WO2021261733A1 - L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법 - Google Patents

L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법 Download PDF

Info

Publication number
WO2021261733A1
WO2021261733A1 PCT/KR2021/005037 KR2021005037W WO2021261733A1 WO 2021261733 A1 WO2021261733 A1 WO 2021261733A1 KR 2021005037 W KR2021005037 W KR 2021005037W WO 2021261733 A1 WO2021261733 A1 WO 2021261733A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
seq
isoleucine
polypeptide
microorganism
Prior art date
Application number
PCT/KR2021/005037
Other languages
English (en)
French (fr)
Inventor
김경림
이임상
김희영
이광우
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to BR112021019009A priority Critical patent/BR112021019009A2/pt
Priority to CN202180003186.4A priority patent/CN114402070B/zh
Priority to US17/440,172 priority patent/US20230098971A1/en
Publication of WO2021261733A1 publication Critical patent/WO2021261733A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y403/00—Carbon-nitrogen lyases (4.3)
    • C12Y403/01—Ammonia-lyases (4.3.1)
    • C12Y403/01019—Threonine ammonia-lyase (4.3.1.19)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • the present application relates to a novel variant of L-threonine dehydratase and a method for producing L-isoleucine using the same.
  • L-isoleucine is one of the branched-chain amino acids among the 20 amino acids and is classified as an essential amino acid and is used in animal feed, food additives, and pharmaceutical fields. Since L-isoleucine has functions such as energy production, hemoglobin production, blood sugar control, muscle production and repair after metabolism, its use is increasing not only in infusions, nutritional supplements, sports nutrition, but also in animal feed.
  • L-isoleucine For the production of L-isoleucine, Corynebacterium glutamicum and Escherichia coli are used as representative microorganisms. In these microorganisms, L-isoleucine shares a major biosynthetic pathway with other branched-chain amino acids, L-valine and L-leucine. Looking at the biosynthetic pathway of L-isoleucine, 2-ketobutyrate produced from L-threonine, an amino acid derived from pyruvate and aspartic acid, produced during glycolysis It is used as a precursor to finally produce L-isoleucine.
  • L-Threonine dehydratase (TD) (EC 4.3.1.19) encoded by the ilvA gene. It is known that the more sensitive L-threonine dehydratase is to the threonine concentration, the higher the ability to produce L-isoleucine. (Peng et al. Bioprocess Biosyst Eng 33:339-345. 2010; Guillouet et al. Appl Microbiol Biotechnol. 2001 Dec;57(5-6):667-73.). Therefore, L-threonine dehydratase can be a limiting factor in the production of L-isoleucine, and is a very important enzyme for improving the ability to produce isoleucine.
  • TD L-Threonine dehydratase
  • the present inventors have secured an ilvA mutant that increases L-isoleucine production, and have completed the present application by developing a microorganism having increased L-isoleucine production ability, including this. .
  • the present application provides a variant of L-threonine dehydratase, in which the amino acid at position 381 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
  • the present application provides polynucleotides encoding the variants of the present application.
  • the present application provides a vector comprising the polynucleotide of the present application.
  • the present application relates to variants of the present application; polynucleotides encoding the variants of the present application; and a vector comprising the polynucleotide of the present application; It provides a microorganism that produces L-isoleucine, including any one or more.
  • the present application relates to variants of the present application; polynucleotides encoding the variants of the present application; and a vector comprising the polynucleotide of the present application; It provides a method for producing L-isoleucine, comprising the step of culturing a microorganism comprising any one or more in a medium.
  • the present application provides a composition for producing L-isoleucine, comprising the microorganism of the present application or a culture of the microorganism of the present application.
  • One aspect of the present application provides a variant of L-threonine dehydratase, in which the amino acid at the position corresponding to the 381st position of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid will be.
  • the variant may be one selected from the group consisting of alanine, serine, proline, glutamine, valine, isoleucine, glycine and methionine in which the amino acid at position 381 of the amino acid sequence of SEQ ID NO: 1 is substituted. , but not limited thereto.
  • the amino acid at the position corresponding to position 381 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid
  • the amino acid at the position corresponding to position 383 of the amino acid sequence of SEQ ID NO: 1 is another amino acid It may be additionally substituted, but is not limited thereto.
  • the other amino acid may specifically be a non-polar amino acid, and more specifically, may be alanine, but is not limited thereto.
  • L-isoleucine refers to one of the essential amino acids and structurally L-valine and L-leucine together with the chemical formula HO 2 CCH(NH 2 )CH(CH 3 )CH 2 CH 3 which corresponds to a branched chain amino acid. It means L-amino acid.
  • L-threonine dehydratase is an enzyme involved in the L-isoleucine biosynthesis pathway, and aspartate; Aspartic acid during the L-isoleucine biosynthesis step. ) refers to an enzyme that produces 2-ketobutyrate from L-threonine, an amino acid derived from it. L-isoleucine is produced using the 2-ketobutyric acid and pyruvate generated in glycolysis as precursors.
  • the L-threonine dehydratase may be, for example, a protein comprising the amino acid sequence of SEQ ID NO: 1.
  • the protein comprising the amino acid sequence of SEQ ID NO: 1 may be used in combination with the protein having the amino acid sequence of SEQ ID NO: 1 and the protein consisting of the amino acid sequence of SEQ ID NO: 1.
  • SEQ ID NO: 1 may be the amino acid sequence of L-threonine dehydratase encoded by the ilvA gene.
  • the amino acid sequence of SEQ ID NO: 1 can be obtained from GenBank of NCBI, which is a known database.
  • GenBank of NCBI which is a known database.
  • Corynebacterium glutamicum may be derived, but is not limited thereto, and sequences having the same activity as the amino acids may be included without limitation.
  • L-threonine dehydratase in the present application is defined as a protein containing the amino acid of SEQ ID NO: 1, insignificant sequence addition before and after the amino acid sequence of SEQ ID NO: 1 or a naturally occurring mutation, Or it does not exclude its latent mutation (silent mutation), and if it has the same or corresponding activity as the protein comprising the amino acid sequence of SEQ ID NO: 1, L-threonine dehydratase of the present application It will be apparent to those skilled in the art. As a specific example, L-threonine dehydratase of the present application is the amino acid sequence of SEQ ID NO: 1 or 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99 thereof.
  • It may be a protein composed of an amino acid sequence having % or more homology or identity.
  • a protein having an amino acid sequence in which some sequence is deleted, modified, substituted or added is also included within the scope of the protein subject to mutation of the present application. is self-evident
  • a 'polypeptide consisting of the amino acid sequence of SEQ ID NO: 1' may belong to a 'polypeptide consisting of the amino acid sequence of SEQ ID NO: 1' if it has the same or corresponding activity.
  • variant means that one or more amino acids are conservatively substituted and/or modified so that they differ from the amino acid sequence before the mutation of the variant, but have functions or properties refers to a polypeptide that is maintained.
  • variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation.
  • some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, have been removed.
  • variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein.
  • variant may be used interchangeably with terms such as mutant, modified, mutant polypeptide, mutated protein, mutant and mutant (in English, modified, modified polypeptide, modified protein, mutant, mutein, divergent, etc.) and, as long as it is a term used in a mutated sense, it is not limited thereto.
  • the mutant may have increased L-isoleucine production by increasing the activity of the mutated protein compared to the natural wild-type or unmodified protein, but is not limited thereto.
  • conservative substitution means substituting one amino acid with another amino acid having similar structural and/or chemical properties. Such amino acid substitutions may generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.
  • variants may contain deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide.
  • the polypeptide may be conjugated with a signal (or leader) sequence at the N-terminus of the protein involved in the transfer of the protein either co-translationally or post-translationally.
  • the polypeptide may also be conjugated with other sequences or linkers to enable identification, purification, or synthesis of the polypeptide.
  • the 'substitution with another amino acid' is not limited as long as it is substituted with an amino acid different from the amino acid before the substitution. That is, it is not limited as long as threonine, which is the 381th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1, is substituted with an amino acid residue other than threonine, specifically arginine, lysine, histidine, glutamic acid, and arpart Acid, glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine may be substituted with any one amino acid.
  • amino acid threonine at the position 381 of the amino acid sequence of SEQ ID NO: 1 is substituted with any one selected from the group consisting of alanine, serine, proline, glutamine, valine, isoleucine, glycine and methionine may be, but is not limited thereto.
  • substituted amino acid residue may include a natural amino acid as well as a non-natural amino acid.
  • the unnatural amino acid may be, for example, a D-amino acid, a homo-amino acid, a beta-homo-amino acid, an N-methyl amino acid, an alpha-methyl amino acid, an unconventional amino acid (eg, citrulline or naph thylalanine, etc.), but is not limited thereto.
  • an unconventional amino acid eg, citrulline or naph thylalanine, etc.
  • the mutant may be one in which the amino acid at the position 381 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, and the amino acid at the position 383 is additionally substituted with another amino acid. More specifically, the amino acid at the position 383 of the amino acid sequence of SEQ ID NO: 1 may be substituted with a non-polar amino acid, and the non-polar amino acid may be alanine, but is not limited thereto.
  • the variant is substituted with any one selected from the group consisting of alanine, serine, proline, glutamine, valine, isoleucine, glycine and methionine, i) the amino acid at the position 381 of the amino acid sequence of SEQ ID NO: 1, and / or ii) the amino acid at the position corresponding to position 383 may be substituted with alanine, but is not limited thereto.
  • the variant may have 80% or more and less than 100% sequence homology with the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.
  • the variant of the present application may be one having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% homology with the amino acid sequence of SEQ ID NO: 1 It is evident that proteins having an amino acid sequence in which some sequences other than the amino acid sequence at positions 381 and / or 383 are deleted, modified, substituted or added are also included in the variants of the present application if the amino acid sequence exhibits efficacy corresponding to the protein. .
  • corresponding to refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar to, identical to, or homologous to a residue listed in a polypeptide. Identifying the amino acid at the corresponding position may be determining the specific amino acid of a sequence that refers to the specific sequence.
  • corresponding region generally refers to a similar or corresponding position in a related or reference protein.
  • any amino acid sequence is aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1.
  • a sequence alignment algorithm such as that described in this application can identify the position of an amino acid, or a position at which modifications, such as substitutions, insertions, or deletions, occur compared to a query sequence (also referred to as a "reference sequence").
  • Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277), but is not limited thereto, and a sequence alignment program, pairwise sequence comparison algorithm, etc. known in the art may be appropriately used.
  • L-threonine dehydratase provided in the present application, an amino acid at a specific position is substituted in the L-threonine dehydratase described above, thereby increasing the production of a precursor of L-isoleucine. Accordingly, the production capacity of L-isoleucine can be increased compared to the protein before mutation.
  • the variant of L-threonine dehydratase in which the amino acid at the position corresponding to the 381st of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, comprises the amino acid sequence of any one of SEQ ID NOs: 3 to 10 It may be one, specifically, it may consist essentially of any one of the amino acid sequences of SEQ ID NOs: 3 to 10, and more specifically, it may consist of any one of the amino acid sequences of SEQ ID NOs: 3 to 10 can, but is not limited thereto.
  • amino acid sequence of SEQ ID NOs: 3 to 10 the amino acid at the position corresponding to position 381 of the amino acid sequence of SEQ ID NO: 1 is substituted with alanine, serine, proline, glutamine, valine, isoleucine, glycine or methionine, respectively. It is not limited thereto.
  • the variant may include an amino acid sequence having at least 80% homology or identity with the amino acid sequence of any one of SEQ ID NOs: 3 to 10 or the amino acid at the position 381 of the amino acid sequence is fixed.
  • the present invention is not limited thereto.
  • the variant of the present application comprises a polypeptide having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity to the amino acid sequence of any one of SEQ ID NOs: 3 to 10.
  • proteins having an amino acid sequence in which some sequences are deleted, modified, substituted or added in addition to the 381 amino acid position are also included within the scope of the present application. can be self-evident
  • the variant of L-threonine dehydratase in which the amino acid at the position corresponding to position 381 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid corresponds to position 383 of the amino acid sequence of SEQ ID NO: 1 It may be that the amino acid at the position to be substituted with another amino acid.
  • the variant of the dihydratase may be one comprising the amino acid sequence of any one of SEQ ID NOs: 23 to 30; It may consist essentially of the amino acid sequence of any one of SEQ ID NOs: 23 to 30; Or it may consist of the amino acid sequence of any one of SEQ ID NOs: 23 to 30, but is not limited thereto.
  • each of the amino acids at the position corresponding to i) 381 of the amino acid sequence of SEQ ID NO: 1 is substituted with alanine, serine, proline, glutamine, valine, isoleucine, glycine or methionine, respectively, and/or ii) the amino acid at the position corresponding to position 383 may be substituted with alanine, but is not limited thereto.
  • amino acid sequence of SEQ ID NO: 1 a) i) the amino acid at position 381 is substituted with alanine, and/or ii) the amino acid at position 383 is substituted with alanine; b) i) the amino acid at the position corresponding to position 381 is substituted with serine, and/or ii) the amino acid at the position corresponding to position 383 is substituted with alanine; c) i) the amino acid at the position corresponding to position 381 is substituted with proline, and/or ii) the amino acid at the position corresponding to position 383 is substituted with alanine; d) i) the amino acid at the position corresponding to position 381 is substituted with glutamine, and/or ii) the amino acid at the position corresponding to position 383 is substituted with alanine; e) i) the amino acid at the position corresponding to position 381 is substituted with valine, and/or ii) the amino acid at the amino acid at
  • the variant has an amino acid sequence of any one of SEQ ID NOs: 23 to 30 or in the amino acid sequence, any one or more amino acids selected from amino acids at positions 381 and/or 383 are fixed, and at least 80% It may include, but is not limited to, amino acid sequences having homology or identity.
  • the variant of the present application comprises a polypeptide having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity to the amino acid sequence of any one of SEQ ID NOs: 23 to 30.
  • proteins may include In addition, if it is an amino acid sequence having such homology or identity and exhibiting efficacy corresponding to the protein, in addition to the amino acid at positions 381 and/or 383, some sequences have an amino acid sequence deleted, modified, substituted or added It is obvious that proteins are also included within the scope of the present application.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of a sequence under moderate or high stringent conditions. It is apparent that hybridization also includes hybridization with a polynucleotide containing a common codon in a polynucleotide or a codon in consideration of codon degeneracy.
  • a GAP program can be defined as the total number of symbols in the shorter of two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • Another aspect of the present application provides a polynucleotide encoding a variant of L-threonine dehydratase of the present application.
  • amino acid sequence of SEQ ID NO: 1, L-threonine dehydratase and variants thereof are as described above.
  • polynucleotide refers to a DNA or RNA strand of a certain length or more as a polymer of nucleotides in which nucleotide monomers are connected in a long chain form by covalent bonds.
  • the polynucleotide may refer to a polynucleotide fragment encoding a variant of L-threonine dehydratase of the present application.
  • the polynucleotide may be included without limitation as long as it is a polynucleotide sequence encoding a variant of L-threonine dehydratase of the present application.
  • the gene encoding the amino acid sequence of L-threonine dehydratase is an ilvA gene, and the gene may be specifically derived from Corynebacterium glutamicum , but is not limited thereto. .
  • the polynucleotide encoding the variant of L-threonine dehydratase of the present application is L-threo in which the amino acid at the position corresponding to position 381 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid It may include a nucleotide sequence encoding a variant of nin dihydratase.
  • polynucleotide various modifications can be made in the coding region within the range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or in consideration of codons preferred in the organism in which the polypeptide is to be expressed.
  • the polynucleotide may include without limitation as long as it is a polynucleotide sequence encoding a variant of L-threonine dehydratase in which the amino acid at the position 381 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid. .
  • polynucleotide of the present application may be included without limitation as long as it can hybridize under stringent conditions with a probe that can be prepared from a known gene sequence, for example, a sequence complementary to all or part of the polynucleotide sequence of the present application.
  • stringent condition means a condition that enables specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • polynucleotides with high homology or identity 70% or more, 75% or more, 6% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or a condition in which polynucleotides having 99% or more homology or identity hybridize with each other and polynucleotides with lower homology or identity do not hybridize, or 60 ° C., which is a washing condition of conventional Southern hybridization; 1 ⁇ SSC, 0.1% SDS, specifically at a salt concentration and temperature equivalent to 60° C., 0.1 ⁇ SSC, 0.1% SDS, more specifically 68° C., 0.1 ⁇ SSC, 0.1% SDS, washed once, specifically 2 to 3 times conditions can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other.
  • adenine is complementary to thymine
  • cytosine is complementary to guanine.
  • the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the overall sequence.
  • a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using the hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by those skilled in the art depending on the purpose.
  • the appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (eg, J. Sambrook et al., supra).
  • the amino acid at the position 381 is substituted with another amino acid
  • the amino acid at position 383 may include a nucleotide sequence encoding a variant of L-threonine dehydratase substituted with another amino acid.
