter)" is a protein that can be involved in both serine, alanine and glycine transport, a known database NCBI Genbank The information can be obtained by searching for the D-Serine/D-Alanine/glycine transporter sequence, etc.
  • the transporter may specifically be CycA or AapA, and more specifically, may be a CycA protein, but is not limited thereto.
  • CycA protein of the present application refers to a protein involved in serine, alanine and glycine uptake. CycA protein is encoded by the cycA gene, the cycA gene is Escherichia coli , Klebsialla pneumoniae , Mycobacterium bovis , Salmonella enterica , Erwinia Amylo bora ( Erwinia amylovora ) and Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ) It is known to exist in microorganisms such as.
  • the CycA protein of the present application may include any protein capable of enhancing isoleucine-producing ability.
  • the CycA protein may be derived from a microorganism of the genus Corynebacterium, and more specifically, may be derived from Corynebacterium ammoniagenes, but is not limited thereto.
  • the Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ) Brevibacterium ammoniagenes and the same species as, Corynebacterium stationis ( Corynebacterium stationis ), Brevibacterium stationis ( Brevibacterium stationis ) ) and the same taxon (International Journal of Systematic and Evolutionary Microbiology 60: 874-879).
  • the Brevibacterium ammoniagenes has been renamed and changed to Corynebacterium stationionis.
  • Corynebacterium ammoniagenes Corynebacterium ammoniagenes
  • Brevibacterium ammoniagenes Corynebacterium stationionis
  • Brevibacterium stationionis may be used interchangeably.
  • the CycA protein of the present application may include SEQ ID NO: 15 or an amino acid sequence having 70% or more homology or identity thereto.
  • the CycA protein comprises the amino acid sequence of SEQ ID NO: 15, or at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, an amino acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology or identity.
  • amino acid sequence having the homology or identity and exhibiting efficacy corresponding to the protein it is apparent that some sequences are included within the scope of the present application even if they have an amino acid sequence that is deleted, modified, substituted or added.
  • polypeptide encoded by a polynucleotide that hybridizes under stringent conditions with a probe that can be prepared from a known gene sequence for example, a sequence complementary to all or part of a nucleotide sequence encoding the polypeptide, serine, Polypeptides having alanine and glycine uptake activity may also be included without limitation.
  • 'protein or polypeptide comprising the amino acid sequence described in a specific SEQ ID NO:', 'protein or polypeptide consisting of the amino acid sequence described in the specific SEQ ID NO:' or 'protein having the amino acid sequence described in the specific SEQ ID NO: or Even if it is described as 'polypeptide', if it has the same or corresponding activity as the polypeptide consisting of the amino acid sequence of the corresponding SEQ ID NO:
  • conservative substitution means substituting an amino acid for another amino acid having similar structural and/or chemical properties. Such amino acid substitutions may generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the polypeptide.
  • polynucleotide has a meaning comprehensively encompassing DNA or RNA molecules, and nucleotides, which are basic structural units in polynucleotides, may include not only natural nucleotides, but also analogs in which sugar or base sites are modified ( Scheit, Nucleotide Analogs, John Wiley, New York (1980); see Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).
  • the polynucleotide comprises a polynucleotide encoding the CycA protein of the present application or at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91 with the CycA protein of the present application. It may be a polynucleotide encoding a polypeptide having %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology or identity.
  • a polynucleotide comprising a protein comprising an amino acid sequence having at least 70% homology or identity with SEQ ID NO: 15 or SEQ ID NO: 15 is at least 70% with the polynucleotide sequence of SEQ ID NO: 18 or SEQ ID NO: 18 , 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99 It may be a polynucleotide having % homology or identity.
  • polynucleotides that can be translated into a protein comprising an amino acid sequence having 70% or more identity to SEQ ID NO: 15 or SEQ ID NO: 15 or a protein having homology or identity thereto by codon degeneracy may also be included. It is self-evident that Or a probe that can be prepared from a known gene sequence, for example, hybridized under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence, having at least 70% identity with the amino acid sequence of SEQ ID NO: 15 Any polynucleotide sequence encoding a protein comprising an amino acid sequence may be included without limitation.
  • the "stringent conditions” means conditions that allow specific hybridization between polynucleotides.
  • SSC 0.1% SDS, specifically at a salt concentration and temperature equivalent to 60° C., 0.1 ⁇ SSC, 0.1% SDS, more specifically 68° C., 0.1 ⁇ SSC, 0.1% SDS, once, specifically 2 Conditions for washing three to three times can be enumerated.
  • Hybridization requires that two polynucleotides have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the present application may also encompass substantially similar polynucleotide sequences as well as isolated polynucleotide fragments complementary to the overall sequence.
  • polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60 °C, 63 °C, or 65 °C, but is not limited thereto and may be appropriately adjusted by those skilled in the art depending on the purpose.
  • homology refers to the degree to which two given amino acid sequences or base sequences are related, and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably. Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially, homologous or identical sequences are generally at least about 50%, 60%, 70%, 80% of the entire or full-length sequence under moderate or high stringent conditions. or more than 90% hybrid. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotides.
  • Homology or identity to said polypeptide or polynucleotide sequence can be determined, for example, by the algorithm BLAST according to the literature [Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA by Pearson (see Methods Enzymol., 183, 63, 1990). Based on such an algorithm BLAST, a program called BLASTN or BLASTX has been developed (refer to http://www.ncbi.nlm.nih.gov).
  • the term "enhancement of protein activity" of the present application means that the activity is improved compared to the intrinsic activity or activity before modification of the protein of the microorganism.
  • the activity enhancement may include both introducing an exogenous protein and enhancing the activity of an intrinsic protein.
  • it includes introducing a foreign protein into a microorganism having intrinsic activity of a specific protein, and introducing the protein into a microorganism having no intrinsic activity.
  • the "protein introduction” means that the activity of a specific protein is introduced into a microorganism and modified so that it is expressed. This can also be expressed as enhancing the activity of the corresponding protein.
  • the term “intrinsic” refers to a state originally possessed by the parent strain before transformation when the trait of a microorganism is changed due to genetic variation caused by natural or artificial factors.
  • the activity enhancement is,
  • the increase in the copy number of the polynucleotide is not particularly limited thereto, but may be performed in a form operably linked to a vector or inserted into a chromosome in a host cell.
  • the polynucleotide encoding the protein of the present disclosure is operably linked to a vector capable of replicating and functioning independently of the host and introduced into a host cell, or inserting the polynucleotide into a chromosome in the host cell.
  • the polynucleotide is operably linked to a capable vector and introduced into a host cell, thereby increasing the number of copies of the polynucleotide in the chromosome of the host cell.
  • modification of the expression control sequence so as to increase the expression of the polynucleotide is not particularly limited thereto, deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence to further enhance the activity of the expression control sequence, or these It can be carried out by inducing a mutation in the sequence with a combination of
  • the expression control sequence is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence for regulating the termination of transcription and translation.
  • a strong heterologous promoter may be linked to the upper portion of the polynucleotide expression unit instead of the original promoter.
  • Examples of the strong promoter include CJ7 promoter (Korean Patent Registration Nos. 0620092 and WO2006/065095), lysCP1 promoter (WO2009/096689), EF -Tu promoter, groEL promoter, aceA or aceB promoter, etc., but are not limited thereto.
  • the modification of the polynucleotide sequence on the chromosome is not particularly limited thereto, but the expression control sequence by deletion, insertion, non-conservative or conservative substitution of a nucleic acid sequence or a combination thereof to further enhance the activity of the polynucleotide sequence. It can be carried out by inducing a mutation in the phase, or by replacing it with an improved polynucleotide sequence to have stronger activity.
  • a foreign polynucleotide sequence a foreign polynucleotide encoding a protein exhibiting the same/similar activity as the protein, or a codon-optimized mutant polynucleotide thereof may be introduced into a host cell.
  • the foreign polynucleotide may be used without limitation in origin or sequence as long as it exhibits the same/similar activity as the protein.
  • the introduced foreign polynucleotide can be introduced into the host cell by optimizing its codon so that the optimized transcription and translation are performed in the host cell. The introduction can be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to generate a protein and increase its activity.
  • protein activity enhancement may be one having enhanced protein activity than the wild-type Corynebacterium genus microorganism.
  • the microorganism having enhanced glycine transporter activity in the present application may have enhanced glycine transporter activity compared to microorganisms that do not include the glycine transporter of the present application or whose activity is weakened or inactivated. .
  • the microorganism of the present application may have enhanced glycine transporter activity compared to wild-type Corynebacterium glutamicum. More specifically, L-isoleucine production ability may be increased by introducing a glycine transporter activity into wild-type Corynebacterium glutamicum ATCC13032 to have enhanced glycine transporter activity.
  • the microorganism of the present application introduces at least one of a glycine transporter, a polynucleotide encoding the same, and a vector including the polynucleotide into a microorganism having L-isoleucine-producing ability, so that the glycine transporter activity is enhanced to L -It may be that the production of isoleucine is increased.
  • a glycine transporter a polynucleotide encoding the same
  • a vector including the polynucleotide into a microorganism having L-isoleucine-producing ability, so that the glycine transporter activity is enhanced to L -It may be that the production of isoleucine is increased.
  • L-isoleucine-producing ability so that the glycine transporter activity is enhanced to L -It may be that the production of isoleucine is increased.
  • the term “vector” refers to a DNA preparation containing a polynucleotide sequence encoding a target protein operably linked to a suitable regulatory sequence so that the target protein can be expressed in a suitable host.
  • the regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • a polynucleotide encoding a target protein in a chromosome may be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into a chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • the vector of the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as a phage vector or a cosmid vector
  • pBR-based, pUC-based, pBluescriptII-based plasmid vectors may be used.
  • pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.
  • pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used.
  • the term “transformation” refers to introducing a vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located extrachromosomally, as long as they can be expressed in the host cell.
  • the polynucleotide includes DNA and RNA encoding a target protein. The polynucleotide may be introduced into a host cell and expressed in any form, as long as it can be expressed.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked in the present application means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a target protein of the present application.
  • the method for transforming the vector of the present application includes any method of introducing a nucleic acid into a cell, and may be performed by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and acetic acid Lithium-DMSO method and the like, but is not limited thereto.
  • a suitable standard technique as known in the art depending on the host cell.
  • electroporation calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and acetic acid Lithium-DMSO method and the like, but is not limited thereto.
  • microorganism that produces L-isoleucine in the present application includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially, and microorganisms that naturally have L-isoleucine-producing ability or that do not have L-isoleucine-producing ability It may refer to a microorganism to which the production ability of L-isoleucine is imparted to the parent strain.
  • a microorganism in which a specific mechanism is weakened or strengthened due to a cause such as insertion of an external gene or intensification or inactivation of the activity of an endogenous gene can
  • the microorganism producing L-isoleucine may be a microorganism having enhanced glycine transporter activity.
