WO2022191635A1 - 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-아미노산 생산 방법 - Google Patents

신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-아미노산 생산 방법 Download PDF

Info

Publication number
WO2022191635A1
WO2022191635A1 PCT/KR2022/003359 KR2022003359W WO2022191635A1 WO 2022191635 A1 WO2022191635 A1 WO 2022191635A1 KR 2022003359 W KR2022003359 W KR 2022003359W WO 2022191635 A1 WO2022191635 A1 WO 2022191635A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
seq
variant
present application
microorganism
Prior art date
Application number
PCT/KR2022/003359
Other languages
English (en)
French (fr)
Inventor
장진숙
김주연
김선혜
최선형
윤병훈
김형준
조승현
이재민
김서윤
이임상
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to EP22767531.1A priority Critical patent/EP4282959A1/en
Priority to JP2023551745A priority patent/JP2024507936A/ja
Priority to BR112023017369A priority patent/BR112023017369A2/pt
Priority to MX2023010437A priority patent/MX2023010437A/es
Priority to CN202280020564.4A priority patent/CN117500920A/zh
Priority to CA3210256A priority patent/CA3210256A1/en
Priority to US18/549,838 priority patent/US20240182872A1/en
Publication of WO2022191635A1 publication Critical patent/WO2022191635A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/12—Methionine; Cysteine; Cystine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/03—Acyl groups converted into alkyl on transfer (2.3.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/03—Acyl groups converted into alkyl on transfer (2.3.3)
    • C12Y203/03001—Citrate (Si)-synthase (2.3.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • the present application relates to a novel citrate synthase variant, a microorganism comprising the variant, and a method for producing L-amino acids using the microorganism.
  • citrate synthase is an enzyme that produces citrate by polymerizing acetyl-CoA and oxaloacetate produced in the glycolysis process of microorganisms, and is also an important enzyme that determines carbon influx into the TCA pathway. to be.
  • the present inventors completed the present application by confirming that a novel citrate synthase mutant increases L-amino acid production ability as a result of earnest efforts to produce L-amino acids in high yield.
  • One object of the present application is to provide a citrate synthase variant in which lysine, an amino acid corresponding to position 415 of the amino acid sequence of SEQ ID NO: 1, is substituted with histidine.
  • Another object of the present application is to provide a polynucleotide encoding the variant of the present application.
  • Another object of the present application is to provide a microorganism of the genus Corynebacterium, which includes a mutant of the present application or a polynucleotide encoding the mutant.
  • Another object of the present application is to provide a method for producing L-amino acids using the microorganism of the present application.
  • Another object of the present application is the microorganism of the present application; Medium in which the microorganism of the present application is cultured; Or to provide a composition for the production of L- amino acids comprising a combination thereof.
  • citrate synthase variant of the present application When the citrate synthase variant of the present application is used, it is possible to produce L-amino acids in high yield.
  • One aspect of the present application is to provide a citrate synthase variant in which lysine, an amino acid corresponding to position 415 of the amino acid sequence of SEQ ID NO: 1, is substituted with histidine.
  • the amino acid corresponding to position 415 based on the amino acid sequence of SEQ ID NO: 1 in the amino acid sequence set forth in SEQ ID NO: 1 is histidine, and at least 70% of the amino acid sequence described in SEQ ID NO: 1, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or a variant having at least 99.9% homology or identity.
  • the amino acid corresponding to position 415 based on the amino acid sequence of SEQ ID NO: 1 is histidine, and at least 70%, 75 with the amino acid sequence set forth in SEQ ID NO: 1 %, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or more homology or identity with an amino acid sequence having or comprising , or may consist of or consist essentially of the above amino acid sequence.
  • variants having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added are also included within the scope of the present application. is self-evident
  • sequence additions or deletions naturally occurring mutations, silent mutations or conservation within the N-terminus, C-terminus and/or within the amino acid sequence that do not alter the function of the variants of the present application It is a case of having an enemy substitution.
  • conservative substitution means substituting an amino acid for another amino acid having similar structural and/or chemical properties. Such amino acid substitutions may generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.
  • variant means that one or more amino acids are conservatively substituted and/or modified so that they differ from the amino acid sequence before the mutation of the variant, but have functions or properties. refers to a polypeptide that is maintained. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. In addition, some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, have been removed.
  • variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein.
  • variant may be used interchangeably with terms such as mutant, modified, mutant polypeptide, mutated protein, mutant and mutant (in English, modified, modified polypeptide, modified protein, mutant, mutein, divergent, etc.) and, as long as it is a term used in a mutated sense, it is not limited thereto.
  • the variant may be a variant in which lysine (Lysine, Lys, K), which is an amino acid corresponding to the 415th position of the amino acid sequence of SEQ ID NO: 1, is substituted with histidine (Histidine, His, H).
  • variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide.
  • a signal (or leader) sequence involved in protein translocation may be conjugated to the N-terminus of the mutant, either co-translationally or post-translationally.
  • the variants may also be conjugated with other sequences or linkers for identification, purification, or synthesis.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of a sequence under moderate or high stringent conditions. It is apparent that hybridization also includes hybridization with polynucleotides containing common codons or codons taking codon degeneracy into account in the polynucleotide.
  • a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap open penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • corresponding to refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue similar to, identical to, or homologous to a residue listed in a polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that refers to a specific sequence.
  • corresponding region generally refers to a similar or corresponding position in a related protein or reference protein.
  • any amino acid sequence is aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1.
  • a sequence alignment algorithm such as that described in this application can identify the position of an amino acid, or a position at which modifications, such as substitutions, insertions, or deletions, occur compared to a query sequence (also referred to as a "reference sequence").
  • Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277), etc., but is not limited thereto, and a sequence alignment program known in the art, a pairwise sequence comparison algorithm, etc. may be appropriately used.
  • citrate synthase is an enzyme that generates citrate by polymerizing acetyl-CoA and oxaloacetate produced in the glycolysis of microorganisms.
  • the enzyme is capable of catalyzing the condensation reaction of acetyl coei with a 2-carbon acetate moiety from a molecule of 4-carbon oxaloacetate to form 6-carbon oxaloacetate.
  • citrate synthase may be used interchangeably with citrate synthase, CS, GltA protein, or GltA.
  • the GltA sequence can be obtained from GenBank of NCBI, which is a known database.
  • the GltA may be a polypeptide having citrate synthase activity encoded by the gltA gene, but is not limited thereto.
  • the mutant of the present application may have an activity to increase the ability to produce L-amino acids compared to the wild-type polypeptide.
  • the variant of the present application may have 80% or more sequence identity with the amino acid sequence of SEQ ID NO: 1.
  • the variant of the present application may include a polypeptide described in the amino acid sequence of SEQ ID NO: 3.
  • the amino acid sequence of SEQ ID NO: 3 may be an amino acid sequence in which lysine corresponding to position 415 in the amino acid sequence from positions 362 to 415 from the N-terminus of the amino acid sequence set forth in SEQ ID NO: 1 is substituted with histidine.
  • the variant of the present application may include an amino acid sequence of the following general formula 1:
  • X 1 of Formula 1 is asparagine or serine
  • X 2 is alanine or glutamic acid
  • X 3 is tyrosine or cysteine.
  • the variant of the present application may have at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 8, 10 or 12.
  • the variant of the present application may include, consist of, or consist essentially of an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 8, 10 or 12.
  • the variant of the present application has the amino acid sequence of SEQ ID NO: 8, 10 or 12 and 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5 %, or 99.7% or more, or comprises an amino acid sequence having the sequence identity, or may consist of or consist essentially of an amino acid sequence having the sequence identity.
  • Another aspect of the present application is to provide a polynucleotide encoding the variant of the present application.
  • polynucleotide refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are linked in a long chain by covalent bonds, and more specifically, encoding the variant. polynucleotide fragments.
  • the base corresponding to positions 1243 to 1245 based on the nucleotide sequence of SEQ ID NO: 2 is CAC, and at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or a polynucleotide described with a nucleotide sequence having at least 99.9%, less than 100% homology or identity may include
  • a sequence encoding a polypeptide or protein having such homology or identity and exhibiting efficacy corresponding to the variant of the present application is a polynucleotide described as a nucleotide sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added It is obvious that also included within the scope of the present application.
  • the polynucleotides of the present application are various in the coding region within the range that does not change the amino acid sequence of the variants of the present application. Deformation can be made.
  • the codon encoding the amino acid corresponding to the 415th position of SEQ ID NO: 1 may be one of the codons encoding histidine.
  • polynucleotide of the present application may be included without limitation as long as it can hybridize under stringent conditions with a probe that can be prepared from a known gene sequence, for example, a sequence complementary to all or part of the polynucleotide sequence of the present application.
  • stringent condition means a condition that enables specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • polynucleotides with high homology or identity 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or a condition in which polynucleotides having 99% or more homology or identity hybridize with each other and polynucleotides with lower homology or identity do not hybridize, or a washing condition of conventional Southern hybridization at 60°C, 1XSSC, 0.1% SDS, specifically 60°C, 0.1XSSC, 0.1% SDS, more specifically 68°C, 0.1XSSC, 0.1% SDS at a salt concentration and temperature equivalent to one wash, specifically two to three washes conditions can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other.
  • adenine is complementary to thymine
  • cytosine is complementary to guanine.
  • the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary to the overall sequence as well as substantially similar nucleotide sequences.
  • a polynucleotide having homology or identity to the polynucleotide of the present application can be detected using the hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60° C., 63° C. or 65° C., but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • the appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (eg, J. Sambrook et al., supra).
  • the polynucleotide of the present application is a polynucleotide described with the nucleotide sequence at positions 1084 to 1245 based on the nucleotide sequence of SEQ ID NO: 9, 11 or 13, or a nucleic acid of SEQ ID NO: 9, 11, 13 or 15 It may include a polynucleotide described as a nucleotide sequence.
  • the variant is as described in the other aspects above.
  • Another aspect of the present application is to provide a vector comprising the polynucleotide of the present application.
  • the vector may be an expression vector for expressing the polynucleotide in a host cell, but is not limited thereto.
  • the vector of the present application may include a DNA preparation comprising a nucleotide sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable expression control region (or expression control sequence) so that the target polypeptide can be expressed in a suitable host.
  • the expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the vector After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors may be used.
  • pBluescript II-based pGEM-based, pTZ-based, pCL-based, pET-based and the like
  • pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117 Biotechnology letters vol 13, No. 10, p. 721-726 (1991), Republic of Korea Patent No. 10-1992-0007401
  • pUC19, pBR322, pMW118, pCC1BAC vector, etc. can be used.
  • a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion.
  • the insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted.
  • the selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. Markers to be given can be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
  • the term "transformation” refers to introducing a vector including a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell.
  • the polynucleotide includes DNA and/or RNA encoding a target polypeptide.
  • the polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the target variant of the present application and the polynucleotide sequence are functionally linked.
  • variants and polynucleotides are as described in the other aspects above.
  • Another aspect of the present application is to provide a microorganism comprising the mutant or polynucleotide of the present application, Corynebacterium genus (The genus of Corynebacterium ).
  • the microorganism of the present application may include a mutant of the present application, a polynucleotide encoding the mutant, or a vector including the polynucleotide of the present application.
  • microorganism or strain
  • microorganism includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially, and causes such as insertion of an external gene or enhanced or inactivated activity of an intrinsic gene
  • a specific mechanism is weakened or enhanced as a microorganism, and may be a microorganism including genetic modification for the production of a desired polypeptide, protein or product.
