WO2022216088A1 - L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법 - Google Patents

L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법 Download PDF

Info

Publication number
WO2022216088A1
WO2022216088A1 PCT/KR2022/005056 KR2022005056W WO2022216088A1 WO 2022216088 A1 WO2022216088 A1 WO 2022216088A1 KR 2022005056 W KR2022005056 W KR 2022005056W WO 2022216088 A1 WO2022216088 A1 WO 2022216088A1
Authority
WO
WIPO (PCT)
Prior art keywords
microorganism
protein
arginine
seq
present application
Prior art date
Application number
PCT/KR2022/005056
Other languages
English (en)
French (fr)
Inventor
김효경
장진숙
최선형
오해나
윤병훈
김형준
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to EP22784997.3A priority Critical patent/EP4321622A1/en
Priority to MX2023011892A priority patent/MX2023011892A/es
Priority to AU2022253999A priority patent/AU2022253999A1/en
Priority to JP2023562457A priority patent/JP2024514138A/ja
Priority to BR112023020855A priority patent/BR112023020855A2/pt
Priority to CN202280040469.0A priority patent/CN118613586A/zh
Publication of WO2022216088A1 publication Critical patent/WO2022216088A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/10—Citrulline; Arginine; Ornithine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • the present application relates to a weakened protein comprising the amino acid sequence of SEQ ID NO: 1, L-arginine-producing microorganisms; and L-arginine.
  • L-arginine is used for medicinal purposes such as liver function promoter, brain function promoter, and general amino acid formulation.
  • the present inventors have completed the present application by developing a microorganism of the genus Corynebacterium that produces L-arginine and a method for producing L-arginine using the same.
  • One object of the present application is to provide a recombinant microorganism of the genus of Corynebacterium producing L-arginine, in which the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 is weakened.
  • Another object of the present application is to provide a method for producing L-arginine, comprising culturing a recombinant microorganism of the genus Corynebacterium in which the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 is weakened in a medium. .
  • the microorganism of the genus Corynebacterium in which the protein comprising the amino acid sequence of SEQ ID NO: 1 of the present application is weakened can produce L-arginine in high yield, and thus can be usefully used in industrial production.
  • One aspect of the present application is to provide a recombinant microorganism of the genus of Corynebacterium in which the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 is weakened.
  • the protein of the present application may have, include, or consist of, or essentially consist of, the amino acid sequence set forth in SEQ ID NO: 1.
  • the protein comprising the amino acid sequence of SEQ ID NO: 1 may be an endogenous protein of the microorganism of the present application, but is not limited thereto.
  • the amino acid sequence of SEQ ID NO: 1 can be obtained from a known database, National Institutes of Health (NIH GenBank).
  • the amino acid sequence of SEQ ID NO: 1 is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, It may comprise an amino acid sequence having at least 99%, 99.5%, 99.7% or 99.9% homology or identity.
  • variants having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added are also included within the scope of the present application. is self-evident
  • sequence additions or deletions naturally occurring mutations, silent mutations or conservation within the N-terminus, C-terminus and/or within the amino acid sequence that do not alter the function of the variants of the present application It is a case of having an enemy substitution.
  • conservative substitution means substituting one amino acid with another amino acid having similar structural and/or chemical properties. Such variants may have, for example, one or more conservative substitutions while still retaining one or more biological activities. Such amino acid substitutions may generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. For example, among amino acids with electrically charged amino acids, positively charged (basic) amino acids are arginine, lysine, and histidine, and negatively charged (acidic) amino acids are glutamic acid and arpartate.
  • nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan and proline
  • polar or hydrophilic ( hydrophilic) amino acids include serine, threonine, cysteine, tyrosine, asparagine and glutamine
  • aromatic amino acids among the amino acids include phenylalanine, tryptophan and tyrosine.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or protein is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of a sequence under moderate or high stringent conditions. It is apparent that hybridization also includes hybridization with polynucleotides containing common codons or codons taking codon degeneracy into account in the polynucleotide.
  • a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap open penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • polynucleotide encoding the protein comprising the amino acid sequence of SEQ ID NO: 1 may be named NCgl2608 gene.
  • polynucleotide refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are linked in a long chain by covalent bonds, and more specifically, encoding the variant. polynucleotide fragments.
  • the polynucleotide encoding the variant of the present application may include a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 1.
  • the polynucleotide of the present application may have or include the nucleotide sequence of SEQ ID NO: 2.
  • the polynucleotide of the present application may consist of, or consist essentially of, the nucleotide sequence of SEQ ID NO: 2.
  • the polynucleotides of the present application are various in the coding region within the range that does not change the amino acid sequence of the variants of the present application. Deformation can be made.
  • the polynucleotide of the present application has 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, homology or identity to the nucleotide sequence of SEQ ID NO: 2, has or comprises a nucleotide sequence of 97% or more, 98% or more, and less than 100%, or has 70% or more, 75% or more, 80% or more, 85% or more, 90% or more homology or identity to the sequence of SEQ ID NO: 2 % or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% of the nucleotide sequence, but may consist essentially of, but is not limited to.
  • the polynucleotide of the present application is a probe that can be prepared from a known gene sequence, for example, a sequence that can hybridize under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application, without limitation. may be included.
  • the "stringent condition” means a condition that enables specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • polynucleotides with high homology or identity 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or a condition in which polynucleotides having 99% or more homology or identity hybridize with each other and polynucleotides with lower homology or identity do not hybridize, or a washing condition of conventional Southern hybridization at 60°C, 1 ⁇ SSC, 0.1% SDS, specifically 60° C., 0.1 ⁇ SSC, 0.1% SDS, more specifically 68° C., 0.1 ⁇ SSC, 0.1% SDS at a salt concentration and temperature equivalent to one wash, specifically two to three times conditions can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other.
  • adenine is complementary to thymine
  • cytosine is complementary to guanine.
  • the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary to the overall sequence as well as substantially similar nucleotide sequences.
  • a polynucleotide having homology or identity to the polynucleotide of the present application can be detected using the hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60° C., 63° C. or 65° C., but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • the appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (eg, J. Sambrook et al., supra).
  • microorganism or strain
  • microorganism includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially, and causes such as insertion of an external gene or enhanced or inactivated activity of an intrinsic gene
  • a specific mechanism is weakened or enhanced as a microorganism, and may be a microorganism including genetic modification for the production of a desired protein, protein or product.
  • the microorganism of the present application is a microorganism in which a protein comprising the amino acid sequence of SEQ ID NO: 1 of the present application is weakened or a polynucleotide encoding it is deleted;
  • the protein comprising the amino acid sequence of SEQ ID NO: 1 of the present application may be a microorganism (eg, a recombinant microorganism) genetically modified through a vector such that the protein comprising the amino acid sequence is weakened or the polynucleotide encoding the same is deleted, but is not limited thereto.
  • the microorganism of the present application may be a microorganism having L-arginine-producing ability.
  • the microorganism of the present application may be a microorganism having an increased ability to produce L-arginine compared to the parent strain.
  • the microorganism of the present application is a protein comprising the amino acid sequence of SEQ ID NO: 1 of the present application to the parent strain (eg, a parent strain that has naturally L-arginine-producing ability or does not have L-arginine-producing ability) is weakened or a poly encoding the same It may be a microorganism in which L-arginine-producing ability is conferred due to a deletion of the nucleotide, but is not limited thereto.
  • the recombinant microorganism of the present application is transformed through a vector such that the protein containing the amino acid sequence of SEQ ID NO: 1 of the present application is weakened or the polynucleotide encoding it is deleted,
  • a protein containing the amino acid sequence of SEQ ID NO: 1 of the present application to a natural wild-type microorganism or a microorganism producing L-arginine or a polynucleotide encoding the same is deficient
  • L- arginine-producing ability may be a microorganism in which the protein comprising the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 1 is increased compared to that of the unmodified microorganism, but is not limited thereto.
  • the unmodified microorganism which is the target strain for comparing whether the increase in L-arginine production capacity
  • Corynebacterium glutamicum KCCM10741P van der Rest et al., Appl Microbiol) Biotechnol 52:541-545, 1999
  • wild-type Corynebacterium glutamicum ATCC13869 may be a strain in which the argR gene is deleted (eg, Corynebacterium glutamicum CJ1R), but is not limited thereto.
  • the recombinant strain with increased production capacity is about 1% or more, specifically about 1% or more, about 2.5% or more, about 5% or more, compared to the L-arginine production capacity of the parent strain or unmodified microorganism before mutation.
  • the upper limit is not particularly limited, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 40% or less, about 30 % or less or about 25% or less), but is not limited thereto, as long as it has an increased amount of + value compared to the production capacity of the parent strain or unmodified microorganism before mutation.
  • the recombinant strain with increased production capacity has an L-arginine production capacity of about 1.1 times or more, about 1.12 times or more, about 1.13 times or more, or 1.14 times or more (the upper limit is a special There is no limitation, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less) may be increased, but is not limited thereto.
  • the term "about” is a range including all of ⁇ 0.5, ⁇ 0.4, ⁇ 0.3, ⁇ 0.2, ⁇ 0.1, etc., including all numerical values in a range equal to or similar to the numerical value following the term about, but not limited
  • the term "unmodified microorganism” does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a wild-type strain or a natural-type strain itself, or a genetic variation caused by natural or artificial factors. It may mean the strain before being changed.
  • the unmodified microorganism may refer to a microorganism before weakening or deletion of a polynucleotide encoding the protein comprising the amino acid sequence of SEQ ID NO: 1 described herein.
  • the "unmodified microorganism” may be used interchangeably with "strain before modification", “microbe before modification”, “unmodified strain”, “unmodified strain”, “unmodified microorganism” or "reference microorganism”.
