WO2022163951A1 - 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법 - Google Patents

신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법 Download PDF

Info

Publication number
WO2022163951A1
WO2022163951A1 PCT/KR2021/007122 KR2021007122W WO2022163951A1 WO 2022163951 A1 WO2022163951 A1 WO 2022163951A1 KR 2021007122 W KR2021007122 W KR 2021007122W WO 2022163951 A1 WO2022163951 A1 WO 2022163951A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
substituted
acid sequence
lysine
Prior art date
Application number
PCT/KR2021/007122
Other languages
English (en)
French (fr)
Inventor
권나라
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210013691A external-priority patent/KR20220110412A/ko
Priority claimed from KR1020210013690A external-priority patent/KR20220110411A/ko
Priority claimed from KR1020210013694A external-priority patent/KR20220110413A/ko
Priority claimed from PCT/KR2021/003261 external-priority patent/WO2022163904A1/ko
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Publication of WO2022163951A1 publication Critical patent/WO2022163951A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine

Definitions

  • the present application relates to a novel protein variant, a Corynebacterium glutamicum strain comprising the variant, and a method for producing L- lysine using the strain.
  • One object of the present application is to provide one or more (eg, one or two or more) protein variants selected from the group consisting of the following (1) to (19):
  • an endogenous membrane transport protein variant consisting of the amino acid sequence set forth in SEQ ID NO: 1 in which phenylalanine, an amino acid corresponding to position 220 of SEQ ID NO: 3, is substituted with cysteine;
  • DNA polymerase III gamma and tau subunit variants consisting of the amino acid sequence set forth in SEQ ID NO: 5 in which proline, an amino acid corresponding to position 43 of SEQ ID NO: 7, is substituted with leucine;
  • (6) a malate dehydrogenase variant consisting of the amino acid sequence set forth in SEQ ID NO: 21 in which threonine, an amino acid corresponding to position 272 of SEQ ID NO: 23, is substituted with isoleucine;
  • a primosome assembly protein variant consisting of the amino acid sequence shown in SEQ ID NO: 25, in which arginine, an amino acid corresponding to position 304 of SEQ ID NO: 27, is substituted with glutamine;
  • a Co/Zn/Cd efflux system component variant consisting of the amino acid sequence set forth in SEQ ID NO: 41 in which glycine, an amino acid corresponding to position 130 of SEQ ID NO: 43, is substituted with aspartic acid;
  • DAHP synthase variant consisting of the amino acid sequence set forth in SEQ ID NO: 45 in which glycine, an amino acid corresponding to position 382 of SEQ ID NO: 47, is substituted with cysteine;
  • a helicase variant consisting of the amino acid sequence set forth in SEQ ID NO: 53 in which tyrosine, an amino acid corresponding to position 592 of SEQ ID NO: 55, is substituted with phenylalanine;
  • a sugar phosphate isomerase/epimerase variant consisting of the amino acid sequence shown in SEQ ID NO: 61 in which alanine, an amino acid corresponding to position 321 of SEQ ID NO: 63, is substituted with valine;
  • cytolytic membrane protein variant consisting of the amino acid sequence shown in SEQ ID NO: 65 in which isoleucine, an amino acid corresponding to position 307 of SEQ ID NO: 67, is substituted with valine;
  • a major promoter superfamily permease mutant consisting of the amino acid sequence set forth in SEQ ID NO: 73, wherein histidine, an amino acid corresponding to position 377 of SEQ ID NO: 75, is substituted with glutamine.
  • Another object of the present application is to provide a polynucleotide encoding the variant of the present application.
  • Another object of the present application is to include one or more (eg, one or two or more) protein variants selected from the group consisting of the following (1) to (19) or a polynucleotide encoding the variant, L-Lysine-producing ability, Corynebacterium glutamicum ( Corynebacterium glutamicum ) To provide a strain:
  • an endogenous membrane transport protein variant consisting of the amino acid sequence set forth in SEQ ID NO: 1 in which phenylalanine, an amino acid corresponding to position 220 of SEQ ID NO: 3, is substituted with cysteine;
  • DNA polymerase III gamma and tau subunit variants consisting of the amino acid sequence set forth in SEQ ID NO: 5 in which proline, an amino acid corresponding to position 43 of SEQ ID NO: 7, is substituted with leucine;
  • (6) a malate dehydrogenase variant consisting of the amino acid sequence set forth in SEQ ID NO: 21 in which threonine, an amino acid corresponding to position 272 of SEQ ID NO: 23, is substituted with isoleucine;
  • a primosome assembly protein variant consisting of the amino acid sequence shown in SEQ ID NO: 25, in which arginine, an amino acid corresponding to position 304 of SEQ ID NO: 27, is substituted with glutamine;
  • a Co/Zn/Cd efflux system component variant consisting of the amino acid sequence set forth in SEQ ID NO: 41 in which glycine, an amino acid corresponding to position 130 of SEQ ID NO: 43, is substituted with aspartic acid;
  • DAHP synthase variant consisting of the amino acid sequence set forth in SEQ ID NO: 45 in which glycine, an amino acid corresponding to position 382 of SEQ ID NO: 47, is substituted with cysteine;
  • a helicase variant consisting of the amino acid sequence set forth in SEQ ID NO: 53 in which tyrosine, an amino acid corresponding to position 592 of SEQ ID NO: 55, is substituted with phenylalanine;
  • a sugar phosphate isomerase/epimerase variant consisting of the amino acid sequence shown in SEQ ID NO: 61 in which alanine, an amino acid corresponding to position 321 of SEQ ID NO: 63, is substituted with valine;
  • cytolytic membrane protein variant consisting of the amino acid sequence shown in SEQ ID NO: 65 in which isoleucine, an amino acid corresponding to position 307 of SEQ ID NO: 67, is substituted with valine;
  • a major promoter superfamily permease mutant consisting of the amino acid sequence set forth in SEQ ID NO: 73, wherein histidine, an amino acid corresponding to position 377 of SEQ ID NO: 75, is substituted with glutamine.
  • Another object of the present application is to provide a method for producing L-lysine, comprising culturing the Corynebacterium glutamicum strain of the present application in a medium.
  • One aspect of the present application is to provide one or more (eg, one or two or more) protein variants selected from the group consisting of the following (1) to (19):
  • an endogenous membrane transport protein variant consisting of the amino acid sequence set forth in SEQ ID NO: 1 in which phenylalanine, an amino acid corresponding to position 220 of SEQ ID NO: 3, is substituted with cysteine;
  • DNA polymerase III gamma and tau subunit variants consisting of the amino acid sequence set forth in SEQ ID NO: 5 in which proline, an amino acid corresponding to position 43 of SEQ ID NO: 7, is substituted with leucine;
  • (6) a malate dehydrogenase variant consisting of the amino acid sequence set forth in SEQ ID NO: 21 in which threonine, an amino acid corresponding to position 272 of SEQ ID NO: 23, is substituted with isoleucine;
  • a primosome assembly protein variant consisting of the amino acid sequence shown in SEQ ID NO: 25, in which arginine, an amino acid corresponding to position 304 of SEQ ID NO: 27, is substituted with glutamine;
  • a Co/Zn/Cd efflux system component variant consisting of the amino acid sequence set forth in SEQ ID NO: 41 in which glycine, an amino acid corresponding to position 130 of SEQ ID NO: 43, is substituted with aspartic acid;
  • DAHP synthase variant consisting of the amino acid sequence set forth in SEQ ID NO: 45 in which glycine, an amino acid corresponding to position 382 of SEQ ID NO: 47, is substituted with cysteine;
  • a helicase variant consisting of the amino acid sequence set forth in SEQ ID NO: 53 in which tyrosine, an amino acid corresponding to position 592 of SEQ ID NO: 55, is substituted with phenylalanine;
  • a sugar phosphate isomerase/epimerase variant consisting of the amino acid sequence shown in SEQ ID NO: 61 in which alanine, an amino acid corresponding to position 321 of SEQ ID NO: 63, is substituted with valine;
  • cytolytic membrane protein variant consisting of the amino acid sequence shown in SEQ ID NO: 65 in which isoleucine, an amino acid corresponding to position 307 of SEQ ID NO: 67, is substituted with valine;
  • a major promoter superfamily permease variant consisting of the amino acid sequence set forth in SEQ ID NO: 73, wherein histidine, an amino acid corresponding to position 377 of SEQ ID NO: 75, is substituted with glutamine.
  • variants of the present application are selected from the group consisting of SEQ ID NOs: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61, 65, 69, and 73 It may have or include, or essentially consist of, one or more (eg, one or two or more) amino acid sequences described in SEQ ID NOs.
  • the variant of the present application is described in SEQ ID NO: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61, 65, 69, or 73
  • SEQ ID NO: 3 Based on the amino acid sequence of SEQ ID NO: 3, 7, 11, 15, 19, 23, 27, 31, 35, 39, 43, 47, 51, 55, 59, 63, 67, 71, or 75 in the amino acid sequence, respectively 220, 43, 33, 210, 199, 272, 304, 169, 294, 358, 130, 382, 209, 592, 170, 321, 307, respectively
  • the amino acids corresponding to positions 676, or 377 are cysteine, leucine, serine, aspartic acid, methionine, isoleucine, glutamine, valine, lysine, serine, aspartic acid, cysteine, leucine, phenylalanine, lysine, valine, valine, Tyrosine, or glutamine, and the group consist
  • amino acid sequence The amino acid sequence as a reference for counting positions location type of amino acid
  • SEQ ID NO: 1 SEQ ID NO: 3 220 cysteine 2 SEQ ID NO: 5 SEQ ID NO: 7 43 leucine 3 SEQ ID NO: 9 SEQ ID NO: 11 33 serine 4 SEQ ID NO: 13 SEQ ID NO: 15 210 aspartic acid 5 SEQ ID NO: 17 SEQ ID NO: 19 199 methionine 6 SEQ ID NO: 21 SEQ ID NO: 23 272 isoleucine 7 SEQ ID NO: 25 SEQ ID NO: 27 304 glutamine 8 SEQ ID NO: 29 SEQ ID NO: 31 169 valine 9 SEQ ID NO: 33 SEQ ID NO: 35 294 lysine 10 SEQ ID NO: 37 SEQ ID NO: 39 358 serine 11 SEQ ID NO: 41 SEQ ID NO: 43 130 aspartic acid 12 SEQ ID NO: 45 SEQ ID NO: 47 382 cysteine 13 SEQ ID NO: 49 SEQ ID NO: 51 209 leucine 14
  • sequence additions or deletions naturally occurring mutations, silent mutations or conservation within the N-terminus, C-terminus and/or within the amino acid sequence that do not alter the function of the variants of the present application It is a case of having an enemy substitution.
  • conservative substitution means substituting an amino acid for another amino acid having similar structural and/or chemical properties. Such amino acid substitutions may generally occur based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.
  • variant refers to a conservative substitution and Refers to a polypeptide that is different from the amino acid sequence before modification of the mutant by modification (modification) but retains functions or properties.
  • variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation.
  • some variants may include variants in which one or more portions such as an N-terminal leader sequence or a transmembrane domain have been removed.
  • variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein.
  • variant may be used interchangeably with terms such as mutant, modified, mutant polypeptide, mutated protein, mutant and mutant (in English, modified, modified polypeptide, modified protein, mutant, mutein, divergent, etc.) and, as long as it is a term used in a mutated sense, it is not limited thereto.
  • the variants are amino acids of SEQ ID NOs: 3, 7, 11, 15, 19, 23, 27, 31, 35, 39, 43, 47, 51, 55, 59, 63, 67, 71, or 75 220, 43, 33, 210, 199, 272, 304, 169, 294, 358, 130, 382, 209, 592, 170, 321, amino acids corresponding to positions 307, 676, or 377, respectively, phenylalanine, proline, cysteine, asparagine, valine, threonine, arginine, alanine, glutamic acid, proline, glycine, glycine, proline, tyrosine, glutamic acid, alanine, isoleucine; Substitution of aspartic acid or histidine with cysteine, leucine, serine, aspartic acid, methionine, isoleucine, glutamine, valine, lysine, serine, aspartic acid, cysteine
  • amino acid sequence The amino acid sequence as a reference for counting positions mutation position Type of amino acid before substitution
  • amino acid sequence One SEQ ID NO: 1 SEQ ID NO: 3 220 phenylalanine cysteine 2 SEQ ID NO: 5 SEQ ID NO: 7 43 proline leucine 3 SEQ ID NO: 9 SEQ ID NO: 11 33 cysteine serine 4 SEQ ID NO: 13 SEQ ID NO: 15 210 asparagine aspartic acid 5 SEQ ID NO: 17 SEQ ID NO: 19 199 valine methionine 6 SEQ ID NO: 21 SEQ ID NO: 23 272 threonine isoleucine 7 SEQ ID NO: 25 SEQ ID NO: 27 304 arginine glutamine 8 SEQ ID NO: 29 SEQ ID NO: 31 169 alanine valine 9 SEQ ID NO: 33 SEQ ID NO: 35 294 glutamic acid lysine 10 SEQ ID NO: 37 SEQ ID NO: 39 358 proline serine 11 SEQ ID NO: 41
  • variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide.
  • a signal (or leader) sequence involved in protein translocation may be conjugated to the N-terminus of the mutant, either co-translationally or post-translationally.
  • the variants may also be conjugated with other sequences or linkers for identification, purification, or synthesis.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of a sequence under moderate or high stringent conditions. It is obvious that hybridization also includes hybridization with polynucleotides containing codons taking into account common codons or codon degeneracy in the polynucleotide.
  • a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap open penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • the variant of the present application is an integral membrane transport protein; DNA polymerase III subunits gamma and tau; a polypeptide comprising the amino acid sequence of SEQ ID NO: 11 and/or a protein encoded by the NCgl3069 gene; transcription antitermination protein; ABC transporter ATP-binding protein; malate dehydrogenase; primosome assembly protein; type II citrate synthase; membrane protein (TerC); mycothione reductase; Co/Zn/Cd efflux system component; DAHP synthase (3-deoxy-D-arabinoheptulosonate-7-phosphate synthase; DAHP synthase); N-succinyldiaminopimelate aminotransferase; Helicase; a polypeptide comprising the amino acid sequence of SEQ ID NO: 59 and/or a protein encoded by the NCgl1098 gene; sugar phosphate isomerase/epimerase; cytoplasmic acid sequence of SEQ
  • the term "integral membrane transport protein” refers to the formation of macromolecules, small molecules, and ions, such as other proteins across biological membranes. It is a membrane protein that is involved in migration and is attached to a biological membrane. Specifically, the integral membrane transport protein of the present application can be used interchangeably as an integral membrane transport protein.
  • the intrinsic membrane transport protein is known The sequence can be obtained from GenBank of NCBI, which is the base, for example, it can be GenBank Accession No. YP_227155.1, WP_011015489.1. Specifically, it can be a polypeptide having an intrinsic membrane transport protein activity encoded by the NCgl2816 gene. However, it is not limited thereto.
  • DNA polymerase III subunits gamma and tau is a major enzyme responsible for DNA replication
  • the DNA polymerase III tau subunit is a core (alpha ( alpha), epsilon, and theta (consisting of chains) bind to dimerization of the core
  • DNA polymerase III gamma subunit is a clamp loader that obtains the beta subunit to the lagging strand.
  • the DNA polymerase III gamma and tau subunits of the present application may be used interchangeably as DNA polymerase III gamma and tau subunits, or DNA polymerase III subunit gamma/tau.
  • Polymerase III gamma and tau subunits can be sequenced from GenBank of NCBI, which is a known database, for example, GenBank Accession No. YP_224542.1, WP_011013499.1. Specifically, the dnaZX gene (or NCgl0239) gene) encoded by DNA polymerase III gamma and tau subunit activity, but is not limited thereto.
  • transcription antitermination protein is a transcription complex, capable of interacting with the termination factor Rho and RNA polymerase, transcription termination and/or anti-termination It is a polypeptide that is a transcriptional elongation factor involved in Specifically, the transcriptional anti-termination protein of the present application may be used interchangeably as a transcription termination/antitermination protein, NusG protein, or NusG.
  • the transcriptional anti-termination protein can be sequenced from GenBank of NCBI, a known database, for example, GenBank Accession No. It may be WP_011013678.1, YP_224775.1. Specifically, it may be a polypeptide having transcriptional anti-termination protein activity encoded by the nusG gene (or NCgl0458 gene), but is not limited thereto.
  • the term "ABC transporter ATP-binding protein” refers to a transmembrane protein that uses the energy obtained by hydrolyzing ATP to move and/or transport various substrates across the membrane, and Polypeptides with biological functions such as repair of unrelated DNA and RNA.
  • the ABC transporter ATP-binding protein of the present application may be used in combination as the ABC transporter ATP-binding protein.
  • the ABC transporter ATP-binding protein may be sequenced from GenBank of NCBI, a known database, for example, GenBank Accession No. It may be WP_011013802.1, YP_224957.1. Specifically, it may be a polypeptide having an ABC transporter ATP-binding protein activity encoded by the NCgl0636 gene, but is not limited thereto.
  • N-succinyldiaminopimelate aminotransferase refers to L-glutamate and N-succinyl-2-amino-6-ketopimelate as substrates, 2-oxoglutarate and N-succinyl-L,L It is an enzyme involved in the lysine biosynthetic pathway to produce -2,6-diaminopimelate.
  • N-succinyldiaminopimelate aminotransferase of the present application can be used interchangeably with N-succinyldiaminopimelate aminotransferase.
  • N-succinyldiaminopimelate aminotransferase sequence can be obtained from GenBank of NCBI, a known database, for example, GenBank Accession No. WP_011014123.1, YP_225395.1.
  • NCgl1058 It may be a polypeptide having N-succinyldiaminopimelate aminotransferase activity encoded by the gene (or dapC gene), but is not limited thereto.
  • malate dehydrogenase is an enzyme that reversibly catalyzes the oxidation of malate (malic acid) to oxaloacetic acid and the reduction of NAD+ to NADH in this process.
  • the malate dehydrogenase of the application can be used interchangeably with malate dehydrogenase, MDH, or malate dehydrogenase
  • the malate dehydrogenase sequence can be obtained from NCBI's GenBank, a known database. and may be, for example, GenBank Accession No. WP_011015079.1, YP_226625.1. Specifically, it may be a polypeptide having malate dehydrogenase activity encoded by NCgl2297 gene (or mdh gene), but is not limited thereto. does not
  • primosome assembly protein refers to a protein having a helicase activity and involved in the DNA replication process.
  • the primosome assembly protein of the present application may be used interchangeably as primosome assembly protein, PriA protein, PriA, or primosomal protein N'.
  • sequence of the primosome assembly protein can be obtained from GenBank of NCBI, a known database, for example, GenBank Accession No. It may be WP_011014474.1, YP_225886.1. Specifically, it may be a polypeptide having a primosome assembly protein activity encoded by the NCgl1540 gene (or priA gene), but is not limited thereto.
  • helicase is a polypeptide capable of separating a DNA double helix or a strand of a self-associated RNA molecule.
  • the helicase of the present application may be used in combination with a helicase.
  • the helicase sequence can be obtained from GenBank of NCBI, a known database, for example, GenBank Accession No. It can be WP_011014500.1, YP_225922.1. Specifically, it may be a polypeptide having a helicase activity encoded by the NCgl1575 gene, but is not limited thereto.
  • Type II citrate synthase of the present application may be used in combination with integral type II citrate synthase, citrate synthase, or citrate synthase.
  • the type II citrate synthase may have its sequence obtained from GenBank of NCBI, which is a known database, for example, GenBank Accession No. It can be YP_225121.1, WP_011013914.1. Specifically, it may be a polypeptide having a type II citrate synthase activity encoded by the gltA gene (or NCgl0795 gene), but is not limited thereto.
  • the membrane protein of the present application may be used interchangeably as a membrane protein, a membrane protein, TerC, or a TerC protein.
  • the membrane protein sequence can be obtained from GenBank of NCBI, which is a known database, for example, GenBank Accession No. It may be YP_226209.1 or WP_011014789.1. Specifically, it may be a polypeptide having a membrane protein activity encoded by the terC gene (or NCgl1892 gene), but is not limited thereto.
  • Mycothione reductase of the present application may be used in combination with mycothione reductase, or mycothione reductase.
  • the mycothione reductase sequence can be obtained from GenBank of NCBI, a known database, for example, GenBank Accession No. It may be YP_226245.1 or WP_011014816.1. Specifically, it may be a polypeptide having mycothione reductase activity encoded by the mtr gene (or NCgl1928 gene), but is not limited thereto.
  • the Co/Zn/Cd efflux system component of the present application may be used in combination as a Co/Zn/Cd efflux system component.
  • the Co/Zn/Cd efflux system component can obtain its sequence from NCBI's GenBank, a known database, for example, GenBank Accession No. It may be YP_226309.1, WP_011014862.1. Specifically, it may be a polypeptide having a Co/Zn/Cd efflux system component activity encoded by the NCgl1992 gene, but is not limited thereto.
  • DAHP synthase of the present application is 3-deoxy-D-arabinoheptulosonic acid 7-phosphate synthase, 3-deoxy-D-arabinoheptulosonic acid 7-phosphate synthase, 3-deoxy-D-arabinoheptulosonate -7-phosphate synthase, or DAHP synthase may be used in combination.
  • the sequence of the DAHP synthase can be obtained from GenBank of NCBI, a known database, for example, GenBank Accession No. It may be YP_226420.1, WP_011014936.1. Specifically, it may be a polypeptide having DAHP synthase activity encoded by the aroG gene (or NCgl2098 gene), but is not limited thereto.
  • sugar phosphate isomerase/epimerase may be used interchangeably with sugar phosphate isomerase/epimerase, NCgl0169 protein, and/or NCgl0169.
  • the sugar phosphate isomerase/epimerase can obtain the sequence from GenBank of NCBI, a known database, for example, GenBank Accession No. WP_011013444.1.
  • the sugar phosphate isomerase/epimerase activity encoded by the NCgl0169 gene It may be a polypeptide having, but is not limited to.
  • cytolytic membrane protein is an enzyme involved in cell division.
  • the cell division membrane protein of the present application may be used interchangeably as cell division membrane protein, RodA protein, or RodA.
  • its sequence can be obtained from GenBank of NCBI, which is a known database, for example, GenBank Accession No. WP_011013343.1. Specifically, it is encoded by the NCgl0043 gene (or rodA gene). It may be a polypeptide having a cytolytic membrane protein activity, but is not limited thereto.
  • major promoter superfamily permeases is a superfamily of membrane transport proteins that facilitate the movement of small solutes across cell membranes in response to chemorequired gradients. can be used interchangeably with major facilitator superfamily permease, LmrB protein, or LmrB.
  • the major facilitator superfamily permease sequence can be obtained from GenBank of NCBI, a known database, for example, GenBank Accession It may be No. WP_011015308.1 Specifically, it may be a polypeptide having a major promoter superfamily permease activity encoded by NCgl2592 gene (or lmrB gene), but is not limited thereto.
  • the mutant of the present application may have an activity to increase L-lysine production capacity compared to the wild-type polypeptide.
  • the endogenous membrane transport protein DNA polymerase III gamma and tau subunits; a protein encoded by the NCgl3069 gene; transcriptional anti-termination protein; ABC transporter ATP-binding protein; malate dehydrogenase; primosome assembly protein; type II citrate synthase; membrane protein; mycothion reductase; Co/Zn/Cd effluent system components; DAHP synthase; N-succinyldiaminopimelate aminotransferase; helicase; a polypeptide comprising the amino acid sequence of SEQ ID NO: 59 and/or a protein encoded by the NCgl1098 gene; sugar phosphate isomerase/epimerase; cytolytic membrane protein; a polypeptide comprising the amino acid sequence of SEQ ID NO: 71 and/or a protein encoded by the NCgl0752 gene; and the amino acid sequence of the wild-type polypeptide of the major promoter superfamily permease and an
  • SEQ ID NO: 8 Protein encoded by the NCgl3069 gene SEQ ID NO: 11 SEQ ID NO: 12 transcriptional anti-termination protein SEQ ID NO: 15 SEQ ID NO: 16 ABC transporter ATP-binding protein SEQ ID NO: 19 SEQ ID NO: 20 malate dehydrogenase SEQ ID NO: 23 SEQ ID NO: 24 primosome assembly protein SEQ ID NO: 27 SEQ ID NO: 28 Type II citrate synthase SEQ ID NO: 31 SEQ ID NO: 32 membrane protein SEQ ID NO: 35 SEQ ID NO: 36 mycothion reductase SEQ ID NO: 39 SEQ ID NO: 40 Co/Zn/Cd effluent system components SEQ ID NO: 43 SEQ ID NO: 44 DAHP synthase SEQ ID NO: 47 SEQ
  • corresponding to refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue similar to, identical to, or homologous to a residue listed in a polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that refers to a specific sequence.
  • corresponding region generally refers to a similar or corresponding position in a related protein or reference protein.
  • any amino acid sequence can be combined with SEQ ID NOs: 3, 7, 11, 15, 19, 23, 27, 31, 35, 39, 43, 47, 51, 55, 59, 63, 67, 71, or 75 Aligned, and based on this, each amino acid residue of the amino acid sequence is SEQ ID NO: 3, 7, 11, 15, 19, 23, 27, 31, 35, 39, 43, 47, 51, 55, 59, 63, Numbering may be done with reference to amino acid residues 67, 71, or 75 and the numerical position of the corresponding amino acid residue.
  • a sequence alignment algorithm such as that described in this application can identify the position of an amino acid, or a position at which modifications, such as substitutions, insertions, or deletions, occur compared to a query sequence (also referred to as a "reference sequence").
  • Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277), etc., but is not limited thereto, and a sequence alignment program, pairwise sequence comparison algorithm, etc. known in the art may be appropriately used.
  • Another aspect of the present application is to provide a polynucleotide encoding the variant of the present application.
  • polynucleotide refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are linked in a long chain by covalent bonds, and more specifically, encoding the variant. polynucleotide fragments.
  • the polynucleotide encoding the variant of the present application is SEQ ID NO: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61, 65, 69, or 73 It may include a nucleotide sequence encoding the amino acid sequence described as As an example of the present application, the polynucleotide of the present application is SEQ ID NO: 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 46, 50, 54, 58, 62, 66, 70, or 74.
  • polynucleotide of the present application has the sequence of SEQ ID NO: 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 46, 50, 54, 58, 62, 66, 70, or 74 It may consist of, or may consist essentially of.
  • the polynucleotide of the present application is SEQ ID NO: 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 46, 50, 54, 58, 62, 66, 70, or a nucleic acid of SEQ ID NO: 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, or 76, respectively, in the nucleic acid sequence set forth in 74 Based on the sequence, 659, 128, 97, 628, 595, 815, 911, 506, 880, 1072, 389, 1144, 626, 1775, 508, 962
  • the bases corresponding to positions 919, 2026, or 1131, respectively, are G, T, A ,G, A, T, A, T, A, T, T, T, or A, T , G, T, or A, wherein SEQ ID NO: 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 46, 50, 54, 58, 62
  • a polynucleotide having a nucleic acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added is also It is obvious that they are included within the scope of the present application.
  • Table 4 below shows the correspondence of each nucleic acid sequence, position, and base type corresponding to the position of the polynucleotide of the present application.
  • nucleic acid sequence Nucleic acid sequence as a reference for counting positions location base type One SEQ ID NO: 2 SEQ ID NO: 4 659 G 2 SEQ ID NO: 6 SEQ ID NO: 8 128 T 3 SEQ ID NO: 10 SEQ ID NO: 12 97 A 4 SEQ ID NO: 14 SEQ ID NO: 16 628 G 5 SEQ ID NO: 18 SEQ ID NO: 20 595 A 6 SEQ ID NO: 22 SEQ ID NO: 24 815 T 7 SEQ ID NO: 26 SEQ ID NO: 28 911 A 8 SEQ ID NO: 30 SEQ ID NO: 32 506 T 9 SEQ ID NO: 34 SEQ ID NO: 36 880 A 10 SEQ ID NO: 38 SEQ ID NO: 40 1072 T 11 SEQ ID NO: 42 SEQ ID NO: 44 389 A 12 SEQ ID NO: 46 SEQ ID NO: 48 1144 T 13 SEQ ID NO: 50 SEQ ID NO: 52 626 T 14 SEQ ID NO: 54 SEQ ID NO: 56 1775 T 15 SEQ ID NO: 58 SEQ ID
  • the polynucleotides of the present application are various in the coding region within the range that does not change the amino acid sequence of the variants of the present application. Deformation can be made.
  • the polynucleotide of the present application is a polynucleotide of SEQ ID NO: 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 46, 50, 54, 58, 62, 66, 70, or 74
  • a nucleotide sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity to the sequence has, contains, or is identical to the sequence of SEQ ID NOs: 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 46, 50, 54, 58, 62, 66, 70, or 74
  • Consists of or essential to a nucleotide sequence that is 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homogeneity or identity may be made, but
  • SEQ ID NO: 1 in the sequence having the homology or identity, SEQ ID NO: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61, 65, 69, or 73 of 220, 43, 33, 210, 199, 272, 304, 169, 294, 358, 130, 382, 209, 592, 170, 321
  • the codons encoding the amino acids corresponding to positions , 307, 676, and 377, respectively, are cysteine, leucine, serine, aspartic acid, methionine, isoleucine, glutamine, valine, lysine, serine, aspartic acid, cysteine, and leucine, respectively.