  • the microorganism of the present application includes a microorganism comprising any one or more of a mutant of the present application, a polynucleotide of the present application, and a vector including the polynucleotide of the present application; a microorganism modified to express a variant of the present application or a polynucleotide of the present application; a microorganism (eg, a recombinant strain) expressing a variant of the present application or a polynucleotide of the present application; Or it may be a microorganism (eg, a recombinant strain) having the mutant activity of the present application, but is not limited thereto.
  • the microorganism of the present application may be a strain having the ability to produce L- amino acids.
  • the L-amino acid production ability in the microorganism of the present application may be L-valine or O-acetyl-L-homoserine production ability.
  • the microorganism of the present application is a microorganism naturally having GltA or L-amino acid production ability, or a mutant of the present application or a polynucleotide encoding the same in a microorganism having no GltA or L-amino acid production ability (or a vector containing the polynucleotide) ) may be introduced and/or may be a microorganism to which GltA or L-amino acid production ability is imparted, but is not limited thereto.
  • the microorganism of the present application is a cell or microorganism that is transformed with a vector containing the polynucleotide of the present application or the polynucleotide of the present application, and expresses the variant of the present application, and for the purpose of the present application, the microorganism of the present application is It may include all microorganisms capable of producing L-amino acids, including the variants of the present application.
  • the strain of the present application may be a recombinant strain having an increased ability to produce L-amino acids by introducing a polynucleotide encoding a variant of the present application into a natural wild-type microorganism or a microorganism producing L-amino acids.
  • the recombinant strain with increased L-amino acid production ability is a natural wild-type microorganism or a citrate synthase unmodified microorganism (that is, a microorganism expressing a wild-type (SEQ ID NO: 1) protein or a microorganism that does not express the mutant of the present application) Compared to that, it may be a microorganism having an increased ability to produce L-amino acids, but is not limited thereto.
  • the citrate synthase unmodified microorganism which is the target strain for comparing the increase in L-amino acid production ability, is ATCC14067 strain, ATCC13032 strain, ATCC13869 strain, Corynebacterium glutamicum CJ7V strain, Corynebacterium It may be a glutamicum CJ8V strain or a CA08-0072 strain, but is not limited thereto.
  • the recombinant strain with increased production capacity has an L-amino acid production capacity of about 1% or more, 5% or more, 7% or more, about 10% or more, about 20% or more, compared to the parent strain or unmodified microorganism before mutation, or about 30% or more (the upper limit is not particularly limited, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, about 40% or less, or about 30% or less. Yes) may be increased, but it is not limited thereto as long as it has an increased amount of + value compared to the production capacity of the parent strain or unmodified microorganism before mutation.
  • the recombinant strain with increased production capacity has an L-valine production capacity of about 1.01 times or more, about 1.05 times or more, about 1.07 times or more, about 1.1 times or more, about 1.2 times or more, compared to the parent strain or unmodified microorganism before mutation. It may be increased by at least twice or at least about 1.3 times (the upper limit is not particularly limited, and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less).
  • the term "unmodified microorganism” does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a wild-type strain or a natural-type strain itself, or a genetic variation caused by natural or artificial factors. It may mean the strain before being changed.
  • the unmodified microorganism may refer to a strain in which the protein variant described herein has not been introduced or has been introduced.
  • the "unmodified microorganism” may be used interchangeably with "strain before modification", “microbe before modification”, “unmodified strain”, “unmodified strain”, “unmodified microorganism” or "reference microorganism”.
  • the microorganism of the present application is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Cory Nebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium callunae ), Corynebacterium stationis , Corynebacterium stationis ), Corynebacterium singulare ( Corynebacterium singulare ), Corynebacterium halo Tolerans ( Corynebacterium halotolerans ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Corynebacterium pollutisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans imitans imitans imitans imit
  • the microorganism of the present application may be a microorganism in which the NCgl2335 protein is further weakened.
  • the microorganism of the present application is acetolactate synthase isozyme 1 small subunit (IlvN), L-methionine / branched-chain amino acid exporter (L-methionine / branched-chain amino acid exporter, YjeH)
  • the activity of a protein selected from the group consisting of may be an additionally enhanced microorganism.
  • the L-valine-producing microorganism of the present application may be a microorganism that additionally enhances IlvN activity and/or weakens NCgl2335.
  • the microorganism producing O-acetyl-L-homoserine of the present application may be a microorganism with enhanced YjeH (L-methionine/branched-chain amino acid exporter) activity.
  • the term “attenuation” of polypeptide activity is a concept that includes both reduced or no activity compared to intrinsic activity.
  • the attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, attenuation, and the like.
  • the attenuation is when the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism due to mutation of the polynucleotide encoding the polypeptide, etc.
  • the overall polypeptide activity level and/or concentration (expression amount) in the cell is lower than that of the native strain due to (translation) inhibition, etc., when the expression of the polynucleotide is not made at all, and/or when the expression of the polynucleotide is Even if there is no activity of the polypeptide, it may also be included.
  • the "intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification”. "Inactivation, deficiency, reduction, downregulation, reduction, attenuation” of the activity of the polypeptide compared to the intrinsic activity means that the activity of the specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation is lowered.
  • Attenuation of the activity of such a polypeptide may be performed by any method known in the art, but is not limited thereto, and may be achieved by application of various methods well known in the art (eg, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
  • the attenuation of the polypeptide activity of the present application is
  • an antisense oligonucleotide eg, antisense RNA
  • an antisense oligonucleotide that complementarily binds to the transcript of said gene encoding the polypeptide
  • deletion of a part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide in which some nucleotides are deleted, or replacement with a marker gene.
  • the expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the modification of the amino acid sequence or polynucleotide sequence of 3) and 4) above may result in deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, or these It may be an amino acid sequence or polynucleotide sequence improved to have a weaker activity or replacement with an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto.
  • the expression of a gene may be inhibited or attenuated, but is not limited thereto.
  • the base sequence modification encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a base encoding another start codon having a lower expression rate of the polypeptide compared to the intrinsic start codon It may be substituted with a sequence, but is not limited thereto.
  • antisense oligonucleotide eg, antisense RNA
  • antisense RNA an antisense oligonucleotide that complementarily binds to the transcript of the gene encoding the polypeptide
  • Weintraub, H. et al. Antisense-RNA as a molecular tool. for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
  • a promoter transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) is complementary to the transcript of the gene encoding the polypeptide It may be to weaken the activity by creating a hostile antisense nucleotide.
  • the term "enhancement" of a polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity.
  • the reinforcement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.
  • activation, enhancement, up-regulation, overexpression, and increase may include all of those exhibiting an activity that was not originally possessed, or exhibiting an improved activity compared to an intrinsic activity or an activity prior to modification.
  • the "intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before the transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification”.
  • Enhancement means the activity and/or concentration (expression) of a specific polypeptide originally possessed by the parent strain or unmodified microorganism prior to transformation. amount), which means improved.
  • the enrichment can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and/or concentration (expression amount) of the endogenous polypeptide. Whether or not the activity of the polypeptide is enhanced can be confirmed from the increase in the level of activity, expression level, or the amount of product excreted from the polypeptide.
  • the enhancement of the activity of the polypeptide can be applied by various methods well known in the art, and is not limited as long as it can enhance the activity of the target polypeptide compared to the microorganism before modification. Specifically, it may be one using genetic engineering and/or protein engineering well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (eg, Sitnicka et al. Functional Analysis of Genes. Advances in Cell). Biology 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • modification of the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide eg, modification of the polynucleotide sequence of the polypeptide gene to encode a polypeptide that has been modified to enhance the activity of the polypeptide;
  • the increase in the intracellular copy number of the polynucleotide encoding the polypeptide is achieved by introduction of a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked, into a host cell.
  • the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into a chromosome in a host cell.
  • the introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome in the host cell into the host cell, but is not limited thereto.
  • the vector is the same as described above.
  • Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence with strong activity is, for example, deletion, insertion, non-conservative or Conservative substitution or a combination thereof may result in a mutation in the sequence, or replacement with a sequence having a stronger activity.
  • the expression control region is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling the termination of transcription and translation.
  • the original promoter may be replaced with a strong promoter, but is not limited thereto.
  • Examples of known strong promoters include CJ1 to CJ7 promoters (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, etc., but is not limited thereto.
  • Modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a nucleotide sequence encoding another start codon having a higher expression rate of the polypeptide compared to the intrinsic start codon. It may be a substitution, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may include deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide;
  • a combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto.
  • the replacement may be specifically performed by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
  • the vector used may further include a selection marker for confirming whether or not the chromosome is inserted.
  • the selection marker is the same as described above.
  • the introduction of the foreign polynucleotide exhibiting the activity of the polypeptide may be the introduction of the foreign polynucleotide encoding the polypeptide exhibiting the same/similar activity as the polypeptide into a host cell.
  • the foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same/similar activity as the polypeptide.
  • the method used for the introduction can be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to generate a polypeptide and increase its activity.
  • Codon optimization of the polynucleotide encoding the polypeptide is codon-optimized so that the transcription or translation of the endogenous polynucleotide is increased in the host cell, or the transcription and translation of the foreign polynucleotide is optimized in the host cell. It may be that its codons are optimized so that the
  • the tertiary structure of the polypeptide is analyzed and the exposed site is selected and modified or chemically modified, for example, by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored. It may be to determine a template protein candidate according to the degree, check the structure based on this, and select an exposed site to be modified or chemically modified and modified or modified.
  • Such enhancement of polypeptide activity is to increase the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or pre-modified microbial strain, or increase the amount of product produced from the polypeptide.
  • the present invention is not limited thereto.
  • Modification of some or all of the polynucleotide in the microorganism of the present application is (a) homologous recombination using a vector for chromosome insertion in the microorganism or engineered nuclease (e.g., CRISPR) -Cas9) and/or (b) induced by light and/or chemical treatment such as ultraviolet and radiation, but not limited thereto.
  • the method of modifying part or all of the gene may include a method by DNA recombination technology.
  • a part or all of the gene may be deleted.
  • the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
  • the microorganism producing L-valine of the present application may be a microorganism comprising the polypeptide described in the amino acid sequence of SEQ ID NO: 27 and/or the polynucleotide described in the nucleic acid sequence of SEQ ID NO: 28.
  • the microorganism producing O-acetyl-L-homoserine of the present application includes the polypeptide described in the amino acid sequence of SEQ ID NO: 47 and/or the polynucleotide described in the nucleic acid sequence of SEQ ID NO: 48; It may be a microorganism comprising a mutation selected from the group consisting of polypeptide inactivation described in the amino acid sequence of SEQ ID NO: 37 and/or polynucleotide deletion described in the nucleotide sequence of SEQ ID NO: 38.
  • Another aspect of the present application provides a method for producing L-amino acids, comprising culturing a microorganism of the genus Corynebacterium comprising the mutant or polynucleotide of the present application in a medium.
  • the L-amino acid production method of the present application may include culturing a Corynebacterium glutamicum strain comprising the mutant of the present application or the polynucleotide of the present application or the vector of the present application in a medium.