  • the microorganism of the genus Corynebacterium of the present application is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium callunae ( Corynebacterium callunae ), Corynebacterium stationis ( Corynebacterium stationis ), Corynebacterium singulare ( Corynebacterium singulare ) Corynebacterium halotolerans ( Corynebacterium halotolerans ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Corynebacterium pollutisoli ( Coryne
  • the recombinant microorganism of the present application may be a microorganism in which all or part of the polynucleotide encoding the protein consisting of the amino acid sequence of SEQ ID NO: 1 is deleted.
  • the microorganism of the present application may be a microorganism in which the activity of an arginine transcription repressor (ArgR, arginine repressor) is further weakened.
  • the microorganism of the present application may be a microorganism in which all or part of the argR gene is further deleted.
  • the ArgR may include a polypeptide set forth in the amino acid sequence of SEQ ID NO: 13.
  • the argR gene may include a polynucleotide described in the nucleotide sequence of SEQ ID NO: 14, but is not limited thereto.
  • the microorganism of the present application is additionally carbamoyl phosphate synthase small subunit (CarA: carbamoyl phosphate synthase small subunit) and / or large subunit (CarB: carbamoyl phosphate synthase large subunit) activity is enhanced or normal carbamoyltransferase F (ArgF: ornithine carbamoyltransferase F) or may be a microorganism containing a combination thereof.
  • CarA carbamoyl phosphate synthase small subunit
  • CarB carbamoyl phosphate synthase large subunit
  • ArgF ornithine carbamoyltransferase F
  • the microorganism of the present application is Corynebacterium glutamicum KCCM10741P (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999) in which the NCgl2608 gene is deleted or Corynebacterium glutamicum with enhanced carA and/or carB protein activity in addition to the strain in which the NCgl2608 gene is deleted in Corynebacterium glutamicum CJ1R It may be a cum microbe.
  • the microorganism of the present application may be a strain in which the NCgl2608 gene is deleted in Corynebacterium glutamicum KCCM10741P or a microorganism additionally expressing normal argF in Corynebacterium glutamicum CJ1R, and the microorganism expressing the normal argF may additionally be a Corynebacterium glutamicum microorganism with enhanced carA and/or carB protein activity.
  • the argF protein may include a polypeptide described in the amino acid sequence of SEQ ID NO: 15, and the argF gene may include a polynucleotide described in the nucleic acid sequence of SEQ ID NO: 16, but is not limited thereto.
  • the carA protein may include the polypeptide set forth in the amino acid sequence of SEQ ID NO: 17, the carB protein may include the polypeptide set forth in SEQ ID NO: 19, and the carA gene is a polynucleotide described in the nucleic acid sequence of SEQ ID NO: 18, the The carB gene may include a polynucleotide described in the nucleotide sequence of SEQ ID NO: 20.
  • the term "weakening" of a protein is a concept that includes both reduced or no activity compared to intrinsic activity.
  • the attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, attenuation, and the like.
  • the attenuation is when the activity of the protein itself is reduced or eliminated compared to the activity of the protein possessed by the original microorganism due to mutation of the polynucleotide encoding the protein, etc.
  • the overall protein activity level and/or concentration (expression amount) in the cell is lower than that of the native strain due to (translation) inhibition, etc., when the expression of the polynucleotide is not made at all, and/or when the expression of the polynucleotide is Even if there is no protein activity, it may also be included.
  • intrinsic activity refers to the activity of a specific protein originally possessed by the parent strain, wild-type or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification”. "Inactivation, deficiency, reduction, downregulation, reduction, attenuation” of protein activity compared to intrinsic activity means that the activity of a specific protein originally possessed by the parent strain or unmodified microorganism before transformation is lowered.
  • the attenuation of the protein activity may be performed by any method known in the art, but is not limited thereto, and may be achieved by application of various methods well known in the art (eg, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
  • the attenuation of the protein of the present application is
  • modification of the gene sequence encoding the protein to remove or attenuate the activity of the protein eg, one or more nucleotides on the nucleotide sequence of the protein gene to encode the modified protein to remove or attenuate the activity of the protein) deletion/replacement/addition of);
  • an antisense oligonucleotide eg, antisense RNA
  • an antisense oligonucleotide that complementarily binds to the transcript of the gene encoding the protein
  • deletion of a part or all of the gene encoding the protein may be the removal of the entire polynucleotide encoding the endogenous target protein in the chromosome, replacement with a polynucleotide in which some nucleotides are deleted, or replacement with a marker gene.
  • the expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the modification of the nucleotide sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the protein for example, encodes another start codon having a lower protein expression rate than the intrinsic start codon. It may be substituted with a nucleic acid nucleotide sequence, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above deletes, inserts, non-conservative or conservative substitution of the amino acid sequence of the protein or the polynucleotide sequence encoding the protein to weaken the activity of the protein. Or a combination thereof may result in a mutation in sequence, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto.
  • the expression of a gene may be inhibited or attenuated, but is not limited thereto.
  • antisense oligonucleotide eg, antisense RNA
  • antisense RNA an antisense oligonucleotide that complementarily binds to the transcript of the gene encoding the protein
  • RTE reverse transcription engineering
  • the term “enhancement” of the activity of a protein means that the activity of the protein is increased compared to the intrinsic activity.
  • the reinforcement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.
  • activation, enhancement, up-regulation, overexpression, and increase may include all of those exhibiting an activity that was not originally possessed, or exhibiting an improved activity compared to an intrinsic activity or an activity prior to modification.
  • the "intrinsic activity” refers to the activity of a specific protein originally possessed by the parent strain or unmodified microorganism before the transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification”.
  • Enhancement means that the activity and/or concentration (expression) of a specific protein originally possessed by the parent strain or unmodified microorganism before transformation. amount), which means improved.
  • the enhancement may be achieved by introducing an exogenous protein, or by enhancing the activity and/or concentration (expression amount) of an endogenous protein. Whether or not the activity of the protein is enhanced can be confirmed from an increase in the activity level, expression level, or amount of a product discharged from the protein.
  • the enhancement of the activity of the protein can be applied by various methods well known in the art, and is not limited as long as it can enhance the activity of the target protein compared to the microorganism before modification. Specifically, it may be one using genetic engineering and/or protein engineering well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (eg, Sitnicka et al. Functional Analysis of Genes. Advances in Cell). Biology 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • the enhancement of the protein of the present application is
  • modification of the polynucleotide sequence encoding the protein to enhance the protein activity eg, modification of the polynucleotide sequence of the protein gene to encode the modified protein to enhance the activity of the protein
  • the increase in the intracellular copy number of the polynucleotide encoding the protein is achieved by introduction of a vector, to which the polynucleotide encoding the protein is operably linked, capable of replicating and functioning independently of the host, into a host cell.
  • the polynucleotide encoding the protein may be achieved by introducing one copy or two or more copies into a chromosome in a host cell.
  • the introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome in the host cell into the host cell, but is not limited thereto.
  • the vector is the same as described above.
  • Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the protein with a sequence with strong activity is, for example, deletion, insertion, non-conservative or Conservative substitution or a combination thereof may result in a mutation in the sequence, or replacement with a sequence having a stronger activity.
  • the expression control region is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling the termination of transcription and translation.
  • the original promoter may be replaced with a strong promoter, but is not limited thereto.
  • Examples of known strong promoters include CJ1 to CJ7 promoters (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, etc., but is not limited thereto.
  • the modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the protein is, for example, a nucleotide encoding another start codon having a higher protein expression rate than the intrinsic start codon. It may be substituted with a sequence, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may include deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the protein or the polynucleotide sequence encoding the protein, or A combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto.
  • the replacement may be specifically performed by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
  • the vector used may further include a selection marker for confirming whether or not the chromosome is inserted.
  • the selection marker is the same as described above.
  • the introduction of a foreign polynucleotide exhibiting protein activity may be introduction of a foreign polynucleotide encoding a protein exhibiting the same/similar activity as the protein into a host cell.
  • the foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same/similar activity as the protein.
  • the method used for the introduction may be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to generate a protein and increase its activity.
  • Codon optimization of the polynucleotide encoding the protein is codon-optimized so that the transcription or translation of the endogenous polynucleotide is increased in the host cell, or the transcription and translation of the foreign polynucleotide is optimized in the host cell. It may be that its codons are optimized so that the
  • Selecting an exposed site by analyzing the tertiary structure of the protein and modifying or chemically modifying it for example, compares the sequence information of the protein to be analyzed with a database in which sequence information of known proteins is stored to determine the degree of sequence similarity. Accordingly, it may be to determine a template protein candidate, check the structure based on this, and select an exposed site to be modified or chemically modified and modified or modified.
  • Such enhancement of protein activity is to increase the activity or concentration of the corresponding protein based on the activity or concentration of the protein expressed in the wild-type or pre-modified microbial strain, or to increase the amount of product produced from the protein.
  • the present invention is not limited thereto.
  • the term "vector” refers to a nucleotide sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so that the target polypeptide can be expressed in a suitable host. DNA preparations.
  • the expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors may be used.
  • pBluescript II-based pGEM-based, pTZ-based, pCL-based, pET-based and the like