  • the polynucleotide encodes a variant of L-threonine dehydratase in which one or more amino acids selected from amino acids at positions 381 and/or 383 of the amino acid sequence of SEQ ID NO: 1 are substituted with other amino acids
  • Any polynucleotide sequence may include without limitation.
  • Another aspect of the present application provides a vector comprising a polynucleotide encoding a variant of L-threonine dehydratase of the present application.
  • amino acid sequence of SEQ ID NO: 1, L-threonine dehydratase, variants and polynucleotides thereof are as described above.
  • the term “vector” refers to a DNA preparation containing a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable regulatory sequence so that the target polypeptide can be expressed in a suitable host.
  • the regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors
  • pBR-based, pUC-based, and pBluescriptII-based plasmid vectors may be used.
  • pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.
  • pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used.
  • a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion.
  • the insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted.
  • the selection marker is used to select cells transformed with a vector, that is, to determine whether a target nucleic acid molecule is inserted, and to confer a selectable phenotype such as drug resistance, auxotrophicity, resistance to cytotoxic agents, or expression of a surface polypeptide. markers may be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
  • Another aspect of the present application is a variant of L-threonine dehydratase of the present application; a polynucleotide encoding the variant; and a vector comprising the polynucleotide; It provides a microorganism that produces L-isoleucine, including any one or more.
  • amino acid sequence of SEQ ID NO: 1, L-threonine dehydratase, variants thereof, polynucleotides and vectors are as described above.
  • microorganism that produces L-isoleucine includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially. As a microorganism whose specific mechanism is weakened or enhanced due to a cause, it may be a microorganism including genetic modification for the production of a desired protein or product.
  • the microorganism producing L-isoleucine of the present application is the polypeptide; a polynucleotide encoding it; And it may be a microorganism having the ability to produce a target protein or a target product involved in the production of the target protein, including any one or more of vectors comprising the polynucleotide, but is not limited thereto.
  • the microorganism may be, but is not limited to, a microorganism having the ability to naturally produce the target protein or target product, or a microorganism in which the target protein or target product production ability is imparted to the parent strain without the target protein or target product production ability.
  • the target protein may be a variant of L-threonine dehydratase
  • the target product may be L-isoleucine.
  • the microorganism producing the L-isoleucine may include a microorganism genetically modified through any one or more of a polypeptide of the present application, a polynucleotide encoding the same, and a vector including the polynucleotide; a microorganism modified to express the polypeptide, or a polynucleotide encoding the same; a recombinant microorganism expressing the polypeptide or a polynucleotide encoding the same; Or it may be a recombinant microorganism having the polypeptide activity, but is not limited thereto.
  • the L-isoleucine-producing microorganism is a microorganism having a naturally weak L-isoleucine-producing ability, wherein a mutant of L-threonine dehydratase is introduced to increase the L-isoleucine-producing ability. It may mean microorganisms.
  • the microorganism is a microorganism expressing a variant of L-threonine dehydratase in which the amino acid at the position corresponding to the 381th position of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid
  • the L-th The variant of leonine dehydratase is any one or more selected from the group consisting of alanine, serine, proline, glutamine, valine, isoleucine, glycine and methionine, wherein the amino acid at position 381 of the amino acid sequence of SEQ ID NO: 1 is selected from the group consisting of It may be substituted with an amino acid, but is not limited thereto.
  • unmodified microorganism does not exclude strains containing mutations that can occur naturally in microorganisms, either wild-type strains or natural-type strains themselves, or genetic mutations caused by natural or artificial factors. It may mean the strain before becoming.
  • the "unmodified microorganism” may be used interchangeably with “strain before modification”, “microbe before modification”, “unmodified strain”, “unmodified strain”, “unmodified microorganism” or "reference microorganism”.
  • the microorganism producing L-isoleucine of the present application is not only a variant of L-threonine dehydratase, in which the amino acid at the position 381 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
  • the amino acid at the position 381 is substituted with another amino acid, and/or ii) the position corresponding to position 383
  • It may be to express a variant of L-threonine dehydratase, in which the amino acid of the amino acid is substituted with another amino acid, and more specifically, i) the amino acid at the position corresponding to the 381st position of the amino acid sequence of SEQ ID NO: 1 L, which is substituted with any one or more amino acids selected from the group consisting of alanine, serine, proline, glutamine, valine, isoleucine, glycine and methionine, and/or ii) the amino acid at position 383 is substituted with alanine -It may be to express a mutant of threonine dehydratase, but is not limited thereto.
  • the term "to be/are" a protein refers to a state in which a target protein is introduced into a microorganism or modified to be expressed in the microorganism.
  • the target protein is a protein present in a microorganism, it refers to a state in which the activity is enhanced compared to before intrinsic or modified.
  • the "target protein” may be a variant of the aforementioned L-threonine dehydratase.
  • introduction of protein means that the activity of a specific protein that the microorganism did not originally have or exhibited an improved activity compared to the intrinsic activity or activity before modification of the protein.
  • a polynucleotide encoding a specific protein may be introduced into a chromosome in a microorganism, or a vector including a polynucleotide encoding a specific protein may be introduced into the microorganism to exhibit its activity.
  • the term “enhancement” of a polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity.
  • the reinforcement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.
  • activation, enhancement, upregulation, overexpression, and increase may include all of those exhibiting an activity that was not originally possessed, or exhibiting an improved activity compared to intrinsic activity or activity before modification.
  • intrinsic activity refers to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors.
  • the enrichment can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and/or concentration (expression amount) of an endogenous polypeptide. Whether or not the activity of the polypeptide is enhanced can be confirmed from the increase in the level of activity, expression level, or the amount of product excreted from the polypeptide.
  • the enhancement of the activity of the polypeptide can be applied by various methods well known in the art, and is not limited as long as it can enhance the activity of the target polypeptide compared to the microorganism before modification. Specifically, it may be one using genetic engineering and/or protein engineering well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (eg, Sitnicka et al. Functional Analysis of Genes. Advances in Cell). Biology 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • modification of the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide eg, modification of the polynucleotide sequence of the polypeptide gene to encode a polypeptide that has been modified to enhance the activity of the polypeptide;
  • the increase in the intracellular copy number of the polynucleotide encoding the polypeptide is achieved by introduction of a vector, to which the polynucleotide encoding the polypeptide is operably linked, which can replicate and function independently of the host, into a host cell.
  • the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into a chromosome in a host cell.
  • the introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome in the host cell into the host cell, but is not limited thereto.
  • the vector is the same as described above.
  • Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence with strong activity is, for example, deletion, insertion, non-conservative or Conservative substitution or a combination thereof may result in a mutation in the sequence, or replacement with a sequence having a stronger activity.
  • the expression control region is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence for regulating the termination of transcription and translation. As an example, it may be to replace the original promoter with a strong promoter, but is not limited thereto.
  • Examples of known strong promoters include CJ1 to CJ7 promoter (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, etc., but is not limited thereto.
  • the modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a nucleotide sequence encoding another start codon having a higher expression rate of the polypeptide compared to the intrinsic start codon. It may be a substitution, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may include deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance activity of the polypeptide; A combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto.
  • the replacement may be specifically performed by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
  • the vector used may further include a selection marker for confirming whether or not the chromosome is inserted. The selection marker is the same as described above.
  • the introduction of the foreign polynucleotide exhibiting the activity of the polypeptide may be introduction of the foreign polynucleotide encoding the polypeptide exhibiting the same/similar activity as the polypeptide into a host cell.
  • the foreign polynucleotide is not limited in origin or sequence as long as it exhibits the same/similar activity as the polypeptide.
  • the method used for the introduction can be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to generate a polypeptide and increase its activity.
  • Codon optimization of the polynucleotide encoding the polypeptide is codon-optimized so that the transcription or translation of the endogenous polynucleotide is increased in the host cell, or the transcription and translation of the foreign polynucleotide is optimized in the host cell. It may be that its codons are optimized so that the
  • Selecting an exposed site by analyzing the tertiary structure of the polypeptide and modifying or chemically modifying it for example, compares the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored to determine the degree of sequence similarity. Accordingly, it may be to determine a template protein candidate, check the structure based on it, select an exposed site to be modified or chemically modified, and modify or modify it.
  • Such enhancement of polypeptide activity is to increase the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild-type or pre-modified microbial strain, or increase the amount of product produced from the polypeptide.
  • the present invention is not limited thereto.
  • Modification of part or all of the polynucleotide in the microorganism of the present application is (a) homologous recombination using a vector for chromosome insertion in the microorganism or genome correction using engineered nuclease (eg, CRISPR-Cas9) and/or (b) It may be induced by light and/or chemical treatments such as, but not limited to, ultraviolet and radiation.
  • the method for modifying part or all of the gene may include a method by DNA recombination technology.
  • a part or all of the gene may be deleted.
  • the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
  • the enhancement of such polypeptide or protein activity is a function in which the activity or concentration of the corresponding polypeptide or protein is increased relative to the activity or concentration of the polypeptide or protein expressed in the wild-type or pre-modified microbial strain, or is produced from the polypeptide or protein.
  • the amount of the product may be increased, but is not limited thereto.
  • the microorganism including the variant of L-threonine dehydratase may be a recombinant microorganism, and the recombination may be achieved by genetic modification such as transformation.
  • the microorganism of the present application may be a recombinant microorganism prepared by transformation with a vector including a polynucleotide encoding a variant of L-threonine dehydratase, but is not limited thereto.
  • the term "transformation” refers to introducing a vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located extrachromosomally, as long as they can be expressed in the host cell.
  • the polynucleotide includes DNA and RNA encoding a target protein.
  • the polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a target polypeptide of the present application and the gene sequence are functionally linked.
  • the method for transforming the vector of the present application includes any method of introducing a nucleic acid into a cell, and may be performed by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method and the like, but is not limited thereto.
  • Microorganism producing the L- isoleucine if capable of producing L- isoleucine but not to its kind is not particularly limited, for example, Corynebacterium (Corynebacterium) genus Escherichia (Escherichia) genus Enterobacter (Enterbacter) , An air Winiah (Erwinia) genus, Serratia marcescens (Serratia) genus, Providencia (Providencia) may be a microorganism belonging to the genus and Brevibacterium (Brevibacterium), specifically, Corynebacterium (Corynebacterium) microorganism of the genus can be
  • the "microorganism of the genus Corynebacterium” of the present application may include all microorganisms of the genus Corynebacterium. Specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium efficiens ( Corynebacterium efficiens ) , Corynebacterium callunae ( Corynebacterium callunae ), Corynebacterium stationis ( Corynebacterium stationis ), Corynebacterium singulare ( Corynebacterium singulare ), Corynebacterium halo Tolerans ( Corynebacterium halotolerans ), Corynebacterium Lium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes ), Corynebacterium
  • the parent strain of the microorganism may be a microorganism that additionally enhances the biosynthetic pathway of L-isoleucine in order to increase the production of L-isoleucine, but is not limited thereto.
  • the microorganism has a genetic mutation in the hom gene encoding homoserine dehydrogenase to enhance the biosynthetic pathway of L-isoleucine, for example, to eliminate feedback inhibition of threonine, a precursor of isoleucine.
  • R407H U.S. Publication No. US 2020-0340022 A1
  • L377K a genetic mutation in the lysC gene encoding aspartokinase
  • the term "enhancement/increase” is a concept that includes all those in which activity is increased compared to intrinsic activity.
  • This enhancement or increase in gene activity can be achieved by application of various methods well known in the art.
  • the method include increasing the intracellular copy number of a gene; a method of introducing a mutation into an expression control sequence of a gene; a method of replacing a gene expression control sequence with a sequence with strong activity; a method of additionally introducing a mutation into the gene to enhance the activity of the gene; And it may consist of any one or more methods selected from the group consisting of a method of introducing a foreign gene into a microorganism, and may be achieved by a combination thereof, but is not limited thereto.
  • the parent strain of the microorganism in the present application may be a microorganism in which a gene that further weakens the biosynthetic pathway of L-isoleucine is inactivated in order to increase the production of L-isoleucine.
  • a gene that further weakens the biosynthetic pathway of L-isoleucine is inactivated in order to increase the production of L-isoleucine.
  • it is not limited thereto.
  • the term "weakening" of a polypeptide is a concept that includes both reduced or no activity compared to intrinsic activity.
  • the attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, attenuation, and the like.
  • the attenuation is when the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism due to mutation of the polynucleotide encoding the polypeptide, etc.
  • the overall polypeptide activity level and/or concentration (expression amount) in the cell is lower than that of the native strain due to (translation) inhibition, etc., when the expression of the polynucleotide is not made at all, and/or when the expression of the polynucleotide is Even if there is no activity of the polypeptide, it may also be included.
  • the "intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification”. "Inactivation, deficiency, reduction, downregulation, reduction, attenuation” of the activity of a polypeptide compared to the intrinsic activity means that the activity of the specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation is lowered.
  • Attenuation of the activity of the polypeptide may be performed by any method known in the art, but is not limited thereto, and may be achieved by application of various methods well known in the art (eg, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
  • the attenuation of the polypeptide activity of the present application is
  • an antisense oligonucleotide eg, antisense RNA
  • an antisense oligonucleotide that complementarily binds to the transcript of said gene encoding the polypeptide
  • deletion of a part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide in which some nucleotides are deleted, or replacement with a marker gene.
  • the above 2) modification of the expression control region is deletion, insertion, non-conservative or conservative substitution or a combination thereof, resulting in mutation in the expression control region (or expression control sequence), or weaker replacement with an active sequence.
  • the expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the base sequence modification encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a base encoding another start codon having a lower polypeptide expression rate than the intrinsic start codon It may be substituted with a sequence, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 3) and 4) above is a deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide. Or a combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto.
  • the expression of a gene may be inhibited or attenuated, but is not limited thereto.
  • antisense oligonucleotide eg, antisense RNA
  • antisense RNA an antisense oligonucleotide that complementarily binds to the transcript of the gene encoding the polypeptide
  • Weintraub, H. et al. Antisense-RNA as a molecular tool. for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
  • the parent strain of the microorganism is wild-type Corynebacterium glutamicum ATCC13032, hom (R407H) encoding homoserine dehydrogenase to resolve feedback inhibition of threonine, a precursor of isoleucine, to ATCC1303. (U.S. Publication No.
  • Another aspect of the present application is a variant of L-threonine dehydratase of the present application; a polynucleotide encoding the variant; and a vector comprising the polynucleotide; It provides a method for producing L-isoleucine, comprising the step of culturing a microorganism comprising any one or more in a medium.
  • amino acid sequence of SEQ ID NO: 1, L-threonine dehydratase, variants thereof, polynucleotides, vectors and microorganisms are as described above.
  • the microorganism may be of the genus Corynebacterium, specifically Corynebacterium glutamicum, but is not limited thereto. This is the same as described above.
  • the term “cultivation” means growing the microorganism in an appropriately controlled environmental condition.
  • the culture process of the present application may be made according to an appropriate medium and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art according to the selected strain. Specifically, the culture may be batch, continuous, and fed-batch, but is not limited thereto.
  • the term "medium” refers to a material mixed with nutrients required for culturing the microorganism as a main component, and supplies nutrients and growth factors, including water, which are essential for survival and growth.
  • any medium and other culture conditions used for culturing the microorganisms of the present application may be used without any particular limitation as long as they are conventional media used for culturing microorganisms. It can be cultured while controlling temperature, pH, etc. under aerobic conditions in a conventional medium containing compounds, amino acids and/or vitamins.
