WO2021085999A1 - 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법 - Google Patents

외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법 Download PDF

Info

Publication number
WO2021085999A1
WO2021085999A1 PCT/KR2020/014780 KR2020014780W WO2021085999A1 WO 2021085999 A1 WO2021085999 A1 WO 2021085999A1 KR 2020014780 W KR2020014780 W KR 2020014780W WO 2021085999 A1 WO2021085999 A1 WO 2021085999A1
Authority
WO
WIPO (PCT)
Prior art keywords
methionine
microorganism
activity
protein
gene
Prior art date
Application number
PCT/KR2020/014780
Other languages
English (en)
French (fr)
Inventor
최솔
이진남
김희주
노진아
이한형
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to JP2022523724A priority Critical patent/JP7450712B2/ja
Priority to CN202080076044.6A priority patent/CN114729379A/zh
Priority to US17/754,988 priority patent/US20230212623A1/en
Priority to BR112022007907A priority patent/BR112022007907A2/pt
Priority to EP20883239.4A priority patent/EP4032981A4/en
Publication of WO2021085999A1 publication Critical patent/WO2021085999A1/ko
Priority to ZA2022/05485A priority patent/ZA202205485B/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/12—Methionine; Cysteine; Cystine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria

Definitions

  • the present application relates to an L-methionine-producing microorganism into which a protein encoded by a foreign metZ gene is introduced and a method for producing L-methionine using the same.
  • L-methionine is a kind of essential amino acid in vivo, and is used as a raw material for pharmaceuticals and food additives such as feed, infusion, and synthetic raw material for pharmaceuticals.
  • Methionine is an important amino acid involved in the methyl group transfer reaction in vivo, and plays a role of providing sulfur.
  • the chemical synthesis of methionine is mainly through a reaction that hydrolyzes 5-( ⁇ -methylmercaptoethyl)hydantoin (5-( ⁇ -methylmercaptoethyl)-hydantoin), in the form of a mixture of L-type and D-type.
  • a method of producing methionine is being used.
  • the above chemical synthesis is produced in the form of a mixture of L-type and D-type.
  • L-methionine can be produced using biological methods. More specifically, one of the ways in which microorganisms produce L-methionine is direct sulfhydration using O-acyl homoserine (O-acetyl homoserine or O-succinyl homoserine) and hydrogen sulfide as substrates. By producing methionine. For example, an enzyme encoded by the metY gene in coryneform microorganisms is known to perform a direct sulfhydration function.
  • Another way for microorganisms to produce L-methionine is to produce methionine by transsulfuration using O-acyl homoserine (O-acetyl homoserine or O-succinyl homoserine) and cysteine as substrates.
  • O-acyl homoserine O-acetyl homoserine or O-succinyl homoserine
  • cysteine an enzyme encoded by the metB gene in coryneform microorganisms is known to perform a transsulfuration function.
  • the enzyme encoded by metB produces a lot of by-products, and the metY gene has a disadvantage that it receives feedback inhibition, so it is difficult to apply to mass-produce L-methionine industrially (Kromer JO et al., J. Bacteriol 188(2):609-618, 2006, Yeom HJ et al., J Microbiol Biotechnol 14(2): 373-378, 2004 et
  • the present inventors have made diligent efforts to discover a protein that can replace the protein, and then a microorganism that introduced a protein encoded by the metZ gene By confirming that L-methionine was produced in high yield, the present application was completed.
  • the object of the present application is to provide an L-methionine-producing microorganism into which a protein encoded by a foreign metZ gene is introduced.
  • Another object of the present application is to provide a method for preparing L-methionine comprising culturing the microorganism in a medium containing thiosulfate.
  • Another object of the present application is to provide a composition for producing L-methionine comprising the microorganism and thiosulfate.
  • the microorganism into which the protein activity encoded by metZ of the present application is introduced has a high yield because it produces less by-products than metY, and does not receive feedback inhibition unlike metB, which is subjected to feedback inhibition by methionine, so L-methionine in high yield Can be produced, so it can be usefully used in industrial production of L-methionine.
  • 1 is a schematic diagram of the pDCM2 plasmid.
  • One aspect of the present application provides an L-methionine-producing microorganism into which a protein encoded by a foreign metZ gene is introduced.
  • Another aspect of the present application provides a method for producing L-methionine, comprising culturing the L-methionine-producing microorganism in a medium containing thiosulfate.
  • the term'metZ gene' in the present application is a gene encoding an enzyme involved in sulfhydration using acylhomoserine as a substrate.
  • acylhomoserine refers to a compound in which an acyl group is bound to homoserine, and includes both succinylhomoserine and acetylhomoserine.
  • the acyl homoserine may be O-succinyl homoserine or O-acetyl homoserine, but is not limited thereto.
  • the enzyme encoded by the metZ gene is sulfhydration using succinylhomoserine sulfhydrylase, acetylhomoserine sulfhydrylase, or O-succinylhomoserine as a substrate. It may be a gene known to encode an enzyme involved in, but is not limited thereto.
  • sulfhydration is used interchangeably with the term “sulfhydrylation”, and refers to a reaction in which a sulfhydryl (-SH) functional group is provided to a specific molecule.
  • sulfhydryl a sulfhydryl (-SH) functional group
  • the term may mean a reaction in the process of synthesizing methionine, but is not limited thereto.
  • the enzyme involved in the "sulfhydration” may be referred to as “sulfhydrylase”, but is not limited thereto.
  • the first step of preparing a methionine precursor using a microorganism the first step of preparing a methionine precursor using a microorganism; And in the method for producing methionine comprising a two-step reaction of performing an enzymatic reaction in vitro by adding methylmercaptan and a methionine converting enzyme to a fermentation broth containing a methionine precursor, the enzyme expressed by the metZ gene is methionine in vitro. It was used as a converting enzyme (see US 2010-0184164 A1)
  • the other is to convert O-acetyl homoserine to homocysteine by using an enzyme encoded by a gene called metY.
  • inorganic sulfur compounds such as hydrogen sulfide are used as the sulfur source. do.
  • the reaction of converting acyl homoserine and hydrogen sulfide to homocysteine as a reactant unlike the above-described transsulfuration, is direct because cystathionine, an intermediate product, is not produced in the process of producing homocysteine, a precursor of methionine. It is referred to as direct sulfhydrylation.
  • the sulfhydration pathway may mean a reaction pathway for converting to another substance through a reaction between acylhomoserine and a sulfur source, and can be largely divided into transsulfuration and direct sulfhydration.
  • the protein encoded by the metB gene uses acetylhomoserine and homocysteine in addition to cystathionine to produce a by-product called homolanthionine (Kromer JO et al., J Bacteriol 188(2): 609-618, 2006)
  • homolanthionine Kromer JO et al., J Bacteriol 188(2): 609-618, 2006
  • methionine Yeom HJ et al., J Microbiol Biotechnol 14(2): 373-378, 2004.
  • the present application is characterized by clarifying that the introduction of the metZ gene can be usefully used in methionine fermentation to biologically produce methionine by introducing the foreign metZ gene into a Corynebacterium strain.
  • the amount of by-products produced may be reduced.
  • the by-product may be homolanthionine.
  • the decrease in the amount of by-products produced may mean a decrease compared to the amount of by-products produced in a synthetic pathway involving a protein encoded by metB or compared to a wild-type microorganism, but is not limited thereto.
  • the microorganism into which the foreign metZ gene of the present application is introduced and the method for methionine production including culturing the same may be a by-product generation amount reduced compared to the methionine-producing microorganism to which the foreign metZ gene is not introduced and the method for producing methionine using the same.
  • the protein encoded by the metZ gene of the present application may not be subjected to feedback inhibition by methionine.
  • the protein encoded by the metZ gene of the present application is O-acylhomoserine sulfhydrylase, and hydrogen sulfide can be used as a sulfur source, as well as O-acylhomoserine transsulfure.
  • As an acylhomoserine transsulfurase cysteine may be used as a sulfur source.
  • the protein is O-acetylhomoserine sulfhydrylase, O-acetylhomoserine transsulfurase, O-succinylhomoserine sulfhydrylase or O-succinylhomoserine transsulfuraseyl I can.
  • the protein encoded by the metZ gene may be a protein having O-acylhomoserine sulfhydrylase activity, and specifically, O-acetylhomoserine sulfhydrylase, O-acetylhomoserine transsulphate. It may be a protein having at least one activity of purase, O-succinylhomoserine sulfhydrylase, and O-succinylhomoserine transsulfurase.
  • the foreign metZ gene of the present application may be a gene derived from different from the L-methionine-producing microorganism into which the gene is introduced, or may be different from a gene inherently present in the L-methionine-producing microorganism into which the gene is introduced.
  • the gene may be a gene named metZ derived from Chromobacterium violaceum , Hyphomonas neptunium , or Rhodobacter sphaeroides, but is not limited thereto.
  • the gene is not limited as long as it can enhance L-methionine production ability, and any gene may be included.
  • the sequence of the metZ gene can be obtained from GenBank of NCBI, a known database, and various methods well known in the art can be applied as a method of securing the sequence.
  • the protein encoded by the foreign metZ is any one or more amino acid sequences selected from the group consisting of any one of SEQ ID NOs: 60, 61, and 62 and a polypeptide sequence having 90% or more homology or identity thereto (polypeptide Sequence), but is not limited thereto.
  • the protein is 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 97.7%, 97.8% with the polypeptide sequence of any one of SEQ ID NOs: 60, 61 and 62 , 98%, 98.5%, 98.7%, 98.8%, 99%, 99.5%, 99.7%, 99.8% or more may include a polypeptide sequence having less than 100% homology or identity, for example SEQ ID NO: 66 to It may include a sequence selected from the polypeptide sequence of any one of 71 and a polypeptide sequence having at least 90% homology or identity thereto, but is not limited thereto.
  • the metZ gene of the present application may include a polynucleotide sequence having 90% or more homology or identity to any one or more polynucleotide sequences selected from SEQ ID NOs: 63, 64, and 65.
  • the gene is 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 97.7% with any one or more polynucleotide sequences selected from SEQ ID NOs: 63, 64 and 65 , 97.8%, 98%, 98.5%, 98.7%, 98.8%, 99%, 99.5%, 99.7%, 99.8% or more may include polynucleotide sequences having less than 100% homology or identity.
  • polynucleotide is a polymer of nucleotides in which nucleotide units are connected in a long chain by covalent bonds, and is a DNA strand having a predetermined length or more.
  • the metZ gene is a protein encoded by any one or more polynucleotide sequences selected from SEQ ID NOs: 63, 64 and 65, or a protein having an amino acid sequence of any one or more of SEQ ID NOs: 60, 61 and 62
  • a polynucleotide encoding a protein having a is included, it is obvious that a part of the sequence is included within the scope of the present application even if it includes a polynucleotide encoding a deleted, modified, substituted or added amino acid sequence.
  • the metZ gene may be a part of the amino acid sequence of any one of SEQ ID NOs: 60, 61 and 62, for example, encoding an amino acid sequence in which 1 to 20 amino acids are substituted.
  • the metZ gene is 20, 19, 18, 17, 16, 15, 14, 13, 12, or 11 or less amino acid sequences are added before and after the amino acid sequence. It may be a sequence encoding the sequence.
  • the metZ gene may be a sequence encoding an amino acid sequence including all of the above-described substitutions and additions, but is not limited thereto.
  • probes that can be prepared from known gene sequences, for example, a polynucleotide that hybridizes under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence may be included without limitation.
  • polynucleotide comprising a base sequence of a specific sequence number, a polynucleotide consisting of a base sequence of a specific sequence number, or a polynucleotide having a base sequence of a specific sequence number
  • polynucleotide of the sequence number Polynucleotides encoding amino acid sequences in which some sequences are deleted, modified, substituted, conservatively substituted or added are also within the scope of the present application if they have the same or corresponding activity as the polypeptide encoded by the nucleotide sequence consisting of It is self-evident to be included. For example, if the amino acid sequence N-terminus and/or C-terminus has a sequence that does not change the function of the protein, a naturally occurring mutation, a silent mutation or a conservative substitution thereof. .
  • the "conservative substitution” means the substitution of one amino acid for another amino acid having similar structural and/or chemical properties. Such amino acid substitutions can generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues.
  • the terms "homology” and “identity” mean the degree to which two given base sequences are related and may be expressed as a percentage.
  • sequence homology or identity of conserved polynucleotides is determined by standard alignment algorithms, and the default gap penalty established by the program used can be used together.
  • Substantially, homologous or identical (identical) sequences are generally in moderate or high stringent conditions along at least about 50%, 60%, 70%, 80% or 90% of the sequence or full-length. (stringent conditions) can be hybridized. It is apparent that hybridization also includes polynucleotides containing codons that consider degeneracy instead of normal codons in polynucleotides.
  • GAP program is defined as the total number of symbols in the shorter of the two sequences, divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are (1) binary comparison matrix (contains values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); And (3) no penalty for end gaps.
  • the polynucleotide of the present application is subject to various modifications in the coding region within a range that does not change the polypeptide sequence due to codon degeneracy or in consideration of a codon preferred in an organism to express the polynucleotide. Can be done.
  • a probe that can be prepared from a known gene sequence for example, a complementary sequence for all or part of the nucleotide sequence and hydride under strict conditions, is not a sequence naturally present in the microorganism to be introduced, and L -Any polynucleotide sequence capable of increasing methionine-producing ability may be included without limitation.
  • the "stringent condition” means a condition that enables specific hybridization between polynucleotides.
  • genes with high homology or identity 40% or more, specifically 70% or more, 80% or more, 85% or more, 90% or more, more specifically 95% or more, More specifically, genes having a homology or identity of 97% or more, in particular, 99% or more, are hybridized, and genes with lower homology or identity are not hybridized, or a conventional Southern hybridization (southern hybridization) hybridization) at a salt concentration and temperature corresponding to 60°C, 1XSSC, 0.1% SDS, specifically 60°C, 0.1XSSC, 0.1% SDS, and more specifically 68°C, 0.1XSSC, 0.1% SDS, The conditions for washing once, specifically two to three times, can be enumerated.
  • Hybridization requires that two polynucleotides have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.
  • the present application may also include substantially similar polynucleotide sequences as well as isolated polynucleotide fragments that are complementary to the entire sequence.
  • polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose.
  • the appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
  • introduction of a protein means that the microorganism exhibits an activity of a specific protein that was not originally possessed, or that an improved activity compared to the intrinsic activity of the protein or the activity before modification is exhibited.
  • a specific protein may be introduced, a polynucleotide encoding a specific protein may be introduced into a chromosome in a microorganism, or a vector including a polynucleotide encoding a specific protein may be introduced into the microorganism to exhibit its activity.
  • protein introduction can also be expressed by enhancing the activity of a protein in a microorganism that does not have a specific protein activity.
  • the introduction of the protein may be performed by introducing a foreign polynucleotide encoding a protein exhibiting the same/similar activity as the protein, or a codon-optimized variant polynucleotide thereof into a host cell.
  • the foreign polynucleotide may be used without limitation in its origin or sequence as long as it exhibits the same/similar activity as the protein.
  • the introduced foreign polynucleotide can be introduced into the host cell by optimizing its codon so that optimized transcription and translation are performed in the host cell.
  • the introduction may be performed by appropriately selecting a known transformation method by a person skilled in the art, and the introduced polynucleotide may be expressed in a host cell to produce a protein, thereby increasing its activity.
  • vector in the present application refers to a DNA preparation containing a polynucleotide sequence of interest operably linked to a suitable regulatory sequence so that the gene of interest can be introduced into a suitable host.
  • the regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • Vectors can be transformed into suitable host cells and then replicated or function independently of the host genome, and can be integrated into the genome itself. For example, a target polynucleotide in a chromosome may be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • the vector of the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses, and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as a phage vector or a cosmid vector, and as a plasmid vector, pBR-based, pUC-based, pBluescriptII-based , pGEM system, pTZ system, pCL system, pET system, etc. can be used.
  • pDZ pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, and the like can be used.
  • transformation means introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • Transformed polynucleotides may include all of them, whether inserted into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed in the host cell.
  • the polynucleotide includes DNA and RNA encoding the target protein.
  • the polynucleotide may be introduced in any form as long as it can be introduced into a host cell and expressed.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements necessary for self-expression.
  • the expression cassette may generally include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replicating.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked in the present application means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a protein of interest herein and the gene sequence are functionally linked.
  • the method of transforming the vector of the present application includes any method of introducing a nucleic acid into a cell, and may be performed by selecting an appropriate standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method and the like, but are not limited thereto.
  • electroporation calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method and the like, but are not limited thereto.
  • microorganisms of the present application include wild-type microorganisms or microorganisms that have undergone genetic modification naturally or artificially, and microorganisms into which the foreign metZ gene as described in the present application is introduced or included may be included without limitation.