  • pDZ pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like
  • pC1BAC vectors and the like can be used.
  • a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion.
  • the insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted.
  • the selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. Markers to be given can be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
  • the term "transformation” refers to introducing a vector including a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell.
  • the polynucleotide includes DNA and/or RNA encoding a target polypeptide.
  • the polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the target variant of the present application and the polynucleotide sequence are functionally linked.
  • Part or all of the polynucleotide in the microorganism of the present application is modified by (a) homologous recombination using a vector for chromosome insertion in the microorganism or genome editing using engineered nuclease (e.g., CRISPR-Cas9) and/or (b) It may be induced by light and/or chemical treatments such as, but not limited to, ultraviolet and radiation.
  • the method for modifying part or all of the gene may include a method by DNA recombination technology.
  • a part or all of the gene may be deleted.
  • the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
  • Another aspect of the present application provides a method for producing L-arginine, comprising culturing a recombinant microorganism of the genus Corynebacterium in which the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 is weakened in a medium.
  • Proteins, attenuated microorganisms, and the like comprising the amino acid sequence of SEQ ID NO: 1 are the same as those described in the other embodiments.
  • the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum, but is not limited thereto.
  • the microorganism may have an arginine transcriptional repressor (ArgR) activity further weakened or an argR gene may be further deleted, but is not limited thereto, and this is as described in another aspect.
  • ArgR arginine transcriptional repressor
  • the term "cultivation” means growing the microorganisms of the genus Corynebacterium of the present application in appropriately controlled environmental conditions.
  • the culture process of the present application may be performed according to a suitable medium and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art according to the selected strain.
  • the culture may be a batch, continuous and/or fed-batch, but is not limited thereto.
  • the term "medium” refers to a material in which nutrients required for culturing the microorganism of the genus Corynebacterium of the present application are mixed as a main component, and includes water essential for survival and development, as well as nutrients and development supplies, etc.
  • any medium and other culture conditions used for culturing the microorganisms of the genus Corynebacterium of the present application may be used without particular limitation as long as they are media used for culturing conventional microorganisms, but the genus Corynebacterium of the present application
  • the microorganisms can be cultured in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid and/or vitamin, etc. under aerobic conditions while controlling temperature, pH, and the like.
  • the culture medium for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology” by the American Society for Bacteriology (Washington D.C., USA, 1981)].
  • the carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, and the like; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine
  • organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract
  • the phosphorus may include potassium first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto.
  • potassium first potassium phosphate potassium phosphate
  • second potassium phosphate or a sodium-containing salt corresponding thereto.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, the present invention is not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium.
  • an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without or without gas to maintain anaerobic and microaerobic conditions, it is not
  • the culture temperature may be maintained at 20 to 45 °C, specifically, 25 to 40 °C, and may be cultured for about 10 to 160 hours, but is not limited thereto.
  • L-arginine prepared by the culturing of the present application may be secreted into the medium or remaining in the cells.
  • the L-arginine production method of the present application includes the steps of preparing the microorganism of the genus Corynebacterium of the present application, preparing a medium for culturing the microorganism, or a combination thereof (regardless of the order, in any order) , for example, prior to the culturing step, may further include.
  • the L-arginine production method of the present application may further include recovering L-arginine from the microorganism of the genus Corynebacterium according to the culture medium (the culture medium) or the culture medium according to the culture.
  • the recovering step may be further included after the culturing step.
  • the recovery may be to collect the desired L-arginine using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method. .
  • a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method.
  • centrifugation, filtration, treatment with a crystallized protein precipitating agent (salting out method) extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity
  • Various chromatography such as island chromatography, HPLC, or a combination thereof may be used, and the desired L-arginine may be recovered from the medium or microorganism using a suitable method known in the art.
  • the L-arginine production method of the present application may include an additional purification step.
  • the purification may be performed using a suitable method known in the art.
  • the recovery step and the purification step are performed continuously or discontinuously, regardless of the order, or are integrated simultaneously or in one step. may be performed, but is not limited thereto.
  • Another aspect of the present application is a microorganism of the genus Corynebacterium with weakened activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 of the present application; the culture medium; Or to provide a composition for preparing L- arginine comprising a combination thereof.
  • composition of the present application may further include any suitable excipients commonly used in compositions for the production of amino acids, and these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc.
  • excipients commonly used in compositions for the production of amino acids
  • these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc.
  • the present invention is not limited thereto.
  • the protein, attenuation, microorganism, culture and medium, etc. comprising the amino acid sequence of SEQ ID NO: 1 are as described in the other aspects above.
  • Another aspect of the present application provides a method for producing a microorganism of the genus Corynebacterium, comprising the step of weakening the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1.
  • Another aspect of the present application provides a use of L- arginine production of a microorganism of the genus Corynebacterium, in which the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 is weakened.
  • the protein, weakening, and microorganism including the amino acid sequence of SEQ ID NO: 1 are as described in the other aspects .
  • the plasmid obtained using EZ-Tn5TM ⁇ R6K ⁇ ori/KAN-2> Tnp TransposomeTM Kit (Epicentre) was used for Corynebacterium glutamicum KCCM10741P (Korea Patent Registration No. No. 0791659) as the parent strain, transformed by the electric pulse method (Appl. Microbiol. Biothcenol. (1999) 52:541-545), and spread on a complex plate medium containing kanamycin (25 mg/l) to about 20,000 Dog colonies were obtained.
  • Glucose 10 g peptone 10 g, beef extract 5 g, yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, urea 2 g, sorbitol 91 g, agar 20 g (based on 1 liter of distilled water)
  • Glucose 6% Ammonium Sulfate 3%, Potassium Monophosphate 0.1%, Magnesium Sulphate 7 mustard 0.2%, CSL (corn steep liquor) 1.5%, NaCl 1%, Yeast Extract 0.5%, Biotin 100 mg/L, CaCO 3 3 %, (based on 1 liter of distilled water).
  • KCCM10741P/mt-5 was finally selected as a strain with significantly improved L-arginine production ability.
  • the genomic DNA of KCCM10741P/mt-5 was extracted, cut, ligated, transformed into E. coli DH5 ⁇ , and plated on LB solid medium containing kanamycin (25 mg/l). After selecting 20 transformed colonies, a plasmid containing a part of an unknown gene was obtained, and primer 1 (SEQ ID NO: 3) and primer 2 (SEQ ID NO: 3) of the EZ-Tn5TM ⁇ R6K ⁇ ori/KAN-2> Tnp TransposomeTM Kit ( As a result of analyzing the nucleotide sequence using SEQ ID NO: 4), it was found that the gene comprising the nucleotide sequence of SEQ ID NO: 2 was inactivated based on the nucleotide sequence reported to the National Institutes of Health (NIH Genbank). became
  • primers 3 to 6 were synthesized and are shown in Table 3.
  • Primer 3 (SEQ ID NO: 5) tcggtacccggggatccTCGGTGGCGGTTTCGGC
  • Primer 4 (SEQ ID NO: 6) TTGCAGAAAGGGATACCAGGGCTAGCTCATAGAC Primer 5 (SEQ ID NO: 7) GGTATCCCTTTCTGCAACGATGTGCTGTGTGACG
  • Primer 6 (SEQ ID NO: 8) tgcaggtcgactctagaAGGACCTGGAAAAGGGC
  • primer 3 (SEQ ID NO: 5), primer 4 (SEQ ID NO: 6), primer 5 (SEQ ID NO: 6) to have a BamHI site at the 5' end and an XbaI restriction enzyme site at the 3' end No. 7
  • primer 6 (SEQ ID NO: 8) (Table 2) was synthesized and PCR [Sambrook et al, Molecular Cloning, a Laboratory Manual (1989) using chromosomal DNA of wild-type Corynebacterium glutamicum ATCC 13869 as a template) , Cold Spring Harbor Laboratories].
  • plasmid was obtained using a plasmid extraction method, and this plasmid was named pDZ- ⁇ NCgl2608.
  • Example 5 Construction of a strain lacking the NCgl2608 gene derived from Corynebacterium glutamicum KCCM10741P and evaluation of L-arginine production ability
  • pDZ- ⁇ NCgl2608 was transformed into an L-arginine-producing strain, Corynebacterium glutamicum KCCM10741P, by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol). Biotechnol 52:541-545, 1999).
  • the parent strain Corynebacterium glutamicum KCCM10741P and the strain Corynebacterium glutamicum KCCM10741P- ⁇ NCgl2608 prepared in Example 6 were inoculated into a 250 ml corner-baffle flask containing 25 ml of the following seed medium, Incubated with shaking at 30 °C for 20 hours at 200 rpm. Then, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium and cultured with shaking at 30° C. for 72 hours at 200 rpm.
  • the composition of the species medium and the production medium is as follows, respectively.
  • Example 6 Construction of a strain in which the NCgl2608 gene is deleted from Corynebacterium glutamicum CJ1R and evaluation of L-arginine production ability
  • a recombinant vector for deletion of the gene argR was prepared in the same manner as in Example 4, and the primers used for vector construction are shown in Table 5.
  • Primers 7 to 10 for constructing a fragment for deletion of the argR gene primer used nucleotide sequence
  • Primer 7 (SEQ ID NO: 9) tcggtacccggggatccAGCAGGCCTTAAGGGTAAG
  • Primer 8 (SEQ ID NO: 10) AGGGGCGCTGTCTTACCTCGGCTGGTGGGCCAGC
  • Primer 9 (SEQ ID NO: 11) GGTAAGACAGCGCCCCTAGTTCAAGGCTTGTTAATC Primer 10 (SEQ ID NO: 12) tgcaggtcgactctagaACCGTTGAACTGCTTGCCAG
  • this plasmid was named pDZ- ⁇ argR.
  • Corynebacterium glutamicum wild strain was transformed in the same manner as in Example 6 using pDZ- ⁇ argR, and the transformed strain was transformed on the chromosome by PCR using primers 7 and 10.
  • a strain lacking argR was identified.
  • the recombinant strain was named CJ1R, and thus a strain lacking the NCgl2608 gene was prepared in the same manner as in Example 6 for Corynebacterium glutamicum CJ1R, which had arginine-producing ability, and CJ1R- ⁇ NCgl2608 named.
  • CJ1R- ⁇ NCgl2608, in which the NCgl2608 gene is deleted was cultured in the same manner as in Example 5, and the production of L-arginine was measured by HPLC (Waters 2478) after completion of the culture. 6 is shown.
  • the strain CJ1R- ⁇ NCgl2608 was named CA06-7204 and deposited with the Korea Center for Conservation of Microorganisms (KCCM), a trustee under the Budapest Treaty, on February 23, 2021, and was given an accession number KCCM12961P.
  • KCCM Korea Center for Conservation of Microorganisms

