WO2021049866A1 - L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법 - Google Patents

L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법 Download PDF

Info

Publication number
WO2021049866A1
WO2021049866A1 PCT/KR2020/012154 KR2020012154W WO2021049866A1 WO 2021049866 A1 WO2021049866 A1 WO 2021049866A1 KR 2020012154 W KR2020012154 W KR 2020012154W WO 2021049866 A1 WO2021049866 A1 WO 2021049866A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
threonine
rhtc
amino acid
protein
Prior art date
Application number
PCT/KR2020/012154
Other languages
English (en)
French (fr)
Inventor
서창일
김효진
이지선
최솔
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to JP2021569881A priority Critical patent/JP7295276B2/ja
Priority to BR112021025448A priority patent/BR112021025448A2/pt
Priority to AU2020346645A priority patent/AU2020346645B2/en
Priority to US17/623,226 priority patent/US20230012923A1/en
Priority to CN202080055138.5A priority patent/CN114729012B/zh
Priority to MX2021014853A priority patent/MX2021014853A/es
Priority to EP20862085.6A priority patent/EP3957646A4/en
Publication of WO2021049866A1 publication Critical patent/WO2021049866A1/ko
Priority to ZA2021/09716A priority patent/ZA202109716B/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01003—Homoserine dehydrogenase (1.1.1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/02—Phosphotransferases with a carboxy group as acceptor (2.7.2)
    • C12Y207/02004—Aspartate kinase (2.7.2.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y604/00—Ligases forming carbon-carbon bonds (6.4)
    • C12Y604/01—Ligases forming carbon-carbon bonds (6.4.1)
    • C12Y604/01001—Pyruvate carboxylase (6.4.1.1)