  • L-methionine-producing microorganism in the present application includes all wild-type microorganisms or microorganisms that have undergone natural or artificial genetic modification, and is due to the insertion of an external gene or the enhancement or inactivation of the endogenous gene. As a result, a specific mechanism is weakened or enhanced, and may be a microorganism including a genetic modification to produce a desired L-methionine.
  • the L-methionine-producing microorganism may include a protein encoded by the foreign metZ gene of the present application, and may be a microorganism having an improved L-methionine-producing ability than a parent strain or an unmodified microorganism.
  • pre-modification strain does not exclude strains containing mutations that may occur naturally in microorganisms, and is either a wild-type strain or a natural-type strain itself, or caused by natural or artificial factors. It may mean a strain before the trait is changed by genetic mutation.
  • the "pre-modified strain” or “pre-modified microorganism” may be used interchangeably with "non-modified strain", “unmodified strain”, “non-modified microorganism”, “unmodified microorganism” or “reference microorganism”.
  • the expression level of the gene involved in the L-methionine biosynthetic pathway may be unregulated, or may be a microorganism into which the metZ gene, which is not inherently present, is not introduced.
  • the L-methionine-producing microorganism of the present application may be a microorganism having enhanced L-methionine-producing ability by enhancing the activity of a part of a protein in the L-methionine biosynthetic pathway or weakening the activity of a part of the protein in the L-methionine decomposition pathway.
  • proteins or genes capable of regulating expression to enhance L-methionine biosynthetic pathway or weaken/inactivate degradation pathways are as follows. Protein, a representative gene encoding a protein, and a representative EC number were listed in order. The first letter of the protein is capitalized, and the gene is italicized.
  • thiosulphate sulphurtransferases such as Rdl2p, GlpE, PspE, YgaP, ThiI, YbbB, SseA, YnjE, YceA, YibN, NCgl0671, NCgl1369, NCgl2616, NCgl0053, NCgl0054, NCGl2678, NCgl2890, etc.; Sulfite reductase, cysI; Thiosulphate /sulphate transport system, cysPUWA (EC 3.6.3.25); 3'-phosphoadenosine 5'-phosphosulphate reductase, cysH (EC 1.8.4.8); Sulfite reductase, cysJI (EC 1.8.1.2); Cysteine synthase A, cysK (EC 2.5.1.47); Cysteine synthase B, cysM (EC 2.5.1.47)
  • glucose 6-phosphate isomerase pgi (EC 5.3.1.9); Homoserine kinase, thrB (EC 2.7.1.39); S-adenosylmethionine synthase, metK (EC 2.5.1.6); Dihydrodipicolinate synthase, dapA (EC 4.2.1.52); Phosphoenolpyruvate carboxylkinase, pck (EC 4.1.1.49);, formyltetrahydrofolate hydrolase, purU (EC 3.5.1.10); Pyruvate kinase I, pykF (EC 2.7.1.40); Pyruvate kinase II, pykA (EC 2.7.1.40); Cystathionine ⁇ -lyase, cg3086 (EC 4.4.1.1); Cystathionine ⁇ -synthase, cg2344 (EC 4.2.1.22); Regulatory proteins Cg3031, cg3031
  • the L-methionine-producing microorganism of the present application in addition to the introduction of metZ, weakens or inactivates the activity of cystathionine gamma synthase; Weakening or inactive activity of O-acetylhomoserine sulfhydrylase; Weakened or inactive activity of methionine-cysteine biosynthesis inhibitors; Enhancing the activity of methionine synthase; And one or more genetic modifications selected from the group consisting of enhancing the activity of sulfite reductase.
  • the genetic modification may include inhibition of deletion/expression of the metB gene; deletion of the metY gene; deletion/expression inhibition of mcbR gene; And one or more mutations selected from the group consisting of enhancement of metH expression and enhancement of cysI gene expression may be additionally introduced, for example, the metB gene is SEQ ID NO: 25, the metY gene is SEQ ID NO: 26, and the mcbR gene is SEQ ID NO: 1, metH gene is SEQ ID NO: 39, cysI gene is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91% of the polynucleotide sequence of SEQ ID NO: 40 , 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% may include a polynucleotide sequence having homology or identity, but is not limited thereto. The description of the homology or identity described above is the same for the metB, metY, mcbR, metH and
  • genes are only examples and are not limited thereto, and may be microorganisms that enhance protein activity of various known L-methionine biosynthetic pathways or inactivate/weak protein activity of degradation pathways.
  • the term "enhancement" of a polypeptide or protein activity means that the activity of the polypeptide or protein is increased compared to the intrinsic activity.
  • the enhancement may be used interchangeably with terms such as up-regulation, overexpression, and increase.
  • the increase may include both exhibiting an activity that was not originally possessed, or exhibiting an improved activity compared to an intrinsic activity or an activity before modification.
  • intrinsic activity refers to the activity of a specific polypeptide or protein originally possessed by a parent strain or an unmodified microorganism before the change in the trait when the trait is changed due to genetic variation caused by natural or artificial factors. It can be used interchangeably with "active before modification”.
  • the activity of a polypeptide or protein is "enhanced” or “increased” compared to the intrinsic activity, it means that the activity of the specific polypeptide or protein originally possessed by the parental strain or unmodified microorganism prior to transformation of the trait is improved. "” may be achieved through the introduction of a foreign polypeptide or protein, or through enhancing the activity of an endogenous polypeptide or protein, but specifically, may be achieved through enhancing the activity of an endogenous polypeptide or protein. Whether or not the activity of the polypeptide or protein is enhanced can be confirmed from an increase in the level of activity, the expression level, or the amount of a product excreted from the protein.
  • the enhancement of the activity of the polypeptide or protein may be applied by various methods well known in the art, and may not be limited as long as the activity of the target polypeptide or protein can be enhanced than that of the microorganism before modification.
  • the method is not limited thereto, but may be one using genetic engineering and/or protein engineering well known to those skilled in the art, which is a routine method of molecular biology (Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • the method of enhancing the activity of a polypeptide or protein using protein engineering may be performed, for example, by analyzing the tertiary structure of the polypeptide or protein and selecting and modifying the exposed site or chemically modifying, but is limited thereto. It doesn't work.
  • the 1) increase in the intracellular copy number of a gene or polynucleotide encoding a polypeptide or protein is performed by any method known in the art, for example, a gene or polynucleotide encoding the polypeptide or protein is operably linked, This can be accomplished by introducing a vector capable of replicating and functioning independently of the host into the host cell. Alternatively, a vector capable of inserting the gene or polynucleotide into a chromosome in a host cell to which the gene is operably linked may be introduced into the host cell, but is not limited thereto. The vector is as described above.
  • the 2) method of replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide or protein with an active sequence is any method known in the art, for example, the activity of the expression control region.
  • deletion, insertion, non-conservative or conservative substitution, or a combination thereof may be used to induce a mutation in the sequence, or by replacing with a nucleic acid sequence having a stronger activity.
  • the expression control region is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence controlling the termination of transcription and translation, and the like.
  • the method may be to link a strong heterologous promoter instead of the original promoter, but is not limited thereto.
  • Examples of known strong promoters include cj1 to cj7 promoters (US Patent US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US patent US 10584338 B2), O2 promoter (US patent US 10273491 B2), a tkt promoter, and a yccA promoter, but are not limited thereto.
  • the method of modifying the nucleotide sequence of the 3) polypeptide or protein initiation codon or the 5'-UTR region is any method known in the art, for example, the intrinsic initiation codon of the polypeptide or protein to the intrinsic initiation codon. Compared to, it may be substituted with another initiator codon having a higher expression rate of the polypeptide or protein, but is not limited thereto.
  • the 4) method of modifying the polynucleotide sequence on the chromosome to increase the activity of the polypeptide or protein is any method known in the art, for example, deletion, insertion of the nucleic acid sequence to further enhance the activity of the polynucleotide sequence, Non-conservative or conservative substitutions or combinations thereof may be performed by inducing mutations in the expression control sequence, or by replacing with a polynucleotide sequence modified to have stronger activity. The replacement may specifically be to insert the gene into the chromosome by homologous recombination, but is not limited thereto.
  • the vector used at this time may additionally include a selection marker for confirming whether a chromosome is inserted.
  • the selection marker is as described above.
  • the introduction of a foreign polynucleotide exhibiting the activity of the 5) polypeptide or protein may be performed by any method known in the art, for example, a foreign polynucleotide encoding a polypeptide or protein exhibiting the same/similar activity as the polypeptide or protein, Alternatively, it may be carried out by introducing a codon-optimized variant polynucleotide thereof into a host cell.
  • the foreign polynucleotide may be used without limitation in its origin or sequence as long as it exhibits the same/similar activity as the polypeptide or protein.
  • the introduced foreign polynucleotide can be introduced into the host cell by optimizing its codon so that optimized transcription and translation are performed in the host cell.
  • the introduction may be performed by appropriately selecting a known transformation method by a person skilled in the art, and the introduced polynucleotide is expressed in a host cell to produce a polypeptide or protein, thereby increasing its activity.
  • a combination of the above methods may be performed by applying any one or more of the above methods 1) to 5) together.
  • Such enhancement of the polypeptide or protein activity is such that the activity or concentration of the corresponding polypeptide or protein is increased based on the activity or concentration of the polypeptide or protein expressed in the wild type or microbial strain before modification, or produced from the corresponding polypeptide or protein.
  • the amount of the product may be increased, but is not limited thereto.
  • the term "inactivation” or “attenuation” of a polypeptide or protein is a concept that includes both reduced or no activity compared to intrinsic activity.
  • the inactivation or attenuation may be used interchangeably with terms such as down-regulation, decrease, and decrease.
  • the inactivation or attenuation is when the activity of the protein itself is reduced or eliminated compared to the activity of the protein of the original microorganism due to mutation of the gene encoding the protein, and the expression of the gene encoding the protein is inhibited or translated.
  • the "intrinsic activity” refers to the activity of a specific polypeptide or protein originally possessed by a parent strain or an unmodified microorganism before the change in the trait when the trait is changed due to genetic variation caused by natural or artificial factors. It can be used interchangeably with "active before modification”.
  • activity of the polypeptide or protein is "reduced” compared to the intrinsic activity, it means that the activity of the specific polypeptide or protein originally possessed by the parent strain or unmodified microorganism before the transformation of the trait is lowered.
  • the inactivation or attenuation of the activity of such a protein may be achieved by application of various methods well known in the art, but is not limited thereto (Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 et al.).
  • an antisense oligonucleotide eg, antisense RNA
  • an antisense oligonucleotide that complementarily binds to the transcript of the gene encoding the protein
  • a secondary structure is formed by adding a sequence complementary to the sine-Dalgarno sequence to the front of the sine-Dalgarno sequence of the gene encoding the protein, thereby making it impossible to attach a ribosome. Way;
  • the method of deleting some or all of the gene encoding the protein is a polynucleotide encoding a chromosomal endogenous target protein through a vector for chromosome insertion in a microorganism, a polynucleotide or a marker gene in which some nucleotide sequences are deleted. It can be done by replacing with.
  • a method of deleting some or all of these polynucleotides a method of deleting a polynucleotide by homologous recombination may be used, but is not limited thereto.
  • the method of deleting a part or all of the gene may be performed by inducing a mutation using light or chemical substances such as ultraviolet rays, and selecting a strain in which the target gene is deleted from the obtained mutant.
  • the gene deletion method includes a method by DNA recombination technology.
  • the DNA recombination technique may be achieved by, for example, injecting a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene into the microorganism to cause homologous recombination.
  • the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
  • the method of modifying the expression control sequence can be achieved by applying various methods well known in the art.
  • the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination of the polynucleotide sequence to further weaken the activity of the expression control region (or expression control sequence) It can be carried out by inducing a phase mutation, or can be carried out by replacing with a polynucleotide sequence having a weaker activity.
  • the expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling termination of transcription and translation.
  • the method of modifying the gene sequence is carried out by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination of the gene sequence to further weaken the activity of the polypeptide, or to achieve a weaker activity. It can be carried out by replacing with an improved gene sequence to have or an improved gene sequence so as not to have activity, but is not limited thereto.
  • expression of a gene can be inhibited or attenuated.
  • the above-described method is an example, and methods for enhancing or inactivating protein activity and methods for genetic manipulation are known in the art, and the L-methionine-producing microorganism can be prepared by applying various known methods.
  • the microorganism of the present application may be a microorganism of the genus Corynebacterium.
  • the microorganism of the genus Corynebacterium may include all microorganisms of the genus Corynebacterium. Specifically, Corynebacterium glutamicum , Corynebacterium crudilactis , Corynebacterium deserti , Corynebacterium deserti, Corynebacterium efficiens , Corynebacterium callunae , Corynebacterium stationis , Corynebacterium singulare , Corynebacterium halotolerans , Corynebacterium Corynebacterium striatum , Corynebacterium ammoniagenes , Corynebacterium pollutisoli , Corynebacterium imitans , Corynebacterium testudino Lys ( Corynebacterium testudinoris ) or Corynebacterium flavescens (Corynebacterium flavescens) may be,
  • any medium and other culture conditions used for culturing the microorganisms of the present application may be used without particular limitation as long as it is a medium used for culturing the microorganisms of the genus Corynebacterium.
  • the microorganisms of the present application may be used as a suitable carbon source, It can be cultured while controlling temperature, pH, etc. under aerobic or anaerobic conditions in a conventional medium containing nitrogen sources, personnel, inorganic compounds, amino acids and/or vitamins.
  • the carbon source includes carbohydrates such as glucose, fructose, sucrose, maltose, and the like; Carbohydrates such as glucose, fructose, sucrose, maltose, and the like; Sugar alcohols such as mannitol and sorbitol, organic acids such as pyruvic acid, lactic acid, and citric acid; Amino acids such as glutamic acid, methionine, and lysine may be included.
  • natural organic nutrients such as starch hydrolyzate, molasses, black strap molasses, rice winter, cassava, sugarcane residue and corn steep liquor can be used.
  • Carbohydrates such as molasses
  • other appropriate amounts of carbon sources can be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, etc., organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its degradation products, skim soybean cake or its degradation products, etc. Can be used. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine, etc.
  • organic nitrogen sources such as peptone, NZ-amine,
  • the personnel may include first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto.
  • the inorganic compound sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, and the like may be used.
  • sulfur source methanesulfonate, alkanesulfonate including ethanesulfonate, sulfate, sulfite, hydrogen sulfide such as H 2 S, sulfide, sulfide derivative, thio
  • substances other than thiosulfate may not be included, but are not limited thereto.
  • the method for preparing L-methionine of the present application may include culturing the microorganism in a medium containing thiosulfate.
  • the microorganism of the present application may be one using thiosulfate as a sulfur source including foreign metZ, and the thiosulfate may be one used as a sulfur source of microorganisms, but is not limited thereto.
  • the inorganic compound sodium chloride, calcium chloride, iron chloride, calcium carbonate, etc. may be used, and in addition, vitamins and/or appropriate precursors may be included in the medium.
  • the medium or precursor may be added to the culture in a batch or continuous manner, but is not limited thereto.
  • a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the culture in an appropriate manner during the culture of the microorganism, so that the pH of the culture can be adjusted.
  • foaming can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester.
  • oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen, or carbon dioxide gas may be injected without the injection of gas to maintain the anaerobic and microaerobic state, but is limited thereto. It doesn't work.
  • the temperature of the culture may be 25°C to 40°C, and more specifically 28°C to 37°C, but is not limited thereto.
  • the cultivation period may be continued until the production amount of the desired useful substance is obtained, and specifically, may be 1 hour to 100 hours, but is not limited thereto.
  • the method for preparing methionine of the present application may include recovering L-methionine from the microorganism or medium.
  • the desired sulfur-containing amino acid or sulfur-containing amino acid derivative can be recovered from the medium by using a suitable method known in the art according to the method of culturing the microorganism of the present application, for example, a batch, continuous, or fed-batch culture method. .
  • a suitable method known in the art for example, a batch, continuous, or fed-batch culture method.
  • extraction ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography
  • chromatography such as, HPLC, and methods thereof may be used in combination, but are not limited to these examples.
  • the method may include an additional purification process.
  • the purification process may use a suitable method known in the art.
  • compositions for producing L-methionine comprising the microorganism and thiosulfate.