  • the L-amino acid may be L-valine, O-acetyl-L-homoserine or L-methionine.
  • the term "cultivation” means growing the microorganisms of the genus Corynebacterium of the present application in appropriately controlled environmental conditions.
  • the culture process of the present application may be performed according to a suitable medium and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art according to the selected strain.
  • the culture may be a batch, continuous and/or fed-batch, but is not limited thereto.
  • the term "medium” refers to a material in which nutrients required for culturing the microorganism of the genus Corynebacterium of the present application are mixed as a main component, and includes water essential for survival and development, as well as nutrients and development supplies, etc.
  • any medium and other culture conditions used for culturing the microorganisms of the genus Corynebacterium of the present application may be used without particular limitation as long as they are media used for culturing conventional microorganisms, but the genus Corynebacterium of the present application
  • the microorganisms can be cultured in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid and/or vitamin, etc. under aerobic conditions while controlling temperature, pH, and the like.
  • the culture medium for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology” by the American Society for Bacteriology (Washington D.C., USA, 1981)].
  • the carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, and the like; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine
  • organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract
  • the phosphorus may include potassium monobasic phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto.
  • potassium monobasic phosphate dipotassium phosphate
  • sodium-containing salt corresponding thereto.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, the present invention is not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium.
  • an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without or without gas to maintain anaerobic and microaerobic conditions, it is not
  • the culture temperature may be maintained at 20 to 45° C., specifically, 25 to 40° C., and may be cultured for about 10 to 160 hours, but is not limited thereto.
  • the L-amino acid produced by the culture of the present application may be secreted into the medium or may remain in the cell.
  • the L-amino acid production method of the present application includes the steps of preparing the microorganism of the genus Corynebacterium of the present application, preparing a medium for culturing the microorganism, or a combination thereof (regardless of the order, in any order) , for example, prior to the culturing step, may be further included.
  • the method for producing L-amino acids of the present application may further include recovering L-amino acids from the culture medium (cultured medium) or the microorganism of the genus Corynebacterium of the present application.
  • the recovering step may be further included after the culturing step.
  • the recovery may be to collect the desired L-amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method, etc. .
  • a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method, etc. .
  • chromatography such as island chromatography, HPLC, or a combination thereof may be used, and a desired L-amino acid may be recovered from a medium or a microorganism using a suitable method known in the art.
  • the L-amino acid production method of the present application may include an additional purification step.
  • the purification may be performed using a suitable method known in the art.
  • the recovery step and the purification step are performed continuously or discontinuously, regardless of the order, or integrated into one step may be performed, but is not limited thereto.
  • the L-methionine production method of the present application may further include the step of converting the O-acetyl-L-homoserine to L-methionine.
  • the converting step may be further included after the culturing step or the recovering step.
  • the converting step can be carried out using a suitable method known in the art (US 8426171 B2).
  • the L-methionine production method of the present application is O-acetyl-L-homoserine, methyl mercaptan and O-acetyl homoserine sulfhydrylase (Oacetylhomoserine sulfhydrylase) or cystathionine- ⁇ -synthase (cystathionine) gamma-synthase) or O-succinyl homoserine sulfhydrylase (O-succinyl homoserine sulfhydrylase) to contact to produce L-methionine.
  • Oacetylhomoserine sulfhydrylase Oacetylhomoserine sulfhydrylase
  • cystathionine- ⁇ -synthase cystathionine- ⁇ -synthase
  • O-succinyl homoserine sulfhydrylase O-succiny
  • Another aspect of the present application is a microorganism of the genus Corynebacterium comprising a vector comprising a mutant of the present application, a polynucleotide encoding the mutant of the present application, or a polynucleotide of the present application; the culture medium; Or to provide a composition for the production of L- amino acids comprising a combination thereof.
  • composition of the present application may further include any suitable excipients commonly used in compositions for the production of amino acids, and these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc.
  • excipients commonly used in compositions for the production of amino acids
  • these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc.
  • the present invention is not limited thereto.
  • the L-amino acid may be L-valine, O-acetyl-L-homoserine, or L-methionine.
  • composition of the present application variants, polynucleotides, vectors, strains and media are the same as those described in the other aspects above.
  • the present inventors have discovered that the 415th amino acid residue of GltA is an acetyl-coA (acetyl-coA) binding site, and when it is substituted with another amino acid, the Km value of acetyl-coA increases and citrate synthase activity is predicted to be weakened.
  • a vector was constructed in which lysine, which is the 415th amino acid of GltA, was substituted with another amino acid.
  • a vector containing mutations was constructed to replace lysine, the 415th amino acid, with histidine (K415H), tryptophan (K415W) and glycine (K415G).
  • the primer pair of SEQ ID NOs: 15 and 17 and the primer pair of SEQ ID NOs: 16 and 18, the primer pair of SEQ ID NOs: 15 and 20 and SEQ ID NO: 18 and PCR was performed for the primer pair of 19, using the primer pair of SEQ ID NOs: 15 and 22 and the primer pair of SEQ ID NOs: 18 and 21, respectively.
  • Overlapping PCR was performed again using the primer pair of SEQ ID NO: 15 and SEQ ID NO: 18 using the mixture of two fragments among the six fragments obtained above as a template to obtain three fragments, respectively.
  • PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • pDCM2 vector SEQ ID NO: 14, Republic of Korea Publication No. 10-2020-0136813
  • smaI the three PCR products obtained above were each fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech).
  • the plasmids obtained as a result of cloning were named pDCM2-gltA (K415H), pDCM2-gltA (K415W), and pDCM2-gltA (K415G), respectively.
  • the sequences of the primers used in this Example are shown in Table 1 below.
  • PCR was performed using the primer pair of SEQ ID NOs: 29 and 31 and the primer pair of SEQ ID NOs: 30 and 32 using gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC14067 as a template, respectively.
  • gDNA genomic DNA
  • overlapping PCR was performed again to obtain three fragments, respectively.
  • PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 vector was treated with smaI, and the three PCR products obtained above were each fusion cloned.
  • the plasmids obtained as a result of cloning were named pDCM2-ilvN (A42V), respectively.
  • the pDCM2-ilvN (A42V) was transformed into wild-type Corynebacterium glutamicum ATCC14067 and ATCC13869 strains, respectively, to induce homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545). , 1999).
  • the strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was selected in a medium containing 25 mg/L of kanamycin. After amplifying the gene fragment through PCR using the primer pair of SEQ ID NOs: 33 and 34 for the selected Corynebacterium glutamicum transformant, it was confirmed that the mutation was properly introduced through gene sequence analysis.
  • the recombinant strains were named Corynebacterium glutamicum CJ7V and CJ8V, respectively.
  • the sequences of the primers used in this Example are shown in Table 2 below.
  • Glucose 10g broth 5g, polypeptone 10g, sodium chloride 2.5g, yeast extract 5g, agar 20g, urea 2g (based on 1 liter of distilled water)
  • the L-valine-producing ability was evaluated by introducing a GltA mutant into the L-valine-producing strain.
  • the pDCM2-gltA (K415H), pDCM2-gltA (K415W), and pDCM2-gltA (K415G) vectors constructed in Example 1 were subjected to chromosomal homologous recombination with L-valine-producing strains CJ7V, CJ8V and CA08-0072 (KCCM11201P). , US 8465962 B2), respectively.
  • the strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was selected in a medium containing 25 mg/L of kanamycin.
  • the gene fragment was amplified through PCR using the primer pair of SEQ ID NOs: 23 and 24 (Table 4) for the Corynebacterium glutamicum transformant, and then mutated through gene sequence analysis Insertion strains were identified.
  • the recombinant strain was named as follows, Corynebacterium glutamicum, and titer was evaluated in the same manner as in Example 2-1, and is shown in Table 5 below.
  • CA08-0072:gltA(K415H) was named CA08-1688, and it was deposited with the Korea Microorganism Conservation Center, an institution under the Budapest Treaty, on September 28, 2020, and was given an accession number KCCM12795P.
  • Example 3 O-acetyl-L- homoserine production enhancement strain production and O-acetyl-L- homoserine production capacity evaluation
  • the gene (SEQ ID NO: 48) encoding the YjeH variant (SEQ ID NO: 47) was A chromosomal introduction vector containing
  • a primer pair for amplifying the 5' upper region centering on the position of the gene encoding the transposase (SEQ ID NO: 38, gene number NCgl2335) and 40) and primer pairs (SEQ ID NOs: 41 and 42) for amplifying the 3' bottom region were designed.
  • the primer pair of SEQ ID NOs: 39 and 42 inserted XbaI restriction enzyme sites at each end, and the primer pairs of SEQ ID NOs: 40 and 41 were designed to cross each other, and the restriction enzyme SmaI sequence was positioned at this site.
  • the primer sequences are shown in Table 6 below.
  • PCR was performed using the primer pair of SEQ ID NOs: 39 and 40 and the primer pair of SEQ ID NOs: 41 and 42 using the ATCC13032 wild-type (WT) chromosome as a template. PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization for 30 seconds at 72°C, followed by polymerization at 72°C for 7 minutes. As a result, an 851 bp DNA fragment at the 5' upper end and an 847 bp DNA fragment at the 3' lower end were obtained centering on the deletion site of the NCgl2335 gene.
  • PCR was performed using primer pairs of SEQ ID NOs: 39 and 42. PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization for 90 seconds at 72°C, followed by polymerization at 72°C for 7 minutes.
  • a 1648 bp DNA fragment containing a region capable of deletion of a gene (SEQ ID NO: 38, gene number NCgl2335) encoding a transposase was amplified.
  • the obtained PCR product was fusion cloned using the SmaI restriction enzyme-treated pDCM2 vector and the Infusion HD cloning kit.
  • the cloned vector was transformed into E. coli DH5 ⁇ , and the transformed E. coli was plated on LB solid medium containing 25 mg/L of kanamycin. After selecting colonies transformed with the plasmid into which the desired gene was inserted through PCR, the plasmid was obtained using the plasmid extraction method, and finally, a pDCM2- ⁇ NCgl2335 recombinant vector in which the NCgl2335 deletion cassette was cloned was prepared.
  • a chromosome introduction vector including a gene (SEQ ID NO: 48) encoding a YjeH mutant derived from E. coli was constructed.
  • a vector expressing the yjeH gene was prepared using the CJ7 promoter (US 7662943 B2).
  • a pair of primers (SEQ ID NOs: 43 and 44) for amplifying the CJ7 promoter region and a pair of primers (SEQ ID NOs: 45 and 46) for amplifying the yjeH region of E. coli were designed. Primer sequences are shown in Table 7 below.
  • PCR was performed using the primer pairs of SEQ ID NOs: 45 and 46, respectively carried out. PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization for 90 seconds at 72°C, followed by polymerization at 72°C for 7 minutes. As a result, a 360 bp DNA fragment of the CJ7 promoter region and a 1297 bp DNA fragment of the yjeH gene region of E. coli were obtained.
  • PCR was performed with SEQ ID NO: 43 and SEQ ID NO: 46 primers. PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization for 90 seconds at 72°C, followed by polymerization at 72°C for 7 minutes. As a result, a 1614 bp DNA fragment including the CJ7 promoter and the site into which the yjeH gene was introduced was amplified.
  • the gene-deleted DNA fragment obtained through PCR was cloned into pDCM2- ⁇ NCgl2335 vector treated with restriction enzyme SmaI using Infusion HD cloning kit, and pDCM2- ⁇ NCgl2335::PCJ7-yjeH(eco,WT) recombinant vector was prepared. .
  • pDCM2- ⁇ NCgl2335::PCJ7-yjeH(eco,WT) plasmid as a template and using the primers of SEQ ID NO: 49 and SEQ ID NO: 50, phenylalanine, the 351th amino acid of the YjeH amino acid sequence, was substituted with leucine ( F351L).
  • the plasmid containing the gene encoding the constructed mutant YjeH (F351L) was named pDCM2- ⁇ NCgl2335::PCJ7-yjeH(eco,F351L).
  • the primer sequences are shown in Table 8 below.
  • the prepared pDCM2- ⁇ NCgl2335, pDCM2- ⁇ NCgl2335::PCJ7-yjeH(eco,F351L) strains were transformed into ATCC13032 strain by electric pulse method, and through a secondary crossover process, ATCC13032 ⁇ NCgl2335 in which the NCgl2335 gene was deleted on the chromosome; ATCC13032 ⁇ NCgl2335::PCJ7-yjeH (eco,F351L) was obtained. Whether the gene encoding the NCgl2335 gene deletion and the YjeH variant was inserted was finally confirmed by comparison with ATCC13032 after PCR using the primer pair of SEQ ID NOs: 39 and 42.
  • O-acetyl homoserine O-AH; O-Acetyl Homoserine
  • O-acetyl homoserine was analyzed in the culture medium by culturing in the following manner.
  • the GltA mutant was introduced into the O-acetyl-L-homoserine-producing strain of Example 3-2 to evaluate the ability to produce O-acetyl-L-homoserine.
  • the pDCM2-gltA (K415H) vector constructed in Example 1 was subjected to chromosomal homologous recombination with wild-type strains ATCC13032, ATCC13032 ⁇ NCgl2335 and O-acetyl-L-homoserine-producing strain ATCC13032 ⁇ NCgl2335::PCJ7-yjeH ( eco, F351L) respectively.
  • the strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was selected in a medium containing 25 mg/L of kanamycin.
  • gltA K415H mutation through gene sequence analysis Insertion strains were identified.
  • the recombinant strain was named as follows, Corynebacterium glutamicum, and titer was evaluated in the same manner as in Example 3-2, and is shown in Table 10 below.
  • the ATCC13032 ⁇ NCgl2335::PCJ7-yjeH(eco,F351L) gltA(K415H) was named CM04-1006, and was deposited with the Korea Microorganism Conservation Center, a trustee institution under the Budapest Treaty on October 21, 2020, and given an accession number KCCM12809P. received.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 출원은 신규한 시트레이트 신타아제(Citrate synthase) 변이체, 상기 변이체를 포함하는 미생물 및 상기 미생물을 이용한 L-아미노산 생산 방법에 관한 것이다.