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 출원은 서열번호 1의 아미노산 서열을 포함하는 단백질이 약화된, L-아르기닌 생산 미생물 및 이를 이용한, L-아르기닌 제조방법에 관한 것이다.

Description

L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 L-아르기닌 생산방법
본 출원은 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된, L-아르기닌 생산 미생물; 및 L-아르기닌의 제조방법에 관한 것이다.
L-아르기닌(L-arginine)은 간 기능 촉진제, 뇌기능 촉진제, 종합 아미노산 제제 등의 의약용으로 사용되고 있으며, 생선묵 첨가제, 건강음료 첨가제, 고혈압 환자의 식염 대체용 등의 식품용으로도 최근 각광받고 있는 물질이다. 산업적으로 이용 가능한 고농도의 아르기닌을 생산하기 위하여 미생물을 이용하려는 연구가 지속적으로 이루어지고 있으며, 글루타민산(glutamate) 생산 균주인 브레비박테리움(Brevibacterium) 또는 코리네박테리움(Corynebacterium)속 미생물로부터 유도된 변이주를 이용하는 방법, 세포융합으로 생육 개선된 아미노산 생산 균주를 이용하는 방법 등이 보고되었다. 한편, 코리네박테리움 속 미생물은 L-lysine 배출능을 가지는 lysE가 동일한 염기성 아미노산인 L-아르기닌도 배출한다고 보고된 바 있으며 (Bellmann A, et al, Microbiology, 147:1765-1774, 2001), 상기 유전자의 강화를 통해 L-아르기닌 생산균주의 생산능을 향상시키는 방법이 알려져 있다(미국공개특허번호 US 2003-0113899 A1).
본 발명자들은 L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 L-아르기닌 생산방법을 개발하여 본 출원을 완성하였다.
본 출원의 하나의 목적은 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된, L-아르기닌을 생산하는 코리네박테리움 속 (the genus of Corynebacterium) 재조합 미생물을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 코리네박테리움 속 재조합 미생물을 배지에서 배양하는 단계를 포함하는, L-아르기닌 제조방법을 제공하는 것이다.
본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질이 약화된 코리네박테리움 속 미생물은 고수율로 L-아르기닌을 생산할 수 있어 산업적 생산에 유용하게 이용될 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 출원의 하나의 양태는 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 코리네박테리움 속 (the genus of Corynebacterium) 재조합 미생물을 제공하는 것이다.
본 출원의 단백질은 서열번호 1로 기재된 아미노산 서열을 가지거나, 포함하거나, 상기 아미노산 서열로 이루어지거나 필수적으로 이루어질(essentially consisting of) 수 있다.
본 출원에 있어서, 상기 서열번호 1의 아미노산 서열을 포함하는 단백질은 본 출원 미생물의 내재적 단백질일 수 있으나, 이에 제한되지 않는다.
상기 서열번호 1의 아미노산 서열은 공지의 데이터 베이스인 미국국립보건원 진뱅크(NIH GenBank)에서 얻을 수 있다. 본 출원에 있어서, 상기 서열번호 1의 아미노산 서열은 상기 서열번호 1로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 변이체에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 변이체도 본 출원의 범위 내에 포함됨은 자명하다.
예를 들어, 상기 아미노산 서열 N-말단, C-말단 그리고/또는 내부에 본 출원의 변이체의 기능을 변경하지 않는 서열 추가 또는 결실, 자연적으로 발생할 수 있는 돌연변이, 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다.
본 출원에서 용어 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 상기 변이체는 하나 이상의 생물학적 활성을 여전히 보유하면서, 예를 들어 하나 이상의 보존적 치환을 가질 수 있다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 예를 들면, 전하를 띠는 곁사슬(electrically charged amino acid)을 갖는 아미노산 중 양으로 하전된(염기성) 아미노산은 알지닌, 리신, 및 히스티딘을, 음으로 하전된(산성) 아미노산은 글루탐산 및 아르파르트산을 포함하고; 전하를 띠지 않는 곁사슬(uncharged amino acid)을 갖는 아미노산 중 비극성 아미노산(nonpolar amino acid)은 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판 및 프롤린을 포함하고, 극성(polar) 또는 친수성(hydrophilic) 아미노산은 세린, 트레오닌, 시스테인, 티로신, 아스파라긴 및 글루타민을 포함하고, 상기 아미노산 중 방향족 아미노산은 페닐알라닌, 트립토판 및 티로신을 포함한다.
본 출원에서 용어, '상동성 (homology)' 또는 '동일성 (identity)'은 두 개의 주어진 아미노산 서열 또는 핵산염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 단백질의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 단백질 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 단백질의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
본 출원에 있어서, 상기 서열번호 1의 아미노산 서열을 포함하는 단백질을 코딩하는 폴리뉴클레오티드는 NCgl2608 유전자로 명명될 수 있다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이체를 코딩하는 폴리뉴클레오티드 단편을 의미한다.
본 출원의 변이체를 코딩하는 폴리뉴클레오티드는 서열번호 1으로 기재된 아미노산 서열을 코딩하는 핵산염기 서열을 포함할 수 있다. 본 출원의 일 예로, 본 출원의 폴리뉴클레오티드는 서열번호 2의 핵산염기 서열을 가지거나 포함할 수 있다. 또한, 본 출원의 폴리뉴클레오티드는 서열번호 2의 핵산염기 서열로 이루어지거나, 필수적으로 구성될 수 있다.
본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 출원의 변이체를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 본 출원의 변이체의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 출원의 폴리뉴클레오티드는 서열번호 2의 핵산염기 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 핵산염기 서열을 가지거나 포함하거나, 또는 서열번호 2의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 핵산염기 서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화할 수 있는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1ХSSC, 0.1% SDS, 구체적으로 60℃, 0.1ХSSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1ХSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산염기 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
본 출원에서 용어, "미생물(또는, 균주)"는 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 단백질, 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
본 출원의 미생물은 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질이 약화 또는 이를 코딩하는 폴리뉴클레오티드가 결손된 미생물; 또는 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질이 약화 또는 이를 코딩하는 폴리뉴클레오티드가 결손되도록 벡터를 통해 유전적으로 변형된 미생물 (예컨대, 재조합 미생물)일 수 있으나, 이에 제한되지 않는다.
본 출원의 미생물은 L-아르기닌 생산능을 가진 미생물일 수 있다.
본 출원의 미생물은 모균주에 비해 L-아르기닌 생산능이 증가된 미생물일 수 있다.
본 출원의 미생물은 모균주(예컨대, 자연적으로 L-아르기닌 생산능을 가지거나 L-아르기닌 생산능이 없는 모균주)에 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질이 약화 또는 이를 코딩하는 폴리뉴클레오티드가 결손되어 L-아르기닌 생산능이 부여된 미생물일 수 있으나 이에 제한되지 않는다.
일 예로, 본 출원의 재조합 미생물은, 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질이 약화 또는 이를 코딩하는 폴리뉴클레오티드가 결손되도록 벡터를 통해 형질 전환되어, 서열번호 1의 아미노산 서열을 포함하는 단백질이 약화 또는 이를 코딩하는 폴리뉴클레오티드가 결손된 균주 또는 미생물로서, 천연의 야생형 미생물 또는 L-아르기닌을 생산하는 미생물에 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질 약화 또는 이를 코딩하는 폴리뉴클레오티드가 결손되어, L-아르기닌 생산능이 천연의 야생형 미생물 또는 서열번호 1의 아미노산 서열을 포함하는 단백질 또는 이를 코딩하는 폴리뉴클레오티드가 비변형된 미생물에 비하여 증가된 미생물일 수 있으나, 이에 제한되는 것은 아니다.
그 예로, 상기 L-아르기닌 생산능의 증가 여부를 비교하는 대상 균주인 비변형 미생물은 코리네박테리움 글루타미쿰 KCCM10741P(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999), 야생형 코리네박테리움 글루타미쿰 ATCC13869에서 argR 유전자가 결손된 균주(예컨대, 코리네박테리움 글루타미쿰 CJ1R)일 수 있으나, 이에 제한되지 않는다.
일 예로, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물의 L-아르기닌 생산능에 비하여 약 1% 이상, 구체적으로는 약 1% 이상, 약 2.5% 이상, 약 5% 이상, 약 6% 이상, 약 7% 이상, 약 8% 이상, 약 9% 이상, 약 10% 이상, 약 10.5% 이상, 약 11% 이상, 약 11.5%이상, 약 12% 이상, 약 12.5% 이상, 약 13% 이상, 약 13.5% 이상 또는 약 14% 이상 (상한값은 특별한 제한은 없으며, 예컨대, 약 200% 이하, 약 150% 이하, 약 100% 이하, 약 50% 이하, 약 40% 이하, 약 30% 이하 또는 약 25% 이하 일 수 있음) 증가된 것일 수 있으나, 변이 전 모균주 또는 비변형 미생물의 생산능에 비해 +값의 증가량을 갖는 한, 이에 제한되지 않는다. 다른 예에서, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물에 비하여, L-아르기닌 생산능이 약 1.1배 이상, 약 1.12배 이상, 약 1.13배 이상 또는 1.14배 이상 (상한값은 특별한 제한은 없으며, 예컨대, 약 10배 이하, 약 5배 이하, 약 3배 이하, 또는 약 2배 이하일 수 있음) 증가된 것일 수 있으나, 이에 제한되지 않는다. 상기 용어 "약(about)"은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