  • composition of the present application may further include any suitable excipients commonly used in the composition for producing L-methionine, and such excipients are, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents. And the like, but is not limited thereto.
  • Another aspect of the present application provides a method for producing a microorganism producing L-methionine, comprising the step of introducing a protein encoded by a foreign metZ gene into the microorganism.
  • Another aspect of the present application provides a use of a microorganism into which a protein encoded by a foreign metZ gene is introduced, for producing L-methionine.
  • a plasmid (pDCM2, Fig. 1, SEQ ID NO: 81) for the insertion and replacement of genes in the Corynebacterium chromosome was designed, and a plasmid was synthesized using the Gene-synthesis service of Binix Co., Ltd.
  • a plasmid was designed to contain a restriction enzyme that is easy to use for cloning by referring to the commonly known sacB system related paper [Gene, 145 (1994) 69-73].
  • the pDCM2 plasmid synthesized in this way has the following characteristics.
  • Example 1 Preparation of a synthetic vector for the deletion of the mcbR gene
  • mcbR J. Biotechnol. 103:51-65, 2003
  • a vector was constructed for inactivation of.
  • a recombinant plasmid vector was constructed by the following method. Based on the nucleotide sequence reported to the National Institutes of Health (NIH Genbank), the mcbR gene of Corynebacterium glutamicum and the surrounding sequence (SEQ ID NO: 1) were obtained.
  • PCR was performed using the primers of SEQ ID NO: 2 and SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 using the chromosomal DNA of Corynebacterium glutamicum ATCC 13032 as a template. (Table 1).
  • Sequence number Sequence number Sequence (5'-3') 2 TCGAGCTCGGTACCCCTGCCTGGTTTGTCTTGTA 3 CGGAAAATGAAGAAAGTTCGGCCACGTCCTTTCGG 4 AGGACGTGGCCGAACTTTCTTCATTTTCCGAAGGG 5 CTCTAGAGGATCCCCGTTTCGATGCCCACTGAGCA
  • PCR conditions were denatured at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 30 seconds were repeated 30 times, followed by polymerization at 72°C for 7 minutes. As a result, each 700bp DNA fragment was obtained.
  • pDCM2 vector and the amplified mcbR gene fragments were treated with smaI restriction enzyme for chromosome introduction, followed by isothermal assembly cloning reaction , transformed into E. coli DH5 ⁇ , and kanamycin (25mg/l ) was spread on LB solid medium containing.
  • a plasmid was obtained using a plasmid extraction method after selecting a colony transformed with a vector into which the fragments of the target genes were inserted through PCR, and named pDCM2- ⁇ mcbR.
  • Example 2 mcbR gene deletion strain production and culture
  • the pDC- ⁇ mcbR and vector prepared in Example 1 were transformed into ATCC13032 strains by electroporation, respectively, by homologous recombination on chromosomes (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Thereafter, secondary recombination was performed in a solid medium containing sucrose.
  • the strain in which the mcbR gene was deleted was confirmed through PCR using SEQ ID NOs: 6 and 7 (Table 2) for the Corynebacterium glutamicum transformant strain, which was completed with secondary recombination, and this recombinant strain was used as a Corynebacterium glutamicum transformant. It was named Nebacterium glutamicum CM02-0618.
  • CM02-0618 was deposited on January 4, 2019 with the Korean Microbiological Conservation Center, a trust organization under the Budapest Treaty, and was given the accession number KCCM12425P.
  • Corynebacterium glutamicum ATCC13032 and the invention strain Corynebacterium glutamicum CM02-0618 were inoculated into a 250 ml corner-baffle flask containing the following 25 ml, and shaken at 30° C. for 20 hours and 200 rpm. Cultured. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium, followed by shaking culture at 30° C. for 48 hours and at 200 rpm.
  • the composition of the species medium and the production medium are as follows, respectively.
  • As the sulfur source in the production medium (NH 4 ) 2 S 2 O 3 , which is a kind of thiosulfate, was used.
  • Glucose 50 g (NH 4 ) 2 S 2 O 3 12 g, Yeast extract 5 g, KH 2 PO 4 1 g, MgSO 4 7H 2 O 1.2 g, biotin 100 ⁇ g, thiamine hydrochloride 1000 ⁇ g, calcium-pantothenic acid 2000 ⁇ g, nicotinamide 3000 ⁇ g, CaCO 3 30 g, cyanocobalamin (Vitamin B12) 1 ⁇ g (based on 1 liter of distilled water).
  • Example 3-1 Construction of a vector for introduction of three foreign metZ genes
  • a recombinant plasmid vector was constructed by the following method in order to additionally insert the three foreign metZ genes on each of the Corynebacterium ATCC13032 chromosomes.
  • Ncgl1021 Transposase
  • a vector for removing Ncgl1021 was constructed to insert metZ.
  • Ncgl1021 and surrounding sequences of Corynebacterium glutamicum SEQ ID NO: 8 were obtained based on the nucleotide sequence reported to the National Institutes of Health (NIH Genbank).
  • NIH Genbank National Institutes of Health
  • primers of SEQ ID NO: 9 and SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12 (Table 4) were used using the chromosomal DNA of Corynebacterium glutamicum ATCC 13032 as a template. Then, PCR was performed.
  • PCR conditions were denatured at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 30 seconds were repeated 30 times, and then polymerization was performed at 72°C for 7 minutes.
  • each DNA fragment was obtained.
  • the pDCM2 vector and the amplified Ncgl1021 gene fragments were treated with the restriction enzyme smaI for chromosome introduction, followed by isothermal assembly cloning reaction , transformed into E. coli DH5 ⁇ , and kanamycin (25mg/l ) was spread on LB solid medium containing. After selecting a colony transformed with a vector into which the fragments of the target genes were deleted through PCR, a plasmid was obtained using a plasmid extraction method, and it was named pDCM2- ⁇ Ncgl1021.
  • the chromobacterium ratio PCR was performed using the chromosomal DNA of Orasium, Hyhomonas Neptunium, and Rhodobacter spheroids as templates, using SEQ ID NOs: 13 and 14, 15 and 16, 17 and 18.
  • Pspl1 was PCR performed using the previously known spl1-GFP (KR 10-1783170 B1) vector DNA as a template, respectively, using SEQ ID NOs: 19 and 20, 19 and 21, 19 and 22 (Table 5). ). PCR conditions were denatured at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 30 seconds were repeated 30 times, and then polymerization was performed at 72°C for 7 minutes.
  • plasmid extraction method After selecting the colonies transformed with the vector into which the target gene was inserted through PCR, a total of three plasmids were obtained using a plasmid extraction method, respectively, pDCM2- ⁇ Ncgl1021-PsplCvimetZ ( Chromobacterium Violaceum ). metZ), pDCM2- ⁇ Ncgl1021-PsplHnemetZ ( Hyphomonas Neptunium ) metZ), pDCM2- ⁇ Ncgl1021-PsplRspmetZ ( Rhodobacter sphaeroides metZ).
  • Example 3-2 Construction of a vector for introduction of metZ gene
  • PCR was performed using SEQ ID NOs: 19 and 22, 72 and 18 using the chromosomal DNA of Rhodobacter spheroid for the purpose of obtaining RspmetZ_long.
  • the amplified spl1 promoter fragment and metZ fragment for each strain were subjected to isothermal assembly cloning reaction, and then transformed into E. coli DH5 ⁇ . It was spread on LB solid medium containing kanamycin (25mg/l). After selecting a colony transformed with a vector into which the target gene was inserted through PCR, a plasmid was obtained using a plasmid extraction method, and was named pDCM2- ⁇ Ncgl1021-PsplRspmetZ_long.
  • the pDCM2- ⁇ Ncgl1021-PsplRspmetZ_long vector was used as a DNA template, and SEQ ID NOs: 72 and 73, 74 and 18 (RspmetZ_3) and SEQ ID NOs: 72 and 75 18 (RspmetZ_65), SEQ ID NOs: 72 and 77, 78 and 18 (RspmetZ_104), SEQ ID NOs: 71 and 79, 80 and 18 (RspmetZ_196), SEQ ID NOs: 72 and 73, 74 and 75.
  • PCR 76 and 77, 77 and 18 (RspmetZ_3_65_104 ) was used to perform PCR. PCR conditions were denatured at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 30 seconds were repeated 30 times, followed by polymerization at 72°C for 7 minutes.
  • RspmetZ_3 is fragment 1
  • RspmetZ_65 is fragment 3
  • RspmetZ_104 is fragment 5, fragment 6, respectively.
  • RspmetZ_196 was transformed into E. coli DH5 ⁇ after isothermal assembly cloning reaction as fragment 7, fragment 8, and RspmetZ_3_65_104 fragment 1, fragment 11, fragment 12, and fragment 6, and plated on LB solid medium containing kanamycin (25mg/l). .
  • plasmid extraction method After selecting the colonies transformed with the vector into which the target gene was inserted through PCR, a total of 6 plasmids were obtained using a plasmid extraction method. , pDCM2- ⁇ Ncgl1021-PsplRspmetZ_104, pDCM2- ⁇ Ncgl1021-PsplRspmetZ_196, pDCM2- ⁇ Ncgl1021-PsplRspmetZ_3_65_104.
  • the ⁇ Ncgl1021-PsplRspmetZ_104, pDCM2- ⁇ Ncgl1021-PsplRspmetZ_196, and pDCM2- ⁇ Ncgl1021-PsplRspmetZ_3_65_104 vectors were transformed into the CM02-0618 strain prepared in
  • the strains were inoculated into a 250 ml corner-baffle flask containing the following 25 ml, and cultured with shaking at 30° C. for 20 hours and 200 rpm. Then, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium, followed by shaking culture at 30° C. for 48 hours and at 200 rpm.
  • the composition of the species medium and the production medium are as follows, respectively.
  • Glucose 50 g (NH 4 ) 2 S 2 O 3 12 g, Yeast extract 5 g, KH 2 PO 4 1 g, MgSO 4 7H 2 O 1.2 g, biotin 100 ⁇ g, thiamine hydrochloride 1000 ⁇ g, calcium-pantothenic acid 2000 ⁇ g, nicotinamide 3000 ⁇ g, CaCO 3 30 g, cobalamin (Vitamin B12) 1 ⁇ g (based on 1 liter of distilled water).
  • the sulfur source in the production medium is thiosulfate (S 2 O 3 )
  • CH 3 SH methyl mercaptan
  • CM02-0757, CM02-0758, and CM02-0759 strains were deposited with the Korean Microbiological Conservation Center, a trust organization under the Budapest Treaty, on May 2, 2019, and were given accession numbers KCCM12506P, KCCM12507P, and KCCM12508P, respectively.
  • Example 5 Construction of a recombinant vector for deletion of metB and metY genes
  • metB and metY possessed by C.gl were deleted, respectively.
  • a recombinant plasmid vector was constructed by the following method. Based on the nucleotide sequence reported to the National Institutes of Health (NIH Genbank), the metB and metY genes of Corynebacterium glutamicum and peripheral sequences (SEQ ID NOs: 25 and 26) were obtained.
  • PCR conditions were denatured at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 30 seconds were repeated 30 times, followed by polymerization at 72°C for 7 minutes. As a result, each 700bp DNA fragment was obtained.
  • the pDCM2 vector that cannot be replicated in Corynebacterium glutamicum and the amplified metB and metY gene fragments were treated with smaI restriction enzyme for chromosome introduction, respectively, and ligated using a DNA conjugation enzyme, and then transformed into E. coli DH5 ⁇ . It was converted and plated on LB solid medium containing kanamycin (25mg/l). After selecting a colony transformed with a vector into which the fragments of the target genes were inserted through PCR, a plasmid was obtained using a plasmid extraction method, and the obtained plasmids were named pDCM2- ⁇ metB and pDCM2- ⁇ metY, respectively.
  • Example 6 Preparation and cultivation of strains in which metB and metY genes were removed from each of the three strains enriched with metZ
  • the pDCM2- ⁇ metB and pDCM2- ⁇ metY vectors prepared above were transformed into CM02-0618, CM02-0757, CM02-0758, and CM02-0759 strains respectively by electroporation by homologous recombination on chromosomes (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Thereafter, secondary recombination was performed in a solid medium containing sucrose. For the Corynebacterium glutamicum transformant that has completed the secondary recombination, use SEQ ID NOs: 35 and 36 (metB) and SEQ ID NOs: 37 and 38 (metY) to determine whether metB and metY genes are respectively deleted. (Table 10).
  • CM02-0618/ ⁇ metB CM02-0757/ ⁇ metB, CM02-0758/ ⁇ metB, CM02-0759/ ⁇ metB, CM02-0618/ ⁇ metY, CM02-0757/ ⁇ metY, CM02-0758/ ⁇ metY, CM02-0759/ ⁇ metY
  • CM02-0618/ ⁇ metY CM02-0757/ ⁇ metY, CM02-0758/ ⁇ metY, CM02-0759/ ⁇ metY
  • CM02-0618, CM02-0757, CM02-0758, CM02-0759 and the above prepared CM02-0618/ ⁇ metB, CM02-0757/ ⁇ metB, CM02- 0758/ ⁇ metB, CM02-0759/ ⁇ metB, CM02-0618/ ⁇ metY, CM02-0757/ ⁇ metY, CM02-0758/ ⁇ metY, CM02-0759/ ⁇ metY were respectively inoculated, and incubated with shaking at 30° C. for 20 hours and 200 rpm I did.
  • the composition of the species medium and the production medium are as follows, respectively.
  • Glucose 50 g (NH 4 ) 2 S 2 O 3 12 g, Yeast extract 5 g, KH 2 PO 4 1 g, MgSO 4 7H 2 O 1.2 g, biotin 100 ⁇ g, thiamine hydrochloride 1000 ⁇ g, calcium-pantothenic acid 2000 ⁇ g, nicotinamide 3000 ⁇ g, CaCO 3 30 g, cobalamin (Vitamin B12) 1 ⁇ g (based on 1 liter of distilled water).
  • the foreign metZ performs the same function as metB, that is, produces methionine through transsulfuration using cysteine as a sulfur source. That is, even if metB or metY is deleted, it is possible to maintain high yield of methionine production using metZ, so the gene can be replaced with foreign metZ in order to compensate for the shortcomings of metB and/or metY of the existing Corynebacterium.
  • homolanthionine production was only about 20% compared to the control (CM02-0618). I could confirm.
  • Homoranthionine is a substance synthesized by consuming O-acetylhomoserine, and the production of homolanthionine reduces methionine production. It can be seen that it inhibits and enhances the amount of methionine synthesis.
  • metZ of the present application can be transsulfurized using cysteine, and metZ of the present application to compensate for the shortcomings of metB of the strain of the genus Corynebacterium as well as increase methionine production. It was confirmed that it can be used.
  • Example 7 metH, cysI Recombinant vector that enhances at the same time
  • a vector was constructed to simultaneously enhance metH (Ncgl1450) encoding methionine synthase and cysI (Ncgl2718) encoding sulfite reductase.
  • a recombinant plasmid vector was constructed by the following method in order to additionally insert the metH and cysI genes on the Corynebacterium ATCC13032 chromosome. Based on the nucleotide sequence reported to the National Institutes of Health (NIH Genbank), the metH gene and peripheral sequence (SEQ ID NO: 39), cysI gene, and peripheral sequence (SEQ ID NO: 40) of Corynebacterium glutamicum were obtained. .
  • PCR was performed using primers of SEQ ID NO: 41 and SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44 using the chromosomal DNA of Corynebacterium glutamicum ATCC 13032 as a template.
  • the Pcj7 promoter was used to enhance the expression of the metH gene
  • the Pspl1 promoter was used to enhance the expression of the cysI gene.
  • PCR was performed using SEQ ID NOs: 45 and 46 using Corynebacterium ammoniagenes ATCC 6872 chromosomal DNA as a template, and Pspl1 was previously known spl1-GFP (KR 10- 1783170 B1) PCR was performed using SEQ ID NOs: 47 and 48 using vector DNA as a template.
  • the primer sequences used are shown in Table 12 below.
  • PCR conditions were denatured at 95° C. for 5 minutes, then denaturation at 95° C. for 30 seconds, annealing at 53° C. for 30 seconds, and polymerization at 72° C. for 4 minutes were repeated 30 times, followed by polymerization at 72° C. for 7 minutes.
  • DNA fragments of the metH gene, cysI, Pcj7 promoter, and Pspl1 promoter were obtained.
  • Example 8 metH, cysI Production of strains that simultaneously enhance and L-methionine production using the same
  • the pDCM2- ⁇ Ncgl1021 and pDCM2- ⁇ Ncgl1021 and pDCM2- ⁇ Ncgl1021-Pcj7metH-Pspl1cysI vectors prepared above were transformed into ATCC13032 strains by electroporation, respectively, by homologous recombination on chromosomes (van der Rest et al., Appl Microbiol Biotechnol 52:541- 545, 1999). Thereafter, secondary recombination was performed in a solid medium containing sucrose.
  • Corynebacterium glutamicum ATCC13032 and the prepared strain 13032/ ⁇ Ncgl1021, CM02-0753 were inoculated into a 250 ml corner-baffle flask containing the following 25 ml, and cultured with shaking at 30° C. for 20 hours and 200 rpm I did. Then, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium, followed by shaking culture at 30° C. for 48 hours and at 200 rpm.
  • the composition of the species medium and the production medium are as follows, respectively.
  • Glucose 50 g (NH 4 ) 2 S 2 O 3 12 g, Yeast extract 5 g, KH 2 PO 4 1 g, MgSO 4 7H 2 O 1.2 g, biotin 100 ⁇ g, thiamine hydrochloride 1000 ⁇ g, calcium-pantothenic acid 2000 ⁇ g, nicotinamide 3000 ⁇ g, CaCO 3 30 g, cobalamin (Vitamin B12) 1 ⁇ g (based on 1 liter of distilled water).
  • Example 9-1 Construction of a vector for enhancing metZ genes at sites other than the Ncgl1021 site
  • Recombinant plasmid vectors were constructed by the following method in order to insert the three foreign metZ genes into different locations on the Corynebacterium ATCC13032 chromosome.
  • Ncgl2748 Transposase
  • a vector for removing Ncgl2748 was constructed to insert metZ.
  • Ncgl2748 of Corynebacterium glutamicum and surrounding sequences SEQ ID NO: 49
  • primers of SEQ ID NO: 50 and SEQ ID NO: 51, SEQ ID NO: 52 and SEQ ID NO: 53 (Table 14) were used using the chromosomal DNA of Corynebacterium glutamicum ATCC 13032 as a template. Then, PCR was performed.
  • PCR conditions were denatured at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 30 seconds were repeated 30 times, followed by polymerization at 72°C for 7 minutes. As a result, each DNA fragment was obtained.
  • the pDCM2 vector and the amplified Ncgl2748 gene fragments were treated with smaI restriction enzyme for chromosome introduction, and after IST reaction , transformed into E. coli DH5 ⁇ and kanamycin (25mg/l) It was spread on the included LB solid medium. After selecting a colony transformed with a vector into which the fragments of the target genes were inserted through PCR, a plasmid was obtained using a plasmid extraction method, and was named pDCM2- ⁇ Ncgl2748.
  • metZ Chromobacterium Violaceum
  • Hyphomonas Neptunium Hyphomonas Neptunium
  • Rhodobacter sphaeroides PCR was performed using the vector as a template (Table 15) using SEQ ID NOs: 54 and 55, 54 and 56, 54 and 57.
  • PCR conditions were denatured at 95°C for 5 minutes, then 95°C for 30 seconds. Denaturation, annealing at 53° C. for 30 seconds, polymerization at 72° C. for 60 seconds were repeated 30 times, and then polymerization was performed for 7 minutes at 72° C. As a result, three kinds of PCR fragments were obtained.
  • pDCM2- ⁇ Ncgl2748-PsplHnemetZ Hyphomonas Neptunium metZ
  • pDCM2- ⁇ Ncgl2748-PsplRspmetZ Rhodobacter sphaeroides metZ
  • Example 9-2 Construction of a vector for enhancing metZ genes at sites other than the Ncgl1021 site
  • Example 3-2 In addition, in order to confirm whether the production amount of methionine is increased even in the strain into which the metZ gene having a sequence homology of 99% or more is introduced, a vector for the five metZ genes of Example 3-2 was additionally constructed.
  • Example 9-1 In the same manner as in Example 9-1 described above, a vector into which each of the six metZ genes was introduced was prepared.
  • ⁇ Ncgl1021-PsplRspmetZ_long pDCM2- ⁇ Ncgl1021-PsplRspmetZ_3, pDCM2- ⁇ Ncgl1021-PsplRspmetZ_65, pDCM2- ⁇ Ncgl1021-PsplRspmetZ_104, pDCM2- ⁇ Ncgl1021-PsplRspmetZ_long pDCM2- ⁇ Ncgl1021-PsplRspmetZ_3 Was used. The rest of the process is the same as in Example 9-1.
  • Example 10 Development of a foreign metZ-enhancing strain based on an L-methionine producer in which mcbR is present and production of L-methionine using the same
  • Each strain was inoculated into a 250 ml corner-baffle flask containing the following 25 ml, and cultured with shaking at 30° C. for 20 hours and 200 rpm. Then, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium, followed by shaking culture at 30° C. for 48 hours and at 200 rpm.
  • the composition of the species medium and the production medium are as follows, respectively.
  • Glucose 50 g (NH 4 ) 2 S 2 O 3 12 g, Yeast extract 5 g, KH 2 PO 4 1 g, MgSO 4 7H 2 O 1.2 g, biotin 100 ⁇ g, thiamine hydrochloride 1000 ⁇ g, calcium-pantothenic acid 2000 ⁇ g, nicotinamide 3000 ⁇ g, CaCO 3 30 g, cobalamin (Vitamin B12) 1 ⁇ g (based on 1 liter of distilled water).
  • CM02-0765, CM02-0766, and CM02-0767 were deposited with the Korean Microbiological Conservation Center, a trust organization under the Budapest Treaty, on May 2, 2019, and were given accession numbers KCCM12509P, KCCM12510P, and KCCM12511P, respectively.