  • the activity enhancement includes the introduction of activity of an exogenous glycine transporter as described above.
  • it may be a microorganism in which feedback restriction of an enzyme on the isoleucine biosynthetic pathway is inhibited, or by enhancing or inhibiting an enzyme involved in the isoleucine biosynthetic pathway to produce isoleucine.
  • it may be a microorganism that produces isoleucine by inactivating the activity of an enzyme or protein that does not affect isoleucine biosynthesis to facilitate metabolism into the isoleucine biosynthetic pathway.
  • it may be a microorganism in which the activity of an intermediate, a cofactor, or a protein or enzyme on an isoleucine biosynthetic pathway is inactivated, or an energy source-consuming pathway.
  • homoserine dehydrogenase (hom) and/or threonine dehydratase (ilvA) are mutated to inhibit feedback restriction of the isoleucine biosynthetic pathway or enhance protein activity involved in the increase in isoleucine production Or, it may be a microorganism that has inactivated the isoleucine degradation pathway enzyme.
  • the isoleucine biosynthetic pathway, production increase and degradation pathway may include its precursor synthesis pathway.
  • this is only one example, and is not limited thereto, and may be a microorganism in which the expression of a gene encoding an enzyme of various known L-isoleucine biosynthetic pathways is enhanced or an enzyme of a degradation pathway is inactivated.
  • the microorganism producing the above L-isoleucine can be prepared by applying various known methods.
  • activation of protein activity means that the expression of an enzyme or protein is not expressed at all compared to a natural wild-type strain, a parent strain, or a strain in which the protein is unmodified, or the activity is absent or reduced. means that In this case, the decrease is when the activity of the protein is reduced compared to the activity of the protein originally possessed by the microorganism due to mutation of the gene encoding the protein, modification of the expression control sequence, deletion of part or all of the gene, and the gene encoding it When the overall protein activity level in the cell is lower than that of the native strain or the strain before transformation due to inhibition of expression or translation inhibition, the concept also includes a combination thereof.
  • the inactivation may be achieved by applying various methods well known in the art.
  • the method include: 1) a method of deleting all or part of the gene encoding the protein; 2) modification of the expression control sequence to decrease the expression of the gene encoding the protein, 3) modification of the gene sequence encoding the protein so that the activity of the protein is removed or attenuated, 4) the gene encoding the protein introduction of an antisense oligonucleotide (eg, antisense RNA) that complementarily binds to the transcript of 5) By adding a sequence complementary to the Shine-Dalgarno sequence to the front end of the Shine-Dalgarno sequence of the gene encoding the protein, a secondary structure is formed to make attachment of the ribosome impossible Way; 6) There is a method of adding a promoter transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the polynucleotide sequence of the gene encoding the protein (Reverse transcription
  • the microorganism of the present application may be any microorganism including the glycine transporter and capable of producing L-isoleucine.
  • microorganism capable of producing L-isoleucine may be used interchangeably with "a microorganism producing L-isoleucine", "a microorganism having an ability to produce L-isoleucine”, and "a microorganism for producing L-isoleucine”.
  • the amount of by-products can be reduced. Therefore, the microorganism of the present application may have a reduced amount of by-products.
  • the by-product is a substance other than isoleucine that shares a precursor with isoleucine, for example, L-norvaline (L-norvaline), alpha-aminobutyric acid (AABA), and L-valine (L-valine) selected from It may be any one or more substances.
  • L-norvaline L-norvaline
  • AABA alpha-aminobutyric acid
  • L-valine L-valine selected from It may be any one or more substances.
  • the reduction in the amount of by-products produced, compared to the amount of by-products produced in the synthetic pathway involving the protein, compared to the wild-type microorganism, or a microorganism that does not include the glycine transporter, or whose activity is weakened or inactivated. can be, but is not limited thereto.
  • the microorganism having enhanced glycine transporter activity of the present application and the isoleucine production method comprising culturing the same do not include the glycine transporter of the present application, or have a weakened or inactivated activity compared to the microorganisms produced by-products This may be reduced.
  • the term "the genus of Corynebacterium microorganism that produces L-isoleucine” is a microorganism that produces L-isoleucine, and the genus of the microorganism may refer to a microorganism belonging to the genus Corynebacterium. .
  • the microorganism producing the L-isoleucine is the same as described above.
  • the microorganism of the genus Corynebacterium having L-isoleucine-producing ability means that the activity of the glycine transporter of the present application is enhanced or transformed with a vector containing a gene encoding the glycine transporter, It may mean a microorganism of the genus Corynebacterium having an improved L-isoleucine-producing ability.
  • microorganism of the genus Corynebacterium having improved L-isoleucine-producing ability refers to a microorganism having improved L-isoleucine-producing ability than the parent strain or unmodified microorganism before transformation.
  • the 'unmodified microorganism' does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a native Corynebacterium sp. strain itself, or a microorganism that does not contain a gene encoding the glycine transporter; Alternatively, it may be a microorganism that has not been transformed with a vector containing a gene encoding the glycine transporter.
  • microorganisms of the genus Corynebacterium may include all microorganisms of the genus Corynebacterium. Specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium efficiens ( Corynebacterium efficiens ) , Corynebacterium callunae ( Corynebacterium callunae ), Corynebacterium stationis ( Corynebacterium stationis ), Corynebacterium singulare ( Corynebacterium singulare ), Corynebacterium halo Tolerans ( Corynebacterium halotolerans ), Corynebacterium Lium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes ), Corynebacterium
  • compositions for producing L-isoleucine comprising the microorganism for producing L-isoleucine of the present application.
  • the composition for producing L-isoleucine may refer to a composition capable of producing L-isoleucine by a microorganism producing L-isoleucine of the present application.
  • the composition includes a microorganism that produces the L-isoleucine, and may include without limitation an additional composition capable of producing isoleucine using the strain.
  • the additional component capable of producing isoleucine may further include, for example, any suitable excipient commonly used in a composition for fermentation, or a component of a medium. Such excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, but are not limited thereto.
  • Another aspect of the present application provides a method for producing L-isoleucine comprising the step of culturing the microorganism.
  • the medium and other culture conditions used for culturing the microorganism of the present application may be used without any particular limitation as long as it is a medium used for culturing a microorganism of the genus Corynebacterium.
  • the microorganism of the present application is a suitable carbon source, It can be cultured while controlling temperature, pH, etc. under aerobic or anaerobic conditions in a normal medium containing a nitrogen source, phosphorus, inorganic compounds, amino acids and/or vitamins.
  • carbohydrates such as glucose, fructose, sucrose, maltose; alcohols such as sugar alcohols, glycerol, and the like; fatty acids such as palmitic acid, stearic acid, and linoleic acid; Organic acids such as pyruvic acid, lactic acid, acetic acid, and citric acid, amino acids such as glutamic acid, methionine, lysine, and the like may be included, but are not limited thereto.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, and sterilized pre-treated molasses (i.e. molasses converted to reducing sugar), etc.
  • Carbohydrates may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine
  • organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract
  • the phosphorus may include potassium monobasic phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto.
  • potassium monobasic phosphate dipotassium phosphate
  • sodium-containing salt corresponding thereto.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used.
  • the medium may contain vitamins and/or appropriate precursors.
  • the medium or precursor may be added to the culture in a batch or continuous manner, but is not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the culture in an appropriate manner during the culture of the microorganism to adjust the pH of the culture.
  • an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation.
  • oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected with or without gas to maintain anaerobic and microaerobic conditions.
  • the temperature of the culture may be 25°C to 40°C, and more specifically, 28°C to 37°C, but is not limited thereto.
  • the incubation period may be continued until a desired production amount of useful substances is obtained, and specifically, it may be 1 hour to 100 hours, but is not limited thereto.
  • the method for preparing L-isoleucine may include recovering L-isoleucine from at least one material selected from among the microorganism, the medium, its culture, a supernatant of the culture, an extract of the culture, and a lysate of the microorganism after the culturing step. have.
  • the target material L-isoleucine
  • the target material can be recovered from the culture solution using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method.
  • a suitable method known in the art for example, a batch, continuous or fed-batch culture method.
  • methods such as precipitation, centrifugation, filtration, chromatography and crystallization may be used.
  • a supernatant obtained by removing the biomass by centrifuging the culture at low speed may be separated through ion exchange chromatography, but is not limited thereto.
  • the recovery step may include a purification process.
  • Example 1 For the production of L-isoleucine producing strain Identification of novel mutations that resolve feedback inhibition of L-threonine dehydratase (ilvA)
  • Example 1-1 ilvA mutant (F383A) plasmid construction having L-threonine dehydratase activity
  • microbial mutation was induced by using the following method.
  • PCR was performed using the primers of SEQ ID NO: 27 and SEQ ID NO: 30, SEQ ID NO: 28 and SEQ ID NO: 29 using the chromosome of wild type Corynebacterium glutamicum ATCC 13032 as a template. PCR conditions were repeated 30 times of denaturation at 95° C. for 5 minutes, then denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 90 seconds, followed by polymerization at 72° C. for 5 minutes.
  • PCR was performed with primers of SEQ ID NO: 27 and SEQ ID NO: 28.
  • a DNA fragment of 1531 bp containing the ilvA mutation (SEQ ID NO: 31) in which phenylalanine at position 383 was substituted with alanine was amplified.
  • the pECCG117 (Korean Patent No. 10-0057684) vector and ilvA DNA fragment were treated with restriction enzyme BamHI, ligated using a DNA splicing enzyme, and then cloned to obtain a plasmid, which was named pECCG117-ilvA (F383A). .
  • Example 1-2 ilvA mutant plasmid construction having L-threonine dehydratase activity
  • an ilvA mutant gene plasmid was prepared using a random mutagenesis kit (Agilent Technologies, USA). PCR was performed using the primers of SEQ ID NO: 27 and SEQ ID NO: 28 using the ilvA (F383A) chromosome of Example 1-1 as a template. PCR conditions were repeated 30 times of denaturation at 95° C. for 2 minutes, denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 90 seconds, followed by polymerization at 72° C. for 10 minutes.
  • a DNA fragment of 1531 bp, an ilvA mutant capable of encoding L-threonine dehydratase having additional random mutations in addition to the mutation in which the 383th phenylalanine was substituted with alanine was amplified.
  • the pECCG117 vector and the ilvA mutant DNA fragment were treated with a restriction enzyme BamHI, ligated using a DNA conjugation enzyme, and then cloned to obtain a plasmid group.
  • Example 1-3 Production and evaluation of Corynebacterium sp. strain having L-isoleucine-producing ability
  • a strain producing L-isoleucine was prepared using wild-type Corynebacterium glutamicum ATCC13032. Specifically, in order to solve the feedback inhibition of threonine, a precursor of isoleucine, in the 4 pathway of L-isoleucine biosynthesis, arginine, the 407th amino acid of hom, a gene encoding homoserine dehydrogenase, was converted to histidine. was replaced with (Korea Patent Registration No. 10-1996769)
  • PfuUltra TM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C, 30 seconds; annealing 55° C., 30 seconds; and the polymerization reaction at 72° C. for 1 minute was repeated 28 times.
  • PCR was performed with primers of SEQ ID NO: 32 and SEQ ID NO: 35. PCR conditions were repeated 28 times of denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.
  • a 2 kb DNA fragment containing a mutation in the hom gene encoding a homoserine dehydrogenase mutant in which arginine at position 407 was substituted with histidine was amplified.
  • the amplification product was purified using a PCR purification kit (QUIAGEN) and used as an insert DNA fragment for vector construction. After the purified amplification product was treated with restriction enzyme smaI, the molar concentration (M) ratio of the pDZ vector (US 9109242 B2) and the amplification product, the inserted DNA fragment, which was heat-treated at 65° C. for 20 minutes was 1:2.