Description

신규한 시트레이트 신타아제 변이체 및 이를 이용한 L-아미노산 생산 방법
본 출원은 신규한 시트레이트 신타아제(Citrate synthase) 변이체, 상기 변이체를 포함하는 미생물 및 상기 미생물을 이용한 L-아미노산 생산 방법에 관한 것이다.
L-아미노산 및 기타 유용물질을 생산하기 위하여, 고효율 생산 미생물 및 발효공정기술 개발을 위한 다양한 연구들이 수행되고 있다. 예를 들어, L-발린 생합성에 관여하는 효소를 코딩하는 유전자의 발현을 증가시키거나 또는 생합성에 불필요한 유전자를 제거하는 것과 같은 목적 물질 특이적 접근 방법이 주로 이용되고 있다(US 8465962 B2, KR 10-2153534 B1).
한편, 시트레이트 신타아제(Citrate synthase; CS)는 미생물의 해당과정에서 생성되는 아세틸 코에이와 옥살로아세테이트를 중합하여 시트레이트를 생성하는 효소이며, 또한 TCA 경로로의 탄소유입을 결정하는 중요한 효소이다.
시트레이트 신타아제를 코딩하는 gltA 유전자 결손에 따른 L-리신 생산 균주의 phenotype 변화에 관한 내용은 선행문헌에 보고되어 있다 (Ooyen et al., Biotechnol. Bioeng., 109(8):2070-2081, 2012). 그러나 gltA 유전자 결손 균주의 경우 균주의 생장이 저해될 뿐만 아니라, 당 소모속도가 대폭 감소되어 단위시간당 리신 생산량이 낮은 단점이 있다. 따라서, 효과적인 L-아미노산의 생산능 증가 및 균주의 생장을 함께 고려한 연구가 여전히 필요한 실정이다.
본 발명자들은 L-아미노산을 고수율로 생산하기 위해 예의 노력한 결과, 신규한 시트레이트 신타아제 변이체가 L-아미노산 생산능을 증가시킴을 확인함으로써 본 출원을 완성하였다.
본 출원의 하나의 목적은 서열번호 1의 아미노산 서열의 415번째 위치에 상응하는 아미노산인 리신이 히스티딘으로 치환된, 시트레이트 신타아제 변이체를 제공하는 것이다.
본 출원의 다른 하나의 목적은 본 출원의 변이체를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 출원의 다른 하나의 목적은 본 출원의 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하는, 코리네박테리움 속 미생물을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 본 출원의 미생물을 이용하여 L-아미노산을 생산하는 방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 본 출원의 미생물; 본 출원의 미생물을 배양한 배지; 또는 이들의 조합을 포함하는 L-아미노산 생산용 조성물을 제공하는 것이다.
본 출원의 시트레이트 신타아제 변이체를 이용하는 경우, 고수율의 L-아미노산 생산이 가능하다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 출원의 하나의 양태는 서열번호 1의 아미노산 서열의 415번째 위치에 상응하는 아미노산인 리신이 히스티딘으로 치환된, 시트레이트 신타아제 변이체를 제공하는 것이다.
본 출원의 변이체는 상기 서열번호 1로 기재된 아미노산 서열에서 서열번호 1의 아미노산 서열을 기준으로 415번 위치에 상응하는 아미노산은 히스티딘(Histidine)이고, 상기 서열번호 1로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 변이체일 수 있다. 예컨대, 본 출원의 변이체는 상기 서열번호 1로 기재된 아미노산 서열에서 서열번호 1의 아미노산 서열을 기준으로 415번 위치에 상응하는 아미노산은 히스티딘이고, 상기 서열번호 1로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 가지거나 포함할 수 있으며, 또는 상기의 아미노산 서열로 이루어지거나 필수적으로 이루어질 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 변이체에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 변이체도 본 출원의 범위 내에 포함됨은 자명하다.
예를 들어, 상기 아미노산 서열 N-말단, C-말단 그리고/또는 내부에 본 출원의 변이체의 기능을 변경하지 않는 서열 추가 또는 결실, 자연적으로 발생할 수 있는 돌연변이, 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다.
상기 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
본 출원에서 용어, "변이체(variant)"는 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)되어 상기 변이체의 변이 전 아미노산 서열과 상이하나 기능(functions) 또는 특성(properties)이 유지되는 폴리펩티드를 지칭한다. 이러한 변이체는 일반적으로 상기 폴리펩티드의 아미노산 서열 중 하나 이상의 아미노산을 변형하고, 상기 변형된 폴리펩티드의 특성을 평가하여 동정(identify)될 수 있다. 즉, 변이체의 능력은 변이 전 폴리펩티드에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 또한, 일부 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이체를 포함할 수 있다. 다른 변이체는 성숙 단백질(mature protein)의 N- 및/또는 C-말단으로부터 일부분이 제거된 변이체를 포함할 수 있다. 상기 용어 "변이체"는 변이형, 변형, 변이형 폴리펩티드, 변이된 단백질, 변이 및 변이체 등의 용어(영문 표현으로는 modification, modified polypeptide, modified protein, mutant, mutein, divergent 등)가 혼용되어 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다. 본 출원의 목적상 상기 변이체는 서열번호 1의 아미노산 서열의 415번째 위치에 상응하는 아미노산인 리신(Lysine, Lys, K)이 히스티딘(Histidine, His, H)으로 치환된 변이체일 수 있다.
또한, 변이체는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 변이체의 N-말단에는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이동(translocation)에 관여하는 시그널(또는 리더) 서열이 컨쥬게이트 될 수 있다. 또한 상기 변이체는 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
본 출원에서 용어, '상동성 (homology)' 또는 '동일성 (identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ET AL/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
본 출원에서 용어, "상응하는(corresponding to)"은, 폴리펩티드에서 열거되는 위치의 아미노산 잔기이거나, 또는 폴리펩티드에서 열거되는 잔기와 유사하거나 동일하거나 상동한 아미노산 잔기를 지칭한다. 상응하는 위치의 아미노산을 확인하는 것은 특정 서열을 참조하는 서열의 특정 아미노산을 결정하는 것일 수 있다. 본 출원에 사용된 "상응 영역"은 일반적으로 관련 단백질 또는 참조 (reference) 단백질에서의 유사하거나 대응되는 위치를 지칭한다.
예를 들어, 임의의 아미노산 서열을 서열번호 1과 정렬(align)하고, 이를 토대로 상기 아미노산 서열의 각 아미노산 잔기는 서열번호 1의 아미노산 잔기와 상응하는 아미노산 잔기의 숫자 위치를 참조하여 넘버링 할 수 있다. 예를 들어, 본 출원에 기재된 것과 같은 서열 정렬 알고리즘은, 쿼리 시퀀스("참조 서열"이라고도 함)와 비교하여 아미노산의 위치, 또는 치환, 삽입 또는 결실 등의 변형이 발생하는 위치를 확인할 수 있다.
이러한 정렬에는 예를 들어 Needleman-Wunsch 알고리즘 (Needleman 및 Wunsch, 1970, J. Mol. Biol. 48: 443-453), EMBOSS 패키지의 Needleman 프로그램 (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) 등을 이용할 수 있으나, 이에 제한되지 않고 당업계에 알려진 서열 정렬 프로그램, 쌍 서열(pairwise sequence) 비교 알고리즘 등을 적절히 사용할 수 있다.
본 출원에서 용어, "시트레이트 신타아제(Citrate synthase)"는 미생물의 해당과정에서 생성되는 아세틸 코에이와 옥살로아세테이트를 중합하여 시트레이트를 생성하는 효소이다. 또한, 상기 효소는 아세틸 코에이와 4-탄소 옥살로아세테이트의 분자로부터의 2-탄소 아세테이트 잔기의 축합 반응을 촉매하여 6-탄소 옥살로아세테이트를 형성할 수 있다. 본 출원의 용어 "시트레이트 신타아제"는 시트레이트 합성효소, CS, GltA 단백질 또는 GltA로 혼용하여 사용될 수 있다. 본 출원에서 상기 GltA는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있다. 더불어, 상기 GltA는 gltA 유전자에 의해 코딩되는 시트레이트 신타아제 활성을 갖는 폴리펩타이드일 수 있으나, 이에 제한되지 않는다.
본 출원의 변이체는 야생형 폴리펩티드에 비해 L-아미노산 생산능이 증가되도록 하는 활성을 가질 수 있다.
본 출원의 변이체는 서열번호 1의 아미노산 서열과 80% 이상의 서열 동일성을 가지는 것일 수 있다.
또한, 본 출원의 변이체는 서열번호 3의 아미노산 서열로 기재된 폴리펩티드를 포함할 수 있다. 상기 서열번호 3의 아미노산 서열은 서열번호 1로 기재된 아미노산 서열의 N-말단으로부터 362번 위치 내지 415번 위치의 아미노산 서열에서 415번째 위치에 상응하는 리신이 히스티딘으로 치환된 아미노산 서열일 수 있다.
본 출원의 변이체는 하기의 일반식 1의 아미노산 서열을 포함할 수 있다:
[일반식 1]
X1N HGGDATX2FMN KVKNKEDGVR LMGFGHRVYK NYDPRAAIVK ETAHEILEHL GGDDLLDLAI KLEEIALADD X3FISRKLYPN VDFYTGLIYR AMGFPTDFFT VLFAIGRLPG WIAHYREQLG AAGNH (서열번호 51);
여기서 상기 일반식 1의 X1은 아스파라긴 또는 세린이고,
X2는 알라닌 또는 글루탐산이고,
X3은 티로신 또는 시스테인.
본 출원의 변이체는 서열번호 8, 10 또는 12의 아미노산 서열과 90% 이상의 서열 동일성을 가질 수 있다. 또한, 본 출원의 변이체는 서열번호 8, 10 또는 12의 아미노산 서열과 90% 이상의 서열 동일성을 가지는 아미노산 서열을 포함하거나, 상기 아미노산 서열로 이루어지거나 필수적으로 이루어질 수 있다. 일 예로, 본 출원의 변이체는 서열번호 8, 10 또는 12의 아미노산 서열과 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 또는 99.7% 이상의 서열 동일성을 가지거나, 상기 서열 동일성을 가지는 아미노산 서열을 포함하거나, 상기 서열 동일성을 가지는 아미노산 서열로 이루어지거나 필수적으로 이루어질 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 변이체를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이체를 코딩하는 폴리뉴클레오티드 단편을 의미한다.
본 출원의 폴리뉴클레오티드는 서열번호 2의 핵산염기 서열을 기준으로 1243번에서 1245번 위치에 상응하는 염기는 CAC이고, 상기 서열번호 2로 기재된 핵산염기 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, 또는 99.9% 이상, 100% 미만의 상동성 또는 동일성을 가지는 핵산염기 서열로 기재된 폴리뉴클레오티드를 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 변이체에 상응하는 효능을 나타내는 폴리펩티드나 단백질을 암호화하는 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 핵산염기 서열로 기재된 폴리뉴클레오티드도 본 출원의 범위 내에 포함됨은 자명하다.
본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 출원의 변이체를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 본 출원의 변이체의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 이때, 상기 상동성 또는 동일성을 갖는 서열에서, 서열번호 1의 415번째 위치에 상응하는 아미노산을 코딩하는 코돈은, 히스티딘을 코딩하는 코돈 중 하나일 수 있다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화할 수 있는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1XSSC, 0.1% SDS, 구체적으로 60℃, 0.1XSSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1XSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산염기 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
일 예로, 본 출원의 폴리뉴클레오티드는 서열번호 9, 11 또는 13의 핵산염기 서열을 기준으로 1084번 내지 1245번 위치의 핵산염기 서열로 기재된 폴리뉴클레오티드, 또는 서열번호 9, 11, 13 또는 15의 핵산염기 서열로 기재된 폴리뉴클레오티드를 포함할 수 있다.
본 출원의 폴리뉴클레오티드에서, 상기 변이체는 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 제공하는 것이다. 상기 벡터는 상기 폴리뉴클레오티드를 숙주세포에서 발현시키기 위한 발현 벡터일 수 있으나, 이에 제한되지 않는다.
본 출원 벡터는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 포함하는 DNA 제조물을 포함할 수 있다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117(Biotechnology letters vol 13, No. 10, p. 721-726(1991), 대한민국 등록특허 제 10-1992-0007401), pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 표적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 폴리펩티드가 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 변이체를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 벡터에서, 변이체 및 폴리뉴클레오티드는 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드를 포함하는, 코리네박테리움 속(The genus of Corynebacterium) 미생물을 제공하는 것이다.