  • the polynucleotide of the present application can be included without limitation as long as it can hybridize under stringent conditions with a probe that can be prepared from a known gene sequence, for example, a sequence complementary to all or part of the polynucleotide sequence of the present application.
  • stringent condition refers to a condition that enables specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M.
  • polynucleotides with high homology or identity 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or a condition in which polynucleotides having 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize, or 60 ° C., which is a washing condition of conventional Southern hybridization, 1 ⁇ SSC, 0.1% SDS, specifically 60°C, 0.1 ⁇ SSC, 0.1% SDS, more specifically 68°C, 0.1 ⁇ SSC, 0.1% SDS at a salt concentration and temperature equivalent to once, specifically twice The conditions for washing to 3 times can be listed.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • the term “complementary” is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the overall sequence.
  • a polynucleotide having homology or identity to the polynucleotide of the present application can be detected using the hybridization conditions including a hybridization step at a Tm value of 55°C and using the above-described conditions.
  • the Tm value may be 60 °C, 63 °C, or 65 °C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • Appropriate stringency for hybridizing the polynucleotide depends on the length of the polynucleotide and the degree of complementarity, and the variables are well known in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; see F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • Another aspect of the present application is to provide a vector comprising the polynucleotide of the present application.
  • the vector may be an expression vector for expressing the polynucleotide in a host cell, but is not limited thereto.
  • vector refers to a DNA preparation comprising a base sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable expression control region (or expression control sequence) so that the target polypeptide can be expressed in a suitable host.
  • suitable expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the vector After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors may be used.
  • pBluescript II-based pGEM-based, pTZ-based, pCL-based, pET-based and the like
  • pDZ pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like
  • pC1BAC vectors and the like can be used.
  • a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion.
  • the insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted.
  • the selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. Markers to be given can be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
  • the term "transformation” means introducing a vector including a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell.
  • the polynucleotide includes DNA and/or RNA encoding a target polypeptide.
  • the polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the target variant of the present application and the polynucleotide sequence are functionally linked.
  • Another aspect of the present application includes a variant of the present application or a polynucleotide of the present application, Corynebacterium glutamicum ( Corynebacterium glutamicum ) to provide a strain.
  • One example is one or more (eg, one or more or two or more) protein variants selected from the group consisting of (1) to (19) or a polynucleotide encoding the variant, Corynebacterium Glutamicum strain ( Corynebacterium glutamicum ) can be provided:
  • an endogenous membrane transport protein variant consisting of the amino acid sequence set forth in SEQ ID NO: 1 in which phenylalanine, an amino acid corresponding to position 220 of SEQ ID NO: 3, is substituted with cysteine;
  • DNA polymerase III gamma and tau subunit variants consisting of the amino acid sequence set forth in SEQ ID NO: 5 in which proline, an amino acid corresponding to position 43 of SEQ ID NO: 7, is substituted with leucine;
  • (6) a malate dehydrogenase variant consisting of the amino acid sequence set forth in SEQ ID NO: 21 in which threonine, an amino acid corresponding to position 272 of SEQ ID NO: 23, is substituted with isoleucine;
  • a primosome assembly protein variant consisting of the amino acid sequence shown in SEQ ID NO: 25, in which arginine, an amino acid corresponding to position 304 of SEQ ID NO: 27, is substituted with glutamine;
  • a Co/Zn/Cd efflux system component variant consisting of the amino acid sequence set forth in SEQ ID NO: 41 in which glycine, an amino acid corresponding to position 130 of SEQ ID NO: 43, is substituted with aspartic acid;
  • DAHP synthase variant consisting of the amino acid sequence set forth in SEQ ID NO: 45 in which glycine, an amino acid corresponding to position 382 of SEQ ID NO: 47, is substituted with cysteine;
  • N-succinyldiaminopimelate aminotransferase variant consisting of the amino acid sequence set forth in SEQ ID NO: 49, wherein proline, which is the amino acid corresponding to position 209 of SEQ ID NO: 51, is substituted with leucine;
  • a helicase variant consisting of the amino acid sequence set forth in SEQ ID NO: 53 in which tyrosine, an amino acid corresponding to position 592 of SEQ ID NO: 55, is substituted with phenylalanine;
  • a sugar phosphate isomerase/epimerase variant consisting of the amino acid sequence shown in SEQ ID NO: 61 in which alanine, an amino acid corresponding to position 321 of SEQ ID NO: 63, is substituted with valine;
  • cytolytic membrane protein variant consisting of the amino acid sequence shown in SEQ ID NO: 65 in which isoleucine, an amino acid corresponding to position 307 of SEQ ID NO: 67, is substituted with valine;
  • a major promoter superfamily permease mutant consisting of the amino acid sequence set forth in SEQ ID NO: 73, wherein histidine, an amino acid corresponding to position 377 of SEQ ID NO: 75, is substituted with glutamine.
  • An example is a protein variant of the following (a) and (b) or a polynucleotide encoding the variant (eg, (a) a polynucleotide encoding the variant, (b) a polynucleotide encoding the variant, and/or It is possible to provide a Corynebacterium glutamicum strain comprising (a) and (b) a polynucleotide encoding:
  • an endogenous membrane transport protein variant consisting of the amino acid sequence set forth in SEQ ID NO: 1 in which phenylalanine, an amino acid corresponding to position 220 of SEQ ID NO: 3, is substituted with cysteine;
  • DNA polymerase III gamma and tau subunit variants consisting of the amino acid sequence set forth in SEQ ID NO: 5 in which proline, an amino acid corresponding to position 43 of SEQ ID NO: 7, is substituted with leucine;
  • (6) a malate dehydrogenase variant consisting of the amino acid sequence set forth in SEQ ID NO: 21 in which threonine, an amino acid corresponding to position 272 of SEQ ID NO: 23, is substituted with isoleucine;
  • a primosome assembly protein variant consisting of the amino acid sequence shown in SEQ ID NO: 25, in which arginine, an amino acid corresponding to position 304 of SEQ ID NO: 27, is substituted with glutamine;
  • a Co/Zn/Cd efflux system component variant consisting of the amino acid sequence set forth in SEQ ID NO: 41 in which glycine, an amino acid corresponding to position 130 of SEQ ID NO: 43, is substituted with aspartic acid;
  • DAHP synthase variant consisting of the amino acid sequence set forth in SEQ ID NO: 45 in which glycine, an amino acid corresponding to position 382 of SEQ ID NO: 47, is substituted with cysteine;
  • N-succinyldiaminopimelate aminotransferase variant consisting of the amino acid sequence set forth in SEQ ID NO: 49, wherein proline, which is the amino acid corresponding to position 209 of SEQ ID NO: 51, is substituted with leucine;
  • a helicase variant consisting of the amino acid sequence set forth in SEQ ID NO: 53 in which tyrosine, an amino acid corresponding to position 592 of SEQ ID NO: 55, is substituted with phenylalanine;
  • a sugar phosphate isomerase/epimerase variant consisting of the amino acid sequence shown in SEQ ID NO: 61 in which alanine, an amino acid corresponding to position 321 of SEQ ID NO: 63, is substituted with valine;
  • cytolytic membrane protein variant consisting of the amino acid sequence shown in SEQ ID NO: 65 in which isoleucine, an amino acid corresponding to position 307 of SEQ ID NO: 67, is substituted with valine;
  • a major promoter superfamily permease variant consisting of the amino acid sequence set forth in SEQ ID NO: 73, wherein histidine, an amino acid corresponding to position 377 of SEQ ID NO: 75, is substituted with glutamine.
  • An example is a protein variant of (A) and (B) or a polynucleotide encoding the variant (eg, (A) a polynucleotide encoding the variant, (B) a polynucleotide encoding the variant, and/or It is possible to provide a Corynebacterium glutamicum strain comprising (A) and (B) encoding polynucleotides:
  • (A) a helicase variant consisting of the amino acid sequence set forth in SEQ ID NO: 53 in which tyrosine, an amino acid corresponding to position 592 of SEQ ID NO: 55, is substituted with phenylalanine, and
  • an endogenous membrane transport protein variant consisting of the amino acid sequence set forth in SEQ ID NO: 1 in which phenylalanine, an amino acid corresponding to position 220 of SEQ ID NO: 3, is substituted with cysteine;
  • DNA polymerase III gamma and tau subunit variants consisting of the amino acid sequence set forth in SEQ ID NO: 5 in which proline, an amino acid corresponding to position 43 of SEQ ID NO: 7, is substituted with leucine;
  • (6) a malate dehydrogenase variant consisting of the amino acid sequence set forth in SEQ ID NO: 21 in which threonine, an amino acid corresponding to position 272 of SEQ ID NO: 23, is substituted with isoleucine;
  • a primosome assembly protein variant consisting of the amino acid sequence shown in SEQ ID NO: 25, in which arginine, an amino acid corresponding to position 304 of SEQ ID NO: 27, is substituted with glutamine;
  • a Co/Zn/Cd efflux system component variant consisting of the amino acid sequence set forth in SEQ ID NO: 41 in which glycine, an amino acid corresponding to position 130 of SEQ ID NO: 43, is substituted with aspartic acid;
  • DAHP synthase variant consisting of the amino acid sequence set forth in SEQ ID NO: 45 in which glycine, an amino acid corresponding to position 382 of SEQ ID NO: 47, is substituted with cysteine;
  • N-succinyldiaminopimelate aminotransferase variant consisting of the amino acid sequence set forth in SEQ ID NO: 49, wherein proline, which is the amino acid corresponding to position 209 of SEQ ID NO: 51, is substituted with leucine;
  • a sugar phosphate isomerase/epimerase variant consisting of the amino acid sequence shown in SEQ ID NO: 61 in which alanine, an amino acid corresponding to position 321 of SEQ ID NO: 63, is substituted with valine;
  • cytolytic membrane protein variant consisting of the amino acid sequence shown in SEQ ID NO: 65, wherein isoleucine, an amino acid corresponding to position 307 of SEQ ID NO: 67, is substituted with valine;
  • a major promoter superfamily permease mutant comprising the amino acid sequence set forth in SEQ ID NO: 73, wherein histidine, an amino acid corresponding to position 377 of SEQ ID NO: 75, is substituted with glutamine.
  • An example is a protein variant of the following (I) and (II) or a polynucleotide encoding the variant (eg, (I) a polynucleotide encoding the variant, (II) a polynucleotide encoding the variant, and/or A Corynebacterium glutamicum strain comprising (I) and (II) encoding polynucleotides) can be provided:
  • an endogenous membrane transport protein variant consisting of the amino acid sequence set forth in SEQ ID NO: 1 in which phenylalanine, an amino acid corresponding to position 220 of SEQ ID NO: 3, is substituted with cysteine;
  • DNA polymerase III gamma and tau subunit variants consisting of the amino acid sequence set forth in SEQ ID NO: 5 in which proline, an amino acid corresponding to position 43 of SEQ ID NO: 7, is substituted with leucine;
  • (6) a malate dehydrogenase variant consisting of the amino acid sequence set forth in SEQ ID NO: 21 in which threonine, an amino acid corresponding to position 272 of SEQ ID NO: 23, is substituted with isoleucine;
  • a primosome assembly protein variant consisting of the amino acid sequence shown in SEQ ID NO: 25, in which arginine, an amino acid corresponding to position 304 of SEQ ID NO: 27, is substituted with glutamine;
  • a Co/Zn/Cd efflux system component variant consisting of the amino acid sequence set forth in SEQ ID NO: 41 in which glycine, an amino acid corresponding to position 130 of SEQ ID NO: 43, is substituted with aspartic acid;
  • DAHP synthase variant consisting of the amino acid sequence set forth in SEQ ID NO: 45 in which glycine, an amino acid corresponding to position 382 of SEQ ID NO: 47, is substituted with cysteine;
  • a sugar phosphate isomerase/epimerase variant consisting of the amino acid sequence shown in SEQ ID NO: 61 in which alanine, which is the amino acid corresponding to position 321 of SEQ ID NO: 63, is substituted with valine;
  • cytolytic membrane protein variant consisting of the amino acid sequence shown in SEQ ID NO: 65 in which isoleucine, an amino acid corresponding to position 307 of SEQ ID NO: 67, is substituted with valine;
  • a major promoter superfamily permease variant consisting of the amino acid sequence set forth in SEQ ID NO: 73, wherein histidine, an amino acid corresponding to position 377 of SEQ ID NO: 75, is substituted with glutamine.
  • the strain of the present application may include a vector comprising the mutant polypeptide of the present application, a polynucleotide encoding the polypeptide, or the polynucleotide of the present application.
  • strain or microorganism
  • strain includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially.
  • a specific mechanism is weakened or enhanced as a microorganism, and may be a microorganism including genetic modification for the production of a desired polypeptide, protein or product.
  • the strain of the present application includes any one or more (eg, one or more or two or more) of the variant of the present application, the polynucleotide of the present application, and a vector including the polynucleotide of the present application; a strain modified to express a variant of the present application or a polynucleotide of the present application; a strain expressing the variant of the present application or the polynucleotide of the present application (eg, a recombinant strain); Or it may be a strain having the mutant activity of the present application (eg, a recombinant strain), but is not limited thereto.
  • the strain of the present application may be a strain having L-lysine-producing ability.
  • the strain of the present application naturally comprises (i) an integral membrane transport protein; (ii) DNA polymerase III subunits gamma and tau; (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 11 and/or a protein encoded by the NCgl3069 gene; (iv) transcription antitermination protein; (v) ABC transporter ATP-binding protein; (vi) malate dehydrogenase; (vii) primosome assembly protein; (viii) type II citrate synthase; (ix) membrane protein (TerC); (x) mycothione reductase; (xi) Co/Zn/Cd efflux system component; (xii) DAHP synthase (3-deoxy-D-arabinoheptulosonate-7-phosphate synthase; DAHP synthase); (xiii) N-succinyldiaminopimelate aminotransferase; (xiv) helicase; (
  • the strain of the present application is transformed with a vector containing the polynucleotide of the present application or a polynucleotide encoding the variant of the present application, and expresses the variant of the present application as a cell or microorganism
  • the strains of the application may include all microorganisms capable of producing L-lysine, including the variants of the present application.
  • the strain of the present application is a recombinant strain in which the protein variant is expressed by introducing a polynucleotide encoding the variant of the present application into a natural wild-type microorganism or a microorganism producing L-lysine, and L-lysine-producing ability is increased.
  • the strain of the present application has an increased L-lysine-producing ability compared to a strain (eg, Corynebacterium glutamicum) that does not include a protein variant or a polynucleotide encoding the variant of the present application (eg, Corynebacterium glutamicum). It may be a recombinant strain.
  • a strain eg, Corynebacterium glutamicum
  • a polynucleotide encoding the variant of the present application eg, Corynebacterium glutamicum
  • the recombinant strain having an increased ability to produce L-amino acids is a natural wild-type microorganism or an unmodified microorganism in which one or more proteins selected from the group consisting of (i) to (xviv) are unmodified (that is, the (i) to (xv) ) a microorganism expressing one or more wild-type proteins selected from the group consisting of; for example, SEQ ID NOs: 3, 7, 11, 15, 19, 23, 27, 31, 35, 39, 43, 47, 51, 55, 59, 63, 67, 71, or 75, and/or a microorganism comprising a polynucleotide encoding the same) may be a microorganism having an increased L-lysine-producing ability, but is not limited thereto.
  • the non-modified microorganism which is the target strain to compare whether the increase in the L-lysine production ability, is ATCC13032 strain and / or Corynebacterium glutamicum CJ3P (US 9556463 B2; the entire document is incorporated herein by reference) ), but is not limited thereto.
  • the recombinant strain with increased production capacity has an L-lysine production capacity of about 1% or more, about 2.5% or more, about 5% or more, about 6% or more, about 7% compared to the parent strain or unmodified microorganism before mutation.
  • the recombinant strain with increased production capacity has an L-lysine production capacity of about 1.1 times or more, about 1.12 times or more, about 1.13 times or more, 1.15 times or more, 1.16 times or more, compared to the parent strain or unmodified microorganism before mutation. , 1.17 times or more, 1.18 times or more, 1.19 times or more, about 1.2 times or more, 1.25 times or more, or about 1.3 times or more (the upper limit is not particularly limited, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less) may be increased.
  • the term “about” is a range including all of ⁇ 0.5, ⁇ 0.4, ⁇ 0.3, ⁇ 0.2, ⁇ 0.1, etc. not limited
  • the term "unmodified microorganism” does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a wild-type strain or a natural-type strain itself, or a genetic variation caused by natural or artificial factors. It may mean the strain before being changed.
  • the unmodified microorganism may refer to a strain in which the transcriptional anti-termination protein variant described herein is not introduced or before it is introduced.
  • the "unmodified microorganism” may be used interchangeably with "strain before modification", “microbe before modification”, “unmodified strain”, “unmodified strain”, "unmodified microorganism” or "reference microorganism”.
  • the microorganism of the present application is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Cory Nebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium callunae ), Corynebacterium stationis , Corynebacterium stationis ), Corynebacterium singulare ( Corynebacterium singulare ), Corynebacterium halo Tolerans ( Corynebacterium halotolerans ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Corynebacterium pollutisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans imitans imitans imitans imit
  • the term “weakened” of a polypeptide is a concept that includes both reduced or no activity compared to intrinsic activity.
  • the attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, attenuation, and the like.
  • the attenuation is when the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism due to mutation of the polynucleotide encoding the polypeptide, etc.
  • the overall polypeptide activity level and/or concentration (expression amount) in the cell is lower than that of the native strain due to (translation) inhibition, etc., when the expression of the polynucleotide is not made at all, and/or when the expression of the polynucleotide is Even if there is no activity of the polypeptide, it may also be included.
  • the “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification”. “Inactivation, deficiency, reduction, downregulation, reduction, attenuation” of the activity of a polypeptide compared to the intrinsic activity means that the activity of the specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation is lowered.
  • Attenuation of the activity of such a polypeptide may be performed by any method known in the art, but is not limited thereto, and may be achieved by application of various methods well known in the art (eg, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
  • the attenuation of the polypeptide of the present application is
  • an antisense oligonucleotide eg, antisense RNA
  • an antisense oligonucleotide that complementarily binds to the transcript of said gene encoding the polypeptide
  • deletion of a part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide in which some nucleotides are deleted, or replacement with a marker gene.
  • the expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the base sequence modification encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a base encoding another start codon having a lower polypeptide expression rate than the intrinsic start codon It may be substituted with a sequence, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above is a deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide.
  • a combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto.
  • the expression of a gene may be inhibited or attenuated, but is not limited thereto.
  • antisense oligonucleotide eg, antisense RNA
  • antisense RNA an antisense oligonucleotide that complementarily binds to the transcript of the gene encoding the polypeptide
  • Weintraub, H. et al. Antisense-RNA as a molecular tool. for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
  • RTE reverse transcription engineering
  • the term “enhancement” of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity.
  • the reinforcement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.
  • activation, enhancement, up-regulation, overexpression, and increase may include all of those exhibiting an activity that was not originally possessed, or exhibiting an improved activity compared to an intrinsic activity or an activity prior to modification.
  • intrinsic activity refers to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before the transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification”.
  • Enhancement”, “up-regulation”, “overexpression” or “increase” in the activity of a polypeptide compared to its intrinsic activity means that the activity and/or concentration (expression) of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation. amount), which means improved.
  • the enrichment can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and/or concentration (expression amount) of the endogenous polypeptide. Whether or not the activity of the polypeptide is enhanced can be confirmed from the increase in the level of activity, expression level, or the amount of product excreted from the polypeptide.
  • the enhancement of the activity of the polypeptide can be applied by various methods well known in the art, and is not limited as long as it can enhance the activity of the target polypeptide compared to the microorganism before modification. Specifically, it may be one using genetic engineering and/or protein engineering well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (eg, Sitnicka et al. Functional Analysis of Genes. Advances in Cell). Biology 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • modification of the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide eg, modification of the polynucleotide sequence of the polypeptide gene to encode a polypeptide that has been modified to enhance the activity of the polypeptide;
  • the increase in the intracellular copy number of the polynucleotide encoding the polypeptide is achieved by introduction of a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked, into a host cell.
  • the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into a chromosome in a host cell.
  • the introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome in the host cell into the host cell, but is not limited thereto.
  • the vector is the same as described above.
  • Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence with strong activity is, for example, deletion, insertion, non-conservative or Conservative substitution or a combination thereof may result in a mutation in the sequence, or replacement with a sequence having a stronger activity.
  • the expression control region is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling the termination of transcription and translation.
  • the original promoter may be replaced with a strong promoter, but is not limited thereto.
  • Examples of known strong promoters include CJ1 to CJ7 promoters (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, etc., but is not limited thereto.
  • Modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a nucleotide sequence encoding another start codon having a higher expression rate of the polypeptide compared to the intrinsic start codon. It may be a substitution, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may include deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, or A combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto.
  • the replacement may be specifically performed by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
  • the vector used may further include a selection marker for confirming whether or not the chromosome is inserted.
  • the selection marker is the same as described above.
  • the introduction of the foreign polynucleotide exhibiting the activity of the polypeptide may be the introduction of the foreign polynucleotide encoding the polypeptide exhibiting the same/similar activity as the polypeptide into a host cell.
  • the foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same/similar activity as the polypeptide.
  • the method used for the introduction can be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to generate a polypeptide and increase its activity.
  • Codon optimization of the polynucleotide encoding the polypeptide is codon-optimized so that the transcription or translation of the endogenous polynucleotide is increased in the host cell, or the transcription and translation of the foreign polynucleotide is optimized in the host cell. It may be that its codons are optimized so that the
  • Selecting an exposed site by analyzing the tertiary structure of the polypeptide and modifying or chemically modifying it for example, compares the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored to determine the degree of sequence similarity. Accordingly, it may be to determine a template protein candidate, check the structure based on this, and select an exposed site to be modified or chemically modified and modified or modified.
  • Such enhancement of polypeptide activity is to increase the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild-type or unmodified microbial strain, or increase the amount of product produced from the polypeptide.
  • the present invention is not limited thereto.
  • Modification of some or all of the polynucleotide in the microorganism of the present application is (a) homologous recombination using a vector for chromosomal insertion in the microorganism or engineered nuclease (e.g., CRISPR) -Cas9) and/or (b) induced by light and/or chemical treatment such as ultraviolet and radiation, but not limited thereto.
  • the method for modifying part or all of the gene may include a method by DNA recombination technology.
  • a part or all of the gene may be deleted.
  • the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
  • Corynebacterium glutamicum strain comprising a mutant or polynucleotide of the present application (eg, one selected from the group consisting of (1) to (19) above) It provides a method for producing L-amino acids, comprising the step of culturing in a medium (for example, one or more or two or more) protein variants or a strain comprising a polynucleotide encoding the variant.
  • a medium for example, one or more or two or more
  • it may provide a method for producing L- amino acids, comprising the step of culturing the Corynebacterium glutamicum strain of the present application in a medium.
  • the L-amino acid production method of the present application is a medium of the Corynebacterium glutamicum (or Corynebacterium glutamicum comprising the mutant of the present application or the polynucleotide of the present application or the vector of the present application) of the present application. It may include the step of culturing in
  • L-amino acid of the present application may be L-lysine.
  • the term "cultivation” means growing the Corynebacterium glutamicum strain of the present application under moderately controlled environmental conditions.
  • the culture process of the present application may be performed according to a suitable medium and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art according to the selected strain.
  • the culture may be a batch, continuous and/or fed-batch, but is not limited thereto.
  • the term "medium” refers to a material in which nutrients required for culturing the Corynebacterium glutamicum strain of the present application are mixed as a main component, and nutrients including water essential for survival and growth and growth factors.
  • any medium and other culture conditions used for culturing the Corynebacterium glutamicum strain of the present application may be used without any particular limitation as long as it is a medium used for culturing conventional microorganisms, but the Corynebacterium glutamicum of the present application Lium glutamicum strain can be cultured while controlling the temperature, pH, etc. under aerobic conditions in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid and / or vitamin and the like.
  • the culture medium for the Corynebacterium sp. strain can be found in the literature ["Manual of Methods for General Bacteriology” by the American Society for Bacteriology (Washington D.C., USA, 1981)].