  • the culture medium for the Corynebacterium sp. strain can be found in the literature ["Manual of Methods for General Bacteriology” by the American Society for Bacteriology (Washington D.C., USA, 1981)].
  • carbon source in the present application, carbohydrates such as glucose, fructose, sucrose, maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine
  • organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract
  • the phosphorus may include potassium monobasic phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto.
  • potassium monobasic phosphate dipotassium phosphate, or a sodium-containing salt corresponding thereto.
  • the inorganic compound sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium in a batch or continuous manner, but is not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium.
  • an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without injection of gas or without injection of gas to maintain anaerobic and microaerobic conditions, but is not limited thereto does not
  • the temperature of the medium may be 20 °C to 50 °C, specifically 30 °C to 37 °C, but is not limited thereto.
  • the incubation period may be continued until a desired production amount of a useful substance is obtained, and specifically, it may be 10 hours to 100 hours, but is not limited thereto.
  • L-isoleucine produced by the culture may be discharged into the medium or may not be discharged and remain in the cell.
  • the method for producing L-isoleucine of the present application may further include recovering L-isoleucine from the culture medium or the microorganism.
  • the method for recovering the L-isoleucine may be collecting L-isoleucine from the culture solution using a suitable method known in the art according to the culture method. For example, centrifugation, filtration, anion exchange chromatography, treatment with a crystallized protein precipitating agent (salting out method), extraction, ultrasonic wave disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Various chromatography such as exchange chromatography, affinity chromatography, HPLC, and methods thereof can be used in combination, and the desired L-isoleucine can be recovered from the medium or microorganism using a suitable method known in the art. .
  • a suitable method known in the art for example, centrifugation, filtration, anion exchange chromatography, treatment with a crystallized protein precipitating agent (salting out method), extraction, ultrasonic wave disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption
  • the production method may include an additional purification process.
  • the purification process may purify the recovered L-isoleucine using a suitable method known in the art. Accordingly, the recovered L-isoleucine may be in a purified form or a microbial fermentation broth containing a target product (Introduction to Biotechnology and Genetic Engineering, A. J. Nair., 2008).
  • L- threonine dehydratase variant of the present application is L- threonine dehydratase variant of the present application; a polynucleotide encoding the variant; and a vector comprising the polynucleotide; It provides a composition for producing L-isoleucine, comprising a microorganism or a culture of the microorganism that produces L-isoleucine, including any one or more.
  • amino acid sequence of SEQ ID NO: 1, L-threonine dehydratase, variants thereof, polynucleotides, vectors and microorganisms are as described above.
  • the microorganism may be of the genus Corynebacterium, specifically Corynebacterium glutamicum, but is not limited thereto. This is the same as described above.
  • the composition for producing L-isoleucine may refer to a composition capable of producing L-isoleucine by a mutant of L-threonine dehydratase of the present application.
  • the composition may include, without limitation, a variant of the L-threonine dehydratase or a composition capable of operating the variant of the L-threonine dehydratase.
  • the variant of L-threonine dehydratase may be in a form included in a vector so that an operably linked gene can be expressed in an introduced host cell.
  • the composition may further comprise a cryoprotectant or an excipient.
  • the cryoprotectant or excipient may be a non-naturally occurring material or a naturally occurring material, but is not limited thereto.
  • the cryoprotectant or excipient may be a material that the microorganism does not naturally contact, or a material that is not naturally included with the microorganism at the same time, but is not limited thereto.
  • Example 1 ilvA mutant (F383A) plasmid construction having L-threonine dehydratase activity
  • microbial mutation was induced by using the following method.
  • ilvA which is a gene encoding L-Threonine dehydratase (TD)
  • TD L-Threonine dehydratase
  • PCR was performed using the primers of SEQ ID NO: 11 and SEQ ID NO: 14, SEQ ID NO: 12 and SEQ ID NO: 13 using the chromosome of wild type Corynebacterium glutamicum ATCC 13032 as a template. PCR conditions were repeated 30 times of denaturation at 95° C. for 5 minutes, then denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 90 seconds, followed by polymerization at 72° C. for 5 minutes.
  • PCR was performed with primers of SEQ ID NO: 11 and SEQ ID NO: 12.
  • a DNA fragment of 1531 bp containing the ilvA mutation (SEQ ID NO: 7) in which phenylalanine at position 383 was substituted with alanine was amplified.
  • the pECCG117 (Korean Patent No. 10-0057684) vector and ilvA DNA fragment were treated with restriction enzyme BamHI, ligated using a DNA splicing enzyme, and then cloned to obtain a plasmid, which was named pECCG117-ilvA (F383A). .
  • Example 2 Construction of ilvA mutant plasmid having L-threonine dehydratase activity
  • an ilvA mutant gene plasmid was prepared using a random mutagenesis kit (Agilent Technologies, USA). PCR was performed using the primers of SEQ ID NO: 11 and SEQ ID NO: 12 using the ilvA (F383A) chromosome of Example 1 as a template. PCR conditions were repeated 30 times of denaturation at 95° C. for 2 minutes, denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 90 seconds, followed by polymerization at 72° C. for 10 minutes.
  • a DNA fragment of 1531 bp, an ilvA mutant capable of encoding L-threonine dehydratase having additional random mutations in addition to the mutation in which the 383th phenylalanine was substituted with alanine was amplified.
  • the pECCG117 vector and the ilvA mutant DNA fragment were treated with a restriction enzyme BamHI, ligated using a DNA conjugation enzyme, and then cloned to obtain a plasmid group.
  • Example 3 Production and evaluation of Corynebacterium sp. strain having L-isoleucine-producing ability
  • a strain producing L-isoleucine was prepared using wild-type Corynebacterium glutamicum ATCC13032. Specifically, in order to resolve feedback inhibition of threonine, a precursor of isoleucine, in the L-isoleucine biosynthesis pathway, arginine, the 407th amino acid of hom, a gene encoding homoserine dehydrogenase, is converted to histidine. was substituted (US Publication US 2020-0340022 A1, SEQ ID NO: 17)
  • SEQ ID NO: designation order 18 primer5 TCGAGCTCGGTACCCCGCTTTTGCACTCATCGAGC 19 primer6 CACGATCAGATGTGCATCATCAT 20 primer7 ATGATGATGCACATCTGATCGTG 21 primer8 CTCTAGAGGATCCCCGAGCATCTTCCAAAACCTTG
  • PfuUltra TM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C, 30 seconds; annealing 55° C., 30 seconds; and the polymerization reaction at 72° C. for 1 minute was repeated 28 times.
  • PCR was performed with primers of SEQ ID NO: 18 and SEQ ID NO: 21. PCR conditions were repeated 28 times of denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.
  • a 2 kb DNA fragment containing a mutation in the hom gene encoding a homoserine dehydrogenase mutant in which arginine at position 407 was substituted with histidine was amplified.
  • the amplification product was purified using a PCR purification kit (QUIAGEN) and used as an insert DNA fragment for vector construction. After the purified amplification product was treated with restriction enzyme smaI, the molar concentration (M) ratio of the pDZ vector (US 9109242 B2) and the amplification product, the inserted DNA fragment, which was heat-treated at 65° C. for 20 minutes was 1:2.
  • a vector pDZ-R407H for introducing a hom(R407H) mutation onto a chromosome was prepared by cloning using the Infusion Cloning Kit (TaKaRa) according to the provided manual.
  • the prepared vector was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and a strain containing a hom (R407H) mutation was obtained on the chromosome through a secondary crossover process, which was Corynebacterium glutamicum. It was named ATCC13032 hom (R407H).
  • a strain was prepared in the following manner. Specifically, the plasmid prepared in Example 1 was introduced into the Corynebacterium glutamicum ATCC 13032 hom (R407H) strain prepared in Example 3, and the strain into which the prepared plasmid was introduced was ATCC 13032 hom (R407H) / It was named pECCG117-ilvA (F383A). In addition, the mutant plasmid group obtained in Example 2 was introduced into the Corynebacterium glutamicum ATCC 13032 hom (R407H) strain, and the apoptosis rate was 70% as a result of plating on a minimal medium.
  • L-isoleucine was prepared by inoculating the strain into a 250 ml corner-barpool flask containing 25 ml of isoleucine production medium, and then culturing with shaking at 32° C. for 60 hours at 200 rpm.
  • the composition of the production medium used in this example is as follows.
  • Glucose 5% Bactopeptone 1%, Sodium Chloride 0.25%, Yeast Extract 1%, Urea 0.4%, pH 7.2
  • Glucose 10% yeast extract 0.2%, ammonium sulfate 1.6%, potassium monophosphate 0.1%, magnesium sulfate 0.1%, iron sulfate 10 mg/L, manganese sulfate 10 mg/L, biotin 200 ⁇ g/L , pH 7.2
  • the parent strain Corynebacterium glutamicum ATCC 13032 hom(R407H)/pECCG117-ilvA(F383A) produced L-isoleucine at a concentration of 2.5 g/L, but according to the present application
  • the mutant Corynebacterium glutamicum CJILE-301 produced L-isoleucine at a concentration of 4.3 g/L, confirming that the productivity of L-isoleucine was increased by about 172% compared to the parent strain.
  • the residual L-threonine concentration was decreased from 1.5 g/L to 0.0 g/L, thereby increasing the activity of ilvA for threonine.
  • the plasmid was isolated from the CJILE-301 strain and the ilvA gene was sequenced.
  • the 1141st nucleotide sequence of the ilvA gene was substituted from A to G, and 383th F of the ilvA protein was substituted with A. It was confirmed that the 381th T can encode a mutant protein substituted with A, which is shown in SEQ ID NO: 22.
  • the above result means that the strain introducing the ilvA mutant (T381A) of Example 2 obtained through random mutagenesis can produce L-isoleucine with high efficiency and high yield as a result.
  • Example 5 ilvA (T381A) and ilvA (T381A, F383A) mutant introduction strain having L-threonine dehydratase activity
  • Primers of SEQ ID NO: 31 and SEQ ID NO: 32 were prepared to introduce the ilvA mutants (T381A, F383A) identified in Example 4 into the wild-type strain.
  • PCR was performed using the primers of SEQ ID NO: 31 and SEQ ID NO: 32 using the plasmid DNA extracted from the CJLE-301 strain of Example 4 as a template.
  • the primer sequences used herein are shown in Table 4 below.
  • PfuUltra TM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C for 30 seconds; annealing 55° C. 30 seconds; and the polymerization reaction at 72° C. for 2 minutes was repeated 28 times.
  • the amplification product was purified using a PCR purification kit and used as an insert DNA fragment for vector construction. After the purified amplification product was treated with restriction enzyme smaI, the molar concentration (M) ratio of the pDZ vector and the inserted DNA fragment, which is the amplification product, was 1:2, which was heat-treated at 65° C. for 20 minutes, and an infusion cloning kit was used. By cloning according to the provided manual, a vector pDZ-T381A_F383A for introducing T381A and F383A mutations onto a chromosome was constructed.
  • the constructed vector was transformed into Corynebacterium glutamicum ATCC13032 hom (R407H) by electroporation, and a strain containing ilvA (T381A, F383A) mutation was obtained on the chromosome through a secondary crossover process. It was named CA10-3101.
  • the strain CA10-3101 was internationally deposited with the Korea Center for Microorganisms Conservation (KCCM), an international depository under the Budapest Treaty, as of May 27, 2020, and was given a deposit number as KCCM12739P.
  • KCCM Microorganisms Conservation
  • primers of SEQ ID NO: 47 and SEQ ID NO: 48 were prepared to confirm the isoleucine-producing ability and threonine-degrading effect of the ilvA (T381A) alone variant.
  • PCR was performed using Cgl13032 genomic DNA as a template and primers of SEQ ID NO: 31 and SEQ ID NO: 48, and SEQ ID NO: 32 and SEQ ID NO: 47, respectively.
  • the primer sequences used herein are shown in Table 5 below.
  • PfuUltra TM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C for 30 seconds; annealing 55° C. 30 seconds; And the polymerization reaction was repeated 28 times at 72°C for 2 minutes.
  • PCR was performed with primers of SEQ ID NO: 31 and SEQ ID NO: 32. PCR conditions were denatured at 95° C. for 10 minutes, followed by denaturation at 95° C. for 30 seconds, annealing at 56° C. for 30 seconds, and polymerization at 72° C. for 2 minutes repeated 30 times, followed by polymerization at 72° C. for 10 minutes.
  • the amplification product was purified using a PCR purification kit and used as an insert DNA fragment for vector construction. After the purified amplification product was treated with restriction enzyme smaI, the molar concentration (M) ratio of the pDZ vector and the inserted DNA fragment that was the amplification product, which was heat-treated at 65° C. for 20 minutes, was 1:2, and an infusion cloning kit was used.
  • a vector pDZ-T381A for introducing a T381A mutation onto a chromosome was constructed by cloning according to the provided manual.
  • the constructed vector was transformed into Corynebacterium glutamicum ATCC13032 hom (R407H) by electroporation, and a strain containing ilvA (T381A) mutation was obtained on the chromosome through a secondary crossover process, which was obtained by ATCC13032 hom It was named (R407H) ilvA (T381A).
  • the strain was inoculated into a 250 ml corner-barpool flask containing 25 ml of isoleucine production medium, and then cultured with shaking at 32° C. for 60 hours at 200 rpm to prepare L-isoleucine.
  • the composition of the production medium used in this example is as follows.
  • Glucose 10% yeast extract 0.2%, ammonium sulfate 1.6%, potassium monophosphate 0.1%, magnesium sulfate 0.1%, iron sulfate 10 mg/L, manganese sulfate 10 mg/L, biotin 200 ⁇ g/L , pH 7.2
  • the ATCC 13032 hom (R407H) ilvA (T381A, F383A) mutant line containing the F383A mutation additionally produced L-isoleucine at a concentration of 3.9 g/L, confirming that the L-isoleucine productivity was significantly increased compared to the parent strain. did
  • Example 6 Construction of ilvA mutant vector having L-threonine dehydratase activity
  • Example 7 The effect was confirmed by preparing a mutant in which another amino acid was substituted at the ilvA mutation position having high L-isoleucine-producing ability revealed in Example 4 above. Specifically, using the plasmid prepared in Example 3 as a template, 7 variants in which other amino acids were substituted at the 381 amino acid position of ilvA were prepared. Each variant, the amino acid substituted, and the primer sequence used to construct each variant are shown in Table 7 below.
  • PCR was performed using each of the primers shown in Tables 7 and 8 above.
  • Solg TM Pfu-X DNA polymerase SolGent co., Ltd.
  • PCR conditions were denatured at 95°C for 10 minutes, then denatured at 95°C for 30 seconds, annealed at 56°C for 30 seconds, and at 72°C for 90 seconds. After repeating the polymerization 30 times, the polymerization reaction was performed at 72° C. for 5 minutes.
  • PCR was performed with primers of SEQ ID NO: 11 and SEQ ID NO: 12. PCR conditions were denatured at 95° C. for 10 minutes, followed by denaturation at 95° C. for 30 seconds, annealing at 56° C. for 30 seconds, and polymerization at 72° C. for 2 minutes repeated 30 times, followed by polymerization at 72° C. for 10 minutes.
  • a 1736 bp DNA fragment containing a mutation in the ilvA gene encoding a threonine dehydratase variant in which threonine at position 381 was substituted with each amino acid of Table 3 was amplified.
  • the ilvA DNA fragment of 1736 bp obtained through PCR with the pECCG117 vector was treated with a restriction enzyme BamHI, ligated using a DNA splicing enzyme, and then cloned to obtain a plasmid.
  • seven types of ilvA mutant vectors in which threonine at position 381 was substituted with the amino acids shown in Table 3 were prepared, and they were named as shown in Table 9 below.
  • Example 7 Evaluation of L-isoleucine-producing ability of ilvA mutant introduced strain having L-threonine dehydratase activity
  • a pair of primers (SEQ ID NO: 50 and SEQ ID NO: 51) and a pair of primers (SEQ ID NO: 52 and SEQ ID NO: 53) for amplifying the 3' bottom region were designed.
  • the primers of SEQ ID NOs: 50 and 53 inserted Xba I and SalI restriction enzyme sites at each end, and the primers of SEQ ID NOs: 51 and 52 were designed to cross each other and nucleotide substitution mutations were located at these sites. Primer sequences were shown in Table 10 below.
  • SEQ ID NO: designation order SEQ ID NO: 50 lysC_L377K_5 F tcctctagaGCTGCGCAGTGTTGAATACG SEQ ID NO: 51 lysC_L377K_5 R AGGTGGAAATCTTTTCGATGTTC SEQ ID NO: 52 lysC_L377K_3 F GAACATCGAAAAGATTTCCACCT SEQ ID NO: 53 lysC_L377K_3 R gactctagaGTTCACCTCAGAGACGATTA
  • PCR was performed using the primers of SEQ ID NO: 50 and SEQ ID NO: 51, SEQ ID NO: 52 and SEQ ID NO: 53 using the chromosome of Corynebacterium glutamicum ATCC13032 as a template. PCR conditions were repeated 30 times of denaturation at 95° C. for 5 minutes, denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 30 seconds, followed by polymerization at 72° C. for 7 minutes.
  • PCR was performed with primers of SEQ ID NO: 50 and SEQ ID NO: 53. PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization for 60 seconds at 72°C, followed by polymerization at 72°C for 7 minutes.
  • Restriction enzymes XbaI and SalI contained at the end of the lysC (L377K) PCR fragment obtained through the PCR are treated, and the restriction enzymes XbaI and SalI are treated with pDZ (KR 2008-0025355) vector by ligation and cloning.
  • pDZ KR 2008-0025355
  • the prepared pDZ-lysC (L377K) vector was transformed into the ATCC13032 hom (R407H) strain of Example 3 by an electric pulse method, and a mutation was introduced into the lysC gene on the chromosome through a secondary crossover process Corynebacterium ATCC 13032 hom(R407H) lysC (L377K) was obtained. The gene into which the mutation was introduced was finally confirmed by comparison with the sequence of the wild-type lysC gene through sequencing after PCR using the primers of SEQ ID NOs: 50 and 53.
  • Example 7 types of ilvA mutant vectors prepared in Example 6 and pECCG117-ilvA (T381A, F383A) extracted from the CJLE-301 strain of Example 4 were prepared above Corynebacterium glutamicum ATCC 13032 hom (R407H) lysC (L377K) ) strains were introduced by the electric pulse method and then plated on a selective medium containing 25 mg/L of kanamycin to obtain each transformant. Thereafter, the concentrations of L-isoleucine and L-threonine in the culture medium were measured in the same manner as in Example 4, and the results are shown in Table 11 below.
  • T381A, T381S, T381P, T381Q, T381V, T381I, T381G, and T381M mutants of ilvA had a higher threonine degradation rate and increased L-isoleucine production capacity than the wild type.
  • Example 8 Evaluation of L-isoleucine-producing ability of mutant ilvA having threonine dehydratase activity in L-isoleucine-producing strains
  • Example 7 the ilvA (T381A, F383A) mutation, which showed the best increase in L-isoleucine production capacity, was treated with NTG (N-Methyl-N'-nitro-N-nitrosoguanidine), L-isoleucine-producing strain KCJI-38 ( KCCM11248P, Republic of Korea Patent No. 10-1335789) was introduced into the strain by the electric pulse method, and then plated on a selective medium containing 25 mg/L of kanamycin to obtain each transformant. Thereafter, the concentrations of L-isoleucine and L-threonine in the culture medium were measured in the same manner as in Example 4, and the results are shown in Table 12 below.
  • the KCCM11248P / pECCG117-ilvA (T381A, F383A) strain introduced with the ilvA (F381T, F383A) mutation significantly increased L-isoleucine production compared to the KCCM11248P or KCCM11248P / pECCG117-ilvA (F383A) strain. and it was confirmed that the L-threonine decomposition rate was high.
  • the ilvA variant of the present application can increase the production of L-isoleucine.
  • the mutation at position 381 of the ilvA gene was a mutation that helps L-threonine to be bound to be degraded, it was confirmed that the mutation serves to increase the production of L-isoleucine.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 출원은 L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 L-이소류신 생산 방법에 관한 것이다.