본 출원의 미생물은 본 출원의 변이체, 상기 변이체를 암호화하는 폴리뉴클레오티드, 또는 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 포함할 수 있다.
본 출원에서 용어, "미생물(또는, 균주)"는 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 폴리펩티드, 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
본 출원의 미생물은 본 출원의 변이체, 본 출원의 폴리뉴클레오티드 및 본 출원의 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하는 미생물; 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드를 발현하도록 변형된 미생물; 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드를 발현하는 미생물 (예컨대, 재조합 균주); 또는 본 출원의 변이체 활성을 갖는 미생물 (예컨대, 재조합 균주)일 수 있으나, 이에 제한되지 않는다.
본 출원의 미생물은 L-아미노산 생산능을 가지는 균주일 수 있다. 구체적으로, 본 출원의 미생물에서 상기 L-아미노산 생산능은 L-발린 또는 O-아세틸-L-호모세린 생산능일 수 있다.
본 출원의 미생물은 자연적으로 GltA 또는 L-아미노산 생산능을 가지고 있는 미생물, 또는 GltA 또는 L-아미노산 생산능이 없는 모균주에 본 출원의 변이체 또는 이를 코딩하는 폴리뉴클레오티드 (또는 상기 폴리뉴클레오티드를 포함하는 벡터)가 도입되거나 및/또는 GltA 또는 L-아미노산 생산능이 부여된 미생물일 수 있으나 이에 제한되지 않는다.
일 예로, 본 출원의 미생물은 본 출원의 폴리뉴클레오티드 또는 본 출원의 폴리뉴클레오티드를 포함하는 벡터로 형질전환되어, 본 출원의 변이체를 발현하는 세포 또는 미생물로서, 본 출원의 목적상 본 출원의 미생물은 본 출원의 변이체를 포함하여 L-아미노산을 생산할 수 있는 미생물을 모두 포함할 수 있다. 예를 들어, 본 출원의 균주는 천연의 야생형 미생물 또는 L-아미노산을 생산하는 미생물에 본 출원의 변이체를 코딩하는 폴리뉴클레오티드가 도입됨으로써 L-아미노산 생산능이 증가된 재조합 균주일 수 있다. 상기 L-아미노산 생산능이 증가된 재조합 균주는, 천연의 야생형 미생물 또는 시트레이트 신타아제 비변형 미생물 (즉, 야생형 (서열번호 1) 단백질을 발현하는 미생물 또는 본 출원의 변이체를 발현하지 않는 미생물)에 비하여 L-아미노산 생산능이 증가된 미생물일 수 있으나, 이에 제한되는 것은 아니다. 그 예로, 상기 L-아미노산 생산능의 증가 여부를 비교하는 대상 균주인, 시트레이트 신타아제 비변형 미생물은 ATCC14067 균주, ATCC13032 균주, ATCC13869 균주, 코리네박테리움 글루타미쿰 CJ7V 균주, 코리네박테리움 글루타미쿰 CJ8V 균주 또는 CA08-0072 균주일 수 있으나, 이에 제한되지 않는다.
일 예로, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물에 비하여, L-아미노산 생산능이 약 1% 이상, 5% 이상, 7% 이상, 약 10% 이상, 약 20% 이상, 또는 약 30% 이상 (상한값은 특별한 제한은 없으며, 예컨대, 약 200% 이하, 약 150% 이하, 약 100% 이하, 약 50% 이하, 약 45% 이하, 약 40% 이하 또는 약 30% 이하일 수 있음) 증가된 것일 수 있으나, 변이 전 모균주 또는 비변형 미생물의 생산능에 비해 +값의 증가량을 갖는 한, 이에 제한되지 않는다. 다른 예에서, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물에 비하여, L-발린 생산능이 약 1.01배 이상, 약 1.05 배 이상, 약 1.07배 이상, 약 1.1배 이상, 약 1.2배 이상 또는 약 1.3배 이상 (상한값은 특별한 제한은 없으며, 예컨대, 약 10배 이하, 약 5배 이하, 약 3배 이하, 또는 약 2배 이하일 수 있음) 증가된 것일 수 있다.
상기 용어 "약(about)"은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
본 출원에서 용어, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 본 명세서에 기재된 단백질 변이체가 도입되지 않거나 도입되기 전의 균주를 의미할 수 있다. 상기 "비변형 미생물"은 "변형 전 균주", "변형 전 미생물", "비변이 균주", "비변형 균주", "비변이 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
본 출원의 또 다른 일 예로, 본 출원의 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris), 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있다.
본 출원의 미생물은 NCgl2335 단백질이 추가적으로 약화된 미생물일 수 있다. 또한, 본 출원의 미생물은 아세토락테이트 신타아제 아이소자임 1 서브 유닛(Acetolactate synthase isozyme 1 small subunit, IlvN), L-메티오닌/분지쇄 아미노산 배출자(L-methionine/branched-chain amino acid exporter, YjeH) 로 이루어진 군으로부터 선택되는 단백질의 활성이 추가적으로 강화된 미생물일 수 있다.
구체적으로, 본 출원의 L-발린을 생산하는 미생물은 추가적으로 IlvN 활성 강화 및/또는 NCgl2335 약화된 미생물일 수 있다. 또한, 본 출원의 O-아세틸-L-호모세린을 생산하는 미생물은 추가적으로 YjeH(L-methionine/branched-chain amino acid exporter) 활성 강화된 미생물일 수 있다.
본 출원에서 용어, 폴리펩티드 활성의 "약화"는 내재적 활성에 비하여 활성이 감소되거나 또는 활성이 없는 것을 모두 포함하는 개념이다. 상기 약화는 불활성화(inactivation), 결핍(deficiency), 하향조절(down-regulation), 감소(decrease), 저하(reduce), 감쇠(attenuation) 등의 용어와 혼용될 수 있다.
상기 약화는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드의 변이 등으로 폴리펩티드 자체의 활성이 본래 미생물이 가지고 있는 폴리펩티드의 활성에 비해 감소 또는 제거된 경우, 이를 코딩하는 폴리뉴클레오티드의 유전자의 발현 저해 또는 폴리펩티드로의 번역(translation) 저해 등으로 세포 내에서 전체적인 폴리펩티드 활성 정도 및/또는 농도(발현량)가 천연형 균주에 비하여 낮은 경우, 상기 폴리뉴클레오티드의 발현이 전혀 이루어지지 않은 경우, 및/또는 폴리뉴클레오티드의 발현이 되더라도 폴리펩티드의 활성이 없는 경우 역시 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주, 야생형 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "불활성화, 결핍, 감소, 하향조절, 저하, 감쇠"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성에 비하여 낮아진 것을 의미한다.
이러한 폴리펩티드의 활성의 약화는, 당업계에 알려진 임의의 방법에 의하여 수행될 수 있으나 이로 제한되는 것은 아니며, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다(예컨대, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드 활성의 약화는
1) 폴리펩티드를 코딩하는 유전자 전체 또는 일부의 결손;
2) 폴리펩티드를 코딩하는 유전자의 발현이 감소하도록 발현조절영역(또는 발현조절서열)의 변형;
3) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 구성하는 아미노산 서열의 변형(예컨대, 아미노산 서열 상의 1 이상의 아미노산의 삭제/치환/부가);
4) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 코딩하는 유전자 서열의 변형 (예를 들어, 폴리펩티드의 활성이 제거 또는 약화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 핵산염기 서열 상의 1 이상의 핵산염기의 삭제/치환/부가);
5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입;
7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가;
8) 폴리펩티드를 코딩하는 유전자 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE); 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
예컨대,
상기 1) 폴리펩티드를 코딩하는 상기 유전자 일부 또는 전체의 결손은, 염색체 내 내재적 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드 전체의 제거, 일부 뉴클레오티드가 결실된 폴리뉴클레오티드로의 교체 또는 마커 유전자로 교체일 수 있다.
상기 2) 발현조절영역(또는 발현조절서열)의 변형은, 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절영역(또는 발현조절서열) 상의 변이 발생, 또는 더욱 약한 활성을 갖는 서열로의 교체일 수 있다. 상기 발현조절영역에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
상기 3) 및 4)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은 폴리펩티드의 활성을 약화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 약한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 없도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 예를 들면, 폴리뉴클레오티드 서열 내 변이를 도입하여 종결 코돈을 형성시킴으로써, 유전자의 발현을 저해하거나 약화시킬 수 있으나, 이에 제한되지 않는다.
또한, 상기 5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 낮은 다른 개시코돈을 코딩하는 염기서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입은 예를 들어 문헌 [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986]을 참고할 수 있다.
상기 7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가는 mRNA 번역을 불가능하게 하거나 속도를 저하시키는 것일 수 있다.
또한, 상기 8) 폴리펩티드를 코딩하는 유전자서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE)는 상기 폴리펩티드를 코딩하는 유전자의 전사체에 상보적인 안티센스 뉴클레오티드를 만들어 활성을 약화하는 것일 수 있다.
본 출원에서 용어, 폴리펩티드 활성의 "강화"는, 폴리펩티드의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 활성화(activation), 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 활성화, 강화, 상향조절, 과발현, 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "강화", "상향조절", "과발현" 또는 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성 및/또는 농도(발현량)에 비하여 향상된 것을 의미한다.
상기 강화는 외래의 폴리펩티드를 도입하거나, 내재적인 폴리펩티드의 활성 강화 및/또는 농도(발현량)를 통해 달성할 수 있다. 상기 폴리펩티드의 활성의 강화 여부는 해당 폴리펩티드의 활성 정도, 발현량 또는 해당 폴리펩티드로부터 배출되는 산물의 양의 증가로부터 확인할 수 있다.
상기 폴리펩티드의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 폴리펩티드의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드 활성의 강화는
1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가;
2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역을 활성이 강력한 서열로 교체;
3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
4) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드의 아미노산 서열의 변형;
5) 폴리펩티드 활성이 강화도록 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열의 변형 (예를 들어, 폴리펩티드의 활성이 강화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 폴리뉴클레오티드 서열의 변형);
6) 폴리펩티드의 활성을 나타내는 외래 폴리펩티드 또는 이를 코딩하는 외래 폴리뉴클레오티드의 도입;
7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
보다 구체적으로,
상기 1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터의 숙주세포 내로의 도입에 의해 달성되는 것일 수 있다. 또는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 숙주세포 내의 염색체 내에 1 카피 또는 2 카피 이상 도입에 의해 달성되는 것일 수 있다. 상기 염색체 내에 도입은 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다. 상기 벡터는 전술한 바와 같다.