본 출원에서 용어, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 본 명세서에 기재된 서열번호 1의 아미노산 서열을 포함하는 단백질의 약화 또는 이를 코딩하는 폴리뉴클레오티드의 결손이 되기 전의 미생물을 의미할 수 있다. 상기 "비변형 미생물"은 "변형 전 균주", "변형 전 미생물", "비변이 균주", "비변형 균주", "비변이 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
본 출원의 또 다른 일 예로, 본 출원의 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있다.
구체적으로, 본 출원의 재조합 미생물은 서열번호 1의 아미노산 서열로 이루어진 단백질을 코딩하는 폴리뉴클레오티드 전체 또는 일부가 결손된 미생물일 수 있다.
또한, 본 출원의 미생물은 아르기닌 전사 억제 인자(ArgR, arginine repressor)의 활성이 추가적으로 약화된 미생물일 수 있다. 구체적으로, 본 출원의 미생물은 argR 유전자 전체 또는 일부가 추가로 결손된 미생물일 수 있다.
상기 ArgR은 서열번호 13의 아미노산 서열로 기재된 폴리펩티드를 포함하는 것일 수 있다. 또한, 상기 argR 유전자는 서열번호 14의 핵산염기 서열로 기재된 폴리뉴클레오티드을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
더불어, 본 출원의 미생물은 추가적으로 카바모일 포스페이트 신타제 스몰 서브유닛(CarA: carbamoyl phosphate synthase small subunit) 및/또는 라지 서브유닛(CarB: carbamoyl phosphate synthase large subunit) 활성이 강화되거나 정상적 카바모일트랜스퍼라제 F(ArgF: ornithine carbamoyltransferase F)를 발현하거나 또는 이들의 조합을 포함하는 미생물일 수 있다.
일 예로, 본 출원의 미생물은 코리네박테리움 글루타미쿰 KCCM10741P(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999)에서 NCgl2608유전자가 결손된 균주 또는 코리네박테리움 글루타미쿰 CJ1R 에서 NCgl2608유전자가 결손된 균주에 추가적으로 carA 및/또는 carB 단백질 활성이 강화된 코리네박테리움 글루타미쿰 미생물일 수 있다.
또한, 본 출원의 미생물은 코리네박테리움 글루타미쿰 KCCM10741P에서 NCgl2608유전자가 결손된 균주 또는 코리네박테리움 글루타미쿰 CJ1R에서 추가적으로 정상적 argF를 발현하는 미생물일 수 있으며, 상기 정상적 argF를 발현하는 미생물은 추가적으로 carA 및/또는 carB 단백질 활성이 강화된 코리네박테리움 글루타미쿰 미생물일 수 있다.
상기 argF 단백질은 서열번호 15의 아미노산 서열로 기재된 폴리펩티드를 포함하는 것일 수 있고, 상기 argF 유전자는 서열번호 16의 핵산염기 서열로 기재된 폴리뉴클레오티드 포함하는 것일 수 있으나, 이에 제한되지 않는다. 또한, 상기 carA 단백질은 서열번호 17의 아미노산 서열로 기재된 폴리펩티드, 상기 carB 단백질은 서열번호 19로 기재된 폴리펩티드를 포함하는 것일 수 있고, 상기 carA 유전자는 서열번호 18의 핵산염기 서열로 기재된 폴리뉴클레오티드, 상기 carB 유전자는 서열번호 20의 핵산염기 서열로 기재된 폴리뉴클레오티드를 포함하는 것일 수 있다.
본 출원에서 용어, 단백질의 "약화"는 내재적 활성에 비하여 활성이 감소되거나 또는 활성이 없는 것을 모두 포함하는 개념이다. 상기 약화는 불활성화(inactivation), 결핍(deficiency), 하향조절(down-regulation), 감소(decrease), 저하(reduce), 감쇠(attenuation) 등의 용어와 혼용될 수 있다.
상기 약화는 상기 단백질을 코딩하는 폴리뉴클레오티드의 변이 등으로 단백질 자체의 활성이 본래 미생물이 가지고 있는 단백질의 활성에 비해 감소 또는 제거된 경우, 이를 코딩하는 폴리뉴클레오티드의 유전자의 발현 저해 또는 단백질로의 번역(translation) 저해 등으로 세포 내에서 전체적인 단백질 활성 정도 및/또는 농도(발현량)가 천연형 균주에 비하여 낮은 경우, 상기 폴리뉴클레오티드의 발현이 전혀 이루어지지 않은 경우, 및/또는 폴리뉴클레오티드의 발현이 되더라도 단백질의 활성이 없는 경우 역시 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주, 야생형 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 단백질의 활성이 내재적 활성에 비하여 "불활성화, 결핍, 감소, 하향조절, 저하, 감쇠"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성에 비하여 낮아진 것을 의미한다.
이러한 단백질의 활성의 약화는, 당업계에 알려진 임의의 방법에 의하여 수행될 수 있으나 이로 제한되는 것은 아니며, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다(예컨대, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 단백질의 약화는
1) 단백질을 코딩하는 유전자 전체 또는 일부의 결손;
2) 단백질을 코딩하는 유전자의 발현이 감소하도록 발현조절영역(또는 발현조절서열)의 변형;
3) 단백질의 활성이 제거 또는 약화되도록 상기 단백질을 구성하는 아미노산 서열의 변형(예컨대, 아미노산 서열 상의 1 이상의 아미노산의 삭제/치환/부가);
4) 단백질의 활성이 제거 또는 약화되도록 상기 단백질을 코딩하는 유전자 서열의 변형 (예를 들어, 단백질의 활성이 제거 또는 약화되도록 변형된 단백질을 코딩하도록 상기 단백질 유전자의 핵산염기 서열 상의 1 이상의 핵산염기의 삭제/치환/부가);
5) 단백질을 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 핵산염기 서열의 변형;
6) 단백질을 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입;
7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 단백질을 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가;
8) 단백질을 코딩하는 유전자 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE); 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
예컨대,
상기 1) 단백질을 코딩하는 상기 유전자 일부 또는 전체의 결손은, 염색체 내 내재적 목적 단백질을 코딩하는 폴리뉴클레오티드 전체의 제거, 일부 뉴클레오티드가 결실된 폴리뉴클레오티드로의 교체 또는 마커 유전자로 교체일 수 있다.
또한, 상기 2) 발현조절영역(또는 발현조절서열)의 변형은, 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절영역(또는 발현조절서열) 상의 변이 발생, 또는 더욱 약한 활성을 갖는 서열로의 교체일 수 있다. 상기 발현조절영역에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 3) 단백질을 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 핵산염기 서열 변형은, 예를 들면, 내재적 개시코돈에 비해 단백질의 발현율이 더 낮은 다른 개시코돈을 코딩하는 핵산염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은 단백질의 활성을 약화하도록 상기 단백질의 아미노산 서열 또는 상기 단백질을 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 약한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 없도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 예를 들면, 폴리뉴클레오티드 서열 내 변이를 도입하여 종결 코돈을 형성시킴으로써, 유전자의 발현을 저해하거나 약화시킬 수 있으나, 이에 제한되지 않는다.
상기 6) 단백질을 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입은 예를 들어 문헌 [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986]을 참고할 수 있다.
상기 7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 단백질을 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가는 mRNA 번역을 불가능하게 하거나 속도를 저하시키는 것일 수 있다.
상기 8) 단백질을 코딩하는 유전자서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE)는 상기 단백질을 코딩하는 유전자의 전사체에 상보적인 안티센스 뉴클레오티드를 만들어 활성을 약화하는 것일 수 있다.
본 출원에서 용어, 단백질의 활성의 "강화"는, 단백질의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 활성화(activation), 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 활성화, 강화, 상향조절, 과발현, 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 단백질의 활성이 내재적 활성에 비하여 "강화", "상향조절", "과발현" 또는 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성 및/또는 농도(발현량)에 비하여 향상된 것을 의미한다.
상기 강화는 외래의 단백질을 도입하거나, 내재적인 단백질의 활성 강화 및/또는 농도(발현량)를 통해 달성할 수 있다. 상기 단백질의 활성의 강화 여부는 해당 단백질의 활성 정도, 발현량 또는 해당 단백질로부터 배출되는 산물의 양의 증가로부터 확인할 수 있다.
상기 단백질의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 단백질의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 단백질의 강화는
1) 단백질을 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가;
2) 단백질을 코딩하는 염색체상의 유전자 발현조절영역을 활성이 강력한 서열로 교체;
3) 단백질을 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 핵산염기 서열의 변형;
4) 단백질 활성이 강화되도록 상기 단백질의 아미노산 서열의 변형;