Description

L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 L-이소류신 생산 방법
본 출원은 L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 L-이소류신 생산 방법에 관한 것이다.
L-이소류신은 총 20가지의 아미노산 중 분지쇄 아미노산(branched-chain amino acid)의 한 종류로 필수아미노산으로 분류되어 동물 사료, 식품 첨가물 및 의약 분야에 사용된다. L-이소류신은 대사 후 에너지 생성, 헤모글로빈 생성, 혈당 조절, 근육 생성 및 보수 등의 기능을 하기 때문에 수액제, 영양제, 스포츠 영양제뿐만 아니라 동물 사료에도 사용이 증가되고 있다.
L-이소류신 생산을 위해서는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)과 대장균(Escherichia coli)이 대표적인 미생물로 이용되고 있다. 이 미생물들에서 L-이소류신은 다른 분지쇄 아미노산인 L-발린, L-류신과 주된 생합성 경로를 공유하고 있다. L-이소류신의 생합성 경로를 살펴보면 해당 과정(Glycolysis)에서 생성되는 피루브산(pyruvate)과 아스파르트산(Aspartate; Aspartic acid) 유래 아미노산인 L-쓰레오닌으로부터 생성된 2-케토부티르산(2-ketobutyrate)이 전구체로 사용되어 최종적으로 L-이소류신이 생산된다.
이 때, ilvA 유전자가 코딩하는 L-쓰레오닌 디하이드라타아제(L-Threonine dehydratase, TD)(EC 4.3.1.19)에 의해 L-쓰레오닌으로부터 2-케토부티르산이 생성된다. L-쓰레오닌 디하이드라타아제가 쓰레오닌 농도에 민감할수록 L-이소류신 생산능이 높아질 수 있고, 또한 L-쓰레오닌 디하이드라타아제 효소는 L-이소류신에 의해 피드백저해를 받는 것으로 알려져 있다(Peng et al. Bioprocess Biosyst Eng 33:339-345. 2010; Guillouet et al.Appl Microbiol Biotechnol. 2001 Dec;57(5-6):667-73.). 따라서 L-쓰레오닌 디하이드라타아제는 L-이소류신 생산에서 제한인자가 될 수 있는 한편, 이소류신 생산능을 향상시키기 위한 매우 중요한 효소이다.
본 발명자들은 미생물에서의 L-이소류신 생산을 증가시키기 위해 예의 노력한 결과, L-이소류신 생산을 증가시키는 ilvA 변이체를 확보하고, 이를 포함하여 L-이소류신 생산능이 증가된 미생물을 개발함으로써 본 출원을 완성하였다.
본 출원은 서열번호 1의 아미노산 서열의 381번째 위치의 아미노산이 다른 아미노산으로 치환된, L-쓰레오닌 디하이드라타아제(L-threonine dehydratase)의 변이체를 제공한다.
본 출원은 본 출원의 변이체를 코딩하는 폴리뉴클레오티드를 제공한다.
본 출원은 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 제공한다.
본 출원은 본 출원의 변이체; 본 출원의 변이체를 코딩하는 폴리뉴클레오티드; 및 본 출원의 폴리뉴클레오티드를 포함하는 벡터; 중 어느 하나 이상을 포함하여, L-이소류신을 생산하는 미생물을 제공한다.
본 출원은 본 출원의 변이체; 본 출원의 변이체를 코딩하는 폴리뉴클레오티드; 및 본 출원의 폴리뉴클레오티드를 포함하는 벡터; 중 어느 하나 이상을 포함하는 미생물을 배지에서 배양하는 단계를 포함하는, L-이소류신 생산 방법을 제공한다.
본 출원은 본 출원의 미생물 또는 본 출원의 미생물의 배양물을 포함하는, L-이소류신 생산용 조성물을 제공한다.
본 출원의 L-쓰레오닌 디하이드라타아제의 변이체를 이용하여, L-이소류신 생산능을 갖는 미생물을 배양하는 경우, 기존 비변형 단백질에 비해 고수율의 L-이소류신 생산이 가능하다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
본 출원의 하나의 양태는 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된, L-쓰레오닌 디하이드라타아제(L-threonine dehydratase)의 변이체를 제공하는 것이다.
구체적으로, 상기 변이체는 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 알라닌, 세린, 프롤린, 글루타민, 발린, 이소류신, 글리신 및 메티오닌으로 이루어지는 군으로부터 선택되는 어느 하나로 치환된 것일 수 있으나, 이로 제한되지 않는다.
또한, 본 출원의 변이체는 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된 것 외에, 서열번호 1의 아미노산 서열의 383번째에 상응하는 위치의 아미노산이 다른 아미노산으로 추가로 치환된 것일 수 있으나, 이에 제한되지 않는다. 상기 다른 아미노산은 구체적으로 비극성 아미노산일 수 있고, 보다 구체적으로 알라닌일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "L-이소류신"은 필수아미노산의 하나로 구조적으로 L-발린, L-류신과 함께 분지쇄 아미노산에 해당하는 화학식 HO2CCH(NH2)CH(CH3)CH2CH3인 L-아미노산을 의미한다.
본 출원에서 용어, "L-쓰레오닌 디하이드라타아제(L-threonine dehydratase, TD)"는 L-이소류신 생합성 경로에 관여하는 효소로, L-이소류신 생합성 단계 중 아스파르트산(Aspartate; Aspartic acid) 유래 아미노산인 L-쓰레오닌으로부터 2-케토부티르산(2-ketobutyrate)을 생성하는 효소를 의미한다. L-이소류신은 상기 2-케토부티르산과 해당 과정(Glycolysis)에서 생성되는 피루브산(pyruvate)을 전구체로 사용하여 생산된다.
상기 L-쓰레오닌 디하이드라타아제는 예를 들면, 서열번호 1의 아미노산 서열을 포함하는 단백질일 수 있다. 상기 서열번호 1의 아미노산 서열을 포함하는 단백질은 서열번호 1의 아미노산 서열을 가지는 단백질, 서열번호 1의 아미노산 서열로 구성되는 단백질과 혼용하여 사용될 수 있다.
구체적으로, 상기 서열번호 1은 ilvA 유전자에 의해 코딩되는 L-쓰레오닌 디하이드라타아제의 아미노산 서열일 수 있다. 상기 서열번호 1의 아미노산은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있다. 일 예로, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 유래일 수 있으나, 이에 제한되지 않으며 상기 아미노산과 동일한 활성을 갖는 서열은 제한없이 포함될 수 있다. 또한, 본 출원에서의 L-쓰레오닌 디하이드라타아제는 비록 서열번호 1의 아미노산을 포함하는 단백질이라고 정의하였으나, 서열번호 1의 아미노산 서열 앞뒤로의 무의미한 서열 추가 또는 자연적으로 발생할 수 있는 돌연변이, 또는 이의 잠재성 돌연변이(silent mutation)를 제외하는 것이 아니며, 서열번호 1의 아미노산 서열을 포함하는 단백질과 서로 동일 또는 상응하는 활성을 가지는 경우라면 본 출원의 L-쓰레오닌 디하이드라타아제에 해당됨은 당업자에게 자명하다. 구체적인 예를 들어, 본 출원의 L-쓰레오닌 디하이드라타아제는 서열번호 1의 아미노산 서열 또는 이와 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 갖는 아미노산 서열로 구성되는 단백질일 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 변이 대상이 되는 단백질의 범위 내에 포함됨은 자명하다.
즉, 본 출원에서 '특정 서열번호로 기재된 아미노산 서열을 갖는 단백질 또는 폴리펩티드', '특정 서열번호로 기재된 아미노산 서열을 포함하는 단백질 또는 폴리펩티드'라고 기재되어 있다 하더라도, 해당 서열번호의 아미노산 서열로 이루어진 폴리펩티드와 동일 또는 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원에서 사용될 수 있음은 자명하다. 예를 들어, '서열번호 1의 아미노산 서열로 이루어진 폴리펩티드'는, 이와 동일 또는 상응하는 활성을 가지는 경우라면 '서열번호 1의 아미노산 서열로 이루어진 폴리펩티드'에 속할 수 있음은 자명하다.
본 출원에서 용어, "변이체(variant)"는 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)되어 상기 변이체의 변이 전 아미노산 서열과 상이하나 기능(functions) 또는 특성(properties)이 유지되는 폴리펩티드를 지칭한다. 이러한 변이체는 일반적으로 상기 폴리펩티드의 아미노산 서열 중 하나 이상의 아미노산을 변형하고, 상기 변형된 폴리펩티드의 특성을 평가하여 동정(identify)될 수 있다. 즉, 변이체의 능력은 변이 전 폴리펩티드에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 또한, 일부 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이체를 포함할 수 있다. 다른 변이체는 성숙 단백질(mature protein)의 N- 및/또는 C-말단으로부터 일부분이 제거된 변이체를 포함할 수 있다. 상기 용어 "변이체"는 변이형, 변형, 변이형 폴리펩티드, 변이된 단백질, 변이 및 변이체 등의 용어(영문 표현으로는 modification, modified polypeptide, modified protein, mutant, mutein, divergent 등)가 혼용되어 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다.
본 출원의 목적상, 상기 변이체는 천연의 야생형 또는 비변형 단백질 대비 변이된 단백질의 활성이 증가되어 L-이소류신 생산이 증대된 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
또한, 변이체는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 폴리펩티드는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이전(transfer)에 관여하는 단백질 N-말단의 시그널(또는 리더) 서열과 컨쥬게이트 할 수 있다. 또한 상기 폴리펩티드는 폴리펩티드를 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
상기 '다른 아미노산으로 치환'은 치환 전의 아미노산과 다른 아미노산으로 치환되는 것이면 제한되지 않는다. 즉, 서열번호 1의 아미노산 서열의 N-말단으로부터 381번째 아미노산인 쓰레오닌이 쓰레오닌 이외의 다른 아미노산 잔기로 치환된 것이라면 제한되지 않으며, 구체적으로 알지닌, 리신, 히스티딘, 글루탐산, 아르파르트산, 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판, 프롤린, 세린, 쓰레오닌, 시스테인, 티로신, 아스파라긴 및 글루타민 중 어느 하나의 아미노산으로 치환된 것일 수 있다. 보다 구체적으로, 상기 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산인 쓰레오닌은 알라닌, 세린, 프롤린, 글루타민, 발린, 이소류신, 글리신 및 메티오닌으로 이루어지는 군으로부터 선택되는 어느 하나로 치환되는 것일 수 있으나, 이에 제한되지 않는다. 또한, 상기 치환된 아미노산 잔기에는 천연 아미노산뿐만 아니라 비천연 아미노산 역시 포함될 수 있다. 상기 비천연 아미노산은 예를 들어, D-아미노산, 호모(Homo)-아미노산, 베타-호모(Beta-homo)-아미노산, N-메틸 아미노산, 알파-메틸 아미노산, 비통상 아미노산 (예컨대, 시트룰린 또는 나프틸알라닌 등) 일 수 있으나, 이에 제한되지 않는다. 한편, 본 출원에서 '특정 아미노산이 치환되었다'고 표현하는 경우, 다른 아미노산으로 치환되었다고 별도로 표기하지 않더라도 치환 전의 아미노산과 다른 아미노산으로 치환되는 것임은 자명하다.
또한, 상기 변이체는 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환되는 것 외에 추가로 383번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된 것일 수 있다. 보다 구체적으로, 상기 서열번호 1의 아미노산 서열의 383번째에 상응하는 위치의 아미노산은 비극성 아미노산으로 치환된 것일 수 있으며, 상기 비극성 아미노산은 알라닌일 수 있으나, 이에 제한되지 않는다.
즉, 상기 변이체는 서열번호 1의 아미노산 서열의 i) 381번째에 상응하는 위치의 아미노산이 알라닌, 세린, 프롤린, 글루타민, 발린, 이소류신, 글리신 및 메티오닌으로 이루어지는 군으로부터 선택되는 어느 하나로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 알라닌으로 치환된 것일 수 있으나, 이로 제한되지 않는다.
상기 변이체는 서열번호 1의 아미노산 서열과 80% 이상, 100% 미만의 서열 상동성을 가지는 것일 수 있으나, 이에 제한되지 않는다. 구체적으로 본 출원의 상기 변이체는 서열번호 1의 아미노산 서열과 적어도 80%, 90%, 95%, 96%, 97%, 98%, 또는 99% 상동성을 가지는 것일 수 있으며 또한, 이러한 상동성을 가지며 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면 381 및/또는 383번째 위치의 아미노산 서열 이외의 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 변이체에 포함됨은 자명하다.
본 출원에서 용어 "상응하는(corresponding to)"은, 폴리펩티드에서 열거되는 위치의 아미노산 잔기이거나, 또는 폴리펩티드에서 열거되는 잔기와 유사하거나 동일하거나 상동한 아미노산 잔기를 지칭한다. 상응하는 위치의 아미노산을 확인하는 것은 특정 서열을 참조하는 서열의 특정 아미노산을 결정하는 것일 수 있다. 본 출원에 사용된 "상응 영역"은 일반적으로 관련 단백질 또는 참조 (reference) 단백질에서의 유사하거나 대응되는 위치를 지칭한다.
예를 들어, 임의의 아미노산 서열을 서열번호 1과 정렬(align)하고, 이를 토대로 상기 아미노산 서열의 각 아미노산 잔기는 서열번호 1의 아미노산 잔기와 상응하는 아미노산 잔기의 숫자 위치를 참조하여 넘버링 할 수 있다. 예를 들어, 본 출원에 기재된 것과 같은 서열 정렬 알고리즘은, 쿼리 시퀀스("참조 서열"이라고도 함)와 비교하여 아미노산의 위치, 또는 치환, 삽입 또는 결실 등의 변형이 발생하는 위치를 확인할 수 있다.
이러한 정렬에는 예를 들어 Needleman-Wunsch 알고리즘 (Needleman 및 Wunsch, 1970, J. Mol. Biol. 48: 443-453), EMBOSS 패키지의 Needleman 프로그램 (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) 등을 이용할 수 있으나, 이에 제한되지 않고 당업계에 알려진 서열 정렬 프로그램, 쌍 서열(pairwise sequence) 비교 알고리즘 등을 적절히 사용할 수 있다.
본 출원에서 제공하는 L-쓰레오닌 디하이드라타아제의 변이체는, 상기에서 설명한 L-쓰레오닌 디하이드라타아제에서 특이적 위치의 아미노산이 치환되어, L-이소류신의 전구체 생산이 증가됨으로써, 이에 따라 L-이소류신의 생산능이 변이 전 단백질 대비 증가될 수 있다.
상기 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된, L-쓰레오닌 디하이드라타아제의 변이체는 서열번호 3 내지 10 중 어느 하나의 아미노산 서열을 포함하는 것일 수 있고, 구체적으로는 서열번호 3 내지 10 중 어느 하나의 아미노산 서열로 필수적으로 구성되는(consisting essentially of) 것일 수 있고, 보다 구체적으로는 서열번호 3 내지 10 중 어느 하나의 아미노산 서열로 이루어진 것일 수 있으나, 이에 제한되지 않는다. 상기 서열번호 3 내지 10의 아미노산 서열은 각각 상기 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 알라닌, 세린, 프롤린, 글루타민, 발린, 이소류신, 글리신 또는 메티오닌으로 치환된 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 변이체는 서열번호 3 내지 10 중 어느 하나의 아미노산 서열 또는 상기 아미노산 서열의, 381번째에 상응하는 위치의 아미노산은 고정되고, 이와 80% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함할 수 있으나, 이에 제한되는 것은 아니다. 구체적으로, 본 출원의 변이체는 서열번호 3 내지 10 중 어느 하나의 아미노산 서열과 적어도 80%, 90%, 95%, 96%, 97%, 98%, 또는 99% 상동성 또는 동일성을 가지는 폴리펩티드를 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면 381번째 아미노산 위치 이외에, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 범위 내에 포함됨은 자명할 수 있다.
더하여, 상기 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된 L-쓰레오닌 디하이드라타아제의 변이체는 추가로 서열번호 1의 아미노산 서열의 383번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된 것일 수 있다. 상기 서열번호 1의 아미노산 서열의 i) 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된, L-쓰레오닌 디하이드라타아제의 변이체는 서열번호 23 내지 30 중 어느 하나의 아미노산 서열을 포함하는 것일 수 있거나; 서열번호 23 내지 30 중 어느 하나의 아미노산 서열로 필수적으로 구성되는 것일 수 있거나; 또는 서열번호 23 내지 30 중 어느 하나의 아미노산 서열로 이루어진 것일 수 있으나, 이에 제한되지 않는다. 상기 서열번호 23 내지 30의 아미노산 서열은 각각 상기 서열번호 1의 아미노산 서열의 i) 381번째에 상응하는 위치의 아미노산이 각각 알라닌, 세린, 프롤린, 글루타민, 발린, 이소류신, 글리신 또는 메티오닌으로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 알라닌으로 치환된 것일 수 있으나, 이에 제한되지 않는다. 구체적으로, 상기 서열번호 1의 아미노산 서열의 a) i) 381번째에 상응하는 위치의 아미노산이 알라닌으로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 알라닌으로 치환; b) i) 381번째에 상응하는 상응하는 위치의 아미노산이 세린으로 치환되고, 및/또는 ii) 383번째 에 상응하는 위치의 아미노산이 알라닌으로 치환; c) i) 381번째에 상응하는 위치의 아미노산이 프롤린으로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 알라닌으로 치환; d) i) 381번째에 상응하는 위치의 아미노산이 글루타민으로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 알라닌으로 치환; e) i) 381번째에 상응하는 위치의 아미노산이 발린으로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 알라닌으로 치환; f) i) 381번째에 상응하는 위치의 아미노산이 이소류신으로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 알라닌으로 치환; g) i) 381번째에 상응하는 위치의 아미노산이 글리신으로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 알라닌으로 치환; 또는 h) i) 381번째에 상응하는 위치의 아미노산이 메티오닌으로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 알라닌으로 치환;된 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 변이체는 서열번호 23 내지 30 중 어느 하나의 아미노산 서열 또는 상기 아미노산 서열에서, 381번째 및/또는 383번째에 상응하는 위치의 아미노산 중 선택된 어느 하나 이상의 아미노산은 고정되고, 이와 80% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함할 수 있으나, 이에 제한되는 것은 아니다. 구체적으로, 본 출원의 변이체는 서열번호 23 내지 30 중 어느 하나의 아미노산 서열과 적어도 80%, 90%, 95%, 96%, 97%, 98%, 또는 99% 상동성 또는 동일성을 가지는 폴리펩티드를 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면 381번째 및/또는 383번째에 상응하는 위치의 아미노산 이외에, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 범위 내에 포함됨은 자명하다.