Definitions

  • the present application relates to a variant of the L-threonine excreting protein and a method for producing L-threonine using the same.
  • L-Threonine (L-Thr) is one of the essential amino acids and has been widely used as a feed additive, and has also been widely used as a raw material for pharmaceuticals such as infusions and health food materials.
  • microorganisms used for the production of L-threonine were mainly selected strains that showed resistance to analogs through chemical or physical mutations in the early days.However, due to the rapid development of gene recombination technology in the 1990s and the discovery of molecular-level regulatory mechanisms, genes Recombinant strains using engineering techniques are mainly used.
  • the expression of a specific amino acid excreting gene has caused an increase in the productivity of the corresponding amino acid in microorganisms.
  • Enhancing the expression of the L-lysine excreting gene (lysE) in microorganisms of the genus Corynebacterium improved the productivity of lysine (WO9723597A2).
  • L-glutamic acid, L-lysine, L-threonine, L-alanine, L-histidine, L-proline by enhancing the yahN gene, yeaS gene, yfiK gene and yggA gene, which are genes whose function is not known in E. coli.
  • L-arginine, L-valine, and L-isoleucine are disclosed in the patent (EP1016710B1) that the productivity is improved.
  • the present inventors completed the present application by selecting a mutant rhtC to improve the excretion ability of L-threonine-releasing protein (RhtC) encoded by rhtC, and confirming that the amount of L-threonine production was dramatically improved through this. .
  • One object of the present application is to include a substitution with another amino acid at the position corresponding to the 53rd or 62nd position of SEQ ID NO: 1, and at least 80% or more and less than 100% sequence homology with the amino acid sequence of SEQ ID NO: 1 It is to provide a variant of the L- threonine-releasing protein, having an L-threonine-releasing activity.
  • Another object of the present application is to provide a polynucleotide encoding a variant of the L-threonine excreting protein.
  • Another object of the present application is to provide a vector containing the polynucleotide.
  • Another object of the present application is to produce L-threonine comprising any one or more of a variant of the L-threonine-releasing protein, a polynucleotide encoding the variant of the protein, and a vector containing the polynucleotide. It is to provide microorganisms.
  • Another object of the present application is to provide a method for producing L-threonine, comprising the step of culturing the microorganism in a medium.
  • One aspect of the present application for achieving the above object provides a variant of the L-threonine-releasing protein comprising one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1.
  • the present application provides a variant of a protein in which i) the 53rd amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, and/or ii) the 62nd amino acid is substituted with another amino acid.
  • the amino acid substitution is i) the 53rd amino acid is substituted with threonine, or ii) the 62nd amino acid is serine, arginine, alanine, aspartic acid, lysine, proline, cysteine, glycine, threonine, isoleucine, tyrosine, valine, It may include those substituted with an amino acid selected from histidine, phenylalanine, methionine, glutamine, asparagine, glutamic acid or tryptophan.
  • Threonine is one of essential amino acids that are not synthesized in the body and can be supplied only as food, and constitutes mucine, which is a protective substance for intestinal epithelium. Can cause a decrease.
  • Threonine is widely used as a raw material for pharmaceuticals such as feed additives and infusions, and as a health food material.
  • threonine also has D-type and L-type stereoisomers, and threonine derived from nature mostly exists as L-threonine (L-Threonine, L-Thr), which is an L-type stereoisomer. do.
  • threonine (Threonine, Thr) may be used in combination with L-threonine (L-Threonine, L-Thr).
  • L-threonine exporter (L-threonine efflux protein) is a protein that mediates L-threonine to be released out of cells, and has five transmembrane domains. It is known as an inner membrane protein with ). Experimental topology analysis suggests that its C-terminus is present in the cytoplasm (Daley DO et al., Global topology analysis of the Escherichia coli inner membrane proteome, Science. 2005 May 27; 308(5726):1321) -3.).
  • the L-threonine-releasing protein may be, for example, a protein comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115.
  • the protein comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115 is a protein having the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115, SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115 It can be used interchangeably with a protein composed of an amino acid sequence.
  • the L-threonine-releasing protein may be used in combination with RhtC protein or RhtC.
  • SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115 refers to an amino acid sequence having L-threonine excretion activity.
  • SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115 is a protein sequence having L-threonine excretion activity encoded by the rhtC gene.
  • the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115 can be obtained from GenBank of NCBI, a known database.
  • SEQ ID NO: 1 is derived from Escherichia coli ( E.
  • SEQ ID NO: 113 is derived from Shigella flexneri (Shegella flexneri )
  • SEQ ID NO: 115 may be derived from Escherichia fergusonii (Escherichia fergusonii) However, it is not limited thereto, and any amino acid sequence of a protein having the same activity as that of the protein containing the amino acid sequence may be included without limitation.
  • the SEQ ID NO: 113 or SEQ ID NO: 115 may each have 99% homology to SEQ ID NO: 1, but are not limited thereto.
  • the protein having L-threonine excretion activity in the present application is defined as a protein comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115, SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: A protein comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115, not excluding insignificant sequence additions before and after the amino acid sequence of 115, or naturally occurring mutations, or silent mutations thereof It will be apparent to those skilled in the art that if it has the same or corresponding activity to each other, it corresponds to the protein having L-threonine excretion activity of the present application.
  • the protein having L-threonine excretion activity of the present application is the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 or 80%, 85%, 90%, 95%, 96%, It may be a protein composed of an amino acid sequence having 97%, 98%, or 99% or more homology or identity.
  • a protein having an amino acid sequence in which some sequence is deleted, modified, substituted or added is also included within the range of the protein subject to mutation of the present application. Is self-explanatory.
  • polypeptide consisting of the amino acid sequence of SEQ ID NO: 1' is a sequence corresponding to SEQ ID NO: 1, or in the case of a sequence having the same or corresponding activity, a'polypeptide consisting of the amino acid sequence of SEQ ID NO: 1' It is self-evident that it can belong.
  • variants are different from the recited sequence in which one or more amino acids are conservative substitution and/or modification, but the function of the protein ( functions) or properties are maintained. Variants differ from the identified sequence by several amino acid substitutions, deletions or additions. Such variants can generally be identified by modifying one or more amino acids of the amino acid sequence of the protein and evaluating the properties of the modified protein. That is, the ability of the variant may be increased, unchanged, or decreased compared to the native protein. In addition, some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, have been removed.
  • variants may include variants in which a portion of the mature protein has been removed from the N- and/or C-terminus.
  • variant may include terms such as variant, modified, mutated protein, variant polypeptide, and mutant (in English, modified, modified protein, modified polypeptide, mutant, mutein, divergent, variant, etc.), If it is a term used in a mutated meaning, it is not limited thereto.
  • the mutant may be one having an increased activity of a mutated protein compared to a natural wild-type or unmodified protein, but is not limited thereto.
  • conservative substitution means replacing one amino acid with another amino acid having similar structural and/or chemical properties. Such variants may, for example, have one or more conservative substitutions while still retaining one or more biological activities.
  • amino acid substitutions can generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. For example, among amino acids having an electrically charged amino acid, positively charged (basic) amino acids are arginine, lysine, and histidine, and negatively charged (acidic) amino acids are glutamic acid and arpartic acid.
  • nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan and proline, and are polar or hydrophilic ( hydrophilic) amino acids include serine, threonine, cysteine, tyrosine, asparagine and glutamine, and among the non-polar amino acids, aromatic amino acids include phenylalanine, tryptophan and tyrosine.
  • variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide.
  • the polypeptide can be conjugated with a signal (or leader) sequence at the N-terminus of the protein involved in the transfer of the protein co-translationally or post-translationally.
  • the polypeptide may be conjugated with other sequences or linkers to identify, purify, or synthesize the polypeptide.
  • substitution with another amino acid' is not limited as long as it is an amino acid different from the amino acid before substitution. That is, if alanine, which is the 53rd amino acid in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115, is substituted with an amino acid residue other than alanine, or the 62nd amino acid leucine is substituted with an amino acid residue other than leucine, it is not limited. Does not.
  • alanine which is the 53rd amino acid in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115, is substituted with an amino acid residue other than alanine, or the 62nd amino acid leucine is substituted with an amino acid residue other than leucine, it is not limited. Does not.
  • a specific amino acid when expressing'a specific amino acid has been substituted', it is obvious that it is substituted with an amino acid different from the amino acid before the substitution, even if
  • the variant may be one in which any one or more of the 53rd or 62nd amino acids in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115 is substituted with an amino acid different from the previous amino acid.
  • the variant may be a variant having an uncharged amino acid, substituted with an amino acid different from the amino acid before substitution, but is not limited thereto.
  • the variant may be a variant in which i) the 53rd amino acid is substituted with another amino acid, or ii) the 62nd amino acid is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115.
  • Substitution with the other amino acid is i) the 53rd amino acid is substituted with threonine, or ii) the 62nd amino acid is serine, arginine, alanine, aspartic acid, lysine, proline, cysteine, glycine, threonine, isoleucine, tyrosine , Valine, histidine, phenylalanine, methionine, glutamine, asparagine, glutamic acid or tryptophan.
  • the variant is in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 i) the 53rd amino acid is substituted with threonine, or ii) the 62nd amino acid is serine, arginine, alanine, aspartic acid, It may be a variant substituted with an amino acid selected from lysine, proline, cysteine, glycine, threonine, isoleucine, tyrosine, valine, histidine, phenylalanine, methionine, glutamine, asparagine, glutamic acid or tryptophan.
  • the variant of the L-threonine-releasing protein provided in the present application is substituted with an amino acid at a specific position among the proteins having the L-threonine-releasing ability described above, so that the L-threonine-releasing ability is compared to the pre-mutation protein. May mean increased variants.
  • amino acid sequence of SEQ ID NO: 1 SEQ ID NO: 113, or SEQ ID NO: 115, i) the 53rd amino acid is substituted with threonine, or ii) the 62nd amino acid is substituted with another amino acid. It may include an amino acid sequence of any one of 116, specifically, may be one consisting essentially of an amino acid sequence of any one of SEQ ID NOs: 93 to 112, 114 and 116, and more specifically It may consist of an amino acid sequence of any one of SEQ ID NOs: 93 to 112, 114, and 116, but is not limited thereto.
  • the variant includes a substitution with another amino acid at the position corresponding to the 53rd or 62nd position of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115, and the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115 It may have a sequence homology of at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% or more and less than 100%, and may have L-threonine excretion activity.
  • the variant is the amino acid sequence of any one of SEQ ID NOs: 93 to 112, 114, and 116 or at least one amino acid selected from the 53rd or 62nd amino acid in the amino acid sequence is fixed, and 80% or more homology or identity thereto. It may include an amino acid sequence having, but is not limited thereto. Specifically, the variant of the present application is at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the amino acid sequence of any one of SEQ ID NOs: 93 to 112, 114 and 116 It may include a polypeptide having.
  • the term'homology' or'identity' means the degree to which two given amino acid sequences or base sequences are related, and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and the default gap penalty established by the program used can be used together.
  • Substantially, homologous or identical (identical) sequences are generally in moderate or high stringent conditions along at least about 50%, 60%, 70%, 80% or 90% of the sequence or full-length. (stringent conditions) can be hybridized. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotide.
  • the homology, similarity, or identity of a polynucleotide or polypeptide can be found in, for example, Smith and Waterman, Adv. Appl. As known in Math (1981) 2:482, for example, Needleman et al. (1970), J Mol Biol. It can be determined by comparing sequence information using a GAP computer program such as 48:443.
  • the GAP program is defined as the total number of symbols in the shorter of the two sequences, divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are (1) binary comparison matrix (contains values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); And (3) no penalty for end gaps.
  • L-threonine-releasing protein variant refers to a variant polypeptide having L-threonine-producing ability, L-threonine-producing variant polypeptide, and a variant that produces L-threonine.
  • Polypeptides, variant polypeptides having L-threonine excretion activity, L-threonine excretion activity variant, L-threonine excretion variant, variant RhtC, RhtC variant, variant L-threonine excretion protein, etc. Can be used.
  • the protein may be derived from Escherichia coli , E. coli , but is not limited thereto.
  • the variant of the L-threonine-releasing protein may include a mutation at the 53rd and/or 62nd position in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115, and SEQ ID NO: 1, SEQ ID NO: 113 or Even if it is an amino acid sequence in which an amino acid is added or deleted in SEQ ID NO: 115, the amino acid at the position corresponding to amino acid 53 and/or 62 from the N-terminus of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115 is substituted. It is included in the scope of the application.
  • the variant of the L-threonine-releasing protein is that the 53rd or 62nd amino acid in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115 is substituted with another amino acid, and SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: It may be a mutant L-threonine releasing protein comprising an amino acid sequence of 115 or having an enhanced activity compared to the L-threonine releasing protein before mutation derived from a wild-type microorganism.
  • Such a variant of the L-threonine excreting protein is at least 80%, 85%, 90 with SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 and/or SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 as described above. %, 95%, 96%, 97%, 98%, or 99% or more of the amino acid at the position corresponding to the 53rd or 62nd of SEQ ID NO: 1, SEQ ID NO: 113 or SEQ ID NO: 115 in amino acids having homology or identity It means that it has been mutated.
  • the 53rd or 62nd amino acid mutation is i) the 53rd amino acid is substituted with threonine, or ii) the 62nd amino acid is serine, arginine, alanine, aspartic acid, lysine, proline, cysteine, glycine, threonine, isoleucine , Tyrosine, valine, histidine, phenylalanine, methionine, glutamine, asparagine, glutamic acid or tryptophan.
  • the variant of the L-threonine-releasing protein is i) the 53rd amino acid is substituted with threonine in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115, or ii) the 62nd amino acid is serine, Arginine, alanine, aspartic acid, lysine, proline, cysteine, glycine, threonine, isoleucine, tyrosine, valine, histidine, phenylalanine, methionine, glutamine, asparagine, glutamic acid, or tryptophan.
  • a protein comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115 or a wild-type microorganism-derived L-threonine-releasing protein before mutation may have an enhanced activity.
  • the production amount of L-threonine is increased. This is because wild-type microorganisms cannot produce L-threonine, or can produce very trace amounts even if they produce L-threonine, whereas L-threonine through a variant of the L-threonine-releasing protein of the present application It is significant that it can increase production.
  • Another aspect of the present application provides a polynucleotide encoding a variant of the L-threonine excreting protein.
  • the L-threonine, a protein having L-threonine excretion activity including the amino acid sequence of SEQ ID NO: 1, and variants thereof are as described above.
  • polynucleotide refers to a polymer of nucleotides in which a nucleotide unit is connected in a long chain by covalent bonds, and is a DNA or RNA strand having a certain length or more, and more specifically, encoding the variant. Refers to a polynucleotide fragment.
  • the polynucleotide encoding the variant of the L-threonine-releasing protein of the present application may be included without limitation as long as it is a polynucleotide sequence encoding the variant polypeptide having L-threonine-releasing activity of the present application.
  • the gene encoding the amino acid sequence of the L-threonine-releasing protein is the rhtC gene, and the gene is Escherichia coli , E. coli , Shigella flexneri , or Escherichia pergusoni ( Escherichia fergusonii ) may be derived, but is not limited thereto.
  • the gene may be a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115, and more specifically, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1 is the nucleotide sequence of SEQ ID NO: 2 It may be a sequence including, but is not limited thereto.
  • the polynucleotide of the present application varies in the coding region within a range that does not change the amino acid sequence of the polypeptide due to the degeneracy of the codon or in consideration of the preferred codon in the organism to express the polypeptide. Transformation can be made. Specifically, any polynucleotide sequence encoding a variant of the L-threonine-releasing protein in which the 53rd or 62nd amino acid in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115 is substituted with another amino acid may be included without limitation. I can.
  • a probe that can be prepared from a known gene sequence, for example, a complementary sequence for all or part of the nucleotide sequence and hydride under stringent conditions, and the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115
  • stringent condition means a condition that enables specific hybridization between polynucleotides. These conditions are specifically described in the literature (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
  • genes with high homology or identity 40% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly specifically 99% or more homology or Under conditions that hybridize genes with identity and do not hybridize with genes with lower homology or identity, or wash conditions for common southern hybridization, 60°C, 1 ⁇ SSC, 0.1% SDS, specifically At a salt concentration and temperature corresponding to 60° C., 0.1 ⁇ SSC, 0.1% SDS, more specifically 68° C., 0.1 ⁇ SSC, and 0.1% SDS, the conditions for washing once, specifically 2 to 3 times can be listed. have.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other.
  • adenosine is complementary to thymine
  • cytosine is complementary to guanine.
  • the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments that are complementary to the entire sequence.
  • polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose.
  • the appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide and the parameters are well known in the art (eg, J. Sambrook et al., homolog).
  • Another aspect of the present application provides a vector comprising a polynucleotide encoding a variant of the L-threonine excreting protein.
  • the L-threonine, a protein having L-threonine excretion activity including the amino acid sequence of SEQ ID NO: 1, and variants thereof are as described above.
  • vector refers to a DNA preparation containing the nucleotide sequence of a polynucleotide encoding the polypeptide of interest operably linked to a suitable regulatory sequence so that the polypeptide of interest can be expressed in a suitable host.
  • the regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • Vectors can be transformed into suitable host cells and then replicated or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses, and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as a phage vector or a cosmid vector, and as a plasmid vector, pBR system, pUC system, pBluescriptII system , pGEM system, pTZ system, pCL system, pET system, etc. can be used.
  • pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, and the like can be used.
  • a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. It may further include a selection marker for confirming whether the chromosome is inserted. Selection markers are used to select cells transformed with a vector, i.e., to confirm the insertion of a nucleic acid molecule of interest, and impart a selectable phenotype such as drug resistance, nutritional demand, resistance to cytotoxic agents, or expression of surface polypeptides. Markers can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, and thus transformed cells can be selected.
  • the present application provides a microorganism that produces L-threonine, including a variant of the L-threonine-releasing protein or a polynucleotide encoding it.
  • a microorganism comprising a variant polypeptide means a microorganism having a naturally weak L-threonine-producing ability or L- It refers to a microorganism that is endowed with L-threonine-producing ability to a parent strain without threonine-producing ability.
  • the microorganism includes one or more amino acid mutations in the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 113, or SEQ ID NO: 115.
  • the amino acid mutation may include a substitution of another amino acid at the 53rd or 62nd amino acid from the N-terminus.
  • the 53rd or 62nd amino acid in the amino acid sequence of SEQ ID NO: 113 or SEQ ID NO: 115 is substituted with another amino acid, and may be a microorganism expressing a variant polypeptide having L-threonine excretion activity, but is not limited thereto.
  • the L-threonine, a protein having L-threonine excretion activity including the amino acid sequence of SEQ ID NO: 1, and variants thereof are as described above.
  • the term "to be expressed /" refers to a state in which a target protein is introduced into a microorganism or modified to be expressed in a microorganism.
  • the target protein is a protein present in a microorganism, it means a state in which its activity is enhanced compared to intrinsic or before modification.
  • the "target protein” may be a variant of the protein having the above-described L-threonine excretion ability.
  • introduction of a protein means that the microorganism exhibits an activity of a specific protein that it did not originally have, or exhibits an improved activity compared to the intrinsic activity of the protein or the activity before modification.
  • a polynucleotide encoding a specific protein may be introduced into a chromosome in a microorganism, or a vector including a polynucleotide encoding a specific protein may be introduced into a microorganism to exhibit its activity.
  • enhancing the activity means that the activity is improved compared to the intrinsic activity of a specific protein possessed by the microorganism or the activity before modification.
  • the "intrinsic activity” refers to the activity of a specific protein originally possessed by the parent strain before the change in the trait of a microorganism when the trait of a microorganism is changed due to genetic variation caused by natural or artificial factors.
  • the enhancement of the activity of the present application is to increase the intracellular copy number of the gene encoding the protein variant, a method of introducing a mutation into the expression control sequence of the gene encoding the protein variant, and the L-threonine excretion activity.
  • a method of replacing a gene expression control sequence encoding a protein variant having a strong activity and a method of replacing a gene encoding a natural protein having L-threonine excretion activity on a chromosome with a gene encoding the protein variant , Any one or more selected from the group consisting of a method of additionally introducing a mutation into a gene encoding a protein having L-threonine excretion activity so that the activity of the protein variant is enhanced, and a method of introducing a protein variant into a microorganism. It can be made by a method, but is not limited thereto.
  • the increase in the copy number of the gene is not particularly limited thereto, but may be performed in a form operably linked to a vector, or may be performed by being inserted into a chromosome in a host cell.
  • a vector capable of replicating and functioning irrespective of the host, in which the polynucleotide encoding the protein of the present application is operably linked may be introduced into a host cell.
  • a vector capable of inserting the polynucleotide into a chromosome in a host cell to which the polynucleotide is operably linked may be introduced into a chromosome of a host cell. Insertion of the polynucleotide into the chromosome can be accomplished by any method known in the art, for example, by homologous recombination.
  • modifying the expression control sequence to increase the expression of the polynucleotide is not particularly limited thereto, but deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence to further enhance the activity of the expression control sequence, or It can be carried out by inducing a mutation in the sequence in combination, or by replacing it with a nucleic acid sequence having a stronger activity.
  • the expression control sequence is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence controlling termination of transcription and translation, and the like.
  • a strong promoter may be linked to the top of the polynucleotide expression unit instead of the original promoter, but is not limited thereto.
  • Examples of known strong promoters include cj1 to cj7 promoters (Korean Patent Registration No. 10-0620092), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter. , SPL13 (sm3) promoter (Korea Patent Registration No. 10-1783170), O2 promoter (Korea Patent Registration No. 10-1632642), tkt promoter and yccA promoter, but are not limited thereto.
  • modification of the polynucleotide sequence on the chromosome is not particularly limited thereto, but mutations in the expression control sequence by deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence, or a combination thereof to further enhance the activity of the polynucleotide sequence It may be performed by inducing or by replacing with a polynucleotide sequence modified to have stronger activity.
  • the introduction and enhancement of such protein activity is generally at least 1%, 10%, 25%, 50%, based on the activity or concentration of the protein in the wild-type or unmodified microbial strain. It may be increased to 75%, 100%, 150%, 200%, 300%, 400% or 500%, up to 1000% or 2000%, but is not limited thereto.
  • the term "unmodified microorganism” does not exclude strains containing mutations that may occur naturally in microorganisms, and is a natural strain itself, or a microorganism that does not contain a variant of the L-threonine-releasing protein, Or it means a microorganism that has not been transformed with a vector containing a polynucleotide encoding a variant of the L-threonine excreting protein.
  • the microorganism containing the variant of the L-threonine-releasing protein or containing a polynucleotide encoding the same may be a recombinant microorganism produced by transformation with a vector containing the polynucleotide, but is not limited thereto. Does not.
  • the term "transformation” means introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • Transformed polynucleotides may include all of them, whether inserted into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed in the host cell.
  • the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form as long as it can be introduced into a host cell and expressed.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements necessary for self-expression.
  • the expression cassette may generally include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replicating.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked in the above means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target polypeptide of the present application.
  • a microorganism producing L-threonine includes all microorganisms that have undergone genetic modification naturally or artificially, and causes such as insertion of an external gene or enhancement or inactivation of the activity of an endogenous gene. As a result, a specific mechanism is weakened or enhanced, and may be a microorganism having a genetic mutation or enhanced activity for the production of a desired L-threonine.