Abstract

본 출원은 metZ 유전자가 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법에 관한 것이다.

Description

외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법
본 출원은 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법에 관한 것이다.
L-메티오닌 (L-methionine)은 생체내의 필수 아미노산의 한 종류로서, 사료, 수액제, 의약품의 합성 원료 등 의약 원료 및 식품 첨가제로 사용된다. 메티오닌은 생체 내에서 메틸기 전이 반응에 관여하는 중요한 아미노산이며, 황을 제공하는 역할을 한다.
메티오닌의 화학합성은 주로 5-(β-메틸머캅토에틸)하이단토인 (5-(β-methylmercaptoethyl)-hydantoin)을 가수분해시키는 반응을 통하여, L-형과 D-형이 혼합된 형태로 메티오닌을 생산하는 방법이 이용되고 있다. 그러나, 상기 화학합성은 L-형과 D-형이 혼합된 형태로 생산된다.
한편, 생물학적 방법을 이용하여 L-메티오닌을 생산할 수 있다. 보다 구체적으로 미생물이 L-메티오닌을 생산하는 방법 중 하나는 O-아실 호모세린 (O-아세틸 호모세린 또는 O-석시닐 호모세린) 및 황화수소(hydrogen sulfide)를 기질로 사용하는, 다이렉트 설프하이드릴레이션에 의해 메티오닌을 생산하는 것이다. 예를 들면, 코리네형 미생물 내 metY 유전자가 코딩하는 효소가 다이렉트 설프하이드릴레이션 기능을 수행하는 것으로 알려져 있다. 미생물이 L-메티오닌을 생산하는 다른 방법은 O-아실 호모세린 (O-아세틸 호모세린 또는 O-석시닐 호모세린) 및 시스테인을 기질로 사용하는 트랜스 설퓨레이션에 의해 메티오닌을 생산하는 것이다. 예를 들면, 코리네형 미생물 내 metB 유전자가 코딩하는 효소가 트랜스 설퓨레이션 기능을 수행하는 것으로 알려져 있다. 다만, metB 가 코딩하는 효소는 부산물을 많이 생성시키고, metY 유전자는 피드백 저해를 받는다는 단점이 존재하여, 산업적으로 L-메티오닌을 대량 생산하기 위해 적용하기는 어려운 실정이다(Kromer JO et al., J Bacteriol 188(2):609-618, 2006, Yeom HJ et al., J Microbiol Biotechnol 14(2): 373-378, 2004 외).
본 발명자들은 상기 단백질을 대체할 수 있는 단백질을 발굴하고자 예의 노력한 끝에 metZ 유전자에 의해 코딩되는 단백질을 도입한 미생물이 L-메티오닌을 고수율로 생산함을 확인함으로써, 본 출원을 완성하였다.
본 출원의 목적은 외래 metZ 유전자에 의해 코딩되는 단백질을 도입한, L-메티오닌 생산 미생물을 제공하는 것이다.
본 출원의 다른 목적은 상기 미생물을 티오설페이트를 포함하는 배지에서 배양하는 것을 포함하는 L-메티오닌 제조방법을 제공하는 것이다.
본 출원의 다른 목적은 상기 미생물 및 티오설페이트를 포함하는 L-메티오닌 생산용 조성물을 제공하는 것이다.
본 출원의 metZ에 의해 코딩되는 단백질 활성이 도입된 미생물은, metY에 비해 부산물이 적게 생성되어 수율이 높으며, 메티오닌에 의해 피드백저해를 받는 metB와 달리 피드백 저해를 받지 않으므로, 고수율로 L-메티오닌을 생산할 수 있어 L-메티오닌의 산업적 생산에 유용하게 이용될 수 있다.
도 1은 pDCM2 플라스미드의 모식도이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
본 출원의 하나의 양태는 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물을 제공한다.
본 출원의 다른 하나의 양태는 상기 L-메티오닌 생산 미생물을 티오설페이트를 포함하는 배지에서 배양하는 것을 포함하는, L-메티오닌 제조방법을 제공한다.
본 출원의 용어 'metZ 유전자' 는, 아실호모세린을 기질로 설프하이드레이션(sulfhydration)에 관여하는 효소를 코딩하는 유전자이다.
본 출원에서 "아실호모세린"은 호모세린(homoserine)에 아실기(acyl)가 결합한 화합물을 의미하며, 숙시닐호모세린 및 아세틸호모세린을 모두 포함한다. 일 예로, 상기 아실호모세린은 O-숙시닐호모세린 또는 O-아세틸호모세린일 수 있으나 이에 제한되지 않는다.
본 출원에서, 상기 metZ 유전자가 코딩하는 효소는 숙시닐호모세린 설프히드릴라아제(succinylhomoserine sulfhydrylase), 아세틸호모세린 설프히드릴라아제(acetylhomoserine sulfhydrylase), 또는 O-숙시닐호모세린을 기질로 설프하이드레이션에 관여하는 효소를 코딩하는 것으로 알려진 유전자일 수 있으나 이에 제한되지 않는다.
본 출원에서 용어 "설프하이드레이션(sulfhydration)"은 용어 "설프하이드릴레이션(sulfhydrylation)"과 상호교환적으로 사용되며, 설프하이드릴(-SH)작용기를 특정 분자에 제공하는 반응을 의미한다. 상기 용어는 본 출원의 목적상 메티오닌 합성과정에서의 반응을 의미하는 것일 수 있으나 이에 제한되지 않는다. 상기 "설프하이드레이션" 에 관여하는 효소는 "설프히드릴라아제(sulfhydrylase)" 로 명명할 수 있으나 이에 제한되지 않는다.
종래에 메티오닌 발효반응에 있어서 metZ 유전자가 발현하는 효소는, in vitro 내 아래와 같은 반응에 사용되었다:
CH3SH + O-아세틸-L-호모세린 => 아세테이트 + 메티오닌
CH3SH + O-석시닐-L-호모세린 => 석시네이트 + 메티오닌
즉, 미생물을 이용하여 메티오닌 전구체를 제조하는 1단계; 및 메티오닌 전구체를 포함하는 발효액에 메칠머캅탄 및 메티오닌 전환 효소를 첨가하여 in vitro에서 효소반응을 수행하는 2단계의 반응으로 포함하는 메티오닌 제조방법에 있어서, metZ 유전자가 발현하는 효소는 in vitro 에서 메티오닌 전환효소로 사용되었었다 (US 2010-0184164 A1참조)
한편, 코리네박테리움 속 미생물에서의 메티오닌 발효는 두 종류의 설프하이드레이션 경로(sulfhydrylation step)를 사용한다. (Hwang BJ et al., J Bacteriol 184(5):1277-1286, 2002) 하나는 metB 라는 유전자에 의해 코딩되는 효소를 이용하여, O-아세틸호모세린(acetyl homoserine: AH)를 시스타티오닌(cystationine)으로 전환하는 것으로서, 이 경우에 시스테인(cysteine)을 황원으로 사용한다. 즉 아실호모세린과 시스테인을 반응물로 하여 시스타티오닌으로 전환하는 반응을 "트랜스설퓨레이션(transsulfuration)"이라 지칭하며, 이에 관여하는 효소를 "트랜스설퓨레이즈(transsulfurase)"라고 명명하기도 한다. 다른 하나는 metY라는 유전자에 의해 코딩되는 효소를 이용해서 O-아세틸 호모세린을 호모시스테인(homocysteine)으로 전환하는 것으로서, 이 경우에 하이드로겐 설파이드(hydrogen sulfide) 등 무기(inorganic) 황 화합물을 황원으로 사용한다. 이와 같이 아실호모세린과 하이드로겐 설파이드를 반응물로 하여 호모시스테인으로 전환하는 반응은, 전술한 트랜스설퓨레이션과 달리 메티오닌의 전구체인 호모시스테인이 생성되는 과정에서 중간산물인 시스타티오닌이 생성되지 않으므로, 이를 다이렉트 설프하이드레이션(direct sulfhydrylation)이라 지칭한다.
즉, 상기 설프하이드레이션 경로는 아실호모세린과 황원의 반응을 통해 다른 물질로 전환하는 반응 경로를 의미할 수 있고, 크게 트랜스설퓨레이션과 다이렉트 설프하이드레이션으로 나눌 수 있다.
하지만 코리네박테리움 균주에서 상기 설프하이드레이션에 관여하는 두 효소 모두 단점을 가지고 있다. 예를 들면 metB 유전자에 의해 코딩되는 단백질은 시스타티오닌 이외에, 아세틸호모세린과 호모시스테인을 이용해서 호모란티오닌(homolanthionine) 이라는 부산물을 생성한다 (Kromer JO et al., J Bacteriol 188(2):609-618, 2006) 또한, metY 유전자는 메티오닌에 의해 피드백 저해(feedback inhibition)를 많이 받는다고 알려져 있다 (Yeom HJ et al., J Microbiol Biotechnol 14(2): 373-378, 2004).
본 출원은 상기 외래 metZ 유전자를 코리네박테리움 균주에 도입하여, 단일단계 반응만으로 메티오닌을 생물학적으로 제조하는 데에 상기 metZ 유전자 도입이 메티오닌 발효에 유용하게 사용될 수 있음을 규명한 것에 특징이 있다.
본 출원의 metZ 유전자에 의해 코딩되는 단백질이 관여하는 메티오닌 합성 경로에서는 부산물 생성량이 감소될 수 있다. 상기 부산물은 호모란티오닌일 수 있다. 상기 부산물 생성량의 감소는, 야생형 미생물에 비해, 또는 metB에 의해 코딩되는 단백질이 관여하는 합성 경로에서의 부산물 생성량과 비교하여 감소된 것을 의미할 수 있으나 이에 제한되지 않는다.
따라서, 본 출원의 외래 metZ 유전자가 도입된 미생물 및 이를 배양하는 것을 포함하는 메티오닌 생산 방법은, 외래 metZ 유전자가 도입되지 않은 메티오닌 생산 미생물 및 이를 이용한 메티오닌 생산 방법에 비해 부산물 생성량이 감소된 것일 수 있다. 본 출원의 metZ 유전자에 의해 코딩되는 단백질은 메티오닌에 의해 피드백 저해를 받지 않는 것일 수 있다.
본 출원의 metZ 유전자에 의해 코딩되는 단백질은 O-아실호모세린 설프히드릴라아제(acylhomoserine sulfhydrylase)로서, 하이드로겐 설파이드(hydrogen sulfide)를 황원으로 사용할 수 있을 뿐 아니라, O-아실호모세린 트랜스설퓨레이즈(acylhomoserine transsulfurase)로서, cysteine을 황원으로 사용할 수 있는 것일 수 있다. 보다 구체적으로, 상기 단백질은, O-아세틸호모세린 설프히드릴라아제, O-아세틸호모세린 트랜스설퓨레이즈, O-석시닐호모세린 설프히드릴라아제 또는 O-석시닐호모세린 트랜스설퓨레이즈일 수 있다. 따라서 본 출원에서 metZ 유전자에 의해 코딩되는 단백질은, O-아실호모세린 설프히드릴라아제 활성을 갖는 단백질일 수 있고, 구체적으로, O-아세틸호모세린 설프히드릴라아제, O-아세틸호모세린 트랜스설퓨레이즈, O-석시닐호모세린 설프히드릴라아제 및 O-석시닐호모세린 트랜스설퓨레이즈 중 1 이상의 활성을 갖는 단백질 일 수 있다.
일 예로, 본 출원의 외래 metZ 유전자는, 상기 유전자가 도입되는 L-메티오닌 생산 미생물과는 상이한 유래의 유전자이거나, 또는 상기 유전자가 도입되는 L-메티오닌 생산 미생물에 내재적으로 존재하는 유전자와 상이한 것일 수 있다. 구체적으로, 상기 유전자는 크로모박테리움 비오라슘 (Chromobacterium violaceum), 하이호모나스 넵튜니윰 (Hyphomonas neptunium) 또는 로도박터 스페로이드 (Rhodobacter sphaeroides) 유래의 metZ로 명명된 유전자일 수 있으나 이에 제한되지 않으며, 본 출원의 목적상 상기 유전자는 L-메티오닌 생산능을 강화할 수 있는 것이면 제한되지 않고 어느 것이든 포함될 수 있다. 상기 metZ 유전자는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있으며, 해당 서열을 확보하는 방법은 당해 분야에서 잘 알려진 다양한 방법이 적용 가능하다.
본 출원에서 외래 metZ에 의해 코딩되는 단백질은 서열번호 60, 61 및 62 중 어느 하나의 폴리펩티드 서열 및 이와 90% 이상의 상동성 또는 동일성을 갖는 폴리펩티드 서열로 이루어지는 군에서 선택되는 어느 하나 이상의 아미노산 서열(폴리펩티드 서열)을 포함하는 것일 수 있으나 이에 제한되지 않는다. 예를 들어, 상기 단백질은 서열번호 60, 61 및 62 중 어느 하나의 폴리펩티드 서열과 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 97.7%, 97.8%, 98%, 98.5%, 98.7%, 98.8%, 99%, 99.5%, 99.7%, 99.8% 또는 그 이상 100% 미만 상동성 또는 동일성을 갖는 폴리펩티드 서열을 포함할 수 있고, 일 예로 서열번호 66 내지 71 중 어느 하나의 폴리펩티드 서열 및 이와 90% 이상의 상동성 또는 동일성을 갖는 폴리펩티드 서열 중에서 선택되는 서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
본 출원의 metZ 유전자는 서열번호 63, 64 및 65 중에서 선택되는 어느 하나 이상의 폴리뉴클레오티드 서열과 90% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드 서열을 포함하는 것일 수 있다. 예를 들어, 상기 유전자는 서열번호 63, 64 및 65 중에서 선택되는 어느 하나 이상의 폴리뉴클레오티드 서열과 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.5%, 97.7%, 97.8%, 98%, 98.5%, 98.7%, 98.8%, 99%, 99.5%, 99.7%, 99.8% 또는 그 이상 100% 미만 상동성 또는 동일성을 갖는 폴리뉴클레오티드 서열을 포함할 수 있다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 가닥이다.
본 출원에서 metZ 유전자가, 서열번호 63, 64 및 65 중에서 선택되는 어느 하나 이상의 폴리뉴클레오티드 서열에 의해 코딩되는 단백질, 또는 서열번호 60, 61 및 62 중 어느 하나 이상의 아미노산 서열을 갖는 단백질과 상응하는 효과를 갖는 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 경우라면, 상기 서열의 일부가 결실, 변형, 치환 또는 부가된 아미노산 서열을 코딩하는 폴리뉴클레오티드를 포함하더라도 본 출원의 범위 내에 포함됨은 자명하다.
예를 들어, 상기 metZ 유전자는, 상기 서열번호 60, 61 및 62 중 어느 하나의 아미노산 서열의 일부, 예를 들어 1 내지 20개의 아미노산이 치환된 아미노산 서열을 코딩하는 것일 수 있다. 다른 구현예로, 상기 metZ 유전자는, 상기 아미노산 서열의 앞뒤로 20개, 19개, 18개, 17개, 16개, 15개, 14개, 13개, 12개 또는 11개 이하의 아미노산 서열이 부가된 서열을 코딩하는 서열일 수 있다. 또 다른 구현예로, 상기 metZ 유전자는 전술한 치환 및 부가를 모두 포함하는 아미노산 서열을 코딩하는 서열 일 수 있으나 이에 제한되지 않는다.
더불어, 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화되는 폴리뉴클레오티드도 제한 없이 포함될 수 있다.
즉, 본 출원에서 특정 서열번호의 염기서열을 포함하는 폴리뉴클레오티드, 특정 서열번호의 염기서열로 이루어진 폴리뉴클레오티드, 특정 서열번호의 염기서열을 갖는 폴리뉴클레오티드로 기재되어 있다고 하더라도, 상기 서열번호의 폴리뉴클레오티드로 구성되는 염기서열에 의해 코딩되는 폴리펩타이드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 코딩하는 폴리뉴클레오티드도 본 출원의 범위에 포함되는 것은 자명하다. 예를 들어, 상기 아미노산 서열 N-말단 그리고/또는 C-말단에 단백질의 기능을 변경하지 않는 서열 추가, 자연적으로 발생할 수 있는 돌연변이, 이의 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다.
상기 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다.
본 출원에서 용어 "상동성(homology)" 및 "동일성(identity)"은 두 개의 주어진 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다.
용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된 (conserved) 폴리뉴클레오티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나 (homologous) 또는 동일한 (identical) 서열은 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90%를 따라 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 대신 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드 또한 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48 : 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
또한, 임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다.
또한, 본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리뉴클레오티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩티드 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 또한 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, 도입하고자 하는 미생물 내에 자연적으로 존재하는 서열이 아니면서 L-메티오닌 생산능을 증가시킬 수 있는 폴리뉴클레오티드 서열이라면 제한 없이 포함할 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 여러 문헌 (예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989)에 구체적으로 기재되어 있고, 당업계에 잘 알려져 있다. 예를 들어, 상동성(homology) 또는 동일성(identity)이 높은 유전자끼리, 40% 이상, 구체적으로는 70% 이상, 80% 이상, 85% 이상, 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성 또는 동일성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1XSSC, 0.1% SDS, 구체적으로는 60℃, 0.1XSSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1XSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 폴리뉴클레오티드가 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 폴리뉴클레오티드 서열뿐만 아니라 전체 서열에 상보적인 단리된 폴리뉴클레오티드 단편을 포함할 수 있다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
본 출원의 용어 "단백질의 도입"은 미생물이 본래 가지고 있지 않았던 특정 단백질의 활성을 나타나게 되는 것 또는 해당 단백질의 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타나게 되는 것을 의미한다. 예를 들어, 특정 단백질이 도입되거나, 특정 단백질을 코딩하는 폴리뉴클레오티드가 미생물 내 염색체로 도입되거나, 특정 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터가 미생물 내로 도입되어 이의 활성이 나타나는 것일 수 있다. 본 출원에서 단백질 도입은 특정 단백질 활성이 없는 미생물에서의 단백질의 활성 강화로도 표현할 수 있다.
상기 단백질의 도입은, 상기 단백질과 동일/유사한 활성을 나타내는 단백질을 암호화하는 외래 폴리뉴클레오티드, 또는 이의 코돈 최적화된 변이형 폴리뉴클레오티드를 숙주세포 내로 도입하여 수행될 수 있다. 상기 외래 폴리뉴클레오티드는 상기 단백질과 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한 없이 사용될 수 있다. 또한 도입된 상기 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화하여 숙주세포 내로 도입할 수 있다. 상기 도입은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 단백질이 생성되어 그 활성이 증가될 수 있다.
상기 도입된 단백질의 활성 강화는,
1) 상기 단백질을 코딩하는 유전자 또는 폴리뉴클레오티드의 세포 내 카피수 증가,
2) 상기 단백질을 코딩하는 염색체상의 유전자 발현조절영역을 활성이 강력한 서열로 교체하는 방법,
3) 상기 단백질의 개시코돈 또는 5'-UTR 지역의 염기서열을 변형시키는 방법,
4) 상기 단백질의 활성이 증가되도록 염색체 상의 폴리뉴클레오티드 서열을 변형시키는 방법, 또는
5) 상기 방법들의 조합 등에 의하여 수행될 수 있으나, 이에 제한되지 않는다.
본 출원의 용어 "벡터"는 적합한 숙주 내에서 목적 유전자를 도입할 수 있도록, 적합한 조절 서열에 작동 가능하게 연결된 목적 폴리뉴클레오티드 서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다. 일례로 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 폴리뉴클레오티드를 변이된 폴리뉴클레오티드로 교체시킬 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다.
본 출원의 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
본 출원의 용어 "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트 (expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터 (promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다.
또한, 본 출원의 용어 "작동 가능하게 연결"된 것이란 본원의 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 벡터를 형질전환 시키는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법 (electroporation), 인산칼슘 (CaPO4) 침전, 염화칼슘 (CaCl2) 침전, 미세주입법 (microinjection), 폴리에틸렌 글리콜 (PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
본 출원의 미생물은 야생형 미생물이나, 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 본 출원에서 설명하는 바와 같은 외래 metZ 유전자가 도입되거나 포함되는 미생물은 제한 없이 포함될 수 있다.
상기 미생물은, 본 출원의 외래 metZ 유전자; 이에 의해 코딩되는 단백질; 및 상기 metZ 유전자를 포함하는 벡터 중 어느 하나 이상을 포함하여, L-메티오닌을 생산하는 미생물일 수 있다.
본 출원의 용어 "L-메티오닌 생산 미생물"은, 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 L-메티오닌 생산을 위하여 유전적 변이 (modification)를 포함하는 미생물일 수 있다.
상기 L-메티오닌 생산 미생물은, 본 출원의 외래 metZ 유전자에 의해 코딩되는 단백질을 포함하여 모균주 또는 비변형 미생물보다 L-메티오닌 생산능이 향상되는 미생물일 수 있다.
본 출원에서 용어, "변형 전 균주" 또는 "변형 전 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 상기 "변형 전 균주" 또는 "변형 전 미생물”은 "비변이 균주", "비변형 균주", "비변이 미생물", "비변형 미생물" 또는 “기준 미생물"과 혼용될 수 있다. 또는 L-메티오닌 생합성 경로에 관여하는 유전자의 발현량이 조절되지 않은 미생물일 수 있으며, 또는, 내재적으로 존재하지 않는 metZ 유전자가 도입되지 않은 미생물일 수 있다.