본 출원에서 용어, '상동성 (homology)' 또는 '동일성 (identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 L-쓰레오닌 디하이드라타아제의 변이체를 코딩하는 폴리뉴클레오티드를 제공한다.
상기 서열번호 1의 아미노산 서열, L-쓰레오닌 디하이드라타아제 및 이의 변이체에 대해서는 전술한 바와 같다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥을 의미한다. 본 출원에 있어서, 상기 폴리뉴클레오티드는 본 출원의 L-쓰레오닌 디하이드라타아제의 변이체를 코딩하는 폴리뉴클레오티드 단편을 의미할 수 있다.
상기 폴리뉴클레오티드는, 본 출원의 L-쓰레오닌 디하이드라타아제의 변이체를 코딩하는 폴리뉴클레오티드 서열이라면 제한없이 포함될 수 있다. 본 출원에서 L-쓰레오닌 디하이드라타아제의 아미노산 서열을 코딩하는 유전자는 ilvA 유전자이며, 상기 유전자는 구체적으로 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 유래일 수 있으나, 이에 제한되지 않는다.
구체적으로, 본 출원의 L-쓰레오닌 디하이드라타아제의 변이체를 코딩하는 폴리뉴클레오티드는 상기 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된 L-쓰레오닌 디하이드라타아제의 변이체를 코딩하는 염기서열을 포함할 수 있다.
상기 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리펩티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩티드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 상기 폴리뉴클레오티드는 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된 L-쓰레오닌 디하이드라타아제의 변이체를 코딩하는 폴리뉴클레오티드 서열이라면 제한 없이 포함할 수 있다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화할 수 있는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 6% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1ХSSC, 0.1% SDS, 구체적으로 60℃, 0.1ХSSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1ХSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
또한, 본 출원의 L-쓰레오닌 디하이드라타아제의 변이체를 코딩하는 폴리뉴클레오티드는 상기 서열번호 1의 아미노산 서열의 i) 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된 L-쓰레오닌 디하이드라타아제의 변이체를 코딩하는 염기서열을 포함할 수 있다. 상기 폴리뉴클레오티드는 서열번호 1의 아미노산 서열의 381번째 및/또는 383번째에 상응하는 위치의 아미노산 중 선택된 어느 하나 이상의 아미노산이 다른 아미노산으로 치환된 L-쓰레오닌 디하이드라타아제의 변이체를 코딩하는 폴리뉴클레오티드 서열이라면 제한 없이 포함할 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 L-쓰레오닌 디하이드라타아제의 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 제공한다.
상기 서열번호 1의 아미노산 서열, L-쓰레오닌 디하이드라타아제, 이의 변이체 및 폴리뉴클레오티드에 대해서는 전술한 바와 같다.
본 출원에서 사용된 용어 "벡터"는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 L-쓰레오닌 디하이드라타아제의 변이체; 상기 변이체를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터; 중 어느 하나 이상을 포함하여, L-이소류신을 생산하는 미생물을 제공한다.
상기 서열번호 1의 아미노산 서열, L-쓰레오닌 디하이드라타아제, 이의 변이체, 폴리뉴클레오티드 및 벡터에 대해서는 전술한 바와 같다.
본 출원에서 용어 "L-이소류신을 생산하는 미생물"이란, 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
본 출원의 L-이소류신을 생산하는 미생물은 상기 폴리펩티드; 이를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하여, 목적 단백질 또는 상기 목적 단백질의 생산에 관여하는 목적 산물의 생산능을 갖는 미생물일 수 있으나 이에 제한되지 않는다. 상기 미생물은, 자연적으로 목적 단백질 또는 목적 산물 생산능을 가지고 있는 미생물, 또는 목적 단백질 또는 목적 산물 생산능이 없는 모균주에 목적 단백질 또는 목적산물 생산능이 부여된 미생물 일 수 있으나 이에 제한되지 않는다. 본 출원의 목적상, 상기 목적 단백질은 L-쓰레오닌 디하이드라타아제의 변이체일 수 있고, 상기 목적 산물은 L-이소류신일 수 있다.
상기 L-이소류신을 생산하는 미생물은 본 출원의 폴리펩티드, 이를 코딩하는 폴리뉴클레오티드, 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 통해 유전적으로 변형된 미생물; 상기 폴리펩티드, 또는 이를 코딩하는 폴리뉴클레오티드를 발현하도록 변형된 미생물; 상기 폴리펩티드, 또는 이를 코딩하는 폴리뉴클레오티드를 발현하는 재조합 미생물; 또는 상기 폴리펩티드 활성을 갖는 재조합 미생물일 수 있으나, 이에 제한되지 않는다. 본 출원의 목적상, 상기 L-이소류신을 생산하는 미생물은 자연적으로 약한 L-이소류신 생산능을 가지고 있는 미생물에 L-쓰레오닌 디하이드라타아제의 변이체가 도입되어 L-이소류신 생산능이 증가된 미생물을 의미할 수 있다. 구체적으로, 상기 미생물은 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된, L-쓰레오닌 디하이드라타아제의 변이체를 발현하는 미생물로서, 상기 L-쓰레오닌 디하이드라타아제의 변이체는 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 알라닌, 세린, 프롤린, 글루타민, 발린, 이소류신, 글리신 및 메티오닌으로 이루어지는 군으로부터 선택되는 어느 하나 이상의 아미노산으로 치환된 것일 수 있으나, 이로 제한되지 않는다.
또한, 상기 L-이소류신을 생산하는 미생물의 경우, 야생형 또는 비변형 미생물에 비하여 L-쓰레오닌 디하이드라타아제의 활성이 증가함에 따라, L-이소류신의 전구체인 2-케토부티르산의 생산능이 증가함으로써, L-이소류신의 생산능이 증가하는 것을 특징으로 할 수 있다. 이는 야생형 또는 비변형 미생물이 L-이소류신을 생산하지 못하거나, L-이소류신을 생산하더라도 극미량을 생산할 수 있는 것에 반해, 본 출원의 L-쓰레오닌 디하이드라타아제의 변이체를 도입함으로써 미생물의 L-이소류신의 전구체 생산량을 증가시켜, L-이소류신 생산량을 증가시킬 수 있다는 것에 의의가 있을 수 있다.
본 출원에서 용어 "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 상기 "비변형 미생물"은 "변형 전 균주", "변형 전 미생물", "비변이 균주", "비변형 균주", "비변이 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
더하여, 본 출원의 L-이소류신을 생산하는 미생물은 상기 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된, L-쓰레오닌 디하이드라타아제의 변이체뿐만 아니라, 상기 서열번호 1의 아미노산 서열에서 추가로 서열번호 1의 아미노산 서열의 383번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된 L-쓰레오닌 디하이드라타아제의 변이체를 발현하는 것일 수 있다. 본 출원의 L-이소류신을 생산하는 미생물은 구체적으로, 상기 서열번호 1의 아미노산 서열의 i) 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된, L-쓰레오닌 디하이드라타아제의 변이체를 발현하는 것일 수 있고, 보다 구체적으로, 상기 서열번호 1의 아미노산 서열의 i) 381번째에 상응하는 위치의 아미노산이 알라닌, 세린, 프롤린, 글루타민, 발린, 이소류신, 글리신 및 메티오닌으로 이루어지는 군으로부터 선택되는 어느 하나 이상의 아미노산으로 치환되고, 및/또는 ii) 383번째에 상응하는 위치의 아미노산이 알라닌으로 치환된, L-쓰레오닌 디하이드라타아제의 변이체를 발현하는 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, 단백질이 "발현되도록/되는"은 목적 단백질이 미생물 내에 도입되거나, 미생물 내에서 발현되도록 변형된 상태를 의미한다. 상기 목적 단백질이 미생물 내 존재하는 단백질인 경우 내재적 또는 변형 전에 비하여 그 활성이 강화된 상태를 의미한다. 본 출원의 목적상, 상기 "목적 단백질"은 전술한 L-쓰레오닌 디하이드라타아제의 변이체일 수 있다. 구체적으로, "단백질의 도입"은, 미생물이 본래 가지고 있지 않았던 특정 단백질의 활성을 나타나게 되는 것 또는 해당 단백질의 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타나게 되는 것을 의미한다. 예를 들어, 특정 단백질을 코딩하는 폴리뉴클레오티드가 미생물 내 염색체로 도입되거나, 특정 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터가 미생물 내로 도입되어 이의 활성이 나타나는 것일 수 있다.
본 출원에서 용어, 폴리펩티드 활성의 "강화"는, 폴리펩티드의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 활성화(activation), 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 활성화, 강화, 상향조절, 과발현, 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 “내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "강화", "상향조절", "과발현" 또는 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성 및/또는 농도(발현량)에 비하여 향상된 것을 의미한다.
상기 강화는 외래의 폴리펩티드를 도입하거나, 내재적인 폴리펩티드의 활성 강화 및/또는 농도(발현량)를 통해 달성할 수 있다. 상기 폴리펩티드의 활성의 강화 여부는 해당 폴리펩티드의 활성 정도, 발현량 또는 해당 폴리펩티드로부터 배출되는 산물의 양의 증가로부터 확인할 수 있다.
상기 폴리펩티드의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 폴리펩티드의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드 활성의 강화는
1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가;
2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역을 활성이 강력한 서열로 교체;
3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
4) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드의 아미노산 서열의 변형;
5) 폴리펩티드 활성이 강화도록 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열의 변형 (예를 들어, 폴리펩티드의 활성이 강화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 폴리뉴클레오티드 서열의 변형);
6) 폴리펩티드의 활성을 나타내는 외래 폴리펩티드 또는 이를 코딩하는 외래 폴리뉴클레오티드의 도입;
7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
보다 구체적으로,
상기 1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터의 숙주세포 내로의 도입에 의해 달성되는 것일 수 있다. 또는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 숙주세포 내의 염색체 내에 1 카피 또는 2 카피 이상 도입에 의해 달성되는 것일 수 있다. 상기 염색체 내에 도입은 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다. 상기 벡터는 전술한 바와 같다.
상기 2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역(또는 발현조절서열)을 활성이 강력한 서열로 교체는, 예를 들면, 상기 발현조절영역의 활성을 더욱 강화하도록 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 가지는 서열로의 교체일 수 있다. 상기 발현조절영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 그리고 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 일 예로, 본래의 프로모터를 강력한 프로모터로 교체시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터, yccA 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 높은 다른 개시코돈을 코딩하는 염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 폴리펩티드의 활성을 강화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 증가하도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 상기 교체는 구체적으로 상동재조합에 의하여 폴리뉴클레오티드를 염색체내로 삽입함으로써 수행될 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 전술한 바와 같다.
상기 6) 폴리펩티드의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 상기 폴리펩티드와 동일/유사한 활성을 나타내는 폴리펩티드를 코딩하는 외래 폴리뉴클레오티드의 숙주세포 내 도입일 수 있다. 상기 외래 폴리뉴클레오티드는 상기 폴리펩티드와 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한이 없다. 상기 도입에 이용되는 방법은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 폴리펩티드가 생성되어 그 활성이 증가될 수 있다.
상기 7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩티드의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 폴리펩티드 활성의 강화는, 상응하는 폴리펩티드의 활성 또는 농도 발현량이 야생형이나 변형 전 미생물 균주에서 발현된 폴리펩티드의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩티드로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 미생물에서 폴리뉴클레오티드의 일부 또는 전체의 변형은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위 (engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오티드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
이와 같은 폴리펩티드 또는 단백질 활성의 강화는, 상응하는 폴리펩티드 또는 단백질의 활성 또는 농도가 야생형이나 변형 전 미생물 균주에서 발현된 폴리펩티드 또는 단백질의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩티드 또는 단백질로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 상기 L-쓰레오닌 디하이드라타아제의 변이체를 포함하는 미생물은 재조합 미생물일 수 있고, 상기 재조합은 형질전환과 같은 유전적 변형에 의해 이루어질 수 있다. 구체적으로, 본 출원의 미생물은 상기 L-쓰레오닌 디하이드라타아제의 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환되어 제조된 재조합 미생물일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어 "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 벡터를 형질전환 시키는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법(electroporation), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌 글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
상기 L-이소류신을 생산하는 미생물은 L-이소류신을 생산할 수 있다면 그 종류가 특별히 제한되지 않으나, 예를 들면, 코리네박테리움(Corynebacterium) 속, 에스케리키아(Escherichia) 속, 엔테로박터(Enterbacter) 속, 어위니아(Erwinia) 속, 세라티아(Serratia) 속, 프로비덴시아(Providencia) 속 및 브레비박테리움(Brevibacterium) 속에 속하는 미생물 일 수 있고, 구체적으로, 코리네박테리움(Corynebacterium) 속 미생물일 수 있다.
본 출원의 "코리네박테리움 속 미생물"은 모든 코리네박테리움 속 미생물을 포함할 수 있다. 구체적으로, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있고, 더욱 구체적으로는 코리네박테리움 글루타미쿰일 수 있다.
본 출원에서 상기 미생물의 모균주는 L-이소류신의 생산량을 증가시키기 위해 추가적으로 L-이소류신의 생합성 경로를 강화시킨 미생물일 수 있으나, 이로 제한되지 않는다.
구체적으로, 상기 미생물은 상기 L-이소류신의 생합성 경로를 강화시키기 위해, 예를 들면, 이소류신의 전구체인 쓰레오닌의 피드백 저해 해소를 위해 호모세린 디하이드로게나제를 코딩하는 hom 유전자에 유전적 변이(R407H)(미국공개공보 US 2020-0340022 A1)를 추가로 도입하거나, 아스파르토키나아제를 코딩하는 lysC 유전자에 유전적 변이(L377K)(미국등록공보 US 10662450 B2)를 추가로 도입한 미생물일 수 있다. 그러나, 상기에 제한되지 않고 당업계에 공지된 유전자 발현 조절 방법으로 L-이소류신의 생산량을 증가시킬 수 있다.
본 출원에서, 용어 "강화/증가"는 내재적 활성에 비하여 활성이 증가되는 것을 모두 포함하는 개념이다.
이러한 유전자 활성의 강화 또는 증가는, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다. 상기 방법의 예로, 유전자의 세포 내 카피수 증가; 유전자의 발현 조절 서열에 변이를 도입하는 방법; 유전자 발현 조절 서열을 활성이 강력한 서열로 교체하는 방법; 유전자의 활성이 강화되도록 해당 유전자에 변이를 추가적으로 도입시키는 방법; 및 미생물에 외래 유전자를 도입하는 방법으로 이루어진 군으로부터 선택되는 어느 하나 이상의 방법으로 이루어질 수 있으며, 이들의 조합으로도 달성할 수 있으나, 이에 제한되지 않는다.
L-이소류신의 생산량을 증가시키기 위한 또 하나의 예로, 본 출원에서 상기 미생물의 모균주는 L-이소류신의 생산량을 증가시키기 위해 추가적으로 L-이소류신의 생합성 경로를 약화시키는 유전자를 불활성화시킨 미생물일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, 폴리펩티드의 "약화"는 내재적 활성에 비하여 활성이 감소되거나 또는 활성이 없는 것을 모두 포함하는 개념이다. 상기 약화는 불활성화(inactivation), 결핍(deficiency), 하향조절(down-regulation), 감소(decrease), 저하(reduce), 감쇠(attenuation) 등의 용어와 혼용될 수 있다.