  • the microorganism producing L-threonine includes a variant of the L-threonine-releasing protein, and compares the desired L-threonine with a wild-type or unmodified microorganism from a carbon source in the medium.
  • microorganisms that can be produced in excess.
  • the “microorganism producing L-threonine” may be used interchangeably with “a microbe having an ability to produce L-threonine” or “a microbe producing L-threonine”.
  • the microorganism producing the L-threonine may be a recombinant microorganism.
  • the recombinant microorganism is as described above.
  • the type of the microorganism producing L-threonine is not particularly limited as long as it can produce L-threonine, but specifically, Corynebacterium genus, Escherichia genus, Enterobacter (Enterbacter), An air Winiah (Erwinia) genus, Serratia marcescens (Serratia) may be a microorganism belonging to the genus Providencia (Providencia) in and Brevibacterium (Brevibacterium), and more specifically, Corynebacterium ( Corynebacterium ) or Escherichia (Escherichia) may be a microorganism belonging to the genus.
  • Escherichia microorganisms may be Escherichia coli , and microorganisms of the genus Corynebacterium are Corynebacterium glutamicum , Corynebacterium Corynebacterium ammoniagenes , Corynebacterium crudilactis , Corynebacterium deserti , Corynebacterium efficiens, Corynebacterium caluna ( Corynebacterium callunae ), Corynebacterium stationis , Corynebacterium singulare , Corynebacterium halotolerans , Corynebacterium striatum , Corynebacterium Paul Ruti Solidarity (Corynebacterium pollutisoli), Corynebacterium or the like already Tansu Cxorynebacterium imitans), Corynebacterium test-to-gavel lease (Corynebacterium testudinoris) or Coryne
  • the parent strain of a microorganism producing L-threonine modified to express the protein having L-threonine excretion activity or the protein variant is not particularly limited as long as it is a microorganism that produces L-threonine.
  • the L-threonine-producing microorganism enhances the biosynthetic pathway of L-threonine, or releases feedback inhibition for L-threonine, in order to increase the production of L-threonine, It may be a microorganism that inactivates a gene that weakens the biosynthetic pathway of L-threonine, increases the activity of the L-threonine operon, and/or confers resistance to L-threonine analogs.
  • thrC encoding threonine synthase
  • ppc gene encoding phosphoenol pyruvate carboxylase
  • glucose influx The galP gene involved, the lysC gene encoding lysine-sensitive aspartokinase 3, the hom gene encoding homoserine dehydrogenase, or inducing an increase in the oxaloacetate pool
  • the expression of the pyc gene or the like may be enhanced or increased in microorganisms.
  • the lysC gene, the hom gene, or the thrA gene having the dual functionality of aspartokinase and homoserine dehydrogenase 1 (Bifunctional aspartokinase/homoserine dehydrogenase 1) Genetic mutations in the back can be introduced into microorganisms.
  • oxaloacetate an intermediate of L-threonine biosynthesis, is converted to phosphoenol pyruvate (PEP).
  • PEP phosphoenol pyruvate
  • a plasmid containing a threonine operon (Japanese Patent Laid-Open No. 2005-227977) composed of a gene encoding E. coli or a threonine operon derived from E. coli was introduced into a microorganism (TURBA E, et al, Agric. Biol. Chem. 53:2269 ⁇ 2271, 1989), can increase the expression of threonine operon in microorganisms.
  • the microorganism may have resistance to ⁇ -amino- ⁇ -hydroxy valeric acid or D,L-threonine hydroxamate, which is an L-threonine analog.
  • L-threonine production capacity may be enhanced by a method for regulating gene expression known in the art.
  • the term "strengthening/increasing” is a concept including both increased activity compared to intrinsic activity.
  • Such enhancement or increase in gene activity can be achieved by application of various methods well known in the art.
  • Examples of the method include increasing the intracellular copy number of the gene; A method of introducing a mutation into an expression control sequence of a gene; A method of replacing the gene expression control sequence with a sequence having strong activity; A method of additionally introducing a mutation into the gene so that the activity of the gene is enhanced; And it may be made by any one or more methods selected from the group consisting of a method of introducing a foreign gene into a microorganism, and may be achieved by a combination thereof, but is not particularly limited by the above examples.
  • activation is a concept that includes both weakened or no activity compared to intrinsic activity.
  • Inactivation of such gene activity can be achieved by application of various methods well known in the art.
  • Examples of the method include a method of deleting all or part of a gene on a chromosome, including when the activity of the gene is removed; A method of replacing the gene encoding the protein on the chromosome with a gene mutated to decrease the activity of the protein; A method of introducing a mutation into an expression control sequence of a gene on a chromosome encoding the protein; A method of replacing the expression control sequence of the gene encoding the protein with a sequence having weak or no activity (eg, replacing the promoter of the gene with a promoter weaker than the intrinsic promoter); A method of deleting all or part of a gene on a chromosome encoding the protein; A method of introducing an antisense oligonucleotide (eg, antisense RNA) that complements the transcript of the gene on the chromosome and inhibits translation from the mRNA into a protein; A method of making
  • a method for producing L-threonine comprising the step of culturing a microorganism that produces the L-threonine in a medium.
  • the L-threonine a protein having L-threonine excretion activity including the amino acid sequence of SEQ ID NO: 1, its variants, expression of the protein, and microorganisms are as described above.
  • the term "culture” refers to growing the microorganism under appropriately controlled environmental conditions.
  • the cultivation process of the present application may be performed according to a suitable medium and culture conditions known in the art. This culture process can be easily adjusted and used by a person skilled in the art according to the selected strain.
  • the culture may be a batch type, continuous type, and fed-batch type, but is not limited thereto.
  • the term "medium” refers to a material obtained by mixing nutrients required for culturing the microorganism as a main component, and supplies nutrients and growth factors, including water, which is essential for survival and development.
  • any medium and other culture conditions used for cultivation of microorganisms of the present application may be used without particular limitation as long as it is a medium used for cultivation of ordinary microorganisms, but the microorganisms of the present application may be used as appropriate carbon sources, nitrogen sources, personnel, and inorganic.
  • a conventional medium containing compounds, amino acids, and/or vitamins it can be cultured while controlling temperature, pH, and the like under aerobic conditions.
  • the carbon source includes carbohydrates such as glucose, fructose, sucrose, maltose, and the like; Sugar alcohols such as mannitol and sorbitol, organic acids such as pyruvic acid, lactic acid, and citric acid; Amino acids such as glutamic acid, methionine, and lysine may be included.
  • natural organic nutrients such as starch hydrolyzate, molasses, black strap molasses, rice winter, cassava, sugarcane residue and corn steep liquor can be used, specifically glucose and sterilized pretreated molasses (i.e., converted to reducing sugar)
  • Carbohydrates such as molasses
  • carbon sources may be used alone or in combination of two or more, but are not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, etc., organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its degradation products, skim soybean cake or its degradation products, etc. Can be used. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine, etc.
  • organic nitrogen sources such as peptone, NZ-amine,
  • the personnel may include first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto.
  • the inorganic compound sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, and the like may be used, and amino acids, vitamins, and/or suitable precursors may be included. These constituents or precursors may be added to the medium batchwise or continuously. However, it is not limited thereto.
  • the temperature of the medium may be 20 °C to 50 °C, specifically 30 °C to 37 °C, but is not limited thereto.
  • the cultivation period may be continued until a desired amount of the useful substance is obtained, and specifically, may be 10 to 100 hours, but is not limited thereto.
  • L-threonine produced by the culture may be discharged into the medium or may not be discharged and may remain in the cells.
  • the L-threonine production method may include the step of recovering L-threonine from a cultured microorganism or medium.
  • the method of recovering L-threonine produced in the culture step of the present application may be to collect the desired L-threonine from the culture medium using a suitable method known in the art according to the culture method. .
  • a suitable method known in the art for example, centrifugation, filtration, anion exchange chromatography, crystallization, HPLC, and the like may be used, and desired L-threonine may be recovered from a medium or microorganism using a suitable method known in the art.
  • the recovery step may include a purification process, and may be performed using a suitable method known in the art.
  • the recovered L-threonine may be a purified form or a microbial fermentation broth containing L-threonine (Introduction to Biotechnology and Genetic Engineering, A. J. Nair., 2008).
  • a nucleotide sequence fragment was obtained by performing PCR from Escherichia coli W3110 genomic DNA with SEQ ID NO: 43 and SEQ ID NO: 44.
  • pCL1920 digested with SmaI restriction enzyme Nucleic Acids Rersearch, 18, (1990) 4631
  • SmaI restriction enzyme Nucleic Acids Rersearch, 18, (1990) 4631
  • Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
  • Error-prone PCR was performed for a random mutagenesis induction system in wild-type rhtC encoding L-threonine-releasing protein, and a diversify PCR random mutagenesis kit (Takara) was used when performing error-prone PCR. I did.
  • error-prone PCR was performed under two conditions as follows according to the concentration of MnSO 4.
  • the DNA template to introduce mutation was carried out using pCL1920-Pn_rhtC mentioned above.
  • the composition of the composition for performing error-prone PCR was shown in Table 1 below.
  • a recombinant mutant plasmid library was obtained using DNA from which the template plasmid was removed by treating the error-producing PCR product under the conditions of Table 1 and pCL1920 digested with SmaI restriction enzyme using the Gibson assembly method.
  • the mutant library obtained by the above method, pCL1920-Pn_rhtC and pCL1920 were transformed into Escherichia coli K12 cells, and plated on an LB plate medium containing 50 ug/L spectinomycin. Sequencing was performed to determine the mutation rate and the presence or absence of mutations at various locations by selecting 50 colonies from the mutant library-transformed K12.
  • the rate of mutation in case #1 condition was 1.2 kb -1 and in case #2 condition, it was 2.0 kb -1. It was determined that both cases #1 and #2 satisfies the mutation incidence rate suitable for securing a mutant library, and the effective mutation selection was performed using the library produced under the above conditions.
  • K12/pCL1920-Pn_rhtC transformed previously after dispensing 300 ul of M9 minimal media containing 60 g/L of L-Threonine into 96 deep-well plates , K12/pCL1920, K12/mutant library colonies were inoculated. And after incubation at 1200 rpm/15 hr/37°C, the OD was measured with a wavelength of 600 nm.
  • the wild-type E. coli K12 strain generally inhibits growth at around 30 g/L, which is the L-threonine MIC (Minimal Inhibition Concentration) concentration in M9 medium. It was judged to be able to grow at a concentration of 60 g/L of nin. Most of the mutant strain libraries showed little growth like the control strains (K12/pCL1920, K12/pCL1920-Pn_rhtC) in the deep well plate, and in contrast, 4 strains in which growth was observed were selected and OD was recorded.
  • L-threonine MIC Minimal Inhibition Concentration
  • variant plasmid mentioned in Table 2 was named pCL1920-Pn_rhtC(m1), pCL1920-Pn_rhtC(m2), pCL1920-Pn_rhtC(m3), pCL1920-Pn_rhtC(m4) from above.
  • plasmid for insertion was prepared by the following method.
  • the upstream and downstream regions of Ncgl2533 were amplified with SEQ ID NO: 45 and SEQ ID NO: 46 and SEQ ID NO: 51 and SEQ ID NO: 52, respectively.
  • PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template using primers of SEQ ID NO: 47 and SEQ ID NO: 48.
  • PCR fragments obtained by the above procedure and the vector pDZ for chromosome transformation digested with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain five wild-type and mutant rhtC recombinant plasmids. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
  • the constructed plasmids were named pDZ-PgapA_rhtC, pDZ-PgapA_rhtC (m1), pDZ-PgapA_rhtC (m2), pDZ-PgapA_rhtC (m3), pDZ-PgapA_rhtC (m4), respectively.
  • the upstream region of the lysC promoter in which homologous recombination occurs on the chromosome and the downstream region of mutation 377 of lysC were obtained, and Corynebacterium glutamicum ATCC13032 Using the genomic DNA of SEQ ID NO: 3 and SEQ ID NO: 4 as a template, the lysC promoter upstream region, and SEQ ID NO: 9 and SEQ ID NO: 10 using the primers of lysC 377 mutation downstream (Downstream) Local gene fragments were obtained by PCR.
  • SEQ ID NO: 4 (lysC promoter Up 2)
  • a Pcj7 promoter fragment was obtained by PCR using the primers of SEQ ID NO: 5 and SEQ ID NO.
  • the above PCR reaction was performed using the polymerase SolgTM Pfu-X DNA polymerase, and the conditions were: after denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, polymerization at 72°C for 60 seconds, 30 times. After repeating, polymerization was performed at 72° C. for 5 minutes.
  • the four PCR fragments obtained by the above process and the vector pDZ for chromosome transformation (Korean Patent No. 10-1126041) digested with SmaI restriction enzyme are Gibson assembly (DG Gibson et al., NATURE METHODS, VOL.6 NO. .5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix), a recombinant plasmid was obtained by cloning using the method, and it was named pDZ-Pcj7_lysC L377K. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
  • the prepared pDZ-Pcj7_lysC L377K vector was transformed into a wild-type Corynebacterium glutamicum ATCC13032 strain by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), followed by a secondary crossover process.
  • a strain in which the wild-type lysC gene was replaced with the mutant Pcj7_lysC L377K gene was obtained.
  • the genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO: 11 and SEQ ID NO: 12, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the gene was inserted, respectively.
  • the resulting transformed strain was named Cgl-TH-1.
  • a mutation for releasing the feedback inhibition of hom's L-threonine (G378E, R398Q) was applied to Cgl-TH-1 to increase L-threonine production.
  • pDZ-Pcj7_hom (G378E, R398Q) was prepared.
  • a hom promoter upstream region where homologous recombination occurs was obtained. Specifically, using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, a fragment of the hom promoter upstream region was obtained by PCR using the primers of SEQ ID NO: 14 and SEQ ID NO: 55.
  • pECCG117-Pcj7-GFP (Korean Patent No. 10-0620092) plasmid as a template
  • a Pcj7 promoter fragment was obtained by PCR using primers of SEQ ID NO: 13 and SEQ ID NO: 56.
  • the upper part of the coding sequence of hom amino acids 1 to 378, the sequence including the G378E/R398Q mutation, and the lower sequence of R398Q were obtained by the following method.
  • PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template using primers of SEQ ID NO: 17 and SEQ ID NO: 18, and a fragment of the hom amino acid 1 to 378 coding sequence was obtained. .
  • PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template using primers of SEQ ID NO: 15 and SEQ ID NO: 20, and a sequence fragment including the hom G378E/R398Q mutation was obtained.
  • PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template using primers of SEQ ID NO: 19 and SEQ ID NO: 21, and a lower sequence fragment of hom R398Q where homologous recombination occurs was obtained.
  • the five PCR fragments obtained by the above procedure and the vector pDZ for chromosome transformation digested with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain a recombinant plasmid, and were named pDZ-Pcj7_hom (G378E, R398Q). Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
  • the prepared pDZ-Pcj7_hom (G378E, R398Q) vector was transformed into Cgl-TH-1 strain by electroporation, and then the wild-type hom gene on the chromosome was replaced with the mutant Pcj7_hom (G378E, R398Q) gene through a second crossover process. Strain was obtained. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO: 22 and SEQ ID NO: 23, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the corresponding gene is inserted, respectively.
  • the resulting transformed strain was named Cgl-TH-2.
  • a region upstream of the pyc promoter where homologous recombination occurs was obtained. Specifically, using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, a fragment of the pyc promoter upstream region was obtained by PCR using the primers of SEQ ID NO: 25 and SEQ ID NO: 26.
  • the genomic DNA of Corynebacterium glutamicum ATCC13032 is used as a template with SEQ ID NO: 27. PCR was performed using the primer of No. 28, and a fragment under the pyc promoter was obtained.
  • the three PCR fragments obtained by the above procedure and the vector pDZ for chromosome transformation digested with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain a recombinant plasmid, and were named pDZ-Pcj7_pyc. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
  • the prepared pDZ-Pcj7_pyc vector was transformed into a Cgl-TH-2 strain by electroporation, and then a strain in which the wild-type pyc promoter was replaced with the mutant Pcj7_pyc gene on the chromosome was obtained through a secondary crossover process.
  • the genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO: 29 and SEQ ID NO: 30, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the corresponding gene is inserted, respectively.
  • the obtained transformed strain was named Cgl-TH-3.
  • the L-threonine operon derived from E. coli was intended to be applied.
  • the thrA gene which has the dual functionality of aspartokinase and homoserine dehydrogenase 1 (Bifunctional aspartokinase/homoserine dehydrogenase 1), is thrA(S352P) (J Bacteriol. 1993 Feb. ;175(4):959-65) mutation was applied. And it was intended to increase the expression of the L-threonine operon using the SPL7 promoter (Korean Patent No. 10-1783170).
  • the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template was Ncgl0179 upper and lower homologous region fragments, respectively, SEQ ID NO: 31 and The base sequence was amplified with SEQ ID NO: 32, SEQ ID NO: 37, and SEQ ID NO: 38. And SPL7 was amplified with SEQ ID NO: 33 and SEQ ID NO: 34 using the synthesized SPL7 promoter as a template.
  • the thrA(S352P) amino acid 352th coordination sequence top was amplified with SEQ ID NO: 35 and SEQ ID NO: 36
  • thrA(S352P) amino acid 352th bottom and thrBC were amplified with SEQ ID NO: 39 and SEQ ID NO: 40.
  • the 5 PCR fragments obtained by the above procedure and the vector pDZ for chromosome transformation digested with SmaI restriction enzyme were cloned using the Gibson assembly method to obtain a recombinant plasmid, and were named pDZ-SPL7_thrA(S352P)BC. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated mole number and then storing at 50° C. for 1 hour.
  • the prepared pDZ-SPL7_thrA(S352P)BC vector was transformed into a Cgl-TH-3 strain by electroporation, and then a strain in which the SPL7_thrA(S352P)BC operon was inserted on the chromosome was obtained through a second crossover process.
  • the genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO: 41 and SEQ ID NO: 42, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the gene is inserted, respectively.
  • the obtained transformed strain was named Cgl-TH-4.
  • the strain, Cgl-TH-4 was named CJ09-5010, and on May 31, 2019, it was internationally deposited with the Korea Microbial Conservation Center (KCCM), an international depository under the Budapest Treaty, and was given a deposit number as KCCM12537P.
  • KCCM Korea Microbial Conservation Center
  • PDZ-PgapA_rhtC, pDZ-PgapA_rhtC(m1), pDZ-PgapA_rhtC(m2), pDZ-PgapA_rhtC(m3), pDZ-PgapA_rhtC(m4) vectors prepared in Example 1 were electroporated into Cgl-TH-4 strains, respectively. After transformation and transformation, each strain into which four kinds of wild-type rhtC and mutant rhtC genes were inserted on the chromosome were obtained through a second crossover process. The genetic manipulation was confirmed through PCR and genome sequencing using primers of SEQ ID NO: 53 and SEQ ID NO: 54, which can amplify the regions outside the homologous recombination upstream region and downstream region into which the gene is inserted, respectively.
  • the obtained transformed strains were named Cgl-TH-5, Cgl-TH-5 (m1), Cgl-TH-5 (m2), Cgl-TH-5 (m3), Cgl-TH-5 (m4), respectively. I did.
  • Cgl-TH-5, Cgl-TH-5 (m1), Cgl-TH-5 (m2), Cgl-TH-5 ( m3), Cgl-TH-5 (m4) strains were cultured in the following manner to compare the production of L-threonine.
  • Seed medium (glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO 4 7H 2 O 0.5 g, biotin 100 ug, thiamine HCl 1000 ug, Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of calcium-pantothenic acid 2000 ug, nicotinamide 2000 ug, pH 7.0 (based on 1 liter of distilled water), and incubated with shaking at 30° C. for 20 hours and 200 rpm. I did.
  • production medium glucose 70g, (NH 4 )2SO 4 15 g, MgSO 4 7H 2 O 1.2 g, KH 2 PO 4 1 g, yeast extract 5 g, biotin 900 ug, thiamine hydrochloride 4500 ug, calcium-pantothenic acid 4500 ug, CaCO 3 30 g, pH 7.0 (based on 1 liter of distilled water)
  • 25 ml of a 250 ml corner-baffle flask was inoculated with 1 ml of the seed culture solution and cultured at 30° C. for 24 hours and shaking at 200 rpm. .
  • the production amount of L-threonine was measured by HPLC, and the results are shown in Table 3.
  • Cgl-TH-4 prepared by the method of Example 2-4 showed 11.1 g/L of L-threonine production, and Cgl-TH-5 into which the PgapA_rhtC wild-type trait was inserted was 14.0. g/L of L-threonine was produced.
  • /L, 24.0 g/L, 21.8 g/L, and 17.9 g/L of L-threonine were produced.
  • Cgl-TH-5 showed an increase of 4.1%p compared to Cgl-TH-4, whereas variant forms of Cgl-TH-5 (m1), Cgl-TH-5 (m2), Cgl-TH-5(m3) and Cgl-TH-5(m4) strains showed 9.7%p, 18.4%p, 15.3%p, and 9.7%p increase compared to Cgl-TH-4, respectively.
  • Cgl-TH-5(m2) and Cgl-TH-5(m3) showed a large yield increase effect of about 4 times compared to that of Cgl-TH-5.
  • the variant RhtC applied to Cgl-TH-5 has the amino acid sequence of SEQ ID NO: 94 and specifically contains a mutation (L62S) in which Leucine at amino acid 62 position is modified with Serine (Ser).
  • the variant RhtC applied to Cgl-TH-5 has the amino acid sequence of SEQ ID NO: 93, and specifically, a mutation (A53T) in which alanine (Ala) at amino acid position 53 is modified into threonine (Thr).
  • Cgl-TH-5 m2
  • Cgl-TH-5 m3
  • CA09-5012 CA09-5036
  • KCCM KCCM12538P
  • KCCM12539P deposit numbers
  • Example 3 L-threonine production of E. coli strain introduced with mutant L-threonine-releasing protein
  • TF4076 KFCC10718, Korean Patent Application No. 90-22965
  • TF4076/pCL1920, TF4076/pCL1920-Pn_rhtC, TF4076/pCL1920-Pn_rhtC(m1), TF4076/pCL1920-Pn_rhtC(m2), TF4076/pCL1920-Pn_rhtC(m3), TF4076/pCL1920-strains were prepared. I did.
  • Flask evaluation was performed to compare the production of L-threonine of the produced strains.
  • the flask test was performed by streaking each strain on an LB plate to which 50 ug/ml of spectinomycin was added and incubating for 16 hours in a 33° C. incubator, and then inoculating a single colony into 2 ml of LB medium. Then, it was incubated for 12 hours in an incubator at 200 rpm/33°C.
  • 25 ml of an L-threonine production flask medium having a composition according to Table 4 was added to a 250 ml flask, and 500 ul of the culture solution previously cultured was added thereto. Thereafter, the flask was cultured in an incubator at 200 rpm/33° C. for 48 hours, and then the amounts of L-threonine obtained in each strain were compared using HPLC, and the results are shown in Table 5.
  • glucose 70 g Ammonium sulfate 25 g KH 2 PO 4 1 g MgSO 4 7H 2 O 0.5 g FeSO 4 7H 2 O 5 mg MnSO 4 8H 2 O 5 mg ZnSO 4 5 mg Calcium carbonate 30 g Yeast extract 2 g Methionine 0.15 g pH 6.8
  • Example 4 Saturated mutagenesis of leucine, amino acid 62 of L-threonine excreting protein
  • the mutant type of rhtC (L62S) showed a higher yield synergistic effect compared to the wild type, so that leucine, amino acid 62 of RhtC, was mutated to another amino acid to improve L-threonine excretion at position 62
  • site-directed mutagenesis Site-Directed Mutagenesis
  • a PCR composition as shown in Table 6 was prepared, and PCR was performed under the conditions of Table 7.
  • a set of mutagenic primers shown in Table 8 was used.
  • 1ul of DpnI restriction enzyme was added, followed by treatment at 37°C for 1 hour.
  • DpnI-treated DNA 3ul DH5a competent cells were transformed to obtain pDZ-PgapA_rhtC mutant plasmids, and it was confirmed that they were replaced with respective mutations shown in Table 8 through sequencing.
  • PDZ-PgapA_rhtC L62R pDZ-PgapA_rhtC L62A, pDZ-PgapA_rhtC L62D, pDZ-PgapA_rhtC L62K, pDZ-PgapA_rhtC L62K, pDZ-PgapA_rhtC L62P, pDZ-PgapA_PgRh62, pDZ-PgPgArh62, pDZ-PgTrhArh62 examples of L62I, pDZ-PgapA_rhtC L62Y, pDZ-PgapA_rhtC L62V, pDZ-PgapA_rhtC L62H, pDZ-PgapA_rhtC L62F, pDZ-PgapA_rhtC
  • the obtained transformed strains were Cgl-TH-5 (L62R), Cgl-TH-5 (L62A), Cgl-TH-5 (L62D), Cgl-TH-5 (L62K), Cgl-TH-5 (L62P), respectively. ), Cgl-TH-5(L62C), Cgl-TH-5(L62G), Cgl-TH-5(L62T), Cgl-TH-5(L62I), Cgl-TH-5(L62Y), Cgl-TH -5(L62V), Cgl-TH-5(L62H), Cgl-TH-5(L62F), Cgl-TH-5(L62M), Cgl-TH-5(L62Q), Cgl-TH-5(L62N) , Cgl-TH-5 (L62E), Cgl-TH-5 (L62W).
  • the 18 strains produced by the above method and the previously produced Cgl-TH-4, Cgl-TH-5, and Cgl-TH-5 (m2) strains were used in the flask medium for producing L-threonine of Example 2-5. And cultured by the culture method, and after the completion of the culture, the production amount of L-threonine was measured by HPLC, and is shown in Table 9.
  • Example 5 Screening for AHV-resistant strains through artificial mutation method
  • NTG N-methyl-N'-nitro-N-nitrosoguanidine
  • the KFCC10881 strain cultured for 18 hours in the seed medium of Example 2-5 was again inoculated into 4 ml of the seed medium, and then cultured until the OD660 reached about 1.0.
  • the culture solution was centrifuged to recover the cells, washed twice with 50 mM Tris-malate buffer (pH 6.5), and suspended in the final 4 ml of the same buffer solution.
  • NTG solution (2 mg/ml concentration in 0.05M tris-malate buffer solution (pH6.5)) was added to the cell suspension to a final concentration of 150 mg/l, allowed to stand at room temperature for 20 minutes, and then centrifuged.
  • the cells were collected and washed twice with the same buffer solution to remove NTG. Finally, the washed cells were suspended in 4 ml of a 20% glycerol solution, and then stored at -70 °C until use.
  • the NTG-treated strain was plated on a minimal medium containing 3 g/l of AHV, and 155 strains of variant KFCC10881 with AHV resistance of 155 strains were obtained through the above process.
  • Example 6 Selection of L-threonine-producing strains from AHV-resistant KFCC10881 strains
  • the L-threonine production ability test was performed on the 155 strains of AHV-resistant strains obtained in Example 5. 155 strains were inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium of Example 2-5, and then cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • L-threonine production medium (glucose 30g, KH 2 PO 4 2g, urea 3g, (NH 4 )2SO 4 40g, peptone 2.5g, CSL(Sigma) 5g (10 ml), MgSO 4 7H 2 O 0.5g, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of leucine 400 mg, CaCO 3 20 g, pH 7.2 (based on 1 liter of distilled water) and incubated with shaking at 30° C. for 48 hours at 200 rpm.
  • Table 10 shows the concentrations in the culture medium of amino acids for the top 22 strains, which showed excellent L-threonine production ability among the 155 strains tested.
  • the 22 candidates identified through the above process were named KFCC10881-1 to KFCC10881-22, respectively.
  • KFCC10881-10 was selected as the most excellent L-threonine strain.
  • Example 7 L-threonine production of variant L-threonine excreting protein introduction KFCC10881-10 strain
  • the obtained transformed strains were KFCC10881-10 (rhtC WT), KFCC10881-10 (rhtC L62S), KFCC10881-10 (rhtC A53T), KFCC10881-10 (rhtC L62R), KFCC10881-10 (rhtC L62A), KFCC10881-10, respectively.
  • the genetic manipulation was confirmed through PCR and genomic sequencing using primers of SEQ ID NO: 53 and SEQ ID NO: 54, which can amplify the external regions of the homologous recombination upstream region and downstream region into which the rhtC gene is inserted, respectively.
  • the mutation of the present application was introduced into rhtC derived from another strain having high homology with the rhtC protein (SEQ ID NO: 1) derived from Escherichia coli W3110 to confirm the L-threonine production result.
  • PCR was performed from genomic DNA of E. coli W3110, Shegella flexneri , and Escherichia fergusonii in the same manner as in Example 1 to obtain nucleotide sequence fragments, respectively (eco rhtC , sfe rhtC, efe rhtC), and mutant rhtCs in which the L62S mutation was introduced by the method of Example 1 were prepared, respectively.
  • Each of the prepared plasmids prepared above was transformed into TF4076, an E. coli strain capable of producing L-threonine, and TF4076/pCL1920, TF4076/pCL1920-Pn_rhtC.eco, TF4076/pCL1920-Pn_rhtC.eco L62S, TF4076/pCL1920- Pn_rhtC.sfe, TF4076/pCL1920-Pn_rhtC.sfe L62S, TF4076/pCL1920-Pn_rhtC.efe, TF4076/pCL1920-Pn_rhtC.efe L62S strains were prepared. Flask evaluation was performed to compare the production of L-threonine of the produced strains, and the results are shown in Table 12.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Saccharide Compounds (AREA)