본 출원의 L-메티오닌 생산 미생물은, L-메티오닌 생합성 경로 내 단백질 일부의 활성이 강화되거나, L-메티오닌 분해 경로 내 단백질 일부의 활성이 약화되어 L-메티오닌 생산능이 강화된 미생물일 수 있다.
구체적으로, L-메티오닌 생합성 경로를 강화하거나 분해 경로를 약화/불활성시키기 위해 발현을 조절할 수 있는 단백질 또는 유전자의 예시는 다음과 같다. 단백질, 단백질을 코딩하는 대표적인 유전자, 대표적인 EC number 순으로 기재하였으며 단백질은 첫 글자를 대문자로, 유전자는 이탤릭체로 표기하였다. 예를 들어, Rdl2p, GlpE, PspE, YgaP, ThiI, YbbB, SseA, YnjE, YceA, YibN, NCgl0671, NCgl1369, NCgl2616, NCgl0053, NCgl0054, NCGl2678, NCgl2890 등의 티오설페이트 황전이효소(thiosulphate sulphurtransferase); 설파이트 환원효소, cysI; 티오설페이트/설페이트 수송 시스템(thiosulphate/sulphate transport system), cysPUWA (EC 3.6.3.25); 3'-포스포아데노신 5'-포스포설페이트 환원효소 (3'-phosphoadenosine 5'-phosphosulphate reductase), cysH (EC 1.8.4.8); 설파이트 환원효소(sulphite reductase), cysJI (EC 1.8.1.2); 시스테인 합성효소 A (cysteine synthase), cysK (EC 2.5.1.47); 시스테인 합성효소 B, cysM (EC 2.5.1.47); 세린 아세틸트랜스퍼라제(serine acetyltransferase), cysE (EC 2.3.1.30); 글리신 절단 시스템(glycine cleavage system), gcvTHP-lpd (EC 2.1.2.10, EC 1.4.4.2, EC 1.8.1.4); 리포일 합성효소(lipoyl synthase), lipA (EC 2.8.1.8); 리포일 단백질 리가아제(lipoyl protein ligase), lipB (EC 2.3.1.181); 포스포글리세레이트 디하이드로게나아제(phosphoglycerate dehydrogenase), serA (EC 1.1.1.95); 3-포스포세린 포스파타아제(3-phosphoserine phosphatase), serB (EC 3.1.3.3); 3-포스포세린/포스포하이드록시트레오닌 아미노트랜스퍼라제(3-phosphoserine/phosphohydroxythreonine aminotransferase), serC (EC 2.6.1.52); 세린 하이드록시메틸트랜스퍼라제(serine hydroxymethyltransferase), glyA (EC 2.1.2.1); 아스파토키나아제 I(aspartokinase I)(EC 2.7.2.4); 호모세린 디하이드로게나아제 I (homoserine dehydrogenase I), thrA (EC 1.1.1.3); 아스파테이트 키나아제(aspartate kinase), lysC (EC 2.7.2.4); 호모세린 디하이드로게나아제(homoserine dehydrogenase), hom (EC 1.1.1.3); 호모세린 O-아세틸트랜스퍼라제(homoserine O-acetyltransferase), metX (EC 2.3.1.31); 호모세린 O-석시닐트랜스퍼라제(homoserine O-succinyltransferase), metA (EC 2.3.1.46); 시스타티오닌 감마-합성효소(cystathionine gamma-synthase), metB (EC 2.5.1.48); β-C-S-리아제(β-C-S-lyase), aecD (EC 4.4.1.8, beta-lyase); 시스타티오닌 베타-리아제(cystathionine beta-lyase), metC (EC 4.4.1.8); B12-독립적 호모시스테인 S-메틸트랜스퍼라제(B12-independent homocysteine S-methyltransferase), metE (EC 2.1.1.14); 메티오닌 합성효소, metH (EC 2.1.1.13); 메틸렌테트라하이드로폴레이트 환원효소(methylenetetrahydrofolate reductase), metF (EC 1.5.1.20); L-methionine 외수송체 BrnFE; 발린 외수송체 YgaZH(B2682, B2683), ygaZH(b2682. b2683); 외수송체 YjeH ,b4141; 피리딘 뉴클레오티드 트랜스하이드로게나아제 PntAB, pntAB (EC 1.6.1.2); 및 포스포엔올피루베이트 카르복실라아제(phosphoenolpyruvate carboxylase), Pyc (EC 4.1.1.31) 중에서 선택된 하나 이상의 단백질 또는 시스템을 구성하는 일부 단백질의 활성 강화 또는 이를 코딩하는 폴리뉴클레오티드가 과발현되어 L-아미노산 생합성 경로를 강화하거나 분해 경로를 약화시킬 수 있다. 또는, 글루코스 6-인산 이성화효소, pgi (EC 5.3.1.9); 호모세린 키나아제, thrB (EC 2.7.1.39); S-아데노실메티오닌 합성효소, metK (EC 2.5.1.6); 다이하이드로다이피콜리네이트(dihydrodipicolinate) 합성효소, dapA (EC 4.2.1.52); 포스포엔올파이루베이트 카르복실키나아제, pck (EC 4.1.1.49);, 포밀테트라하이드로폴레이트 하이드롤라아제(formyltetrahydrofolate hydrolase), purU (EC 3.5.1.10); 파이루베이트 키나아제 I, pykF (EC 2.7.1.40); 파이루베이트 키나아제II, pykA (EC 2.7.1.40); 시스타티오닌 γ-리아제, cg3086(EC 4.4.1.1); 시스타티오닌 β-합성효소, cg2344 (EC 4.2.1.22); 조절단백질 Cg3031, cg3031; 메티오닌-시스테인 생합성 억제인자 (methionine and cysteine biosynthesis repressor protein) McbR, mcbR; L-메티오닌 합성 전사조절인자 (Met transcriptional repressor protein), metJ; L-메티오닌 수송체 MetQNI, metQ, metN, metI; N-아실트랜스퍼라제, yncA; sRNA fnrS; 및 L-메티오닌 수송체, metP로 구성된 군에서 선택된 하나 이상의 단백질의 활성이 불활성화 또는 약화되거나 또는 상기 단백질을 코딩하는 유전자의 발현이 억제 또는 제거된 것일 수 있다.
일 구현예로, 본 출원의 L-메티오닌 생산 미생물은 metZ 도입 이외에도, 시스타티오닌 감마 신타아제의 활성 약화 또는 불활성; O-아세틸호모세린 설피드릴라제의 활성 약화 또는 불활성; 메티오닌-시스테인 생합성 억제인자의 활성 약화 또는 불활성; 메티오닌 합성 효소의 활성 강화; 및 설파이트 환원 효소의 활성 강화로 이루어진 군에서 선택되는 하나 이상의 유전적 변형을 포함하는 것일 수 있다. 또는, 상기 유전적 변형은 metB 유전자의 결실/발현 억제; metY 유전자의 결실; mcbR 유전자의 결실/발현 억제; 및 metH 발현 강화 및 cysI 유전자 발현 강화로 이루어진 군에서 선택되는 하나 이상의 변이가 추가로 도입된 것일 수 있으며, 일 예로, 상기 metB 유전자는 서열번호 25, metY 유전자는 서열번호 26, mcbR 유전자는 서열번호 1, metH 유전자는 서열번호 39, cysI 유전자는 서열번호 40의 폴리뉴클레오티드 서열과 적어도 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 또는 99% 상동성 또는 동일성을 가지는 폴리뉴클레오티드 서열을 포함할 수 있으나, 이에 제한되지 않는다. 전술한상동성 또는 동일성에 대한 설명은, metB, metY, mcbR, metH 및 cysI 유전자에 대해서도 동일하다.
다만 상기 유전자들은 한 가지 예이며 이에 제한되지 않고, 다양한 공지의 L-메티오닌 생합성경로의 단백질 활성을 강화시키거나 분해경로의 단백질 활성을 불활성화/약화시킨 미생물일 수 있다.
본 출원에서 용어, 폴리펩티드 또는 단백질 활성의 "강화"는, 폴리펩티드 또는 단백질의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드 또는 단백질의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드 또는 단백질의 활성이 내재적 활성에 비하여 "강화" 또는 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고있던 특정 폴리펩티드 또는 단백질의 활성에 비하여 향상된 것을 의미한다.상기 "활성 증가"는 외래의 폴리펩티드 또는 단백질을 도입하거나, 내재적인 폴리펩티드 또는 단백질의 활성 강화를 통해 달성할 수 있으나, 구체적으로는 내재적인 폴리펩티드 또는 단백질의 활성 강화를 통해 달성하는 것일 수 있다. 상기 폴리펩티드 또는 단백질의 활성의 강화 여부는 해당 폴리펩티드 또는 단백질의 활성 정도, 발현량 또는 해당 단백질로부터 배출되는 산물의 양의 증가로부터 확인할 수 있다.
상기 폴리펩티드 또는 단백질의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 폴리펩티드 또는 단백질의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않을 수 있다. 상기 방법은 이로 제한되는 것은 아니나, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있다(Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
상기 유전자 공학을 이용하여 폴리펩티드 또는 단백질 활성을 강화하는 방법은, 예를 들면,
1) 상기 폴리펩티드 또는 단백질을 코딩하는 유전자 또는 폴리뉴클레오티드의 세포 내 카피수 증가,
2) 상기 폴리펩티드 또는 단백질을 코딩하는 염색체상의 유전자 발현조절영역을 활성이 강력한 서열로 교체하는 방법,
3) 상기 폴리펩티드 또는 단백질의 개시코돈 또는 5'-UTR 지역의 염기서열을 변형시키는 방법,
4) 상기 폴리펩티드 또는 단백질 활성이 증가되도록 염색체 상의 폴리뉴클레오티드 서열을 변형시키는 방법,
5) 상기 폴리펩티드 또는 단백질의 활성을 나타내는 외래 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드의 코돈 최적화된 변이형 폴리뉴클레오티드의 도입, 또는
6) 상기 방법들의 조합 등에 의하여 수행될 수 있으나, 이에 제한되지 않는다.
상기 단백질 공학을 이용하여 폴리펩티드 또는 단백질 활성을 강화하는 방법은, 예를 들면, 폴리펩티드 또는 단백질의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 방법 등에 의하여 수행될 수 있으나, 이에 제한되지 않는다.
상기 1) 폴리펩티드 또는 단백질을 코딩하는 유전자 또는 폴리뉴클레오티드의 세포 내 카피수 증가는, 당업계에 알려진 임의의 방법, 예를 들면, 해당 폴리펩티드 또는 단백질을 코딩하는 유전자 또는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있다. 또는, 상기 유전자가 작동가능하게 연결된, 숙주세포 내의 염색체 내로 상기 유전자 또는 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다. 상기 벡터는 전술한 바와 같다.
상기 2) 폴리펩티드 또는 단백질을 코딩하는 염색체상의 유전자 발현조절영역(또는 발현조절서열)을 활성이 강력한 서열로 교체하는 방법은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 발현조절영역의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 가지는 핵산 서열로 교체함에 의하여 수행될 수 있다. 상기 발현조절영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 상기 방법은 구체적으로 본래의 프로모터 대신 강력한 이종 프로모터를 연결시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 cj1 내지 cj7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터 (미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터 및 yccA 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 폴리펩티드 또는 단백질의 개시코돈 또는 5'-UTR 지역의 염기서열을 변형시키는 방법은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 폴리펩티드 또는 단백질의 내재적 개시코돈을 상기 내재적 개시코돈에 비해 폴리펩티드 또는 단백질 발현율이 더 높은 다른 개시코돈으로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 폴리펩티드 또는 단백질 활성이 증가되도록 염색체 상의 폴리뉴클레오티드 서열을 변형시키는 방법은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 폴리뉴클레오티드 서열의 활성을 더욱 강화하도록 핵산 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절 서열상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖도록 개량된 폴리뉴클레오티드 서열로 교체함에 의하여 수행될 수 있다. 상기 교체는 구체적으로 상동재조합에 의하여 상기 유전자를 염색체내로 삽입하는 것일 수 있으나, 이에 제한되지 않는다.
이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 전술한 바와 같다.
상기 5) 폴리펩티드 또는 단백질의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 당업계에 알려진 임의의 방법, 예를 들면, 상기 폴리펩티드 또는 단백질과 동일/유사한 활성을 나타내는 폴리펩티드 또는 단백질을 코딩하는 외래 폴리뉴클레오티드, 또는 이의 코돈 최적화된 변이형 폴리뉴클레오티드를 숙주세포 내로 도입하여 수행될 수 있다. 상기 외래 폴리뉴클레오티드는 상기 폴리펩티드 또는 단백질과 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한 없이 사용될 수 있다. 또한 도입된 상기 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화하여 숙주세포 내로 도입할 수 있다. 상기 도입은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 폴리펩티드 또는 단백질이 생성되어 그 활성이 증가될 수 있다.
마지막으로, 6) 상기 방법들의 조합은 상기 1) 내지 5) 중 어느 하나 이상의 방법을 함께 적용하여 수행될 수 있다.
이와 같은 폴리펩티드 또는 단백질 활성의 강화는, 상응하는 폴리펩티드 또는 단백질의 활성 또는 농도가 야생형이나 변형 전 미생물 균주에서 발현된 폴리펩티드 또는 단백질의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩티드 또는 단백질로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, 폴리펩티드 또는 단백질의 "불활성화" 또는 "약화"는 내재적 활성에 비하여 활성이 감소되거나 또는 활성이 없는 것을 모두 포함하는 개념이다. 상기 불활성화 또는 약화는 하향조절(down-regulation), 감소(decrease), 저하(reduce) 등의 용어와 혼용될 수 있다. 상기 불활성화 또는 약화는 상기 단백질을 코딩하는 유전자의 변이 등으로 단백질 자체의 활성이 본래 미생물이 가지고 있는 단백질의 활성에 비해 감소 또는 제거된 경우와, 이를 코딩하는 유전자의 발현 저해 또는 번역(translation) 저해 등으로 세포 내에서 전체적인 단백질 활성 정도가 천연형 균주에 비하여 낮은 경우, 상기 유전자의 발현이 전혀 이루어지지 않은 경우, 및 발현이 되더라도 활성이 없는 경우 역시 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드 또는 단백질의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드 또는 단백질의 활성이 내재적 활성에 비하여 "감소"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드 또는 단백질의 활성에 비하여 낮아진 것을 의미한다.
이러한 단백질의 불활성화 또는 활성의 약화는, 이로 제한되는 것은 아니나, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다(Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 등).
상기 방법의 예로,
1) 상기 단백질을 코딩하는 상기 유전자의 전체 또는 일부를 결실시키는 방법;
2) 상기 단백질을 코딩하는 상기 유전자의 발현이 감소하도록 발현조절영역(또는 발현조절서열)의 변형,
3) 상기 단백질의 활성이 제거 또는 약화되도록 단백질을 코딩하는 상기 유전자 서열의 변형,
4) 상기 단백질을 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입;
5) 상기 단백질을 코딩하는 상기 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열을 부가하여 2차 구조물을 형성시켜 리보솜(ribosome)의 부착을 불가능하게 만드는 방법;
6) 상기 단백질을 코딩하는 상기 유전자의 폴리뉴클레오티드 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터를 부가하는 방법(Reverse transcription engineering, RTE) 등이 있으며, 이들의 조합으로도 달성할 수 있으나, 이에 특별히 제한되는 것은 아니다.
구체적으로, 상기 단백질을 코딩하는 상기 유전자의 일부 또는 전체를 결실하는 방법은, 미생물 내 염색체 삽입용 벡터를 통해 염색체 내 내재적 목적 단백질을 코딩하는 폴리뉴클레오티드를 일부 뉴클레오티드 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체함으로써 수행될 수 있다. 이러한 폴리뉴클레오티드의 일부 또는 전체를 결실하는 방법의 일례로 상동 재조합에 의하여 폴리뉴클레오티드를 결실시키는 방법을 사용할 수 있으나, 이에 한정되지는 않는다.
또한, 상기 유전자의 일부 또는 전체를 결손시키는 방법은 자외선과 같은 빛 또는 화학물질을 이용하여 돌연변이를 유발하고, 얻어진 돌연변이체로부터 목적 유전자가 결손된 균주를 선별하여 수행될 수 있다. 상기 유전자 결손 방법에는 DNA 재조합 기술에 의한 방법이 포함된다. 상기 DNA 재조합 기술에는 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 이루어질 수 있다. 또한, 상기 주입되는 뉴클레오티드 서열 또는 벡터에는 우성 선별 마커를 포함할 수 있으나 이에 제한되는 것은 아니다.
또한, 상기 발현 조절 서열을 변형하는 방법은 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다. 상기 방법의 예로, 상기 발현조절영역(또는 발현조절 서열)의 활성을 더욱 약화하도록 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절영역(또는 발현조절서열) 상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖는 폴리뉴클레오티드 서열로 교체함으로써 수행할 수 있다. 상기 발현조절영역에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 유전자 서열을 변형하는 방법은 상기 폴리펩티드의 활성을 더욱 약화하도록 유전자 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이를 유도하여 수행하거나, 더욱 약한 활성을 갖도록 개량된 유전자 서열 또는 활성이 없도록 개량된 유전자 서열로 교체함으로써 수행할 수 있으나, 이에 한정되는 것은 아니다.
예를 들면, 유전자 서열 내 변이를 도입하여 종결 코돈을 형성시킴으로써, 유전자의 발현을 저해하거나 약화시킬 수 있다.
다만 전술한 방법은 하나의 예시로, 단백질의 활성 강화 또는 불활성화 방법 및 유전자 조작 방법은 당업계에 공지되어 있는바, 상기 L-메티오닌 생산 미생물은 공지의 다양한 방법을 적용하여 제조될 수 있다.
본 출원의 미생물은 코리네박테리움 속 미생물일 수 있다.
본 출원에서 "코리네박테리움 속 미생물"은 모든 코리네박테리움 속 미생물을 포함할 수 있다. 구체적으로, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있고, 더욱 구체적으로 코리네박테리움 글루타미쿰일 수 있다.
본 출원의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 코리네박테리움속 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용될 수 있으며, 구체적으로는 본 출원의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 또는 혐기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 글루코오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으나, 이에 제한되지 않는다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있다.
상기 황원으로는, 메탄설포네이트(methanesulfonate), 에탄설포네이트(ethanesulfonate)를 포함하는 알칸설포네이트(alkanesulfonate), 황산염, 아황산염(sulfite), H2S와 같은 하이드로겐 설파이드, 설파이드, 설파이드 유도체, 티오글리콜라이트, 티오시아네이트 및/또는 티오유레아와 같은 유기 및 무기 황 함유성 화합물과 티오설페이트의 혼합물 형태이거나, 또는 황원으로서 티오설페이트 이외의 물질은 포함하지 않을 수 있으나, 이에 제한되지 않는다.
본 출원의 L-메티오닌 제조 방법은 티오설페이트를 포함하는 배지에서 상기 미생물을 배양하는 것을 포함할 수 있다. 구체적으로, 본 출원의 미생물은 외래 metZ를 포함하여 티오설페이트를 황원으로 이용하는 것일 수 있고, 상기 티오설페이트는 미생물의 황원으로 사용되는 것일 수 있으나 이에 제한되지 않는다.
무기화합물로는 염화나트륨, 염화칼슘, 염화철, 탄산칼슘 등이 사용될 수 있고, 그 외에 상기 배지에는 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 상기 배지 또는 전구체는 배양물에 회분식 또는 연속식으로 첨가될 수 있으며, 이에 제한되지 않는다.
본 출원에서는 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배양물에 적절한 방식으로 첨가하여, 배양물의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으나, 이에 제한되지 않는다.
배양물의 온도는 25℃ 내지 40℃일 수 있으며, 보다 구체적으로는 28℃ 내지 37℃일 수 있으나 이에 제한되지 않는다. 배양 기간은 원하는 유용 물질의 생성량이 수득될 때까지 계속될 수 있으며, 구체적으로는 1 시간 내지 100 시간일 수 있으나 이에 제한되지 않는다.
본 출원의 메티오닌 제조방법은 상기 미생물 또는 배지로부터 L-메티오닌을 회수하는 것을 포함할 수 있다.
본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 배지로부터 목적하는 황 함유 아미노산 또는 황 함유 아미노산 유도체를 회수할 수 있다. 예컨대 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 및 이들의 방법을 조합하여 사용될 수 있으나, 이들 예에 한정되는 것은 아니다.