  • the carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, and the like; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine
  • organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract
  • the phosphorus may include potassium first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto.
  • potassium first potassium phosphate potassium phosphate
  • second potassium phosphate or a sodium-containing salt corresponding thereto.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, the present invention is not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium.
  • an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without or without gas to maintain anaerobic and microaerobic conditions, it is not
  • the culture temperature may be maintained at 20 to 45° C., specifically, 25 to 40° C., and may be cultured for about 10 to 160 hours, but is not limited thereto.
  • the L-amino acid produced by the culture of the present application may be secreted into the medium or may remain in the cell.
  • the L-amino acid production method of the present application includes the steps of preparing the Corynebacterium glutamicum strain of the present application, preparing a medium for culturing the strain, or a combination thereof (regardless of the order, in any order) ), for example, prior to the culturing step, may further include.
  • the method for producing L-amino acids of the present application may further include recovering L-amino acids from the culture medium (the culture medium) or the Corynebacterium glutamicum strain.
  • the recovering step may be further included after the culturing step.
  • the recovery may be to collect the desired L-amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method, etc. .
  • a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method, etc. .
  • chromatography such as island chromatography, HPLC, or a combination thereof may be used, and a desired L-amino acid may be recovered from a medium or a microorganism using a suitable method known in the art.
  • the L-amino acid production method of the present application may include an additional purification step.
  • the purification may be performed using a suitable method known in the art.
  • the recovery step and the purification step are performed continuously or discontinuously, regardless of the order, or integrated into one step may be performed, but is not limited thereto.
  • variants, polynucleotides, vectors, strains, and the like are as described in the other aspects above.
  • Another aspect of the present application is a variant of the present application, a polynucleotide encoding the variant, a vector including the polynucleotide or a Corynebacterium glutamicum strain comprising the polynucleotide of the present application; the culture medium; Or to provide a composition for producing L- amino acids comprising a combination of two or more of them.
  • composition of the present application may further include any suitable excipients commonly used in compositions for the production of amino acids, and these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc.
  • excipients commonly used in compositions for the production of amino acids
  • these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc.
  • the present invention is not limited thereto.
  • composition of the present application variants, polynucleotides, vectors, strains, media and L-amino acids are the same as those described in the other aspects above.
  • FIG. 1 is a schematic diagram of a pDCM2 plasmid.
  • a plasmid (pDCM2, FIG. 1, SEQ ID NO: 173) for the insertion and replacement of genes in the Corynebacterium chromosome was designed, and the plasmid was synthesized using the Gene-synthesis service of Bionics Co., Ltd.
  • a plasmid was designed to include a restriction enzyme that is easy to use for cloning with reference to a generally known sacB system related paper [Gene, 145 (1994) 69-73].
  • the thus synthesized pDCM2 plasmid has the following characteristics.
  • Example 2 Construction of a vector for the expression of endogenous membrane transport protein mutants in microorganisms
  • a mutant (F220C; SEQ ID NO: 1) in which phenylalanine (Phe) at position 220 of the amino acid sequence (SEQ ID NO: 3) of the integral membrane transport protein is substituted with a cysteine (Cys) amino acid produces L-lysine
  • the vector was prepared as follows.
  • PCR was performed using a primer pair of sequences of SEQ ID NOs: 77 and 78 and a pair of primers of sequences of SEQ ID NOs: 79 and 80 using gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13032 as a template, respectively.
  • gDNA genomic DNA
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 77 and SEQ ID NO: 80 to obtain a fragment.
  • PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCgl2816 (F220C). The sequences of the primers used in this Example are shown in Table 5 below.
  • Example 3 immanence membrane transport protein a variant L- of the expressing microorganism lysine Productivity evaluation
  • the vector prepared in Example 2 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • CJ3P_NCgl2816_F220C (or CA01-7531), which is an international depository organization under the Budapest Treaty, the Korea Microorganism Conservation Center. It was deposited with the (Korean Culture Center of Microorganisms, KCCM) on December 22, 2020 and was given the deposit number KCCM12904P.
  • the sequences of the primers used in this Example are shown in Table 6 below.
  • the L-lysine production capacity was analyzed by evaluating the flask fermentation titer of each strain and the control parent strain prepared in 3-1 above.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured with shaking at 30° C. for 72 hours at 200 rpm.
  • the production ability of L- lysine was measured by HPLC. Lysine concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 7 below.
  • Example 4 Construction of a vector for expression of DNA polymerase III gamma and tau subunit variants in microorganisms
  • a mutant (P43L; SEQ ID NO: 5) was prepared as follows to determine the effect of L- lysine production vector for the production of its expression strain.
  • PCR was performed using a primer pair of sequences of SEQ ID NOs: 83 and 84 and a pair of primers of sequences of SEQ ID NOs: 85 and 86 using gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13032 as a template, respectively.
  • gDNA genomic DNA
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 83 and SEQ ID NO: 86 to obtain a fragment.
  • PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-dnaZX (P43L). The sequences of the primers used in this Example are shown in Table 8 below.
  • Example 5 DNA polymerase III gamma and tau sub unit a variant L- of the expressing microorganism lysine productivity evaluation
  • the vector prepared in Example 4 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • CJ3P_dnaZX_P43L or CA01-7532
  • Korea Microorganism Conservation Center an international depository under the Budapest Treaty ( It was deposited at the Korean Culture Center of Microorganisms (KCCM) on December 2, 2020 and was given the deposit number KCCM12869P.
  • the sequences of the primers used in this Example are shown in Table 9 below.
  • the L-lysine production capacity was analyzed by evaluating the flask fermentation titer of each strain and the control parent strain prepared in 5-1 above.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured with shaking at 30° C. for 72 hours at 200 rpm.
  • the production capacity of L-lysine was measured by HPLC. The lysine concentration and the concentration increase rate in the culture medium for each strain tested are shown in Table 10 below.
  • PCR was performed using the primer pair of SEQ ID NOs: 89 and 90 and the primer pair of SEQ ID NOs: 91 and 92 using gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13032 as a template, respectively.
  • gDNA genomic DNA
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 89 and SEQ ID NO: 92 to obtain a fragment.
  • PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCgl3069(C33S). The sequences of the primers used in this Example are shown in Table 11 below.
  • Example 7 Protein a variant L- of the expressing microorganism lysine productivity evaluation
  • the vector prepared in Example 6 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • CJ3P_NCgl3069_C33S (or CA01-7533), which is an international depository organization under the Budapest Treaty, the Korea Microorganism Conservation Center. It was deposited with (Korean Culture Center of Microorganisms, KCCM) on December 22, 2020 and was given deposit number KCCM12905P.
  • the sequences of the primers used in this Example are shown in Table 12 below.
  • the L-lysine production capacity was analyzed by evaluating the flask fermentation titer of each strain and the control parent strain prepared in 7-1 above.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured with shaking at 30° C. for 72 hours at 200 rpm.
  • the production ability of L- lysine was measured by HPLC. Lysine concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 13 below.
  • CJ3P_NCgl3069_C33S strain exhibited increased L-lysine production compared to the control.
  • Example 8 Construction of a vector for expression of transcriptional anti-termination protein mutants in microorganisms
  • a mutant (N210D; SEQ ID NO: 13) in which asparagine (Asn) at position 210 of the amino acid sequence (SEQ ID NO: 15) of the transcription antitermination protein is substituted with an aspartic acid (Asp) amino acid is used in L-lysine production
  • a vector for the production of an expression strain thereof was prepared as follows.
  • PCR was performed using a primer pair of sequences of SEQ ID NOs: 95 and 96 and a pair of primers of sequences of SEQ ID NOs: 97 and 98, respectively.
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 95 and SEQ ID NO: 98 to obtain a fragment.
  • PCR was repeated 30 times for 30 seconds at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NusG (N210D). The sequences of the primers used in this Example are shown in Table 14 below.
  • Example 9 Warrior anti-termination protein a variant L- of the expressing microorganism lysine productivity evaluation
  • the vector prepared in Example 8 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • CJ3P_NusG_N210D (or CA01-7534), which is an international depository organization under the Budapest Treaty, Korea Center for Conservation of Microorganisms. It was deposited with the (Korean Culture Center of Microorganisms, KCCM) on December 2, 2020 and was given deposit number KCCM12870P.
  • the sequences of the primers used in this Example are shown in Table 15 below.
  • the L-lysine production capacity was analyzed by evaluating the flask fermentation titer of each strain and the control parent strain prepared in 9-1 above.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured with shaking at 30° C. for 72 hours at 200 rpm.
  • the production ability of L- lysine was measured by HPLC. The lysine concentration and the concentration increase rate in the culture medium for each strain tested are shown in Table 16 below.
  • a mutant (V199M; SEQ ID NO: 17) in which valine (Val) at position 199 of the amino acid sequence (SEQ ID NO: 19) of the ABC transporter ATP-binding protein is substituted with a methionine (Met) amino acid was prepared as follows.
  • PCR was performed using a pair of primers of SEQ ID NOs: 101 and 102 and a pair of primers of SEQ ID NOs: 103 and 104 using gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13032 as a template, respectively.
  • gDNA genomic DNA
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 101 and SEQ ID NO: 104 to obtain a fragment.
  • PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-Ncgl0636 (V199M). The sequences of the primers used in this Example are shown in Table 17 below.
  • Example 11 ABC transporter ATP-binding protein a variant L-Lysine of the expressing microorganism productivity evaluation
  • the vector prepared in Example 10 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • CJ3P_Ncgl0636_V199M (or CA01-7535), which is an international depository institution under the Budapest Treaty, the Korea Microorganism Conservation Center. It was deposited with (Korean Culture Center of Microorganisms, KCCM) on December 2, 2020 and was given deposit number KCCM12871P.
  • the sequences of the primers used in this Example are shown in Table 18 below.
  • NCgl0636_5F GGCCCCAACGGATGCGGCAAA
  • NCgl0636_6R AGTAGGTGCGCATGACGCCGC
  • L-lysine-producing ability was analyzed through flask fermentation titer evaluation of each strain and control parent strain prepared in 11-1 above.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured with shaking at 30° C. for 72 hours at 200 rpm.
  • the production ability of L- lysine was measured by HPLC. The lysine concentration and the concentration increase rate in the culture medium for each strain tested are shown in Table 19 below.
  • CJ3P_Ncgl0636_V199M strain exhibited increased L-lysine production compared to the control group.
  • T272I A mutant (T272I; SEQ ID NO: 21) in which threonine (Thr) at position 272 of the amino acid sequence of malate dehydrogenase (SEQ ID NO: 23) is substituted with an isoleucine (Ile) amino acid (T272I; SEQ ID NO: 21) is in the production of L-lysine
  • a vector for the production of an expression strain thereof was prepared as follows.
  • PCR was performed using a primer pair of SEQ ID NOs: 107 and 108 and a pair of primers of SEQ ID NOs: 109 and 110, respectively.
  • overlapping PCR was performed again using a primer pair of SEQ ID NO: 107 and SEQ ID NO: 110 to obtain a fragment.
  • PCR was repeated 30 times for 30 seconds at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCgl2297(T272I). The sequences of the primers used in this Example are shown in Table 20 below.
  • Example 13 malate dehydrogenase a variant L- of the expressing microorganism lysine productivity evaluation
  • the vector prepared in Example 12 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • the strain that has undergone homologous recombination using the primer pair of SEQ ID NOs: 111 and 112 is selected and named CJ3P_NCgl2297_T272I (or CA01-7537), which is an international depository institution under the Budapest Treaty, the Korea Microorganism Conservation Center It was deposited with the (Korean Culture Center of Microorganisms, KCCM) on December 22, 2020 and was given the deposit number KCCM12907P.
  • the sequences of the primers used in this Example are shown in Table 21 below.
  • the L-lysine production capacity was analyzed by evaluating the flask fermentation titer of each strain and the control parent strain prepared in 13-1 above.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured with shaking at 30° C. for 72 hours at 200 rpm.
  • the production ability of L- lysine was measured by HPLC. Lysine concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 22 below.
  • Example 14 Construction of a vector for the expression of primosome assembly protein variants in microorganisms
  • PCR was performed, respectively.
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 113 and SEQ ID NO: 116 to obtain a fragment.
  • PCR was repeated 30 times for 30 seconds at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCgl1540 (R304Q). The sequences of the primers used in this Example are shown in Table 23 below.
  • Example 15 Primosome assembly protein a variant L- of the expressing microorganism lysine Productivity evaluation
  • the vector prepared in Example 14 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • CJ3P_NCgl1540_R304Q (or CA01-7539), which is an international depository organization under the Budapest Treaty, the Korea Microorganism Conservation Center. It was deposited with the (Korean Culture Center of Microorganisms, KCCM) on December 22, 2020 and was given deposit number KCCM12908P.
  • the sequences of the primers used in this Example are shown in Table 24 below.
  • the L-lysine production ability was analyzed by evaluating the flask fermentation titer of each strain and the control parent strain prepared in 15-1 above.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured at 30° C. for 72 hours with shaking at 200 rpm.
  • the production ability of L- lysine was measured by HPLC. The lysine concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 25 below.
  • CJ3P_NCgl1540_R304Q strain exhibited increased L-lysine production compared to the control group.
  • Example 16 Construction of a vector for expression of type II citrate synthase mutants in microorganisms
  • a vector for the production of an expression strain thereof was produced as follows using the plasmid pDCM2 (Korea Patent Publication No. 10-2020-0136813) for the insertion and replacement of genes in the Corynebacterium chromosome did.
  • gDNA genomic DNA
  • SEQ ID NOs: 119 and SEQ ID NO: 120 primer pair of SEQ ID NOs: 119 and 120 and a pair of primers of SEQ ID NOs: 121 and 122, respectively.
  • overlapping PCR was performed again to obtain a fragment.
  • PCR was repeated 30 times for 30 seconds at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCgl0795 (A169V). The sequences of the primers used in this Example are shown in Table 26 below.
  • Example 17 Type II citrate synthase a variant L-Lysine of the expressing microorganism productivity evaluation
  • the vector prepared in Example 16 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • the L-lysine production capacity was analyzed by evaluating the flask fermentation titer of each strain and the control parent strain prepared in 17-1 above.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured at 30° C. for 72 hours with shaking at 200 rpm.
  • the production ability of L- lysine was measured by HPLC. The lysine concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 28 below.
  • CJ3P_NCgl0795_A169V strain exhibited increased L-lysine production compared to the control.
  • Example 18 Construction of a vector for the expression of mutant TerC membrane protein in microorganisms
  • PCR was performed using the primer pair of the sequences of SEQ ID NOs: 125 and 126 and the primer pair of the sequences of SEQ ID NOs: 127 and 128 using gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13032 as a template, respectively.
  • gDNA genomic DNA
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 125 and SEQ ID NO: 128 to obtain a fragment.
  • PCR was repeated 30 times for 30 seconds at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCg1892 (E294K). The sequences of the primers used in this Example are shown in Table 29 below.
  • Example 19 membrane protein TerC a variant L- of the expressing microorganism lysine productivity evaluation
  • the vector prepared in Example 18 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • L-lysine-producing ability was analyzed through flask fermentation titer evaluation of each strain and control parent strain prepared in 19-1 above.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured at 30° C. for 72 hours with shaking at 200 rpm.
  • the production ability of L- lysine was measured by HPLC. Lysine concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 31 below.
  • Example 20 Construction of a vector for the expression of mycothione reductase mutants in microorganisms
  • PCR was performed using the primer pair of the sequences of SEQ ID NOs: 131 and 132 and the primer pairs of the sequences of SEQ ID NOs: 133 and 134 using gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13032 as a template, respectively.
  • gDNA genomic DNA
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 5 and SEQ ID NO: 8 to obtain a fragment.
  • PCR was repeated 30 times for 30 seconds at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCgl1928 (P358S). The sequences of the primers used in this Example are shown in Table 32 below.
  • Example 21 Mycothion reductase a variant L- of the expressing microorganism lysine productivity evaluation
  • the vector prepared in Example 20 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • the L-lysine production capacity was analyzed by evaluating the flask fermentation titer of each strain and the control parent strain prepared in 20-1 above.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured at 30° C. for 72 hours with shaking at 200 rpm.
  • the production ability of L- lysine was measured by HPLC. Lysine concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 34 below.
  • CJ3P_NCgl1928_P358S strain exhibited increased L-lysine production compared to the control.
  • Example 22 Construction of a vector for the expression of component variants of Co/Zn/Cd efflux system in microorganisms
  • Mutant (G130D; sequence) in which glycine (Gly) at position 130 of the amino acid sequence (SEQ ID NO: 43) of Co/Zn/Cd efflux system component is substituted with aspartic acid (Asp) amino acid No. 41) to determine the effect of L- lysine production of the vector for the production of its expression strain plasmid pDCM2 for the insertion and replacement of genes in the Corynebacterium chromosome (Korea Patent Publication No. 10-2020-0136813) was prepared as follows.
  • PCR was performed. Using the mixture of the two fragments obtained above as a template, overlapping PCR was performed again using the primer pair of SEQ ID NO: 137 and SEQ ID NO: 140 to obtain a fragment. After denaturing at 94°C for 5 minutes, PCR was repeated 30 times for 30 seconds at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCgl1992 (G130D). The sequences of the primers used in this Example are shown in Table 35 below.
  • Example 23 Co/Zn/Cd Emission System Components a variant L-Lysine of the expressing microorganism productivity evaluation
  • the vector prepared in Example 22 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • the L-lysine production ability was analyzed by evaluating the flask fermentation titer of each strain and the control parent strain prepared in 23-1 above.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured at 30° C. for 72 hours with shaking at 200 rpm.
  • the production capacity of L-lysine was measured by HPLC. Lysine concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 37 below.
  • CJ3P_NCgl1992_G130D strain exhibited increased L-lysine production compared to the control.
  • Example 24 in microbes DAHP synthase variant Vector construction for expression
  • DAHP synthase (3-deoxy-D-arabinoheptulosonate-7-phosphate synthase) mutant (G382C; SEQ ID NO: 45) in which glycine (Gly) at position 382 of the amino acid sequence (SEQ ID NO: 47) is substituted with a cysteine (Cys) amino acid ) using plasmid pDCM2 (Korea Patent Publication No. 10-2020-0136813) for the insertion and replacement of genes in the Corynebacterium chromosome for the vector for the production of the expression strain to confirm the effect of L-lysine production
  • plasmid pDCM2 Korea Patent Publication No. 10-2020-0136813
  • PCR was performed using a pair of primers of SEQ ID NOs: 143 and 144 and a pair of primers of SEQ ID NOs: 145 and 146, respectively.
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 143 and SEQ ID NO: 146 to obtain a fragment.
  • PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with smal and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCgl2098 (G382C). The sequences of the primers used in this Example are shown in Table 38 below.
  • Example 25 DAHP synthase a variant L- of the expressing microorganism lysine productivity evaluation
  • the vector prepared in Example 24 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • the L-lysine production capacity was analyzed by evaluating the flask fermentation titer of each strain and control parent strain prepared in 25-1 above.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of the production medium was inoculated with 1 ml of the seed culture and cultured at 30° C. for 72 hours with shaking at 200 rpm.
  • the production ability of L- lysine was measured by HPLC. The lysine concentration and the concentration increase rate in the culture medium for each strain tested are shown in Table 40 below.
  • Example 26 Construction of a vector for expression of sugar phosphate isomerase/epimerase variants in microorganisms
  • a mutant (A321V; SEQ ID NO: 61) in which alanine (Ala) at position 321 of the amino acid sequence (SEQ ID NO: 63) of sugar phosphate isomerase / epimerase is substituted with valine (Val) amino acids
  • the vector for the production of its expression strain using the plasmid pDCM2 (Korea Patent Publication No. 10-2020-0136813) for the insertion and replacement of genes in the Corynebacterium chromosome It was prepared as follows.
  • PCR was performed using a pair of primers of SEQ ID NOs: 149 and 150 and a pair of primers of SEQ ID NOs: 151 and 152, respectively.
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 149 and SEQ ID NO: 152 to obtain a fragment.
  • PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with SmaI and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCgl0169 (A321V). The sequences of the primers used in this Example are shown in Table 41 below.
  • Example 27 sugar phosphate isomerase / epimurais a variant L- of the expressing microorganism lysine productivity evaluation
  • the vector prepared in Example 26 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • the L-lysine production ability was analyzed by evaluating the flask fermentation titer of the strain prepared in 27-1 and the control parent strain.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of the production medium was inoculated with 1 ml of the seed culture and cultured at 30° C. for 72 hours with shaking at 200 rpm.
  • the production capacity of L-lysine was measured by HPLC. Lysine concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 43 below.
  • CJ3P_NCgl0169_A321V strain exhibited increased L-lysine production compared to the control.
  • Example 28 in microbes cell breakdown membrane protein variant Vector construction for expression
  • a mutant (I307V; SEQ ID NO: 65) in which isoleucine (Ile) at position 307 of the amino acid sequence (SEQ ID NO: 67) of the cell division membrane protein is substituted with an amino acid valine (Val) was used in L-lysine production
  • a vector for the production of an expression strain thereof was prepared as follows using the plasmid pDCM2 (Korea Patent Publication No. 10-2020-0136813 No. 10-2020-0136813) for the insertion and replacement of genes in the Corynebacterium chromosome.
  • PCR was performed using a pair of primers of SEQ ID NOs: 155 and 156 and a pair of primers of SEQ ID NOs: 157 and 158, respectively.
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 155 and SEQ ID NO: 158 to obtain a fragment.
  • PCR was repeated 30 times for 30 seconds at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with SmaI and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCgl0043 (I307V). The sequences of the primers used in this Example are shown in Table 44 below.
  • Example 29 cell degradation membrane protein a variant L- of the expressing microorganism lysine productivity evaluation
  • the vector prepared in Example 28 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • the L-lysine production ability was analyzed by evaluating the flask fermentation titer of the strain prepared in 29-1 and the control parent strain.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured at 30° C. for 72 hours with shaking at 200 rpm.
  • the production capacity of L-lysine was measured by HPLC. Lysine concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 46 below.
  • CJ3P_NCgl0043_I307V strain exhibited an increased L-lysine production compared to the control.
  • Example 30 Construction of a vector for expression of protein variants in microorganisms
  • a vector for was prepared as follows using the plasmid pDCM2 (Korean Patent Publication No. 10-2020-0136813) for the insertion and replacement of genes in the Corynebacterium chromosome.
  • PCR was performed using a pair of primers of SEQ ID NOs: 161 and 162 and a pair of primers of SEQ ID NOs: 163 and 164, respectively.
  • overlapping PCR was performed again using the primer pair of SEQ ID NO: 161 and SEQ ID NO: 164 to obtain a fragment.
  • PCR was repeated 30 times for 30 seconds at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with SmaI and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCgl0752 (D676Y). The sequences of the primers used in this Example are shown in Table 47 below.
  • Example 31 protein a variant L- of the expressing microorganism lysine productivity evaluation
  • the vector prepared in Example 30 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • the L-lysine production ability was analyzed by evaluating the flask fermentation titer of the strain prepared in 31-1 and the control parent strain.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured at 30° C. for 72 hours, shaking at 200 rpm.
  • the production capacity of L-lysine was measured by HPLC. Lysine concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 49 below.
  • CJ3P_NCgl0752_D676Y strain exhibited increased L-lysine production compared to the control.
  • Example 32 Construction of a vector for the expression of a major promoter superfamily permease mutant in microorganisms
  • His histidine
  • Gln glutamine
  • PCR was performed using the primer pair of SEQ ID NOs: 167 and 168 and the primer pair of SEQ ID NOs: 169 and 170 using gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC13032 as a template, respectively.
  • gDNA genomic DNA
  • overlapping PCR was performed again using a primer pair of SEQ ID NO: 167 and SEQ ID NO: 170 to obtain a fragment.
  • PCR was repeated 30 times for 30 seconds at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the pDCM2 plasmid was treated with SmaI and the PCR product obtained above was fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDCM2-NCgl2592 (H377Q). The sequences of the primers used in this Example are shown in Table 50 below.
  • Example 33 main accelerator super family perme AIDS a variant L- of the expressing microorganism lysine productivity evaluation
  • the vector prepared in Example 32 was transformed into Corynebacterium glutamicum CJ3P (US 9556463 B2).
  • the L-lysine production ability was analyzed through the flask fermentation titer evaluation of the strain prepared in 33-1 and the control parent strain.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured at 30° C. for 72 hours, shaking at 200 rpm.
  • the production capacity of L-lysine was measured by HPLC. Lysine concentration and concentration increase rate in the culture medium for each strain tested are shown in Table 52 below.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 출원은 신규한 단백질 변이체, 상기 변이체를 포함하는 코리네박테리움 글루타미쿰 균주 및 상기 균주를 이용한 L-라이신 생산 방법에 관한 것이다.