Abstract

본 출원은 L-쓰레오닌 배출 단백질의 변이체, 이를 포함하는 미생물, 및 이를 이용한 L-쓰레오닌 생산 방법에 관한 것이다.

Description

L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 L-쓰레오닌 생산 방법
본 출원은 L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 L-쓰레오닌 생산 방법에 관한 것이다.
L-쓰레오닌(L-Threonine, L-Thr)은 필수 아미노산의 하나로 사료 첨가제 등으로 널리 사용되어 왔으며, 또한 수액제 등의 의약품 원료 및 건강식품소재 등으로 널리 사용되어 왔다.
현재에는 미생물을 이용한 직접 발효법이 L-쓰레오닌 생산에 주로 이용되고 있다. L-쓰레오닌 생산에 사용되는 미생물들은 초기에 화학적 또는 물리적 돌연변이를 통한 유사체 내성을 나타내는 선별 균주들이 주로 사용되어 왔으나, 1990년대 유전자 재조합 기술의 급격한 발전과 분자수준의 조절 기작들이 규명됨에 따라 유전자 조작 기법을 이용한 재조합 균주들이 주로 사용되고 있다.
한편, 특정 아미노산 배출 유전자의 발현은 미생물에서 해당 아미노산의 생산성 향상을 야기하여 왔다. 코리네박테리움 속 미생물의 L-리신 배출 유전자 (lysE)의 발현 강화는 리신의 생산성을 향상시켰다(WO9723597A2). 또한, 대장균에서 기능이 공지되지 않은 유전자들인 yahN 유전자, yeaS 유전자, yfiK 유전자 그리고 yggA 유전자를 강화시킴으로써 L-글루타민산, L-리신, L-쓰레오닌, L-알라닌, L-히스티딘, L-프롤린, L-아르기닌, L-발린 및 L-이소류신의 생산성이 향상되었다는 내용이 특허(EP1016710B1)에 개시되어 있다.
본 발명자들은 rhtC에 의해 코딩되는 L-쓰레오닌 배출 단백질(RhtC)의 배출능 향상을 위해서 변이형 rhtC를 선별하고 이를 통해서 L-쓰레오닌 생산량이 획기적으로 향상됨을 확인함으로써 본 출원을 완성하였다.
본 출원의 하나의 목적은 서열번호 1의 53번째 또는 62번째 위치에 상응하는 위치에서 다른 아미노산으로의 치환을 포함하고, 서열번호 1의 아미노산 서열과 적어도 80% 이상, 100% 미만의 서열 상동성을 가지며, L-쓰레오닌 배출 활성을 가지는, L-쓰레오닌 배출 단백질의 변이체를 제공하는 것이다.
본 출원의 다른 하나의 목적은 상기 L-쓰레오닌 배출 단백질의 변이체를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
본 출원의 또 다른 목적은 상기 폴리뉴클레오티드를 포함하는 벡터를 제공하는 것이다.
본 출원의 또 다른 목적은 상기 L-쓰레오닌 배출 단백질의 변이체, 상기 단백질의 변이체를 코딩하는 폴리뉴클레오티드 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하는 L-쓰레오닌을 생산하는 미생물을 제공하는 것이다.
본 출원의 또 다른 목적은 상기 미생물을 배지에서 배양하는 단계를 포함하는, L-쓰레오닌 생산 방법을 제공하는 것이다.
본 출원의 L-쓰레오닌 배출 단백질의 변이체를 이용하여, L-쓰레오닌을 생산하는 미생물을 배양하는 경우, 기존 비변형 단백질을 갖는 미생물에 비해 고수율의 L-쓰레오닌 생산이 가능하다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
상기 목적을 달성하기 위한 본 출원의 하나의 양태는 서열번호 1의 아미노산 서열 내 하나 이상의 아미노산 치환을 포함하는 L-쓰레오닌 배출 단백질의 변이체를 제공한다.
구체적으로, 본 출원은 서열번호 1의 아미노산 서열에서 i) 53번째 아미노산이 다른 아미노산으로 치환, 및/또는 ii) 62번째 아미노산이 다른 아미노산으로 치환된 단백질의 변이체를 제공한다. 상기 아미노산 치환은 i) 53번째 아미노산이 쓰레오닌으로 치환, 또는 ii) 62번째 아미노산이 세린, 아르기닌, 알라닌, 아스파르트산, 리신, 프롤린, 시스테인, 글리신, 쓰레오닌, 이소류신, 티로신, 발린, 히스티딘, 페닐알라닌, 메티오닌, 글루타민, 아스파라긴, 글루탐산 또는 트립토판으로부터 선택되는 아미노산으로 치환되는 것을 포함할 수 있다.
본 출원에서 용어, "쓰레오닌(Threonine, Thr)"은 체내에서 합성되지 않고 식품으로만 공급가능한 필수 아미노산의 하나로, 장상피 보호 물질인 뮤신(mucine)을 구성하며, 부족하면 성장정지, 체중감소를 일으킬 수 있다. 쓰레오닌은 사료 첨가제, 수액제 등의 의약품 원료 및 건강식품소재 등으로 널리 사용된다. 다른 아미노산과 마찬가지로 쓰레오닌 또한 D형과 L형의 입체이성질체가 존재하며, 자연에서 유래하는 쓰레오닌은 대부분 L형 입체이성질체인 L-쓰레오닌(L-Threonine, L-Thr)으로 존재한다. 본 발명에서 쓰레오닌(Threonine, Thr)은 L-쓰레오닌(L-Threonine, L-Thr)과 혼용하여 사용될 수 있다.
본 출원에서 용어, "L-쓰레오닌 배출 단백질(L-threonine exporter, L-threonine efflux protein)"은 L-쓰레오닌을 세포 밖으로 배출하도록 매개하는 단백질로, 5개의 막전이 도메인(transmembrane domains)을 가지는 내막 단백질로 알려져 있다. 실험적 토폴로지(experimental topology) 분석에서는 이의 C-말단이 세포질에 존재함을 시사한다(Daley DO et al., Global topology analysis of the Escherichia coli inner membrane proteome, Science. 2005 May 27; 308(5726):1321-3.). 상기 L-쓰레오닌 배출 단백질은 예를 들면, 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열을 포함하는 단백질일 수 있다. 상기 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열을 포함하는 단백질은 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열을 가지는 단백질, 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열로 구성되는 단백질과 혼용하여 사용될 수 있다. 본 출원에서, 상기 L-쓰레오닌 배출 단백질은 RhtC 단백질 또는 RhtC과 혼용하여 사용될 수 있다.
본 출원에서 상기 서열번호 1, 서열번호 113 또는 서열번호 115는 L-쓰레오닌 배출 활성을 갖는 아미노산 서열을 의미한다. 구체적으로, 상기 서열번호 1, 서열번호 113 또는 서열번호 115는 rhtC 유전자에 의해 코딩되는 L-쓰레오닌 배출 활성을 갖는 단백질 서열이다. 상기 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열은 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있다. 일 예로, 서열번호 1은 대장균(Escherichia coli, E. coli) 유래, 서열번호 113은 시겔라 플렉스네리(Shegella flexneri) 유래, 서열번호 115는 에스케리키아 페르구소니(Escherichia fergusonii) 유래일 수 있으나, 이에 제한되지 않으며 상기 아미노산 서열을 포함하는 단백질과 동일한 활성을 갖는 단백질의 아미노산 서열이라면 제한 없이 포함될 수 있다. 상기 서열번호 113 또는 서열번호 115는 서열번호 1과 상동성이 각각 99%일 수 있으나, 이에 제한되지 않는다.
또한, 본 출원에서의 L-쓰레오닌 배출 활성을 갖는 단백질은 비록 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열을 포함하는 단백질이라고 정의하였으나, 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열 앞뒤로의 무의미한 서열 추가 또는 자연적으로 발생할 수 있는 돌연변이, 혹은 이의 잠재성 돌연변이(silent mutation)를 제외하는 것이 아니며, 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열을 포함하는 단백질과 서로 동일 또는 상응하는 활성을 가지는 경우라면 본 출원의 L-쓰레오닌 배출 활성을 갖는 단백질에 해당됨은 당업자에게 자명하다. 구체적인 예를 들어, 본 출원의 L- 쓰레오닌 배출 활성을 갖는 단백질은 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열 또는 이와 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 갖는 아미노산 서열로 구성되는 단백질일 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 변이 대상이 되는 단백질의 범위 내에 포함됨은 자명하다.
즉, 본 출원에서 '특정 서열번호로 기재된 아미노산 서열을 갖는 단백질 또는 폴리펩티드', '특정 서열번호로 기재된 아미노산 서열을 포함하는 단백질 또는 폴리펩티드'라고 기재되어 있다 하더라도, 해당 서열번호의 아미노산 서열로 이루어진 폴리펩티드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원에서 사용될 수 있음은 자명하다. 예를 들어, '서열번호 1의 아미노산 서열로 이루어진 폴리펩티드'는, 서열번호 1에 상응하는 서열이거나, 이와 동일 혹은 상응하는 활성을 가지는 서열인 경우라면 '서열번호 1의 아미노산 서열로 이루어진 폴리펩티드'에 속할 수 있음은 자명하다.
본 출원에서 용어, "변이체(variant)"는 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)에 있어서 상기 열거된 서열 (the recited sequence)과 상이하나, 상기 단백질의 기능(functions) 또는 특성(properties)이 유지되는 단백질을 지칭한다. 변이체는 수 개의 아미노산 치환, 결실 또는 부가에 의해 식별되는 서열(identified sequence)과 상이하다. 이러한 변이체는 일반적으로 상기 단백질의 아미노산 서열 중 하나 이상의 아미노산을 변형하고, 상기 변형된 단백질의 특성을 평가하여 식별될 수 있다. 즉, 변이체의 능력은 본래 단백질(native protein)에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 또한, 일부 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이체를 포함할 수 있다. 다른 변이체는 성숙 단백질(mature protein)의 N- 및/또는 C-말단으로부터 일부분이 제거된 변이체를 포함할 수 있다. 상기 용어 "변이체"는 변이형, 변형, 변이된 단백질, 변이형 폴리펩티드, 변이 등의 용어(영문 표현으로는 modification, modified protein, modified polypeptide, mutant, mutein, divergent, variant 등)가 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다. 본 출원의 목적상, 상기 변이체는 천연의 야생형 또는 비변형 단백질 대비 변이된 단백질의 활성이 증가된 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 상기 변이체는 하나 이상의 생물학적 활성을 여전히 보유하면서, 예를 들어 하나 이상의 보존적 치환을 가질 수 있다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 예를 들면, 전하를 띠는 곁사슬(electrically charged amino acid)을 갖는 아미노산 중 양으로 하전된(염기성) 아미노산은 알지닌, 리신, 및 히스티딘을, 음으로 하전된(산성) 아미노산은 글루탐산 및 아르파르트산을 포함하고; 전하를 띠지 않는 곁사슬(uncharged amino acid)을 갖는 아미노산 중 비극성 아미노산(nonpolar amino acid)은 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판 및 프롤린을 포함하고, 극성(polar) 또는 친수성(hydrophilic) 아미노산은 세린, 트레오닌, 시스테인, 티로신, 아스파라긴 및 글루타민을 포함하고, 상기 비극성 아미노산 중 방향족 아미노산은 페닐알라닌, 트립토판 및 티로신을 포함한다.
또한, 변이체는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 폴리펩티드는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이전(transfer)에 관여하는 단백질 N-말단의 시그널(또는 리더) 서열과 컨쥬게이트 할 수 있다. 또한 상기 폴리펩티드는 폴리펩티드를 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
상기 '다른 아미노산으로 치환'은 치환 전의 아미노산과 다른 아미노산이면 제한되지 않는다. 즉, 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열의 53번째 아미노산인 알라닌이 알라닌 이외의 다른 아미노산 잔기로, 또는 62번째 아미노산인 류신이 류신 이외의 다른 아미노산 잔기로 치환된 것이라면 제한되지 않는다. 한편, 본 출원에서 '특정 아미노산이 치환되었다'고 표현하는 경우, 다른 아미노산으로 치환되었다고 별도로 표기하지 않더라도 치환 전의 아미노산과 다른 아미노산으로 치환되는 것임은 자명하다.
상기 변이체는 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열에서 53번째 또는 62번째 아미노산 중 어느 하나 이상의 아미노산이 치환 전 아미노산과 다른 아미노산으로 치환된 것일 수 있다. 또는 상기 변이체는 전하를 띠지 않는 곁사슬(uncharged amino acid)을 갖는, 치환 전 아미노산과 다른 아미노산으로 치환된, 변이체일 수 있으나, 이에 제한되지 않는다.
구체적으로, 상기 변이체는 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열에서 i) 53번째 아미노산이 다른 아미노산으로 치환, 또는 ii) 62번째 아미노산이 다른 아미노산으로 치환된 변이체일 수 있다. 상기 다른 아미노산으로의 치환은 i) 53번째 아미노산이 쓰레오닌으로 치환, 또는 ii) 62번째 아미노산이 세린, 아르기닌, 알라닌, 아스파르트산, 리신, 프롤린, 시스테인, 글리신, 쓰레오닌, 이소류신, 티로신, 발린, 히스티딘, 페닐알라닌, 메티오닌, 글루타민, 아스파라긴, 글루탐산 또는 트립토판으로부터 선택되는 아미노산으로 치환되는 것일 수 있다. 보다 구체적으로, 상기 변이체는 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열에서 i) 53번째 아미노산이 쓰레오닌으로 치환, 또는 ii) 62번째 아미노산이 세린, 아르기닌, 알라닌, 아스파르트산, 리신, 프롤린, 시스테인, 글리신, 쓰레오닌, 이소류신, 티로신, 발린, 히스티딘, 페닐알라닌, 메티오닌, 글루타민, 아스파라긴, 글루탐산 또는 트립토판으로부터 선택되는 아미노산으로 치환된 변이체일 수 있다.
본 출원에서 제공하는 L-쓰레오닌 배출 단백질의 변이체는, 상기에서 설명한 L-쓰레오닌 배출능을 갖는 단백질 중 특이적 위치의 아미노산이 치환되어, L-쓰레오닌 배출능이 변이 전 단백질 대비 증가된 변이체를 의미할 수 있다.
상기 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열에서 i) 53번째 아미노산이 쓰레오닌으로 치환, 또는 ii) 62번째 아미노산이 다른 아미노산으로 치환된 변이체는 서열번호 93 내지 112, 114 및 116 중 어느 하나의 아미노산 서열을 포함하는 것일 수 있고, 구체적으로는 서열번호 93 내지 112, 114 및 116 중 어느 하나의 아미노산 서열로 필수적으로 구성되는(consisting essentially of) 것일 수 있고, 보다 구체적으로는 서열번호 93 내지 112, 114 및 116 중 어느 하나의 아미노산 서열로 이루어진 것일 수 있으나, 이에 제한되지 않는다.
상기 변이체는 서열번호 1, 서열번호 113 또는 서열번호 115의 53번째 또는 62번째 위치에 상응하는 위치에서 다른 아미노산으로의 치환을 포함하고, 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열과 적어도 80%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상, 100% 미만의 서열 상동성을 가지며, L-쓰레오닌 배출 활성을 가지는 것일 수 있다.
또한, 상기 변이체는 서열번호 93 내지 112, 114 및 116 중 어느 하나의 아미노산 서열 또는 상기 아미노산 서열에서, 53번째 또는 62번째 아미노산 중 선택된 하나 이상의 아미노산은 고정되고, 이와 80% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함할 수 있으나, 이에 제한되는 것은 아니다. 구체적으로, 본 출원의 변이체는 서열번호 93 내지 112, 114 및 116 중 어느 하나의 아미노산 서열과 적어도 80%, 90%, 95%, 96%, 97%, 98%, 또는 99% 상동성 또는 동일성을 가지는 폴리펩티드를 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면 53번째 또는 62번째 아미노산 위치 이외에, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 범위 내에 포함됨은 자명하다.
본 출원에서 용어 '상동성(homology)' 또는 '동일성(identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된 (conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나 (homologous) 또는 동일한 (identical) 서열은 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90%를 따라 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
또한, 임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다.
본 출원에서 용어, "L-쓰레오닌 배출 단백질의 변이체"는 L-쓰레오닌 생산능을 가지는 변이형 폴리펩티드, L-쓰레오닌 생산 변이형 폴리펩티드, L-쓰레오닌을 생산하는 변이형 폴리펩티드, L-쓰레오닌 배출 활성을 갖는 변이형 폴리펩티드, L-쓰레오닌 배출 활성 변이체, L-쓰레오닌 배출 변이체, 변이형 RhtC, RhtC 변이체, 변이형 L-쓰레오닌 배출 단백질 등과 혼용되어 사용될 수 있다. 또한 상기 단백질은 대장균(Escherichia coli, E. coli) 유래일 수 있으나, 이에 제한되지 않는다.
상기 L-쓰레오닌 배출 단백질의 변이체는 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열에서 53번째 및/또는 62번째 위치에서 변이를 포함할 수 있으며, 서열번호 1, 서열번호 113 또는 서열번호 115에 아미노산이 부가, 결실된 아미노산 서열이라고 해도 서열번호 1, 서열번호 113 또는 서열번호 115의 N-말단으로부터 53번 및/또는 62번 아미노산에 상응하는 위치의 아미노산이 치환된 변이체면 본 출원의 범위에 포함된다. 상기 L-쓰레오닌 배출 단백질의 변이체는 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열에서 53번째 또는 62번째 아미노산이 다른 아미노산으로 치환된 것이며, 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열을 포함하거나 야생형 미생물 유래 변이 전 L-쓰레오닌 배출 단백질에 비하여 강화된 활성을 갖는 변이형 L-쓰레오닌 배출 단백질일 수 있다. 이와 같은 L-쓰레오닌 배출 단백질의 변이체는 상기에서 설명한 서열번호 1, 서열번호 113 또는 서열번호 115 및/또는 상기 서열번호 1, 서열번호 113 또는 서열번호 115와 적어도 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가지는 아미노산에서 서열번호 1, 서열번호 113 또는 서열번호 115의 53번째 또는 62번째에 상응하는 위치의 아미노산이 변이된 것을 의미한다.
상기 53번째 또는 62번째 아미노산 변이는 i) 53번째 아미노산이 쓰레오닌으로 치환, 또는 ii) 62번째 아미노산이 세린, 아르기닌, 알라닌, 아스파르트산, 리신, 프롤린, 시스테인, 글리신, 쓰레오닌, 이소류신, 티로신, 발린, 히스티딘, 페닐알라닌, 메티오닌, 글루타민, 아스파라긴, 글루탐산 또는 트립토판으로부터 선택되는 아미노산으로 치환되는 것일 수 있다.
구체적으로, 상기 L-쓰레오닌 배출 단백질의 변이체는 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열에서 i) 53번째 아미노산이 쓰레오닌으로 치환, 또는 ii) 62번째 아미노산이 세린, 아르기닌, 알라닌, 아스파르트산, 리신, 프롤린, 시스테인, 글리신, 쓰레오닌, 이소류신, 티로신, 발린, 히스티딘, 페닐알라닌, 메티오닌, 글루타민, 아스파라긴, 글루탐산 또는 트립토판으로부터 선택되는 아미노산으로 치환된 것일 수 있으며, 상기 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열을 포함하는 단백질 또는 야생형 미생물 유래 변이 전 L-쓰레오닌 배출 단백질에 비하여 강화된 활성을 갖는 것일 수 있다.
본 출원의 목적상 상기 L-쓰레오닌 배출 단백질의 변이체를 포함하는 미생물의 경우, L-쓰레오닌 생산량이 증가하는 것을 특징으로 한다. 이는 야생형 미생물이 L-쓰레오닌을 생산하지 못하거나, L-쓰레오닌을 생산하더라도 극미량을 생산할 수 있는 것에 반해, 본 출원의 L-쓰레오닌 배출 단백질의 변이체를 통해 L-쓰레오닌 생산량을 증가시킬 수 있다는 것에 의의가 있다.
본 출원의 다른 하나의 양태는 상기 L-쓰레오닌 배출 단백질의 변이체를 코딩하는 폴리뉴클레오티드를 제공한다.
상기 L-쓰레오닌, 서열번호 1의 아미노산 서열을 포함하는 L-쓰레오닌 배출 활성을 갖는 단백질 및 이의 변이체에 대해서는 전술한 바와 같다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이체를 코딩하는 폴리뉴클레오티드 단편을 의미한다.
본 출원의 L-쓰레오닌 배출 단백질의 변이체를 코딩하는 폴리뉴클레오티드는, 본 출원의 L-쓰레오닌 배출 활성을 갖는 변이형 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열이라면 제한없이 포함될 수 있다. 본 출원에서 L-쓰레오닌 배출 단백질의 아미노산 서열을 코딩하는 유전자는 rhtC 유전자이며, 상기 유전자는 대장균(Escherichia coli, E. coli), 시겔라 플렉스네리(Shegella flexneri) 또는 에스케리키아 페르구소니(Escherichia fergusonii) 유래일 수 있으나 이로 제한되는 것은 아니다. 또한, 상기 유전자는 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열을 코딩하는 염기서열일 수 있으며, 보다 구체적으로 상기 서열번호 1의 아미노산 서열을 코딩하는 염기서열은 서열번호 2의 염기서열을 포함하는 서열일 수 있으나, 이에 제한되지 않는다.
구체적으로, 본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리펩티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩티드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열에서 53번째 또는 62번째 아미노산이 다른 아미노산으로 치환된 L-쓰레오닌 배출 단백질의 변이체를 코딩하는 폴리뉴클레오티드 서열이라면 제한 없이 포함할 수 있다.
또한 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열에서 53번째 또는 62번째 아미노산이 다른 아미노산으로 치환된 L-쓰레오닌 배출 활성을 가지는 단백질을 코딩하는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 유전자끼리, 40% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성 또는 동일성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60 ℃, 1ХSSC, 0.1% SDS, 구체적으로는 60 ℃, 0.1ХSSC, 0.1% SDS, 보다 구체적으로는 68 ℃, 0.1ХSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
본 출원의 다른 하나의 양태는 상기 L-쓰레오닌 배출 단백질의 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 제공한다.
상기 L-쓰레오닌, 서열번호 1의 아미노산 서열을 포함하는 L-쓰레오닌 배출 활성을 갖는 단백질 및 이의 변이체에 대해서는 전술한 바와 같다.
본 출원에서 사용된 용어 "벡터"는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원의 또 하나의 양태로서, 본 출원은 상기 L-쓰레오닌 배출 단백질의 변이체를 포함하거나, 이를 코딩하는 폴리뉴클레오티드를 포함하여, L-쓰레오닌을 생산하는 미생물을 제공한다.
본 출원에서 용어 "변이형 폴리펩티드를 포함하는 미생물", " 또는 "L-쓰레오닌 배출 단백질의 변이체를 포함하는 미생물"이란, 자연적으로 약한 L-쓰레오닌 생산능을 가지고 있는 미생물 또는 L-쓰레오닌 생산능이 없는 모균주에 L-쓰레오닌 생산능이 부여된 미생물을 의미한다. 구체적으로 상기 미생물은 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열 내 하나 이상의 아미노산 변이를 포함하는 L-쓰레오닌 배출 단백질의 변이체를 발현하는 미생물로서, 상기 아미노산 변이는 N-말단으로부터 53번째 또는 62번째 아미노산이 다른 아미노산으로의 치환을 포함하는 것일 수 있다. 또한, 상기 미생물은 서열번호 1, 서열번호 113 또는 서열번호 115의 아미노산 서열에서 53번째 또는 62번째 아미노산이 다른 아미노산으로 치환되고, L-쓰레오닌 배출 활성을 갖는, 변이형 폴리펩티드를 발현하는 미생물일 수 있으나 이에 제한되지 않는다.
상기 L-쓰레오닌, 서열번호 1의 아미노산 서열을 포함하는 L-쓰레오닌 배출 활성을 갖는 단백질 및 이의 변이체에 대해서는 전술한 바와 같다.
본 출원에서 용어, 단백질이 "발현되도록/되는"은 목적 단백질이 미생물 내에 도입되거나, 미생물 내에서 발현되도록 변형된 상태를 의미한다. 상기 목적 단백질이 미생물 내 존재하는 단백질인 경우 내재적 또는 변형 전에 비하여 그 활성이 강화된 상태를 의미한다. 본 출원의 목적상 "목적 단백질"은 전술한 L-쓰레오닌 배출능을 갖는 단백질의 변이체일 수 있다.
구체적으로, "단백질의 도입"은, 미생물이 본래 가지고 있지 않았던 특정 단백질의 활성을 나타나게 되는 것 또는 해당 단백질의 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타나게 되는 것을 의미한다. 예를 들어, 특정 단백질을 코딩하는 폴리뉴클레오티드가 미생물 내 염색체로 도입되거나, 특정 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터가 미생물 내로 도입되어 이의 활성이 나타나는 것일 수 있다. 또한, "활성의 강화"는 미생물이 가진 특정 단백질의 내재적 활성 또는 변형 전 활성에 비하여 활성이 향상된 것을 의미한다. 상기 "내재적 활성"은 자연적, 또는 인위적 요인에 의한 유전적 변이로 미생물의 형질이 변화하는 경우, 형질 변화 전 모균주가 본래 가지고 있던 특정 단백질의 활성을 말한다.
구체적으로, 본 출원의 활성 강화는 상기 단백질 변이체를 코딩하는 유전자의 세포 내 카피수 증가, 상기 단백질 변이체를 암호화하는 유전자의 발현 조절 서열에 변이를 도입하는 방법, 상기 L-쓰레오닌 배출 활성을 갖는 단백질 변이체를 암호화하는 유전자 발현 조절 서열을 활성이 강력한 서열로 교체하는 방법, 염색체상의 L-쓰레오닌 배출 활성을 갖는 자연형 단백질을 코딩하는 유전자를 상기 단백질 변이체를 암호화하는 유전자로 대체하는 방법, 상기 단백질 변이체의 활성이 강화되도록 상기 L-쓰레오닌 배출 활성을 갖는 단백질을 암호화하는 유전자에 변이를 추가적으로 도입시키는 방법, 및 미생물에 단백질 변이체를 도입하는 방법으로 이루어진 군으로부터 선택되는 어느 하나 이상의 방법으로 이루어질 수 있으나 이에 제한되지 않는다.
상기에서 유전자의 카피수 증가는, 특별히 이에 제한되지 않으나, 벡터에 작동 가능하게 연결된 형태로 수행되거나, 숙주세포 내의 염색체 내로 삽입됨으로써 수행될 수 있다. 구체적으로, 본 출원의 단백질을 코딩하는 폴리뉴클레오티드가 작동 가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터가 숙주세포 내에 도입되는 것일 수 있다. 또는, 상기 폴리뉴클레오티드가 작동 가능하게 연결된, 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포의 염색체 내에 도입되는 것일 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있다.
다음으로, 폴리뉴클레오티드의 발현이 증가하도록 발현 조절서열을 변형하는 것은, 특별히 이에 제한되지 않으나, 상기 발현 조절서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖는 핵산 서열로 교체함에 의하여 수행될 수 있다. 상기 발현 조절서열은, 특별히 이에 제한되지 않으나, 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다.
상기 폴리뉴클레오티드 발현 단위의 상부에는 본래의 프로모터 대신 강력한 프로모터가 연결될 수 있으며 이에 한정되는 것은 아니다. 공지된 강력한 프로모터의 예에는 cj1 내지 cj7 프로모터(대한민국 등록특허 제10-0620092호), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(대한민국 등록특허 제 10-1783170호), O2 프로모터(대한민국 등록특허 제10-1632642), tkt 프로모터 및 yccA 프로모터 등이 있으나 이에 한정되는 것은 아니다.
아울러, 염색체상의 폴리뉴클레오티드 서열의 변형은, 특별히 이에 제한되지 않으나, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다.
이와 같은 단백질 활성의 도입 및 강화는, 상응하는 단백질의 활성 또는 농도가 야생형이나 비변형 미생물 균주에서의 단백질의 활성 또는 농도를 기준으로 하여 일반적으로 최소 1%, 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% 또는 500%, 최대 1000% 또는 2000%까지 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어 "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 천연형 균주 자체이거나, 상기 L-쓰레오닌 배출 단백질의 변이체를 포함하지 않는 미생물, 또는 상기 L-쓰레오닌 배출 단백질의 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환되지 않은 미생물을 의미한다.
본 출원에서 상기 L-쓰레오닌 배출 단백질의 변이체를 포함하거나, 이를 코딩하는 폴리뉴클레오티드를 포함하는 미생물은 상기 폴리뉴클레오티드를 포함하는 벡터로 형질전환에 의해 제조되는 재조합 미생물일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어 "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원에서 용어, "L-쓰레오닌을 생산하는 미생물"은 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 L-쓰레오닌 생산을 위하여 유전적 변이가 일어나거나 활성을 강화시킨 미생물일 수 있다. 본 출원의 목적상 상기 L-쓰레오닌을 생산하는 미생물은 상기 L-쓰레오닌 배출 단백질의 변이체를 포함하여, 배지 중의 탄소원으로부터 목적하는 L-쓰레오닌을 야생형이나 비변형 미생물과 비교하여 과량으로 생산할 수 있는 미생물을 의미할 수 있다. 본 출원에서 상기 "L-쓰레오닌을 생산하는 미생물"은 "L-쓰레오닌 생산능을 갖는 미생물" 또는 "L-쓰레오닌 생산 미생물"과 혼용되어 사용될 수 있다.