  • a vector pDZ-R407H for introducing a hom(R407H) mutation onto a chromosome was prepared by cloning using the Infusion Cloning Kit (TaKaRa) according to the provided manual.
  • the constructed vector was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and a strain containing a hom (R407H) mutation was obtained on the chromosome through a secondary crossover process, which was Corynebacterium glutamicum. It was named ATCC13032 hom (R407H).
  • Example 1-4 Evaluation of L-isoleucine-producing ability of L-isoleucine-producing strains introduced with ilvA mutants
  • Example 1-2 In order to confirm the L-isoleucine productivity of the mutant obtained in Example 1-2, a strain was prepared in the following manner. Specifically, the plasmid prepared in Example 1-1 was introduced into the Corynebacterium glutamicum ATCC 13032 hom (R407H) strain prepared in Example 1-3, and the strain into which the prepared plasmid was introduced was ATCC 13032 hom It was named (R407H)/pECCG117-ilvA (F383A). In addition, the mutant plasmid group obtained in Example 1-2 was introduced into the Corynebacterium glutamicum ATCC 13032 hom (R407H) strain, and the apoptosis rate was 70% as a result of plated on minimal medium and the survival rate was 70%.
  • L-isoleucine was prepared by inoculating the strain into a 250 ml corner-barpool flask containing 25 ml of isoleucine production medium, and then culturing with shaking at 32° C. for 60 hours at 200 rpm.
  • the composition of the used production medium is as follows.
  • Glucose 5% Bactopeptone 1%, Sodium Chloride 0.25%, Yeast Extract 1%, Urea 0.4%, pH 7.2
  • Glucose 10% yeast extract 0.2%, ammonium sulfate 1.6%, potassium monophosphate 0.1%, magnesium sulfate 0.1%, iron sulfate 10mg/L, manganese sulfate 10 mg/L, biotin 200 ⁇ g/l pH 7.2
  • the parent strain Corynebacterium glutamicum ATCC 13032 hom (R407H) / pECCG117-ilvA (F383A) produced L-isoleucine at a concentration of 2.5 g / l, but the mutant Corynebacter Lium glutamicum CJILE-301 produced L-isoleucine at a concentration of 4.3 g/L, confirming that the productivity of L-isoleucine was increased by about 172% compared to the parent strain. In addition, it was confirmed that the residual L-threonine concentration was decreased from 1.5 g/L to 0.0 g/L, thereby increasing the activity of ilvA for threonine.
  • the plasmid was isolated from the CJILE-301 strain and the ilvA gene was sequenced.
  • the 1141st nucleotide sequence of the ilvA gene was substituted from A to G, and 383th F of the ilvA protein was substituted with A. It was confirmed that the 381th T can encode a mutant protein substituted with A, which is shown in SEQ ID NO: 36.
  • the above result means that the strain introduced with the ilvA mutant (T381A) of Example 1-2 obtained through random mutagenesis can produce L-isoleucine with high efficiency and high yield as a result.
  • Example 2 Production of L-isoleucine-producing strain Corynebacterium glutamicum ATCC13032 hom (R407H) ilvA (T381A, F383A) strain using wild-type Corynebacterium microorganisms
  • a strain producing L-isoleucine was developed from the wild species Corynebacterium glutamicum ATCC13032.
  • the first precursor in the isoleucine biosynthesis pathway arginine, the 407th amino acid of hom, a gene encoding homoseine dehydrogenase, was substituted with histidine (Korea Patent 10). - 1996769, SEQ ID NO: 1). More specifically, PCR was performed using the primers of SEQ ID NO: 2 and SEQ ID NO: 3 or SEQ ID NO: 4 and SEQ ID NO: 5 using the chromosome of ATCC13032 as a template to produce strains into which the hom (R407H) mutation was introduced.
  • PfuUltraTM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation at 95°C for 30 seconds; annealing 55° C. 30 seconds; And after repeating the polymerization reaction at 72°C for 1 minute 28 times, the polymerization reaction was performed at 72°C for 5 minutes.
  • PCR was performed with primers of SEQ ID NO: 2 and SEQ ID NO: 5. PCR conditions were repeated 28 times of denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.
  • the amplification product was purified using QUIAGEN's PCR purification kit and used as an insert DNA fragment for vector construction. Meanwhile, after treatment with restriction enzyme smaI, the molar concentration (M) ratio of the pDZ vector, which was heat-treated at 65° C. for 20 minutes, and the insert DNA fragment amplified through the PCR was 1:2, so that the Infusion Cloning Kit of TaKaRa was used to construct a vector pDZ-R407H for introducing hom(R407H) mutations onto the chromosome by cloning according to the provided manual.
  • the prepared vector was transformed into ATCC13032 by electroporation, and through a secondary crossover process, a strain in which each nucleotide mutation was substituted with a mutant nucleotide on the chromosome was obtained, which was named ATCC13032 hom (R407H).
  • PCR was performed using the primers of SEQ ID NO: 6 and SEQ ID NO: 7 or SEQ ID NO: 8 and SEQ ID NO: 9 using the ATCC13032 chromosome as a template to prepare a strain in which T381A and F383A mutations were introduced.
  • PfuUltraTM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C, 30 seconds; annealing 55° C., 30 seconds; And the polymerization reaction 72 °C, 1 minute 30 seconds was repeated 28 times.
  • PCR was performed with primers of SEQ ID NO: 6 and SEQ ID NO: 9. PCR conditions were denaturation 95°C, 30 seconds; annealing 55° C., 30 seconds; And after repeating the polymerization reaction at 72°C for 2 minutes 28 times, the polymerization reaction was performed at 72°C for 5 minutes.
  • the amplification product was purified using QIAGEN's PCR purification kit and used as an insert DNA fragment for vector construction.
  • vectors pDZ-T381A, F383A for introducing ilvA (T381A, F383A) mutations onto chromosomes were prepared by cloning using the Infusion Cloning Kit of TaKaRa according to the provided manual.
  • the prepared vector was transformed into ATCC13032 hom (R407H) prepared in Example 2-1 by electroporation, and a strain in which each nucleotide mutation was substituted with a mutant nucleotide on the chromosome was obtained through a secondary crossover process, This was named ATCC13032 hom (R407H) ilvA (T381A, F383A).
  • Example 3 Wild strain-derived L-isoleucine-producing strain Corynebacterium glutamicum ATCC13032 hom (R407H) ilvA (T381A, F383A) strain Corynebacterium ammoniagenes Production and evaluation of strains introduced with the derived cycA gene
  • Example 3-1 Corynebacterium ammoniagenes-derived alanine / D-serine / glycerine transporter gene (cycA) introduced strain production
  • cycA D-alanine / D-serine / glycerine transporter gene
  • alaT alanine transaminase
  • PCR was performed using the primers of SEQ ID NO: 11 and SEQ ID NO: 12 or SEQ ID NO: 13 and SEQ ID NO: 14 using the ATCC13032 chromosome as a template.
  • PfuUltraTM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C, 30 seconds; annealing 55° C., 30 seconds; And after repeating the polymerization reaction at 72°C for 1 minute 28 times, the polymerization reaction was performed at 72°C for 5 minutes.
  • the amplification product was purified using QIAGEN's PCR purification kit and used as a DNA fragment for vector construction. Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NO: 11 and SEQ ID NO: 14. Conditions were: denaturation 95°C, 30 seconds; annealing 55° C., 30 seconds; And after repeating the polymerization reaction at 72°C for 2 minutes 28 times, the polymerization reaction was performed at 72°C for 5 minutes.
  • the amplification product was purified using QIAGEN's PCR Purification Kit and used as an insert DNA fragment for vector construction. Meanwhile, after treatment with restriction enzyme smaI, the molar concentration (M) ratio of the pDZ vector, which was heat-treated at 65° C. for 20 minutes, and the insert DNA fragment amplified through the PCR was 1:2, so that the Infusion Cloning Kit of TaKaRa was used to construct a vector pDZ-N2747 for insertion into the Ncgl2131 gene locus by cloning according to the provided manual.
  • the constructed vector was transformed into ATCC13032 hom(R407H)ilvA(T381A, F383A) by electroporation, and a strain in which the NCgl2747 gene was deleted on the chromosome was obtained through a secondary crossover process, which was obtained by ATCC13032 hom(R407H)ilvA( It was designated as T381A, F383A)-N2747.
  • SEQ ID NO: 15 a protein having D-alanine / D-serine / glycine transporter activity
  • Corynebacterium ammoniagenes ATCC 6872 chromosome as a template, SEQ ID NO: PCR was performed using the primers of 16 and SEQ ID NO: 17.
  • PfuUltraTM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C, 30 seconds; annealing 55° C., 30 seconds; And after repeating the polymerization reaction at 72°C for 1 minute and 30 seconds 28 times, the polymerization reaction was performed at 72°C for 5 minutes.
  • a 1595bp cycA gene fragment (SEQ ID NO: 18) was obtained, and the amplified product was purified using QIAGEN's PCR purification kit and used as an insert DNA fragment for vector construction.
  • PCR was performed using p117-cj7-gfp containing the promoter cj7 derived from a known microorganism of the genus Corynebacterium as a template (Korean Patent Registration No. 10-0620092).
  • 'p117' represents an E. coli-Corynebacterium shuttle vector, pECCG117 (Biotechnology Letters 13(10): 721-726, 1991).
  • PfuUltraTM high-confidence DNA polymerase (Stratagene) was used, and the PCR reaction was performed at 95° C.
  • the amplified PCR product was purified using QIAGEN's PCR purification kit to obtain a cj7 fragment of 350 bp size (SEQ ID NO: 21).
  • fusion (seqing) PCR was performed using the primers of SEQ ID NO: 19 and SEQ ID NO: 17. PCR reaction was denatured at 95°C, 30 seconds; annealing 55° C., 30 seconds; And after repeating the polymerization reaction at 72°C for 2 minutes 28 times, the polymerization reaction was performed at 72°C for 5 minutes.
  • a cj7-cycA gene fragment of 1945 bp was obtained, and the amplified product was purified using QIAGEN's PCR purification kit and used as an insert DNA fragment for vector construction.
  • the molar concentration (M) ratio of the obtained cj7-cycA fragment was 1:2 so that TaKaRa (TaKaRa ), a vector pDZ-N2747/Pcj7-cycA(Cam) capable of inserting the cycA gene into the NCgl2747 position was constructed by cloning according to the provided manual using the Infusion Cloning Kit.
  • the prepared vector was transformed into the ATCC13032 hom(R407H)ilvA(T381A, F383A) strain by electroporation, and the Ncgl2747 position on the chromosome was substituted in the form of cj7-cycA(Cam) through a secondary crossover process (ATCC13032) Obtained hom(R407H)ilvA(T381A, F383A)/cycA(Cam)), named it CA10-3115, and deposited it internationally on May 27, 2020 at the Korea Center for Conservation of Microorganisms (KCCM), an international depository under the Budapest Treaty. Therefore, it was given accession number KCCM12740P.
  • Example 3-2 E. coli-derived alanine / D-serine / glycerine transporter gene (cycA) introduced strain production
  • PCR was performed using the primers of SEQ ID NO: 23 and SEQ ID NO: 24 using the E. coli K-12 w3110 chromosome as a DNA template.
  • PfuUltraTM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C, 30 seconds; annealing 55° C., 30 seconds; And after repeating the polymerization reaction at 72°C for 1 minute 28 times, the polymerization reaction was performed at 72°C for 5 minutes.
  • a cycA gene fragment of 1544 bp was obtained, and the amplified product was purified using QIAGEN's PCR purification kit and used as an insert DNA fragment for vector construction (SEQ ID NO: 25).
  • fusion PCR was performed using the primers of SEQ ID NO: 19 and SEQ ID NO: 24.
  • PCR reaction was denatured at 95°C, 30 seconds; annealing 55° C., 30 seconds; And after repeating the polymerization reaction at 72°C for 90 seconds 28 times, the polymerization reaction was performed at 72°C for 5 minutes.
  • a cj7-cycA gene fragment of 1894bp was obtained, and the amplified product was purified using QIAGEN's PCR purification kit and used as an insert DNA fragment for vector construction.
  • the molar concentration (M) ratio of the obtained cj7-cycA fragment was 1:2 so that TaKaRa (TaKaRa ), a vector pDZ-N2747/Pcj7-cycA(Eco) capable of inserting the E. coli-derived cycA gene into the NCgl2747 position was constructed by cloning according to the provided manual using the Infusion Cloning Kit.
  • the prepared vector was transformed into ATCC13032 hom(R407H)ilvA(T381A, F383A) strain by electroporation, and the Ncgl2747 position on the chromosome was substituted in the form of cj7-cycA(Eco) through the secondary crossover process to obtain a strain and named it ATCC13032 hom(R407H)ilvA(T381A, F383A)/cycA(Eco).
  • Example 4 Evaluation of the ability to reduce fermentation by-products (L-norvaline, alpha-aminobutyric acie (AABA), L-valine) of a wild-type isoleucine-producing strain into which CycA was introduced
  • strains obtained above were inoculated into a 250ml corner-baffle flask containing 25ml of L-isoleucine production medium, and then cultured with shaking at 32°C for 48 hours at 200rpm.
  • Glucose 10% yeast extract 0.2%, ammonium sulfate 1.6%, potassium monophosphate 0.1%, magnesium sulfate 0.1%, iron sulfate 10mg/L, manganese sulfate 10 mg/L, biotin 200 ⁇ g/l
  • Example 5 Confirmation of AABA, L-norvaline, L-valine reduction effect of the glycine transporter in the isoleucine NTG strain
  • Example 3 The two introduced plasmids prepared in Example 3 were transformed into isoleucine NTG strain KCCM11248P (Korea Patent No. 10-1335789) strain by electroporation, and the Ncgl2747 position on the chromosome was Pcj7-cycA ( Cam) to obtain a strain and Pcj7-cycA (Eco) strain substituted in the form, which was named KCCM11248P / cycA (Cam), KCCM11248P / cycA (Eco).
  • Each strain was inoculated with the strains obtained above in a 250ml corner-baffle flask containing 25ml of L-isoleucine production medium, respectively, and then cultured with shaking at 32°C for 48 hours at 200rpm. After the end of the culture, the production of L-isoleucine, L-norvaline, alpha-aminobutric acid, and L-valine was measured using liquid high-speed chromatography (HPLC), and each concentration in the culture solution for each strain tested was It is shown in Table 5 below.
  • microorganisms with enhanced glycine transporter activity derived from the genus Corynebacterium can be usefully used for isoleucine synthesis.