5) 단백질 활성이 강화도록 상기 단백질을 코딩하는 폴리뉴클레오티드 서열의 변형 (예를 들어, 단백질의 활성이 강화되도록 변형된 단백질을 코딩하도록 상기 단백질 유전자의 폴리뉴클레오티드 서열의 변형);
6) 단백질의 활성을 나타내는 외래 단백질 또는 이를 코딩하는 외래 폴리뉴클레오티드의 도입;
7) 단백질을 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 단백질의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
보다 구체적으로,
상기 1) 단백질을 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가는, 해당 단백질을 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터의 숙주세포 내로의 도입에 의해 달성되는 것일 수 있다. 또는, 해당 단백질을 코딩하는 폴리뉴클레오티드가 숙주세포 내의 염색체 내에 1 카피 또는 2 카피 이상 도입에 의해 달성되는 것일 수 있다. 상기 염색체 내에 도입은 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다. 상기 벡터는 전술한 바와 같다.
상기 2) 단백질을 코딩하는 염색체상의 유전자 발현조절영역(또는 발현조절서열)을 활성이 강력한 서열로 교체는, 예를 들면, 상기 발현조절영역의 활성을 더욱 강화하도록 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 가지는 서열로의 교체일 수 있다. 상기 발현조절영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 그리고 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 일 예로, 본래의 프로모터를 강력한 프로모터로 교체시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터, yccA 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 단백질을 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 핵산염기 서열 변형은, 예를 들면, 내재적 개시코돈에 비해 단백질 발현율이 더 높은 다른 개시코돈을 코딩하는 핵산염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 단백질의 활성을 강화하도록 상기 단백질의 아미노산 서열 또는 상기 단백질을 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 증가하도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 상기 교체는 구체적으로 상동재조합에 의하여 폴리뉴클레오티드를 염색체내로 삽입함으로써 수행될 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 전술한 바와 같다.
상기 6) 단백질의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 상기 단백질과 동일/유사한 활성을 나타내는 단백질을 코딩하는 외래 폴리뉴클레오티드의 숙주세포 내 도입일 수 있다. 상기 외래 폴리뉴클레오티드는 상기 단백질과 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한이 없다. 상기 도입에 이용되는 방법은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 단백질이 생성되어 그 활성이 증가될 수 있다.
상기 7) 단백질을 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 단백질의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 단백질의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 단백질 활성의 강화는, 상응하는 단백질의 활성 또는 농도 발현량이 야생형이나 변형 전 미생물 균주에서 발현된 단백질의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 단백질로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "벡터"는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 핵산염기 서열을 포함하는 DNA 제조물을 포함할 수 있다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 표적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 폴리펩티드가 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 변이체를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 미생물에서 폴리뉴클레오티드의 일부 또는 전체의 변형은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위 (engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오티드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 또 다른 하나의 양태는 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 코리네박테리움 속 재조합 미생물을 배지에서 배양하는 단계를 포함하는, L-아르기닌 제조방법을 제공한다.
상기 서열번호 1의 아미노산 서열을 포함하는 단백질, 약화 및 미생물 등은 상기 다른 양태에서 기재한 바와 같다.
상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰일 수 있으나, 이에 제한되지 않는다.
상기 미생물은 아르기닌 전사 억제 인자(ArgR) 활성이 추가로 약화되거나, argR 유전자가 추가로 결손된 것일 수 있으나, 이에 제한되지 않으며, 이에 대해서는 다른 태양에서 기재한 바와 같다.
본 출원에서, 용어 "배양"은 본 출원의 코리네박테리움 속 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및/또는 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 본 출원의 코리네박테리움 속 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 코리네박테리움 속 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 코리네박테리움 속 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
구체적으로, 코리네박테리움 속 미생물에 대한 배양 배지는 문헌["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)]에서 찾아 볼 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 본 출원의 코리네박테리움 속 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
본 출원의 배양에서 배양온도는 20 내지 45℃구체적으로는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 배양에 의하여 제조된 L-아르기닌은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 L-아르기닌 제조방법은, 본 출원의 코리네박테리움 속 미생물을 준비하는 단계, 상기 미생물을 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 L-아르기닌 생산방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 배양에 따른 배지 코리네박테리움 속 미생물로부터 L-아르기닌을 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 L-아르기닌을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-아르기닌을 회수할 수 있다.
또한, 본 출원의 L-아르기닌 생산방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 L-아르기닌 생산방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 연속적 또는 비연속적으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 또 다른 하나의 양태는 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 코리네 박테리움 속 미생물; 이를 배양한 배지; 또는 이들의 조합을 포함하는 L-아르기닌 제조용 조성물을 제공하는 것이다.
본 출원의 조성물은 아미노산 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 조성물에서, 서열번호 1의 아미노산 서열을 포함하는 단백질, 약화, 미생물, 배양 및 배지 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성을 약화하는 단계를 포함하는, 코리네박테리움 속 미생물의 제조방법을 제공한다.
본 출원의 또 다른 하나의 양태는 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된, 코리네박테리움 속 미생물의 L-아르기닌 생산 용도를 제공한다.
상기 코리네박테리움 속 미생물의 제조방법 및 코리네박테리움 속 미생물의 L-아르기닌 생산 용도에 있어서 상기 서열번호 1의 아미노산 서열을 포함하는 단백질, 약화 및 미생물 등은 상기 다른 양태에서 기재한 바와 같다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 하기 실시예는 본 출원을 예시하기 위한 바람직한 실시양태에 불과한 것이며 따라서, 본 출원의 권리범위를 이에 한정하는 것으로 의도되지는 않는다. 한편, 본 명세서에 기재되지 않은 기술적인 사항들은 본 출원의 기술 분야 또는 유사 기술 분야에서 숙련된 통상의 기술자이면 충분히 이해하고 용이하게 실시할 수 있다.
실시예 1. 트랜스포존을 이용한 무작위적 돌연변이 라이브러리 제작 및 스크리닝
L-아르기닌 생산능이 증가된 균주를 얻기 위하여, EZ-Tn5™ <R6Kγori/KAN-2>Tnp Transposome™ Kit(Epicentre)를 사용하여 얻은 플라스미드를 코리네박테리움 글루타미쿰 KCCM10741P(대한민국 특허등록번호 제 0791659호)를 모균주로 하여 전기펄스법(Appl. Microbiol. Biothcenol.(1999)52:541-545)으로 형질전환하고, 카나마이신 (25 ㎎/ℓ)이 포함된 복합평판배지에 도말하여 약 20,000개의 콜로니를 확보하였다.
<복합평판배지 (pH 7.0)>
포도당 10 g, 펩톤 10 g, 쇠고기 추출물 5 g, 효모 추출물 5 g, 뇌심장 침출액(Brain Heart Infusion) 18.5 g, NaCl 2.5 g, 요소 2 g, 소르비톨 91 g, 한천 20g (증류수 1 리터 기준)
닌하이드린 방법(Moore, S., Stein, W. H., Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem.1948, 176, 367-388)을 이용하여 모균주인 코리네박테리움 글루타미쿰 KCCM10741P 균주 대비 L-아르기닌 생산능이 향상된 상위 10종의 돌연변이주를 선별하였다.
실시예 2: 선별된 무작위적 돌연변이주들의 L-아르기닌 생산능 분석