Description

신규한 단백질 변이체 및 이를 이용한 L-라이신 생산 방법
본 출원은 신규한 단백질 변이체, 상기 변이체를 포함하는 코리네박테리움 글루타미쿰 균주 및 상기 균주를 이용한 L- 라이신 생산 방법에 관한 것이다.
L-아미노산 및 기타 유용물질을 생산하기 위하여, 고효율 생산 미생물 및 발효공정기술 개발을 위한 다양한 연구들이 수행되고 있다. 예를 들어, L-라이신 생합성에 관여하는 효소를 코딩하는 유전자의 발현을 증가시키거나 또는 생합성에 불필요한 유전자를 제거하는 것과 같은 목적 물질 특이적 접근 방법이 주로 이용되고 있다(WO2008-082181 A1).
다만, L-라이신의 수요 증가에 따라 효과적인 L-라이신의 생산능 증가를 위한 연구가 여전히 필요한 실정이다.
본 출원의 하나의 목적은 하기 (1) 내지 (19)로 이루어지는 군에서 선택되는 1종 이상 (예컨대, 1종 또는 2종 이상)의 단백질 변이체를 제공하는 것이다:
(1) 서열번호 3의 220번째 위치에 상응하는 아미노산인 페닐알라닌이 시스테인으로 치환된, 서열번호 1로 기재된 아미노산 서열로 이루어진 내재성 막 수송 단백질 변이체;
(2) 서열번호 7의 43번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 5로 기재된 아미노산 서열로 이루어진 DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 변이체;
(3) 서열번호 11의 33번째 위치에 상응하는 아미노산인 시스테인이 세린으로 치환된, 서열번호 9로 기재된 아미노산 서열로 이루어진 단백질 변이체;
(4) 서열번호 15의 210번째 위치에 상응하는 아미노산인 아스파라긴이 아스파르트산으로 치환된, 서열번호 13로 기재된 아미노산 서열로 이루어진 전사 안티터미네이션 단백질 변이체;
(5) 서열번호 19의 199번째 위치에 상응하는 아미노산인 발린이 메티오닌으로 치환된, 서열번호 17로 기재된 아미노산 서열로 이루어진 ABC 트랜스포터 ATP-결합 단백질 변이체;
(6) 서열번호 23의 272번째 위치에 상응하는 아미노산인 트레오닌이 이소류신으로 치환된, 서열번호 21로 기재된 아미노산 서열로 이루어진 말레이트 디하이드로게나제 변이체;
(7) 서열번호 27의 304번째 위치에 상응하는 아미노산인 아르기닌이 글루타민으로 치환된, 서열번호 25로 기재된 아미노산 서열로 이루어진 프리모솜 조립 단백질 변이체;
(8) 서열번호 31의 169번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 29로 기재된 아미노산 서열로 이루어진 타입 II 시트레이트 신타아제 변이체;
(9) 서열번호 35의 294번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 33로 기재된 아미노산 서열로 이루어진 막 단백질 변이체;
(10) 서열번호 39의 358번째 위치에 상응하는 아미노산인 프롤린이 세린으로 치환된, 서열번호 37로 기재된 아미노산 서열로 이루어진 미코티온 리덕타제 변이체;
(11) 서열번호 43의 130번째 위치에 상응하는 아미노산인 글리신이 아스파르트산으로 치환된, 서열번호 41로 기재된 아미노산 서열로 이루어진 Co/Zn/Cd 유출 시스템 컴포넌트 변이체;
(12) 서열번호 47의 382번째 위치에 상응하는 아미노산인 글리신이 시스테인으로 치환된, 서열번호 45으로 기재된 아미노산 서열로 이루어진 DAHP 신타아제 변이체;
(13) 서열번호 51의 209번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 49로 기재된 아미노산 서열로 이루어진 N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제 변이체;
(14) 서열번호 55의 592번째 위치에 상응하는 아미노산인 티로신이 페닐알라닌으로 치환된, 서열번호 53으로 기재된 아미노산 서열로 이루어진 헬리카제 변이체;
(15) 서열번호 59의 170번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 57로 기재된 아미노산 서열로 이루어진 단백질 변이체;
(16) 서열번호 63의 321번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 61로 기재된 아미노산 서열로 이루어진 당 인산염 이성질화효소/에피머레이즈 변이체;
(17) 서열번호 67의 307번째 위치에 상응하는 아미노산인 이소류신이 발린으로 치환된, 서열번호 65로 기재된 아미노산 서열로 이루어진 세포분해 막단백질 변이체;
(18) 서열번호 71의 676번째 위치에 상응하는 아미노산인 아스파트산이 타이로신으로 치환된, 서열번호 69로 기재된 아미노산 서열로 이루어진 단백질 변이체; 및
(19) 서열번호 75의 377번째 위치에 상응하는 아미노산인 히스티딘이 글루타민으로 치환된, 서열번호 73로 기재된 아미노산 서열로 이루어진 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체.
본 출원의 다른 하나의 목적은 본 출원의 변이체를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 하기 (1) 내지 (19)로 이루어지는 군에서 선택된 1종 이상 (예컨대, 1종 또는 2종 이상)의 단백질 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하고, L-라이신 생산능을 가진, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 균주를 제공하는 것이다:
(1) 서열번호 3의 220번째 위치에 상응하는 아미노산인 페닐알라닌이 시스테인으로 치환된, 서열번호 1로 기재된 아미노산 서열로 이루어진 내재성 막 수송 단백질 변이체;
(2) 서열번호 7의 43번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 5로 기재된 아미노산 서열로 이루어진 DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 변이체;
(3) 서열번호 11의 33번째 위치에 상응하는 아미노산인 시스테인이 세린으로 치환된, 서열번호 9로 기재된 아미노산 서열로 이루어진 단백질 변이체;
(4) 서열번호 15의 210번째 위치에 상응하는 아미노산인 아스파라긴이 아스파르트산으로 치환된, 서열번호 13로 기재된 아미노산 서열로 이루어진 전사 안티터미네이션 단백질 변이체;
(5) 서열번호 19의 199번째 위치에 상응하는 아미노산인 발린이 메티오닌으로 치환된, 서열번호 17로 기재된 아미노산 서열로 이루어진 ABC 트랜스포터 ATP-결합 단백질 변이체;
(6) 서열번호 23의 272번째 위치에 상응하는 아미노산인 트레오닌이 이소류신으로 치환된, 서열번호 21로 기재된 아미노산 서열로 이루어진 말레이트 디하이드로게나제 변이체;
(7) 서열번호 27의 304번째 위치에 상응하는 아미노산인 아르기닌이 글루타민으로 치환된, 서열번호 25로 기재된 아미노산 서열로 이루어진 프리모솜 조립 단백질 변이체;
(8) 서열번호 31의 169번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 29로 기재된 아미노산 서열로 이루어진 타입 II 시트레이트 신타아제 변이체;
(9) 서열번호 35의 294번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 33로 기재된 아미노산 서열로 이루어진 막 단백질 변이체;
(10) 서열번호 39의 358번째 위치에 상응하는 아미노산인 프롤린이 세린으로 치환된, 서열번호 37로 기재된 아미노산 서열로 이루어진 미코티온 리덕타제 변이체;
(11) 서열번호 43의 130번째 위치에 상응하는 아미노산인 글리신이 아스파르트산으로 치환된, 서열번호 41로 기재된 아미노산 서열로 이루어진 Co/Zn/Cd 유출 시스템 컴포넌트 변이체;
(12) 서열번호 47의 382번째 위치에 상응하는 아미노산인 글리신이 시스테인으로 치환된, 서열번호 45으로 기재된 아미노산 서열로 이루어진 DAHP 신타아제 변이체;
(13) 서열번호 51의 209번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 49로 기재된 아미노산 서열로 이루어진 N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제 변이체;
(14) 서열번호 55의 592번째 위치에 상응하는 아미노산인 티로신이 페닐알라닌으로 치환된, 서열번호 53으로 기재된 아미노산 서열로 이루어진 헬리카제 변이체;
(15) 서열번호 59의 170번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 57로 기재된 아미노산 서열로 이루어진 단백질 변이체;
(16) 서열번호 63의 321번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 61로 기재된 아미노산 서열로 이루어진 당 인산염 이성질화효소/에피머레이즈 변이체;
(17) 서열번호 67의 307번째 위치에 상응하는 아미노산인 이소류신이 발린으로 치환된, 서열번호 65로 기재된 아미노산 서열로 이루어진 세포분해 막단백질 변이체;
(18) 서열번호 71의 676번째 위치에 상응하는 아미노산인 아스파트산이 타이로신으로 치환된, 서열번호 69로 기재된 아미노산 서열로 이루어진 단백질 변이체; 및
(19) 서열번호 75의 377번째 위치에 상응하는 아미노산인 히스티딘이 글루타민으로 치환된, 서열번호 73로 기재된 아미노산 서열로 이루어진 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체.
본 출원의 또 다른 하나의 목적은 본 출원의 코리네박테리움 글루타미쿰 균주를 배지에서 배양하는 단계를 포함하는, L-라이신 생산 방법을 제공하는 것이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 출원의 하나의 양태는 본 출원의 하나의 목적은 하기 (1) 내지 (19)로 이루어지는 군에서 선택되는 1종 이상 (예컨대, 1종 또는 2종 이상)의 단백질 변이체를 제공하는 것이다:
(1) 서열번호 3의 220번째 위치에 상응하는 아미노산인 페닐알라닌이 시스테인으로 치환된, 서열번호 1로 기재된 아미노산 서열로 이루어진 내재성 막 수송 단백질 변이체;
(2) 서열번호 7의 43번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 5로 기재된 아미노산 서열로 이루어진 DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 변이체;
(3) 서열번호 11의 33번째 위치에 상응하는 아미노산인 시스테인이 세린으로 치환된, 서열번호 9로 기재된 아미노산 서열로 이루어진 단백질 변이체;
(4) 서열번호 15의 210번째 위치에 상응하는 아미노산인 아스파라긴이 아스파르트산으로 치환된, 서열번호 13로 기재된 아미노산 서열로 이루어진 전사 안티터미네이션 단백질 변이체;
(5) 서열번호 19의 199번째 위치에 상응하는 아미노산인 발린이 메티오닌으로 치환된, 서열번호 17로 기재된 아미노산 서열로 이루어진 ABC 트랜스포터 ATP-결합 단백질 변이체;
(6) 서열번호 23의 272번째 위치에 상응하는 아미노산인 트레오닌이 이소류신으로 치환된, 서열번호 21로 기재된 아미노산 서열로 이루어진 말레이트 디하이드로게나제 변이체;
(7) 서열번호 27의 304번째 위치에 상응하는 아미노산인 아르기닌이 글루타민으로 치환된, 서열번호 25로 기재된 아미노산 서열로 이루어진 프리모솜 조립 단백질 변이체;
(8) 서열번호 31의 169번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 29로 기재된 아미노산 서열로 이루어진 타입 II 시트레이트 신타아제 변이체;
(9) 서열번호 35의 294번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 33로 기재된 아미노산 서열로 이루어진 막 단백질 변이체;
(10) 서열번호 39의 358번째 위치에 상응하는 아미노산인 프롤린이 세린으로 치환된, 서열번호 37로 기재된 아미노산 서열로 이루어진 미코티온 리덕타제 변이체;
(11) 서열번호 43의 130번째 위치에 상응하는 아미노산인 글리신이 아스파르트산으로 치환된, 서열번호 41로 기재된 아미노산 서열로 이루어진 Co/Zn/Cd 유출 시스템 컴포넌트 변이체;
(12) 서열번호 47의 382번째 위치에 상응하는 아미노산인 글리신이 시스테인으로 치환된, 서열번호 45으로 기재된 아미노산 서열로 이루어진 DAHP 신타아제 변이체;
(13) 서열번호 51의 209번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 49로 기재된 아미노산 서열로 이루어진 N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제 변이체;
(14) 서열번호 55의 592번째 위치에 상응하는 아미노산인 티로신이 페닐알라닌으로 치환된, 서열번호 53으로 기재된 아미노산 서열로 이루어진 헬리카제 변이체;
(15) 서열번호 59의 170번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 57로 기재된 아미노산 서열로 이루어진 단백질 변이체;
(16) 서열번호 63의 321번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 61로 기재된 아미노산 서열로 이루어진 당 인산염 이성질화효소/에피머레이즈 변이체;
(17) 서열번호 67의 307번째 위치에 상응하는 아미노산인 이소류신이 발린으로 치환된, 서열번호 65로 기재된 아미노산 서열로 이루어진 세포분해 막단백질 변이체;
(18) 서열번호 71의 676번째 위치에 상응하는 아미노산인 아스파트산이 타이로신으로 치환된, 서열번호 69로 기재된 아미노산 서열로 이루어진 단백질 변이체; 및
(19) 서열번호 75의 377번째 위치에 상응하는 아미노산인 히스티딘이 글루타민으로 치환된, 서열번호 73로 기재된 아미노산 서열로 이루어진 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체.
본 출원의 변이체는 서열번호 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61, 65, 69, 및 73으로 이루어지는 군에서 선택된 1종 이상 (예컨대, 1종 또는 2종 이상)의 서열번호로 기재된 아미노산 서열을 가지거나 포함하거나, 상기 아미노산 서열로 필수적으로 이루어질(essentially consisting of) 수 있다.
또한, 본 출원의 변이체는 상기 서열번호 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61, 65, 69, 또는 73로 기재된 아미노산 서열에서 각각 서열번호 3, 7, 11, 15, 19, 23, 27, 31, 35, 39, 43, 47, 51, 55, 59, 63, 67, 71, 또는 75의 아미노산 서열을 기준으로 각각 220번, 43번, 33번, 210번, 199번, 272번, 304번, 169번, 294번, 358번, 130번, 382번, 209번, 592번, 170번, 321번, 307번, 676번, 또는 377번 위치에 상응하는 아미노산은 시스테인, 류신, 세린, 아스파르트산, 메티오닌, 이소류신, 글루타민, 발린, 라이신, 세린, 아스파르트산, 시스테인, 류신, 페닐알라닌, 라이신, 발린, 발린, 타이로신, 또는 글루타민이고, 상기 서열번호 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61, 65, 69, 및 73로 이루어지는 군에서 선택된 서열번호로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 본 출원의 변이체의 각 아미노산 서열, 위치, 및 위치에 상응하는 아미노산 종류에 대한 대응관계를 하기 표 1에 나타내었다. 또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 변이체에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 변이체도 본 출원의 범위 내에 포함됨은 자명하다.
　 아미노산 서열 위치를 카운팅하기 위해 기준이 되는 아미노산 서열 위치 아미노산 종류
1 서열번호 1 서열번호 3 220 시스테인
2 서열번호 5 서열번호 7 43 류신
3 서열번호 9 서열번호 11 33 세린
4 서열번호 13 서열번호 15 210 아스파르트산
5 서열번호 17 서열번호 19 199 메티오닌
6 서열번호 21 서열번호 23 272 이소류신
7 서열번호 25 서열번호 27 304 글루타민
8 서열번호 29 서열번호 31 169 발린
9 서열번호 33 서열번호 35 294 라이신
10 서열번호 37 서열번호 39 358 세린
11 서열번호 41 서열번호 43 130 아스파르트산
12 서열번호 45 서열번호 47 382 시스테인
13 서열번호 49 서열번호 51 209 류신
14 서열번호 53 서열번호 55 592 페닐알라닌
15 서열번호 57 서열번호 59 170 라이신
16 서열번호 61 서열번호 63 321 발린
17 서열번호 65 서열번호 67 307 발린
18 서열번호 69 서열번호 71 676 타이로신
19 서열번호 63 서열번호 75 377 글루타민
예를 들어, 상기 아미노산 서열 N-말단, C-말단 그리고/또는 내부에 본 출원의 변이체의 기능을 변경하지 않는 서열 추가 또는 결실, 자연적으로 발생할 수 있는 돌연변이, 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다. 상기 “보존적 치환(conservative substitution)”은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.본 출원에서 용어, "변이체(variant)"는 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)되어 상기 변이체의 변이 전 아미노산 서열과 상이하나 기능(functions) 또는 특성(properties)이 유지되는 폴리펩티드를 지칭한다. 이러한 변이체는 일반적으로 상기 폴리펩티드의 아미노산 서열 중 하나 이상의 아미노산을 변형하고, 상기 변형된 폴리펩티드의 특성을 평가하여 동정(identify)될 수 있다. 즉, 변이체의 능력은 변이 전 폴리펩티드에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 또한, 일부 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이체를 포함할 수 있다. 다른 변이체는 성숙 단백질(mature protein)의 N- 및/또는 C-말단으로부터 일부분이 제거된 변이체를 포함할 수 있다. 상기 용어 “변이체”는 변이형, 변형, 변이형 폴리펩티드, 변이된 단백질, 변이 및 변이체 등의 용어(영문 표현으로는 modification, modified polypeptide, modified protein, mutant, mutein, divergent 등)가 혼용되어 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다. 본 출원의 목적상 상기 변이체는 서열번호 3, 7, 11, 15, 19, 23, 27, 31, 35, 39, 43, 47, 51, 55, 59, 63, 67, 71, 또는 75의 아미노산 서열의 220번째, 43번째, 33번째, 210번째, 199번째, 272번째, 304번째, 169번째, 294번째, 358번째, 130번째, 382번째, 209번째, 592번째, 170번째, 321번째, 307번째, 676번째, 또는 377번째 위치에 각각 상응하는 아미노산인 페닐알라닌, 프롤린, 시스테인, 아스파라긴, 발린, 트레오닌, 아르기닌, 알라닌, 글루탐산, 프롤린, 글리신, 글리신, 프롤린, 티로신, 글루탐산, 알라닌, 이소류신, 아스파트산, 또는 히스티딘이 시스테인, 류신, 세린, 아스파르트산, 메티오닌, 이소류신, 글루타민, 발린, 라이신, 세린, 아스파르트산, 시스테인, 류신, 페닐알라닌, 라이신, 발린, 발린, 타이로신, 또는 글루타민으로 각각 치환된, 서열번호 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61, 65, 69, 또는 73로 기재된 아미노산 서열을 포함하는 폴리펩티드일 수 있다. 본 출원의 변이체의 각 아미노산 서열, 변이 위치, 위치에 상응하는 치환 전 아미노산, 및 치환 후 아미노산 종류에 대한 대응관계를 하기 표 2에 나타내었다.
　 아미노산 서열 위치를 카운팅하기 위해 기준이 되는 아미노산 서열 변이 위치 치환 전 아미노산 종류 치환된 아미노산 종류
1 서열번호 1 서열번호 3 220 페닐알라닌 시스테인
2 서열번호 5 서열번호 7 43 프롤린 류신
3 서열번호 9 서열번호 11 33 시스테인 세린
4 서열번호 13 서열번호 15 210 아스파라긴 아스파르트산
5 서열번호 17 서열번호 19 199 발린 메티오닌
6 서열번호 21 서열번호 23 272 트레오닌 이소류신
7 서열번호 25 서열번호 27 304 아르기닌 글루타민
8 서열번호 29 서열번호 31 169 알라닌 발린
9 서열번호 33 서열번호 35 294 글루탐산 라이신
10 서열번호 37 서열번호 39 358 프롤린 세린
11 서열번호 41 서열번호 43 130 글리신 아스파르트산
12 서열번호 45 서열번호 47 382 글리신 시스테인
13 서열번호 49 서열번호 51 209 프롤린 류신
14 서열번호 53 서열번호 55 592 티로신 페닐알라닌
15 서열번호 57 서열번호 59 170 글루탐산 라이신
16 서열번호 61 서열번호 63 321 알라닌 발린
17 서열번호 65 서열번호 67 307 이소류신 발린
18 서열번호 69 서열번호 71 676 아스파트산 타이로신
19 서열번호 63 서열번호 75 377 히스티딘 글루타민
또한, 변이체는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 변이체의 N-말단에는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이동(translocation)에 관여하는 시그널(또는 리더) 서열이 컨쥬게이트 될 수 있다. 또한 상기 변이체는 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
본 출원에서 용어, ‘상동성 (homology)’ 또는 ‘동일성 (identity)’은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
본 출원의 일 예로, 본 출원의 변이체는 내재성 막 수송 단백질(integral membrane transport protein); DNA 중합효소 III 감마 및 타우 서브유닛(DNA polymerase III subunits gamma and tau); 서열번호 11의 아미노산 서열을 포함하는 폴리펩티드 및/또는 NCgl3069 유전자에 의해 코딩되는 단백질; 전사 안티터미네이션 단백질 (Transcription antitermination protein); ABC 트랜스포터 ATP-결합 단백질(ABC transporter ATP-binding protein); 말레이트 디하이드로게나제(malate dehydrogenase); 프리모솜 조립 단백질(primosome assembly protein); 타입 II 시트레이트 신타아제(type II citrate synthase); 막 단백질 (membrane protein, TerC); 미코티온 리덕타제(mycothione reductase); Co/Zn/Cd 유출 시스템 컴포넌트(Co/Zn/Cd efflux system component); DAHP 신타아제(3-deoxy-D-arabinoheptulosonate-7-phosphate synthase; DAHP synthase); N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제(N-succinyldiaminopimelate aminotransferase); 헬리카제(Helicase); 서열번호 59의 아미노산 서열을 포함하는 폴리펩티드 및/또는 NCgl1098 유전자에 의해 코딩되는 단백질; 당 인산염 이성질화효소/에피머레이즈; 세포분해 막단백질; 서열번호 71의 아미노산 서열을 포함하는 폴리펩티드 및/또는 NCgl0752 유전자에 의해 코딩되는 단백질; 및/또는 주요 촉진제 수퍼패밀리 퍼미에이즈의 활성을 가질 수 있다.
본 출원에서 용어, "내재성 막 수송 단백질(integral membrane transport protein)”는 생물학적 막(biological membrane)을 가로지르는 다른 단백질과 같은 거대분자(macromolecules), 소분자(small molecules), 및 이온(ions)의 이동에 관여하는, 생물학적 막에 부착되는 막 단백질이다. 구체적으로, 본 출원의 내재성 막 수송 단백질은 integral membrane transport protein로 혼용하여 사용될 수 있다. 본 출원에서 상기 내재성 막 수송 단백질은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. YP_227155.1, WP_011015489.1 일 수 있다. 구체적으로 NCgl2816 유전자에 의해 코딩되는 내재성 막 수송 단백질 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "DNA 중합효소 III 감마 및 타우 서브유닛(DNA polymerase III subunits gamma and tau)”는 DNA 복제를 담당하는 주요 효소로서, DNA 중합효소 III 타우 (tau) 서브유닛은 코어 (알파(alpha), 엡실론(epsilon), 및 세타(theta) 사슬로 구성됨)와 결합하여 코어를 이합체화시키는 역할을 하고, DNA 중합효소 Ⅲ 감마 서브유닛은 베타 서브유닛을 지연 가닥 (lagging strand)에 얻는 클램프 로더 역할을 하는 폴리펩티드이다. 구체적으로, 본 출원의 DNA 중합효소 Ⅲ 감마 및 타우 서브유닛은 DNA polymerase III gamma and tau subunits, 또는 DNA polymerase III subunit gamma/tau로 혼용하여 사용될 수 있다. 본 출원에서 상기 DNA 중합효소 III 감마 및 타우 서브유닛은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. YP_224542.1, WP_011013499.1일 수 있다. 구체적으로 dnaZX 유전자 (또는 NCgl0239 유전자)에 의해 코딩되는 DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "전사 안티터미네이션 단백질(transcription antitermination protein)"는 전사 복합체(transcription complex)이며, 종결 인자(termination factor) Rho 및 RNA 중합효소와 상호작용할 수 있으며, 전사 종결 및/또는 항-종결에 관여하는 전사 신장 인자(transcriptional elongation factor)인 폴리펩티드이다. 구체적으로, 본 출원의 전사 안티터미네이션 단백질은 transcription termination/antitermination protein, NusG 단백질, 또는 NusG 로 혼용하여 사용될 수 있다. 본 출원에서 상기 전사 안티터미네이션 단백질 는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. WP_011013678.1, YP_224775.1일 수 있다. 구체적으로 nusG 유전자 (또는 NCgl0458 유전자)에 의해 코딩되는 전사 안티터미네이션 단백질 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "ABC 트랜스포터 ATP-결합 단백질(ABC transporter ATP-binding protein)"는 막관통단백질로 ATP를 가수분해한 에너지를 사용하여 다양한 기질을 막을 넘기며 이동시키고/이동시키거나, 수송과 관련이 없는 DNA, RNA의 수리와 같은 생물학적인 기능을 하는 폴리펩티드이다. 구체적으로, 본 출원의 ABC 트랜스포터 ATP-결합 단백질은 ABC transporter ATP-binding protein로 혼용하여 사용될 수 있다. 본 출원에서 상기 ABC 트랜스포터 ATP-결합 단백질은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. WP_011013802.1, YP_224957.1일 수 있다. 구체적으로 NCgl0636 유전자에 의해 코딩되는 ABC 트랜스포터 ATP-결합 단백질 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, " N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제”는 L-glutamate 및 N-succinyl-2-amino-6-ketopimelate를 기질로 하여, 2-oxoglutarate 및 N-succinyl-L,L-2,6-diaminopimelate을 생산하는 라이신 생합성 경로에 관여하는 효소이다. 구체적으로, 본 출원의 N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제는 N-succinyldiaminopimelate aminotransferase로 혼용하여 사용될 수 있다. 본 출원에서 상기 N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. WP_011014123.1, YP_225395.1 일 수 있다. 구체적으로 NCgl1058 유전자 (또는 dapC 유전자)에 의해 코딩되는 N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "말레이트 디하이드로게나제”는 말레이트(malate, 말산)을 옥살아세트산으로 산화시키고, 이 과정에서 NAD+를 NADH로 환원시키는 반응을 가역적으로 촉매하는 효소이다. 구체적으로, 본 출원의 말레이트 디하이드로게나제는 malate dehydrogenase, MDH, 또는 말산 탈수소효소로 혼용하여 사용될 수 있다. 본 출원에서 상기 말레이트 디하이드로게나제는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. WP_011015079.1, YP_226625.1 일 수 있다. 구체적으로 NCgl2297 유전자 (또는 mdh 유전자)에 의해 코딩되는 말레이트 디하이드로게나제 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "프리모솜 조립 단백질”은 헬리카제(helicase) 활성을 가지는 단백질로 DNA replication 과정에 관여하는 단백질을 의미한다. 구체적으로, 본 출원의 프리모솜 조립 단백질은 primosome assembly protein, PriA 단백질, PriA, 또는 primosomal protein N'로 혼용하여 사용될 수 있다. 본 출원에서 상기 프리모솜 조립 단백질은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. WP_011014474.1, YP_225886.1 일 수 있다. 구체적으로 NCgl1540 유전자 (또는 priA 유전자)에 의해 코딩되는 프리모솜 조립 단백질 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, " 헬리카제(helicase)" 는 DNA 이중 나선 또는 자체 결합된 RNA 분자의 가닥을 분리할 수 있는 폴리펩티드이다. 구체적으로, 본 출원의 헬리카제는 helicase로 혼용하여 사용될 수 있다. 본 출원에서 상기 헬리카제는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. WP_011014500.1, YP_225922.1일 수 있다. 구체적으로 NCgl1575 유전자에 의해 코딩되는 헬리카제 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원의 타입 II 시트레이트 신타아제는 integral type II citrate synthase, 시트레이트 신타아제, 또는 citrate synthase로 혼용하여 사용될 수 있다. 본 출원에서 상기 타입 II 시트레이트 신타아제는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. YP_225121.1, WP_011013914.1 일 수 있다. 구체적으로 gltA 유전자(또는 NCgl0795 유전자)에 의해 코딩되는 타입 II 시트레이트 신타아제 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원의 막 단백질은 멤브레인 단백질, membrane protein, TerC, 또는 TerC 단백질로 혼용하여 사용될 수 있다. 본 출원에서 상기 막 단백질은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. YP_226209.1, WP_011014789.1 일 수 있다. 구체적으로 terC 유전자(또는 NCgl1892 유전자)에 의해 코딩되는 막 단백질 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원의 미코티온 리덕타제는 미코티온 환원효소, 또는 mycothione reductase로 혼용하여 사용될 수 있다. 본 출원에서 상기 미코티온 리덕타제는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. YP_226245.1, WP_011014816.1 일 수 있다. 구체적으로 mtr 유전자(또는 NCgl1928 유전자)에 의해 코딩되는 미코티온 리덕타제 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원의 Co/Zn/Cd 유출 시스템 컴포넌트는 Co/Zn/Cd efflux system component로 혼용하여 사용될 수 있다. 본 출원에서 상기 Co/Zn/Cd 유출 시스템 컴포넌트는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. YP_226309.1, WP_011014862.1일 수 있다. 구체적으로 NCgl1992 유전자에 의해 코딩되는 Co/Zn/Cd 유출 시스템 컴포넌트 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원의 DAHP 신타아제는 3-디옥시-D-아라비노헵툴로손산 7-인산 생성효소, 3-디옥시-D-아라비노헵툴로손산 7-인산 신타아제, 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase, 또는 DAHP synthase로 혼용하여 사용될 수 있다. 본 출원에서 상기 DAHP 신타아제는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. YP_226420.1, WP_011014936.1 일 수 있다. 구체적으로 aroG 유전자(또는 NCgl2098 유전자)에 의해 코딩되는 DAHP 신타아제 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "당 인산염 이성질화효소/에피머레이즈”는 sugar phosphate isomerase/epimerase, NCgl0169 단백질, 및/또는 NCgl0169로 혼용하여 사용될 수 있다. 본 출원에서 상기 당 인산염 이성질화효소/에피머레이즈는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. WP_011013444.1 일 수 있다. 구체적으로 NCgl0169 유전자에 의해 코딩되는 당 인산염 이성질화효소/에피머레이즈 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "세포분해 막단백질”은 세포 분할에 관여하는 효소이다. 구체적으로, 본 출원의 세포분해 막단백질은 cell division membrane protein, RodA 단백질, 또는 RodA로 혼용하여 사용될 수 있다. 본 출원에서 상기 세포분해 막단백질은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. WP_011013343.1 일 수 있다. 구체적으로 NCgl0043 유전자(또는 rodA 유전자)에 의해 코딩되는 세포분해 막단백질 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "주요 촉진제 수퍼패밀리 퍼미에이즈”는 화학요구적 구배에 반응하여 세포막을 가로 질러 작은 용질의 이동을 용이하게하는 막 수송 단백질의 수퍼 패밀리이다. 본 출원의 주요 촉진제 수퍼패밀리 퍼미에이즈는 major facilitator superfamily permease, LmrB 단백질, 또는 LmrB로 혼용하여 사용될 수 있다. 본 출원에서 상기 주요 촉진제 수퍼패밀리 퍼미에이즈는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있고, 예를 들면 GenBank Accession No. WP_011015308.1 일 수 있다. 구체적으로 NCgl2592 유전자(또는 lmrB 유전자)에 의해 코딩되는 주요 촉진제 수퍼패밀리 퍼미에이즈 활성을 갖는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원의 일 예로, 본 출원의 변이체는 야생형 폴리펩티드에 비해 L-라이신 생산능이 증가되도록 하는 활성을 가질 수 있다.