상기 약화는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드의 변이 등으로 폴리펩티드 자체의 활성이 본래 미생물이 가지고 있는 폴리펩티드의 활성에 비해 감소 또는 제거된 경우, 이를 코딩하는 폴리뉴클레오티드의 유전자의 발현 저해 또는 폴리펩티드로의 번역(translation) 저해 등으로 세포 내에서 전체적인 폴리펩티드 활성 정도 및/또는 농도(발현량)가 천연형 균주에 비하여 낮은 경우, 상기 폴리뉴클레오티드의 발현이 전혀 이루어지지 않은 경우, 및/또는 폴리뉴클레오티드의 발현이 되더라도 폴리펩티드의 활성이 없는 경우 역시 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주, 야생형 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "불활성화, 결핍, 감소, 하향조절, 저하, 감쇠"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성에 비하여 낮아진 것을 의미한다.
이러한 폴리펩티드의 활성의 약화는, 당업계에 알려진 임의의 방법에 의하여 수행될 수 있으나 이로 제한되는 것은 아니며, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다(예컨대, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드 활성의 약화는
1) 폴리펩티드를 코딩하는 유전자 전체 또는 일부의 결손;
2) 폴리펩티드를 코딩하는 유전자의 발현이 감소하도록 발현조절영역(또는 발현조절서열)의 변형;
3) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 구성하는 아미노산 서열의 변형(예컨대, 아미노산 서열 상의 1 이상의 아미노산의 삭제/치환/부가);
4) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 코딩하는 유전자 서열의 변형 (예를 들어, 폴리펩티드의 활성이 제거 또는 약화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 핵산염기 서열 상의 1 이상의 핵산염기의 삭제/치환/부가);
5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입;
7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가;
8) 폴리펩티드를 코딩하는 유전자 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE); 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
예컨대,
상기 1) 폴리펩티드를 코딩하는 상기 유전자 일부 또는 전체의 결손은, 염색체 내 내재적 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드 전체의 제거, 일부 뉴클레오티드가 결실된 폴리뉴클레오티드로의 교체 또는 마커 유전자로 교체일 수 있다.
또한, 상기 2) 발현조절영역(또는 발현조절서열)의 변형은, 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절영역(또는 발현조절서열) 상의 변이 발생, 또는 더욱 약한 활성을 갖는 서열로의 교체일 수 있다. 상기 발현조절영역에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 낮은 다른 개시코돈을 코딩하는 염기서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 3) 및 4)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은 폴리펩티드의 활성을 약화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 약한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 없도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 예를 들면, 폴리뉴클레오티드 서열 내 변이를 도입하여 종결 코돈을 형성시킴으로써, 유전자의 발현을 저해하거나 약화시킬 수 있으나, 이에 제한되지 않는다.
상기 6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입은 예를 들어 문헌 [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986]을 참고할 수 있다.
상기 7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가는 mRNA 번역을 불가능하게 하거나 속도를 저하시키는 것일 수 있다.
상기 8) 폴리펩티드를 코딩하는 유전자서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE)는 상기 폴리펩티드를 코딩하는 유전자의 전사체에 상보적인 안티센스 뉴클레오티드를 만들어 활성을 약화하는 것일 수 있다.
본 출원에 있어서, 상기 미생물의 모균주는 야생형 코리네박테리움 글루타미쿰 ATCC13032, 상기 ATCC1303에 이소류신의 전구체인 쓰레오닌의 피드백 저해 해소를 위해 호모세린 디하이드로게나제를 코딩하는 hom(R407H)(미국공개공보 US 2020-0340022 A1)를 추가로 도입한 미생물, 상기 ATCC130에 아스파르토키나아제를 코딩하는 lysC(L377K)(미국등록공보 US 10662450 B2)를 추가로 도입한 미생물, NTG(N-Methyl-N'-nitro-N-nitrosoguanidine) 처리된 L-이소류신 생산 균주인 KCJI-38(KCCM11248P, 대한민국 등록특허 제10-1335789호) 또는 상기 ATCC 13032에 hom(R407H) 및 ilvA(F383A)를 동시에 도입한 ATCC 13032 hom(R407H) /pECCG117-ilvA(F383A) 균주일 수 있으나, 이에 제한되지 않는다.
본 출원의 다른 하나의 양태는 본 출원의 L-쓰레오닌 디하이드라타아제의 변이체; 상기 변이체를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터; 중 어느 하나 이상을 포함하는 미생물을 배지에서 배양하는 단계를 포함하는, L-이소류신 생산 방법을 제공한다.
상기 서열번호 1의 아미노산 서열, L-쓰레오닌 디하이드라타아제, 이의 변이체, 폴리뉴클레오티드, 벡터 및 미생물에 대해서는 전술한 바와 같다.
상기 미생물은 코리네박테리움 속일 수 있고, 구체적으로 코리네박테리움 글루타미쿰일 수 있으나, 이에 제한되지 않는다. 이에 대해서는 전술한 바와 같다.
본 출원에서 용어, "배양"은 상기 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및 유가식일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "배지"는 상기 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
구체적으로, 코리네박테리움 속 균주에 대한 배양 배지는 문헌["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)]에서 찾아 볼 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으나, 이에 제한되지 않는다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으나, 이에 제한되지 않는다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있으나, 이에 제한되지 않는다.
또한, 상기 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으나, 이에 제한되지 않는다.
배지의 온도는 20℃내지 50℃, 구체적으로는 30℃ 내지 37℃ 일 수 있으나 이에 제한되지 않는다. 배양 기간은 유용 물질의 원하는 생성량이 수득될 때까지 계속될 수 있으며, 구체적으로는 10 시간 내지 100 시간일 수 있으나, 이에 제한되지 않는다.
상기 배양에 의하여 생산된 L-이소류신은 배지 중으로 배출되거나 미처 배출되지 못하고 세포 내에 잔류할 수 있다.
본 출원의 L-이소류신 생산 방법은 상기 배양에 따른 배지 또는 상기 미생물로부터 L-이소류신을 회수하는 단계를 추가로 포함할 수 있다.
상기 L-이소류신을 회수하는 방법은 배양방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배양액으로부터 L-이소류신을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파괘, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 및 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-이소류신을 회수할 수 있다.
상기 생산 방법은 추가적인 정제 공정을 포함할 수 있다. 상기 정제 공정은 당해 분야에 공지된 적합한 방법을 이용하여 회수된 L-이소류신을 정제할 수 있다. 따라서, 상기의 회수되는 L-이소류신은 정제된 형태, 혹은 목적 산물을 함유한 미생물 발효액일 수 있다(Introduction to Biotechnology and Genetic Engineering, A. J. Nair., 2008).
본 출원의 다른 하나의 양태는본 출원의 L-쓰레오닌 디하이드라타아제의 변이체; 상기 변이체를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터; 중 어느 하나 이상을 포함하는, L-이소류신을 생산하는 미생물 또는 상기 미생물의 배양물을 포함하는, L-이소류신 생산용 조성물을 제공한다.
상기 서열번호 1의 아미노산 서열, L-쓰레오닌 디하이드라타아제, 이의 변이체, 폴리뉴클레오티드, 벡터 및 미생물에 대해서는 전술한 바와 같다.
상기 미생물은 코리네박테리움 속일 수 있고, 구체적으로 코리네박테리움 글루타미쿰일 수 있으나, 이에 제한되지 않는다. 이에 대해서는 전술한 바와 같다.
상기 L-이소류신 생산용 조성물은 본 출원의 L-쓰레오닌 디하이드라타아제의 변이체에 의해 L-이소류신을 생산할 수 있는 조성물을 의미할 수 있다. 상기 조성물은 상기 L-쓰레오닌 디하이드라타아제의 변이체 또는 상기 L-쓰레오닌 디하이드라타아제의 변이체를 작동시킬 수 있는 구성을 제한없이 포함할 수 있다. 상기 L-쓰레오닌 디하이드라타아제의 변이체는 도입된 숙주 세포에서 작동가능하게 연결된 유전자를 발현시킬 수 있도록 벡터 내에 포함된 형태일 수 있다.
상기 조성물은 동결보호제 또는 부형제를 추가로 포함할 수 있다. 상기 동결보호제 또는 부형제는 비자연적으로 발생한(non-naturally occurring) 물질 또는 자연적으로 발생한 물질일 수 있으나, 이에 제한되는 것은 아니다. 또 하나의 구체 예로, 상기 동결보호제 또는 부형제는 상기 미생물이 자연적으로 접촉하지 않는 물질, 또는 상기 미생물과 자연적으로 동시에 포함되지 않는 물질일 수 있으나, 이에 제한되는 것은 아니다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로, 본 출원의 범위가 이들 실시예에 의해 제한되는 것은 아니며, 본 출원이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어 명백할 것이다.
실시예 1: L-쓰레오닌 디하이드라타아제 활성을 갖는 ilvA 변이체(F383A) 플라스미드 제작
L-이소류신의 생산능이 향상된 미생물 변이주를 얻기 위해 하기와 같은 방법을 사용하여 미생물의 변이를 유도하였다.
L-쓰레오닌 디하이드라타아제(L-Threonine dehydratase, TD)를 코딩하는 유전자인 ilvA(서열번호 2)를 증폭하기 위하여, 기보고된 F383A 변이가 도입된 ilvA 서열(World J Microbiol Biotechnol (2015) 31:1369-1377)에 근거하여 프로모터 부위(개시코돈 상단 약 300bp)로부터 터미네이터 부위(종결코돈 하단 약 100bp)까지 증폭하기 위한 프라이머(서열번호 11 및 서열번호 12)의 양 말단에 BamHI 제한 효소 부위를 삽입하였다. 또한, ilvA에 F383A 변이를 도입하기 위한 프라이머(서열번호 13 및 서열번호 14)를 사용하였다. 여기에서 사용된 프라이머 서열은 하기 표 1과 같다.
서열번호 명칭 서열
11 primer1 ggatccGACTGAGCCTGGGCAACTGG
12 primer2 ggatccCCGTCACCGACACCTCCACA
13 primer3 ACATCACGCTGgcaGAGTACCTCAA
14 primer4 TTGAGGTACTCtgcCAGCGTGATGT
야생형 코리네박테리움 글루타미쿰(wild type Corynebacterium glutamicum) ATCC 13032의 염색체를 주형으로 하여 서열번호 11 및 서열번호 14, 서열번호 12 및 서열번호 13의 프라이머를 이용하여 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 90초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과, ilvA 유전자의 변이를 중심으로 5' 상단 부위의 1460 bp의 DNA 단편과 3' 하단 부위의 276 bp DNA 단편을 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 11 및 서열번호 12의 프라이머로 PCR을 수행하였다.
그 결과, 383번째 페닐알라닌이 알라닌으로 치환된 ilvA 변이(서열번호 7)를 포함하는 1531 bp의 DNA 단편이 증폭되었다. pECCG117(대한민국 등록특허 제10-0057684호) 벡터와 ilvA DNA 단편을 제한 효소 BamHI으로 처리하고, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드를 획득하였고 이를 pECCG117-ilvA(F383A)라 명명하였다.
실시예 2: L-쓰레오닌 디하이드라타아제 활성을 갖는 ilvA 변이체 플라스미드 제작
L-쓰레오닌 디하이드라타아제를 코딩하는 유전자의 변이체를 얻기 위해 무작위 돌연변이 키트(random mutagenesis kit, Agilent Technologies, 미국)를 이용하여 ilvA 변이체 유전자 플라스미드를 제조하였다. 실시예 1의 ilvA(F383A) 염색체를 주형으로 하여 서열번호 11 및 서열번호 12의 프라이머를 이용하여 PCR을 수행하였다. PCR 조건은 95℃에서 2분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 90초 중합을 30회 반복한 후, 72℃에서 10분간 중합반응을 수행하였다.
그 결과, 383번째 페닐알라닌이 알라닌으로 치환된 변이 외에 추가적인 무작위 변이를 가진 L-쓰레오닌 디하이드라타아제를 암호화할 수 있는 ilvA 변이체인 1531 bp의 DNA 단편이 증폭되었다. pECCG117 벡터와 ilvA 변이체 DNA 단편을 제한 효소 BamHI으로 처리하고, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드군을 획득하였다.
실시예 3: L-이소류신 생산능을 갖는 코리네박테리움 속 균주 제작 및 평가
야생형 코리네박테리움 글루타미쿰 ATCC13032를 이용하여 L-이소류신 생산 균주를 제작하였다. 구체적으로, L-이소류신 생합성 경로에서 이소류신의 전구체인 쓰레오닌의 피드백 저해 해소를 위해 호모세린 디하이드로게나제를 코딩하는 유전자인 hom의 407번째 아미노산인 알지닌(Arginine)을 히스티딘(Histidine)으로 치환하였다(미국공개공보 US 2020-0340022 A1, 서열번호 17)
더 구체적으로, hom(R407H) 변이가 도입된 균주들을 제작하기 위해 코리네박테리움 글루타미쿰 ATCC13032의 염색체를 주형으로 하여 서열번호 18 및 서열번호 19 혹은 서열번호 20 및 서열번호 21의 프라이머를 이용하여 PCR을 각각 수행하였다. 여기에서 사용된 프라이머 서열은 하기 표 2와 같다.
서열번호 명칭 서열
18 primer5 TCGAGCTCGGTACCCCGCTTTTGCACTCATCGAGC
19 primer6 CACGATCAGATGTGCATCATCAT
20 primer7 ATGATGATGCACATCTGATCGTG
21 primer8 CTCTAGAGGATCCCCGAGCATCTTCCAAAACCTTG
PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 1분을 28회 반복하였다.
그 결과, hom 유전자의 변이를 중심으로 5' 상단 부위의 1000 bp DNA 단편과 3' 하단 부위의 1000 bp의 DNA 단편을 각각 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 18 및 서열번호 21의 프라이머로 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 2분 중합을 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과, 407번째 알지닌이 히스티딘으로 치환된 호모세린 디하이드로게나제 변이체를 코딩하는 hom 유전자의 변이를 포함하는 2 kb의 DNA 단편이 증폭되었다. 증폭 산물을 PCR 정제 키트(PCR Purification kit, QUIAGEN)를 사용하여 정제하여 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다. 정제한 증폭 산물을 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDZ 벡터(미국등록공보 US 9109242 B2)와 상기 증폭 산물인 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하고, 인퓨전 클로닝 키트(Infusion Cloning Kit, TaKaRa)를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 hom(R407H) 변이를 염색체상에 도입하기 위한 벡터 pDZ-R407H를 제작하였다.
제작된 벡터를 전기천공법으로 코리네박테리움 글루타미쿰 ATCC13032에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 hom(R407H) 변이를 포함하는 균주를 얻었으며, 이를 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H)로 명명하였다.
실시예 4: ilvA 변이체 도입 L-이소류신 생산 균주의 L-이소류신 생산능 평가
상기 실시예 2에서 얻어진 변이체의 L-이소류신 생산성을 확인하기 위해 하기와 같은 방법으로 균주를 제작하였다. 구체적으로, 실시예 3에서 제작한 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) 균주에 실시예 1에서 제작한 플라스미드를 도입하였고, 제작한 플라스미드를 도입한 균주는 ATCC 13032 hom(R407H)/pECCG117-ilvA(F383A)로 명명하였다. 또한 실시예 2에서 얻어진 변이체 플라스미드군을 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) 균주에 도입하였고, 최소배지에 도말하여 사멸율을 구해본 결과 사멸율은 70 %였으며 생존한 세포들을 종배지에 접종 배양, 최종적으로 ATCC 13032 hom(R407H)/pECCG117-ilvA(F383A) 대조군보다 우수한 이소류신 생산능을 나타내는 변이주를 선별하여 코리네박테리움 글루타미쿰 CJILE-301(Corynebacterium glutamicum, CJILE-301)로 명명하였다.
상기 균주를 이소류신 생산배지 25 ㎖을 함유하는 250 ㎖ 코너-바풀 플라스크에 접종한 후, 32℃에서 60시간동안 200 rpm으로 진탕 배양하여 L-이소류신을 제조하였다. 본 실시예에서 사용한 생산배지의 조성은 하기와 같다.
<종배지>
포도당 5%, 박토펩톤 1%, 소듐클로라이드 0.25%, 효모추출물 1%, 요소 0.4%, pH 7.2
<최소배지>
포도당 1.0%, 황산암모늄 0.4%, 황산마그네슘 0.04%, 인산제1칼륨 0.1%, 요소 0.1%, 티아민 0.001%, 비오틴 200 ㎍/L, 한천 2%, pH 7.2
<생산배지>
포도당 10%, 효모추출물 0.2%, 황산암모늄 1.6%, 제1인산칼륨 0.1%, 황산마그네슘7수염 0.1%, 황산철7수염 10mg/L, 황산망간1수염 10 mg/L, 비오틴 200 ㎍/L, pH 7.2