Landscapes

  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)

Abstract

본 출원은 L-이소류신 생산능이 강화된 미생물 및 이를 이용한 L-이소류신 생산 방법에 관한 것이다.

Description

L-이소류신 생산능이 강화된 미생물 및 이를 이용한 L-이소류신 생산방법
본 출원은 L-이소류신 생산능이 강화된 미생물 및 이를 이용한 L-이소류신 생산 방법에 관한 것이다.
분지쇄 아미노산(branched-chain amino acid)은 L-발린, L-류신 및 L-이소류신 3종을 지칭하는 것으로, 식품 첨가제, 약학제 등의 용도로 산업적으로 이용된다. 특히, L-이소류신은 근육에서 대사되어 에너지를 생성하며, 헤모글로빈의 생성에 관여하여 피로 경감과 성장 촉진 기능을 한다. 이에 따라, 수액제제 및 영양제 등 다양하게 이용되고 있으며 스포츠 영양식품에도 사용이 증가되고 있다.
미생물을 이용한 L-이소류신의 생합성은 피루브산(pyruvate)과 2-케토부티르산(2-ketobutyrate)을 전구체로 사용하여 3개의 중간대사 물질을 거쳐 합성된다(Jinhwan Park et al., Appl. Microbial. Biotechnol. 85: 491-506, 2010).
세포 내에서 L-이소류신 생산 수율을 향상시키기 위해서 L-이소류신의 전구체의 합성량을 증가시키는 방법을 고려해 볼 수 있으나, 이러한 생합성 경로에 관여하는 효소들의 대부분은 최종 산물에 의한 피드백 저해를 받아 공업적으로 목적산물을 대량생산하는 데 문제점이 있어 왔다. 또한 생합성 과정 및 조절 메커니즘으로 인하여 이소류신을 배양을 통해 생산하기 위해서는 미생물 대사와 관련된 다양한 시각에서의 접근이 필요하였다.
한편 코리네박테리움 속 미생물의, 글리신 트랜스포터 및 이소류신 생산 간의 효과는 알려진 바 없다.
본 발명자들은 코리네박테리움 속 미생물에서 글리신 트랜스포터 활성을 강화하여, 이소류신 생산능이 증가함을 확인하여 본 발명을 완성하였다.
본 출원의 목적은 강화된 글리신 트랜스포터 활성을 갖는, L-이소류신을 생산하는 코리네박테리움 속 미생물을 제공하는 것이다.
본 출원의 다른 목적은 본 출원의 미생물을 포함하는 L-이소류신 생산용 조성물을 제공하는 것이다.
본 출원의 또 다른 목적은 본 출원의 미생물을 배양하는 단계를 포함하는, L-이소류신 제조방법을 제공하는 것이다.
본 출원의 강화된 글리신 트랜스포터 활성을 갖는 미생물은 우수한 L-이소류신 생산능을 갖는 바, 효율적인 L-이소류신 대량 생산에 활용 될 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
본 출원의 하나의 양태는 강화된 글리신 트랜스포터 활성을 갖는, L-이소류신을 생산하는 코리네박테리움 속 미생물을 제공한다.
본 출원의 용어 "글리신 트랜스포터(glycine transporter)"는 세포 내로 글리신을 유입하는 기능을 갖는 단백질이라면 제한 없이 포함되며, 구체적으로는 D-세린/D-알라닌/글리신 트랜스포터(D-serine/D-alanine/glycine transporter)일 수 있다. 상기 글리신 트랜스포터는 D-세린/D-알라닌/글리신 트랜스포터 또는 글리신 유입 단백질과 혼용되어 사용될 수 있다.
상기 "D-세린/D-알라닌/글리신 트랜스포터(D-serine/D-alanine/glycine transporter)"는, 세린, 알라닌 및 글리신 수송에 모두 관여할 수 있는 단백질로, 공지의 데이터 베이스인 NCBI Genbank 등에서 D-Serine/D-Alanine/glycine transporter 서열을 검색하여 그 정보를 얻을 수 있다. 상기 트랜스포터는 구체적으로 CycA, AapA 일 수 있고, 보다 구체적으로는 CycA 단백질일 수 있으나, 이에 제한되지 않는다.
본 출원의 "CycA 단백질"은 세린, 알라닌 및 글리신 유입(uptake)에 관여하는 단백질을 의미한다. CycA 단백질은 cycA 유전자에 의해 코딩되며, cycA 유전자는 대장균(Escherichia coli), 크렙시엘라 뉴모니에(Klebsialla pneumoniae), 마이코박테리움 보비스(Mycobacterium bovis), 살모넬라 엔테리카(Salmonella enterica), 어위니아 아밀로보라(Erwinia amylovora) 및 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes) 등의 미생물에 존재하는 것으로 알려져 있다.
본 출원의 목적상, 본 출원의 CycA 단백질은 이소류신 생산능을 강화할 수 있는 것이면 어느 것이든 포함될 수 있다. 구체적으로 상기 CycA 단백질은 코리네박테리움속 미생물 유래일 수 있고, 보다 구체적으로는 코리네박테리움 암모니아게네스 유래일 수 있으나, 이에 제한되지 않는다. 상기 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes)는 브레비박테리움 암모니아게네스(Brevibacterium ammoniagenes)와 동종으로, 코리네박테리움 스테이셔니스(Corynebacterium stationis), 브레비박테리움 스테이셔니스(Brevibacterium stationis)와 동일 분류군(taxon)으로 분류되었다(International Journal of Systematic and Evolutionary Microbiology 60: 874-879). 또한 상기 브레비박테리움 암모니아게네스는 코리네박테리움 스테이셔니스로 변경되어 명명된 바 있다.
따라서, 본 출원에서 용어 코리네박테리움 암모니아게네스, 브레비박테리움 암모니아게네스, 코리네박테리움 스테이셔니스, 브레비박테리움 스테이셔니스는 혼용되어 사용될 수 있다.
본 출원의 CycA 단백질은 서열번호 15 또는 이와 70% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함하는 것일 수 있다.
구체적으로, 상기 CycA 단백질은 서열번호 15의 아미노산 서열을 포함하거나, 또는 서열번호 15의 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 또는 99% 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 상기 상동성 또는 동일성을 가지며, 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 가지더라도 본 출원의 범위 내에 포함됨은 자명하다.
더불어, 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 폴리펩티드를 암호화하는 염기서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화되는 폴리뉴클레오티드에 의해 코딩되는 폴리펩티드로서, 세린, 알라닌 및 글리신 유입 활성을 갖는 폴리펩티드도 제한 없이 포함될 수 있다.
즉, 본 출원에서 '특정 서열번호로 기재된 아미노산 서열을 포함하는 단백질 또는 폴리펩타이드', '특정 서열번호로 기재된 아미노산 서열로 이루어진 단백질 또는 폴리펩타이드' 또는 '특정 서열번호로 기재된 아미노산 서열을 갖는 단백질 또는 폴리펩타이드'라고 기재되어 있더라도, 해당 서열번호의 아미노산 서열로 이루어진 폴리펩타이드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원에서 사용될 수 있음은 자명하다. 예를 들어, 상기 아미노산 서열 N-말단 그리고/또는 C-말단에 단백질의 기능을 변경하지 않는 서열 추가, 자연적으로 발생할 수 있는 돌연변이, 이의 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다.
상기 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
본 출원에서 용어 "폴리뉴클레오티드"는 DNA 또는 RNA 분자를 포괄적으로 포함하는 의미를 가지며, 폴리뉴클레오티드에서 기본 구성 단위인 뉴클레오티드는 천연 뉴클레오티드 뿐만 아니라, 당 또는 염기 부위가 변형된 유사체도 포함할 수 있다(Scheit, Nucleotide Analogs, John Wiley, New York(1980); Uhlman 및 Peyman, Chemical Reviews, 90:543-584(1990) 참조).
상기 폴리뉴클레오티드는 본 출원의 CycA 단백질을 코딩하는 폴리뉴클레오티드 또는 본 출원의 CycA 단백질과 적어도 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 또는 99% 상동성 또는 동일성을 갖는 폴리펩티드를 암호화는 폴리뉴클레오티드일 수 있다. 구체적으로 예를 들어, 서열번호 15 또는 서열번호 15와 70% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함하는 단백질을 포함하는 폴리뉴클레오티드는 서열번호 18 또는 서열번호 18의 폴리뉴클레오티드 서열과 적어도 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 또는 99% 상동성 또는 동일성을 가지는 폴리뉴클레오티드일 수 있다.
또한, 코돈 축퇴성 (codon degeneracy)에 의해 서열번호 15 또는 서열번호 15와 70% 이상의 동일성을 갖는 아미노산 서열을 포함하는 단백질 또는 이와 상동성 또는 동일성을 가지는 단백질로 번역될 수 있는 폴리뉴클레오티드 역시 포함될 수 있음은 자명하다. 또는 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, 서열번호 15의 아미노산 서열과 70% 이상의 동일성을 갖는 아미노산 서열을 포함하는 단백질을 코딩하는 폴리뉴클레오티드 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌 (예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 유전자끼리, 70% 이상, 80% 이상, 구체적으로는 85% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성 또는 동일성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화의 세척 조건인 60℃, 1×SSC, 0.1% SDS, 구체적으로는 60℃, 0.1×SSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1×SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 폴리뉴클레오티드가 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 폴리뉴클레오티드 서열뿐만 아니라 전체 서열에 상보적인 단리된 폴리뉴클레오티드 단편을 포함할 수 있다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
본 출원에서 용어 "상동성(homology)" 또는 "동일성(identity)"은 두 개의 주어진 아미노산 서열 또는 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다. 보존된 (conserved) 폴리뉴클레오티드 또는 폴리펩타이드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나 (homologous) 또는 동일한 (identical) 서열은 중간 또는 높은 엄격한 조건(stringent conditions)에서 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90% 이상으로 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
상기 폴리펩타이드 또는 폴리뉴클레오티드 서열에 대한 상동성 또는 동일성은 예를 들면, 문헌에 의한 알고리즘 BLAST[참조: Karlin 및 Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873(1993)]나 Pearson에 의한 FASTA(참조: Methods Enzymol., 183, 63, 1990)을 사용하여 결정할 수 있다. 이러한 알고리즘 BLAST에 기초하여, BLASTN이나 BLASTX라고 불리는 프로그램이 개발되어 있다(참조: http://www.ncbi.nlm.nih.gov). 또한, 임의의 아미노산 또는 폴리뉴클레오티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다.
본 출원의 용어 "단백질의 활성 강화" 는 미생물이 가진 단백질의 내재적 활성 또는 변형 전 활성에 비하여 활성이 향상되는 것을 의미한다. 상기 활성 강화는 외래의 단백질을 도입하는 것과, 내재적인 단백질의 활성 강화를 모두 포함할 수 있다.
즉, 특정 단백질의 내재적 활성이 있는 미생물에 외래 단백질을 도입하는 것과, 내재적 활성이 없는 미생물에 상기 단백질을 도입하는 것도 포함한다.
상기 "단백질 도입"은 특정 단백질의 활성이 미생물 내로 도입되어 발현되도록 변형되는 것을 의미한다. 이는 해당 단백질의 활성 강화로도 표현될 수 있다.
본 출원의 용어 "내재적"은 자연적, 또는 인위적 요인에 의한 유전적 변이로 미생물의 형질이 변화하는 경우, 형질 변화 전 모균주가 본래 가지고 있던 상태를 의미한다.
본 출원에서 활성 강화는,
1) 상기 단백질을 암호화하는 폴리뉴클레오티드의 카피수 증가,
2) 상기 폴리뉴클레오티드의 발현이 증가하도록 발현조절 서열의 변형,
3) 상기 단백질의 활성이 강화되도록 염색체 상의 폴리뉴클레오티드 서열의 변형,
4) 상기 단백질의 활성을 나타내는 외래 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드의 코돈 최적화된 변이형 폴리뉴클레오티드의 도입, 또는
5) 이의 조합에 의해 강화되도록 변형하는 방법 등에 의하여 수행될 수 있으나, 이에 제한되지 않는다.
상기 1) 폴리뉴클레오티드의 카피수 증가는, 특별히 이에 제한되지 않으나, 벡터에 작동 가능하게 연결된 형태로 수행되거나, 숙주세포 내의 염색체 내로 삽입됨으로써 수행될 수 있다. 구체적으로, 숙주와 무관하게 복제되고 기능할 수 있는 벡터에 본원의 단백질을 암호화하는 폴리뉴클레오티드가 작동 가능하게 연결되어 숙주세포 내에 도입됨으로써 수행될 수 있거나, 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터에 상기 폴리뉴클레오티드가 작동 가능하게 연결되어 숙주세포 내에 도입됨으로써 상기 숙주세포의 염색체 내 상기 폴리뉴클레오티드의 카피수를 증가시키는 방법으로 수행될 수 있다.
다음으로, 2) 폴리뉴클레오티드의 발현이 증가하도록 발현조절 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 발현조절 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 가지는 핵산 서열로 교체함에 의하여 수행될 수 있다. 상기 발현조절 서열은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다.
상기 폴리뉴클레오티드 발현 단위의 상부에는 본래의 프로모터 대신 강력한 이종 프로모터가 연결될 수 있는데, 상기 강력한 프로모터의 예로는 CJ7 프로모터(대한민국 등록특허 제0620092호 및 WO2006/065095), lysCP1 프로모터(WO2009/096689), EF-Tu 프로모터, groEL 프로모터, aceA 혹은 aceB 프로모터 등이 있으나, 이에 한정되지 않는다. 아울러, 3) 염색체 상의 폴리뉴클레오티드 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현조절 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다.