상기 L-쓰레오닌을 생산하는 미생물은 재조합 미생물일 수 있다. 상기 재조합 미생물은 전술한 바와 같다.
상기 L-쓰레오닌을 생산하는 미생물은 L-쓰레오닌을 생산할 수 있다면 그 종류가 특별히 제한되지 않으나, 구체적으로, 코리네박테리움(Corynebacterium) 속, 에스케리키아(Escherichia) 속, 엔테로박터(Enterbacter) 속, 어위니아(Erwinia) 속, 세라티아(Serratia) 속, 프로비덴시아(Providencia) 속 및 브레비박테리움(Brevibacterium) 속에 속하는 미생물 일 수 있고, 보다 구체적으로, 코리네박테리움(Corynebacterium) 속 또는 에스케리키아(Escherichia) 속에 속하는 미생물일 수 있다.
보다 더욱 구체적으로는, 에스케리키아속(Escherichia) 미생물은 대장균(Escherichia coli)일 수 있으며, 코리네박테리움(Corynebacterium) 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스Cxorynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens) 등일 수 있고, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)일 수 있으나, L-쓰레오닌 배출 활성을 갖는 단백질이 도입 또는 강화되어 L-쓰레오닌 생산량이 증가될 수 있는 코리네박테리움 속 또는 에스케리키아 속에 속하는 미생물은 제한 없이 포함될 수 있다.
본 출원에서 상기 L-쓰레오닌 배출 활성을 갖는 단백질 또는 상기 단백질 변이체가 발현되도록 변형된 L-쓰레오닌을 생산하는 미생물의 모균주는 L-쓰레오닌을 생산하는 미생물이라면 특별히 제한되지 않는다. 상기 L-쓰레오닌을 생산하는 미생물은 L-쓰레오닌의 생산량을 증가시키기 위해, L-쓰레오닌의 생합성 경로를 강화시키거나, L-쓰레오닌에 대한 피드백 저해를 해제시키거나, L-쓰레오닌의 생합성 경로를 약화시키는 유전자를 불활성화시키거나, L-쓰레오닌 오페론의 활성을 증가시키거나, 및/또는 L-쓰레오닌 유사체에 대한 내성을 부여한 미생물일 수 있다.
구체적으로, 상기 L-쓰레오닌의 생합성 경로를 강화시키기 위해, 예를 들면, 쓰레오닌 합성효소를 코딩하는 thrC, 포스포에놀 파이루베이트 카복실라아제를 코딩하는 ppc 유전자, 포도당 유입에 관여하는 galP 유전자, 리신-민감성 아스파르토키나아제 3(lysine-sensitive aspartokinase 3)를 코딩하는 lysC 유전자, 호모세린 탈수소효소(homoserine dehydrogenase)를 코딩하는 hom 유전자 또는 옥살로아세테이트(Oxaloacetate) pool 증가를 유도하는 pyc 유전자 등의 발현이 미생물 내에서 강화 또는 증가될 수 있다.
상기 L-쓰레오닌에 대한 피드백 저해를 해제시키기 위해, 예를 들면, lysC 유전자, hom 유전자 또는 아스파르토키나아제 및 호모세린 탈수소효소 1의 이중 기능성을 가지는(Bifunctional aspartokinase/homoserine dehydrogenase 1) thrA 유전자 등에 유전자 변이가 미생물 내 도입될 수 있다.
상기 L-쓰레오닌의 생합성 경로를 약화시키는 유전자를 불활성화시키기 위해, 예를 들면, L- 쓰레오닌 생합성 중간체인 옥살로아세테이트(OAA)를 포스포에놀 파이루베이트(PEP)로 전환하는데 관여하는 pckA 유전자, lysC 유전자를 억제하는 tyrR 유전자, 포도당 유입에 관여하는 galP 유전자의 발현을 억제하는 galR 유전자 또는 DNA-결합 전사 이중 조절자(DNA-binding transcriptional dual regulator)인 mcbR 유전자 등의 발현이 미생물 내에서 약화 또는 불활성화 될 수 있다.
상기 L-쓰레오닌 오페론의 활성을 증가시키기 위해, 아스파르토키나아제(aspartokinase), 호모세린디히드로게나아제(homoserine dehydrogenase), 호모세린 키나아제(homoserine kinase) 및 쓰레오닌 신타아제(threonine synthase)를 코딩하는 유전자로 구성된 쓰레오닌 오페론(일본 공개특허 제2005-227977호)을 포함하는 플라스미드 또는 대장균 유래의 쓰레오닌 오페론 등을 미생물에 도입하여(TURBA E, et al, Agric. Biol. Chem. 53:2269~2271, 1989), 미생물 내에서 쓰레오닌 오페론 발현을 증가시킬 수 있다.
또한, 상기 미생물은 L-쓰레오닌 유사체인 α-아미노-β-히드록시 발레르산 또는 D,L- 쓰레오닌 히드록사메이트 등에 대한 내성을 갖는 것일 수 있다.
그러나, 이에 제한되지 않고 당업계에 공지된 유전자 발현 조절 방법으로 L-쓰레오닌 생산능을 강화할 수 있다.
본 출원에서, 용어 "강화/증가"는 내재적 활성에 비하여 활성이 증가되는 것을 모두 포함하는 개념이다.
이러한 유전자 활성의 강화 또는 증가는, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다. 상기 방법의 예로, 유전자의 세포 내 카피수 증가; 유전자의 발현 조절 서열에 변이를 도입하는 방법; 유전자 발현 조절 서열을 활성이 강력한 서열로 교체하는 방법; 유전자의 활성이 강화되도록 해당 유전자에 변이를 추가적으로 도입시키는 방법; 및 미생물에 외래 유전자를 도입하는 방법으로 이루어진 군으로부터 선택되는 어느 하나 이상의 방법으로 이루어질 수 있으며, 이들의 조합으로도 달성할 수 있으나, 상기 예에 의해 특별히 제한되는 것은 아니다.
본 출원에서 용어, "불활성화"는 내재적 활성에 비하여 활성이 약화되거나 또는 활성이 없는 것을 모두 포함하는 개념이다.
이러한 유전자 활성의 불활성화는, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다. 상기 방법의 예로, 상기 유전자의 활성이 제거된 경우를 포함하여 염색체상의 유전자의 전체 또는 일부를 결실시키는 방법; 해당 단백질의 활성이 감소되도록 돌연변이된 유전자로, 염색체상의 상기 단백질을 코딩하는 유전자를 대체하는 방법; 상기 단백질을 코딩하는 염색체상의 유전자의 발현 조절 서열에 변이를 도입하는 방법; 상기 단백질을 코딩하는 유전자의 발현 조절 서열을 활성이 약하거나 없는 서열로 교체하는 방법(예컨대, 상기 유전자의 프로모터를 내재적 프로모터보다 약한 프로모터로 교체하는 방법); 상기 단백질을 코딩하는 염색체상의 유전자의 전체 또는 일부를 결실시키는 방법; 상기 염색체상의 유전자의 전사체에 상보적으로 결합하여 상기 mRNA로부터 단백질로의 번역을 저해하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)를 도입하는 방법; 상기 단백질을 코딩하는 유전자의 SD 서열 앞단에 SD 서열과 상보적인 서열을 인위적으로 부가하여 2차 구조물을 형성시켜 리보솜(ribosome)의 부착이 불가능하게 만드는 법 및 해당 서열의 ORF(open reading frame)의 3' 말단에 역전사되도록 프로모터를 부가하는 RTE(Reverse transcription engineering) 방법 등이 있으며, 이들의 조합으로도 달성할 수 있으나, 상기 예에 의해 특별히 제한되는 것은 아니다.
본 출원의 또 하나의 양태로서, 상기 L-쓰레오닌을 생산하는 미생물을 배지에서 배양하는 단계를 포함하는 L-쓰레오닌 생산 방법을 제공한다.
상기 L-쓰레오닌, 서열번호 1의 아미노산 서열을 포함하는 L-쓰레오닌 배출 활성을 갖는 단백질, 이의 변이체, 단백질의 발현, 및 미생물에 대해서는 전술한 바와 같다.
본 출원에서 용어, "배양"은 상기 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 상기 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
본 출원에서, 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
배지의 온도는 20 ℃내지 50 ℃, 구체적으로는 30 ℃내지 37 ℃일 수 있으나 이에 제한되지 않는다. 배양 기간은 유용 물질의 원하는 생성량이 수득될 때까지 계속될 수 있으며, 구체적으로는 10 시간 내지 100 시간일 수 있으나 이에 제한되지 않는다.
상기 배양에 의하여 생산된 L-쓰레오닌은 배지 중으로 배출되거나 미처 배출되지 못하고 세포 내에 잔류할 수 있다.
상기 L-쓰레오닌 생산 방법은 배양된 미생물 또는 배지에서 L-쓰레오닌을 회수(recover)하는 단계를 포함할 수 있다.
본 출원의 상기 배양 단계에서 생산된 L-쓰레오닌을 회수하는 방법은 배양방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배양액으로부터 목적하는 L-쓰레오닌를 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-쓰레오닌을 회수 할 수 있다.
또한, 상기 회수 단계는 정제 공정을 포함할 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 수행될 수 있다. 따라서, 상기의 회수되는 L-쓰레오닌은 정제된 형태 또는 L-쓰레오닌을 함유한 미생물 발효액일 수 있다(Introduction to Biotechnology and Genetic Engineering, A. J. Nair., 2008).
이하 본 출원을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1 : L-쓰레오닌 배출 단백질의 변이 라이브러리 및 플라스미드 제작
에러유발 PCR(error-prone PCR)에 사용할 주형(template) 제작하기 위해서 대장균(Escherichia coli) W3110 게놈 DNA로부터 서열번호 43과 서열번호 44로 PCR을 수행하여 염기서열 단편을 확보하였다.
서열번호 43 (rhtC F)
GTCGACTCTAGAGGATCCCCGCTGATTCGTGCGCATGTTG
서열번호 44 (rhtC R)
TGAATTCGAGCTCGGTACCCTCACCGCGAAATAATCAAAT
그리고 SmaI 제한효소로 절단된 pCL1920(Nucleic Acids Rersearch, 18, (1990) 4631)과 상기에 획득한 DNA 단편으로 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 pCL1920-Pn_rhtC를 획득하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50 ℃에 1시간 보존함으로써 수행하였다.
L-쓰레오닌 배출 단백질을 코딩하는 야생형 rhtC에 임의 돌연변이(random mutagenesis) 유발시스템를 위해 에러유발 PCR을 수행하였으며, 에러유발 PCR 수행 시 다각화 PCR 임의 돌연변이 키트(diversify PCR random mutagenesis kit, Takara)를 사용하였다. 변이 발생 비율(mutation rate) 조건 선정을 위해 MnSO4 농도에 따라 아래와 같이 두 가지 조건으로 에러유발 PCR을 수행하였다. 변이를 도입할 DNA 주형으로 상기에 언급한 pCL1920-Pn_rhtC를 사용하여 진행하였다. 에러유발 PCR 수행을 위한 조성물의 조성은 하기 표 1과 같았다. 조건은 95 ℃에서 30초간 변성 후, 95 ℃에서 30초 변성, 55 ℃에서 30초 어닐링, 68 ℃에서 30초 중합을 25회 반복한 후, 68 ℃에서 60초간 중합반응을 수행하였다. 프라이머로 서열번호 43 및 44를 사용하였다.
case # 1 (ul) 2 (ul)
10X Titanium taq Buffer 5 5
MnSO4(8mM) 1 2
dGTP (2mM) 1 1
50 X dNTP Mix 1 1
Titanium Taq Polymerase 1 1
Forward primer(5pmol) 2 2
Reverse primer(5pmol) 2 2
Template DNA 1 1
dH2O 36 35
Total 50 50
상기 표 1 조건으로 수행한 에러유발 PCR 산물에 DpnI을 처리하여 주형 플라스미드를 제거한 DNA와 SmaI 제한효소로 절단된 pCL1920으로 깁슨 어셈블리 방법을 이용하여 재조합 변이 플라스미드 라이브러리를 획득하였다. 상기의 방법으로 획득한 변이 라이브러리(mutant library), pCL1920-Pn_rhtC와 pCL1920를 대장균(Escherichia coli) K12 세포에 형질전환시키고, 50 ug/L의 스펙티노마이신이 포함된 LB 평판배지에 플레이팅하였다. 변이 라이브러리가 형질전환된 K12 에서 50개의 콜로니를 선별하여 변이 발생 비율(mutation rate) 및 다양한 위치에 변이 발생유무를 판단하기 위해 시퀀싱(sequencing)을 진행하였다. 시퀀싱 결과 case #1 조건의 변이 발생 비율은 1.2 kb-1, case #2 조건에서는 2.0 kb-1이었다. case #1, #2 모두 돌연변이체 라이브러리(mutant library) 확보에 적합한 변이 발생 비율을 충족시킨다고 판단하여 위의 조건에서 제작된 라이브러리를 이용하여 유효변이 선별 작업을 수행하였다. L-쓰레오닌(L-Threonine) 60g/L가 포함된 M9 최소배지(minimal media)를 96 딥-웰 플레이트(deep-well plate)에 300 ul씩 분주 후 앞서 형질전환 한 K12/pCL1920-Pn_rhtC, K12/pCL1920, K12/변이 라이브러리 콜로니들을 접종하였다. 그리고 1200 rpm/15 hr/37 ℃ 조건 에서 배양 후 600 nm파장으로 OD를 측정하였다. 야생형 대장균 K12균주가 일반적으로 M9 배지에서 L-쓰레오닌 MIC(Minimal Inhibition Concentration) 농도인 30 g/L 전후에서 성장 저해를 보이므로, 획기적으로 쓰레오닌 배출능이 개선된 균주라면 L-쓰레오닌 60 g/L 농도에서 성장할 수 있을 것으로 판단하였다. 대부분 변이 균주 라이브러리들은 딥웰 플레이트에서 컨트롤 균주(K12/pCL1920, K12/pCL1920-Pn_rhtC)와 같이 거의 성장이 관찰되지 않았으며, 이와 대조적으로 성장이 관찰된 4종의 균주를 선별하여 OD를 기록하였다.
균주명 OD
K12/pCL1920 0.15
K12/pCL1920-Pn_rhtC 0.16
K12/pCL1920-Pn_rhtC 변이 라이브러리 (3-1 C5) 1.41
K12/pCL1920-Pn_rhtC 변이 라이브러리 (3-2 D11) 2.60
K12/pCL1920-Pn_rhtC 변이 라이브러리 (3-4 E3) 2.46
K12/pCL1920-Pn_rhtC 변이 라이브러리 (3-4 G2) 2.57
상기 선별된 4종 변이 균주에서 pCL1920-Pn_rhtC 변이형 플라스미드를 추출 후 변이 확인을 위해서 시퀀싱을 수행하였고 프로모터 지역이 아닌 코딩서열(CDS)에 변이가 발생하였음을 확인하였다. 그리고 상기 표 2에서 언급된 변이형 플라스미드를 위에서부터 pCL1920-Pn_rhtC(m1), pCL1920-Pn_rhtC(m2), pCL1920-Pn_rhtC(m3), pCL1920-Pn_rhtC(m4)로 명명하였다.
코리네 균주에서의 변이형 rhtC의 활성을 비교 평가하고자 삽입용 플라스미드를 아래의 방법으로 제작하였다.
상동재조합을 위해서 Ncgl2533의 업스트림과 다운스트림 부위를 각각 서열번호 45 및 서열번호 46과 서열번호 51 및 서열번호 52로 증폭하였다. 그리고 gapA 프로모터를 변이형 rhtC의 프로모터로 활용하기 위해서 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) ATCC13032 의 게놈 DNA를 주형으로 서열번호 47과 서열번호 48의 프라이머를 이용하여 PCR을 수행하였다. 그리고 표 2에서 선별된 변이형 rhtC의 단편을 확보하기 위해서 서열번호 49와 서열번호 50의 프라이머를 이용하여 각각의 rhtC, rhtC(m1), rhtC(m2), rhtC(m3), rhtC(m4) 단편을 획득하였다.
서열번호 45 (Ncgl2533 up F)
TCGAGCTCGGTACCCCAGCAAGATCTAGTCATCAA
서열번호 46 (Ncgl2533 up R)
GTCGTTTTTAGGCTTCCGCTGGAAAACATTTTGCA
서열번호 47 (PgapA F)
AATGTTTTCCAGCGGAAGCCTAAAAACGACCGAGC
서열번호 48 (PgapA R)
AAATAACATCAACATGTTGTGTCTCCTCTAAAGAT
서열번호 49 (rhtC_m F)
TAGAGGAGACACAACATGTTGATGTTATTTCTCAC
서열번호 50 (rhtC_m R)
TAAGCAGGTTGATTTTCACCGCGAAATAATCAAAT
서열번호 51 (Ncgl2533 dn F)
ATTATTTCGCGGTGAAAATCAACCTGCTTAGGCGT
서열번호 52 (Ncgl2533 dn R)
CTCTAGAGGATCCCCTATAGCTACCATCTGGGTGG
상기의 과정으로 수득된 PCR 단편들과 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDZ는 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 야생형과 변이형 rhtC 재조합 플라스미드 5종을 획득하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50 ℃에 1시간 보존함으로써 수행하였다. 제작된 플라스미드는 각각 pDZ-PgapA_rhtC, pDZ-PgapA_rhtC(m1), pDZ-PgapA_rhtC(m2), pDZ-PgapA_rhtC(m3), pDZ-PgapA_rhtC(m4)로 명명하였다.
실시예 2 : L-쓰레오닌 생산 균주 제작
2-1 : 변이형 리신-민감성 아스파르토키나아제 3(LysC) 형질전환
리신-민감성 아스파르토키나아제 3(lysine-sensitive aspartokinase 3)인 lysC 유전자의 발현 강화와 L-리신(L-Lysine) 및 L-쓰레오닌(L-Threonine)에 대한 피드백 저해 해제를 위한 변이(L377K) 형질(한국 공개특허 제10-2019-0003019호)을 도입하고자 하였다. 구체적으로, 염색체상의 상동재조합(Homologous recombination)이 발생하는 lysC 프로모터의 업스트림(Upstream) 지역과 lysC의 377번 변이 다운스트림(Downstream) 지역을 수득하였고, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) ATCC13032 의 genomic DNA를 주형으로 하여 서열번호 3과 서열번호 4의 프라이머를 이용하여 lysC 프로모터 업스트림(Upstream) 지역을, 서열번호 9와 서열번호 10의 프라이머를 이용하여 lysC의 377번 변이 다운스트림(Downstream) 지역의 유전자 단편을 PCR로 수득하였다.
서열번호 3 (lysC promoter Up 1)
TCGAGCTCGGTACCCGACAGGACAAGCACTGGTTG
서열번호 4 (lysC promoter Up 2)
AGTAGCGCTGGGATGTTTCTCTTTGTGCACCTTTC
서열번호 9 (lysC Down 1)
GAACATCGAAAAGATTTCCACCTCTGAGAT
서열번호 10 (lysC Down 2)
CTCTAGAGGATCCCCGTTCACCTCAGAGACGATTA
그리고 pECCG117-Pcj7-GFP(한국 등록특허 제10-0620092호) 플라스미드를 주형으로 하여 서열번호 5와 서열번호 6의 프라이머를 이용하여 Pcj7 프로모터 단편을 PCR로 수득하였다.
서열번호 5 (Pcj7 1)
GAAAGGTGCACAAAGAGAAACATCCCAGCGCTACT
서열번호 6 (Pcj7 2)
TACGACCAGGGCCATGAGTGTTTCCTTTCGTTGGG
코리네박테리움 글루타미쿰(Corynebacterium glutamicum) ATCC13032 의 게놈 DNA를 주형으로 서열번호 7와 서열번호 8의 프라이머를 이용하여 lysC L377K 변이 업스트림 지역의 유전자 단편을 PCR로 수득하였다.
서열번호 7 (lysC 1)
CGAAAGGAAACACTCATGGCCCTGGTCGTACAGAA
서열번호 8 (lysC 2)
GGTGGAAATCTTTTCGATGTTCACGTTGAC
상기의 PCR 반응은 중합효소 SolgTM Pfu-X DNA 폴리머라제를 사용하였고 조건은 95 ℃에서 5분간 변성 후, 95 ℃에서 30초 변성, 60 ℃에서 30초 어닐링, 72 ℃에서 60초 중합을 30회 반복한 후, 72 ℃에서 5분간 중합반응을 수행하였다.
상기의 과정으로 수득된 PCR 4종 단편과 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDZ(한국 등록특허 제10-1126041호)는 깁슨 어셈블리(DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDZ-Pcj7_lysC L377K로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50 ℃에 1시간 보존함으로써 수행하였다.
제작된 pDZ-Pcj7_lysC L377K벡터를 야생형 코리네박테리움 글루타미쿰 ATCC13032 균주에 전기천공법(Appl. Microbiol.Biotechnol. (1999) 52:541-545)으로 형질전환 후, 2차 교차 과정을 거쳐 염색체 상에서 야생형 lysC유전자가 변이형 Pcj7_lysC L377K 유전자로 교체된 균주를 수득하였다. 해당 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 11과 서열번호 12의 프라이머를 이용한 PCR과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였다.
서열번호 11 (confirm lysC1)
ACATTCCACCCATTACTGCA
서열번호 12 (confirm lysC 2)
TCTTCATCGGTTTCGAAGGT
수득한 형질전환 균주를 Cgl-TH-1로 명명하였다.
2-2 : 변이형 호모세린 탈수소효소(Hom) 형질전환
DNA-결합 전사 이중 조절자(DNA-binding transcriptional dual regulator)인 mcbR 조절을 해제하고 호모세린 탈수소효소(homoserine dehydrogenase)인 hom의 발현량을 증가시키기 위해서 hom 프로모터(promoter)를 Pcj7 프로모터로 교체하였다. 추가적으로 hom의 L-쓰레오닌에 대한 피드백 저해 해제를 위한 변이(G378E, R398Q)를 Cgl-TH-1에 적용하여 L-쓰레오닌 생산을 증가시키고자 하였다. 상기의 변이형 hom 형질전환을 위해서 pDZ-Pcj7_hom(G378E, R398Q)를 제작하였다. Pcj7 프로모터를 hom 프로모터와 교체하기 위해 상동재조합(Homologous recombination)이 발생하는 hom 프로모터 업스트림(Upstream) 지역을 수득하였다. 구체적으로, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) ATCC13032의 게놈 DNA를 주형으로 하여 서열번호 14과 서열번호 55의 프라이머를 이용하여 hom 프로모터 업스트림 지역의 단편을 PCR로 수득하였다.
서열번호 14 (up F)
TCGAGCTCGGTACCCTGTCTCCGTATGCAGTGAGC
서열번호 55 (up R)
GGATGTTTCTTTGGAGCTTCGCTCAATCAT
pECCG117-Pcj7-GFP(한국 등록특허 제10-0620092호) 플라스미드를 주형으로 하여 서열번호 13과 서열번호 56의 프라이머를 이용하여 Pcj7 프로모터 단편을 PCR로 수득하였다.
서열번호 13 (cj7 F)
GAAGCTCCAAAGAAACATCCCAGCGCTACT
서열번호 56 (cj7 R)
AGATGCTGAGGTCATGATTGTTCTCCTATAATCGC
그리고 hom 변이(G378E, R398Q)를 적용하기 위해서 hom 아미노산 1~378번째 코딩서열의 상단과 G378E/R398Q 변이를 포함한 서열 및 R398Q의 하단 서열을 아래의 방법으로 획득하였다.
구체적으로, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) ATCC13032의 게놈 DNA를 주형으로 서열번호 17과 서열번호 18의 프라이머를 이용하여 PCR을 수행하였고 hom 아미노산 1~378번째 코딩서열의 단편을 획득하였다. 같은 방법으로 코리네박테리움 글루타미쿰 ATCC13032 의 게놈 DNA를 주형으로 서열번호 15와 서열번호 20의 프라이머를 이용하여 PCR을 수행하였고 hom G378E/R398Q 변이를 포함한 서열 단편을 획득하였다. 그리고 코리네박테리움 글루타미쿰 ATCC13032 의 게놈 DNA를 주형으로 서열번호 19와 서열번호 21의 프라이머를 이용하여 PCR을 수행하였고 상동재조합(Homologous recombination)이 발생하는 hom R398Q의 하단 서열 단편을 획득하였다.
서열번호 17 (hom F)
TATAGGAGAACAATCATGACCTCAGCATCTGCCCC
서열번호 18 (G378E R)
GCCAAAACCTCCACGCGATCTT
서열번호 15 (G378E F)
AAGATCGCGTGGAGGTTTTGGC
서열번호 20 (R398Q R)
GCGCTCTTCCTGTTGGATTGTACGC
서열번호 19 (R398Q F)
GCGTACAATCCAACAGGAAGAGCGC
서열번호 21 (hom R)
CTCTAGAGGATCCCCGACTGCGGAATGTTGTTGTG
상기의 과정으로 수득된 PCR 5종 단편과 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDZ는 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDZ-Pcj7_hom(G378E, R398Q)로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50 ℃에 1시간 보존함으로써 수행하였다.
제작된 pDZ-Pcj7_hom(G378E, R398Q) 벡터를 Cgl-TH-1 균주에 전기천공법으로 형질전환 후, 2차 교차 과정을 거쳐 염색체 상에서 야생형 hom 유전자가 변이형 Pcj7_hom(G378E, R398Q) 유전자로 교체된 균주를 수득하였다. 해당 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 22와 서열번호 23의 프라이머를 이용한 PCR과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였다.
서열번호 22 (hom conf F)
TGGGTAGGTCGAGTTGTTAA
서열번호 23 (hom conf R)
CAGCGCAGTCGCACGAATAT
수득한 형질전환 균주를 Cgl-TH-2로 명명하였다.
2-3 : 피루브산카복실화효소(Pyc) 발현 강화를 위한 변이 적용
옥살로아세테이트(Oxaloacetate) pool 증가를 통해 L-쓰레오닌 생성을 강화할 목적으로 피루브산카복실화효소(pyruvate carboxylase)인 pyc 유전자의 발현을 증가시키고자 하였다. pyc 발현강화를 위해 pyc 유전자의 프로모터를 Pcj7 프로모터로 교체하였다. pECCG117-Pcj7-GFP(한국 등록특허 제10-0620092호) 플라스미드를 주형으로 하여 서열번호 24과 서열번호 16의 프라이머를 이용하여 Pcj7 프로모터 단편을 PCR로 수득하였다.
서열번호 24 (CJ7 F)
CAACCTTTGCAAGGTGAAAAAGAAACATCCCAGCGCTACT
서열번호 16 (CJ7 R)
TGTGTGAGTCGACATGAGTGTTTCCTTTCGTTGGG
상기의 Pcj7 프로모터를 pyc 프로모터와 교체하기 위한 상동재조합(Homologous recombination)이 발생하는 pyc 프로모터 업스트림(Upstream) 지역을 수득하였다. 구체적으로, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) ATCC13032의 게놈 DNA를 주형으로 하여 서열번호 25와 서열번호 26의 프라이머를 이용하여 pyc 프로모터 업스트림(Upstream) 지역의 단편을 PCR로 수득하였다.
서열번호 25 (upstream F)
TCGAGCTCGGTACCCTGACAGTTGCTGATCTGGCT
서열번호 26 (upstream R)
AGTAGCGCTGGGATGTTTCTTTTTCACCTTGCAAAGGTTG
Pcj7 프로모터 하단 상동 지역(homologous region)으로 활용할 pyc 코딩서열의 N-말단(N-term)을 수득하기 위해 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) ATCC13032 의 게놈 DNA를 주형으로 서열번호 27과 서열번호 28의 프라이머를 이용하여 PCR을 수행하였고 pyc 프로모터 하단 단편을 획득하였다.
서열번호 27 (pyc F)
GGAATAATTACTCTAATGTCGACTCACACATCTTC
서열번호 28 (pyc R)
CTCTAGAGGATCCCCGGCATTTTCAGACAGGAAGC
상기의 과정으로 수득된 PCR 3종 단편과 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDZ는 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDZ-Pcj7_pyc로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50 ℃에 1시간 보존함으로써 수행하였다.
제작된 pDZ-Pcj7_pyc 벡터를 Cgl-TH-2 균주에 전기천공법으로 형질전환 후, 2차 교차 과정을 거쳐 염색체 상에서 야생형 pyc 프로모터가 변이형 Pcj7_pyc 유전자로 교체된 균주를 수득하였다. 해당 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 29와 서열번호 30의 프라이머를 이용한 PCR과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였다.
서열번호 29 (pyc conf F)
ACGCACTCGGTGAAGGCGTG
서열번호 30 (pyc conf R)
CGCTTCAGCTTCACGAGATG
수득한 형질전환 균주를 Cgl-TH-3로 명명하였다.
2-4 : 변이형 L-쓰레오닌 오페론, Ncgl0179 결손 및 아스파르토키나아제와 호모세린 탈수소효소 1의 이중 기능성을 가지는 단백질(ThrA(S352P)BC) 1copy 삽입
L-쓰레오닌 생합성을 강화하기 위해서 대장균 유래 L-쓰레오닌 오페론을 적용하고자 하였다. 특히 아스파르토키나아제 및 호모세린 탈수소효소 1의 이중 기능성을 가지는(Bifunctional aspartokinase/homoserine dehydrogenase 1) thrA 유전자는 L-쓰레오닌에 대한 피드백 저해를 해제하기 위해서 thrA(S352P)(J Bacteriol. 1993 Feb;175(4):959-65) 변이를 적용하였다. 그리고 SPL7 프로모터(대한민국 등록특허 제 10-1783170호)를 사용하여 L-쓰레오닌 오페론을 발현을 증가시키고자 하였다.
그리고 상기의 SPL7_thrA(S352P)BC를 Ncgl0179 위치에 삽입하기 위해 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) ATCC13032의 게놈 DNA를 주형으로 Ncgl0179 상단과 하단 상동 지역(homologous region) 단편을 각각 서열번호 31 및 서열번호 32와 서열번호 37 및 서열번호 38로 염기서열을 증폭하였다. 그리고 합성한 SPL7 프로모터를 주형으로 서열번호 33과 서열번호 34로 SPL7을 증폭하였다.
thrA(S352P) 아미노산 352번째 코디서열 상단은 서열번호 35과 서열번호 36으로, thrA(S352P) 아미노산 352번째 하단 및 thrBC는 서열번호 39와 서열번호 40으로 염기서열을 증폭하였다.
서열번호 31 (Ncgl0179 UP F)
TCGAGCTCGGTACCCTTTTGAGTAATTGGTAATAC
서열번호 32 (Ncgl0179 UP R)
TGAAGCGCCGGTACCCGCTTAAACGGGCGATTAT
서열번호 37 (Ncgl0179 DOWN F)
ATGAATCATCAGTAATTAATGGCCCTCGATTTGGC
서열번호 38 (Ncgl0179 DOWN R)
TCTAGAGGATCCCCTGGAATAATCAGACTCTGGA
서열번호 33 (SPL7 F)
ATCGCCCGTTTAAGCGGGTACCGGCGCTTCATGT
서열번호 34 (SPL7 R)
CTTCAACACTCGCATGATATCTGTTTTGATCTCCT
서열번호 35 (S352P UP F)
ATCAAAACAGATATCATGCGAGTGTTGAAGTTCGG
서열번호 36 (S352P UP R)
TACTGTATTCGGAAGATGGTTGCGTAATCAGCACCAC
서열번호 39 (S352P DOWN F)
GTGGTGCTGATTACGCAACCATCTTCCGAATACAGTA
서열번호 40 (S352P DOWN R)