배양종료 후, 액체고속크로마토그래피(HPLC)를 이용하여 배양액 중의 L-이소류신과 L-쓰레오닌 농도를 측정하고, 그 결과를 하기 표 3에 나타내었다.
균주명 L-이소류신 농도 (g/L) L-쓰레오닌 농도 (g/L)
ATCC 13032 hom(R407H) /pECCG117-ilvA(F383A) (모균주) 2.5 1.5
CJILE-301 (변이주) 4.3 0.0
상기 표 3에 나타난 바와 같이, 모균주인 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H)/pECCG117-ilvA(F383A)은 2.5 g/L의 농도로 L-이소류신을 생산하였으나, 본 출원에 따른 변이주 코리네박테리움 글루타미쿰 CJILE-301은 4.3 g/L의 농도로 L-이소류신을 생산하여, 모균주에 비해 약 172% L-이소류신 생산성이 증가한 것을 확인하였다. 또한 잔여 L-쓰레오닌 농도가 1.5 g/L에서 0.0 g/L로 감소하여 쓰레오닌에 대한 ilvA의 활성이 증가된 것으로 확인되었다.
상기의 결과를 바탕으로 CJILE-301균주로부터 플라스미드를 분리하여 ilvA 유전자를 시퀀싱 한 결과, ilvA 유전자의 1141번째 염기서열이 A에서 G로 치환되어 ilvA 단백질의 383번째 F가 A로 치환된 변이 외에 추가로 381번째 T가 A로 치환된 변이 단백질을 암호화할 수 있음을 확인하였으며, 이는 서열번호 22로 나타내었다.
상기의 결과는 무작위 돌연변이법을 통해 얻어진 실시예 2의 ilvA 변이체(T381A)를 도입한 균주가 결과적으로 L-이소류신을 고효율 및 고수율로 생산할 수 있음을 의미한다.
실시예 5: L-쓰레오닌 디하이드라타아제 활성을 갖는 ilvA(T381A) 및 ilvA(T381A, F383A) 변이체 도입 균주 제작
상기 실시예 4에서 확인된 ilvA 변이체(T381A, F383A)를 야생형 균주로 도입하기 위하여 서열번호 31 및 서열번호 32의 프라이머를 제작하였다.
ilvA 변이체(T381A, F383A)가 도입된 균주를 제작하기 위해 실시예 4의 CJILE-301 균주로부터 추출한 플라스미드 DNA를 주형으로 서열번호 31 및 서열번호 32의 프라이머를 사용하여 PCR을 수행하였다. 여기에서 사용된 프라이머 서열은 하기 표 4와 같다.
서열번호 명칭 서열
31 primer9 TCGAGCTCGGTACCCATGAGTGAAACATACGTGTC
32 primer10 CTCTAGAGGATCCCCCGTCACCGACACCTCCACA
PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 변성 95℃ 30초; 어닐링 55℃ 30초; 및 중합반응 72℃, 2분을 28회 반복하였다.
그 결과, 1311bp인 ilvA 유전자의 약 100bp 터미네이터 부위를 포함한 1411bp의 유전자 단편을 각각 수득하였다.
증폭 산물을 PCR 정제 키트를 사용하여 정제하고, 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다. 정제한 증폭 산물을 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDZ벡터와 상기 증폭 산물인 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하고 인퓨전 클로닝 키트를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 T381A, F383A 변이를 염색체상에 도입하기 위한 벡터 pDZ-T381A_F383A를 제작하였다.
제작된 벡터를 전기천공법에 의해 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H)에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 ilvA(T381A, F383A) 변이를 포함하는 균주를 얻었으며, 이를 CA10-3101으로 명명하였다.
상기 균주 CA10-3101은 2020년 5월 27일자로 부다페스트 조약하의 국제기탁기관인 한국미생물보존센터(KCCM)에 국제기탁하여 KCCM12739P로 기탁번호를 부여받았다.
또한 ilvA(T381A) 단독 변이형의 이소류신 생산능 및 쓰레오닌 분해 효과를 확인하기 위해 서열번호 47 및 서열번호 48의 프라이머를 제작하였다.
ilvA 변이체(T381A)가 도입된 균주를 제작하기 위해 Cgl13032 게놈 DNA를 주형으로 서열번호 31 및 서열번호 48, 그리고 서열번호 32 및 서열번호 47의 프라이머를 사용하여 PCR을 각각 수행하였다. 여기에서 사용된 프라이머 서열은 하기 표 5와 같다.
서열번호 명칭 서열
47 primer47 CCGGATGATGACATCgctCTGTTTGAGTACCTC
48 primer48 TCAAACAGagcGATGTCATCATCCGG
PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 변성 95℃ 30초; 어닐링 55℃ 30초; 및 중합반응 72℃ 2분을 28회 반복하였다.
그 결과, 1166 bp와 ilvA 유전자의 약 100bp 터미네이터 부위를 포함한 301 bp의 유전자 단편을 각각 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 31 및 서열번호 32의 프라이머로 PCR을 수행하였다. PCR 조건은 95℃에서 10분간 변성 후, 95℃ 30초 변성, 56℃ 30초 어닐링, 72℃ 2분 중합을 30회 반복한 후, 72℃에서 10분간 중합반응을 수행하였다.
그 결과, 1311bp의 ilvA 유전자와 약 100bp 터미네이터 부위를 포함한 1411bp의 유전자 단편을 수득하였다.
증폭 산물을 PCR 정제 키트를 사용하여 정제하고, 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다. 정제한 증폭 산물을 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDZ 벡터와 상기 증폭 산물인 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하고 인퓨전 클로닝 키트를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 T381A 변이를 염색체상에 도입하기 위한 벡터 pDZ-T381A를 제작하였다.
제작된 벡터를 전기천공법에 의해 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H)에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 ilvA(T381A) 변이를 포함하는 균주를 얻었으며, 이를 ATCC13032 hom(R407H) ilvA(T381A)으로 명명하였다.
상기 균주를 이소류신 생산배지 25 ㎖을 함유하는 250 ㎖ 코너-바풀 플라스크에 접종한 후, 32℃에서 60시간 동안 200 rpm으로 진탕 배양하여 L-이소류신을 제조하였다. 본 실시예에서 사용한 생산배지의 조성은 하기와 같다.
<생산배지>
포도당 10%, 효모추출물 0.2%, 황산암모늄 1.6%, 제1인산칼륨 0.1%, 황산마그네슘7수염 0.1%, 황산철7수염 10mg/L, 황산망간1수염 10 mg/L, 비오틴 200 ㎍/L, pH 7.2
배양종료 후, 고성능액체크로마토그래피(high-performance liquid chromatography, HPLC)를 이용하여 배양액 중의 L-이소류신과 L-쓰레오닌 농도를 측정하고, 그 결과를 하기 표 6에 나타내었다.
균주명 L-이소류신 (g/L) L-쓰레오닌(g/L)
ATCC 13032 hom(R407H) 0.0 3.8
ATCC 13032 hom(R407H) ilvA(WT) 0.0 3.7
ATCC 13032 hom(R407H) ilvA(T381A) 0.5 3.3
CA10-3101(ATCC 13032 hom(R407H) ilvA(T381A, F383A)) 3.3 0.0
상기 표 6에 나타난 바와 같이, 모균주인 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H)은 L-이소류신을 생산하지 못하였으나 ATCC 13032 hom(R407H) ilvA(T381A) 단독 변이주는 L-쓰레오닌이 줄면서 0.5 g/L의 농도로 L-이소류신을 생산하여, 모균주에 비해 L-이소류신 생산성이 증가한 것을 확인하였다. 또한 F383A 변이를 추가로 포함하는 ATCC 13032 hom(R407H) ilvA(T381A, F383A) 변이주는 3.9 g/L의 농도로 L-이소류신을 생산하여, 모균주에 비해 L-이소류신 생산성이 현저하게 증가한 것을 확인하였다.
실시예 6: L-쓰레오닌 디하이드라타아제 활성을 갖는 ilvA 변이체 벡터 제작
상기 실시예 4을 통해 밝혀낸 L-이소류신 생산능이 높은 ilvA 변이 위치에 다른 아미노산이 치환된 변이형을 제작하여 그 효과를 확인하였다. 구체적으로, 실시예 3에서 제작된 플라스미드를 주형으로 사용하여 ilvA의 381번째 아미노산 위치에 다른 아미노산이 치환된 7종의 변이체를 제작하였다. 각각의 변이체, 치환된 아미노산 및 각 변이체 제작에 사용된 프라이머 서열은 하기 표 7에 나타내었다.
유전자 치환 아미노산 프라이머 서열번호
ilvA T381S 서열번호 3, 33 / 서열번호 34, 4
T381P 서열번호 3, 35 / 서열번호 36, 4
T381Q 서열번호 3, 37 / 서열번호 38, 4
T381V 서열번호 3, 39 / 서열번호 40, 4
T381I 서열번호 3, 41 / 서열번호 42, 4
T381G 서열번호 3, 43 / 서열번호 44, 4
T381M 서열번호 3, 45 / 서열번호 46, 4
상기 표 7에서 사용된 프라이머 서열은 하기 표 8과 같다.
서열번호 명칭 서열
33 primer15 AGGTACTCtgcCAGggaGATGTCAT
34 primer16 ATGACATCtccCTGgcaGAGTACCT
35 primer21 AGGTACTCtgcCAGtggGATGTCAT
36 primer22 ATGACATCccaCTGgcaGAGTACCT
37 primer27 AGGTACTCtgcCAGctgGATGTCAT
38 primer28 ATGACATCcagCTGgcaGAGTACCT
39 primer33 AGGTACTCtgcCAGaacGATGTCAT
40 primer34 ATGACATCgttCTGgcaGAGTACCT
41 primer35 AGGTACTCtgcCAGgatGATGTCAT
42 primer36 ATGACATCatcCTGgcaGAGTACCT
43 primer41 AGGTACTCtgcCAGgccGATGTCAT
44 primer42 ATGACATCggcCTGgcaGAGTACCT
45 primer45 AGGTACTCtgcCAGcatGATGTCAT
46 primer46 ATGACATCatgCTGgcaGAGTACCT
상기 표 7 및 표 8에서 제시한 각각의 프라이머를 이용하여 PCR을 수행하였다. 중합효소는 SolgTM Pfu-X DNA 폴리머라제(SolGent co., Ltd.)를 사용하였으며, PCR 조건은 95℃에서 10분간 변성 후, 95℃ 30초 변성, 56℃ 30초 어닐링, 72℃ 90초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과, ilvA 유전자의 변이를 중심으로 5' 상단 부위의 1457 bp DNA 단편과 3' 하단 부위의 279 bp의 DNA 단편을 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 11 및 서열번호 12의 프라이머로 PCR을 수행하였다. PCR 조건은 95℃에서 10분간 변성 후, 95℃ 30초 변성, 56℃ 30초 어닐링, 72℃ 2분 중합을 30회 반복한 후, 72℃에서 10분간 중합반응을 수행하였다.
그 결과, 381번째 쓰레오닌이 표 3의 각 아미노산으로 치환된 쓰레오닌 디하이드라타아제 변이체를 암호화하는 ilvA 유전자의 변이를 포함하는 1736 bp의 DNA 단편이 증폭되었다. pECCG117 벡터와 PCR을 통해 수득한 1736 bp의 ilvA DNA 단편을 제한 효소 BamHI으로 처리하고, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드를 획득하였다. 이로써 381번째 쓰레오닌이 표 3에 나타낸 아미노산으로 치환된 7종의 ilvA 변이체 벡터가 제작되었고, 이들은 하기 표 9와 같이 명명하였다.
유전자 치환 아미노산 ilvA 변이체 벡터 명칭
ilvA T381S pECCG117-ilvA(T381S, F383A)
T381P pECCG117-ilvA(T381P, F383A)
T381Q pECCG117-ilvA(T381Q, F383A)
T381V pECCG117-ilvA(T381V, F383A)
T381I pECCG117-ilvA(T381I, F383A)
T381G pECCG117-ilvA(T381G, F383A)
T381M pECCG117-ilvA(T381M, F383A)
실시예 7: L-쓰레오닌 디하이드라타아제 활성을 갖는 ilvA 변이체 도입 균주의 L-이소류신 생산능 평가
코리네박테리움 글루타미쿰 ATCC13032 유래의 아스파토키나아제를 코딩하는 lysC 유전자에 lysC 유전자의 발현 강화와 L-리신(L-Lysine) 및 L-쓰레오닌(L-Threonine)에 대한 피드백 저해 해제를 위한 변이(L377K)(미국등록공보 US 10662450 B2)를 도입하고, 상기 변이형 lysC 유전자를 포함하는 벡터를 제작하기 위하여, 변이 위치를 중심으로 5' 상단 부위를 증폭하기 위한 프라이머 한 쌍(서열번호 50 및 서열번호 51)과 3' 하단 부위를 증폭하기 위한 프라이머 한쌍(서열번호 52 및 서열번호 53)을 고안하였다. 서열번호 50 및 53의 프라이머는 각 말단에 Xba I, SalI 제한 효소 부위를 삽입하였고, 서열번호 51 및 52의 프라이머는 서로 교차되도록 고안하였으며 이 부위에 뉴클레오티드 치환 변이가 위치하도록 하였다. 프라이머 서열은 하기 표 10과 같았다.
서열번호 명칭 서열
서열번호 50 lysC_L377K_5 F tcctctagaGCTGCGCAGTGTTGAATACG
서열번호 51 lysC_L377K_5 R AGGTGGAAATCTTTTCGATGTTC
서열번호 52 lysC_L377K_3 F GAACATCGAAAAGATTTCCACCT
서열번호 53 lysC_L377K_3 R gactctagaGTTCACCTCAGAGACGATTA
코리네박테리움 글루타미쿰 ATCC13032의 염색체를 주형으로 하여 서열번호 50 및 서열번호 51, 서열번호 52 및 서열번호 53의 프라이머를 이용하여 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃에서 30초 변성, 55℃에서 30초 어닐링, 72℃에서 30초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다.
그 결과, lysC 유전자의 변이를 중심으로 5' 상단 부위의 512 bp DNA 단편과 3' 하단 부위의 522 bp의 DNA 단편을 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 50 및 서열번호 53의 프라이머로 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃에서 30초 변성, 55℃에서 30초 어닐링, 72℃에서 60초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다.
그 결과, 377번째 루이신이 라이신으로 치환된 아스파토키나아제 변이체를 코딩하는 변이 lysC(L377K) 유전자(서열번호 49)를 포함하는 1011 bp의 DNA 단편이 증폭되었다.
상기 PCR을 통하여 획득한 lysC(L377K) PCR 단편 말단에 포함된 제한효소 XbaI, SalI을 처리하고, 제한효소 XbaI, SalI가 처리된 pDZ(KR 2008-0025355) 벡터에 접합(ligation)하여 클로닝함으로써 최종적으로 lysC(L377K) 치환 카세트가 클로닝된 pDZ-lysC(L377K) 재조합 벡터를 제작하였다.
제작된 pDZ-lysC(L377K) 벡터를 실시예 3의 ATCC13032 hom(R407H) 균주에 전기펄스법으로 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 lysC 유전자에 변이가 도입된 코리네박테리움 ATCC 13032 hom(R407H) lysC(L377K)을 수득하였다. 상기 변이가 도입된 유전자는 서열번호 50과 53의 프라이머를 이용한 PCR 수행 후 시퀀싱을 통해 야생형 lysC 유전자의 서열과 비교하여 최종 확인하였다.
실시예 6에서 제작된 ilvA 변이체 벡터 7종과 실시예 4의 CJILE-301 균주로부터 추출한 pECCG117-ilvA(T381A, F383A)를 상기 제작된 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H) lysC(L377K) 균주에 전기펄스법으로 도입한 후 카나마이신(kanamycin) 25 mg/L를 함유한 선별배지에 도말하여 각각의 형질전환주를 획득하였다. 그 후, 실시예 4와 동일한 방법으로 배양액 중의 L-이소류신과 L-쓰레오닌 농도를 측정하고, 그 결과를 하기 표 11에 나타내었다.
균주명 L-이소류신 (g/L) L-쓰레오닌(g/L)
ATCC 13032 hom(R407H) lysC(L377K) 0.0 3.5
ATCC 13032 hom(R407H) lysC(L377K)/pECCG117-ilvA(F383A) 2.3 1.5
ATCC 13032 hom(R407H) lysC(L377K)/pECCG117-ilvA(T381A, F383A) 4.3 0.0
ATCC 13032 hom(R407H) lysC(L377K)/pECCG117-ilvA(T381S, F383A) 2.7 1.1
ATCC 13032 hom(R407H) lysC(L377K)/pECCG117-ilvA(T381P, F383A) 2.9 1.4
ATCC 13032 hom(R407H) lysC(L377K)/pECCG117-ilvA(T381Q, F383A) 2.6 1.3
ATCC 13032 hom(R407H) lysC(L377K)/pECCG117-ilvA(T381V, F383A) 3.0 0.7
ATCC 13032 hom(R407H) lysC(L377K)/pECCG117-ilvA(T381I, F383A) 3.8 0.2
ATCC 13032 hom(R407H) lysC(L377K)/pECCG117-ilvA(T381G, F383A) 3.2 0.5
ATCC 13032 hom(R407H) lysC(L377K)/pECCG117-ilvA(T381M, F383A) 2.5 1.2
상기 표 11에 나타난 바와 같이, ilvA의 T381A, T381S, T381P, T381Q, T381V, T381I, T381G, T381M 변이체가 야생형보다 쓰레오닌 분해율이 높고 L-이소류신 생산능이 증가한 것을 확인하였다.
실시예 8: L-이소류신 생산 균주에서의 쓰레오닌 디하이드라타아제 활성을 갖는 변이형 ilvA의 L-이소류신 생산능 평가
실시예 7에서 L-이소류신 생산능 증가가 가장 우수한 것으로 나타난 ilvA(T381A, F383A) 변이를 NTG(N-Methyl-N'-nitro-N-nitrosoguanidine) 처리된 L-이소류신 생산 균주인 KCJI-38(KCCM11248P, 대한민국 등록특허 제10-1335789호) 균주에 전기펄스법으로 도입한 후 카나마이신 25mg/L를 함유한 선별배지에 도말하여 각각의 형질전환주를 획득하였다. 그 후, 실시예 4와 동일한 방법으로 배양액 중의 L-이소류신과 L-쓰레오닌 농도를 측정하고, 그 결과를 하기 표 12에 나타내었다.
균주명 L-이소류신 (g/L) L-쓰레오닌(g/L)
KCCM11248P 1.5 0.5
KCCM11248P/pECCG117-ilvA(F383A) 2.8 0.6
KCCM11248P/pECCG117-ilvA(T381A, F383A) 4.0 0.0
상기 표 12에 나타난 바와 같이, ilvA(F381T, F383A) 변이를 도입한 KCCM11248P/pECCG117-ilvA(T381A, F383A) 균주는 KCCM11248P 또는 KCCM11248P/pECCG117-ilvA(F383A) 균주에 비해 L-이소류신 생산이 현저히 증가하고, L-쓰레오닌 분해율이 높은 것을 확인하였다.
이상의 결과들은 본 출원의 ilvA 변이체가 L-이소류신의 생산을 증가시킬 수 있음을 시사하는 것이다. 또한, ilvA 유전자의 381번 위치의 변이는 L-쓰레오닌이 분해되기 위해 결합되는 것을 도와주는 변이임을 확인함에 따라, 상기 변이는 L-이소류신의 생산을 증가시키는 역할을 하는 것으로 확인되었다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2021005037-appb-I000001