상기 방법은 추가적인 정제 공정을 포함할 수 있다. 상기 정제공정은 당해 기술분야에 공지된 적합한 방법을 이용할 수 있다.
본 출원의 다른 하나의 양태는 상기 미생물 및 티오설페이트를 포함하는 L-메티오닌 생산용 조성물을 제공한다.
본 출원의 조성물은 L-메티오닌 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 다른 하나의 양태는, 미생물에 외래 metZ 유전자에 의해 코딩되는 단백질을 도입하는 단계를 포함하는, L-메티오닌 생산 미생물 제조 방법을 제공한다.
본 출원의 다른 하나의 양태는 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 미생물의, L-메티오닌 생산 용도를 제공한다.
상기 미생물, 외래 metZ 유전자 및 이에 의해 코딩되는 단백질, 단백질의 도입에 대해서는 전술한 바와 같다.
이하 본 출원을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예에 한정되는 것은 아니다.
참고예 1: 플라스미드의 제작
코리네박테리움 염색체 내 유전자의 삽입 및 교체를 위한 플라스미드(pDCM2, 도 1, 서열번호 81)을 디자인하였고, 바이닉스(주)의 유전자 합성(Gene-synthesis) 서비스를 이용하여 플라스미드를 합성하였다. 일반적으로 알려진 sacB 시스템 관련 논문[Gene, 145 (1994) 69-73]을 참고로 하여 클로닝에 활용하기 용이한 제한효소(restriction enzyme)를 포함하도록 플라스미드를 설계하였다. 이렇게 합성된 pDCM2 플라스미드는 다음과 같은 특성을 갖는다.
1) 대장균에서만 작용하는 복제 기점(replication origin)을 가지고 있어 대장균 내에서는 자가 복제(self-replication)가 가능하나 코리네박테리움에서는 자가 복제가 불가능한 특성을 갖는다.
2) 선별 마커로 카나마이신 내성 유전자를 갖는다.
3) 2차 양성 선별(positive-selection) 마커로 레반 수크라제(Levan sucrose) 유전자(sacB)를 갖는다.
4) 최종 제작된 균주에는 pDCM2 플라스미드로부터 유래한 어떠한 유전자 정보도 남지 않는다.
실시예 1: mcbR 유전자 결손을 위한 제조합 벡터 제작
본 실시 예에서는 메티오닌 생산 균주를 제작하기 위해, 야생형 ATCC13032 균주를 가지고, 기 공지된 메티오닌-시스테인 생합성 억제인자를 코딩하는 mcbR (J. Biotechnol. 103:51-65, 2003) 의 불활성화를 위해 벡터를 제작하였다.
구체적으로, mcbR 유전자를 코리네박테리움 ATCC13032 염색체 상에서 결손시키기 위하여 하기의 방법으로 재조합 플라스미드 벡터를 제작하였다. 미국 국립보건원의 유전자은행(NIH Genbank)에 보고된 염기서열에 근거하여 코리네박테리움 글루타미쿰의 mcbR 유전자 및 주변서열(서열번호 1)을 확보하였다.
결손된 mcbR 유전자를 획득하기 위한 목적으로, 코리네박테리움 글루타미쿰 ATCC 13032의 염색체 DNA를 주형으로 하여 서열번호 2 및 서열번호 3, 서열번호 4 및 서열번호 5의 프라이머를 이용하여 PCR을 수행하였다(표 1).
서열번호 서열(5'-3')
2 TCGAGCTCGGTACCCCTGCCTGGTTTGTCTTGTA
3 CGGAAAATGAAGAAAGTTCGGCCACGTCCTTTCGG
4 AGGACGTGGCCGAACTTTCTTCATTTTCCGAAGGG
5 CTCTAGAGGATCCCCGTTTCGATGCCCACTGAGCA
PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 53℃ 30초 어닐링, 72℃ 30초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 각각 700bp DNA 단편들을 수득하였다.
코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDCM2 벡터와 상기 증폭한 mcbR 유전자 단편들을 염색체 도입용 제한효소 smaI 으로 처리한 뒤, isothermal assembly cloning 반응 후, 대장균 DH5α에 형질전환하고 카나마이신(25mg/ℓ)이 포함된 LB 고체배지에 도말하였다. PCR을 통해 목적한 유전자들의 결손된 단편이 삽입된 벡터로 형질 전환된 콜로니를 선별한 후 플라스미드 추출법을 이용하여 플라스미드를 획득하였고 pDCM2-ΔmcbR 이라 명명하였다.
실시예 2: mcbR 유전자 결손된 균주 제작 및 배양
실시예 1에서 제작된 pDC-ΔmcbR, 벡터를 염색체 상에서의 상동 재조합에 의해 ATCC13032 균주에 각각 전기천공법으로 형질전환시켰다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). 그 후, 수크로오즈를 포함하고 있는 고체배지에서 2차 재조합을 하였다. 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질전환주를 대상으로 서열번호 6, 7 (표 2)을 이용하여 PCR법을 통하여 mcbR 유전자가 결손된 균주를 확인하였고, 본 재조합 균주를 코리네박테리움 글루타미쿰 CM02-0618이라 명명하였다.
상기 CM02-0618은 부다페스트조약 하의 수탁기관인 한국미생물보존센터에 2019년 1월 4일자로 기탁하여 수탁번호 KCCM12425P를 부여받았다.
서열번호 서열(5'-3')
6 AATCTGGATTTCCGCCAGGT
7 CTTCCTAACTCCTGAGGAAG
상기 제작된 CM02-0618의 L-메티오닌 생산능을 분석하기 위해 모균주인 코리네박테리움 글루타미쿰 ATCC13032 균주와 함께 아래와 같은 방법으로 배양하였다.
하기의 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 코리네박테리움 글루타미쿰 ATCC13032과 발명 균주 코리네박테리움 글루타미쿰 CM02-0618를 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 48시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종 배지와 생산 배지의 조성은 각각 하기와 같다. 생산 배지에서 황원으로는 티오설페이트의 일종인 (NH4)2S2O3를 이용하였다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍, (증류수 1 리터 기준)
<생산배지 (pH 8.0)>
포도당 50 g, (NH4)2S2O3 12 g, Yeast extract 5 g, KH2PO4 1 g, MgSO4·7H2O 1.2 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g, 시아노코발라민 (Vitamin B12) 1 ㎍ (증류수 1리터 기준).
상기 배양 방법으로 배양하여 배양액의 중의 L-메티오닌 농도를 분석하여 표 3에 나타내었다.
야생형 및 mcbR이 제거된 균주의 L-메티오닌 생산능 확인
균주 L-메티오닌(g/L)
Corynebacterium glutamicum ATCC 13032 (야생형) 0.00
CM02-0618 0.04
그 결과, mcbR 단독 제거 균주에서 L-메티오닌이 생산되는 것을 확인할 수 있었다.
실시예 3-1: 외래 3종 metZ 유전자 도입을 위한 벡터 제작
코리네박테리움 균주에 외래 metZ를 도입하여 기존 메티오닌 생합성 방법의 단점을 보완하면서 메티오닌 생산을 강화하고자 하였다. 구체적으로, 크로모박테리움 비오라슘 (Chromobacterium Violaceum), 하이호모나스 넵튜니윰 (Hyphomonas Neptunium), 로도박터 스페로이드 (Rhodobacter sphaeroides) 유래 metZ를 도입하기 위한 벡터를 제작하였다.
구체적으로, 3종의 외래 metZ 유전자를 각각 코리네박테리움 ATCC13032 염색체 상에서 추가 삽입시키기 위하여 하기의 방법으로 재조합 플라스미드 벡터를 제작하였다.
먼저 metZ를 삽입하기 위해 Ncgl1021 (Transposase)를 제거하기 위한 벡터를 제작하였다. 미국 국립보건원의 유전자은행(NIH Genbank)에 보고된 염기서열에 근거하여 코리네박테리움 글루타미쿰의 Ncgl1021 및 주변 서열 (서열변호 8)을 확보하였다. 결손된 Ncgl1021 유전자를 획득하기 위한 목적으로, 코리네박테리움 글루타미쿰 ATCC 13032의 염색체 DNA를 주형으로 하여 서열번호 9 및 서열번호 10, 서열번호 11 및 서열번호 12의 프라이머(표 4)를 이용하여 PCR을 수행하였다.
서열번호 서열(5'-3')
9 ACCCGGGGATCCTCTAGAATGTTTGTGATGCGCAG
10 GTCAGAGAGTACTTACGCTGATCGGGAGGGAAAGC
11 ATCAGCGTAAGTACTCTCTGACTAGCGTCACCCTC
12 CTGCAGGTCGACTCTAGAAAAGGGATTGGAGTGTT
PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 53℃ 30초 어닐링, 72℃ 30초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 각각 DNA 단편들을 수득하였다. 코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDCM2 벡터와 상기 증폭한 Ncgl1021 유전자 단편들을 염색체 도입용 제한효소 smaI 으로 처리한 뒤, isothermal assembly cloning 반응 후, 대장균 DH5α에 형질전환하고 카나마이신(25mg/ℓ)이 포함된 LB 고체배지에 도말하였다. PCR을 통해 목적한 유전자들의 결손된 단편이 삽입된 벡터로 형질 전환된 콜로니를 선별한 후 플라스미드 추출법을 이용하여 플라스미드를 획득하였고 pDCM2-ΔNcgl1021 이라 명명하였다.
metZ (크로모박테리움 비오라슘 (Chromobacterium Violaceum), 하이호모나스 넵튜니윰 (Hyphomonas Neptunium), 로도박터 스페로이드 (Rhodobacter sphaeroides) 유래) 유전자들을 획득하기 위한 목적으로, 각각 크로모박테리움 비오라슘, 하이호모나스 넵튜니윰, 로도박터 스페로이드의 염색체 DNA를 주형으로 하여 서열번호 13 및 14, 15 및 16, 17 및 18 이용하여 PCR을 수행하였다. 또한 3종의 metZ 유전자를 각각 발현하기 위해 Pspl1 프로모터를 사용하였으며, Pspl1은 기 공지된 spl1-GFP (KR 10-1783170 B1) 벡터 DNA를 주형으로 하여 각각 서열번호 19 및 20, 19 및 21, 19 및 22 를 이용하여 PCR을 수행하였다(표 5). PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 53℃ 30초 어닐링, 72℃ 30초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다.
서열번호 서열(5'-3')
13 ATCAAAACAGATATCATGGCATCCGACGCGCCGCA
14 CGCTAGTCAGAGAGTTTAGTCAAGGCCCCGCAACA
15 ATCAAAACAGATATCATGGCGGATGCACCCGGCGG
16 CGCTAGTCAGAGAGTTCACAAGCTGTTAAGCGAAG
17 ATCAAAACAGATATCATGACGAAGGACTGGAAGAC
18 CGCTAGTCAGAGAGTTCAGATCACCGCGAGCGCCT
19 CCGATCAGCGTAAGTGGCGCTTCATGTCAACAATC
20 CGCGTCGGATGCCATGATATCTGTTTTGATCTCCT
21 GGGTGCATCCGCCATGATATCTGTTTTGATCTCCT
22 CCAGTCCTTCGTCATGATATCTGTTTTGATCTCCT
그 결과 3종의 외래 metZ 유전자 단편(서열번호 63-65) 및 3종의 metZ 유전자를 발현하기 위한 각각의 spl1 프로모터 단편을 획득할 수 있었다. 코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDCM2-ΔNcgl1021 벡터를 제한효소 scaI 으로 처리한 뒤, 균주별로 상기 증폭한 spl1 promoter 단편 및 metZ 단편들과 같이 isothermal assembly cloning 반응 후, 대장균 DH5α에 형질전환하고 카나마이신(25mg/ℓ)이 포함된 LB 고체배지에 도말하였다. PCR을 통해 목적한 유전자가 삽입된 벡터로 형질 전환된 콜로니를 선별한 후 플라스미드 추출법을 이용하여 총 3종의 플라스미드를 획득하였고 각각 pDCM2-ΔNcgl1021-PsplCvimetZ (크로모박테리움 비오라슘(Chromobacterium Violaceum) metZ), pDCM2-ΔNcgl1021-PsplHnemetZ (하이호모나스 넵튜니윰 (Hyphomonas Neptunium) metZ), pDCM2-ΔNcgl1021-PsplRspmetZ (로도박터 스페로이드 (Rhodobacter sphaeroides) metZ) 라 명명하였다.
실시예 3-2: metZ 유전자 도입을 위한 벡터 제작
종래에 알려진, 로도박터 스페로이드 유래 metZ 유전자 6개의 서열에 대한 벡터를 추가로 제작하였다. (US 2013-0273614 A1 및 US 2018-0355389 A1 참조) 전술된 실시예 3-1의 방법과 동일한 방법으로 서열번호 66 내지 71의 아미노산 서열을 코딩하는 metZ 유전자가 각각 도입된 벡터를 제작하였다. 각 metZ 유전자는, RspmetZ_long, RspmetZ_3, RspmetZ_65, RspmetZ_104, RspmetZ_196, RspmetZ_3_65_104 로 명명되었으며, 각 유전자 도입을 위하여 사용된 프라이머는 다음과 같다.
프라이머 서열(5'-3')
RspmetZ 서열번호 72 ATCAAAACAGATATCATGGGTATCGCGTTTCGTGA
RspmetZ_3 서열번호 73 CCTTCACGAAACGCGtTACCCATGATATCTG
RspmetZ_3 서열번호 74 CAGATATCATGGGTAaCGCGTTTCGTGAAGG
RspmetZ_65 서열번호 75 TAGCGGGCATAGATGtATTCGTCGGCGCCGG
RspmetZ_65 서열번호 76 CCGGCGCCGACGAATaCATCTATGCCCGCTA
RspmetZ_104 서열번호 77 ACGATCGAGGTGAGCgCGCCGTGGATCGCGG
RspmetZ_104 서열번호 78 CCGCGATCCACGGCGcGCTCACCTCGATCGT
RspmetZ_196 서열번호 79 CGGGCGTCGCGAAGAtATTGTCCACGATGAC
RspmetZ_196 서열번호 80 GTCATCGTGGACAATaTCTTCGCGACGCCCG
먼저 RspmetZ_long 을 획득하기 위한 목적으로 로도박터 스페로이드의 염색체 DNA를 이용하여 서열번호 19 및 22, 72 및 18을 이용하여 PCR을 수행하였다.
그 결과 유전자 단편 및 spl1 프로모터 단편을 획득할 수 있었다.
코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDCM2-ΔNcgl1021 벡터를 제한효소 scaI 으로 처리한 뒤, 균주별로 상기 증폭한 spl1 promoter 단편 및 metZ 단편을 같이 isothermal assembly cloning 반응 후, 대장균 DH5α에 형질전환하고 카나마이신(25mg/ℓ)이 포함된 LB 고체배지에 도말하였다. PCR을 통해 목적한 유전자가 삽입된 벡터로 형질 전환된 콜로니를 선별한 후 플라스미드 추출법을 이용하여 플라스미드를 획득하였고 pDCM2-ΔNcgl1021-PsplRspmetZ_long라 명명하였다.
RspmetZ_3, RspmetZ_65, RspmetZ_104, RspmetZ_196, RspmetZ_3_65_104을 획득하기 위한 목적으로, 각각 pDCM2-ΔNcgl1021-PsplRspmetZ_long 벡터를 DNA를 주형으로 하여 서열번호 72 및 73, 74 및 18 (RspmetZ_3), 서열번호 72 및 75, 76 및 18 (RspmetZ_65), 서열번호 72 및 77, 78 및 18 (RspmetZ_104), 서열번호 71 및 79, 80 및 18 (RspmetZ_196), 서열번호 72 및 73, 74 및 75. 76 및 77, 77 및 18 (RspmetZ_3_65_104) 이용하여 PCR을 수행하였다. PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 53℃ 30초 어닐링, 72℃ 30초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다.
그 결과 총 10개의 단편을 획득할 수 있었다.
단편 1 서열번호 72, 73
단편 2 서열번호 74, 18
단편 3 서열번호 72, 75
단편 4 서열번호 76, 18
단편 5 서열번호 72, 77
단편 6 서열번호 78, 18
단편 7 서열번호 72, 79
단편 8 서열번호 80, 18
단편 9 서열번호 74, 75
단편10 서열번호 76, 77
코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDCM2-ΔNcgl1021 벡터를 제한효소 scaI 으로 처리한 뒤, 각각 RspmetZ_3은 단편 1, 단편 2, RspmetZ_65는 단편 3, 단편 4, RspmetZ_104는 단편 5, 단편 6, RspmetZ_196은 단편 7, 단편 8, RspmetZ_3_65_104는 단편 1, 단편 11, 단편 12, 단편 6과 같이 isothermal assembly cloning 반응 후, 대장균 DH5α에 형질전환하고 카나마이신(25mg/ℓ)이 포함된 LB 고체배지에 도말하였다. PCR을 통해 목적한 유전자가 삽입된 벡터로 형질 전환된 콜로니를 선별한 후 플라스미드 추출법을 이용하여 총 6종의 플라스미드를 획득하였고 각각 pDCM2-ΔNcgl1021-PsplRspmetZ_long, pDCM2-ΔNcgl1021-PsplRspmetZ_3, pDCM2-ΔNcgl1021-PsplRspmetZ_65, pDCM2-ΔNcgl1021-PsplRspmetZ_104, pDCM2-ΔNcgl1021-PsplRspmetZ_196, pDCM2-ΔNcgl1021-PsplRspmetZ_3_65_104 라 명명하였다.
실시예 4: 외래 metZ가 도입된 균주 제작 및 배양
실시예 2에서 제작한 메티오닌 생산균주인 CM02-0618 균주에 9종의 외래 metZ를 도입하였다.
구체적으로, 실시예 3에서 제작한 pDCM2-ΔNcgl1021, pDCM2-ΔNcgl1021-PsplCvimetZ pDCM2-ΔNcgl1021-PsplHnemetZ, pDCM2-ΔNcgl1021-PsplRspmetZ, pDCM2-ΔNcgl1021-PsplRspmetZ_long, pDCM2-ΔNcgl1021-PsplRspmetZ_3, pDCM2-ΔNcgl1021-PsplRspmetZ_65, pDCM2-ΔNcgl1021-PsplRspmetZ_104, pDCM2-ΔNcgl1021-PsplRspmetZ_196, 및 pDCM2-ΔNcgl1021-PsplRspmetZ_3_65_104 벡터를 염색체 상에서의 상동 재조합에 의해 실시예 2에서 제작한 메티오닌 생산균주인 CM02-0618 균주에 각각 전기천공법으로 형질전환시켰다. (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).
그 후, 수크로오즈를 포함하고 있는 고체배지에서 2차 재조합을 하였다. 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질전환주를 대상으로 서열번호 23, 24을 이용하여 PCR법을 통하여 Ncgl1021이 결손된 균주 및 Ncgl1021이 결손되면서 metZ 유전자가 삽입된 균주를 확인하였다. CM02-0618 에 상기 9종의 벡터가 각각 도입된 재조합 균주를 CM02-0618/ΔNcgl021 및 CM02-0757, CM02-0758, CM02-0759-1, CM02-0759-2, CM02-0759-3, CM02-0759-4, CM02-0759-5, CM02-0759 라 명명하였다.
상기 제작된 균주들의 L-메티오닌 생산능을 분석하기 위해 모균주인 CM02-0618균주와 함께 아래와 같은 방법으로 배양하였다.
하기의 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 상기 균주들을 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 48시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종 배지와 생산 배지의 조성은 각각 하기와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)
<생산배지 (pH 8.0)>
포도당 50 g, (NH4)2S2O3 12 g, Yeast extract 5 g, KH2PO4 1 g, MgSO4·7H2O 1.2 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g, 코발라민 (Vitamin B12) 1 ㎍ (증류수 1리터 기준).
또한, 종래의 메티오닌 효소전환에서 사용된 황원과의 비교를 위하여, 상기 생산배지에서 황원을 티오설페이트(S2O3) 에서 메칠머캅탄(CH3SH)으로 변경한 후, 상기 균주들을 동일한 방법으로 배양하였다. 각각 배양이 완료된 후, 배양액 내 L-메티오닌 농도를 분석하여 표 8에 나타내었다.
metZ의 발현이 증가된 균주의 L-메티오닌 생산능 확인
균주 L-메티오닌(g/L)
(황원: S2O3)		 L-메티오닌(g/L)
(황원: CH3SH)
CM02-0618 0.04 0.01
CM02-0618ΔNcgl021 0.04 0.01
CM02-0757 (CvimetZ) 0.13 0.02
CM02-0758 (HnemetZ) 0.12 0.01
CM02-0759-1 (RspmetZ) 0.13 0.02
CM02-0759-2 (RspmetZ_long) 0.13 0.02
CM02-0759-3 (RspmetZ_3) 0.13 0.02
CM02-0759-4 (RspmetZ_65) 0.13 0.02
CM02-0759-5 (RspmetZ_104) 0.13 0.02
CM02-0759-6 (RspmetZ_196) 0.13 0.02
CM02-0759 (RspmetZ_3_65_104) 0.14 0.02
그 결과, 9종의 metZ 유전자가 각각 도입됨에 따라 대조군 균주 대비 L-메티오닌 생산능이 266% 이상 증가하는 것을 확인할 수 있었다. 이를 통하여, 본 출원의 외래 metZ가 sulfhydrylation를 통해 메티오닌 생산능을 크게 증가시키며, 특히 메칠머캅탄을 황원으로 사용하는 종래의 방법에 비해 효율이 우수한 것임을 확인하였다. 이는 코리네박테리움 글루타미쿰 metB 및 metY와 달리 본 출원의 외래 metZ는 피드백 저해를 받지 않아 메티오닌 수율이 증가한 것으로 해석할 수 있다.
상기 CM02-0757, CM02-0758, CM02-0759 균주는 부다페스트조약 하의 수탁기관인 한국미생물보존센터에 2019년 5월 2일자로 기탁하여 각각 수탁번호 KCCM12506P, KCCM12507P, KCCM12508P를 부여받았다.
실시예 5: metB 및 metY 유전자 결손을 위한 재조합 벡터 제작
본 출원의 metZ 가 코딩하는 단백질의 기능(활성)을 확인하고 이를 metY 및 metB 활성과 비교하기 위하여, C.gl이 가지고 있는 metB 및 metY를 각각 deletion 하였다. 구체적으로, metB 및 metY 유전자를 각각 결손시키기 위하여 하기의 방법으로 재조합 플라스미드 벡터를 제작하였다. 미국 국립보건원의 유전자은행(NIH Genbank)에 보고된 염기서열에 근거하여 코리네박테리움 글루타미쿰의 metB 및 metY 유전자 및 주변서열(서열번호 25, 26)을 확보하였다.
결손된 metB 및 metY 유전자를 각각 획득하기 위한 목적으로, 코리네박테리움 글루타미쿰 ATCC 13032의 염색체 DNA를 주형으로 하여 서열번호 27 및 28, 서열번호 29 및 30의 프라이머와 (metB), 서열번호 31 및 32, 서열번호 33 및 34 (metY) 의 프라이머를 이용하여 PCR을 수행하였다(표 9).