AAATCGAGGGCCATTAATTACTGATGATTCATCATC
상기의 과정으로 수득된 PCR 5종 단편과 SmaI 제한효소로 절단된 염색체 형질전환용 벡터 pDZ는 깁슨 어셈블리 방법을 이용하여 클로닝함으로써 재조합 플라스미드를 획득하였으며, pDZ-SPL7_thrA(S352P)BC로 명명하였다. 클로닝은 깁슨 어셈블리 시약과 각 유전자 단편들을 계산된 몰수로 혼합 후 50 ℃에 1시간 보존함으로써 수행하였다.
제작된 pDZ-SPL7_thrA(S352P)BC벡터를 Cgl-TH-3 균주에 전기천공법으로 형질전환형질전환 후, 2차 교차 과정을 거쳐 염색체 상에서 SPL7_thrA(S352P)BC 오페론을 삽입한 균주를 수득하였다. 해당 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 41과 서열번호 42의 프라이머를 이용한 PCR과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였다.
서열번호 41 (thr conf F)
GATTCACATCACCAATGTC
서열번호 42 (thr conf R)
GACACCATCGCAGCCCGAC
수득한 형질전환 균주를 Cgl-TH-4로 명명하였다.
상기 균주, Cgl-TH-4는 CJ09-5010로 명명하고, 2019년 5월 31일자로 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(KCCM)에 국제기탁하여 KCCM12537P로 기탁번호를 부여받았다.
2-5 : 변이형 L-쓰레오닌 배출 단백질(RhtC) 도입 코리네박테리움 균주의 L-쓰레오닌 생산
실시예 1에서 제작된 pDZ-PgapA_rhtC, pDZ-PgapA_rhtC(m1), pDZ-PgapA_rhtC(m2), pDZ-PgapA_rhtC(m3), pDZ-PgapA_rhtC(m4) 벡터를 Cgl-TH-4 균주에 각각 전기천공법으로 형질전환형질전환 후, 2차 교차 과정을 거쳐 염색체 상에서 야생형 rhtC와 변이형 rhtC 유전자 4종이 삽입된 각각의 균주를 수득하였다. 해당 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 53과 서열번호 54의 프라이머를 이용한 PCR과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였다.
서열번호 53 (HR outside F)
AAGGAATATCCCGGAGAACC
서열번호 54 (HR outside R)
TTGCGTTTGAAAAGCCCTCG
수득한 형질전환 균주를 각각 Cgl-TH-5, Cgl-TH-5(m1), Cgl-TH-5(m2), Cgl-TH-5(m3), Cgl-TH-5(m4)로 명명하였다.
추가적으로 코리네박테리움 균주에서 변이형 rhtC 도입의 효과를 확인하기 위해서, 제작된 Cgl-TH-5, Cgl-TH-5(m1), Cgl-TH-5(m2), Cgl-TH-5(m3), Cgl-TH-5(m4) 균주들의 L-쓰레오닌 생산량을 비교하고자 아래와 같은 방법으로 배양하였다. 종배지(포도당 20g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, 바이오틴 100 ug, 티아민 HCl 1000 ug, 칼슘-판토텐산 2000 ug, 니코틴아미드 2000 ug, pH 7.0 (증류수 1 리터 기준)) 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주들을 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산배지(포도당 70g, (NH4)2SO4 15 g, MgSO4 7H2O 1.2 g, KH2PO4 1 g, 효모추출물 5 g, 바이오틴 900 ug, 티아민 염산염 4500 ug, 칼슘-판토텐산 4500 ug, CaCO3 30 g, pH 7.0 (증류수 1리터 기준)) 25 ml을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ml의 종배양액을 접종하고 30 ℃에서 24시간 동안, 200 rpm에서 진탕 배양하였다. 배양 종료 후 HPLC에 의해 L-쓰레오닌의 생산량을 측정하고 그 결과를 표 3에 나타내었다.
균주명 L-쓰레오닌 생산량 (g/L) L-쓰레오닌 수율(*100 g/g, %)
Cgl-TH-4 11.1 15.9
Cgl-TH-5 14.0 20.0
Cgl-TH-5(m1) 17.9 25.6
Cgl-TH-5(m2) 24.0 34.3
Cgl-TH-5(m3) 21.8 31.1
Cgl-TH-5(m4) 17.9 25.6
표 3과 같이, 실시예 2-4의 방법으로 제작된 Cgl-TH-4은 11.1 g/L 의 L-쓰레오닌 생산 결과를 보였고 여기에 PgapA_rhtC 야생형 형질이 삽입된 Cgl-TH-5는 14.0 g/L 의 L-쓰레오닌을 생산하였다. 그리고 PgapA_rhtC(m) 변이형 형질이 삽입된 Cgl-TH-5(m1), Cgl-TH-5(m2), Cgl-TH-5(m3), Cgl-TH-5(m4)는 각각 17.9 g/L, 24.0 g/L, 21.8 g/L, 17.9 g/L 의 L-쓰레오닌을 생산하였다. L-쓰레오닌 발효 수율로는 Cgl-TH-4 대비 Cgl-TH-5가 4.1%p 상승을 보인 반면 변이형이 적용된 Cgl-TH-5(m1), Cgl-TH-5(m2), Cgl-TH-5(m3), Cgl-TH-5(m4) 균주는 각각 Cgl-TH-4 대비 9.7%p, 18.4%p, 15.3%p, 9.7%p 상승을 보였다. 특히 Cgl-TH-5(m2), Cgl-TH-5(m3)는 Cgl-TH-5의 수율 상승 대비 약 4배의 큰 수율 상승 효과를 보였다. Cgl-TH-5(m2)에 적용된 변이형 RhtC는 서열번호 94의 아미노산 서열을 갖고 있으며 구체적으로 아미노산 62번 위치의 류신(Leu)이 세린(Ser)로 변형된 변이(L62S)를 포함하고 있었다. 그리고 Cgl-TH-5(m3)에 적용된 변이형 RhtC는 서열번호 93의 아미노산 서열을 갖고 있으며 구체적으로 아미노산 53번 위치의 알라닌(Ala)이 쓰레오닌(Thr)로 변형된 변이(A53T)를 포함하고 있었다.
상기 두 균주, Cgl-TH-5(m2)와 Cgl-TH-5(m3)는 각각 CA09-5012와 CA09-5036로 명명하였으며, 2019년 5월 31일자로 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(KCCM)에 국제기탁하여 KCCM12538P와 KCCM12539P로 기탁번호를 부여받았다.
실시예 3 : 변이형 L-쓰레오닌 배출 단백질 도입 대장균 균주의 L-쓰레오닌 생산
상기 실시예 1에서 제작한 pCL1920-Pn_rhtC와 선별한 변이형 플라스미드 4종 및 공벡터 pCL1920을 각각 L-쓰레오닌 생산능이 있는 대장균 균주인 TF4076(KFCC10718, 대한민국 특허출원 제90-22965호)에 형질전환하여 TF4076/pCL1920, TF4076/pCL1920-Pn_rhtC, TF4076/pCL1920-Pn_rhtC(m1), TF4076/pCL1920-Pn_rhtC(m2), TF4076/pCL1920-Pn_rhtC(m3), TF4076/pCL1920-Pn_rhtC(m4) 균주를 제작하였다. 제작된 균주들의 L-쓰레오닌 생산량 비교를 위해서 플라스크 평가를 수행하였다. 플라스크 테스트는 각각의 균주를 50 ug/ml 의 스펙티노마이신이 첨가된 LB 플레이트에서 스트리킹(streaking)하고 33 ℃ 배양기에 16시간 동안 배양한 후, 단일 콜로니(colony)를 LB 배지 2 ml에 접종한 후 200 rpm/33 ℃ 배양기에서 12시간 동안 배양하였다. 그리고 250 ml 플라스크에 하기 표 4에 따른 조성으로 이루어지는 L-쓰레오닌 생산 플라스크 배지 25 ml을 넣고, 앞서 배양한 배양액을 500 ul씩 투입하였다. 이후, 플라스크를 200 rpm/33 ℃ 배양기에서 48시간 동안 배양한 후, HPLC를 이용해서 각각의 균주에서 얻어진 L-쓰레오닌 양을 비교하고, 그 결과를 표 5에 나타내었다.
조성 함량(리터당)
포도당 70 g
Ammonium sulfate 25 g
KH2PO4 1 g
MgSO47H2O 0.5 g
FeSO47H2O 5 mg
MnSO48H2O 5 mg
ZnSO4 5 mg
탄산칼슘 30 g
효모액기스 2 g
메치오닌 0.15 g
pH 6.8
균주명 L-쓰레오닌 생산량 L-쓰레오닌 수율
(g/L) (*100 g/g, %)
TF4076 25.7 36.7
TF4076/pCL1920 25.9 37.0
TF4076/pCL1920-Pn_rhtC 29.9 42.6
TF4076/pCL1920-Pn_rhtC(m1) 33.4 47.7
TF4076/pCL1920-Pn_rhtC(m2) 40.4 57.7
TF4076/pCL1920-Pn_rhtC(m3) 38.8 55.4
TF4076/pCL1920-Pn_rhtC(m4) 33.8 48.3
표 5와 같이 L-쓰레오닌 생산능이 있는 대장균 균주에 변이형 rhtC 플라스미드가 도입되면 L-쓰레오닌 수율이 크게 상승하는 결과를 얻었다. 특히 pCL1920-Pn_rhtC(m2), pCL1920-Pn_rhtC(m3)가 적용된 경우 L-쓰레오닌 수율이 크게 상승하는 결과를 보였다.
실시예 4 : L-쓰레오닌 배출 단백질의 62번 아미노산인 류신의 포화 돌연변이 생성(Saturated mutagenesis)
표 3 및 표 5에서 언급된 것처럼 rhtC(L62S)의 변이형이 야생형 대비 높은 수율 상승 효과를 나타내어, RhtC의 62번 아미노산인 류신을 다른 아미노산으로 변이시켜 62번 위치의 L-쓰레오닌 배출 개선 유효성에 대해서 검증하고자 하였다. 류신을 류신 이외 19종의 다른 아미노산으로 변이하기 위해서 실시예 1에서 제작된 pDZ-PgapA_rhtC를 주형으로 부위 특이적 돌연변이 생성(Site-Directed Mutagenesis)을 아래의 방법으로 수행하였다.
조성 함량 (ul)
10X pfu-X Buffer 5
10mM dNTP Mix 1
pfu-X Polymerase 1
Mutagenic forward primer(5pmol) 2
Mutagenic reverse primer(5pmol) 2
pDZ-PgapA_rhtC(template DNA, 200 ng/ul) 1
dH2O 38
Total 50
사이클 횟수 온도 시간
1회 95℃ 5 min
18회 95℃ 30 sec
60℃ 1 min
68℃ 10 min
RhtC 62번 류신(L)을 다른 아미노산으로 교체하기 위해서 표 6과 같은 PCR 조성물을 제조하고 표 7의 조건으로 PCR 을 수행하였다. PCR 수행 시 표 8의 돌연변이 생성 프라이머(mutagenic primer) 세트를 이용하였다. PCR이 종료되고 DpnI 제한효소 1ul를 첨가 후 37 ℃로 1시간 처리하였다. DpnI 처리된 DNA 3ul DH5a 컴피던트 셀(competent cell)에 형질전환하여 pDZ-PgapA_rhtC 변이형 플라스미드를 확보하였고 시퀀싱을 통해서 표 8에 표기한 각각의 변이로 교체되었음을 확인하였다.
변이형 rhtC 플라스미드 서열번호 # 염기서열
pDZ-PgapA_rhtC L62R 서열번호 57 GCGCTGCTTGGCCTGCATCGTATTATCGAAAAAATGGCC
서열번호 58 GGCCATTTTTTCGATAATACGATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62A 서열번호 59 GCGCTGCTTGGCCTGCATGCGATTATCGAAAAAATGGCC
서열번호 60 GGCCATTTTTTCGATAATCGCATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62D 서열번호 61 GCGCTGCTTGGCCTGCATGACATTATCGAAAAAATGGCC
서열번호 62 GGCCATTTTTTCGATAATGTCATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62K 서열번호 63 GCGCTGCTTGGCCTGCATAAAATTATCGAAAAAATGGCC
서열번호 64 GGCCATTTTTTCGATAATTTTATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62P 서열번호 65 GCGCTGCTTGGCCTGCATCCGATTATCGAAAAAATGGCC
서열번호 66 GGCCATTTTTTCGATAATCGGATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62C 서열번호 67 GCGCTGCTTGGCCTGCATTGCATTATCGAAAAAATGGCC
서열번호 68 GGCCATTTTTTCGATAATGCAATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62G 서열번호 69 GCGCTGCTTGGCCTGCATGGCATTATCGAAAAAATGGCC
서열번호 70 GGCCATTTTTTCGATAATGCCATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62T 서열번호 71 GCGCTGCTTGGCCTGCATACGATTATCGAAAAAATGGCC
서열번호 72 GGCCATTTTTTCGATAATCGTATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62I 서열번호 73 GCGCTGCTTGGCCTGCATATTATTATCGAAAAAATGGCC
서열번호 74 GGCCATTTTTTCGATAATAATATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62Y 서열번호 75 GCGCTGCTTGGCCTGCATTATATTATCGAAAAAATGGCC
서열번호 76 GGCCATTTTTTCGATAATATAATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62V 서열번호 77 GCGCTGCTTGGCCTGCATGTGATTATCGAAAAAATGGCC
서열번호 78 GGCCATTTTTTCGATAATCACATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62H 서열번호 79 GCGCTGCTTGGCCTGCATCATATTATCGAAAAAATGGCC
서열번호 80 GGCCATTTTTTCGATAATATGATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62F 서열번호 81 GCGCTGCTTGGCCTGCATTTCATTATCGAAAAAATGGCC
서열번호 82 GGCCATTTTTTCGATAATGAAATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62M 서열번호 83 GCGCTGCTTGGCCTGCATATGATTATCGAAAAAATGGCC
서열번호 84 GGCCATTTTTTCGATAATCATATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62Q 서열번호 85 GCGCTGCTTGGCCTGCATCAGATTATCGAAAAAATGGCC
서열번호 86 GGCCATTTTTTCGATAATCTGATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62N 서열번호 87 GCGCTGCTTGGCCTGCATAACATTATCGAAAAAATGGCC
서열번호 88 GGCCATTTTTTCGATAATGTTATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62E 서열번호 89 GCGCTGCTTGGCCTGCATGAAATTATCGAAAAAATGGCC
서열번호 90 GGCCATTTTTTCGATAATTTCATGCAGGCCAAGCAGCGC
pDZ-PgapA_rhtC L62W 서열번호 91 GCGCTGCTTGGCCTGCATTGGATTATCGAAAAAATGGCC
서열번호 92 GGCCATTTTTTCGATAATCCAATGCAGGCCAAGCAGCGC
상기 표 8과 같이 제작된 pDZ-PgapA_rhtC L62R, pDZ-PgapA_rhtC L62A, pDZ-PgapA_rhtC L62D, pDZ-PgapA_rhtC L62K, pDZ-PgapA_rhtC L62P, pDZ-PgapA_rhtC L62C, pDZ-PgapA_rhtC L62G, pDZ-PgapA_rhtC L62T, pDZ-PgapA_rhtC L62I, pDZ-PgapA_rhtC L62Y, pDZ-PgapA_rhtC L62V, pDZ-PgapA_rhtC L62H, pDZ-PgapA_rhtC L62F, pDZ-PgapA_rhtC L62M, pDZ-PgapA_rhtC L62Q, pDZ-PgapA_rhtC L62N, pDZ-PgapA_rhtC L62E, pDZ-PgapA_rhtC L62W 벡터를 실시예 2-5의 방법으로 Cgl-TH-4 균주에 각각 전기천공법으로 형질전환 후, 2차 교차 과정을 거쳐 염색체 상에서 변이형 rhtC 유전자가 삽입된 19종의 균주를 수득하였다. 해당 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 53과 서열번호 54의 프라이머를 이용한 PCR과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였다.
서열번호 53 (HR outside F)
AAGGAATATCCCGGAGAACC
서열번호 54 (HR outside R)
TTGCGTTTGAAAAGCCCTCG
수득한 형질전환 균주를 각각 Cgl-TH-5(L62R), Cgl-TH-5(L62A), Cgl-TH-5(L62D), Cgl-TH-5(L62K), Cgl-TH-5(L62P), Cgl-TH-5(L62C), Cgl-TH-5(L62G), Cgl-TH-5(L62T), Cgl-TH-5(L62I), Cgl-TH-5(L62Y), Cgl-TH-5(L62V), Cgl-TH-5(L62H), Cgl-TH-5(L62F), Cgl-TH-5(L62M), Cgl-TH-5(L62Q), Cgl-TH-5(L62N), Cgl-TH-5(L62E), Cgl-TH-5(L62W)로 명명하였다.
상기의 방법으로 제작된 18종의 균주와 기 제작된 Cgl-TH-4, Cgl-TH-5, Cgl-TH-5(m2) 균주를 실시예 2-5의 L-쓰레오닌 생산 플라스크 배지와 배양방법으로 배양하였고 배양 종료 후 HPLC에 의해 L-쓰레오닌의 생산량을 측정하여 표 9에 나타내었다.
균주명 rhtC 형태 L-쓰레오닌 생산량(g/L) L-쓰레오닌 수율(g/g, %) 야생형 rhtC대비수율향상(△,%p)
Cgl-TH-4 - 11.3 16.1 -
Cgl-TH-5 rhtC 야생형 14.0 20.0 -
Cgl-TH-5(m2) rhtC L62S 24.0 34.3 14.3
Cgl-TH-5(L62R) rhtC L62R 24.9 35.6 15.6
Cgl-TH-5(L62A) rhtC L62A 23.5 33.5 13.5
Cgl-TH-5(L62D) rhtC L62D 17.5 24.9 4.9
Cgl-TH-5(L62K) rhtC L62K 24.0 34.3 14.3
Cgl-TH-5(L62P) rhtC L62P 23.3 33.2 13.2
Cgl-TH-5(L62C) rhtC L62C 15.8 22.6 2.6
Cgl-TH-5(L62G) rhtC L62G 19.8 28.3 8.3
Cgl-TH-5(L62T) rhtC L62T 25.8 36.9 16.9
Cgl-TH-5(L62I) rhtC L62I 17.5 24.9 4.9
Cgl-TH-5(L62Y) rhtC L62Y 16.4 23.4 3.4
Cgl-TH-5(L62V) rhtC L62V 22.5 32.2 12.2
Cgl-TH-5(L62H) rhtC L62H 23.8 34.0 14.0
Cgl-TH-5(L62F) rhtC L62F 16.5 23.6 3.6
Cgl-TH-5(L62M) rhtC L62M 19.1 27.3 7.3
Cgl-TH-5(L62Q) rhtC L62Q 20.0 28.6 8.6
Cgl-TH-5(L62N) rhtC L62N 21.8 31.2 11.2
Cgl-TH-5(L62E) rhtC L62E 18.2 26.0 6.0
Cgl-TH-5(L62W) rhtC L62W 20.7 29.6 9.6
표 9와 같이, 야생형 rhtC 를 삽입한 Cgl-TH-5 대비 RhtC 단백질의 62번 아미노산의 변이를 적용한 19종 변이 모두 3.4~16.9 %p의 발효 수율 향상을 나타내었다.
실시예 5 : 인공변이법을 통한 AHV 내성 균주 스크리닝
코리네박테리움 글루타미쿰 KFCC10881(대한민국 등록특허 제0159812호)을 모균주로 하여 L-쓰레오닌 유사체인 AHV(2-amino-3-hydroxy-valerate)에 대한 내성을 부여하였다.
NTG(N-methyl-N'-nitro-N-nitrosoguanidine)을 사용한 인공변이법으로 변이를 유도하였다. 실시예 2-5의 종배지에서 18시간 동안 배양한 KFCC10881 균주를 다시 종배지 4 ml에 접종한 후, OD660이 약 1.0이 될 때까지 배양하였다. 배양액을 원심분리하여 균체를 회수한 후, 50 mM 트리스-말레이트(Tris-malate) 완충용액(pH 6.5)으로 2회 세척하여 최종 4 ml의 동일한 완충용액으로 현탁하였다. 균체 현탁액에 최종농도 150 mg/l이 되도록 NTG 용액(0.05M 트리스-말레이트 완충용액(pH6.5)에서 2 mg/ml 농도)을 첨가하여 실온에서 20분 간 정치한 후, 원심분리를 통해 균체를 수거하였으며, NTG 제거를 위하여 동일한 완충용액으로 2회 세척하였다. 최종적으로 세척한 균체를 20% 글리세롤 용액 4 ml에 현탁 한 후, 사용 전까지 -70 ℃에 보관하였다. NTG 처리 균주를 3g/l의 AHV를 포함하는 최소배지에 도말하였으며, 상기 과정을 통하여 155주의 AHV 내성을 갖는 변이형 KFCC10881 균주를 155주 수득하였다.
실시예 6 : AHV 내성 KFCC10881 균주로부터 L-쓰레오닌 생산 균주 선별
실시예 5에서 수득한 155주의 AHV 내성 균주에 대하여 L-쓰레오닌 생산능 테스트를 진행하였다. 실시예 2-5의 종배지 25 ml를 함유하는 250 ml 코너-바플 플라스크에 155주의 균주를 접종한 후, 30 ℃에서 20 시간 동안 200 rpm으로 진탕 배양하였다. L-쓰레오닌 생산 배지(포도당 30g, KH2PO4 2g, 요소 3g, (NH4)2SO4 40g, 펩톤 2.5g, CSL(Sigma) 5g(10 ml), MgSO4 7H2O 0.5g, 류신 400 mg, CaCO3 20g, pH 7.2 (증류수 1 리터 기준)) 24 ml를 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종배양액을 접종하고 30 ℃에서 48 시간 동안 200 rpm으로 진탕 배양하였다.
배양 종료 후 HPLC를 이용하여 생산된 여러 아미노산의 생산량을 측정하였다. 실험한 155주의 균주 중 L-쓰레오닌 생산능이 우수한 것으로 나타난 상위 22주에 대한 아미노산의 배양액 내 농도를 표 10에 나타내었다. 상기 과정을 통하여 확인된 22주의 후보를 각각 KFCC10881-1 내지 KFCC10881-22로 명명하였다.
균주명 OD L-Threonine(g/L) Homoserine(g/L)
KFCC10881 58.5 0.0 0.1
KFCC10881-1 60.1 2.0 1.5
KFCC10881-2 57.1 3.0 2.2
KFCC10881-3 47.3 2.8 2.3
KFCC10881-4 51.7 3.2 2.1
KFCC10881-5 58.4 3.1 2.2
KFCC10881-6 52.6 3.4 2.5
KFCC10881-7 14.2 0.4 0.2
KFCC10881-8 55.8 3.0 2.0
KFCC10881-9 44.3 3.2 2.8
KFCC10881-10 47.5 3.7 3.0
KFCC10881-11 57.0 2.7 1.8
KFCC10881-12 51.8 3.3 3.5
KFCC10881-13 49.8 3.0 2.3
KFCC10881-14 62.7 2.4 2.1
KFCC10881-15 62.4 2.9 2.7
KFCC10881-16 59.6 2.8 2.5
KFCC10881-17 24.1 0.1 0.2
KFCC10881-18 60.5 2.6 2.5
KFCC10881-19 60.0 3.0 1.9
KFCC10881-20 65.8 2.7 2.0
KFCC10881-21 17.3 0.3 0.3
KFCC10881-22 60.1 3.5 1.9
표 10과 같이, AHV 내성을 갖는 22종의 균주가 대조군(KFCC10881)에서는 관찰되지 않던 L-쓰레오닌 생산 결과를 보였다. 그리고, 상기 AHV 내성 균주들 중 KFCC10881-10이 가장 우수한 L-쓰레오닌 균주로 선별되었다.
실시예 7: 변이형 L-쓰레오닌 배출 단백질 도입 KFCC10881-10 균주의 L-쓰레오닌 생산
실시예 1에서 제작된 pDZ-PgapA_rhtC, pDZ-PgapA_rhtC(m2), pDZ-PgapA_rhtC(m3) 와 실시예 4의 표 8과 같이 제작된 pDZ-PgapA_rhtC L62R, pDZ-PgapA_rhtC L62A, pDZ-PgapA_rhtC L62D, pDZ-PgapA_rhtC L62K, pDZ-PgapA_rhtC L62P, pDZ-PgapA_rhtC L62C, pDZ-PgapA_rhtC L62G, pDZ-PgapA_rhtC L62T, pDZ-PgapA_rhtC L62I, pDZ-PgapA_rhtC L62Y, pDZ-PgapA_rhtC L62V, pDZ-PgapA_rhtC L62H, pDZ-PgapA_rhtC L62F, pDZ-PgapA_rhtC L62M, pDZ-PgapA_rhtC L62Q, pDZ-PgapA_rhtC L62N, pDZ-PgapA_rhtC L62E, pDZ-PgapA_rhtC L62W 벡터를 KFCC10881-10 균주에 각각 전기천공법으로 형질전환 후, 2차 교차 과정을 거쳐 염색체 상에서 변이형 rhtC 유전자 삽입된 22종의 균주를 수득하였다. 해당 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 53과 서열번호 54의 프라이머를 이용한 PCR과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였다.
서열번호 53 (HR outside F)
AAGGAATATCCCGGAGAACC
서열번호 54 (HR outside R)
TTGCGTTTGAAAAGCCCTCG
수득한 형질전환 균주를 각각 KFCC10881-10(rhtC WT), KFCC10881-10(rhtC L62S), KFCC10881-10(rhtC A53T), KFCC10881-10(rhtC L62R), KFCC10881-10(rhtC L62A), KFCC10881-10(rhtC L62D), KFCC10881-10(rhtC L62K), KFCC10881-10(rhtC L62P), KFCC10881-10(rhtC L62C), KFCC10881-10(rhtC L62G), KFCC10881-10(rhtC L62T), KFCC10881-10(rhtC L62I), KFCC10881-10(rhtC L62Y), KFCC10881-10(rhtC L62V), KFCC10881-10(rhtC L62H), KFCC10881-10(rhtC L62F), KFCC10881-10(rhtC L62M), KFCC10881-10(rhtC L62Q), KFCC10881-10(rhtC L62N), KFCC10881-10(rhtC L62E), KFCC10881-10(rhtC L62W)로 명명하였다.
해당 rhtC 유전자가 삽입된 상동재조합 업스트림 지역과 다운스트림 지역의 외부 부위를 각각 증폭할 수 있는 서열번호 53과 서열번호 54의 프라이머를 이용한 PCR과 게놈 시퀀싱을 통해 해당 유전적 조작을 확인하였다.
그리고 상기의 방법으로 제작된 균주 22종을 실시예 6의 L-쓰레오닌 생산 배지와 배양방법으로 배양하고 배양 종료 후 HPLC에 의해 L-쓰레오닌의 생산량을 측정하여 표 11에 나타내었다.
균주명 L-쓰레오닌 생산량(g/L) L-쓰레오닌 수율(g/g, %) 야생형 rhtC대비 수율 향상(△,%p)
KFCC10881-10 3.8 12.7 -
KFCC10881-10(rhtC WT) 5.5 18.3 -
KFCC10881-10(rhtC A53T) 9.0 30.0 11.7
KFCC10881-10(rhtC L62S) 10.1 33.5 15.2
KFCC10881-10(rhtC L62R) 10.0 33.2 14.9
KFCC10881-10(rhtC L62A) 9.8 32.5 14.2
KFCC10881-10(rhtC L62D) 6.6 22.1 3.8
KFCC10881-10(rhtC L62K) 10.2 34.1 15.8
KFCC10881-10(rhtC L62P) 10.0 33.2 14.9
KFCC10881-10(rhtC L62C) 5.9 19.8 1.5
KFCC10881-10(rhtC L62G) 7.8 26.1 7.8
KFCC10881-10(rhtC L62T) 10.2 34.0 15.7
KFCC10881-10(rhtC L62I) 6.3 20.9 2.6
KFCC10881-10(rhtC L62Y) 6.8 22.5 4.2
KFCC10881-10(rhtC L62V) 9.2 30.5 12.2
KFCC10881-10(rhtC L62H) 9.8 32.8 14.5
KFCC10881-10(rhtC L62F) 6.4 21.3 3.0
KFCC10881-10(rhtC L62M) 7.3 24.2 5.9
KFCC10881-10(rhtC L62Q) 7.9 26.3 8.0
KFCC10881-10(rhtC L62N) 8.9 29.5 11.2
KFCC10881-10(rhtC L62E) 7.4 24.5 6.2
KFCC10881-10(rhtC L62W) 8.5 28.2 9.9
표 11과 같이 KFCC10881-10에 변이형 RhtC를 도입했을 경우 실시예 3과 실시예 4에서 나타났던 결과와 같이 야생형 RhtC 대비 높은 수준의 수율 상승을 관찰할 수 있었다.
실시예 8: 변이형 L-쓰레오닌 배출 단백질 도입 TF4076 균주의 L-쓰레오닌 생산
대장균 W3110 유래 rhtC 단백질(서열번호 1)과 상동성이 높은 다른 균주 유래 rhtC에 본 출원의 변이를 도입하여 L-쓰레오닌 생산 결과를 확인하였다.
구체적으로, 실시예 1과 동일한 방법으로 대장균 W3110, 시겔라 플렉스네리(Shegella flexneri), 에스케리키아 페르구소니(Escherichia fergusonii)의 게놈 DNA로부터 PCR을 수행하여 염기서열 단편을 각각 확보하고(eco rhtC, sfe rhtC, efe rhtC), 이에 실시예 1의 방법으로 L62S 변이를 도입한 변이형 rhtC를 각각 제작하였다. 제작한 변이형 rhtC 또는 각 균주의 야생형 rhtC를 pCL1920과 클로닝함으로써 재조합 플라스미드 pCL1920-Pn_rhtC.eco, pCL1920-Pn_rhtC.eco L62S, pCL1920-Pn_rhtC.sfe, pCL1920-Pn_rhtC.sfe L62S, pCL1920-Pn_rhtC.efe, pCL1920-Pn_rhtC.efe L62S를 획득하였다.
상기에서 제작한 제조합 플라스미드를 각각 L-쓰레오닌 생산능이 있는 대장균 균주인 TF4076에 형질전환하여 TF4076/pCL1920, TF4076/pCL1920-Pn_rhtC.eco, TF4076/pCL1920-Pn_rhtC.eco L62S, TF4076/pCL1920-Pn_rhtC.sfe, TF4076/pCL1920-Pn_rhtC.sfe L62S, TF4076/pCL1920-Pn_rhtC.efe, TF4076/pCL1920-Pn_rhtC.efe L62S 균주를 제작하였다. 제작된 균주들의 L-쓰레오닌 생산량 비교를 위해서 플라스크 평가를 수행하고, 그 결과를 표 12에 나타내었다.
균주명 L-쓰레오닌 생산량 L-쓰레오닌 수율
(g/L) (*100 g/g, %)
TF4076 25.7 36.7
TF4076/pCL1920 25.9 37
TF4076/pCL1920-Pn_rhtC.eco 29.9 42.6
TF4076/pCL1920-Pn_rhtC.eco L62S 40.4 57.7
TF4076/pCL1920-Pn_rhtC.sfe 31.1 44.43
TF4076/pCL1920-Pn_rhtC.sfe L62S 41.5 59.29
TF4076/pCL1920-Pn_rhtC.efe 29.1 41.57
TF4076/pCL1920-Pn_rhtC.efe L62S 38.2 54.57
표 12와 같이 TF4076에 대장균 W3110, 시겔라 플렉스네리 또는 에스케리키아 페르구소니 유래 RhtC에 L62S 변이를 도입한 변이형 RhtC를 도입했을 경우 실시예 3, 실시예 4 및 실시예 7에서 나타났던 결과와 같이 야생형 RhtC 대비 높은 수준의 수율 상승을 관찰할 수 있었다.
이를 통해, 기준 서열이 달라지더라도 본 발명의 53번째 또는 62번째 위치에 상응하는 위치에서 다른 아미노산으로 치환할 경우, L-쓰레오닌 배출능이 향상될 것임을 알 수 있다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2020012154-appb-I000001
Figure PCTKR2020012154-appb-I000002
Figure PCTKR2020012154-appb-I000003