또한, 4) 외래 폴리뉴클레오티드 서열의 도입은, 상기 단백질과 동일/유사한 활성을 나타내는 단백질을 암호화하는 외래 폴리뉴클레오티드, 또는 이의 코돈 최적화된 변이형 폴리뉴클레오티드를 숙주세포 내로 도입하여 수행될 수 있다. 상기 외래 폴리뉴클레오티드는 상기 단백질과 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한 없이 사용될 수 있다. 또한 도입된 상기 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화하여 숙주세포 내로 도입할 수 있다. 상기 도입은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 단백질이 생성되어 그 활성이 증가될 수 있다.
마지막으로, 5) 상기 1) 내지 4)의 조합에 의해 강화되도록 변형하는 방법은, 상기 단백질을 암호화하는 폴리뉴클레오티드의 카피수 증가, 이의 발현이 증가하도록 발현조절 서열의 변형, 염색체 상의 상기 폴리뉴클레오티드 서열의 변형 및 상기 단백질의 활성을 나타내는 외래 폴리뉴클레오티드 또는 이의 코돈 최적화된 변이형 폴리뉴클레오티드의 변형 중 하나 이상의 방법을 함께 적용하여 수행될 수 있다.
본 출원의 목적 상, 단백질 활성 강화는 야생형 코리네박테리움 속 미생물보다 강화된 단백질 활성을 가지는 것일 수 있다. 구체적으로, 본 출원에서 강화된 글리신 트랜스포터 활성을 갖는 미생물은, 본 출원의 글리신 트랜스포터를 포함하지 않거나, 그 활성이 약화 혹은 불활성화된 미생물에 비해 강화된 글리신 트랜스포터 활성을 갖는 것일 수 있다.
일 구현예로 본 출원의 미생물은 야생형 코리네박테리움 글루타미쿰에 비해 강화된 글리신 트랜스포터 활성을 갖는 것 일 수 있다. 보다 구체적으로는 야생형 코리네박테리움 글루타미쿰 ATCC13032에 글리신 트랜스포터 활성을 도입하여 강화된 글리신 트랜스포터 활성을 가짐으로써 L-이소류신 생산능이 증가된 것일 수 있다. 다른 구현예로 본 출원의 미생물은 L-이소류신 생산능을 갖는 미생물에 글리신 트랜스포터, 이를 코딩하는 폴리뉴클레오티드 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 하나 이상을 도입하여, 글리신 트랜스포터 활성이 강화되어 L-이소류신 생산능이 증가된 것 일 수 있다. 그러나 이에 제한되지 않는다.
본 출원의 용어 "벡터"는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 코딩하는 폴리뉴클레오티드 서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다.
벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다. 일례로 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 단백질을 코딩하는 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다.
본 출원의 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
본 출원의 용어 "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트 (expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터 (promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다.
또한, 본 출원의 용어 "작동 가능하게 연결"된 것이란 본원의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 벡터를 형질전환 시키는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법 (electroporation), 인산칼슘 (CaPO4) 침전, 염화칼슘 (CaCl2) 침전, 미세주입법 (microinjection), 폴리에틸렌 글리콜 (PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
본 출원의 "L-이소류신을 생산하는 미생물"은 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 자연적으로 L-이소류신 생산능을 가지고 있는 미생물 또는 L-이소류신의 생산능이 없는 모균주에 L-이소류신의 생산능이 부여된 미생물을 의미할 수 있다. 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 L-이소류신 생산을 위하여 유전적 변이가 일어나거나 활성을 강화시킨 미생물 일 수 있다.
예를 들어, 상기 L-이소류신을 생산하는 미생물은 글리신 트랜스포터 활성이 강화된 미생물 일 수 있다. 상기 활성 강화는 전술한 바와 같이 외래 글리신 트랜스포터의 활성의 도입을 포함한다.
또는 이소류신 생합성 경로상의 효소의 피드백 제한이 억제되거나, 이소류신 생합성 경로에 관여하는 효소를 강화 또는 억제하여 이소류신을 생산하는 미생물일 수 있다. 또는 이소류신 생합성에 영향을 미치지 않는 효소 또는 단백질의 활성이 불활성화 되어 이소류신 생합성 경로로의 대사를 원활하게 함으로써 이소류신을 생산하는 미생물일 수 있다. 또는, 이소류신 생합성 경로상의 중간체, 보조인자, 또는 에너지원을 소모하는 경로상의 단백질 또는 효소의 활성을 불활성화시킨 미생물일 수 있다.
보다 구체적으로, 호모세린 디하이드로게나아제(hom) 및/또는 쓰레오닌 디하이드라타제(ilvA) 가 변이되어, 이소류신 생합성 경로의 피드백 제한을 억제하거나, 이소류신 생산 증가에 관여하는 단백질 활성을 강화시키거나, 이소류신 분해 경로 효소를 불활성화 시킨 미생물 일 수 있다. 상기 이소류신 생합성 경로, 생산 증가 및 분해 경로는 이의 전구체 합성 경로를 포함 할 수 있다.
다만 이는 한 가지 예에 불과하며, 이에 제한되지 않고, 다양한 공지의 L-이소류신 생합성경로의 효소를 암호화하는 유전자의 발현을 증진시키거나 분해경로의 효소를 불활성화시킨 미생물일 수 있다.
상기의 L-이소류신을 생산하는 미생물은 공지의 다양한 방법을 적용하여 제조될 수 있다.
본 출원의 용어"단백질 활성의 불활성화"는 효소 또는 단백질의 발현이 천연의 야생형 균주, 모균주 또는 해당 단백질이 비변형된 균주에 비하여 전혀 발현이 되지 않거나 또는 발현이 되더라도 그 활성이 없거나 감소된 것을 의미한다. 이때, 상기 감소는 상기 단백질을 암호화하는 유전자의 변이, 발현조절서열의 변형, 유전자 일부 또는 전체의 결손 등으로 단백질의 활성이 본래 미생물이 가지고 있는 단백질의 활성에 비해 감소한 경우와, 이를 암호화하는 유전자의 발현 저해 또는 번역(translation) 저해 등으로 세포 내에서 전체적인 단백질의 활성 정도가 천연형 균주 또는 변형전의 균주에 비하여 낮은 경우, 이들의 조합 역시 포함하는 개념이다. 본 출원에 있어서, 상기 불활성화는 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다. 상기 방법의 예로, 1) 상기 단백질을 암호화하는 상기 유전자의 전체 또는 일부를 결실시키는 방법; 2) 상기 단백질을 암호화하는 상기 유전자의 발현이 감소하도록 발현 조절 서열의 변형, 3) 상기 단백질의 활성이 제거 또는 약화되도록 단백질을 암호화하는 상기 유전자 서열의 변형, 4) 상기 단백질을 암호화하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입; 5) 상기 단백질을 암호화하는 상기 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열을 부가하여 2차 구조물을 형성시켜 리보솜(ribosome)의 부착을 불가능하게 만드는 방법; 6) 상기 단백질을 암호화하는 상기 유전자의 폴리뉴클레오티드 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터를 부가하는 방법(Reverse transcription engineering, RTE) 등이 있으며, 이들의 조합으로도 달성할 수 있으나, 이에, 특별히 제한되는 것은 아니다.
본 출원의 목적상 본 출원의 미생물은 상기 글리신 트랜스포터를 포함하고 L-이소류신을 생산할 수 있는 미생물이라면 모두 가능하다.
본 출원에서 상기 "L-이소류신을 생산할 수 있는 미생물"은 "L-이소류신을 생산하는 미생물", "L-이소류신 생산능을 갖는 미생물", "L-이소류신 생산용 미생물"과 혼용되어 사용될 수 있다.
본 출원의 강화된 글리신 트랜스포터 활성을 갖는 미생물의 이소류신 합성 경로에서는, 부산물 생성량이 감소될 수 있다. 따라서, 본 출원의 미생물은 부산물 생성량이 감소된 것일 수 있다.
상기 부산물은 이소류신과 전구체를 공유하는 이소류신 외의 물질로, 예를 들어 L-노르발린(L-norvaline), 알파-아미노부티르산(alpha-aminobutyric acid:AABA) 및 L-발린(L-valine) 중에서 선택된 어느 하나 이상의 물질 일 수 있다.
상기 부산물 생성량의 감소는, 야생형 미생물, 혹은 상기 글리신 트랜스포터를 포함하지 않거나, 그 활성이 약화 혹은 불활성화된 미생물에 비해, 단백질이 관여하는 합성 경로에서의 부산물 생성량과 비교하여 감소된 것을 의미할 수 있으나 이에 제한되지 않는다.
따라서, 본 출원의 강화된 글리신 트랜스포터 활성을 갖는 미생물 및 이를 배양하는 것을 포함하는 이소류신 생산 방법은, 본 출원의 글리신 트랜스포터를 포함하지 않거나, 그 활성이 약화 혹은 불활성화된 미생물에 비해 부산물 생성량이 감소된 것일 수 있다.
본 출원에서 용어 "L-이소류신을 생산하는 코리네박테리움 속 (the genus of Corynebacterium) 미생물"이란, L-이소류신을 생산하는 미생물로써, 미생물의 속이 코리네박테리움 속에 속하는 미생물을 의미할 수 있다. 상기 L-이소류신을 생산하는 미생물은 전술한 바와 같다.
구체적으로, 본 출원에서 L-이소류신 생산능을 가지는 코리네박테리움속 미생물이란 본 출원의 글리신 트랜스포터의 활성이 강화되거나, 또는 상기 글리신 트랜스포터를 코딩하는 유전자를 포함하는 벡터로 형질전환되어, 향상된 L-이소류신 생산능을 가지게 된 코리네박테리움속 미생물을 의미할 수 있다.
상기 "향상된 L-이소류신 생산능을 가지게 된 코리네박테리움 속 미생물"은 형질 변화 전 모균주 또는 비변형 미생물보다 L-이소류신 생산능이 향상된 미생물을 의미한다. 상기 '비변형 미생물'은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 천연형 코리네박테리움 속 균주 자체이거나, 상기 글리신 트랜스포터를 코딩하는 유전자를 포함하지 않는 미생물, 또는 상기 글리신 트랜스포터를 코딩하는 유전자를 포함하는 벡터로 형질전환되지 않은 미생물일 수 있다.
본 출원에서 "코리네박테리움 속 미생물"은 모든 코리네박테리움 속 미생물을 포함할 수 있다. 구체적으로, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있고, 더욱 구체적으로 코리네박테리움 글루타미쿰일 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 L-이소류신 생산용 미생물을 포함하는, L-이소류신 생산용 조성물을 제공한다.
상기 L-이소류신 생산용 조성물은 본 출원의 L-이소류신을 생산하는 미생물에 의해 L-이소류신을 생산할 수 있는 조성물을 의미할 수 있다. 상기 조성물은 상기 L-이소류신을 생산하는 미생물을 포함하며, 상기 균주를 이용하여 이소류신을 생산할 수 있는 추가적인 구성을 제한없이 포함할 수 있다. 상기 이소류신을 생산할 수 있는 추가적인 구성은 예를 들어, 발효용 조성물에 통상 사용되는 임의의 적합한 부형제, 또는 배지의 구성 성분을 추가로 포함할 수 있다. 이러한 부형제로는, 예를 들어, 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 다른 하나의 양태는 상기 미생물을 배양하는 단계를 포함하는 L-이소류신 제조방법을 제공한다.
본 출원의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 코리네박테리움속 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용될 수 있으며, 구체적으로는 본 출원의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 또는 혐기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 당 알코올, 글리세롤, 등과 같은 알코올; 팔미트산, 스테아린산, 리놀레산과 같은 지방산; 피루브산, 락트산, 아세트산, 시트르산과 같은 유기산, 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있으나, 이에 제한되지 않는다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있고, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으나, 이에 제한되지 않는다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있다.
그 외에 상기 배지에는 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 상기 배지 또는 전구체는 배양물에 회분식 또는 연속식으로 첨가될 수 있으며, 이에 제한되지 않는다.
본 출원에서, 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배양물에 적절한 방식으로 첨가하여, 배양물의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있다.
배양물의 온도는 25℃ 내지 40℃일 수 있으며, 보다 구체적으로는 28℃ 내지 37℃일 수 있으나 이에 제한되지 않는다. 배양 기간은 원하는 유용 물질의 생성량이 수득될 때까지 계속될 수 있으며, 구체적으로는 1 시간 내지 100 시간일 수 있으나 이에 제한되지 않는다.
상기 L-이소류신 제조방법은 상기 배양 단계 이후 상기 미생물, 상기 배지, 이의 배양물, 배양물의 상등액, 배양물의 추출물 및 상기 미생물의 파쇄물 중에서 선택된 하나 이상의 물질로부터 L-이소류신을 회수하는 단계를 포함할 수 있다.
상기 회수 단계는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 배양액으로부터 목적 물질인 L-이소류신을 회수할 수 있다. 예를 들어, 상기 L-이소류신의 회수는 침전, 원심분리, 여과, 크로마토그래피 및 결정화 등의 방법이 이용될 수 있다. 예를 들면, 배양물을 저속 원심분리하여 바이오매스를 제거하고 얻어진 상등액을, 이온교환 크로마토그래피를 통하여 분리할 수 있으나, 이에 한정되는 것은 아니다.
상기 회수 단계는 정제 공정을 포함할 수 있다.
이하 본 출원을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다.
실시예 1: L-이소류신 생산 균주 제작을 위한 L-threonine dehydratase(ilvA)의 피드백 저해(feedback inhibition) 해소 신규 변이의 동정
실시예 1-1: L-쓰레오닌 디하이드라타아제 활성을 갖는 ilvA 변이체(F383A) 플라스미드 제작
L-이소류신의 생산능이 향상된 미생물 변이주를 얻기 위해 하기와 같은 방법을 사용하여 미생물의 변이를 유도하였다.