상기 2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역(또는 발현조절서열)을 활성이 강력한 서열로 교체는, 예를 들면, 상기 발현조절영역의 활성을 더욱 강화하도록 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 가지는 서열로의 교체일 수 있다. 상기 발현조절영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 그리고 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 일 예로, 본래의 프로모터를 강력한 프로모터로 교체시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터, yccA 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 높은 다른 개시코돈을 코딩하는 염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 폴리펩티드의 활성을 강화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 증가하도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 상기 교체는 구체적으로 상동재조합에 의하여 폴리뉴클레오티드를 염색체내로 삽입함으로써 수행될 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 전술한 바와 같다.
상기 6) 폴리펩티드의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 상기 폴리펩티드와 동일/유사한 활성을 나타내는 폴리펩티드를 코딩하는 외래 폴리뉴클레오티드의 숙주세포 내 도입일 수 있다. 상기 외래 폴리뉴클레오티드는 상기 폴리펩티드와 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한이 없다. 상기 도입에 이용되는 방법은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 폴리펩티드가 생성되어 그 활성이 증가될 수 있다.
상기 7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
또한, 상기 8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩티드의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 폴리펩티드 활성의 강화는, 상응하는 폴리펩티드의 활성 또는 농도 발현량이 야생형이나 변형 전 미생물 균주에서 발현된 폴리펩티드의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩티드로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 미생물에서 폴리뉴클레오티드의 일부 또는 전체의 변형 (예컨대, 상술한 단백질 변이체를 코딩하기 위한 변형)은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위 (engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오티드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
보다 구체적으로, 본 출원의 L-발린을 생산하는 미생물은 서열번호 27의 아미노산 서열로 기재된 폴리펩티드 및/또는 서열번호 28의 핵산염기 서열로 기재된 폴리뉴클레오티드를 포함하는 미생물일 수 있다. 더불어, 본 출원의 O-아세틸-L-호모세린을 생산하는 미생물은 서열번호 47의 아미노산 서열로 기재된 폴리펩티드 포함 및/또는 서열번호 48의 핵산염기 서열로 기재된 폴리뉴클레오티드 포함; 서열번호 37의 아미노산 서열로 기재된 폴리펩티드불활성 및/또는 서열번호 38의 핵산염기 서열로 기재된 폴리뉴클레오티드 결손;으로 이루어진 군으로부터 선택되는 변이를 포함하는 미생물일 수 있다.
본 출원의 미생물에서, 변이체 및 폴리뉴클레오티드 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드를 포함하는 코리네박테리움 속 미생물을 배지에서 배양하는 단계를 포함하는, L-아미노산 생산방법을 제공한다.
본 출원의 L-아미노산 생산방법은 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드 또는 본 출원의 벡터를 포함하는 코리네박테리움 글루타미쿰 균주를 배지에서 배양하는 단계를 포함할 수 있다.
더불어, 본 출원의 L-아미노산 생산방법에서, 상기 L-아미노산은 L-발린, O-아세틸-L-호모세린 또는 L-메티오닌일 수 있다.
본 출원에서, 용어 "배양"은 본 출원의 코리네박테리움 속 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및/또는 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 본 출원의 코리네박테리움 속 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 코리네박테리움 속 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 코리네박테리움 속 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
구체적으로, 코리네박테리움 속 미생물에 대한 배양 배지는 문헌["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)]에서 찾아 볼 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 본 출원의 코리네박테리움 글루타미쿰 균주의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
본 출원의 배양에서 배양온도는 20 내지 45℃, 구체적으로는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 배양에 의하여 생산된 L-아미노산은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 L-아미노산 생산방법은, 본 출원의 코리네박테리움 속 미생물을 준비하는 단계, 상기 미생물을 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 L-아미노산 생산방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 본 출원의 코리네박테리움 속 미생물로부터 L-아미노산을 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 L-아미노산을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-아미노산을 회수할 수 있다.
또한, 본 출원의 L-아미노산 생산방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 L-아미노산 생산방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 연속적 또는 비연속적으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
더불어, 본 출원의 L-메티오닌 생산방법은, 상기 O-아세틸-L-호모세린을 L-메티오닌으로 전환하는 단계를 추가로 포함할 수 있다. 본 출원의 L-메티오닌 생산방법에 있어서, 상기 전환하는 단계는 상기 배양하는 단계 또는 상기 회수하는 단계 이후에 추가로 포함될 수 있다. 상기 전환하는 단계는 당해 기술 분야에 공지된 적합한 방법을 이용하여 수행할 수 있다(US 8426171 B2). 일 구현예로, 본 출원의 L-메티오닌 생산방법은 O-아세틸-L-호모세린, 메틸 머캅탄 및 O-아세틸 호모세린 설피드릴라아제(Oacetylhomoserine sulfhydrylase) 또는 시스타티오닌-γ-신타아제 (cystathionine gamma-synthase) 또는 O-숙시닐 호모세린 설프히드릴라아제(O-succinyl homoserine sulfhydrylase)를 접촉시켜 L-메티오닌을 생산하는 단계를 포함할 수 있다.
본 출원의 방법에서, 변이체, 폴리뉴클레오티드, 벡터 및 미생물 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이체, 본 출원의 변이체를 코딩하는 폴리뉴클레오타이드 또는 본 출원의 폴리뉴클레오타이드를 포함하는 벡터를 포함하는 코리네박테리움 속 미생물; 이를 배양한 배지; 또는 이들의 조합을 포함하는 L-아미노산 생산용 조성물을 제공하는 것이다.
본 출원의 조성물은 아미노산 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 L-아미노산 생산용 조성물에서, 상기 L-아미노산은 L-발린, O-아세틸-L-호모세린 또는 L-메티오닌일 수 있다.
본 출원의 조성물에서, 변이체, 폴리뉴클레오티드, 벡터, 균주 및 배지 등은 상기 다른 양태에서 기재한 바와 같다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 하기 실시예는 본 출원을 예시하기 위한 바람직한 실시양태에 불과한 것이며 따라서, 본 출원의 권리범위를 이에 한정하는 것으로 의도되지는 않는다. 한편, 본 명세서에 기재되지 않은 기술적인 사항들은 본 출원의 기술 분야 또는 유사 기술 분야에서 숙련된 통상의 기술자이면 충분히 이해하고 용이하게 실시할 수 있다.
실시예 1: 시트레이트 신타아제(GltA) 변이체 벡터 제작
본 발명자들은 GltA의 415번째 아미노산 잔기를 아세틸 coA(acetyl-coA) 결합 위치로 발굴하였으며, 이를 다른 아미노산으로 치환하였을시 아세틸 coA의 Km값이 높아지면서 시트레이트 신타아제 활성이 약화될 것으로 예측하였다.
이에, 상기 GltA의 415번째 아미노산인 리신을 다른 아미노산으로 치환하는 벡터를 제작하였다. 구체적으로, 415번째 아미노산인 리신을 히스티딘(K415H), 트립토판(K415W) 그리고 글리신(K415G)으로 치환하기 위해 변이가 포함된 벡터를 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC14067의 gDNA(genomic DNA)를 주형으로 서열번호 15 및 17의 프라이머 쌍과 서열번호 16 및 18의 프라이머 쌍을, 서열번호 15 및 20의 프라이머 쌍과 서열번호 18 및 19의 프라이머 쌍을, 서열번호 15 및 22 의 프라이머 쌍과 서열번호 18 및 21의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 여섯 개의 단편 중 두 단편의 혼합물을 주형으로 서열번호 15 및 서열번호 18의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 3개의 단편을 각각 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 벡터(서열번호 14, 대한민국 공개번호 제10-2020-0136813호) 는 smaI을 처리하고 상기에서 수득한 3개의 PCR 산물을 각각 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 클로닝 결과로 얻은 플라스미드를 각각 pDCM2-gltA(K415H), pDCM2-gltA(K415W), pDCM2-gltA(K415G)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 1에 기재하였다.
서열번호 프라이머 서열
15 프라이머 1 TCGAGCTCGGTACCC CCGTTCGTATGATCGGTTCCGCACAGGCC
16 프라이머 2 GTGCAGCAGGCAAC CAC ATCAACCGCCCACG
17 프라이머 3 CGTGGGCGGTTGAT GTG GTTGCCTGCTGCAC
18 프라이머 4 CTCTAGAGGATCCCC GCCGTAAGCAGCCTCTGGTGGAATGGTCAGC
19 프라이머 5 GTGCAGCAGGCAAC TGG ATCAACCGCCCACG
20 프라이머 6 CGTGGGCGGTTGAT CCA GTTGCCTGCTGCAC
21 프라이머 7 GTGCAGCAGGCAAC GGC ATCAACCGCCCACG
22 프라이머 8 CGTGGGCGGTTGAT GCC GTTGCCTGCTGCAC
실시예 2: L-발린 생산 균주에 GltA 변이체 도입 및 평가
2-1. L-발린 생산 기반 균주 제작 및 평가
야생주 코리네박테리움 글루타미쿰 ATCC14067과 ATCC13869의 아세토락테이트 신타아제 아이소자임 1 서브 유닛(Acetolactate synthase isozyme 1 small subunit, IlvN)에 각각 1종의 변이[ilvN(A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467](서열번호 27)를 도입하여 L-발린 생산능이 향상된 균주를 제작하였다(KR 10-1947945 B1).
구체적으로, 야생형 코리네박테리움 글루타미쿰 ATCC14067의 gDNA(genomic DNA)를 주형으로 서열번호 29 및 31 의 프라이머 쌍과 서열번호 30 및 32의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 29 및 서열번호 32의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 3개의 단편을 각각 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 벡터는 smaI을 처리하고 상기에서 수득한 3개의 PCR 산물을 각각 퓨전 클로닝하였다. 클로닝 결과로 얻은 플라스미드를 각각 pDCM2-ilvN(A42V)라 명명하였다. 상기 pDCM2-ilvN(A42V)를 야생형인 코리네박테리움 글루타미쿰 ATCC14067과 ATCC13869 균주에 각각 형질전환시켜 염색체 상에서 상동성 재조합을 유도하였다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신(kanamycin) 25㎎/L를 함유한 배지에서 선별하였다. 선별된 코리네박테리움 글루타미쿰 형질 전환주를 대상으로 서열번호 33 및 34의 프라이머 쌍을 이용한 PCR을 통하여 유전자 단편을 증폭한 뒤, 유전자 서열 분석을 통하여 변이가 제대로 도입되었음을 확인하였다. 상기 재조합 균주를 코리네박테리움 글루타미쿰 CJ7V 및 CJ8V라고 각각 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 2에 기재하였다.
서열번호 서열명 서열
29 프라이머 11 TCGAGCTCGGTACCCC CGCGTCACCAAAGCGGA
30 프라이머 12 GTCCCTCGTGTCTGTAAAGACCGAAACACT
31 프라이머 13 AGTGTTTCGGTCTTTACAGACACGAGGGAC
32 프라이머 14 CTCTAGAGGATCCCC TTAGATCTTGGCCGGAGCCA
33 프라이머 15 CCGCGTCACCAAAGCGGA
34 프라이머 16 TTAGATCTTGGCCGGAGCCA
이후, 야생주 코리네박테리움 글루타미쿰 ATCC14067과 ATCC13869 균주, 상기에서 제작한 CJ7V 및 CJ8V 균주들을 대상으로 발효 역가 실험을 실시하였다. 영양배지에서 계대 배양된 각 균주들을 생산 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 접종하고, 30℃에서 72시간 동안, 200rpm에서 진탕 배양하였다. 이후, HPLC를 이용하여 L-발린의 농도를 분석하여 하기 표 3에 나타내었다.