상기 내재성 막 수송 단백질; DNA 중합효소 Ⅲ 감마 및 타우 서브유닛; NCgl3069 유전자에 의해 코딩되는 단백질; 전사 안티터미네이션 단백질; ABC 트랜스포터 ATP-결합 단백질; 말레이트 디하이드로게나제; 프리모솜 조립 단백질; 타입 II 시트레이트 신타아제; 막 단백질; 미코티온 리덕타제; Co/Zn/Cd 유출 시스템 컴포넌트; DAHP 신타아제; N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제; 헬리카제; 서열번호 59의 아미노산 서열을 포함하는 폴리펩티드 및/또는 NCgl1098 유전자에 의해 코딩되는 단백질; 당 인산염 이성질화효소/에피머레이즈; 세포분해 막단백질; 서열번호 71의 아미노산 서열을 포함하는 폴리펩티드 및/또는 NCgl0752 유전자에 의해 코딩되는 단백질; 및 주요 촉진제 수퍼패밀리 퍼미에이즈의 야생형 폴리펩티드의 아미노산 서열 및 이를 코딩하는 핵산 서열의 일 예를 하기 표 3에 기재하였다.
단백질 아미노산 서열 단백질을 코딩하는 핵산 서열
내재성 막 수송 단백질 서열번호 3 서열번호 4
DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 서열번호 7 서열번호 8
NCgl3069 유전자에 의해 코딩되는 단백질 서열번호 11 서열번호 12
전사 안티터미네이션 단백질 서열번호 15 서열번호 16
ABC 트랜스포터 ATP-결합 단백질 서열번호 19 서열번호 20
말레이트 디하이드로게나제 서열번호 23 서열번호 24
프리모솜 조립 단백질 서열번호 27 서열번호 28
타입 II 시트레이트 신타아제 서열번호 31 서열번호 32
막 단백질 서열번호 35 서열번호 36
미코티온 리덕타제 서열번호 39 서열번호 40
Co/Zn/Cd 유출 시스템 컴포넌트 서열번호 43 서열번호 44
DAHP 신타아제 서열번호 47 서열번호 48
N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제 서열번호 51 서열번호 52
헬리카제 서열번호 55 서열번호 56
NCgl1098 유전자에 의해 코딩되는 단백질 서열번호 59 서열번호 60
당 인산염 이성질화효소/에피머레이즈 서열번호 63 서열번호 64
세포분해 막단백질 서열번호 67 서열번호 68
NCgl0752 유전자에 의해 코딩되는 단백질 서열번호 71 서열번호 72
주요 촉진제 수퍼패밀리 퍼미에이즈 서열번호 75 서열번호 76
본 출원에서 용어, "상응하는(corresponding to)"은, 폴리펩티드에서 열거되는 위치의 아미노산 잔기이거나, 또는 폴리펩티드에서 열거되는 잔기와 유사하거나 동일하거나 상동한 아미노산 잔기를 지칭한다. 상응하는 위치의 아미노산을 확인하는 것은 특정 서열을 참조하는 서열의 특정 아미노산을 결정하는 것일 수 있다. 본 출원에 사용된 "상응 영역"은 일반적으로 관련 단백질 또는 참조 (reference) 단백질에서의 유사하거나 대응되는 위치를 지칭한다. 예를 들어, 임의의 아미노산 서열을 서열번호 3, 7, 11, 15, 19, 23, 27, 31, 35, 39, 43, 47, 51, 55, 59, 63, 67, 71, 또는 75과 정렬(align)하고, 이를 토대로 상기 아미노산 서열의 각 아미노산 잔기는 서열번호 3, 7, 11, 15, 19, 23, 27, 31, 35, 39, 43, 47, 51, 55, 59, 63, 67, 71, 또는 75의 아미노산 잔기와 상응하는 아미노산 잔기의 숫자 위치를 참조하여 넘버링 할 수 있다. 예를 들어, 본 출원에 기재된 것과 같은 서열 정렬 알고리즘은, 쿼리 시퀀스("참조 서열"이라고도 함)와 비교하여 아미노산의 위치, 또는 치환, 삽입 또는 결실 등의 변형이 발생하는 위치를 확인할 수 있다.
이러한 정렬에는 예를 들어 Needleman-Wunsch 알고리즘 (Needleman 및 Wunsch, 1970, J. Mol. Biol. 48: 443-453), EMBOSS 패키지의 Needle 프로그램 (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) 등을 이용할 수 있으나, 이에 제한되지 않고 당업계에 알려진 서열 정렬 프로그램, 쌍 서열(pairwise sequence) 비교 알고리즘 등을 적절히 사용할 수 있다.
본 출원의 다른 하나의 양태는 본 출원의 변이체를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이체를 코딩하는 폴리뉴클레오티드 단편을 의미한다.
본 출원의 변이체를 코딩하는 폴리뉴클레오티드는 서열번호 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61, 65, 69, 또는 73으로 기재된 아미노산 서열을 코딩하는 염기서열을 포함할 수 있다. 본 출원의 일 예로, 본 출원의 폴리뉴클레오티드는 서열번호 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 46, 50, 54, 58, 62, 66, 70, 또는 74의 서열을 가지거나 포함할 수 있다. 또한, 본 출원의 폴리뉴클레오티드는 서열번호 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 46, 50, 54, 58, 62, 66, 70, 또는 74의 서열로 이루어지거나, 필수적으로 구성될 수 있다. 또 다른 예에서, 본 출원의 폴리뉴클레오티드는 상기 서열번호 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 46, 50, 54, 58, 62, 66, 70, 또는 74로 기재된 핵산 서열에서 각각 서열번호 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 또는 76의 핵산 서열을 기준으로 659번, 128번, 97번, 628번, 595번, 815번, 911번, 506번, 880번, 1072번, 389번, 1144번, 626번, 1775번, 508번, 962번, 919번, 2026번, 또는 1131번 위치에 각각 상응하는 염기는 G, T, A ,G, A, T, A, T, A, T, A, T, T, T, 또는 A, T, G, T, 또는 A 이고, 상기 서열번호 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 46, 50, 54, 58, 62, 66, 70, 또는 74로 기재된 핵산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 핵산 서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 변이체에 상응하는 효능을 나타내는 폴리펩티드나 단백질을 암호화하는 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 핵산 서열을 갖는 폴리뉴클레오티드도 본 출원의 범위 내에 포함됨은 자명하다. 본 출원의 폴리뉴클레오티드의 각 핵산 서열, 위치, 및 위치에 상응하는 염기 종류에 대한 대응관계를 하기 표 4 에 나타내었다.
　 핵산 서열 위치를 카운팅하기 위해 기준이 되는 핵산 서열 위치 염기 종류
1 서열번호 2 서열번호 4 659 G
2 서열번호 6 서열번호 8 128 T
3 서열번호 10 서열번호 12 97 A
4 서열번호 14 서열번호 16 628 G
5 서열번호 18 서열번호 20 595 A
6 서열번호 22 서열번호 24 815 T
7 서열번호 26 서열번호 28 911 A
8 서열번호 30 서열번호 32 506 T
9 서열번호 34 서열번호 36 880 A
10 서열번호 38 서열번호 40 1072 T
11 서열번호 42 서열번호 44 389 A
12 서열번호 46 서열번호 48 1144 T
13 서열번호 50 서열번호 52 626 T
14 서열번호 54 서열번호 56 1775 T
15 서열번호 58 서열번호 60 508 A
16 서열번호 62 서열번호 64 962 T
17 서열번호 66 서열번호 68 919 G
18 서열번호 70 서열번호 72 2026 T
19 서열번호 74 서열번호 76 1131 A
본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 출원의 변이체를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 본 출원의 변이체의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 출원의 폴리뉴클레오티드는 서열번호 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 46, 50, 54, 58, 62, 66, 70, 또는 74의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열을 가지거나 포함하거나, 또는 서열번호 2, 6, 10, 14, 18, 22, 26, 30, 34, 38, 42, 46, 50, 54, 58, 62, 66, 70, 또는 74의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다. 이때, 상기 상동성 또는 동일성을 갖는 서열에서, 서열번호 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61, 65, 69, 또는 73의 220번, 43번, 33번, 210번, 199번, 272번, 304번, 169번, 294번, 358번, 130번, 382번, 209번, 592번, 170번, 321번, 307번, 676번, 및 377번 위치에 각각 상응하는 아미노산을 코딩하는 코돈은, 각각 시스테인, 류신, 세린, 아스파르트산, 메티오닌, 이소류신, 글루타민, 발린, 라이신, 세린, 아스파르트산, 시스테인, 류신, 페닐알라닌, 라이신, 발린, 발린, 타이로신, 및 글루타민을 코딩하는 코돈 중 하나일 수 있다. 또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화할 수 있는 서열이라면 제한없이 포함될 수 있다. 상기 “엄격한 조건(stringent condition)”이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1×SSC, 0.1% SDS, 구체적으로 60℃, 0.1×SSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1×SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, “상보적”은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J.Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조).
본 출원의 또 다른 하나의 양태는 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 제공하는 것이다. 상기 벡터는 상기 폴리뉴클레오티드를 숙주세포에서 발현시키기 위한 발현 벡터일 수 있으나, 이에 제한되지 않는다.
본 출원에서 "벡터"는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 포함하는 DNA 제조물을 포함할 수 있다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 표적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 폴리펩티드가 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 변이체를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드를 포함하는, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 균주를 제공하는 것이다.
일 예는 (1) 내지 (19)로 이루어지는 군에서 선택된 1종 이상(예를 들면, 1종 이상 또는 2종 이상)의 단백질 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하는, 코리네박테리움 글루타미쿰 균주(Corynebacterium glutamicum)를 제공할 수 있다:
(1) 서열번호 3의 220번째 위치에 상응하는 아미노산인 페닐알라닌이 시스테인으로 치환된, 서열번호 1로 기재된 아미노산 서열로 이루어진 내재성 막 수송 단백질 변이체;
(2) 서열번호 7의 43번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 5로 기재된 아미노산 서열로 이루어진 DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 변이체;
(3) 서열번호 11의 33번째 위치에 상응하는 아미노산인 시스테인이 세린으로 치환된, 서열번호 9로 기재된 아미노산 서열로 이루어진 단백질 변이체;
(4) 서열번호 15의 210번째 위치에 상응하는 아미노산인 아스파라긴이 아스파르트산으로 치환된, 서열번호 13로 기재된 아미노산 서열로 이루어진 전사 안티터미네이션 단백질 변이체;
(5) 서열번호 19의 199번째 위치에 상응하는 아미노산인 발린이 메티오닌으로 치환된, 서열번호 17로 기재된 아미노산 서열로 이루어진 ABC 트랜스포터 ATP-결합 단백질 변이체;
(6) 서열번호 23의 272번째 위치에 상응하는 아미노산인 트레오닌이 이소류신으로 치환된, 서열번호 21로 기재된 아미노산 서열로 이루어진 말레이트 디하이드로게나제 변이체;
(7) 서열번호 27의 304번째 위치에 상응하는 아미노산인 아르기닌이 글루타민으로 치환된, 서열번호 25로 기재된 아미노산 서열로 이루어진 프리모솜 조립 단백질 변이체;
(8) 서열번호 31의 169번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 29로 기재된 아미노산 서열로 이루어진 타입 II 시트레이트 신타아제 변이체;
(9) 서열번호 35의 294번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 33로 기재된 아미노산 서열로 이루어진 막 단백질 변이체;
(10) 서열번호 39의 358번째 위치에 상응하는 아미노산인 프롤린이 세린으로 치환된, 서열번호 37로 기재된 아미노산 서열로 이루어진 미코티온 리덕타제 변이체;
(11) 서열번호 43의 130번째 위치에 상응하는 아미노산인 글리신이 아스파르트산으로 치환된, 서열번호 41로 기재된 아미노산 서열로 이루어진 Co/Zn/Cd 유출 시스템 컴포넌트 변이체;
(12) 서열번호 47의 382번째 위치에 상응하는 아미노산인 글리신이 시스테인으로 치환된, 서열번호 45으로 기재된 아미노산 서열로 이루어진 DAHP 신타아제 변이체;
(13) 서열번호 51의 209번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 49로 기재된 아미노산 서열로 이루어진 N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제 변이체;
(14) 서열번호 55의 592번째 위치에 상응하는 아미노산인 티로신이 페닐알라닌으로 치환된, 서열번호 53으로 기재된 아미노산 서열로 이루어진 헬리카제 변이체;
(15) 서열번호 59의 170번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 57로 기재된 아미노산 서열로 이루어진 단백질 변이체;
(16) 서열번호 63의 321번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 61로 기재된 아미노산 서열로 이루어진 당 인산염 이성질화효소/에피머레이즈 변이체;
(17) 서열번호 67의 307번째 위치에 상응하는 아미노산인 이소류신이 발린으로 치환된, 서열번호 65로 기재된 아미노산 서열로 이루어진 세포분해 막단백질 변이체;
(18) 서열번호 71의 676번째 위치에 상응하는 아미노산인 아스파트산이 타이로신으로 치환된, 서열번호 69로 기재된 아미노산 서열로 이루어진 단백질 변이체; 및
(19) 서열번호 75의 377번째 위치에 상응하는 아미노산인 히스티딘이 글루타민으로 치환된, 서열번호 73로 기재된 아미노산 서열로 이루어진 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체.
일 예는 하기 (a) 및 (b)의 단백질 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드(예를 들면, (a) 변이체를 코딩하는 폴리뉴클레오티드, (b) 변이체를 코딩하는 폴리뉴클레오티드, 및/또는 (a)와 (b)를 코딩하는 폴리뉴클레오티드)를 포함하는, 코리네박테리움 글루타미쿰 균주를 제공할 수 있다:
(a) 서열번호 59의 170번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 57로 기재된 아미노산 서열로 이루어진 단백질 변이체 및
(b) 하기 (1) 내지 (18)로 이루어지는 군에서 선택된 1종 이상의 단백질 변이체:
(1) 서열번호 3의 220번째 위치에 상응하는 아미노산인 페닐알라닌이 시스테인으로 치환된, 서열번호 1로 기재된 아미노산 서열로 이루어진 내재성 막 수송 단백질 변이체;
(2) 서열번호 7의 43번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 5로 기재된 아미노산 서열로 이루어진 DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 변이체;
(3) 서열번호 11의 33번째 위치에 상응하는 아미노산인 시스테인이 세린으로 치환된, 서열번호 9로 기재된 아미노산 서열로 이루어진 단백질 변이체;
(4) 서열번호 15의 210번째 위치에 상응하는 아미노산인 아스파라긴이 아스파르트산으로 치환된, 서열번호 13로 기재된 아미노산 서열로 이루어진 전사 안티터미네이션 단백질 변이체;
(5) 서열번호 19의 199번째 위치에 상응하는 아미노산인 발린이 메티오닌으로 치환된, 서열번호 17로 기재된 아미노산 서열로 이루어진 ABC 트랜스포터 ATP-결합 단백질 변이체;
(6) 서열번호 23의 272번째 위치에 상응하는 아미노산인 트레오닌이 이소류신으로 치환된, 서열번호 21로 기재된 아미노산 서열로 이루어진 말레이트 디하이드로게나제 변이체;
(7) 서열번호 27의 304번째 위치에 상응하는 아미노산인 아르기닌이 글루타민으로 치환된, 서열번호 25로 기재된 아미노산 서열로 이루어진 프리모솜 조립 단백질 변이체;
(8) 서열번호 31의 169번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 29로 기재된 아미노산 서열로 이루어진 타입 II 시트레이트 신타아제 변이체;
(9) 서열번호 35의 294번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 33로 기재된 아미노산 서열로 이루어진 막 단백질 변이체;
(10) 서열번호 39의 358번째 위치에 상응하는 아미노산인 프롤린이 세린으로 치환된, 서열번호 37로 기재된 아미노산 서열로 이루어진 미코티온 리덕타제 변이체;
(11) 서열번호 43의 130번째 위치에 상응하는 아미노산인 글리신이 아스파르트산으로 치환된, 서열번호 41로 기재된 아미노산 서열로 이루어진 Co/Zn/Cd 유출 시스템 컴포넌트 변이체;
(12) 서열번호 47의 382번째 위치에 상응하는 아미노산인 글리신이 시스테인으로 치환된, 서열번호 45으로 기재된 아미노산 서열로 이루어진 DAHP 신타아제 변이체;
(13) 서열번호 51의 209번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 49로 기재된 아미노산 서열로 이루어진 N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제 변이체;
(14) 서열번호 55의 592번째 위치에 상응하는 아미노산인 티로신이 페닐알라닌으로 치환된, 서열번호 53으로 기재된 아미노산 서열로 이루어진 헬리카제 변이체;
(15) 서열번호 63의 321번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 61로 기재된 아미노산 서열로 이루어진 당 인산염 이성질화효소/에피머레이즈 변이체;
(16) 서열번호 67의 307번째 위치에 상응하는 아미노산인 이소류신이 발린으로 치환된, 서열번호 65로 기재된 아미노산 서열로 이루어진 세포분해 막단백질 변이체;
(17) 서열번호 71의 676번째 위치에 상응하는 아미노산인 아스파트산이 타이로신으로 치환된, 서열번호 69로 기재된 아미노산 서열로 이루어진 단백질 변이체; 및
(18) 서열번호 75의 377번째 위치에 상응하는 아미노산인 히스티딘이 글루타민으로 치환된, 서열번호 73로 기재된 아미노산 서열로 이루어진 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체.
일 예는 하기 (A) 및 (B)의 단백질 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드(예를 들면, (A) 변이체를 코딩하는 폴리뉴클레오티드, (B) 변이체를 코딩하는 폴리뉴클레오티드, 및/또는 (A)와 (B)를 코딩하는 폴리뉴클레오티드)를 포함하는, 코리네박테리움 글루타미쿰 균주를 제공할 수 있다:
(A) 서열번호 55의 592번째 위치에 상응하는 아미노산인 티로신이 페닐알라닌으로 치환된, 서열번호 53으로 기재된 아미노산 서열로 이루어진 헬리카제 변이체 및
(B) 하기 (1) 내지 (17)으로 이루어지는 군에서 선택된 1종 이상의 단백질 변이체:
(1) 서열번호 3의 220번째 위치에 상응하는 아미노산인 페닐알라닌이 시스테인으로 치환된, 서열번호 1로 기재된 아미노산 서열로 이루어진 내재성 막 수송 단백질 변이체;
(2) 서열번호 7의 43번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 5로 기재된 아미노산 서열로 이루어진 DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 변이체;
(3) 서열번호 11의 33번째 위치에 상응하는 아미노산인 시스테인이 세린으로 치환된, 서열번호 9로 기재된 아미노산 서열로 이루어진 단백질 변이체;
(4) 서열번호 15의 210번째 위치에 상응하는 아미노산인 아스파라긴이 아스파르트산으로 치환된, 서열번호 13로 기재된 아미노산 서열로 이루어진 전사 안티터미네이션 단백질 변이체;
(5) 서열번호 19의 199번째 위치에 상응하는 아미노산인 발린이 메티오닌으로 치환된, 서열번호 17로 기재된 아미노산 서열로 이루어진 ABC 트랜스포터 ATP-결합 단백질 변이체;
(6) 서열번호 23의 272번째 위치에 상응하는 아미노산인 트레오닌이 이소류신으로 치환된, 서열번호 21로 기재된 아미노산 서열로 이루어진 말레이트 디하이드로게나제 변이체;
(7) 서열번호 27의 304번째 위치에 상응하는 아미노산인 아르기닌이 글루타민으로 치환된, 서열번호 25로 기재된 아미노산 서열로 이루어진 프리모솜 조립 단백질 변이체;
(8) 서열번호 31의 169번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 29로 기재된 아미노산 서열로 이루어진 타입 II 시트레이트 신타아제 변이체;
(9) 서열번호 35의 294번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 33로 기재된 아미노산 서열로 이루어진 막 단백질 변이체;
(10) 서열번호 39의 358번째 위치에 상응하는 아미노산인 프롤린이 세린으로 치환된, 서열번호 37로 기재된 아미노산 서열로 이루어진 미코티온 리덕타제 변이체;
(11) 서열번호 43의 130번째 위치에 상응하는 아미노산인 글리신이 아스파르트산으로 치환된, 서열번호 41로 기재된 아미노산 서열로 이루어진 Co/Zn/Cd 유출 시스템 컴포넌트 변이체;
(12) 서열번호 47의 382번째 위치에 상응하는 아미노산인 글리신이 시스테인으로 치환된, 서열번호 45으로 기재된 아미노산 서열로 이루어진 DAHP 신타아제 변이체;
(13) 서열번호 51의 209번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 49로 기재된 아미노산 서열로 이루어진 N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제 변이체;
(14) 서열번호 63의 321번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 61로 기재된 아미노산 서열로 이루어진 당 인산염 이성질화효소/에피머레이즈 변이체;
(15) 서열번호 67의 307번째 위치에 상응하는 아미노산인 이소류신이 발린으로 치환된, 서열번호 65로 기재된 아미노산 서열로 이루어진 세포분해 막단백질 변이체;
(16) 서열번호 71의 676번째 위치에 상응하는 아미노산인 아스파트산이 타이로신으로 치환된, 서열번호 69로 기재된 아미노산 서열로 이루어진 단백질 변이체; 및
(17) 서열번호 75의 377번째 위치에 상응하는 아미노산인 히스티딘이 글루타민으로 치환된, 서열번호 73로 기재된 아미노산 서열로 이루어진 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체.
일 예는 하기 (I) 및 (II)의 단백질 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드(예를 들면, (I) 변이체를 코딩하는 폴리뉴클레오티드, (II) 변이체를 코딩하는 폴리뉴클레오티드, 및/또는 (I)와 (II)를 코딩하는 폴리뉴클레오티드)를 포함하는, 코리네박테리움 글루타미쿰 균주를 제공할 수 있다:
(I) 서열번호 51의 209번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 49로 기재된 아미노산 서열로 이루어진 N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제 변이체 및
(II) 하기 (1) 내지 (16)으로 이루어지는 군에서 선택된 1종 이상의 단백질 변이체:
(1) 서열번호 3의 220번째 위치에 상응하는 아미노산인 페닐알라닌이 시스테인으로 치환된, 서열번호 1로 기재된 아미노산 서열로 이루어진 내재성 막 수송 단백질 변이체;
(2) 서열번호 7의 43번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 5로 기재된 아미노산 서열로 이루어진 DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 변이체;
(3) 서열번호 11의 33번째 위치에 상응하는 아미노산인 시스테인이 세린으로 치환된, 서열번호 9로 기재된 아미노산 서열로 이루어진 단백질 변이체;
(4) 서열번호 15의 210번째 위치에 상응하는 아미노산인 아스파라긴이 아스파르트산으로 치환된, 서열번호 13로 기재된 아미노산 서열로 이루어진 전사 안티터미네이션 단백질 변이체;
(5) 서열번호 19의 199번째 위치에 상응하는 아미노산인 발린이 메티오닌으로 치환된, 서열번호 17로 기재된 아미노산 서열로 이루어진 ABC 트랜스포터 ATP-결합 단백질 변이체;
(6) 서열번호 23의 272번째 위치에 상응하는 아미노산인 트레오닌이 이소류신으로 치환된, 서열번호 21로 기재된 아미노산 서열로 이루어진 말레이트 디하이드로게나제 변이체;
(7) 서열번호 27의 304번째 위치에 상응하는 아미노산인 아르기닌이 글루타민으로 치환된, 서열번호 25로 기재된 아미노산 서열로 이루어진 프리모솜 조립 단백질 변이체;
(8) 서열번호 31의 169번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 29로 기재된 아미노산 서열로 이루어진 타입 II 시트레이트 신타아제 변이체;
(9) 서열번호 35의 294번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 33로 기재된 아미노산 서열로 이루어진 막 단백질 변이체;
(10) 서열번호 39의 358번째 위치에 상응하는 아미노산인 프롤린이 세린으로 치환된, 서열번호 37로 기재된 아미노산 서열로 이루어진 미코티온 리덕타제 변이체;
(11) 서열번호 43의 130번째 위치에 상응하는 아미노산인 글리신이 아스파르트산으로 치환된, 서열번호 41로 기재된 아미노산 서열로 이루어진 Co/Zn/Cd 유출 시스템 컴포넌트 변이체;
(12) 서열번호 47의 382번째 위치에 상응하는 아미노산인 글리신이 시스테인으로 치환된, 서열번호 45으로 기재된 아미노산 서열로 이루어진 DAHP 신타아제 변이체;
(13) 서열번호 63의 321번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 61로 기재된 아미노산 서열로 이루어진 당 인산염 이성질화효소/에피머레이즈 변이체;
(14) 서열번호 67의 307번째 위치에 상응하는 아미노산인 이소류신이 발린으로 치환된, 서열번호 65로 기재된 아미노산 서열로 이루어진 세포분해 막단백질 변이체;
(15) 서열번호 71의 676번째 위치에 상응하는 아미노산인 아스파트산이 타이로신으로 치환된, 서열번호 69로 기재된 아미노산 서열로 이루어진 단백질 변이체; 및
(16) 서열번호 75의 377번째 위치에 상응하는 아미노산인 히스티딘이 글루타민으로 치환된, 서열번호 73로 기재된 아미노산 서열로 이루어진 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체.
본 출원의 균주는 본 출원의 변이형 폴리펩티드, 상기 폴리펩티드를 암호화하는 폴리뉴클레오티드, 또는 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 포함할 수 있다.
본 출원에서 용어, "균주(또는, 미생물)"는 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 폴리펩티드, 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
본 출원의 균주는 본 출원의 변이체, 본 출원의 폴리뉴클레오티드, 및 본 출원의 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상(예를 들면, 하나 이상 또는 둘 이상)을 포함하는 균주; 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드를 발현하도록 변형된 균주; 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드를 발현하는 균주 (예컨대, 재조합 균주); 또는 본 출원의 변이체 활성을 갖는 균주 (예컨대, 재조합 균주)일 수 있으나, 이에 제한되지 않는다.
본 출원의 균주는 L-라이신 생산능을 가진 균주일 수 있다.
본 출원의 균주는 자연적으로 (i) 내재성 막 수송 단백질(integral membrane transport protein); (ii) DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 (DNA polymerase Ⅲ subunits gamma and tau); (iii) 서열번호 11의 아미노산 서열을 포함하는 폴리펩티드 및/또는 NCgl3069 유전자에 의해 코딩되는 단백질; (iv) 전사 안티터미네이션 단백질(Transcription antitermination protein); (v) ABC 트랜스포터 ATP-결합 단백질(ABC transporter ATP-binding protein); (vi) 말레이트 디하이드로게나제(malate dehydrogenase); (vii) 프리모솜 조립 단백질(primosome assembly protein); (viii) 타입 II 시트레이트 신타아제(type II citrate synthase); (ix) 막 단백질 (membrane protein, TerC); (x) 미코티온 리덕타제(mycothione reductase); (xi) Co/Zn/Cd 유출 시스템 컴포넌트(Co/Zn/Cd efflux system component); (xii) DAHP 신타아제(3-deoxy-D-arabinoheptulosonate-7-phosphate synthase; DAHP synthase); (xiii) N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제(N-succinyldiaminopimelate aminotransferase); (xiv) 헬리카제(Helicase); (xv) 서열번호 59의 아미노산 서열을 포함하는 폴리펩티드 및/또는 NCgl1098 유전자에 의해 코딩되는 단백질; (xvi) 당 인산염 이성질화효소/에피머레이즈; (xvii) 세포분해 막단백질; (xviii) 서열번호 71의 아미노산 서열을 포함하는 폴리펩티드 및/또는 NCgl0752 유전자에 의해 코딩되는 단백질; 및/또는 (xviv) 주요 촉진제 수퍼패밀리 퍼미에이즈의 활성 및/또는 L-라이신 생산능을 가지고 있는 미생물, 또는 상기 (i) 내지 (xviv)로 이루어지는 군에서 선택되는 1종 이상(예를 들면, 1종 이상 또는 2종 이상)의 단백질의 활성 및/또는 L-라이신 생산능이 없는 모균주에 본 출원의 변이체 또는 이를 코딩하는 폴리뉴클레오티드 (또는 상기 폴리뉴클레오티드를 포함하는 벡터)가 도입되거나 및/또는 L-라이신 생산능이 부여된 미생물일 수 있으나 이에 제한되지 않는다.
일 예로, 본 출원의 균주는 본 출원의 폴리뉴클레오티드 또는 본 출원의 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환되어, 본 출원의 변이체를 발현하는 세포 또는 미생물로서, 본 출원의 목적상 본 출원의 균주는 본 출원의 변이체를 포함하여 L-라이신을 생산할 수 있는 미생물을 모두 포함할 수 있다. 예를 들어, 본 출원의 균주는 천연의 야생형 미생물 또는 L-라이신을 생산하는 미생물에 본 출원의 변이체를 코딩하는 폴리뉴클레오티드가 도입됨으로써 단백질 변이체가 발현되어, L-라이신 생산능이 증가된 재조합 균주일 수 있다. 일 예에서, 본 출원의 균주는 본 출원의 단백질 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하지 않는 균주(예를 들면, 코리네박테리움 글루타미쿰)과 비교하여, L-라이신 생산능이 증가된 재조합 균주일 수 있다. 상기 L-아미노산 생산능이 증가된 재조합 균주는, 천연의 야생형 미생물 또는 상기 (i) 내지 (xviv)로 이루어지는 군에서 선택되는 1종 이상의 단백질이 비변형된 미생물 (즉, 상기 (i) 내지 (xv)로 이루어지는 군에서 선택되는 1종 이상의 야생형 단백질을 발현하는 미생물; 예를 들면 서열번호 3, 7, 11, 15, 19, 23, 27, 31, 35, 39, 43, 47, 51, 55, 59, 63, 67, 71, 또는 75의 폴리펩티드 및/또는 이를 코딩하는 폴리뉴클레오티드를 포함하는 미생물)에 비하여 L-라이신 생산능이 증가된 미생물일 수 있으나, 이에 제한되는 것은 아니다. 그 예로, 상기 L-라이신 생산능의 증가 여부를 비교하는 대상 균주인, 비변형 미생물은 ATCC13032 균주 및/또는 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2; 문헌 전체가 본 명세서에 참조로서 포함됨)일 수 있으나, 이에 제한되지 않는다.
일 예로, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물에 비하여, L-라이신 생산능이 약 1% 이상, 약 2.5% 이상, 약 5% 이상, 약 6% 이상, 약 7% 이상, 약 8% 이상, 약 9% 이상, 약 10% 이상, 약 10.5% 이상, 약 11% 이상, 약 11.5%이상, 약 12% 이상, 약 12.5% 이상, 약 13% 이상, 약 13.5% 이상, 약 14% 이상, 약 14.5% 이상, 약 15% 이상, 약 15.5% 이상, 약 16% 이상, 약 16.5% 이상, 약 17% 이상, 약 17.5% 이상, 약 18% 이상, 약 18.5% 이상, 약 19% 이상, 약 19.5% 이상, 약 20% 이상, 약 20.5% 이상, 약 21% 이상, 약 21.5% 이상, 약 22% 이상, 약 22.5% 이상, 약 23% 이상, 약 23.5% 이상, 약 24% 이상, 약 24.5% 이상, 약 25% 이상, 약 25.5% 이상, 약 26% 이상, 약 26.5% 이상, 약 27% 이상, 약 27.5% 이상, 약 28% 이상, 약 28.5% 이상, 약 29% 이상, 약 29.5% 이상, 약 30% 이상, 약 31% 이상, 약 32% 이상, 약 33% 이상, 약 34% 이상, 또는 약 35% 이상(상한값은 특별한 제한은 없으며, 예컨대, 약 200% 이하, 약 150% 이하, 약 100% 이하, 약 50% 이하, 약 45% 이하, 약 40% 이하, 또는 약 35% 이하일 수 있음) 증가된 것일 수 있다. 다른 예에서, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물에 비하여, L-라이신 생산능이 약 1.1배 이상, 약 1.12배 이상, 약 1.13배 이상, 1.15배 이상, 1.16배 이상, 1.17배 이상, 1.18배 이상, 1.19배 이상, 약 1.2 배 이상, 1.25배 이상, 또는 약 1.3배 이상 (상한값은 특별한 제한은 없으며, 예컨대, 약 10배 이하, 약 5배 이하, 약 3배 이하, 또는 약 2배 이하일 수 있음) 증가된 것일 수 있다. 상기 용어 “약(about)”은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
본 출원에서 용어, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 본 명세서에 기재된 전사 안티터미네이션 단백질 변이체가 도입되지 않거나 도입되기 전의 균주를 의미할 수 있다. 상기 "비변형 미생물"은 “변형 전 균주”, “변형 전 미생물”, “비변이 균주”, “비변형 균주”, “비변이 미생물” 또는 “기준 미생물”과 혼용될 수 있다.
본 출원의 또 다른 일 예로, 본 출원의 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있다.
본 출원에서 용어, 폴리펩티드의 “약화”는 내재적 활성에 비하여 활성이 감소되거나 또는 활성이 없는 것을 모두 포함하는 개념이다. 상기 약화는 불활성화(inactivation), 결핍(deficiency), 하향조절(down-regulation), 감소(decrease), 저하(reduce), 감쇠(attenuation) 등의 용어와 혼용될 수 있다.