L-쓰레오닌 디하이드라타아제(L-Threonine dehydratase, TD)를 코딩하는 유전자인 ilvA(서열번호 26)를 증폭하기 위하여, 기보고된 F383A 변이가 도입된 ilvA 서열(World J Microbiol Biotechnol (2015) 31:1369-1377)에 근거하여 프로모터 부위(개시코돈 상단 약 300bp)로부터 터미네이터 부위(종결코돈 하단 약 100bp)까지 증폭하기 위한 프라이머(서열번호 27 및 서열번호 28)의 양 말단에 BamHI 제한 효소 부위를 삽입하였다. 또한, ilvA에 F383A 변이를 도입하기 위한 프라이머(서열번호 29 및 서열번호 30)를 사용하였다. 여기에서 사용된 프라이머 서열은 하기 표 1과 같다.
서열번호 명칭 서열
27 primer1 ggatccGACTGAGCCTGGGCAACTGG
28 primer2 ggatccCCGTCACCGACACCTCCACA
29 primer3 ACATCACGCTGgcaGAGTACCTCAA
30 primer4 TTGAGGTACTCtgcCAGCGTGATGT
야생형 코리네박테리움 글루타미쿰(wild type Corynebacterium glutamicum) ATCC 13032의 염색체를 주형으로 하여 서열번호 27 및 서열번호 30, 서열번호 28 및 서열번호 29의 프라이머를 이용하여 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 90초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과, ilvA 유전자의 변이를 중심으로 5' 상단 부위의 1460 bp의 DNA 단편과 3' 하단 부위의 276 bp DNA 단편을 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 27 및 서열번호 28의 프라이머로 PCR을 수행하였다.
그 결과, 383번째 페닐알라닌이 알라닌으로 치환된 ilvA 변이(서열번호 31)를 포함하는 1531 bp의 DNA 단편이 증폭되었다. pECCG117(대한민국 등록특허 제10-0057684호) 벡터와 ilvA DNA 단편을 제한 효소 BamHI으로 처리하고, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드를 획득하였고 이를 pECCG117-ilvA(F383A)라 명명하였다.
실시예 1-2: L-쓰레오닌 디하이드라타아제 활성을 갖는 ilvA 변이체 플라스미드 제작
L-쓰레오닌 디하이드라타아제를 코딩하는 유전자의 변이체를 얻기 위해 무작위 돌연변이 키트(random mutagenesis kit, Agilent Technologies, 미국)를 이용하여 ilvA 변이체 유전자 플라스미드를 제조하였다. 실시예 1-1의 ilvA(F383A) 염색체를 주형으로 하여 서열번호 27 및 서열번호 28의 프라이머를 이용하여 PCR을 수행하였다. PCR 조건은 95℃에서 2분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 90초 중합을 30회 반복한 후, 72℃에서 10분간 중합반응을 수행하였다.
그 결과, 383번째 페닐알라닌이 알라닌으로 치환된 변이 외에 추가적인 무작위 변이를 가진 L-쓰레오닌 디하이드라타아제를 암호화할 수 있는 ilvA 변이체인 1531 bp의 DNA 단편이 증폭되었다. pECCG117 벡터와 ilvA 변이체 DNA 단편을 제한 효소 BamHI으로 처리하고, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드군을 획득하였다.
실시예 1-3: L-이소류신 생산능을 갖는 코리네박테리움 속 균주 제작 및 평가
야생형 코리네박테리움 글루타미쿰 ATCC13032를 이용하여 L-이소류신 생산 균주를 제작하였다. 구체적으로, L-이소류신 생합성 4경로에서 이소류신의 전구체인 쓰레오닌의 피드백 저해 해소를 위해 호모세린 디하이드로게나제를 코딩하는 유전자인 hom의 407번째 아미노산인 알지닌(Arginine)을 히스티딘(Histidine)으로 치환하였다(대한민국 등록특허 제10-1996769호)
더 구체적으로, hom(R407H) 변이가 도입된 균주들을 제작하기 위해 코리네박테리움 글루타미쿰 ATCC13032의 염색체를 주형으로 하여 서열번호 32 및 서열번호 33 혹은 서열번호 34 및 서열번호 35의 프라이머를 이용하여 PCR을 각각 수행하였다. 여기에서 사용된 프라이머 서열은 하기 표 2와 같다.
서열번호 명칭 서열
32 primer5 TCGAGCTCGGTACCCCGCTTTTGCACTCATCGAGC
33 primer6 CACGATCAGATGTGCATCATCAT
34 primer7 ATGATGATGCACATCTGATCGTG
35 primer8 CTCTAGAGGATCCCCGAGCATCTTCCAAAACCTTG
PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃ 1분을 28회 반복하였다.
그 결과, hom 유전자의 변이를 중심으로 5' 상단 부위의 1000 bp DNA 단편과 3' 하단 부위의 1000 bp의 DNA 단편을 각각 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 32 및 서열번호 35의 프라이머로 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 2분 중합을 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과, 407번째 알지닌이 히스티딘으로 치환된 호모세린 디하이드로게나제 변이체를 코딩하는 hom 유전자의 변이를 포함하는 2 kb의 DNA 단편이 증폭되었다. 증폭 산물을 PCR 정제 키트(PCR Purification kit, QUIAGEN)를 사용하여 정제하여 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다. 정제한 증폭 산물을 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDZ 벡터(미국등록공보 US 9109242 B2)와 상기 증폭 산물인 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하고, 인퓨전 클로닝 키트(Infusion Cloning Kit, TaKaRa)를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 hom(R407H) 변이를 염색체상에 도입하기 위한 벡터 pDZ-R407H를 제작하였다.
제작된 벡터를 전기천공법으로 코리네박테리움 글루타미쿰 ATCC13032에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 hom(R407H) 변이를 포함하는 균주를 얻었으며, 이를 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H)로 명명하였다.
실시예 1-4: ilvA 변이체 도입 L-이소류신 생산 균주의 L-이소류신 생산능 평가
상기 실시예 1-2에서 얻어진 변이체의 L-이소류신 생산성을 확인하기 위해 하기와 같은 방법으로 균주를 제작하였다. 구체적으로, 실시예 1-3에서 제작한 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) 균주에 실시예 1-1에서 제작한 플라스미드를 도입하였고, 제작한 플라스미드를 도입한 균주는 ATCC 13032 hom(R407H)/pECCG117-ilvA(F383A)로 명명하였다. 또한 실시예 1-2에서 얻어진 변이체 플라스미드군을 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) 균주에 도입하였고, 최소배지에 도말하여 사멸율을 구해본 결과 사멸율은 70 %였으며 생존한 세포들을 종배지에 접종 배양, 최종적으로 ATCC 13032 hom(R407H)/pECCG117-ilvA(F383A) 대조군보다 우수한 이소류신 생산능을 나타내는 변이주를 선별하여 코리네박테리움 글루타미쿰 CJILE-301(Corynebacterium glutamicum, CJILE-301)로 명명하였다.
상기 균주를 이소류신 생산배지 25 ㎖을 함유하는 250 ㎖ 코너-바풀 플라스크에 접종한 후, 32℃에서 60시간동안 200 rpm으로 진탕 배양하여 L-이소류신을 제조하였다. 사용한 생산배지의 조성은 하기와 같다.
<종배지>
포도당 5%, 박토펩톤 1%, 소듐클로라이드 0.25%, 효모추출물 1%, 요소 0.4%, pH 7.2
<최소배지>
포도당 1.0%, 황산암모늄 0.4%, 황산마그네슘 0.04%, 인산제1칼륨 0.1%, 요소 0.1%, 티아민 0.001%, 비오틴 200 ㎍/L, 한천 2%, pH 7.2
<생산배지>
포도당 10%, 효모추출물 0.2%, 황산암모늄 1.6%, 제1인산칼륨 0.1%, 황산마그네슘7수염 0.1%, 황산철7수염 10mg/ℓ, 황산망간1수염 10 mg/ℓ, 비오틴 200 ㎍/ℓ pH 7.2
배양종료 후, 액체고속크로마토그래피(HPLC)를 이용하여 배양액 중의 L-이소류신과 L-쓰레오닌 농도를 측정하고, 그 결과를 하기 표 3에 나타내었다.
균주명 L-이소류신 농도 (g/L) L-쓰레오닌 농도 (g/L)
ATCC 13032 hom(R407H) /pECCG117-ilvA(F383A) (모균주) 2.5 1.5
CJILE-301 (변이주) 4.3 0.0
상기 표 3에 나타난 바와 같이, 모균주인 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H)/pECCG117-ilvA(F383A)은 2.5 g/ℓ의 농도로 L-이소류신을 생산하였으나, 변이주 코리네박테리움 글루타미쿰 CJILE-301은 4.3 g/L의 농도로 L-이소류신을 생산하여, 모균주에 비해 약 172% L-이소류신 생산성이 증가한 것을 확인하였다. 또한 잔여 L-쓰레오닌 농도가 1.5 g/L에서 0.0 g/L로 감소하여 쓰레오닌에 대한 ilvA의 활성이 증가된 것으로 확인되었다.
상기의 결과를 바탕으로 CJILE-301균주로부터 플라스미드를 분리하여 ilvA 유전자를 시퀀싱 한 결과, ilvA 유전자의 1141번째 염기서열이 A에서 G로 치환되어 ilvA 단백질의 383번째 F가 A로 치환된 변이 외에 추가로 381번째 T가 A로 치환된 변이 단백질을 암호화할 수 있음을 확인하였으며, 이는 서열번호 36으로 나타내었다.
상기의 결과는 무작위 돌연변이법을 통해 얻어진 실시예 1-2의 ilvA 변이체(T381A)를 도입한 균주가 결과적으로 L-이소류신을 고효율 및 고수율로 생산할 수 있음을 의미한다.
실시예 2: 야생형 코리네박테리움속 미생물을 이용한 L-이소류신 생산 균주 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H)ilvA(T381A, F383A) 균주의 제작
실시예2-1: hom 변이도입
야생종 코리네박테리움 글루타미쿰 ATCC13032 로부터 L-이소류신 생산균주를 개발하였다.
구체적으로, 이소류신 생합성 경로에서 첫 번째 전구체인 쓰레오닌의 피드백 저해 해소를 위해 Homoseine dehydrogenase을 코딩하는 유전자인 hom의 407번째 아미노산인 알지닌(Arginine)을 히스티딘(Histidine)으로 치환하였다(대한민국 특허 10-1996769호, 서열번호 1). 더 구체적으로, hom(R407H) 변이가 도입된 균주들을 제작하기 위해 ATCC13032의 염색체를 주형으로 하여 서열번호 2 및 서열번호 3 혹은 서열번호 4 및 서열번호 5의 프라이머를 이용하여 PCR을 각각 수행하였다. PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 변성 95℃ 30초; 어닐링 55℃ 30초; 및 중합반응 72℃ 1분을 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과 hom 유전자의 변이를 중심으로 5' 상단 부위의 1000 bp DNA 단편과 3' 하단 부위의 1000 bp의 DNA 단편을 각각 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 2 및 서열번호 5의 프라이머로 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 2분 중합을 28회 반복한 후, 72℃ 에서 5분간 중합반응을 수행하였다.
그 결과, 407번째 알지닌이 히스티딘으로 치환된 호모세린 디하이드로게나제 변이체를 코딩하는 hom 유전자의 변이를 포함하는 2 kb의 DNA 단편이 증폭되었다.
증폭산물을 QUIAGEN사의 PCR Purification kit를 사용하여 정제하여 벡터 제작을 위한 삽입 DNA단편으로 사용하였다. 한편 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDZ벡터와 상기 PCR을 통하여 증폭한 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하여 다카라(TaKaRa)의 Infusion Cloning Kit를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 hom(R407H) 변이를 염색체상에 도입하기 위한 벡터 pDZ-R407H를 제작하였다.
제작된 벡터를 전기천공법으로 ATCC13032에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 각 염기변이가 변이형 염기로 치환되어 있는 균주를 얻었으며, 이를 ATCC13032 hom(R407H)로 명명하였다.
실시예2-2: ilvA 변이도입
ATCC13032 hom(R407H)균주를 기반으로, 이소류신 생합성에서 중요한 효소로 작용하는 L-threonine dehydratase(ilvA)의 피드백 저해(feedback inhibition) 해소를 위해 ilvA의 381번 아미노산인 쓰레오닌(Threonine)을 알라닌(Alanine)으로, 383번 아미노산인 페닐알라닌(Phenylalanine)을 알라닌(Alanine)으로 치환하였다(World J Microbiol Biotechnol. 2015 Sep;31(9):1369-77).
더 구체적으로는 T381A, F383A 변이가 도입된 균주를 제작하기 위해 ATCC13032의 염색체를 주형으로 하여 서열번호 6 및 서열번호 7 혹은 서열번호 8 및 서열번호 9의 프라이머를 이용하여 PCR를 각각 수행하였다. PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 1분 30초를 28회 반복하였다.
그 결과 ilvA 유전자의 변이들을 중심으로 5'상단 부위의 1149bp DNA 단편과 3'하단 부위의 176bp의 DNA 단편을 각각 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 6 및 서열번호 9의 프라이머로 PCR을 수행하였다. PCR 조건은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 2분을 28회를 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과 381번째 쓰레오닌이 알라닌으로, 383번째 페닐알라닌이 알라닌으로 치환된 쓰레오닌 디하이드라티아제를 코딩하는 ilvA 유전자의 1311bp의 DNA 단편이 증폭되었다.
증폭산물을 QIAGEN사의 PCR Purification kit를 사용하여 정제하여 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다.
한편 제한효소 SmaI으로 처리한 후, 65℃에서 20분간 열처리한 pDZ(대한민국 등록 특허 제 10-0924065호)벡터와 상기 PCR을 통하여 증폭한 삽입 DNA 단편이 몰농도(M) 비율이 1:2가 되도록 하여 타카라(TaKaRa)의 Infusion Cloning Kit를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 ilvA(T381A, F383A)변이를 염색체 상에 도입하기위한 벡터 pDZ-T381A,F383A 를 제작하였다.