<영양배지 (pH 7.2)>
포도당 10g, 육즙 5g, 폴리펩톤 10g, 염화나트륨 2.5g, 효모엑기스 5g, 한천 20g, 유레아 2g (증류수 1리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, 황산암모늄 40 g, 대두단백질 2.5 g, 옥수수침지고형분(Corn Steep Solids) 5 g, 요소 3 g, 제2인산칼륨 1 g, 황산마그네슘7수염 0.5 g, 바이오틴 100 ㎍, 티아민-HCl 1 ㎎, 판토텐산칼슘 2 ㎎, 니코틴아마이드 3 ㎎, 탄산칼슘 30 g (증류수 1리터 기준)
L-발린 생산 기반균주 CJ7V 및 CJ8V의 L-발린 생산능
균주 L-발린(g/L)
ATCC14067 1.5
CJ7V(ilvN(A42V)) 2.2
ATCC13869 1.0
CJ8V(ilvN(A42V)) 1.9
상기의 결과에서 보듯이, 야생형 코리네박테리움 글루타미쿰 ATCC14067 및 13869 균주와 대비하여 ilvN(A42V)유전자 변이가 도입된 CJ7V 및 CJ8V 균주에서 L-발린 생산능이 증가된 것을 확인하였다.
2-2. L-발린 생산 균주에 GltA 약화 변이체(K415H, K415W, K415G) 도입 및 평가
L-발린 생산 균주에 GltA 변이체를 도입하여 L-발린 생산능을 평가하였다. 실시예 1에서 제작한 pDCM2-gltA(K415H), pDCM2-gltA(K415W), pDCM2-gltA(K415G) 벡터를 염색체 상에서의 상동 재조합에 의해 L-발린 생산 균주인 CJ7V, CJ8V 및 CA08-0072(KCCM11201P, US 8465962 B2)에 각각 형질 전환시켰다. 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신 25㎎/L를 함유한 배지에서 선별하였다.
이후 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질 전환주를 대상으로 서열번호 23 및 24의 프라이머 쌍(표 4)을 이용한 PCR을 통하여 유전자 단편을 증폭한 뒤, 유전자 서열 분석을 통하여 변이 삽입 균주를 확인하였다. 상기 재조합 균주를 코리네박테리움 글루타미쿰 하기와 같이 명명하여 실시예 2-1과 동일한 방법으로 역가 평가하여 하기 표 5에 나타내었다.
서열번호 서열명 서열
23 프라이머 9 CCGTTCGTATGATCGGTTCCGCACAGGCC
24 프라이머 10 GCCGTAAGCAGCCTCTGGTGGAATGGTCAGC
균주 OD600 L-발린(g/L)
CJ7V 77 2.2
CJ7V:gltA(K415H) 75 2.5
CJ7V:gltA(K415W) 47 1.2
CJ7V:gltA(K415G) 42 1.0
CJ8V 89 1.9
CJ8V:gltA(K415H) 89 2.1
CJ8V:gltA(K415W) 50 1.0
CJ8V:gltA(K415G) 49 1.0
CA08-0072 62 2.6
CA08-0072:gltA(K415H) 60 2.9
CA08-0072:gltA(K415W) 35 1.8
CA08-0072:gltA(K415G) 30 1.7
상기의 결과에서 보듯이, K415H 변이체의 경우 생육의 저하 없이 L-발린 생산능이 증가하는 것을 확인하였다.
상기 CA08-0072:gltA(K415H)는 CA08-1688로 명명하였으며, 부다페스트조약 하의 수탁기관인 한국미생물보존센터에 2020년 9월 28일자로 기탁하여 수탁번호 KCCM12795P를 부여받았다.
실시예 3: O-아세틸-L-호모세린 생산 강화 균주 제작 및 O-아세틸-L-호모세린 생산능 평가
3-1 외래 막단백질 변이형 YjeH 도입 균주 제작
코리네박테리움 글루타미쿰 ATCC13032에 도입되는, 외래 막단백질이자 O-아세틸 호모세린 배출 단백질인 YjeH 변이체의 유효성을 판단하기 위하여, YjeH 변이체(서열번호 47)를 코딩하는 유전자(서열번호 48)를 포함하는 염색체 도입 벡터를 제작하였다.
구체적으로, 유전자전위효소(transposase) 결손 벡터를 제작하기 위해, 유전자전위효소를 코딩하는 유전자(서열번호 38, 유전자번호 NCgl2335) 위치를 중심으로 5' 상단 부위를 증폭하기 위한 프라이머 쌍(서열번호 39 및 40) 과 3' 하단 부위를 증폭하기 위한 프라이머 쌍(서열번호 41 및 42)을 고안하였다. 서열번호 39 및 42의 프라이머 쌍은 각 말단에 XbaI 제한 효소 부위를 삽입하였고, 서열번호 40 및 41의 프라이머 쌍은 서로 교차되도록 고안하였으며 이 부위에 제한효소 SmaI 서열이 위치하도록 하였다. 프라이머 서열은 하기 표 6에 기재하였다.
서열번호 서열명 서열
서열번호 39 Tn_5 F tgaattcgagctcggtacccCACCGACGCGCATCTGCCT
서열번호 40 Tn_5 R GGTGTGGTGACTTTCAGCAGTTCCCGGGGGGGAGGAGGCATGTGGTGTTG
서열번호 41 Tn_3 F CAACACCACATGCCTCCTCCCCCCCGGGAACTGCTGAAAGTCACCACACC
서열번호 42 Tn_3 R gtcgactctagaggatccccCTCCCAAACCATTGAGGAATGG
ATCC13032 야생형(WT)의 염색체를 주형으로 하여 서열번호 39 및 40의 프라이머 쌍과 서열번호 41 및 42의 프라이머 쌍을 이용하여 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃에서 30초 변성, 55℃에서 30초 어닐링, 72℃에서 30초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 NCgl2335 유전자의 결손 부위를 중심으로 5' 상단 부위의 851 bp DNA 단편과 3' 하단 부위의 847 bp의 DNA 단편을 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 39 및 42의 프라이머 쌍을 이용하여 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃에서 30초 변성, 55℃에서 30초 어닐링, 72℃에서 90초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과, 유전자전위효소를 코딩하는 유전자(서열번호 38, 유전자번호 NCgl2335)를 결손할 수 있는 부위를 포함하는 1648 bp의 DNA 단편이 증폭되었다.
수득한 PCR 산물을 SmaI 제한효소 처리한 pDCM2 벡터와 인퓨전 HD 클로닝 키트를 사용하여 퓨전 클로닝하였다. 클로닝된 벡터를 대장균 DH5α에 형질전환하고 형질전환된 대장균을 카나마이신 25mg/L이 포함된 LB 고체배지에 도말하였다. PCR을 통해 상기 목적한 유전자가 삽입된 플라스미드로 형질전환된 콜로니를 선별한 후 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 최종적으로 NCgl2335 결손 카세트가 클로닝된 pDCM2-△NCgl2335 재조합 벡터를 제작하였다.
O-아세틸 호모세린 배출 단백질의 유효성을 판단하기 위하여 대장균 유래의 YjeH 변이체를 코딩하는 유전자(서열번호 48) 포함하는 염색체 도입 벡터를 제작하였다. 이를 위해 CJ7 프로모터 (US 7662943 B2)를 이용하여 yjeH 유전자를 발현하는 벡터를 제작하였다. CJ7 프로모터 부위를 증폭하기 위한 프라이머 쌍(서열번호 43 및 44)과 대장균의 yjeH 부위를 증폭하기 위한 프라이머 쌍(서열번호 45 및 46)을 고안하였다. 프라이머 서열은 하기 표 7에 기재하였다.
서열번호 서열명 서열
서열번호 43 CJ7_yjeH F ACACCACATGCCTCCTCcccAGAAACATCCCAGCGCTAC
서열번호 44 CJ7_yjeH R AGTTCTTGTTTGAGTCCACTCATAGTGTTTCCTTTCGTTGGGT
서열번호 45 yjeH F ACCCAACGAAAGGAAACACTATGAGTGGACTCAAACAAGAACTG
서열번호 46 yjeH R GACTTTCAGCAGTTcccgggTTATGTGGTTATGCCATTTTCCGG
pECCG117-PCJ7-gfp(US 7662943 B2, p117-Pcj7-gfp)을 주형으로 하여 서열번호 43 및 서열번호 44, 야생형 대장균의 염색체를 주형으로 하여 서열번호 45 및 46의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃에서 30초 변성, 55℃에서 30초 어닐링, 72℃에서 90초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 CJ7 프로모터 부위의 360bp DNA 단편과 대장균의 yjeH 유전자 부위의 1297bp의 DNA 단편을 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 43 및 서열번호 46 프라이머로 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃에서 30초 변성, 55℃에서 30초 어닐링, 72℃에서 90초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과, CJ7 프로모터와 yjeH 유전자가 도입된 부위를 포함하는 1614bp의 DNA 단편이 증폭되었다.
상기 PCR을 통하여 획득한 유전자 결손 DNA 단편에 제한효소 SmaI 처리된 pDCM2-△NCgl2335 벡터에 인퓨전 HD 클로닝 키트를 이용하여 클로닝하였고 pDCM2-△NCgl2335::PCJ7-yjeH(eco,WT) 재조합 벡터를 제작하였다.
또한, 변이형 yjeH(eco, F351L) 유전자를 도입하기 위한 재조합 벡터를 제작하고자 하였다.
구체적으로는 pDCM2-△NCgl2335::PCJ7-yjeH(eco,WT) 플라스미드를 주형으로 하고 서열번호 49 및 서열번호 50의 프라이머를 이용하여, YjeH 아미노산 서열의 351번째 아미노산인 페닐알라닌을 류신으로 치환하였다(F351L). 제작된 변이 YjeH(F351L)를 코딩하는 유전자를 포함하는 플라스미드를 pDCM2-△NCgl2335::PCJ7-yjeH(eco,F351L)로 명명하였다. 프라이머 서열은 하기 표 8에 기재하였다.
서열번호 서열명 서열
서열번호 49 F351L F CAATGGCATCCTTATTATGATTT
서열번호 50 F351L R AAATCATAATAAGGATGCCATTG
제작된 pDCM2-△NCgl2335, pDCM2-△NCgl2335::PCJ7-yjeH(eco,F351L)를 ATCC13032 균주에 전기펄스법으로 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 NCgl2335 유전자가 결손된 ATCC13032 △NCgl2335, ATCC13032 △NCgl2335::PCJ7-yjeH(eco,F351L)을 수득하였다. NCgl2335 유전자 결손 및 YjeH 변이체를 코딩하는 유전자의 삽입 여부는 서열번호 39 및 42의 프라이머 쌍을 이용한 PCR 후 ATCC13032와 비교하여 최종 확인하였다.
3-2. O-아세틸 호모세린 생산능 평가
실시예 3-1에서 제작된 ATCC13032 △NCgl2335, ATCC13032 △NCgl2335::PCJ7-yjeH(eco,F351L)와 야생형 균주인 ATCC13032의 O-아세틸 호모세린(O-AH; O-Acetyl Homoserine) 생산능을 비교하고자 아래와 같은 방법으로 배양하여 배양액 중 O-아세틸 호모세린을 분석하였다.
하기의 O-아세틸 호모세린 생산배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 균주를 1백금이 접종하고, 33℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. HPLC를 이용하여 O-아세틸 호모세린 농도를 분석하였으며, 분석된 농도는 표 9와 같았다.
O-아세틸 호모세린 생산배지 (pH 7.2)
포도당 30 g, KH2PO4 2 g, 요소(Urea) 3 g, (NH4)2SO4 40 g, 펩톤(Peptone) 2.5 g, CSL(Corn steep liquor, Sigma) 5 g(10 ml), MgSO4·7H2O 0.5 g, CaCO3 20 g (증류수 1 리터 기준)
균주명 O-아세틸 호모세린(g/L)
ATCC13032 0.3
ATCC13032 △NCgl2335 0.3
ATCC13032 △NCgl2335::PCJ7-yjeH(eco,F351L) 1.0
그 결과, 상기 표 9와 같이 대조군 균주인 ATCC13032를 배양 시 O-아세틸-L-호모세린이 0.3g/L로 축적되며 유전자전위효소인 NCgl2335 유전자를 결손하여도 O-아세틸-L-호모세린 생산에는 영향이 없는 것을 확인하였다. 특히, 변이형 yjeH 유전자를 발현시켰을 경우 1.0 g/L 수준으로 축적되었음을 확인하였다.
3-3. O-아세틸-L-호모세린 생산 균주에 GltA 변이체(K415H) 도입 및 평가
실시예 3-2의 O-아세틸-L-호모세린 생산균주에 GltA 변이체를 도입하여 O-아세틸-L-호모세린 생산능을 평가하였다. 실시예 1에서 제작한 pDCM2-gltA(K415H) 벡터를 염색체 상에서의 상동 재조합에 의해 야생형 균주인 ATCC13032, ATCC13032 △NCgl2335와 O-아세틸-L-호모세린 생산 균주인 ATCC13032 △NCgl2335::PCJ7-yjeH(eco,F351L)에 각각 형질 전환시켰다. 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신 25㎎/L를 함유한 배지에서 선별하였다.
이후 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질 전환주를 대상으로 서열번호 23 및 24의 프라이머 쌍을 이용한 PCR을 통하여 유전자 단편을 증폭한 뒤, 유전자 서열 분석을 통하여 gltA(K415H) 변이 삽입 균주를 확인하였다. 상기 재조합 균주를 코리네박테리움 글루타미쿰 하기와 같이 명명하여 실시예 3-2과 동일한 방법으로 역가 평가하고 하기 표 10에 나타내었다.
균주 O-AH (g/L)
ATCC13032 0.3
ATCC13032 gltA(K415H) 0.4
ATCC13032 △NCgl2335 0.3
ATCC13032 △NCgl2335 gltA(K415H) 0.4
ATCC13032 △NCgl2335::PCJ7-yjeH(eco,F351L) 1.0
ATCC13032 △NCgl2335::PCJ7-yjeH(eco,F351L) gltA(K415H) 1.3
상기의 결과에서 보듯이, GltA K415H 변이체를 도입한 균주 모두 이를 도입하지 않은 모균주보다 O-아세틸-L-호모세린 생산능이 증가하는 것을 확인하였다.
상기 ATCC13032 △NCgl2335::PCJ7-yjeH(eco,F351L) gltA(K415H)는 CM04-1006으로 명명하였으며, 부다페스트조약 하의 수탁기관인 한국미생물보존센터에 2020년 10월 21일자로 기탁하여 수탁번호 KCCM12809P를 부여받았다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2022003359-appb-img-000001
Figure PCTKR2022003359-appb-img-000002