서열번호 서열(5'-3')
27 GAATTCGAGCTCGGTACCCGGGCCAGTAAGGTGTTACCCATGC
28 CTGCTTGCCGCCAAATAGTTTAGTACTGGTAGATCAACTCCTGTAATCAGAATTCTA
29 TAGAATTCTGATTACAGGAGTTGATCTACCAGTACTAAACTATTTGGCGGCAAGCAG
30 TCGACTCTAGAGGATCCCCGGGCGATCTCAATTCCCATGCCTC
31 TCGAGCTCGGTACCCCTGCAATAGCTGCAAAGTGG
32 TGAGTCTATTTAAAGCGGGTAATTTTCTTGACTTT
33 CAAGAAAATTACCCGCTTTAAATAGACTCACCCCA
34 CTCTAGAGGATCCCCGCCTTAATTTGGGCGGATTG
PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 53℃ 30초 어닐링, 72℃ 30초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 각각 700bp DNA 단편들을 수득하였다.
코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDCM2 벡터와 상기 증폭한 metB 및 metY 유전자 단편들을 각각 염색체 도입용 제한효소 smaI 으로 처리한 뒤, DNA 접합 효소를 이용하여 연결한 후, 대장균 DH5α에 형질전환하고 카나마이신(25mg/ℓ)이 포함된 LB 고체배지에 도말하였다. PCR을 통해 목적한 유전자들의 결손된 단편이 삽입된 벡터로 형질 전환된 콜로니를 선별한 후 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 획득한 플라스미드를 각각 pDCM2-ΔmetB 및 pDCM2-ΔmetY 라 명명하였다.
실시예 6: 3종의 metZ가 각각 강화된 균주에서 metB 및 metY 유전자를 각각 제거한 균주 제작 및 배양
상기에서 제작된 pDCM2-ΔmetB 및 pDCM2-ΔmetY 벡터를 염색체 상에서의 상동 재조합에 의해 CM02-0618, CM02-0757, CM02-0758, CM02-0759 균주에 각각 전기천공법으로 형질전환시켰다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). 그 후, 수크로오즈를 포함하고 있는 고체배지에서 2차 재조합을 하였다. 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질전환주를 대상으로 각각 서열번호 35 및 36 (metB), 서열번호 37 및 38 (metY) 를 이용하여 metB 및 metY가 유전자가 각각 결손됐는지 확인하였다(표 10).
서열번호 서열(5'-3')
35 TTCCTGGTCTGACGACAGTG
36 GATGTCTTCAGCTTCACCCTG
37 CCGAGGATAATCCACAAGGT
38 CGAAGCGTTCGTCGATTTCT
본 재조합 균주들은 각각 코리네박테리움 글루타미쿰 CM02-0618/ΔmetB CM02-0757/ΔmetB, CM02-0758/ΔmetB, CM02-0759/ΔmetB, CM02-0618/ΔmetY, CM02-0757/ΔmetY, CM02-0758/ΔmetY, CM02-0759/ΔmetY 이라 명명하였다.
상기 제작된 CM02-0618/ΔmetB, CM02-0757/ΔmetB, CM02-0758/ΔmetB, CM02-0759/ΔmetB, CM02-0618/ΔmetY, CM02-0757/ΔmetY, CM02-0758/ΔmetY, CM02-0759/ΔmetY 균주의 L-메티오닌 생산능을 분석하기 위해 아래와 같은 방법으로 배양하였다.
하기의 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 모균주인 CM02-0618, CM02-0757, CM02-0758, CM02-0759 와 상기 제작된 CM02-0618/ΔmetB, CM02-0757/ ΔmetB, CM02-0758/ΔmetB, CM02-0759/ΔmetB, CM02-0618/ΔmetY, CM02-0757/ΔmetY, CM02-0758/ΔmetY, CM02-0759/ΔmetY 를 각각 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 48시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종 배지와 생산 배지의 조성은 각각 하기와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)
<생산배지 (pH 8.0)>
포도당 50 g, (NH4)2S2O3 12 g, Yeast extract 5 g, KH2PO4 1 g, MgSO4·7H2O 1.2 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g, 코발라민 (Vitamin B12) 1 ㎍ (증류수 1리터 기준).
상기 배양 방법으로 배양하여 배양액의 중의 L-메티오닌 및 부산물인 호모란티오닌 농도를 분석하여 표 11에 나타내었다.
metY 및 metB가 각각 제거된 균주의 L-메티오닌 및 호모란티오닌 생산능 확인
균주 L-메티오닌(g/L) 호모란티오닌 (g/L)
CM02-0618 0.04 0.82
CM02-0618/ΔmetB 0.03 0
CM02-0618/ΔmetY 0.02 0.81
CM02-0757 0.13 0.17
CM02-0758 0.12 0.17
CM02-0759 0.13 0.18
CM02-0757/ΔmetB 0.13 0
CM02-0758/ΔmetB 0.12 0
CM02-0759/ΔmetB 0.13 0
CM02-0757/ΔmetY 0.08 0.19
CM02-0758/ΔmetY 0.07 0.18
CM02-0759/ΔmetY 0.08 0.19
이를 통해, 외래 metZ는 metB와 같은 Function을 하는 것, 즉 시스테인(cysteine)을 황원으로 하여 트랜스설퓨레이션(transsulfuration)을 통해 메티오닌(methionine)을 생산함을 확인할 수 있다. 즉 metB나 metY가 결실되어 있어도 metZ를 이용해 메티오닌 생산이 고수율로 유지되는 것이 가능하므로 기존 코리네박테리움의 metB 및/또는 metY의 단점을 보완하기 위해 상기 유전자를 외래 metZ로 대체할 수 있다.
또한 metB가 존재하고 외래 metZ가 도입된 균주에서 메티오닌 생산량은 강화되고 호모란티오닌 생성량은 대조군(CM02-0618) 대비 20% 정도에 그쳐, metZ 강화 시 부산물인 호모란티오닌 생성량이 감소하는 것을 확인할 수 있었다. 호모란티오닌은 O-아세틸호모세린을 소모하여 합성되는 물질로, 호모란티오닌의 생성은 메티오닌 생산을 감소시키는 바, 이러한 부산물 생성을 억제하는 외래 metZ는 metB의 단점을 보완하여 부산물 생성을 억제하고 메티오닌 합성량을 강화하는 것임을 알 수 있다.
상기 결과를 통해 처음으로 본 출원의 metZ가 시스테인을 이용해서 트랜스설퓨레이션 할 수 있다라는 사실을 밝혔으며, 메티오닌 생산 증가뿐 아니라 코리네박테리움 속 균주의 metB의 단점을 보완하기 위해 본 출원의 metZ를 사용할 수 있는 것임을 확인하였다.
실시예 7: metH, cysI 를 동시에 강화하는 재조합 벡터 제작
본 실시 예에서는 mcbR이 결손되지 않은 메티오닌 생산 균주를 제작하기 위해, 메티오닌 합성 효소를 코딩하는 metH (Ncgl1450), 설파이트 환원 효소를 코딩하는 cysI (Ncgl2718)를 동시에 강화하기 위해 벡터를 제작하였다.
구체적으로, metH 및 cysI 유전자를 코리네박테리움 ATCC13032 염색체 상에서 추가 삽입시키기 위하여 하기의 방법으로 재조합 플라스미드 벡터를 제작하였다. 미국 국립보건원의 유전자은행(NIH Genbank)에 보고된 염기서열에 근거하여 코리네박테리움 글루타미쿰의 metH 유전자 및 주변서열(서열번호 39)과 cysI 유전자 및 주변서열(서열번호 40)을 확보하였다.
다음 metH 및 cysI 유전자를 획득하기 위한 목적으로, 코리네박테리움 글루타미쿰 ATCC 13032의 염색체 DNA를 주형으로 하여 서열번호 41 및 서열번호 42, 서열번호 43 및 서열번호 44의 프라이머를 이용하여 PCR을 수행하였고, 또한 metH 유전자의 발현 강화를 위해 Pcj7 프로모터가 사용되고, cysI 유전자의 발현 강화를 위해 Pspl1 프로모터를 사용하였다. 각 프로모터를 획득하기 위해, Pcj7의 경우 코리네박테리움 암모니아게네스 ATCC 6872 염색체 DNA를 주형으로 하여 서열번호 45, 46를 이용하여 PCR을 수행하였고, Pspl1은 기 공지된 spl1-GFP (KR 10-1783170 B1) 벡터 DNA를 주형으로 하여 서열번호 47, 48을 이용하여 PCR을 수행하였다. 사용한 프라이머 서열을 하기 표 12에 나타내었다.
서열번호 서열(5'-3')
41 CAACGAAAGGAAACAATGTCTACTTCAGTTACTTC
42 TAGTCAGAGAGTGATTTAGACGTTAAAGTACTTTG
43 ATCAAAACAGATATCATGACAACAACCACCGGAAG
44 CGCTAGTCAGAGAGTTCACACCAAATCTTCCTCAG
45 CCGATCAGCGTAAGTAGAAACATCCCAGCGCTACT
46 AACTGAAGTAGACATTGTTTCCTTTCGTTGGGTAC
47 TACTTTAACGTCTAAGGTACCGGCGCTTCATGTCA
48 GGTGGTTGTTGTCATGATATCTGTTTTGATCTCCT
PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 53℃ 30초 어닐링, 72℃ 4분 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 metH 유전자 및 cysI, Pcj7 프로모터 및 Pspl1 프로모터 DNA 단편을 확보하였다.
코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDCM2-ΔNcgl1021 벡터를 제한효소 scaI 으로 처리한 뒤, 상기 증폭한 4개의 DNA 단편들을 염색체 도입용 제한효소 scaI 으로 처리한 뒤, IST 반응 후, 대장균 DH5α에 형질전환하고 카나마이신(25mg/ℓ)이 포함된 LB 고체배지에 도말하였다. PCR을 통해 목적한 유전자들의 결손된 단편이 삽입된 벡터로 형질 전환된 콜로니를 선별한 후 플라스미드 추출법을 이용하여 플라스미드를 획득하였고 pDCM2-ΔNcgl1021-Pcj7metH-Pspl1cysI 라 명명하였다.
실시예 8: metH, cysI 를 동시에 강화하는 균주 제작 및 이를 이용한 L-메티오닌 생산
상기에서 제작된 pDCM2-ΔNcgl1021 및 pDCM2-ΔNcgl1021-Pcj7metH-Pspl1cysI 벡터를 염색체 상에서의 상동 재조합에 의해 ATCC13032 균주에 각각 전기천공법으로 형질전환시켰다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). 그 후, 수크로오즈를 포함하고 있는 고체배지에서 2차 재조합을 하였다. 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질전환주를 대상으로 서열번호 23, 24를 이용하여 Ncgl1021 유전자가 결손되고 Pcj7-metH-Pspl1cysI 유전자가 잘 삽입됐는지 확인하였다. 본 재조합 균주들은 13032/ΔNcgl1021, CM02-0753으로 명명하였다.
상기 제작된 13032/ΔNcgl1021, CM02-0753 균주의 L-메티오닌 생산능을 분석하기 위해 모균주인 코리네박테리움 글루타미쿰 ATCC13032 균주와 함께 아래와 같은 방법으로 배양하였다.
하기의 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 코리네박테리움 글루타미쿰 ATCC13032과 상기 제조한 균주 13032/ΔNcgl1021, CM02-0753 를 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 48시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종 배지와 생산 배지의 조성은 각각 하기와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)
<생산배지 (pH 8.0)>
포도당 50 g, (NH4)2S2O3 12 g, Yeast extract 5 g, KH2PO4 1 g, MgSO4·7H2O 1.2 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g, 코발라민 (Vitamin B12) 1 ㎍ (증류수 1리터 기준).
상기 배양 방법으로 배양하여 배양액의 중의 L-메티오닌 농도를 분석하여 표 13에 나타내었다.
mcbR이 존재하는 균주의 L-메티오닌 생산능 확인
균주 L-메티오닌(g/L)
Corynebacterium glutamicum ATCC 13032 (야생형) 0
13032/ΔNcgl1021 0
CM02-0753 0.03
그 결과, mcbR은 그대로 존재하고, metH 및 cysI 과발현 균주는 대조군 균주 대비 L-메티오닌 생산능이 0.03 g/l 향상되었음을 확인 할 수 있었다.
실시예 9-1: Ncgl1021 site가 아닌 다른 site에 metZ 유전자들 강화를 위한 벡터 제작
3종의 외래 metZ 유전자를 각각 코리네박테리움 ATCC13032 염색체 상에서 기존과 다른 위치에 삽입시키기 위하여 하기의 방법으로 재조합 플라스미드 벡터를 제작하였다.
먼저 metZ를 삽입하기 위해 Ncgl2748 (Transposase)를 제거하기 위한 벡터를 제작하였다. 미국 국립보건원의 유전자은행(NIH Genbank)에 보고된 염기서열에 근거하여 코리네박테리움 글루타미쿰의 Ncgl2748 및 주변 서열 (서열번호 49)을 확보하였다. 결손된 Ncgl2748 유전자를 획득하기 위한 목적으로, 코리네박테리움 글루타미쿰 ATCC 13032의 염색체 DNA를 주형으로 하여 서열번호 50 및 서열번호 51, 서열번호 52 및 서열번호 53의 프라이머(표 14)를 이용하여 PCR을 수행하였다. PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 53℃ 30초 어닐링, 72℃ 30초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 각각 DNA 단편들을 수득하였다.
서열번호 서열(5'-3')
50 GTACCCGGGGATCCTCTAGACCTGGGTAACTTCCTGTCCA
51 CAGGTTAGCAGTACTTCTCAAGTTTCTCGGCGGTG
52 AACTTGAGAAGTACTGCTAACCTGCAGAAACCTTG
53 GCCTGCAGGTCGACTCTAGACTCCGCAGAAATCGTGGGGC
코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDCM2 벡터와 상기 증폭한 Ncgl2748 유전자 단편들을 염색체 도입용 제한효소 smaI 으로 처리한 뒤, IST 반응 후, 대장균 DH5α에 형질전환하고 카나마이신(25mg/ℓ)이 포함된 LB 고체배지에 도말하였다. PCR을 통해 목적한 유전자들의 결손된 단편이 삽입된 벡터로 형질 전환된 콜로니를 선별한 후 플라스미드 추출법을 이용하여 플라스미드를 획득하였고 pDCM2-ΔNcgl2748 이라 명명하였다.
다음 3종의 metZ (크로모박테리움 비오라슘 (Chromobacterium Violaceum), 하이호모나스 넵튜니윰 (Hyphomonas Neptunium), 로도박터 스페로이드 (Rhodobacter sphaeroides) 유전자들을 획득하기 위한 목적으로, 각각 상기에서 제작한 pDCM2-ΔNcgl1021-PsplCvimetZ (크로모박테리움 비오라슘(Chromobacterium Violaceum) metZ), pDCM2-ΔNcgl1021-PsplHnemetZ (하이호모나스 넵튜니윰 (Hyphomonas Neptunium) metZ), pDCM2-ΔNcgl1021-PsplRspmetZ (로도박터 스페로이드 (Rhodobacter sphaeroides) metZ) 벡터를 주형으로 하여 서열번호 54 및 55, 54 및 56, 54 및 57을 이용하여(표 15) PCR을 수행하였다. PCR 조건은 95 ℃에서 5분간 변성 후, 95℃ 30초 변성, 53℃ 30초 어닐링, 72℃ 60초 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 3종의 PCR 단편을 획득할 수 있었다.
서열번호 서열(5'-3')
54 CGCCGAGAAACTTGAGAAGTGGCGCTTCATGTCAA
55 CTGCAGGTTAGCAGTTTAGTCAAGGCCCCGCAACA
56 CTGCAGGTTAGCAGTTCACAAGCTGTTAAGCGAAG
57 CTGCAGGTTAGCAGTTCAGATCACCGCGAGCGCCT
코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDCM2-ΔNcgl2748 벡터를 제한효소 scaI 으로 처리한 뒤, 균주별로 상기 증폭한 단편들과 같이 IST 반응 후, 대장균 DH5α에 형질전환하고 카나마이신(25mg/ℓ)이 포함된 LB 고체배지에 도말하였다. PCR을 통해 목적한 유전자가 삽입된 벡터로 형질 전환된 콜로니를 선별한 후 플라스미드 추출법을 이용하여 총 3종의 플라스미드를 획득하였고 각각 pDCM2-ΔNcgl2748-PsplCvimetZ (크로모박테리움 비오라슘 (Chromobacterium Violaceum) metZ), pDCM2-ΔNcgl2748-PsplHnemetZ (하이호모나스 넵튜니윰 (Hyphomonas Neptunium) metZ), pDCM2-ΔNcgl2748-PsplRspmetZ (로도박터 스페로이드 (Rhodobacter sphaeroides) metZ) 라 명명하였다.
실시예 9-2: Ncgl1021 site가 아닌 다른 site에 metZ 유전자들 강화를 위한 벡터 제작
추가적으로, 서열 상동성 99%이상을 갖는 metZ 유전자가 도입된 균주에서도 메티오닌이 생산량이 증가되는지 확인하고자, 실시예 3-2의 metZ 유전자 5개에 대한 벡터를 추가로 제작하였다.
전술된 실시예 9-1의 방법과 동일한 방법으로 상기 6개의 metZ 유전자가 각각 도입된 벡터를 제작하였다.
총 6개의 벡터를 제작하였으며, 그 내용은 다음과 같다. pDCM2-ΔNcgl2748-PsplRspmetZ_long, ΔNcgl2748-PsplRspmetZ_3, pDCM2-ΔNcgl2748-PsplRspmetZ_65, pDCM2-ΔNcgl2748-PsplRspmetZ_104, pDCM2-ΔNcgl2748-PsplRspmetZ_196, 및 pDCM2-ΔNcgl2748-PsplRspmetZ_3_65_104라 명명하였으며, 위 벡터들을 만들기 위해 DNA 주형은 각각 실시예 4에서 제작된 ΔNcgl1021-PsplRspmetZ_long pDCM2-ΔNcgl1021-PsplRspmetZ_3, pDCM2-ΔNcgl1021-PsplRspmetZ_65, pDCM2-ΔNcgl1021-PsplRspmetZ_104, pDCM2-ΔNcgl1021-PsplRspmetZ_196, 및 pDCM2-ΔNcgl1021-PsplRspmetZ_3_65_104 를 사용하였고, 프라이머는 공통으로 서열번호 54, 57을 이용하였다. 나머지 과정은 실시예 9-1과 동일하다.
실시예 10: mcbR이 존재하는 L-메티오닌 생산주 기반 외래 metZ 강화균주 개발 및 이를 이용한 L-메티오닌 생산
상기에서 제작된 pDCM2-ΔNcgl2748, pDCM2-ΔNcgl2748-PsplCvimetZ, pDCM2-ΔNcgl2748-PsplHnemetZ, pDCM2-ΔNcgl2748-PsplRspmetZ, pDCM2-ΔNcgl2748-PsplRspmetZ_long, pDCM2-ΔNcgl2748-PsplRspmetZ_3, pDCM2-ΔNcgl2748-PsplRspmetZ_65, pDCM2-ΔNcgl2748-PsplRspmetZ_104, pDCM2-ΔNcgl2748-PsplRspmetZ_196, 및 pDCM2-ΔNcgl2748-PsplRspmetZ_3_65_104 벡터를 염색체 상에서의 상동 재조합에 의해 CM02-0753 균주에 전기천공법으로 형질전환시켰다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). 그 후, 수크로오즈를 포함하고 있는 고체배지에서 2차 재조합을 하였다. 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질전환주를 대상으로 서열번호 58, 59(표 16)를 이용하여 Ncgl2748 자리에 각각 외래 metZ 유전자가 잘 삽입됐는지 확인하였다.
서열번호 서열(5'-3')
58 TTCTCCGTGCCGAGAAAATC
59 GTAGATGATCTCGCCATTTG
본 재조합 균주를 각각 코리네박테리움 글루타미쿰 13032/ΔNcgl2748, CM02-0765, CM02-0766, CM02-0767-1, CM02-0767-2, CM02-0767-3, CM02-0767-4, CM02-0767-5, CM02-0767-6, CM02-0767 라 명명하였다.
상기 제작된 균주들의 L-메티오닌 생산능을 분석하기 위해 모균주인 코리네박테리움 글루타미쿰 CM02-0753 균주와 함께 아래와 같은 방법으로 배양하였다.
하기의 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각각의 균주를 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 48시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종 배지와 생산 배지의 조성은 각각 하기와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 ·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)
<생산배지 (pH 8.0)>
포도당 50 g, (NH4)2S2O3 12 g, Yeast extract 5 g, KH2PO4 1 g, MgSO4·7H2O 1.2 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3 30 g, 코발라민 (Vitamin B12) 1 ㎍ (증류수 1리터 기준).
상기 배양 방법으로 배양하여 배양액의 중의 L-메티오닌 농도를 분석하여 표 17에 나타내었다.
mcbR이 존재하는 균주에 외래 metZ 과발현 시 L-메티오닌 생산능 확인
균주 L-메티오닌(g/L)
CM02-0753 0.03
CM02-0753/ΔNcgl2748 0.03
CM02-0765 (CvimetZ) 0.10
CM02-0766 (HnemetZ) 0.09
CM02-0767-1(RspmetZ) 0.10
CM02-0767-2(RspmetZ_long) 0.10
CM02-0767-3 (RspmetZ_3) 0.10
CM02-0767-4 (RspmetZ_65) 0.10
CM02-0767-5 (RspmetZ_104) 0.10
CM02-0767-6 (RspmetZ_196) 0.10
CM02-0767(RspmetZ_3_65_104) 0.11
그 결과, mcbR이 존재하는 메티오닌 생산 균주에서도 외래 metZ를 각각 도입하였을 때, 메티오닌 수율이 증가하는 것을 확인 할 수 있었다.
상기 CM02-0765, CM02-0766, CM02-0767은 부다페스트조약 하의 수탁기관인 한국미생물보존센터에 2019년 5월 2일자로 기탁하여 각각 수탁번호 KCCM12509P, KCCM12510P, KCCM12511P를 부여받았다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2020014780-appb-I000001
Figure PCTKR2020014780-appb-I000002
Figure PCTKR2020014780-appb-I000003
Figure PCTKR2020014780-appb-I000004
Figure PCTKR2020014780-appb-I000005
Figure PCTKR2020014780-appb-I000006
Figure PCTKR2020014780-appb-I000007