Claims (9)

  1. 서열번호 1의 53번째 또는 62번째 위치에 상응하는 위치에서 다른 아미노산으로의 치환을 포함하고, 서열번호 1의 아미노산 서열과 적어도 80% 이상, 100% 미만의 서열 상동성을 가지며, L-쓰레오닌 배출 활성을 가지는, L-쓰레오닌 배출 단백질의 변이체.
  2. 제1항에 있어서, 상기 다른 아미노산은 세린, 아르기닌, 알라닌, 아스파르트산, 리신, 프롤린, 시스테인, 글리신, 쓰레오닌, 이소류신, 티로신, 발린, 히스티딘, 페닐알라닌, 메티오닌, 글루타민, 아스파라긴, 글루탐산 또는 트립토판으로부터 선택되는 것인, 단백질의 변이체.
  3. 제1항에 있어서, 상기 단백질의 변이체는 서열번호 93 내지 112 중에서 선택되는 어느 하나의 아미노산 서열을 포함하는, 단백질의 변이체.
  4. 제1항 내지 제3항 중 어느 한 항의 단백질의 변이체를 코딩하는 폴리뉴클레오티드.
  5. 제4항의 폴리뉴클레오티드를 포함하는 벡터.
  6. 서열번호 1의 53번째 또는 62번째 위치에 상응하는 위치에서 다른 아미노산으로의 치환을 포함하고, 서열번호 1의 아미노산 서열과 적어도 80% 이상, 100% 미만의 서열 상동성을 갖는, L-쓰레오닌 배출 단백질의 변이체, 상기 변이체를 코딩하는 폴리뉴클레오티드 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하여, L-쓰레오닌을 생산하는 미생물.
  7. 제6항에 있어서, 상기 미생물은 코리네박테리움 속(Corynebacterium sp.) 또는 에스케리키아 속(Escherichia sp.) 미생물인, L-쓰레오닌을 생산하는 미생물.
  8. 서열번호 1의 53번째 또는 62번째 위치에 상응하는 위치에서 다른 아미노산으로의 치환을 포함하고, 서열번호 1의 아미노산 서열과 적어도 80% 이상, 100% 미만의 서열 상동성을 갖는, L-쓰레오닌 배출 단백질의 변이체, 상기 변이체를 코딩하는 폴리뉴클레오티드 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하는 미생물을 배지에서 배양하는 단계를 포함하는, L-쓰레오닌 생산 방법.
  9. 제8항에 있어서, 상기 방법은 배양된 배지 또는 미생물에서 L-쓰레오닌을 회수하는 단계를 포함하는 것인, L-쓰레오닌 생산 방법.
PCT/KR2020/012154 2019-09-09 2020-09-09 L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법 WO2021049866A1 (ko)