상기 실시예 1에서 선발한 10종의 돌연변이주들을 대상으로 L-아르기닌 생산능이 재현성있게 증가된 균주들을 최종 선별하기 위하여, 하기의 배지를 이용한 플라스크 배양을 실시하였다. 배양이 완료된 후 HPLC를 이용하여 배양액 내 L-아르기닌 농도를 분석하였고, 각 돌연변이주들의 L-아르기닌 생산 농도를 하기 표 1에 나타내었다.
<생산배지 (pH 7.0)>
포도당 6%, 황산암모늄 3%, 제1인산칼륨 0.1%, 황산마그네슘7수염 0.2%, CSL(옥수수 침지액) 1.5%, NaCl 1%, 효모 추출물 0.5%, 비오틴 100 ㎎/ℓ, CaCO3 3%, (증류수 1리터 기준).
선별한 무작위 돌연변이주 10종의 L-아르기닌 생산 농도
　 균주 L-아르기닌(g/L)
배치 1 배치 2 배치 3 평균
대조군 KCCM10741P 3.1 3.2 3 3.1
1 KCCM10741P/mt-1 2.9 3 2.8 2.9
2 KCCM10741P/mt-2 3 2.9 2.7 2.9
3 KCCM10741P/mt-3 3.1 3 3.1 3.1
4 KCCM10741P/mt-4 2.8 2.9 3.2 3.0
5 KCCM10741P/mt-5 3.5 3.5 3.4 3.5
6 KCCM10741P/mt-6 2.9 3.1 3.2 3.1
7 KCCM10741P/mt-7 3 3.2 2.8 3.0
8 KCCM10741P/mt-8 2.9 2.9 3 2.9
9 KCCM10741P/mt-9 3.1 3.1 2.8 3.0
10 KCCM10741P/mt-10 3 2.9 2.9 2.9
선별한 10종의 변이주들 중 L-아르기닌 생산능이 의미있게 향상된 균주로서 KCCM10741P/mt-5을 최종 선별하였다.
실시예 3: 최종 선별주에서의 L-아르기닌 생산능 증가 원인 규명
상기 실시예 2의 KCCM10741P/mt-5에서 트랜스포존의 무작위적인 삽입에 의해 불활성화된 유전자를 동정하였다.
구체적으로, KCCM10741P/mt-5의 Genomic DNA를 추출하여 절단한 후 연결하여 대장균 DH5α에 형질전환하고, 카나마이신 (25 mg/l)이 포함된 LB 고체배지에 도말하였다. 형질전환된 콜로니 20종을 선별한 후, 미지의 유전자 일부가 포함된 플라스미드를 획득하였고, EZ-Tn5™ <R6Kγori/KAN-2> Tnp Transposome™ Kit의 프라이머 1(서열번호 3) 및 프라이머 2(서열번호 4)를 사용하여 핵산염기 서열을 분석한 결과 미국 국립보건원의 유전자은행(NIH Genbank)에 보고된 핵산염기 서열에 근거하여 서열번호 2의 뉴클레오티드 서열을 포함하는 유전자가 불활성화되어 있음을 알게 되었다.
사용된 프라이머 핵산염기 서열
프라이머 1(서열번호 3) ACCTACAACAAAGCTCTCATCAACC
프라이머 2(서열번호 4) CTACCCTGTGGAACACCTACATCT
야생형 코리네박테리움 글루타미쿰 ATCC 13869에서 서열번호 2를 blast search한 결과 NCgl2608 유전자임을 확인하였다.
실시예 4: NCgl2608 유전자 결손을 위한 재조합 벡터 제작
서열번호 2의 뉴클레오티드 서열을 포함하는 유전자의 불활성화가 L-아르기닌 생산에 미치는 영향을 재확인하기 위해서 코리네박테리움 속 균주의 염색체 상에서 NCgl2608 유전자를 결손시키기 위한 재조합 벡터를 제작하였다.
먼저, 상기 유전자의 결손을 위한 단편을 제작하기 위하여 프라이머 3 내지 6을 합성하였고 이를 표 3에 나타내었다.
유전자의 결손을 위한 단편을 제작하기 위한 프라이머 3 내지 6
사용된 프라이머 핵산염기 서열
프라이머 3 (서열번호 5) tcggtacccggggatccTCGGTGGCGGTTTCGGC
프라이머 4 (서열번호 6) TTGCAGAAAGGGATACCAGGGCTAGCTCATAGAC
프라이머 5 (서열번호 7) GGTATCCCTTTCTGCAACGATGTGCTGTGTGACG
프라이머 6 (서열번호 8) tgcaggtcgactctagaAGGACCTGGAAAAGGGC
서열번호 2에 근거하여 ORF 부위를 결손하기 위하여, 5' 말단에 BamHI과 3' 말단에 XbaI 제한효소 부위를 가지도록 프라이머 3(서열번호 5), 프라이머 4(서열번호 6), 프라이머 5(서열번호 7), 프라이머 6(서열번호 8)(표 2)를 합성하고 야생형 코리네박테리움 글루타미쿰 ATCC 13869의 염색체 DNA를 주형으로 하여 PCR[Sambrook et al, Molecular Cloning, a Laboratory Manual (1989), Cold Spring Harbor Laboratories]을 수행하였다. 이로부터 NCgl2608의 뉴클레오티드 서열로 코딩되는 단백질을 암호화하는 부분의 상단 600bp와 하단 600bp가 연결된 DNA 단편을 획득하였다. 이때, PCR 조건은 변성 95℃, 30초; 어닐링 50℃, 30초; 및 중합반응 72℃, 1분을 30회 반복한 후, 72℃에서 7분간 중합반응을 시켜서 수행되었다. 코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDZ 벡터(대한민국 특허 등록번호 제10-0924065호)와 PCR로 증폭된 상기 단편을 염색체 도입용 제한효소 BamHI과 XbaI으로 처리한 뒤, DNA 접합 효소를 이용하여 연결한 후, 대장균 DH5α에 형질전환하고 카나마이신(25mg/l)이 포함된 LB 고체배지에 도말하였다.
PCR을 통해 상기 목적한 유전자가 삽입된 플라스미드로 형질전환된 콜로니를 선별한 후, 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 이 플라스미드를 pDZ-△NCgl2608라 명명하였다.
실시예 5: 코리네박테리움 글루타미쿰 KCCM10741P 유래의 NCgl2608 유전자가 결손된 균주의 제작 및 L-아르기닌 생산능 평가
pDZ-△NCgl2608을 염색체 상에서의 상동 재조합에 의해 L-아르기닌 생산균주인 코리네박테리움 글루타미쿰 KCCM10741P에 형질 전환시켰다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).
그 후, 4%의 수크로오스를 포함하는 고체평판배지에서 2차 재조합을 하였다. 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질 전환주를 대상으로 프라이머 3과 프라이머 6을 이용하여 PCR법을 통하여 염색체상에서 서열번호 2의 유전자가 결손된 균주를 확인하였다. 상기 재조합 균주를 코리네박테리움 글루타미쿰 KCCM10741P-△NCgl2608라 명명하였다.
상기 제작된 코리네박테리움 글루타미쿰 KCCM10741P-△NCgl2608 균주의 L-아르기닌 생산능을 분석하기 위해 모균주인 코리네박테리움 글루타미쿰 KCCM10741P 균주와 함께 아래와 같은 방법으로 배양하였다.
하기의 종배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 모균주인 코리네박테리움 글루타미쿰 KCCM10741P와 실시예 6에서 제작된 균주 코리네박테리움 글루타미쿰 KCCM10741P-△NCgl2608를 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 72시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종 배지와 생산 배지의 조성은 각각 하기와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 6%, 황산암모늄 3%, 제1인산칼륨 0.1%, 황산마그네슘7수염 0.2%, CSL(옥수수 침지액) 1.5%, NaCl 1%, 효모 추출물 0.5%, 비오틴 100 mg/L
배양 종료 후 HPLC (Waters 2478)에 의해 L-아르기닌의 생산량을 측정하였고, 분석한 L-아르기닌의 농도를 하기 표 4에 나타내었다.
KCCM10741P 유래 KCCM10741P-△NCgl2608의 L-아르기닌 생산능 분석
　 균주 L-아르기닌(g/L)
배치 1 배치 2 배치 3 평균
대조군 KCCM10741P 3 2.9 3.1 3.0
실험군 KCCM10741P-△NCgl2608 3.5 3.7 3.6 3.6
상기 결과와 같이, L-아르기닌 생산균주인 코리네박테리움 글루타미쿰 KCCM10741P으로부터 서열번호 2의 뉴클레오티드 서열을 포함하는 유전자를 결손시켰을 경우, 모균주 대비 L-아르기닌 생산능이 평균 20.0% 증가함을 확인하였다.
따라서, 코리네박테리움 속 미생물에서 서열번호 2의 뉴클레오티드 서열을 포함하는 유전자를 결손시킴으로써 L-아르기닌 생산능을 향상시킬 수 있음을 확인하였다.
실시예 6: 코리네박테리움 글루타미쿰 CJ1R 유래의 NCgl2608 유전자가 결손된 균주의 제작 및 L-아르기닌 생산능 평가
L-아르기닌을 생산하는 다른 코리네박테리움 글루타미쿰에 속하는 균주들에서도 상기와 동일한 효과가 있는지를 확인하기 위하여, 야생주(ATCC13869)에 1종의 변이(△argR)를 도입하고자 하였다.
상기 유전자 argR의 결손을 위한 재조합 벡터는 상기 실시예 4과 동일한 방법으로 제작되었으며, 벡터 제작에 사용된 프라이머는 표 5과 같다.
argR 유전자의 결손을 위한 단편을 제작하기 위한 프라이머 7 내지 10
사용된 프라이머 핵산염기 서열
프라이머 7 (서열번호 9) tcggtacccggggatccAGCAGGCCTTAAGGGTAAG
프라이머 8 (서열번호 10) AGGGGCGCTGTCTTACCTCGGCTGGTGGGCCAGC
프라이머 9 (서열번호 11) GGTAAGACAGCGCCCCTAGTTCAAGGCTTGTTAATC
프라이머 10 (서열번호 12) tgcaggtcgactctagaACCGTTGAACTGCTTGCCAG
PCR을 통해 상기 목적한 유전자가 삽입된 플라스미드로 선별한 후, 이 플라스미드를 pDZ-△argR 라 명명하였다. pDZ-△argR을 이용하여 코리네박테리움 글루타미쿰 야생주를 상기 실시예 6과 같은 방법으로 형질 전환시켰으며, 형질 전환주를 대상으로 프라이머 7과 프라이머 10을 이용하여 PCR법을 통하여 염색체상에서 argR이 결손된 균주를 확인하였다. 상기 재조합 균주를 CJ1R라 명명하였고, 이로써 알지닌 생산능을 갖게된 코리네박테리움 글루타미쿰 CJ1R을 대상으로 상기 실시예 6과 같은 방법으로 NCgl2608 유전자가 결손된 균주를 제작하고 CJ1R-△NCgl2608 로 명명하였다.
NCgl2608 유전자가 결손된 CJ1R-△NCgl2608를 상기 실시예 5과 동일한 방법으로 배양하고, 배양 종료 후 HPLC (Waters 2478)에 의해 L-아르기닌의 생산량을 측정하였고, 분석한 L-아르기닌의 농도를 하기 표 6에 나타내었다.
CJ1R 유래 CJ1R-△NCgl2608의 L-아르기닌 생산능
　 균주 L-아르기닌(g/L)
배치 1 배치 2 배치 3 평균
대조군 CJ1R 1.3 1.3 1.4 1.33
실험군 CJ1R-△NCgl2608 1.6 1.5 1.6 1.56
상기 결과와 같이, L-아르기닌 생산균주인 코리네박테리움 글루타미쿰 CJ1R를 대상으로 NCgl2608 유전자를 결손시켰을 경우, L-아르기닌 생산능이 평균 17.3% 증가함을 확인하였다.
따라서, 실시예 5의 결과와 마찬가지로, 코리네박테리움 속 미생물에서 NCgl2608 유전자를 결손시킴으로써 L-아르기닌 생산능을 향상시킬 수 있음을 확인하였다.
상기 균주 CJ1R-△NCgl2608를 CA06-7204로 명명하고 부다페스트조약 하의 수탁기관인 한국미생물보존센터(KCCM)에 2021년 2월 23일자로 기탁하여 수탁번호 KCCM12961P를 부여 받았다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2022005056-appb-img-000001