Claims (13)

  1. 서열번호 1의 아미노산 서열의 381번째에 상응하는 위치의 아미노산이 다른 아미노산으로 치환된, L-쓰레오닌 디하이드라타아제(L-threonine dehydratase)의 변이체.
  2. 제1항에 있어서, 상기 다른 아미노산은 알라닌, 세린, 프롤린, 글루타민, 발린, 이소류신, 글리신 및 메티오닌으로 이루어지는 군으로부터 선택되는 어느 하나인, 변이체.
  3. 제2항에 있어서, 상기 변이체는 서열번호 3 내지 10의 아미노산 서열로 이루어지는 군으로부터 선택되는 어느 하나의 아미노산 서열을 포함하는, 변이체.
  4. 제1항에 있어서, 상기 변이체는 서열번호 1의 아미노산 서열의 383번째에 상응하는 위치의 아미노산이 알라닌으로 추가로 치환된, 변이체.
  5. 제4항에 있어서, 상기 변이체는 서열번호 23 내지 30의 아미노산 서열로 이루어지는 군으로부터 선택되는 어느 하나의 아미노산 서열을 포함하는, 변이체.
  6. 제1항 내지 제5항 중 어느 한 항의 L-쓰레오닌 디하이드라타아제의 변이체를 코딩하는 폴리뉴클레오티드.
  7. 제1항 내지 제5항 중 어느 한 항의 L-쓰레오닌 디하이드라타아제의 변이체; 상기 변이체를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터; 중 어느 하나 이상을 포함하는, 미생물.
  8. 제7항에 있어서, 상기 미생물은 L-이소류신 생산능을 가지는, 미생물.
  9. 제7항에 있어서, 상기 미생물은 코리네박테리움 속인, 미생물.
  10. 제7항에 있어서, 상기 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)인, 미생물.
  11. 제1항 내지 제5항 중 어느 한 항의 L-쓰레오닌 디하이드라타아제의 변이체; 상기 변이체를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터; 중 어느 하나 이상을 포함하는 미생물을 배지에서 배양하는 단계를 포함하는, L-이소류신 생산 방법.
  12. 제11항에 있어서, 상기 방법은 배양된 배지 또는 미생물로부터 L-이소류신을 회수하는 단계를 추가로 포함하는, L-이소류신 생산 방법.
  13. 제1항 내지 제5항 중 어느 한 항의 L-쓰레오닌 디하이드라타아제의 변이체; 상기 변이체를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터; 중 어느 하나 이상을 포함하는 미생물 또는 상기 미생물의 배양물을 포함하는, L-이소류신 생산용 조성물.
PCT/KR2021/005037 2020-06-26 2021-04-21 L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법 WO2021261733A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
BR112021019009A BR112021019009A2 (pt) 2020-06-26 2021-04-21 Variante de l-treonina desidratase, polinucleotídeo, micro-organismo, método para produzir l-isoleucina, e, composição para produzir l-isoleucina
CN202180003186.4A CN114402070B (zh) 2020-06-26 2021-04-21 新的l-苏氨酸脱水酶变体及使用其生产l-异亮氨酸的方法
US17/440,172 US20230098971A1 (en) 2020-06-26 2021-04-21 Novel of l-threonine dehydratase variant and method of producing l-isoleucine using the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200078669A KR102363913B1 (ko) 2020-06-26 2020-06-26 L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법
KR10-2020-0078669 2020-06-26

Publications (1)

Publication Number Publication Date
WO2021261733A1 true WO2021261733A1 (ko) 2021-12-30

Family

ID=79281508

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/005037 WO2021261733A1 (ko) 2020-06-26 2021-04-21 L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법

Country Status (6)

Country Link
US (1) US20230098971A1 (ko)
KR (1) KR102363913B1 (ko)
CN (1) CN114402070B (ko)
AR (1) AR122732A1 (ko)
BR (1) BR112021019009A2 (ko)
WO (1) WO2021261733A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116463304B (zh) * 2023-06-14 2023-09-05 黑龙江伊品生物科技有限公司 苏氨酸脱氢酶基因突变体及其应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6107063A (en) * 1994-01-14 2000-08-22 Forschungszentrum Juelich Gmbh Production of L-isoleucine by means of recombinant microorganisms with deregulated threonine dehydratase
KR20110058731A (ko) * 2009-11-25 2011-06-01 한국과학기술원 Ｌ­이소루신 고생성능을 가지는 변이미생물 및 이의 제조방법
KR20180134695A (ko) * 2017-06-09 2018-12-19 대상 주식회사 L-로이신 생산능이 개선된 변이 균주 및 이를 이용한 l-로이신의 제조 방법

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102006050489A1 (de) * 2006-10-26 2008-04-30 Evonik Degussa Gmbh Allele des prpD1-Gens aus coryneformen Bakterien
DE102011118019A1 (de) * 2011-06-28 2013-01-03 Evonik Degussa Gmbh Varianten des Promotors des für die Glyzerinaldehyd-3-phosphat-Dehydrogenase kodierenden gap-Gens
KR101747542B1 (ko) * 2015-10-23 2017-06-15 씨제이제일제당 (주) L-이소루신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용하여 l-이소루신을 생산하는 방법
WO2019094051A1 (en) * 2017-11-13 2019-05-16 Plant Sensory Systems, Llc Methods for high taurine production using novel decarboxylases
KR101947959B1 (ko) * 2018-05-28 2019-02-13 씨제이제일제당 (주) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
CN110305829B (zh) * 2019-06-25 2020-08-28 天津科技大学 一种生产l-异亮氨酸的基因工程菌及其应用

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6107063A (en) * 1994-01-14 2000-08-22 Forschungszentrum Juelich Gmbh Production of L-isoleucine by means of recombinant microorganisms with deregulated threonine dehydratase
KR20110058731A (ko) * 2009-11-25 2011-06-01 한국과학기술원 Ｌ­이소루신 고생성능을 가지는 변이미생물 및 이의 제조방법
KR20180134695A (ko) * 2017-06-09 2018-12-19 대상 주식회사 L-로이신 생산능이 개선된 변이 균주 및 이를 이용한 l-로이신의 제조 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN 23 May 2020 (2020-05-23), ANONYMOUS : "threonine ammonia-lyase IlvA [Corynebacterium crenatum] ", XP055882467, retrieved from NCBI Database accession no. WP_006284110 *
GUO YANFENG; XU JIANZHONG; HAN MEI; ZHANG WEIGUO: "Generation of mutant threonine dehydratase and its effects on isoleucine synthesis inCorynebacterium glutamicum", WORLD JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY, SPRINGER NETHERLANDS, DORDRECHT, vol. 31, no. 9, 13 June 2015 (2015-06-13), Dordrecht, pages 1369 - 1377, XP035527071, ISSN: 0959-3993, DOI: 10.1007/s11274-015-1885-3 *

Also Published As

Publication number Publication date
CN114402070B (zh) 2024-04-09
KR20220000705A (ko) 2022-01-04
US20230098971A1 (en) 2023-03-30
KR102363913B1 (ko) 2022-02-18
CN114402070A (zh) 2022-04-26
BR112021019009A2 (pt) 2023-01-17
AR122732A1 (es) 2022-10-05

Similar Documents

Publication Publication Date Title
WO2020204427A1 (ko) 신규 l-트립토판 배출 단백질 변이체 및 이를 이용한 l-트립토판을 생산하는 방법
WO2019164348A1 (ko) 신규 l-트립토판 배출 단백질 및 이를 이용한 l-트립토판을 생산하는 방법
WO2021125896A1 (ko) 내막 단백질의 변이체 및 이를 이용한 목적 산물 생산 방법
WO2021049866A1 (ko) L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법
WO2017069578A1 (ko) L-이소루신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용하여 l-이소루신을 생산하는 방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2021150029A1 (ko) Nadp 의존적 글리세르알데하이드-3-포스페이트 디하이드로지나제를 포함하는 미생물을 이용하여 ｌ-아미노산을 생산하는 방법
WO2022163951A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2021085999A1 (ko) 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법
WO2020226341A1 (ko) L-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산을 생산하는 방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2021060696A1 (ko) 디하이드로디피콜린산 리덕타제 변이형 폴리펩티드 및 이를 이용한 l-쓰레오닌 생산방법
WO2021177731A1 (ko) 글루타민 신테타아제 변이형 폴리펩티드 및 이를 이용한 l-글루타민 생산 방법
WO2021261733A1 (ko) L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법
WO2022124708A1 (ko) 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법
WO2022164118A1 (ko) 프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022050671A1 (ko) L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2021060701A1 (ko) 메조 디아미노피멜레이트 디하이드로게네이즈 변이형 폴리펩타이드 및 이를 이용한 l-쓰레오닌 생산방법
WO2022231036A1 (ko) 신규한 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022225075A1 (ko) 신규한 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2021153866A1 (ko) 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법
WO2022005022A1 (ko) L-이소류신 생산능이 강화된 미생물 및 이를 이용한 l-이소류신 생산방법
WO2022124786A1 (ko) 신규한 감마-아미노부티르산 퍼미에이즈 변이체 및 이를 이용한 이소류신 생산 방법

Legal Events

Date Code Title Description
REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021019009

Country of ref document: BR

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21829223

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 112021019009

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20210923

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21829223

Country of ref document: EP

Kind code of ref document: A1