Claims (14)

  1. 서열번호 1의 아미노산 서열의 415번째 위치에 상응하는 아미노산인 리신이 히스티딘으로 치환된, 시트레이트 신타아제 변이체.
  2. 제1항에 있어서, 상기 변이체는 서열번호 1의 아미노산 서열과 80% 이상의 서열 동일성을 가진, 변이체.
  3. 제1항에 있어서, 상기 변이체는 서열번호 3의 아미노산 서열로 기재된 폴리펩티드를 포함하는, 변이체.
  4. 제1항에 있어서, 상기 변이체는 하기의 일반식 1의 아미노산 서열로 기재된 폴리펩티드를 포함하는, 변이체:
    [일반식 1]
    X1N HGGDATX2FMN KVKNKEDGVR LMGFGHRVYK NYDPRAAIVK ETAHEILEHL GGDDLLDLAI KLEEIALADD X3FISRKLYPN VDFYTGLIYR AMGFPTDFFT VLFAIGRLPG WIAHYREQLG AAGNH (서열번호 51);
    여기서 상기 일반식 1의 X1은 아스파라긴 또는 세린이고,
    X2는 알라닌 또는 글루탐산이고,
    X3은 티로신 또는 시스테인.
  5. 제1항에 있어서, 상기 변이체는 서열번호 8, 10 또는 12의 아미노산 서열과 90% 이상의 서열 동일성을 가진, 변이체.
  6. 제1항 내지 제5항 중 어느 한 항의 변이체를 코딩하는 폴리뉴클레오티드.
  7. 서열번호 1의 아미노산 서열의 415번째 위치에 상응하는 아미노산인 리신이 히스티딘으로 치환된 시트레이트 신타아제 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하는, 코리네박테리움 속 미생물.
  8. 제7항에 있어서, 상기 미생물은 L-발린 또는 O-아세틸-L-호모세린 생산능을 가지는, 미생물.
  9. 제7항에 있어서, 상기 미생물은 코리네박테리움 글루타미쿰인, 미생물.
  10. 서열번호 1의 아미노산 서열의 415번째 위치에 상응하는 아미노산인 리신이 히스티딘으로 치환된 시트레이트 신타아제 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 코리네박테리움 속 미생물을 배지에서 배양하는 단계를 포함하는, L-아미노산 생산 방법.
  11. 제10항에 있어서, 상기 방법은 배양된 배지 또는 미생물에서 L-아미노산을 회수하는 단계를 추가로 포함하는, L-아미노산 생산 방법.
  12. 제10항에 있어서, 상기 L-아미노산은 L-발린, O-아세틸-L-호모세린 또는 L-메티오닌인, L-아미노산 생산 방법.
  13. 서열번호 1의 아미노산 서열의 415번째 위치에 상응하는 아미노산인 리신이 히스티딘으로 치환된 시트레이트 신타아제 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 코리네박테리움 속 미생물; 이를 배양한 배지; 또는 이들의 조합을 포함하는 L-아미노산 생산용 조성물.
  14. 제13항에 있어서, 상기 L-아미노산은 L-발린, O-아세틸-L-호모세린 또는 L-메티오닌인, L-아미노산 생산용 조성물.
PCT/KR2022/003359 2021-03-10 2022-03-10 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-아미노산 생산 방법 WO2022191635A1 (ko)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP22767531.1A EP4282959A1 (en) 2021-03-10 2022-03-10 Novel citrate synthase variant and method for producing l-amino acids using same
JP2023551745A JP2024507936A (ja) 2021-03-10 2022-03-10 新規なクエン酸シンターゼ変異体及びそれを用いたｌ－アミノ酸生産方法
BR112023017369A BR112023017369A2 (pt) 2021-03-10 2022-03-10 Nova variante de citrato sintase e método para produzir l-aminoácidos usando a mesma
MX2023010437A MX2023010437A (es) 2021-03-10 2022-03-10 Nueva variante de citrato sintasa y procedimiento de produccion de l-aminoacidos usando la misma.
CN202280020564.4A CN117500920A (zh) 2021-03-10 2022-03-10 新型柠檬酸合酶变体和使用其生产l-氨基酸的方法
CA3210256A CA3210256A1 (en) 2021-03-10 2022-03-10 Novel citrate synthase variant and method for producing l-amino acids using same
US18/549,838 US20240182872A1 (en) 2021-03-10 2022-03-10 Novel citrate synthase variant and method for producing l-amino acids using same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210031641A KR102525072B1 (ko) 2021-03-10 2021-03-10 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-아미노산 생산 방법
KR10-2021-0031641 2021-03-10

Publications (1)

Publication Number Publication Date
WO2022191635A1 true WO2022191635A1 (ko) 2022-09-15

Family

ID=83228058

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/003359 WO2022191635A1 (ko) 2021-03-10 2022-03-10 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-아미노산 생산 방법

Country Status (9)

Country Link
US (1) US20240182872A1 (ko)
EP (1) EP4282959A1 (ko)
JP (1) JP2024507936A (ko)
KR (1) KR102525072B1 (ko)
CN (1) CN117500920A (ko)
BR (1) BR112023017369A2 (ko)
CA (1) CA3210256A1 (ko)
MX (1) MX2023010437A (ko)
WO (1) WO2022191635A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080014618A1 (en) * 2006-07-13 2008-01-17 Degussa Gmbh Method of production of l-amino acids
KR101641770B1 (ko) * 2014-06-23 2016-07-22 씨제이제일제당 (주) O-아세틸 호모세린을 생산하는 미생물 및 상기 미생물을 이용하여 o-아세틸 호모세린을 생산하는 방법
KR101915433B1 (ko) * 2018-02-13 2018-11-05 씨제이제일제당 (주) 시트레이트 신타아제 (Citrate synthase)의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 L-아미노산 생산방법

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102344689B1 (ko) * 2020-09-01 2021-12-29 씨제이제일제당 주식회사 L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
KR20220110412A (ko) * 2021-01-29 2022-08-08 씨제이제일제당 (주) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080014618A1 (en) * 2006-07-13 2008-01-17 Degussa Gmbh Method of production of l-amino acids
KR101641770B1 (ko) * 2014-06-23 2016-07-22 씨제이제일제당 (주) O-아세틸 호모세린을 생산하는 미생물 및 상기 미생물을 이용하여 o-아세틸 호모세린을 생산하는 방법
KR101915433B1 (ko) * 2018-02-13 2018-11-05 씨제이제일제당 (주) 시트레이트 신타아제 (Citrate synthase)의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 L-아미노산 생산방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN 28 November 2019 (2019-11-28), ANONYMOUS : "MULTISPECIES: citrate synthase [Corynebacterium]", XP055964834, retrieved from NCBI Database accession no. WP_034983619 *
JAN VAN OOYEN, STEPHAN NOACK, MICHAEL BOTT, ALEXANDER RETH, LOTHAR EGGELING: "Improved L-lysine production with Corynebacterium glutamicum and systemic insight into citrate synthase flux and activity", BIOTECHNOLOGY AND BIOENGINEERING, WILEY ¬ETC.|, vol. 109, no. 8, 22 August 2012 (2012-08-22), pages 2070 - 2081, XP055111478, ISSN: 00063592, DOI: 10.1002/bit.24486 *

Also Published As

Publication number Publication date
BR112023017369A2 (pt) 2023-10-03
KR102525072B1 (ko) 2023-04-24
EP4282959A1 (en) 2023-11-29
MX2023010437A (es) 2023-09-12
CA3210256A1 (en) 2022-09-15
CN117500920A (zh) 2024-02-02
US20240182872A1 (en) 2024-06-06
JP2024507936A (ja) 2024-02-21
KR20220127077A (ko) 2022-09-19

Similar Documents

Publication Publication Date Title
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2022050671A1 (ko) L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022216088A1 (ko) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163922A1 (ko) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163920A1 (ko) 신규한 시스테인 설피네이트 디설피나제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022005022A1 (ko) L-이소류신 생산능이 강화된 미생물 및 이를 이용한 l-이소류신 생산방법
WO2022191635A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-아미노산 생산 방법
WO2022191633A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 o-아세틸-l-호모세린 또는 l-메티오닌 생산 방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163919A1 (ko) 신규한 우레아제 부속 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163926A1 (ko) 신규한 프롤린 탈수소효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154188A1 (ko) 신규한 폴리케타이드 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163924A1 (ko) 신규한 5,10-메틸렌테트라하이드로폴레이트 리덕타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163941A1 (ko) 신규한 스퍼미딘 신타아제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154189A1 (ko) 신규한 피토엔 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163918A1 (ko) 신규한 테트라하이드로디피콜리네이트 n-숙시닐트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163925A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22767531

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023551745

Country of ref document: JP

Ref document number: 2022767531

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 3210256

Country of ref document: CA

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023017369

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: MX/A/2023/010437

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 18549838

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 202280020564.4

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2022767531

Country of ref document: EP

Effective date: 20230824

ENP Entry into the national phase

Ref document number: 112023017369

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230828

NENP Non-entry into the national phase

Ref country code: DE