Claims (9)

  1. 서열번호 1의 아미노산 서열로 이루어진 단백질의 활성이 약화된, L-아르기닌을 생산하는 코리네박테리움 속 (the genus of Corynebacterium) 재조합 미생물.
  2. 제1항에 있어서, 상기 미생물은 모균주에 비해 L-아르기닌 생산능이 증가된, 미생물.
  3. 제1항에 있어서, 상기 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)인, 미생물.
  4. 제1항에 있어서, 상기 미생물은 추가적으로 아르기닌 전사 억제 인자(arginine repressor)의 활성이 약화된, 미생물.
  5. 제1항에 있어서, 상기 미생물은 상기 서열번호 1의 아미노산 서열로 이루어진 단백질을 코딩하는 폴리뉴클레오티드가 결손된, 미생물.
  6. 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 코리네박테리움 속 재조합 미생물을 배지에서 배양하는 단계를 포함하는, L-아르기닌 제조방법.
  7. 제6항에 있어서, 상기 미생물은 코리네박테리움 글루타미쿰인, 방법.
  8. 제6항에 있어서, 상기 코리네박테리움 속 미생물은 추가적으로 아르기닌 전사 억제 인자가 약화된 것인, 방법.
  9. 제6항에 있어서, 상기 미생물은 상기 서열번호 1의 아미노산 서열로 이루어진 단백질을 코딩하는 핵산염기 서열이 결손된 것인, 방법.
PCT/KR2022/005056 2021-04-07 2022-04-07 L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법 WO2022216088A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP22784997.3A EP4321622A1 (en) 2021-04-07 2022-04-07 L-arginine-producing corynebacterium sp. microorganism and l-arginine production method using same
MX2023011892A MX2023011892A (es) 2021-04-07 2022-04-07 Un genero del microorganismo corynebacterium para producir l-arginina y un metodo para producir l-arginina usando el mismo.
AU2022253999A AU2022253999A1 (en) 2021-04-07 2022-04-07 L-arginine-producing corynebacterium sp. microorganism and l-arginine production method using same
JP2023562457A JP2024514138A (ja) 2021-04-07 2022-04-07 Ｌ－アルギニンを生産するコリネバクテリウム属微生物及びこれを用いたｌ－アルギニン生産方法
BR112023020855A BR112023020855A2 (pt) 2021-04-07 2022-04-07 Microrganismo de gênero corynebacterium para produzir l-arginina e um método para produzir l-arginina usando o mesmo
CN202280040469.0A CN118613586A (zh) 2021-04-07 2022-04-07 产l-精氨酸棒状杆菌属微生物和使用其生产l-精氨酸的方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210045262A KR20220139085A (ko) 2021-04-07 2021-04-07 L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
KR10-2021-0045262 2021-04-07

Publications (1)

Publication Number Publication Date
WO2022216088A1 true WO2022216088A1 (ko) 2022-10-13

Family

ID=83546462

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/005056 WO2022216088A1 (ko) 2021-04-07 2022-04-07 L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법

Country Status (8)

Country Link
EP (1) EP4321622A1 (ko)
JP (1) JP2024514138A (ko)
KR (1) KR20220139085A (ko)
CN (1) CN118613586A (ko)
AU (1) AU2022253999A1 (ko)
BR (1) BR112023020855A2 (ko)
MX (1) MX2023011892A (ko)
WO (1) WO2022216088A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240108882A (ko) * 2022-12-30 2024-07-10 씨제이제일제당 (주) 신규한 폴리뉴클레오티드 및 이를 이용한 l-알라닌 생산 방법

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020045223A1 (en) * 2000-04-28 2002-04-18 Ajinomoto Co., Inc. Arginine repressor deficient strain of coryneform bacterium and method for producing L-arginine
US20030113899A1 (en) 2001-07-25 2003-06-19 Ajinomoto Co., Inc. Method for producing L-arginine
KR100791659B1 (ko) 2006-07-13 2008-01-03 씨제이 주식회사 알지닌을 생산하는 미생물 및 이를 이용한 엘-알지닌의제조방법
KR20090107920A (ko) * 2008-04-10 2009-10-14 한국과학기술원 퓨트레신 고생성능을 가지는 변이 미생물 및 이를 이용한 퓨트레신의 제조방법
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
KR20160043890A (ko) * 2014-10-13 2016-04-22 씨제이제일제당 (주) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌의 제조 방법
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020045223A1 (en) * 2000-04-28 2002-04-18 Ajinomoto Co., Inc. Arginine repressor deficient strain of coryneform bacterium and method for producing L-arginine
US20030113899A1 (en) 2001-07-25 2003-06-19 Ajinomoto Co., Inc. Method for producing L-arginine
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
KR100791659B1 (ko) 2006-07-13 2008-01-03 씨제이 주식회사 알지닌을 생산하는 미생물 및 이를 이용한 엘-알지닌의제조방법
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
KR20090107920A (ko) * 2008-04-10 2009-10-14 한국과학기술원 퓨트레신 고생성능을 가지는 변이 미생물 및 이를 이용한 퓨트레신의 제조방법
KR20160043890A (ko) * 2014-10-13 2016-04-22 씨제이제일제당 (주) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌의 제조 방법
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof

Non-Patent Citations (23)

* Cited by examiner, † Cited by third party
Title
"Atlas of Protein Sequence and Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
"Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
APPL. MICROBIOL. BIOTECHNOL., vol. 52, 1999, pages 541 - 545
ATSCHUL, S. F. ET AL., J MOLEC BIOL, vol. 215, 1990, pages 403
BELLMANN A ET AL., MICROBIOLOGY, vol. 147, 2001, pages 1765 - 1774
CARILLO ET AL., SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DATABASE PROTEIN 21-08-2014, ANONYMOUS : "spermidine synthase [Corynebacterium glutamicum]", XP055976317, retrieved from NCBI Database accession no. AIK88893.1 *
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
J. SAMBROOK ET AL.: "Molecular Cloning, a Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
JIANG LING-YAN; ZHANG YUAN-YUAN; LI ZHEN; LIU JIAN-ZHONG: "Metabolic engineering ofCorynebacterium glutamicumfor increasing the production ofl-ornithine by increasing NADPH availability", JOURNAL OF INDUSTRIAL MICROBIOLOGY & BIOTECHNOLOGY, BASINGSTOKE, GB, vol. 40, no. 10, 9 July 2013 (2013-07-09), GB , pages 1143 - 1151, XP035330784, ISSN: 1367-5435, DOI: 10.1007/s10295-013-1306-2 *
MOORE, S.STEIN, W. H.: "Photometric ninhydrin method for use in the chromatography of amino acids", J. BIOL. CHEM., vol. 176, 1948, pages 367 - 388
NAKASHIMA N ET AL.: "Bacterial cellular engineering by genome editing and gene silencing", INT J MOL SCI., vol. 15, no. 2, 2014, pages 2773 - 2793, XP055376889, DOI: 10.3390/ijms15022773
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET, vol. 16, 2000, pages 276 - 277, XP004200114, DOI: 10.1016/S0168-9525(00)02024-2
SAMBROOK ET AL., MOLECULAR CLONING, 2012
SITNICKA ET AL.: "Functional Analysis of Genes", ADVANCES IN CELL BIOLOGY, vol. 2, 2010, pages 1 - 16
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482
VAN DER REST ET AL., APPL MICROBIOL BIOTECHNOL, vol. 50-51, 1999, pages 541 - 545
WEINTRAUB, H ET AL.: "Antisense-RNA as a molecular tool for genetic analysis", REVIEWS - TRENDS IN GENETICS, vol. 1, no. 1, 1986

Also Published As

Publication number Publication date
JP2024514138A (ja) 2024-03-28
EP4321622A1 (en) 2024-02-14
AU2022253999A1 (en) 2023-11-23
KR20220139085A (ko) 2022-10-14
MX2023011892A (es) 2023-12-15
BR112023020855A2 (pt) 2023-12-19
CN118613586A (zh) 2024-09-06

Similar Documents

Publication Publication Date Title
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022216088A1 (ko) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163939A1 (ko) 신규한 mfs 트랜스포터 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163922A1 (ko) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163923A1 (ko) 신규한 atp 포스포리보실트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163920A1 (ko) 신규한 시스테인 설피네이트 디설피나제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022215800A1 (ko) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022215796A1 (ko) 신규한 전사 조절자 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163919A1 (ko) 신규한 우레아제 부속 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163941A1 (ko) 신규한 스퍼미딘 신타아제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163940A1 (ko) 신규한 갈락토사이드 o-아세틸트랜스퍼라제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163937A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163925A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163924A1 (ko) 신규한 5,10-메틸렌테트라하이드로폴레이트 리덕타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154173A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022163926A1 (ko) 신규한 프롤린 탈수소효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163938A1 (ko) 신규한 리보뉴클레아제 p 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154188A1 (ko) 신규한 폴리케타이드 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22784997

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: MX/A/2023/011892

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2301006604

Country of ref document: TH

WWE Wipo information: entry into national phase

Ref document number: 2023562457

Country of ref document: JP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023020855

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2022784997

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 202317075949

Country of ref document: IN

Ref document number: 12023553053

Country of ref document: PH

Ref document number: 2023127041

Country of ref document: RU

Ref document number: 2022253999

Country of ref document: AU

Ref document number: AU2022253999

Country of ref document: AU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022784997

Country of ref document: EP

Effective date: 20231106

ENP Entry into the national phase

Ref document number: 2022253999

Country of ref document: AU

Date of ref document: 20220407

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112023020855

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20231006