제작된 벡터를 실시예 2-1에서 제조한 ATCC13032 hom(R407H)에 전기천공법으로 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 각 염기변이가 변이형 염기로 치환되어 있는 균주를 얻었으며, 이를 ATCC13032 hom(R407H)ilvA(T381A, F383A)으로 명명하였다.
실시예 3: 야생주 유래의 L-이소류신 생산 균주 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H)ilvA(T381A, F383A) 균주에 Corynebacterium ammoniagenes 유래 cycA 유전자를 도입한 균주의 제작 및 평가
L-노르발린(L-norvaline), 알파-아미노부티르산(alpha-aminobutyric acid:AABA), L-발린(L-valine)과 같은 이소류신 생산균주 발효 부산물의 생산능이 감소된 균주를 개발하기 위하여, 실시예 2에서 제조한 미생물의 염색체 내에 코리네박테리움 암모니아게네스 유래의 alanine/D-serine/glycerine transporter 유전자(cycA)를 삽입하기 위한 실험을 수행하였다.
실시예3-1: 코리네박테리움 암모니아게네스 유래 alanine/D-serine/glycerine transporter 유전자(cycA) 도입 균주 제작
L-이소류신 생산 균주 ATCC13032 hom(R407H)ilvA(T381A, F383A)의 염색체 내에 D-alanine/D-serine/glycerine transporter 유전자(cycA)를 삽입하기 위해 알라닌 트랜스아미나아제(alanine transaminase, alaT)를 코딩하는 NCgl2747 유전자를 이용하였다(서열번호 10).
NCgl2747 삽입용 벡터를 제작하기 위해 ATCC13032의 염색체를 주형으로 하여 서열번호 11 및 서열번호 12 혹은 서열번호 13 및 서열번호 14의 프라이머를 이용하여 PCR을 각각 수행하였다. PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)을 사용하였으며, PCR 조건은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 1분을 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과 각각 NCgl2747유전자로부터 5' 상단 부위의 1045bp DNA 단편과 3' 하단 부위의 1046bp 의 DNA 단편을 각각 수득하였다.
증폭산물을 QIAGEN사의 PCR Purification kit를 사용하여 정제하여 벡터 제작을 위한 DNA 단편으로 사용하였다. 증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 11 및 서열번호 14의 프라이머로 PCR을 수행하였다. 조건은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 2분을 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과 중심부위에 ScaI 제한효소의 인식부위를 포함하는 2045bp의 DNA 단편이 증폭되었다.
증폭산물을 QIAGEN사의 PCR Purification Kit를 사용하여 정제하여 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다. 한편 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDZ 벡터와 상기 PCR을 통하여 증폭한 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하여 다카라(TaKaRa)의 Infusion Cloning Kit를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 Ncgl2131 유전자 위치로의 삽입용 벡터 pDZ-N2747을 제작하였다.
제작된 벡터를 전기천공법으로 ATCC13032 hom(R407H)ilvA(T381A, F383A)에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 NCgl2747 유전자가 결실된 균주를 얻었으며, 이를 ATCC13032 hom(R407H)ilvA(T381A, F383A)-N2747으로 명명하였다.
한편, D-alanine/D-serine/glycine transporter 활성을 가진 단백질(서열번호 15)을 코딩하는 유전자 단편을 획득하기 위해 코리네박테리움 암모니아게네스 (Corynebacterium ammoniagenes) ATCC 6872 염색체를 주형으로 하여 서열번호 16 및 서열번호 17의 프라이머를 이용하여 PCR을 수행하였다. PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 1분 30초를 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과 1595bp의 cycA 유전자 단편(서열번호 18)을 수득하였으며, 이 증폭산물을 QIAGEN사의 PCR Purification kit를 사용하여 정제하여 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다.
공지된 코리네박테리움 속 미생물 유래의 프로모터 cj7을 포함하는 p117-cj7-gfp를 주형으로 하여 PCR을 실시하였다(대한민국 등록특허 제10-0620092호). 여기서 'p117'은 대장균-코리테박테리움 셔틀 벡터(E. coli-Corynebacterium shuttle vector)인 pECCG117(Biotechnology Letters 13(10): 721-726, 1991)을 나타내는 것이다. PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 반응은 서열번호 19 및 서열번호 20의 프라이머를 사용하여 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 30초를 28회 반복한 후, 72℃에서 3분간 중합반응을 수행하였다. 이로부터 증폭된 PCR 결과물을 QIAGEN사의 PCR Purification kit를 사용하여 정제하여 350bp 크기의 cj7 단편을 획득하였다 (서열번호 21).
위에서 획득한 cj7 단편과 cycA 단편을 주형으로 하고, 서열번호 19 및 서열번호 17의 프라이머를 사용하여 융합(seqing) PCR을 실시하였다. PCR 반응은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 2분을 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과, 1945bp의 cj7-cycA 유전자 단편을 수득하였으며, 이 증폭산물을 QIAGEN사의 PCR Purification kit를 사용하여 정제하여 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다.
한편, 위에서 제작한 pDZ-N2747 벡터를 제한효소 ScaI으로 처리하고 처리하고 65℃에서 20분간 열처리한 후, 획득한 cj7-cycA 단편의 몰농도(M) 비율이 1:2가 되도록 하여 다카라(TaKaRa)의 Infusion Cloning Kit를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 NCgl2747 위치로 cycA 유전자를 삽입할 수 있는 벡터 pDZ-N2747/Pcj7-cycA(Cam)을 제작하였다.
제작된 벡터를 전기천공법으로 ATCC13032 hom(R407H)ilvA(T381A, F383A) 균주에 형질전환하고, 2차 교차과정을 거쳐 염색체 상에서 Ncgl2747 위치가 cj7-cycA(Cam) 형태로 치환되어 있는 균주(ATCC13032 hom(R407H)ilvA(T381A, F383A)/cycA(Cam))를 얻었으며, 이를 CA10-3115으로 명명하고 부다페스트 조약하의 국제기탁기관인 한국미생물보존센터(KCCM)에 2020년 5월 27일자로 국제 기탁하여 기탁번호 KCCM12740P를 부여 받았다.
실시예3-2: 대장균 유래 alanine/D-serine/glycerine transporter 유전자(cycA) 도입 균주 제작
한편, 코리네박테리움 암모니아게네스 유래 cycA 유전자와 그 활성을 비교하기 위해 기공지된 대장균 K-12 유래의 D-alanine/D-serine/glycerine transporter 단백질(서열번호 22)을 코딩하는 cycA 유전자를 위와 동일하게 ATCC13032 hom(R407H)ilvA(T381A, F383A) 균주에 도입하였다(Microbiology, 141(Pt 1); 133-40, 1995).
구체적으로 대장균 K-12 w3110 염색체를 DNA 주형으로 하여 서열번호 23 및 서열번호 24의 프라이머를 이용하여 PCR을 수행하였다. PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 1분을 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다. 그 결과, 1544bp의 cycA 유전자 단편을 수득하였으며, 이 증폭산물을 QIAGEN사의 PCR Purification kit를 사용하여 정제하여 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다(서열번호 25).
위에서 획득한 cj7 단편과 대장균 유래 cycA 단편을 주형으로 하고, 서열번호 19 및 서열번호 24의 프라이머를 사용하여 융합(sewing) PCR을 실시하였다. PCR 반응은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 90초를 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다. 그 결과, 1894bp의 cj7-cycA 유전자 단편을 수득하였으며, 이 증폭산물을 QIAGEN사의 PCR Purification kit를 사용하여 정제하여 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다.
한편, 위에서 제작한 pDZ-N2747 벡터를 제한효소 ScaI으로 처리하고 처리하고 65℃에서 20분간 열처리한 후, 획득한 cj7-cycA 단편의 몰농도(M) 비율이 1:2가 되도록 하여 다카라(TaKaRa)의 Infusion Cloning Kit를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 NCgl2747 위치로 대장균 유래 cycA 유전자를 삽입할 수 있는 벡터 pDZ-N2747/Pcj7-cycA(Eco)을 제작하였다.
제작된 벡터를 전기천공법으로 ATCC13032 hom(R407H)ilvA(T381A, F383A) 균주에 형질전환하고, 2차 교차과정을 거쳐 염색체 상에서 Ncgl2747 위치가 cj7-cycA(Eco) 형태로 치환되어 있는 균주를 얻었으며, 이를 ATCC13032 hom(R407H)ilvA(T381A, F383A)/cycA(Eco)으로 명명하였다.
실시예 4: CycA가 도입된 야생형 유래 이소류신 생산균주의 발효 부산물(L-norvaline, alpha-aminobutyric acie(AABA),L-valine) 저감능 평가
실시예 3에서 제작된 균주들의 L-이소류신 생산능 및 발효 부산물인 L-norvaline, alpha-aminoburyric acid(AABA), L-valine의 저감능 테스트를 진행하였다.
L-이소류신 생산 배지 25ml을 함유하는 250ml 코너-바플 플라스크에 위에서 획득한 균주들을 각각 접종한 후, 32℃에서 48시간 동안 200rpm으로 진탕 배양하였다.
L-이소류신 생산배지(pH 7.2)
포도당 10%, 효모추출물 0.2%, 황산암모늄 1.6%, 제1인산칼륨 0.1%, 황산마그네슘7수염 0.1%, 황산철7수염 10mg/ℓ, 황산망간1수염 10 mg/ℓ, 비오틴 200 ㎍/ℓ
배양 종료 후, 액체고속 크로마토그래피(HPLC)를 이용하여 L-이소류신 및 L-노르발린, 알파-아미노부티르산, L-발린의 생산량을 측정하였고, 실험한 각 균주에 대한 배양액 중의 각각의 농도는 하기 표 4에 나타내었다.
균주 L-이소류신 (g/L) AABA(g/L) L-노르발린(g/L) L-발린(g/L)
ATCC 13032 hom(R407H)ilvA(T381A, F383A) 3.1 0.4 0.3 0.3
ATCC 13032 hom(R407H)ilvA(T381A, F383A)ΔNcgl2747 3.2 0.4 0.3 0.1
ATCC 13032 hom(R407H)ilvA(T381A, F383A)/pDZ-N2747-Pcj7-cycA(Cam) 3.5 0.0 0.1 0.2
ATCC 13032 hom(R407H)ilvA(T381A, F383A)/pDZ-N2747-Pcj7-cycA(Eco) 3.2 0.2 0.2 0.2
상기의 표 4를 참고하면, 코리네박테리움 암모니아게네스 유래의 cycA가 대장균 유래의 cycA 및 야생형보다 알파-아미노부티르산, L-노르발린, L-발린의 생산 수준이 낮은 것을 확인하였다. 또한 이소류신 생산능도 약 12% 증가하는 것을 확인하였다.
이를 통해, 본 출원의 글리신 트랜스포터 활성을 강화함으로써 목적 산물인 L-이소류신 생산능을 증가시킬 수 있음을 확인하였다. 또한, 이소류신 합성 경로에서 부산물로 여겨지는 AABA, L-노르발린, L-발린의 생산량도 적어지는 것을 확인하였는바, 코리네박테리움속 유래의 글리신 트랜스포터 활성을 강화함으로써 이소류신 합성에 미생물을 유용하게 사용할 수 있음을 확인하였다.
실시예 5: 이소류신 NTG 균주에서의 글리신 트랜스포터의 AABA, L-노르발린, L-발린 저감효과 확인
이소류신 생산능을 갖는 변이주에서의 글리신 트랜스포터 강화 효과를 확인하기 위한 추가 실험을 수행하였다.
실시예 3에서 제작된 도입 플라스미드 2종을 이소류신 NTG 균주인 KCCM11248P(대한민국특허 제 10-1335789호) 균주에 전기천공법으로 형질전환하고, 2차 교차과정을 거쳐 염색체 상에서 Ncgl2747 위치가 Pcj7-cycA(Cam) 형태로 치환되어 있는 균주 및 Pcj7-cycA(Eco)주를 얻었으며, 이를 KCCM11248P/cycA(Cam), KCCM11248P/cycA(Eco)으로 명명하였다.
각각의 균주는 L-이소류신 생산 배지 25ml을 함유하는 250ml 코너-바플 플라스크에 위에서 획득한 균주들을 각각 접종한 후, 32℃에서 48시간 동안 200rpm으로 진탕 배양하였다. 배양 종료 후, 액체고속 크로마토그래피(HPLC)를 이용하여 L-이소류신 및 L-노르발린, 알파-아미노부트리산, L-발린의 생산량을 측정하였고, 실험한 각 균주에 대한 배양액 중의 각각의 농도는 하기 표 5에 나타내었다.
균주 L-이소류신 (g/L) AABA(g/L) L-노르발린(g/L) L-발린(g/L)
KCCM11248P 1.5 0.3 0.2 0.4
KCCM11248P/cycA(Cam) 1.6 0.1 0.08 0.3
KCCM11248P/cycA(Eco) 1.5 0.1 0.1 0.4
기존 이소류신 생산 균주에 CycA를 도입함으로써 이소류신 생산능이 더욱 증가할 수 있음을 확인하였다. 또한, CycA 도입으로 부산물 AABA, L-노르발린, L-발린의 생산 수준도 낮아지는 것을 확인하였다.
이를 통해, 코리네박테리움속 유래의 글리신 트랜스포터 활성이 강화된 미생물이 이소류신 합성에 유용하게 사용될 수 있음을 확인하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2021006536-appb-I000001