상기 약화는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드의 변이 등으로 폴리펩티드 자체의 활성이 본래 미생물이 가지고 있는 폴리펩티드의 활성에 비해 감소 또는 제거된 경우, 이를 코딩하는 폴리뉴클레오티드의 유전자의 발현 저해 또는 폴리펩티드로의 번역(translation) 저해 등으로 세포 내에서 전체적인 폴리펩티드 활성 정도 및/또는 농도(발현량)가 천연형 균주에 비하여 낮은 경우, 상기 폴리뉴클레오티드의 발현이 전혀 이루어지지 않은 경우, 및/또는 폴리뉴클레오티드의 발현이 되더라도 폴리펩티드의 활성이 없는 경우 역시 포함할 수 있다. 상기 “내재적 활성”은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주, 야생형 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 “변형 전 활성”과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 “불활성화, 결핍, 감소, 하향조절, 저하, 감쇠”한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성에 비하여 낮아진 것을 의미한다.
이러한 폴리펩티드의 활성의 약화는, 당업계에 알려진 임의의 방법에 의하여 수행될 수 있으나 이로 제한되는 것은 아니며, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다(예컨대, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드의 약화는
1) 폴리펩티드를 코딩하는 유전자 전체 또는 일부의 결손;
2) 폴리펩티드를 코딩하는 유전자의 발현이 감소하도록 발현조절영역(또는 발현조절서열)의 변형;
3) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 구성하는 아미노산 서열의 변형(예컨대, 아미노산 서열 상의 1 이상의 아미노산의 삭제/치환/부가);
4) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 코딩하는 유전자 서열의 변형 (예를 들어, 폴리펩티드의 활성이 제거 또는 약화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 핵산염기 서열 상의 1 이상의 핵산염기의 삭제/치환/부가);
5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입;
7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가;
8) 폴리펩티드를 코딩하는 유전자 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE); 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
예컨대,
상기 1) 폴리펩티드를 코딩하는 상기 유전자 일부 또는 전체의 결손은, 염색체 내 내재적 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드 전체의 제거, 일부 뉴클레오티드가 결실된 폴리뉴클레오티드로의 교체 또는 마커 유전자로 교체일 수 있다.
또한, 상기 2) 발현조절영역(또는 발현조절서열)의 변형은, 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절영역(또는 발현조절서열) 상의 변이 발생, 또는 더욱 약한 활성을 갖는 서열로의 교체일 수 있다. 상기 발현조절영역에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 낮은 다른 개시코돈을 코딩하는 염기서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은 폴리펩티드의 활성을 약화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 약한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 없도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 예를 들면, 폴리뉴클레오티드 서열 내 변이를 도입하여 종결 코돈을 형성시킴으로써, 유전자의 발현을 저해하거나 약화시킬 수 있으나, 이에 제한되지 않는다.
상기 6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입은 예를 들어 문헌 [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986]을 참고할 수 있다.
상기 7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가는 mRNA 번역을 불가능하게 하거나 속도를 저하시키는 것일 수 있다.
상기 8) 폴리펩티드를 코딩하는 유전자서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE)는 상기 폴리펩티드를 코딩하는 유전자의 전사체에 상보적인 안티센스 뉴클레오티드를 만들어 활성을 약화하는 것일 수 있다.
본 출원에서 용어, 폴리펩티드 활성의 “강화”는, 폴리펩티드의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 활성화(activation), 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 활성화, 강화, 상향조절, 과발현, 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 “내재적 활성”은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 “변형 전 활성”과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 “강화”, “상향조절”, “과발현” 또는 “증가”한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성 및/또는 농도(발현량)에 비하여 향상된 것을 의미한다.
상기 강화는 외래의 폴리펩티드를 도입하거나, 내재적인 폴리펩티드의 활성 강화 및/또는 농도(발현량)를 통해 달성할 수 있다. 상기 폴리펩티드의 활성의 강화 여부는 해당 폴리펩티드의 활성 정도, 발현량 또는 해당 폴리펩티드로부터 배출되는 산물의 양의 증가로부터 확인할 수 있다.
상기 폴리펩티드의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 폴리펩티드의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드의 강화는
1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가;
2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역을 활성이 강력한 서열로 교체;
3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
4) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드의 아미노산 서열의 변형;
5) 폴리펩티드 활성이 강화도록 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열의 변형 (예를 들어, 폴리펩티드의 활성이 강화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 폴리뉴클레오티드 서열의 변형);
6) 폴리펩티드의 활성을 나타내는 외래 폴리펩티드 또는 이를 코딩하는 외래 폴리뉴클레오티드의 도입;
7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
보다 구체적으로,
상기 1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터의 숙주세포 내로의 도입에 의해 달성되는 것일 수 있다. 또는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 숙주세포 내의 염색체 내에 1 카피 또는 2 카피 이상 도입에 의해 달성되는 것일 수 있다. 상기 염색체 내에 도입은 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다. 상기 벡터는 전술한 바와 같다.
상기 2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역(또는 발현조절서열)을 활성이 강력한 서열로 교체는, 예를 들면, 상기 발현조절영역의 활성을 더욱 강화하도록 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 가지는 서열로의 교체일 수 있다. 상기 발현조절영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 그리고 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 일 예로, 본래의 프로모터를 강력한 프로모터로 교체시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터, yccA 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 높은 다른 개시코돈을 코딩하는 염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 폴리펩티드의 활성을 강화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 증가하도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 상기 교체는 구체적으로 상동재조합에 의하여 폴리뉴클레오티드를 염색체내로 삽입함으로써 수행될 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 전술한 바와 같다.
상기 6) 폴리펩티드의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 상기 폴리펩티드와 동일/유사한 활성을 나타내는 폴리펩티드를 코딩하는 외래 폴리뉴클레오티드의 숙주세포 내 도입일 수 있다. 상기 외래 폴리뉴클레오티드는 상기 폴리펩티드와 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한이 없다. 상기 도입에 이용되는 방법은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 폴리펩티드가 생성되어 그 활성이 증가될 수 있다.
상기 7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩티드의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 폴리펩티드 활성의 강화는, 상응하는 폴리펩티드의 활성 또는 농도 발현량이 야생형이나 변형 전 미생물 균주에서 발현된 폴리펩티드의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩티드로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 미생물에서 폴리뉴클레오티드의 일부 또는 전체의 변형(예컨대, 상술한 단백질 변이체를 코딩하기 위한 변형)은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위 (engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오티드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 미생물에서, 변이체, 폴리뉴클레오티드 및 L-라이신 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드를 포함하는 코리네박테리움 글루타미쿰 균주(예를 들면, 상기 (1) 내지 (19)로 이루어지는 군에서 선택된 1종 이상(예를 들면, 1종 이상 또는 2종 이상)의 단백질 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 균주)를 배지에서 배양하는 단계를 포함하는, L-아미노산 생산방법을 제공한다.
일 예에서, 본 출원의 코리네박테리움 글루타미쿰 균주를 배지에서 배양하는 단계를 포함하는, L-아미노산 생산방법을 제공할 수 있다.
본 출원의 L-아미노산 생산방법은 본 출원의 코리네박테리움 글루타미쿰 (또는 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드 또는 본 출원의 벡터를 포함하는 코리네박테리움 글루타미쿰) 균주를 배지에서 배양하는 단계를 포함할 수 있다.
더불어, 본 출원의 L-아미노산은 L- 라이신일 수 있다.
본 출원에서, 용어 "배양"은 본 출원의 코리네박테리움 글루타미쿰 균주를 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및/또는 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 본 출원의 코리네박테리움 글루타미쿰 균주를 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 코리네박테리움 글루타미쿰 균주의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 코리네박테리움 글루타미쿰 균주를 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
구체적으로, 코리네박테리움 속 균주에 대한 배양 배지는 문헌["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)]에서 찾아 볼 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 라이신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 본 출원의 코리네박테리움 글루타미쿰 균주의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
본 출원의 배양에서 배양온도는 20 내지 45℃ 구체적으로는 25 내지 40℃ 를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 배양에 의하여 생산된 L-아미노산은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 L-아미노산 생산방법은, 본 출원의 코리네박테리움 글루타미쿰 균주를 준비하는 단계, 상기 균주를 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 L-아미노산 생산방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 코리네박테리움 글루타미쿰 균주로부터 L-아미노산을 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 L-아미노산을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-아미노산을 회수할 수 있다.
또한, 본 출원의 L-아미노산 생산방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 L-아미노산 생산방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 연속적 또는 비연속적으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 방법에서, 변이체, 폴리뉴클레오티드, 벡터 및 균주 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이체, 상기 변이체를 코딩하는 폴리뉴클레오타이드, 상기 폴리뉴클레오타이드를 포함하는 벡터 또는 본 출원의 폴리뉴클레오티드를 포함하는 코리네박테리움 글루타미쿰 균주; 이를 배양한 배지; 또는 이들 중 2종 이상의 조합을 포함하는 L-아미노산 생산용 조성물을 제공하는 것이다.
본 출원의 조성물은 아미노산 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 조성물에서, 변이체, 폴리뉴클레오티드, 벡터, 균주, 배지 및 L-아미노산 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 단백질의 변이체를 포함하는, 코리네박테리움 글루타미쿰 균주를 배양하는 경우, 기존 비변형 폴리펩티드를 갖는 미생물에 비해 고수율의 L-라이신 생산이 가능하다.
도 1은 pDCM2 플라스미드의 모식도이다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 하기 실시예는 본 출원을 예시하기 위한 바람직한 실시양태에 불과한 것이며 따라서, 본 출원의 권리범위를 이에 한정하는 것으로 의도되지는 않는다. 한편, 본 명세서에 기재되지 않은 기술적인 사항들은 본 출원의 기술 분야 또는 유사 기술 분야에서 숙련된 통상의 기술자이면 충분히 이해하고 용이하게 실시할 수 있다.
실시예 1: 플라스미드의 제작
코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드(pDCM2, 도 1, 서열번호 173)를 디자인하였고, 바이오닉스(주)의 유전자 합성(Gene-synthesis) 서비스를 이용하여 플라스미드를 합성하였다. 일반적으로 알려진 sacB 시스템 관련 논문[Gene, 145 (1994) 69-73]을 참고로 하여 클로닝에 활용하기 용이한 제한효소(restriction enzyme)를 포함하도록 플라스미드를 설계하였다. 이렇게 합성된 pDCM2 플라스미드는 다음과 같은 특성을 갖는다.
1) 대장균에서만 작용하는 복제 기점(replication origin)을 가지고 있어 대장균 내에서는 자가 복제(self-replication)가 가능하나 코리네박테리움에서는 자가 복제가 불가능한 특성을 갖는다.
2) 선별 마커로 카나마이신 내성 유전자를 갖는다.
3) 2차 양성 선별(positive-selection) 마커로 레반 수크라제(Levan sucrase) 유전자(sacB)를 갖는다.
4) 최종 제작된 균주에는 pDCM2 플라스미드로부터 유래한 어떠한 유전자 정보도 남지 않는다.
실시예 2. 미생물내 내재성 막 수송 단백질 변이체 발현을 위한 벡터 제작
내재성 막 수송 단백질(integral membrane transport protein)의 아미노산 서열(서열번호 3)의 220번째 위치의 페닐알라닌(Phe)이 시스테인(Cys) 아미노산으로 치환된 변이체(F220C; 서열번호 1)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 77 및 78의 서열의 프라이머 쌍과 서열번호 79 및 80의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 77 및 서열번호 80의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCgl2816(F220C)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 5에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl2816_1F TCGAGCTCGGTACCCAAGATGTACTTCCCCAGCGG 서열번호 77
NCgl2816_2R CGGAATCGCGGATACGCTTGCACTCGGGGGTTTCATCAAGG 서열번호 78
NCgl2816_3F CCTTGATGAAACCCCCGAGTGCAAGCGTATCCGCGATTCCG 서열번호 79
NCgl2816_4R CTCTAGAGGATCCCCGCGATAATGGGTGCGGTACC 서열번호 80
실시예 3: 내재성 막 수송 단백질 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
3-1. 내재성 막 수송 단백질 변이체 발현 균주 제작
상기 실시예 2에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 81와 82의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl2816_F220C (또는 CA01-7531) 로 명명하고, 이를 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean CultureCenter of Microorganisms, KCCM)에 2020년 12월 22일자로 기탁하여 기탁번호 KCCM12904P를 부여 받았다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 6에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl2816_5F AAGATGTACTTCCCCAGCGG 서열번호 81
NCgl2816_6R GCGATAATGGGTGCGGTACC 서열번호 82
3-2. 내재성 막 수송 단백질 변이체 발현 균주의 L- 라이신 생산능 비교
상기 3-1에서 제작된 각 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72 시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L- 라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 7과 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 7에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 8
CJ3P_NCgl2816_F220C 9.2 15
표 7과 같이, CJ3P_NCgl2816_F220C 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 4. 미생물내 DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 변이체 발현을 위한 벡터 제작
DNA 중합효소 Ⅲ 감마 및 타우 서브유닛(DNA polymerase Ⅲ subunits gamma and tau)의 아미노산 서열(서열번호 7)의 43번째 위치의 프롤린(Pro)이 류신(Leu) 아미노산으로 치환된 변이체(P43L; 서열번호 5)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 83 및 84의 서열의 프라이머 쌍과 서열번호 85 및 86의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 83 및 서열번호 86의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-dnaZX(P43L)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 8에 기재하였다.
명칭 서열 (5’->3’) 서열번호
dnaZX_1F TCGAGCTCGGTACCCCCAAGAGGGTTTTTCTGTGGT 서열번호 83
dnaZX_2R CGTCTTGCCACAACCACGCAGACCCGAAAAAAGGTACGCATGGT 서열번호 84
dnaZX_3F ACCATGCGTACCTTTTTTCGGGTCTGCGTGGTTGTGGCAAGACG 서열번호 85
dnaZX_4R CTCTAGAGGATCCCCGCCGCCGCCGGCGCGGATGAC 서열번호 86
실시예 5: DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
5-1. DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 변이체 발현 균주 제작
상기 실시예 4에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 87와 88의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_dnaZX_P43L(또는 CA01-7532)로 명명하고, 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean CultureCenter of Microorganisms, KCCM)에 2020년 12월 2일자로 기탁하여 기탁번호 KCCM12869P를 부여 받았다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 9에 기재하였다.
명칭 서열 (5’->3’) 서열번호
dnaZX_5F CCAAGAGGGTTTTTCTGTGGT 서열번호 87
dnaZX_6R GCCGCCGCCGGCGCGGATGAC 서열번호 88
5-2. DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 변이체 발현 균주의 L- 라이신 생산능 비교
상기 5-1에서 제작된 각 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72 시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L-라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 10과 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO47H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 10에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 8
CJ3P_dnaZX_P43L 9.5 18.75
표 10과 같이, CJ3P_dnaZX_P43L 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 6. 미생물내 단백질 변이체 발현을 위한 벡터 제작
아미노산 서열(서열번호 11)의 33번째 위치의 시스테인(Cys)이 세린(Ser) 아미노산으로 치환된 변이체(C33S; 서열번호 9)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 89 및 90의 서열의 프라이머 쌍과 서열번호 91 및 92의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 89 및 서열번호 92의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCgl3069(C33S)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 11에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl3069_1F TCGAGCTCGGTACCCTGCCAGCCAATCACATGGGA 서열번호 89
NCgl3069_2R GGTTTGGAATGTTCGCAGTTAGTCTGTGGAGCACGCTGTAA 서열번호 90
NCgl3069_3F TTACAGCGTGCTCCACAGACTAACTGCGAACATTCCAAACC 서열번호 91
NCgl3069_4R CTCTAGAGGATCCCCAGGCCGGGACACTACGTGTG 서열번호 92
실시예 7: 단백질 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
7-1. 단백질 변이체 발현 균주 제작
상기 실시예 6에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 93와 94의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl3069_C33S (또는 CA01-7533)로 명명하고, 이를 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean CultureCenter of Microorganisms, KCCM)에 2020년 12월 22일자로 기탁하여 기탁번호 KCCM12905P를 부여 받았다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 12에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl3069_5F TGCCAGCCAATCACATGGGA 서열번호 93
NCgl3069_6R AGGCCGGGACACTACGTGTG 서열번호 94
7-2. 단백질 변이체 발현 균주의 L- 라이신 생산능 비교
상기 7-1에서 제작된 각 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72 시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L- 라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 13과 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 13에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 8
CJ3P_NCgl3069_C33S 9.1 13.8
표 13과 같이, CJ3P_NCgl3069_C33S 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 8. 미생물내 전사 안티터미네이션 단백질 변이체 발현을 위한 벡터 제작
전사 안티터미네이션 단백질 (transcription antitermination protein)의 아미노산 서열(서열번호 15)의 210번째 위치의 아스파라긴(Asn)이 아스파르트산(Asp) 아미노산으로 치환된 변이체(N210D; 서열번호 13)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 95 및 96의 서열의 프라이머 쌍과 서열번호 97 및 98의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 95 및 서열번호 98의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NusG(N210D)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 14에 기재하였다.
명칭 서열 (5’->3’) 서열번호
nusG_1F TCGAGCTCGGTACCCCTCCAGAAGAAGCCGCAGAAG 서열번호 95
nusG_2R CAGGAGTTGCATTGCCCTCGTCACCCACAAAGCTGGTCACACCA 서열번호 96
nusG_3F TGGTGTGACCAGCTTTGTGGGTGACGAGGGCAATGCAACTCCTG 서열번호 97
nusG_4R CTCTAGAGGATCCCCCTAGCTAACCTTCTCAACCTG 서열번호 98
실시예 9: 전사 안티터미네이션 단백질 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
9-1. 전사 안티터미네이션 단백질 변이체 발현 균주 제작
상기 실시예 8에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 99와 100의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NusG_N210D (또는 CA01-7534)로 명명하고, 이를 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean CultureCenter of Microorganisms, KCCM)에 2020년 12월 2일자로 기탁하여 기탁번호 KCCM12870P를 부여 받았다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 15에 기재하였다.
명칭 서열 (5’->3’) 서열번호
nusG_5F CTCCAGAAGAAGCCGCAGAAG 서열번호 99
nusG_6R CTAGCTAACCTTCTCAACCTG 서열번호 100
9-2. 전사 안티터미네이션 단백질 변이체 발현 균주의 L- 라이신 생산능 비교
상기 9-1에서 제작된 각 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72 시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L- 라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 16과 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 16에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 8
CJ3P_NusG_N210D 9.8 22.5
표 16과 같이, CJ3P_NusG_N210D 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 10. 미생물내 ABC 트랜스포터 ATP-결합 단백질 변이체 발현을 위한 벡터 제작
ABC 트랜스포터 ATP-결합 단백질(ABC transporter ATP-binding protein)의 아미노산 서열(서열번호 19)의 199번째 위치의 발린(Val)이 메티오닌(Met) 아미노산으로 치환된 변이체(V199M; 서열번호 17)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 101 및 102의 서열의 프라이머 쌍과 서열번호 103 및 104의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 101 및 서열번호 104의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-Ncgl0636(V199M)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 17에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl0636_1F TCGAGCTCGGTACCCGGCCCCAACGGATGCGGCAAA 서열번호 101
NCgl0636_2R AAGTCCCAATTCGTGGAGCATCATGACGATGGTGGTGCCGTGGT 서열번호 102
NCgl0636_3F ACCACGGCACCACCATCGTCATGATGCTCCACGAATTGGGACTT 서열번호 103
NCgl0636_4R CTCTAGAGGATCCCCAGTAGGTGCGCATGACGCCGC 서열번호 104
실시예 11: ABC 트랜스포터 ATP-결합 단백질 변이체를 발현하는 미생물의 L-라이신 생산능 평가
11-1. ABC 트랜스포터 ATP-결합 단백질 변이체 발현 균주 제작
상기 실시예 10에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2) 에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 105와 106의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_Ncgl0636_V199M(또는 CA01-7535)로 명명하고, 이를 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean CultureCenter of Microorganisms, KCCM)에 2020년 12월 2일자로 기탁하여 기탁번호 KCCM12871P 를 부여 받았다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 18에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl0636_5F GGCCCCAACGGATGCGGCAAA 서열번호 105
NCgl0636_6R AGTAGGTGCGCATGACGCCGC 서열번호 106
11-2. ABC 트랜스포터 ATP-결합 단백질 변이체 발현 균주의 L- 라이신 생산능 비교
상기 11-1에서 제작된 각 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72 시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L- 라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 19와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 19에 나타내었다.
균 주 L-라이신 농도(g/L) 라이신 농도 증가율 (%)
CJ3P 8
CJ3P_ Ncgl0636_V199M 9 12.5
표 19와 같이, CJ3P_Ncgl0636_V199M 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 12. 미생물내 말레이트 디하이드로게나제 변이체 발현을 위한 벡터 제작
말레이트 디하이드로게나제(Malate dehydrogenase)의 아미노산 서열(서열번호 23)의 272번째 위치의 트레오닌(Thr)이 이소류신(Ile) 아미노산으로 치환된 변이체(T272I; 서열번호 21)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 107 및 108의 서열의 프라이머 쌍과 서열번호 109 및 110의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 107 및 서열번호 110의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCgl2297(T272I)이라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 20에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl2297_1F TCGAGCTCGGTACCCTTTGCTGGCTAACAACGGCA 서열번호 107
NCgl2297_2R CAGGAATGCCGTATGCACCGATGGAAGGAATTGCCGCAGAG 서열번호 108
NCgl2297_3F CTCTGCGGCAATTCCTTCCATCGGTGCATACGGCATTCCTG 서열번호 109
NCgl2297_4R CTCTAGAGGATCCCCAAGTTCTGCCATGCGACGCT 서열번호 110
실시예 13: 말레이트 디하이드로게나제 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
13-1. 말레이트 디하이드로게나제 변이체 발현 균주 제작
상기 실시예 12에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 111와 112의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl2297_T272I (또는 CA01-7537) 로 명명하고, 이를 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean CultureCenter of Microorganisms, KCCM)에 2020년 12월 22일자로 기탁하여 기탁번호 KCCM12907P를 부여 받았다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 21에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl2297_5F TTTGCTGGCTAACAACGGCA 서열번호 111