Priority Applications (8)

Application Number Priority Date Filing Date Title
JP2021569881A JP7295276B2 (ja) 2019-09-09 2020-09-09 Ｌ－トレオニン排出タンパク質の変異体及びそれを用いたｌ－トレオニン生産方法
BR112021025448A BR112021025448A2 (pt) 2019-09-09 2020-09-09 Variante de proteína de exportação de l-treonina e método para produção de l-treonina com o uso da mesma
AU2020346645A AU2020346645B2 (en) 2019-09-09 2020-09-09 L-threonine export protein variant and method for production of L-threonine using same
US17/623,226 US20230012923A1 (en) 2019-09-09 2020-09-09 L-threonine export protein variant and method for production of l-threonine using same
CN202080055138.5A CN114729012B (zh) 2019-09-09 2020-09-09 L-苏氨酸输出蛋白变体和使用其生产l-苏氨酸的方法
MX2021014853A MX2021014853A (es) 2019-09-09 2020-09-09 Variante de proteina de exportacion de l-treonina y procedimiento para la produccion de l-treonina mediante el uso de la misma.
EP20862085.6A EP3957646A4 (en) 2019-09-09 2020-09-09 L-THREONINE EXPORT PROTEIN VARIANT AND METHODS OF PRODUCTION OF L-THREONINE USING THE SAME
ZA2021/09716A ZA202109716B (en) 2019-09-09 2021-11-29 L-threonine export protein variant and method for production of l-threonine using same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0111509 2019-09-09
KR1020190111509A KR102183209B1 (ko) 2019-09-09 2019-09-09 L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법

Publications (1)

Publication Number Publication Date
WO2021049866A1 true WO2021049866A1 (ko) 2021-03-18

Family

ID=73679199

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/012154 WO2021049866A1 (ko) 2019-09-09 2020-09-09 L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법

Country Status (10)

Country Link
US (1) US20230012923A1 (ko)
EP (1) EP3957646A4 (ko)
JP (1) JP7295276B2 (ko)
KR (1) KR102183209B1 (ko)
CN (1) CN114729012B (ko)
AU (1) AU2020346645B2 (ko)
BR (1) BR112021025448A2 (ko)
MX (1) MX2021014853A (ko)
WO (1) WO2021049866A1 (ko)
ZA (1) ZA202109716B (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024094481A1 (en) 2022-11-03 2024-05-10 Evonik Operations Gmbh Improved biotechnological process to produce guanidinoacetic acid (gaa) by targeted introduction or by increasing the activity of a transmembrane exporter protein

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20230131654A (ko) * 2022-03-07 2023-09-14 씨제이제일제당 (주) 변이형 l-쓰레오닌 배출 단백질 및 이를 이용한 l-쓰레오닌 생산 방법
KR20230131653A (ko) * 2022-03-07 2023-09-14 씨제이제일제당 (주) 변이형 l-쓰레오닌 배출 단백질 및 이를 이용한 l-쓰레오닌 생산 방법
KR20240000168A (ko) * 2022-06-23 2024-01-02 씨제이제일제당 (주) L-히스티딘 배출 단백질 및 이를 이용한 l-히스티딘 생산 방법
KR20240000169A (ko) * 2022-06-23 2024-01-02 씨제이제일제당 (주) L-히스티딘 배출 단백질 및 이를 이용한 l-히스티딘 생산 방법

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997023597A2 (de) 1995-12-22 1997-07-03 Forschungszentrum Jülich GmbH Verfahren zur mikrobiellen herstellung von aminosäuren durch gesteigerte aktivität von exportcarriern
KR0159812B1 (ko) 1995-12-20 1998-11-16 손경식 코리네박테리움 글루타미컴 씨에이치 77 및 이 균주를 이용한 l-라이신의 제조 방법
KR20000048340A (ko) * 1998-12-23 2000-07-25 에가시라 구니오 Ｌ-아미노산을 생산하는 신규한 유전자 및 생산 방법
US20030017554A1 (en) * 2000-11-15 2003-01-23 Mechthild Rieping Process for the fermentative preparation of L-amino acids using strains of the enterobacteriaceae family
JP2005227977A (ja) 2004-02-12 2005-08-25 Fuji Heavy Ind Ltd 車販売支援システム、在庫管理サーバ、車販売支援プログラム及び車販売支援方法
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
KR20080082880A (ko) * 2007-03-09 2008-09-12 한국과학기술원 부위특이적 변이에 의해 제조된 고수율의 ｌ－쓰레오닌생산균주 및 이를 이용한 ｌ－쓰레오닌의 제조방법
EP1016710B1 (en) 1998-12-30 2010-03-17 Ajinomoto Co., Inc. Method for producing L-amino acids
KR101126041B1 (ko) 2008-04-10 2012-03-19 씨제이제일제당 (주) 트랜스포존을 이용한 형질전환용 벡터, 상기 벡터로형질전환된 미생물 및 이를 이용한 ｌ-라이신 생산방법
CN104845995A (zh) * 2014-02-14 2015-08-19 中国科学院微生物研究所 一种动态调控苏氨酸外排转运蛋白基因表达生产l-苏氨酸的方法
KR101632642B1 (ko) 2015-01-29 2016-06-22 씨제이제일제당 주식회사 신규한 프로모터 및 그의 용도
KR101783170B1 (ko) 2016-08-31 2017-09-29 씨제이제일제당 (주) 신규 프로모터 및 이의 용도
KR20190003019A (ko) 2017-06-30 2019-01-09 씨제이제일제당 (주) 신규한 아스파토키나제 변이체 및 이를 이용한 l-아미노산의 제조방법

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002036797A2 (en) * 2000-11-04 2002-05-10 Degussa Ag Process for the fermentative preparation of l-amino acids using strains of the enterobacteriaceae family
CN101597589B (zh) * 2001-02-13 2011-08-24 味之素株式会社 通过埃希氏菌属细菌生产l-氨基酸的方法
DE60219968T2 (de) * 2001-02-13 2008-01-17 Ajinomoto Co., Inc. Verfahren zur Produktion von L-Aminosäuren mittels Bakterien der Gattung Escherichia
DE10135053A1 (de) * 2001-07-18 2003-02-06 Degussa Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung von Stämmen der Familie Enterobacteriaceae
DE102004003410A1 (de) * 2004-01-23 2005-08-25 Degussa Ag Verfahren zur Herstellung von L-Aminosäuren unter Verwendung von Stämmen der Familie Enterobacteriaceae
CN109852572B (zh) * 2019-01-28 2021-05-28 江南大学 一种敲除大肠杆菌pts系统提高l-苏氨酸产量的方法

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR0159812B1 (ko) 1995-12-20 1998-11-16 손경식 코리네박테리움 글루타미컴 씨에이치 77 및 이 균주를 이용한 l-라이신의 제조 방법
WO1997023597A2 (de) 1995-12-22 1997-07-03 Forschungszentrum Jülich GmbH Verfahren zur mikrobiellen herstellung von aminosäuren durch gesteigerte aktivität von exportcarriern
KR20000048340A (ko) * 1998-12-23 2000-07-25 에가시라 구니오 Ｌ-아미노산을 생산하는 신규한 유전자 및 생산 방법
EP1016710B1 (en) 1998-12-30 2010-03-17 Ajinomoto Co., Inc. Method for producing L-amino acids
US20030017554A1 (en) * 2000-11-15 2003-01-23 Mechthild Rieping Process for the fermentative preparation of L-amino acids using strains of the enterobacteriaceae family
JP2005227977A (ja) 2004-02-12 2005-08-25 Fuji Heavy Ind Ltd 車販売支援システム、在庫管理サーバ、車販売支援プログラム及び車販売支援方法
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
KR20080082880A (ko) * 2007-03-09 2008-09-12 한국과학기술원 부위특이적 변이에 의해 제조된 고수율의 ｌ－쓰레오닌생산균주 및 이를 이용한 ｌ－쓰레오닌의 제조방법
KR101126041B1 (ko) 2008-04-10 2012-03-19 씨제이제일제당 (주) 트랜스포존을 이용한 형질전환용 벡터, 상기 벡터로형질전환된 미생물 및 이를 이용한 ｌ-라이신 생산방법
CN104845995A (zh) * 2014-02-14 2015-08-19 中国科学院微生物研究所 一种动态调控苏氨酸外排转运蛋白基因表达生产l-苏氨酸的方法
KR101632642B1 (ko) 2015-01-29 2016-06-22 씨제이제일제당 주식회사 신규한 프로모터 및 그의 용도
KR101783170B1 (ko) 2016-08-31 2017-09-29 씨제이제일제당 (주) 신규 프로모터 및 이의 용도
KR20190003019A (ko) 2017-06-30 2019-01-09 씨제이제일제당 (주) 신규한 아스파토키나제 변이체 및 이를 이용한 l-아미노산의 제조방법

Non-Patent Citations (19)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
A. J. NAIR, INTRODUCTION TO BIOTECHNOLOGY AND GENETIC ENGINEERING, 2008
APPL. MICROBIOL. BIOTECHNOL., vol. 52, 1999, pages 541 - 545
ATSCHUL, S. F. ET AL., J MOLEC BIOL, vol. 215, 1990, pages 403
CARILLO ET AL., SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DALEY DO: "Global topology analysis of the Escherichia coli inner membrane proteome", SCIENCE, vol. 308, no. 5726, 27 May 2005 (2005-05-27), pages 1321 - 3, XP055032414, DOI: 10.1126/science.1109730
DATABASE Protein 20 June 2019 (2019-06-20), "threonine export protein RhtC [Escherichia coli]", XP055791995, retrieved from NCBI Database accession no. WP_097344017 *
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
DG GIBSON ET AL., NATURE METHODS, vol. 6, no. 5, May 2009 (2009-05-01)
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
J BACTERIOL, vol. 175, no. 4, February 1993 (1993-02-01), pages 959 - 65
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
NUCLEIC ACIDS RESEARCH, vol. 18, 1990, pages 4631
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL., TRENDS GENET, vol. 16, 2000, pages 276 - 277
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482
TURBA E., AGRIC. BIOL. CHEM., vol. 53, 1989, pages 2269 - 2271

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024094481A1 (en) 2022-11-03 2024-05-10 Evonik Operations Gmbh Improved biotechnological process to produce guanidinoacetic acid (gaa) by targeted introduction or by increasing the activity of a transmembrane exporter protein

Also Published As

Publication number Publication date
AU2020346645A1 (en) 2022-01-27
EP3957646A4 (en) 2022-06-22
CN114729012B (zh) 2024-02-06
AU2020346645B2 (en) 2023-08-17
ZA202109716B (en) 2022-09-28
MX2021014853A (es) 2022-01-18
EP3957646A1 (en) 2022-02-23
BR112021025448A2 (pt) 2022-03-22
US20230012923A1 (en) 2023-01-19
JP2022534078A (ja) 2022-07-27
JP7295276B2 (ja) 2023-06-20
CN114729012A (zh) 2022-07-08
KR102183209B1 (ko) 2020-11-26

Similar Documents

Publication Publication Date Title
WO2020204427A1 (ko) 신규 l-트립토판 배출 단백질 변이체 및 이를 이용한 l-트립토판을 생산하는 방법
WO2021049866A1 (ko) L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법
WO2019164348A1 (ko) 신규 l-트립토판 배출 단백질 및 이를 이용한 l-트립토판을 생산하는 방법
WO2021150029A1 (ko) Nadp 의존적 글리세르알데하이드-3-포스페이트 디하이드로지나제를 포함하는 미생물을 이용하여 ｌ-아미노산을 생산하는 방법
WO2021125896A1 (ko) 내막 단백질의 변이체 및 이를 이용한 목적 산물 생산 방법
WO2017069578A1 (ko) L-이소루신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용하여 l-이소루신을 생산하는 방법
WO2022163951A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2017014532A1 (ko) 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법
WO2021085999A1 (ko) 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2020226341A1 (ko) L-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산을 생산하는 방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2021060696A1 (ko) 디하이드로디피콜린산 리덕타제 변이형 폴리펩티드 및 이를 이용한 l-쓰레오닌 생산방법
WO2022164118A1 (ko) 프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
WO2021261733A1 (ko) L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법
WO2022124708A1 (ko) 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법
WO2022225075A1 (ko) 신규한 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022231036A1 (ko) 신규한 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2019017706A2 (ko) 퓨트레신을 생산하는 미생물 및 이를 이용한 퓨트레신 생산방법
WO2022050671A1 (ko) L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2021060701A1 (ko) 메조 디아미노피멜레이트 디하이드로게네이즈 변이형 폴리펩타이드 및 이를 이용한 l-쓰레오닌 생산방법
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022231042A1 (ko) 신규한 변이체 및 이를 이용한 l-발린 생산 방법
WO2021242032A1 (ko) 신규 l-타이로신 배출 단백질 변이체 및 이를 이용한 l-타이로신을 생산하는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20862085

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021569881

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020862085

Country of ref document: EP

Effective date: 20211119

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021025448

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2020346645

Country of ref document: AU

Date of ref document: 20200909

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 112021025448

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20211216