Claims (10)

  1. 강화된 글리신 트랜스포터 활성을 갖는, L-이소류신을 생산하는 코리네박테리움 속 미생물.
  2. 제1항에 있어서, 상기 글리신 트랜스포터는 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes) 유래인, 미생물.
  3. 제1항에 있어서, 상기 글리신 트랜스포터 단백질은 CycA 단백질인, 미생물.
  4. 제1항에 있어서, 상기 글리신 트랜스포터는 서열번호 15 또는 이와 90% 이상의 서열 상동성을 갖는 아미노산 서열을 포함하는 것인, 미생물.
  5. 제1항에 있어서, 상기 L-이소류신을 생산하는 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)인, 미생물.
  6. 제1항에 있어서, 상기 미생물은 부산물 생성이 감소된 것인, 미생물.
  7. 제6항에 있어서, 상기 부산물은 L-노르발린(L-norvaline), 알파-아미노부티르산(alpha-aminobutyric acid:AABA) 및 L-발린(L-valine) 중에서 선택된 어느 하나 이상의 물질인 것인, 미생물.
  8. 제1항 내지 제7항 중 어느 한 항의 미생물을 포함하는 L-이소류신 생산용 조성물.
  9. 제1항 내지 제7항 중 어느 한 항의 미생물을 배지에서 배양하는 단계를 포함하는, L-이소류신 제조방법.
  10. 제9항에 있어서, 상기 방법은 상기 미생물 또는 배지에서 L-이소류신을 회수하는 단계를 포함하는, L-이소류신 제조방법.
PCT/KR2021/006536 2020-06-29 2021-05-26 L-이소류신 생산능이 강화된 미생물 및 이를 이용한 l-이소류신 생산방법 WO2022005022A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0078983 2020-06-29
KR20200078983 2020-06-29

Publications (1)

Publication Number Publication Date
WO2022005022A1 true WO2022005022A1 (ko) 2022-01-06

Family

ID=79316409

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/006536 WO2022005022A1 (ko) 2020-06-29 2021-05-26 L-이소류신 생산능이 강화된 미생물 및 이를 이용한 l-이소류신 생산방법

Country Status (1)

Country Link
WO (1) WO2022005022A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114606275A (zh) * 2022-02-11 2022-06-10 安徽丰原发酵技术工程研究有限公司 一种发酵生产l-异亮氨酸的方法

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110058731A (ko) * 2009-11-25 2011-06-01 한국과학기술원 Ｌ­이소루신 고생성능을 가지는 변이미생물 및 이의 제조방법
KR20130083690A (ko) * 2012-01-13 2013-07-23 씨제이제일제당 (주) Ｌ-이소루신을 생산하는 미생물 및 이를 이용한 ｌ-이소루신 제조방법
JP2016202182A (ja) * 2015-04-22 2016-12-08 味の素株式会社 ｃｙｃＡ遺伝子を過剰発現した腸内細菌科の細菌を用いたＬ−イソロイシンの製造方法
KR20190065984A (ko) * 2019-04-22 2019-06-12 씨제이제일제당 (주) L-히스티딘 생산능이 강화된 미생물 및 이를 이용한 히스티딘 생산방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110058731A (ko) * 2009-11-25 2011-06-01 한국과학기술원 Ｌ­이소루신 고생성능을 가지는 변이미생물 및 이의 제조방법
KR20130083690A (ko) * 2012-01-13 2013-07-23 씨제이제일제당 (주) Ｌ-이소루신을 생산하는 미생물 및 이를 이용한 ｌ-이소루신 제조방법
JP2016202182A (ja) * 2015-04-22 2016-12-08 味の素株式会社 ｃｙｃＡ遺伝子を過剰発現した腸内細菌科の細菌を用いたＬ−イソロイシンの製造方法
KR20190065984A (ko) * 2019-04-22 2019-06-12 씨제이제일제당 (주) L-히스티딘 생산능이 강화된 미생물 및 이를 이용한 히스티딘 생산방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN 3 June 2019 (2019-06-03), ANONYMOUS: "D-serine/D-alanine/glycine transporter [Corynebacterium stationis]", XP055883946, retrieved from GENBANK Database accession no. WP_079005619 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114606275A (zh) * 2022-02-11 2022-06-10 安徽丰原发酵技术工程研究有限公司 一种发酵生产l-异亮氨酸的方法

Similar Documents

Publication Publication Date Title
WO2020218736A1 (ko) L-히스티딘 생산능이 강화된 미생물 및 이를 이용한 히스티딘 생산방법
WO2020130236A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2019231159A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2022005022A1 (ko) L-이소류신 생산능이 강화된 미생물 및 이를 이용한 l-이소류신 생산방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2020218737A1 (ko) L-쓰레오닌 생산능이 강화된 미생물 및 이를 이용한 쓰레오닌 생산방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022050671A1 (ko) L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2021261733A1 (ko) L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법
WO2021153866A1 (ko) 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법
WO2022154189A1 (ko) 신규한 피토엔 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154188A1 (ko) 신규한 폴리케타이드 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163931A1 (ko) 신규한 nad(p)-의존성 산화환원효소 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163930A1 (ko) 신규한 2-숙시닐-5-엔도피루빌-6-하이드록시-3-사이클로헥센-1-카복실레이트 신타아제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154179A1 (ko) 신규한 d-알라닌--d-알라닌 리가아제 변이체 및 이를 이용한 imp 생산 방법
WO2024096545A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산 방법
WO2022191635A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-아미노산 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21831601

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21831601

Country of ref document: EP

Kind code of ref document: A1