NCgl2297_6R AAGTTCTGCCATGCGACGCT 서열번호 112
13-2. 말레이트 디하이드로게나제 변이체 발현 균주의 L- 라이신 생산능 비교
상기 13-1에서 제작된 각 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72 시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L- 라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 22와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 22에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 8
CJ3P_NCgl2297_T272I 9.3 16.3%
표 22와 같이, CJ3P_NCgl2297_T272I 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 14. 미생물내 프리모솜 조립 단백질 변이체 발현을 위한 벡터 제작
프리모솜 조립 단백질(primosome assembly protein)의 아미노산 서열(서열번호 27)의 304번째 위치의 아르기닌(Arg)이 글루타민(Gln) 아미노산으로 치환된 변이체(R304Q; 서열번호 25)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 113 및 114의 서열의 프라이머 쌍과 서열번호 115 및 116의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 113 및 서열번호 116의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCgl1540(R304Q)로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 23에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl1540_1F TCGAGCTCGGTACCCACCCGATTTATCGTCGTGGT 서열번호 113
NCgl1540_2R GCAATTGGGTTTCCGCGGTCTGCGCATGTCCCGCAATAATC 서열번호 114
NCgl1540_3F GATTATTGCGGGACATGCGCAGACCGCGGAAACCCAATTGC 서열번호 115
NCgl1540_4R CTCTAGAGGATCCCCCCACCTTGTTGCCACCAGAG 서열번호 116
실시예 15: 프리모솜 조립 단백질 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
15-1. 프리모솜 조립 단백질 변이체 발현 균주 제작
상기 실시예 14에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 117와 118의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl1540_R304Q (또는 CA01-7539) 로 명명하고, 이를 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean CultureCenter of Microorganisms, KCCM)에 2020년 12월 22일자로 기탁하여 기탁번호 KCCM12908P 를 부여 받았다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 24에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl1540_5F ACCCGATTTATCGTCGTGGT 서열번호 117
NCgl1540_6R CCACCTTGTTGCCACCAGAG 서열번호 118
15-2. 프리모솜 조립 단백질 변이체 발현 균주의 L- 라이신 생산능 비교
상기 15-1에서 제작된 각 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L- 라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 25와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 25에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 8
CJ3P_NCgl1540_R304Q 9.7 21.3
표 25와 같이, CJ3P_NCgl1540_R304Q 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 16. 미생물내 타입 II 시트레이트 신타아제 변이체 발현을 위한 벡터 제작
타입 II 시트레이트 신타아제(type II citrate synthase)의 아미노산 서열(서열번호 31)의 169번째 위치의 알라닌(Ala)이 발린(Val) 아미노산으로 치환된 변이체(A169V; 서열번호 29)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드 pDCM2(대한민국 특허 공개번호 제10-2020-0136813호)를 이용하여 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 119 및 120의 서열의 프라이머 쌍과 서열번호 121 및 122의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 119 및 서열번호 122의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCgl0795(A169V)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 26에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl0795_1F TGAATTCGAGCTCGGTACCCAACAAATATGTTTGAAAGG 서열번호 119
NCgl0795_2R CATGAGGCGAACGGTTACCTTATCAAGCTGTGC 서열번호 120
NCgl0795_3F GCACAGCTTGATAAGGTAACCGTTCGCCTCATG 서열번호 121
NCgl0795_4R GTCGACTCTAGAGGATCCCCTTCTTCCAGCTTGATTGCCA 서열번호 122
실시예 17: 타입 II 시트레이트 신타아제 변이체를 발현하는 미생물의 L-라이신 생산능 평가
17-1. 타입 II 시트레이트 신타아제 변이체 발현 균주 제작
상기 실시예 16에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 123와 124의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl0795_A169V (또는 CA01-7542) 로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 27에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl0795_5F AACAAATATGTTTGAAAGG 서열번호 123
NCgl0795_6R TTCTTCCAGCTTGATTGCCA 서열번호 124
17-2. 타입 II 시트레이트 신타아제 변이체 발현 균주의 L-라이신 생산능 비교
상기 17-1에서 제작된 각 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L- 라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 28과 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 28에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 7.8 -
CJ3P_NCgl0795_A169V 8.5 9.0
표 28과 같이, CJ3P_NCgl0795_A169V 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 18. 미생물내 막단백질 TerC 변이체 발현을 위한 벡터 제작
막단백질 TerC(membrane protein TerC)의 아미노산 서열(서열번호 35)의 294번째 위치의 글루탐산(Glu)이 라이신(Lys) 아미노산으로 치환된 변이체(E294K; 서열번호 33)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드 pDCM2(대한민국 특허 공개번호 제10-2020-0136813호)를 이용하여 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 125 및 126의 서열의 프라이머 쌍과 서열번호 127 및 128의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 125 및 서열번호 128의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCg1892(E294K)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 29에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl1892_1F TGAATTCGAGCTCGGTACCCTTCATCCTCGCAGGTGCTGC 서열번호 125
NCgl1892_2R GGTACGGAGACGTTTTTACCACCGTTGATGAAT 서열번호 126
NCgl1892_3F ATTCATCAACGGTGGTAAAAACGTCTCCGTACC 서열번호 127
NCgl1892_4R GTCGACTCTAGAGGATCCCCATGAACAATGATCCATTCCA 서열번호 128
실시예 19. 막단백질 TerC 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
19-1. 막단백질 TerC 변이체 발현 균주 제작
상기 실시예 18에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 129와 130의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl1892_E294K(또는 CA01-7546)로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 30에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl1892_5F TTCATCCTCGCAGGTGCTGC 서열번호 129
NCgl1892_6R ATGAACAATGATCCATTCCA 서열번호 130
19-2. 막단백질 TerC 변이체 발현 균주의 L-라이신 생산능 비교
상기 19-1에서 제작된 각 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L- 라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 31과 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 31에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 8.1 -
CJ3P_NCgl1892_E294K 9.6 18.5
표 31과 같이, CJ3P_NCgl1892_E294K 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 20. 미생물내 미코티온 리덕타제 변이체 발현을 위한 벡터 제작
미코티온 리덕타제(mycothione reductase)의 아미노산 서열(서열번호 39)의 358번째 위치의 프롤린(Pro)이 세린(Ser) 아미노산으로 치환된 변이체(P358S; 서열번호 37)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드 pDCM2(대한민국 특허 공개번호 제10-2020-0136813호)를 이용하여 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 131 및 132의 서열의 프라이머 쌍과 서열번호 133 및 134의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 5 및 서열번호 8의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCgl1928(P358S)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 32에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl1928_1F TGAATTCGAGCTCGGTACCCTGAATCTTTGGTGATTGTTG 서열번호 131
NCgl1928_2R ACCTGCGAGATCTGAGAGTTGGTGAAAACAGCT 서열번호 132
NCgl1928_3F AGCTGTTTTCACCAACTCTCAGATCTCGCAGGT 서열번호 133
NCgl1928_4R GTCGACTCTAGAGGATCCCCAAGTCTATATGTATTTCCTT 서열번호 134
실시예 21. 미코티온 리덕타제 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
21-1. 미코티온 리덕타제 변이체 발현 균주 제작
상기 실시예 20에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 135와 136의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl1928_P358S(또는 CA01-7547) 로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 33에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl1928_5F TGAATCTTTGGTGATTGTTG 서열번호 135
NCgl1928_6R AAGTCTATATGTATTTCCTT 서열번호 136
20-2. 미코티온 리덕타제 변이체 발현 균주의 L-라이신 생산능 비교
상기 20-1에서 제작된 각 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L- 라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 34와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 34에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 7.6 -
CJ3P_NCgl1928_P358S 8.6 13.2
표 34와 같이, CJ3P_NCgl1928_P358S 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 22. 미생물내 Co/Zn/Cd 유출 시스템 컴포넌트 변이체 발현을 위한 벡터 제작
Co/Zn/Cd 유출 시스템 컴포넌트(Co/Zn/Cd efflux system component)의 아미노산 서열(서열번호 43)의 130번째 위치의 글리신(Gly)이 아스파르트산(Asp) 아미노산으로 치환된 변이체(G130D; 서열번호 41)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드 pDCM2(대한민국 특허 공개번호 제10-2020-0136813호)를 이용하여 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 137 및 138의 서열의 프라이머 쌍과 서열번호 139 및 140의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 137 및 서열번호 140의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCgl1992(G130D)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 35에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl1992_1F TGAATTCGAGCTCGGTACCCTTTGCGCTGTCATTGAATGC 서열번호 137
NCgl1992_2R TTGGCCAAGCGAGCCATCATGTTGTCGCACTCG 서열번호 138
NCgl1992_3F CGAGTGCGACAACATGATGGCTCGCTTGGCCAA 서열번호 139
NCgl1992_4R GTCGACTCTAGAGGATCCCCCAGAGGAATCAAACGGGCAA 서열번호 140
실시예 23. Co/Zn/Cd 유출 시스템 컴포넌트 변이체를 발현하는 미생물의 L-라이신 생산능 평가
23-1. Co/Zn/Cd 유출 시스템 컴포넌트 변이체 발현 균주 제작
상기 실시예 22에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 141와 142의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl1992_G130D (또는 CA01-7548) 로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 36에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl1992_5F TTTGCGCTGTCATTGAATGC 서열번호 141
NCgl1992_6R AGAGGAATCAAACGGGCAA 서열번호 142
23-2. Co/Zn/Cd 유출 시스템 컴포넌트 변이체 발현 균주의 L-라이신 생산능 비교
상기 23-1에서 제작된 각 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L-라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 37과 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 37에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 7.9 -
CJ3P_NCgl1992_G130D 8.7 10.1
표 37과 같이, CJ3P_NCgl1992_G130D 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 24. 미생물내 DAHP 신타아제 변이체 발현을 위한 벡터 제작
DAHP 신타아제(3-deoxy-D-arabinoheptulosonate-7-phosphate synthase)의 아미노산 서열(서열번호 47)의 382번째 위치의 글리신(Gly)이 시스테인(Cys) 아미노산으로 치환된 변이체(G382C; 서열번호 45)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드 pDCM2(대한민국 특허 공개번호 제10-2020-0136813호)를 이용하여 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 143 및 144의 서열의 프라이머 쌍과 서열번호 145 및 146의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 143 및 서열번호 146의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 smaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCgl2098(G382C)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 38에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl2098_1F TGAATTCGAGCTCGGTACCCTTCGTTGCGAACTCCCCAGC 서열번호 143
NCgl2098_2R TGACGGGTCTTGTAGCAATTGGATGCGGTGAAA 서열번호 144
NCgl2098_3F TTTCACCGCATCCAATTGCTACAAGACCCGTCA 서열번호 145
NCgl2098_4R GTCGACTCTAGAGGATCCCCAGTTATCTTGAGCGTCATGC 서열번호 146
실시예 25. DAHP 신타아제 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
25-1. DAHP 신타아제 변이체 발현 균주 제작
상기 실시예 24에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 147와 148의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl2098_G382C(또는 CA01-7549) 로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 39에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl2098_5F TTCGTTGCGAACTCCCCAGC 서열번호 147
NCgl2098_6R AGTTATCTTGAGCGTCATGC 서열번호 148
25-2. DAHP 신타아제 변이체 발현 균주의 L-라이신 생산능 비교
상기 25-1에서 제작된 각 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L- 라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 40과 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 40에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 8.0 -
CJ3P_NCgl2098_G382C 9.1 13.8
표 40과 같이, CJ3P_NCgl2098_G382C 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 26: 미생물내 당 인산염 이성질화효소/에피머레이즈 변이체 발현을 위한 벡터 제작
당 인산염 이성질화효소/에피머레이즈(sugar phosphate isomerase/epimerase)의 아미노산 서열(서열번호 63)의 321번째 위치의 알라닌(Ala)이 발린(Val) 아미노산으로 치환된 변이체(A321V; 서열번호 61)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드 pDCM2(대한민국 특허 공개번호 제10-2020-0136813호)를 이용하여 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 149 및 150의 서열의 프라이머 쌍과 서열번호 151 및 152의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 149 및 서열번호 152의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 SmaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCgl0169(A321V)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 41에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl0169_1F TGAATTCGAGCTCGGTACCCGCTTCGCCGCAGATCAC 서열번호 149
NCgl0169_2R CTCGATCAGCACCTTAaCGGCTTCGTTGACGCC 서열번호 150
NCgl0169_3F GGCGTCAACGAAGCCGtTAAGGTGCTGATCGAG 서열번호 151
NCgl0169_4R GTCGACTCTAGAGGATCCCCGCGCTCTTCGTCAAGTAC 서열번호 152
실시예 27: 당 인산염 이성질화효소 / 에피머레이즈 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
27-1. 당 인산염 이성질화효소/에피머레이즈 변이체 발현 균주 제작
상기 실시예 26에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 153와 154의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl0169_A321V로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 42에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl0169_5F CCAGGCGCGAAGTACAC 서열번호 153
NCgl0169_6R CGACGGGGAGTGACCAC 서열번호 154
327-2. 당 인산염 이성질화효소/에피머레이즈 변이체 발현 균주의 L-라이신 생산능 비교
상기 27-1에서 제작된 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L-라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 43과 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 43에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 7.99 -
CJ3P_NCgl0169_A321V 9.70 21.4%
표 43과 같이, CJ3P_NCgl0169_A321V 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 28: 미생물내 세포분해 막단백질 변이체 발현을 위한 벡터 제작
세포분해 막단백질(cell division membrane protein)의 아미노산 서열(서열번호 67)의 307번째 위치의 이소류신(Ile)이 발린(Val) 아미노산으로 치환된 변이체(I307V; 서열번호 65)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드 pDCM2(대한민국 특허 공개번호 제10-2020-0136813호)를 이용하여 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 155 및 156의 서열의 프라이머 쌍과 서열번호 157 및 158의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 155 및 서열번호 158의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 SmaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCgl0043(I307V)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 44에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl0043_1F TGAATTCGAGCTCGGTACCCGGTGGGCATCGTGCTGC 서열번호 155
NCgl0043_2R ATGCCGGTGCCGGTGAcTCCGCCCCAACTCATG 서열번호 156
NCgl0043_3F CATGAGTTGGGGCGGAgTCACCGGCACCGGCAT 서열번호 157
NCgl0043_4R GTCGACTCTAGAGGATCCCCGGAAACCACGTGCGTTC 서열번호 158
실시예 29: 세포분해 막단백질 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
29-1. 세포분해 막단백질 변이체 발현 균주 제작
상기 실시예 28에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 159과 160의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl0043_I307V로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 45에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl0043_5F CGGGCTACAGCACGGTC 서열번호 159
NCgl0043_6R GCGAGTACTTGGCCACC 서열번호 160
29-2. 세포분해 막단백질 변이체 발현 균주의 L-라이신 생산능 비교
상기 29-1에서 제작된 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L-라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 46과 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 46에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 8.12 -
CJ3P_NCgl0043_I307V 9.49 16.9
표 46과 같이, CJ3P_NCgl0043_I307V 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 30: 미생물내 단백질 변이체 발현을 위한 벡터 제작
아미노산 서열(서열번호 71)의 676번째 위치의 아스파트산(Asp)이 타이로신(Tyr) 아미노산으로 치환된 변이체(D676Y; 서열번호 69)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드 pDCM2(대한민국 특허 공개번호 제 10-2020-0136813호)를 이용하여 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 161 및 162의 서열의 프라이머 쌍과 서열번호 163 및 164의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 161 및 서열번호 164의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 SmaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCgl0752(D676Y)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 47에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl0752_1F TGAATTCGAGCTCGGTACCCGCTGAGGAGCTTGGCATC 서열번호 161
NCgl0752_2R GCCTTCAGAACAGGATaTTCGGTGTCGAATTCG 서열번호 162
NCgl0752_3F CGAATTCGACACCGAAtATCCTGTTCTGAAGGC 서열번호 163
NCgl0752_4R GTCGACTCTAGAGGATCCCCCGATCCTCTCGGGCTG 서열번호 164
실시예 31: 단백질 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
31-1. 단백질 변이체 발현 균주 제작
상기 실시예 30에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 165와 166의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl0752_D676Y로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 48에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl0752_5F GGATCCACTCGTGGTGG 서열번호 165
NCgl0752_6R GATGCGGTGTCTCTAGGC 서열번호 166
31-2. 단백질 변이체 발현 균주의 L-라이신 생산능 비교
상기 31-1에서 제작된 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L-라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 49와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 49에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 8.04 -
CJ3P_NCgl0752_D676Y 9.56 18.9
표 49와 같이, CJ3P_NCgl0752_D676Y 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
실시예 32: 미생물내 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체 발현을 위한 벡터 제작
주요 촉진제 수퍼패밀리 퍼미에이즈(major facilitator superfamily permease)의 아미노산 서열(서열번호 75)의 377번째 위치의 히스티딘(His)이 글루타민(Gln) 아미노산으로 치환된 변이체(H377Q; 서열번호 73)가 L-라이신 생산에 미치는 영향을 확인하고자 이의 발현 균주 제작을 위한 벡터를 코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드 pDCM2(대한민국 특허 공개번호 제 10-2020-0136813호)를 이용하여 하기와 같이 제작하였다.
야생형 코리네박테리움 글루타미쿰 ATCC13032의 gDNA(genomic DNA)를 주형으로 서열번호 167 및 168의 서열의 프라이머 쌍과 서열번호 169 및 170의 서열의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 상기에서 얻어진 두 단편의 혼합물을 주형으로 서열번호 167 및 서열번호 170의 서열의 프라이머 쌍을 이용하여 다시 오버랩핑(overlapping) PCR을 수행하여 단편을 수득하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 수행하였다. pDCM2 플라스미드는 SmaI을 처리하고 상기에서 수득한 PCR 산물을 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD 클로닝 키트(Clontech)를 사용하였다. 결과로 얻은 벡터를 pDCM2-NCgl2592(H377Q)라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 50에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl2592_1F TGAATTCGAGCTCGGTACCCCGGTGGTTTGGTGTACGG 서열번호 167
NCgl2592_2R CGATGCTGAACACAACtTGCATGACCACGACCA 서열번호 168
NCgl2592_3F TGGTCGTGGTCATGCAaGTTGTGTTCAGCATCG 서열번호 169
NCgl2592_4R GTCGACTCTAGAGGATCCCCCGCTTAAGGTGAGGTGGC 서열번호 170
실시예 33: 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체를 발현하는 미생물의 L- 라이신 생산능 평가
33-1. 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체 발현 균주 제작
상기 실시예 32에서 제작한 벡터를 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2)에 형질전환 하였다.
형질 전환된 균주들에서 서열번호 171와 172의 서열의 프라이머 쌍을 이용하여 상동성 재조합이 일어난 균주를 선별하고 CJ3P_NCgl2592_H377Q로 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 51에 기재하였다.
명칭 서열 (5’->3’) 서열번호
NCgl2592_5F GGATGATGCTTCCGATCG 서열번호 171
NCgl2592_6R GCCGACCTACCAACAAGC 서열번호 172
33-2. 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체 발현 균주의 L-라이신 생산능 비교
상기 33-1에서 제작된 균주 및 대조군 모균주의 플라스크 발효역가 평가를 통해 L-라이신 생산능을 분석하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 30℃에서 72시간 동안, 200 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC로 L-라이신의 생산능을 측정하였다. 실험한 각 균주에 대한 배양액 중의 라이신 농도 및 농도 증가율은 하기 표 52와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 2 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 100 g, (NH4)2SO4 40 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복하였으며, 그 분석 결과의 평균값을 아래 표 52에 나타내었다.
균 주 L-라이신 농도 (g/L) 라이신 농도 증가율 (%)
CJ3P 7.86 -
CJ3P_NCgl2592_H377Q 9.49 20.7
표 52와 같이, CJ3P_NCgl2592_H377Q 균주는 대조군에 비해 증가된 L-라이신 생산량을 나타내었다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
[수탁번호]
기탁기관명 : 한국미생물보존센터
수탁번호 : KCCM12904P
수탁일자 : 20201222
기탁기관명 : 한국미생물보존센터
수탁번호 : KCCM12869P
수탁일자 : 20201202
기탁기관명 : 한국미생물보존센터
수탁번호 : KCCM12905P
수탁일자 : 20201222
기탁기관명 : 한국미생물보존센터
수탁번호 : KCCM12870P
수탁일자 : 20201202
기탁기관명 : 한국미생물보존센터
수탁번호 : KCCM12871P
수탁일자 : 20201202
기탁기관명 : 한국미생물보존센터
수탁번호 : KCCM12907P
수탁일자 : 20201222
기탁기관명 : 한국미생물보존센터
수탁번호 : KCCM12908P
수탁일자 : 20201222
Figure PCTKR2021007122-appb-img-000001
Figure PCTKR2021007122-appb-img-000002
Figure PCTKR2021007122-appb-img-000003
Figure PCTKR2021007122-appb-img-000004
Figure PCTKR2021007122-appb-img-000005
Figure PCTKR2021007122-appb-img-000006
Figure PCTKR2021007122-appb-img-000007

Claims (3)

  1. i) 하기 (1) 내지 (19)로 이루어지는 군에서 선택되는 어느 하나 이상의 변이체, ii) 상기 변이체를 코딩하는 하나 이상의 폴리뉴클레오티드, 또는 iii) 이들의 조합을 포함하는 코리네박테리움 글루타미쿰:
    (1) 서열번호 3의 220번째 위치에 상응하는 아미노산인 페닐알라닌이 시스테인으로 치환된, 서열번호 1로 기재된 아미노산 서열로 이루어진 내재성 막 수송 단백질 변이체;
    (2) 서열번호 7의 43번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 5로 기재된 아미노산 서열로 이루어진 DNA 중합효소 Ⅲ 감마 및 타우 서브유닛 변이체;
    (3) 서열번호 11의 33번째 위치에 상응하는 아미노산인 시스테인이 세린으로 치환된, 서열번호 9로 기재된 아미노산 서열로 이루어진 단백질 변이체;
    (4) 서열번호 15의 210번째 위치에 상응하는 아미노산인 아스파라긴이 아스파르트산으로 치환된, 서열번호 13로 기재된 아미노산 서열로 이루어진 전사 안티터미네이션 단백질 변이체;
    (5) 서열번호 19의 199번째 위치에 상응하는 아미노산인 발린이 메티오닌으로 치환된, 서열번호 17로 기재된 아미노산 서열로 이루어진 ABC 트랜스포터 ATP-결합 단백질 변이체;
    (6) 서열번호 23의 272번째 위치에 상응하는 아미노산인 트레오닌이 이소류신으로 치환된, 서열번호 21로 기재된 아미노산 서열로 이루어진 말레이트 디하이드로게나제 변이체;
    (7) 서열번호 27의 304번째 위치에 상응하는 아미노산인 아르기닌이 글루타민으로 치환된, 서열번호 25로 기재된 아미노산 서열로 이루어진 프리모솜 조립 단백질 변이체;
    (8) 서열번호 31의 169번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 29로 기재된 아미노산 서열로 이루어진 타입 II 시트레이트 신타아제 변이체;
    (9) 서열번호 35의 294번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 33로 기재된 아미노산 서열로 이루어진 막 단백질 변이체;
    (10) 서열번호 39의 358번째 위치에 상응하는 아미노산인 프롤린이 세린으로 치환된, 서열번호 37로 기재된 아미노산 서열로 이루어진 미코티온 리덕타제 변이체;
    (11) 서열번호 43의 130번째 위치에 상응하는 아미노산인 글리신이 아스파르트산으로 치환된, 서열번호 41로 기재된 아미노산 서열로 이루어진 Co/Zn/Cd 유출 시스템 컴포넌트 변이체;
    (12) 서열번호 47의 382번째 위치에 상응하는 아미노산인 글리신이 시스테인으로 치환된, 서열번호 45으로 기재된 아미노산 서열로 이루어진 DAHP 신타아제 변이체;
    (13) 서열번호 51의 209번째 위치에 상응하는 아미노산인 프롤린이 류신으로 치환된, 서열번호 49로 기재된 아미노산 서열로 이루어진 N-숙시닐디아미노피멜레이트 아미노트랜스퍼라제 변이체;
    (14) 서열번호 55의 592번째 위치에 상응하는 아미노산인 티로신이 페닐알라닌으로 치환된, 서열번호 53으로 기재된 아미노산 서열로 이루어진 헬리카제 변이체;
    (15) 서열번호 59의 170번째 위치에 상응하는 아미노산인 글루탐산이 라이신으로 치환된, 서열번호 57로 기재된 아미노산 서열로 이루어진 단백질 변이체;
    (16) 서열번호 63의 321번째 위치에 상응하는 아미노산인 알라닌이 발린으로 치환된, 서열번호 61로 기재된 아미노산 서열로 이루어진 당 인산염 이성질화효소/에피머레이즈 변이체;
    (17) 서열번호 67의 307번째 위치에 상응하는 아미노산인 이소류신이 발린으로 치환된, 서열번호 65로 기재된 아미노산 서열로 이루어진 세포분해 막단백질 변이체;
    (18) 서열번호 71의 676번째 위치에 상응하는 아미노산인 아스파트산이 타이로신으로 치환된, 서열번호 69로 기재된 아미노산 서열로 이루어진 단백질 변이체; 및
    (19) 서열번호 75의 377번째 위치에 상응하는 아미노산인 히스티딘이 글루타민으로 치환된, 서열번호 73로 기재된 아미노산 서열로 이루어진 주요 촉진제 수퍼패밀리 퍼미에이즈 변이체.
  2. 제1항에 있어서, 상기 단백질 변이체 또는 상기 변이체를 코딩하는 폴리뉴클레오티드를 포함하지 않는 코리네박테리움 글루타미쿰과 비교하여 L-라이신 생산능이 증가된, 균주.
  3. 제1항 또는 제2항의 코리네박테리움 글루타미쿰 균주를 배지에서 배양하는 단계를 포함하는, L-라이신 생산 방법.
PCT/KR2021/007122 2021-01-29 2021-06-08 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법 WO2022163951A1 (ko)

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
KR10-2021-0013694 2021-01-29
KR20210013693 2021-01-29
KR10-2021-0013691 2021-01-29
KR1020210013691A KR20220110412A (ko) 2021-01-29 2021-01-29 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
KR1020210013690A KR20220110411A (ko) 2021-01-29 2021-01-29 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
KR10-2021-0013690 2021-01-29
KR10-2021-0013693 2021-01-29
KR1020210013694A KR20220110413A (ko) 2021-01-29 2021-01-29 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
PCT/KR2021/003261 WO2022163904A1 (ko) 2021-01-29 2021-03-16 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
KRPCT/KR2021/003261 2021-03-16

Publications (1)

Publication Number Publication Date
WO2022163951A1 true WO2022163951A1 (ko) 2022-08-04

Family

ID=82653572

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/007122 WO2022163951A1 (ko) 2021-01-29 2021-06-08 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법

Country Status (1)

Country Link
WO (1) WO2022163951A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4098658A4 (en) * 2021-04-12 2023-05-10 CJ CheilJedang Corporation NEW PROTEIN VARIANT AND PROCESS FOR THE PRODUCTION OF L-LYSINE WITH IT
EP4098749A4 (en) * 2021-04-12 2023-07-19 CJ CheilJedang Corporation NOVEL CELL-DIVIDING MEMBRANE PROTEIN VARIANT AND METHODS FOR PRODUCTION OF L-LYSINE USING SAME
EP4056694A4 (en) * 2021-01-29 2024-01-24 CJ Cheiljedang Corporation NEW TYPE II CITRATE SYNTHASE VARIANT AND METHOD FOR PRODUCING L-LYSINE USING THE SAME

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100838038B1 (ko) * 2006-12-29 2008-06-12 씨제이제일제당 (주) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및그를 이용한 ｌ-라이신 생산 방법
KR20100000665A (ko) * 2008-06-25 2010-01-06 씨제이제일제당 (주) 라이신 생산능이 향상된 코리네박테리움 및 이를 이용한라이신 생산방법
KR101582008B1 (ko) * 2013-10-15 2015-12-31 씨제이제일제당 (주) 생물막 형성 억제 활성을 가지는 유전자 및 이 유전자가 불활성화된 균주를 이용한 l-라이신 생산 방법
KR101851467B1 (ko) * 2016-11-21 2018-04-25 대상 주식회사 핵산 대사 경로가 약화된 아미노산 고생산능 변이 균주 및 이를 이용한 아미노산의 제조 방법
KR102147776B1 (ko) * 2019-09-20 2020-08-26 대상 주식회사 L-라이신 생산능력이 향상된 코리네박테리움속 미생물 및 이를 이용한 라이신의 생산 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100838038B1 (ko) * 2006-12-29 2008-06-12 씨제이제일제당 (주) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및그를 이용한 ｌ-라이신 생산 방법
KR20100000665A (ko) * 2008-06-25 2010-01-06 씨제이제일제당 (주) 라이신 생산능이 향상된 코리네박테리움 및 이를 이용한라이신 생산방법
KR101582008B1 (ko) * 2013-10-15 2015-12-31 씨제이제일제당 (주) 생물막 형성 억제 활성을 가지는 유전자 및 이 유전자가 불활성화된 균주를 이용한 l-라이신 생산 방법
KR101851467B1 (ko) * 2016-11-21 2018-04-25 대상 주식회사 핵산 대사 경로가 약화된 아미노산 고생산능 변이 균주 및 이를 이용한 아미노산의 제조 방법
KR102147776B1 (ko) * 2019-09-20 2020-08-26 대상 주식회사 L-라이신 생산능력이 향상된 코리네박테리움속 미생물 및 이를 이용한 라이신의 생산 방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN 25 May 2020 (2020-05-25), ANONYMOUS : "MHS family MFS transporter [Corynebacterium glutamicum] ", XP055953709, retrieved from NCBI Database accession no. WP_011015489 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4056694A4 (en) * 2021-01-29 2024-01-24 CJ Cheiljedang Corporation NEW TYPE II CITRATE SYNTHASE VARIANT AND METHOD FOR PRODUCING L-LYSINE USING THE SAME
EP4098658A4 (en) * 2021-04-12 2023-05-10 CJ CheilJedang Corporation NEW PROTEIN VARIANT AND PROCESS FOR THE PRODUCTION OF L-LYSINE WITH IT
EP4098749A4 (en) * 2021-04-12 2023-07-19 CJ CheilJedang Corporation NOVEL CELL-DIVIDING MEMBRANE PROTEIN VARIANT AND METHODS FOR PRODUCTION OF L-LYSINE USING SAME

Similar Documents

Publication Publication Date Title
WO2020204427A1 (ko) 신규 l-트립토판 배출 단백질 변이체 및 이를 이용한 l-트립토판을 생산하는 방법
WO2022163951A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2019164348A1 (ko) 신규 l-트립토판 배출 단백질 및 이를 이용한 l-트립토판을 생산하는 방법
WO2021150029A1 (ko) Nadp 의존적 글리세르알데하이드-3-포스페이트 디하이드로지나제를 포함하는 미생물을 이용하여 ｌ-아미노산을 생산하는 방법
WO2021049866A1 (ko) L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법
WO2021125896A1 (ko) 내막 단백질의 변이체 및 이를 이용한 목적 산물 생산 방법
WO2017069578A1 (ko) L-이소루신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용하여 l-이소루신을 생산하는 방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2017014532A1 (ko) 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법
WO2022225075A1 (ko) 신규한 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2021060696A1 (ko) 디하이드로디피콜린산 리덕타제 변이형 폴리펩티드 및 이를 이용한 l-쓰레오닌 생산방법
WO2019164351A1 (ko) 마이코스포린 유사 아미노산을 생산하는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산방법
WO2021085999A1 (ko) 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법
WO2022164118A1 (ko) 프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
WO2020226341A1 (ko) L-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산을 생산하는 방법
WO2022050671A1 (ko) L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
WO2022231036A1 (ko) 신규한 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2019017706A2 (ko) 퓨트레신을 생산하는 미생물 및 이를 이용한 퓨트레신 생산방법
WO2022231042A1 (ko) 신규한 변이체 및 이를 이용한 l-발린 생산 방법
WO2021261733A1 (ko) L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법
WO2022124708A1 (ko) 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022231027A1 (ko) 신규한 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022216088A1 (ko) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21923361

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21923361

Country of ref document: EP

Kind code of ref document: A1