Claims (19)

  1. 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 미생물을 티오설페이트를 포함하는 배지에서 배양하는 것을 포함하는, L-메티오닌 제조방법.
  2. 제1항에 있어서, 상기 단백질은 O-아실호모세린 트랜스설퓨레이즈(acylhomoserine transsulfurase)활성을 갖는 것인, L-메티오닌 제조방법.
  3. 제1항에 있어서, 상기 단백질은 크로모박테리움 비오라슘 (Chromobacterium violaceum), 하이호모나스 넵튜니윰 (Hyphomonas neptunium) 또는 로도박터 스페로이드 (Rhodobacter sphaeroides)유래인 것인, L-메티오닌 제조방법.
  4. 제1항에 있어서, 상기 단백질은 서열번호 60, 61 및 62 중 어느 하나의 폴리펩티드 서열 및 이와 90% 이상의 상동성 또는 동일성을 갖는 폴리펩티드 서열로 이루어지는 군에서 선택되는 어느 하나 이상을 포함하는, L-메티오닌 제조방법.
  5. 제1항에 있어서, 상기 미생물은, 시스타티오닌 감마 신타아제의 활성 약화 또는 불활성; O-아세틸호모세린 설피드릴라제의 활성 약화 또는 불활성; 메티오닌-시스테인 생합성 억제인자의 활성 약화 또는 불활성; 메티오닌 합성 효소의 활성 강화; 및 설파이트 환원 효소의 활성 강화로 이루어진 군에서 선택되는 하나 이상의 유전적 변형을 포함하는, L-메티오닌 제조방법.
  6. 제1항에 있어서, 상기 미생물은 코리네박테리움 속 미생물인, L-메티오닌 제조방법.
  7. 제6항에 있어서, 상기 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)인, L-메티오닌 제조방법.
  8. 제1항에 있어서, 상기 제조방법은 L-메티오닌을 상기 미생물 또는 배지로부터 회수하는 것을 포함하는, L-메티오닌 제조방법.
  9. 제1항에 있어서, 상기 방법은 호모란티오닌 생성량이 감소되는 것인, L-메티오닌 제조방법.
  10. 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된, L-메티오닌 생산 미생물.
  11. 제10항에 있어서, 상기 단백질은 O-아실호모세린 트랜스설퓨레이즈(acylhomoserine transsulfurase)활성을 갖는 것인, L-메티오닌을 생산하는 미생물.
  12. 제10항에 있어서, 상기 단백질은 크로모박테리움 비오라슘 (Chromobacterium violaceum), 하이호모나스 넵튜니윰 (Hyphomonas neptunium) 또는 로도박터 스페로이드 (Rhodobacter sphaeroides)유래인 것인, L-메티오닌을 생산하는 미생물.
  13. 제10항에 있어서, 상기 단백질은 서열번호 60, 61 및 62 중 어느 하나의 폴리펩티드 서열 및 이와 90% 이상의 상동성 또는 동일성을 갖는 폴리펩티드 서열로 이루어지는 군에서 선택되는 어느 하나 이상을 포함하는, L-메티오닌을 생산하는 미생물.
  14. 제10항에 있어서, 상기 미생물은, 시스타티오닌 감마 신타아제의 활성 약화 또는 불활성; O-아세틸호모세린 설피드릴라제의 활성 약화 또는 불활성; 메티오닌-시스테인 생합성 억제인자의 활성 약화 또는 불활성; 메티오닌 합성 효소의 활성 강화; 및 설파이트 환원 효소의 활성 강화로 이루어진 군에서 선택되는 하나 이상의 유전적 변형을 포함하는, L-메티오닌을 생산하는 미생물.
  15. 제10항에 있어서, 상기 미생물은 코리네박테리움 속 미생물인, L-메티오닌을 생산하는 미생물.
  16. 제10항에 있어서, 상기 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)인, L-메티오닌을 생산하는 미생물.
  17. 제10항에 있어서, 상기 미생물은 호모란티오닌 생성량이 감소된 것인, L-메티오닌 생산 미생물.
  18. 제10항 내지 제17항 중 어느 한 항의 미생물 및 티오설페이트를 포함하는, L-메티오닌 생산용 조성물.
  19. 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 미생물의, L-메티오닌 생산 용도.
PCT/KR2020/014780 2019-10-28 2020-10-28 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법 WO2021085999A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
JP2022523724A JP7450712B2 (ja) 2019-10-28 2020-10-28 外来ｍｅｔＺ遺伝子によりコードされるタンパク質が導入されたＬ－メチオニン生産微生物及びそれを用いたＬ－メチオニン生産方法
CN202080076044.6A CN114729379A (zh) 2019-10-28 2020-10-28 引入外源metZ基因编码蛋白的L-蛋氨酸生产微生物及利用其生产L-蛋氨酸的方法
US17/754,988 US20230212623A1 (en) 2019-10-28 2020-10-28 L-methionine producing microorganism to which protein encoded by foreign metz gene is introduced and method for producing l-methionine using same
BR112022007907A BR112022007907A2 (pt) 2019-10-28 2020-10-28 Método de produção de l-metionina, micro-organismo que produz l-metionina, composição para produzir l-metionina, e, uso de um micro-organismo
EP20883239.4A EP4032981A4 (en) 2019-10-28 2020-10-28 L-METHIONINE-PRODUCING MICROORGANISM INTO WHICH A PROTEIN ENCODED BY A FOREIGN METZ GENE IS INTRODUCED AND METHOD FOR PRODUCING L-METHIONINE USING THE SAME
ZA2022/05485A ZA202205485B (en) 2019-10-28 2022-05-18 L-methionine producing microorganism to which protein encoded by foreign metz gene is introduced and method for producing l-methionine using same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020190134797A KR102377500B1 (ko) 2019-10-28 2019-10-28 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법
KR10-2019-0134797 2019-10-28

Publications (1)

Publication Number Publication Date
WO2021085999A1 true WO2021085999A1 (ko) 2021-05-06

Family

ID=75715363

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/014780 WO2021085999A1 (ko) 2019-10-28 2020-10-28 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법

Country Status (8)

Country Link
US (1) US20230212623A1 (ko)
EP (1) EP4032981A4 (ko)
JP (1) JP7450712B2 (ko)
KR (1) KR102377500B1 (ko)
CN (1) CN114729379A (ko)
BR (1) BR112022007907A2 (ko)
WO (1) WO2021085999A1 (ko)
ZA (1) ZA202205485B (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113088503A (zh) * 2021-04-27 2021-07-09 浙江工业大学 一种o-琥珀酰巯基转移酶突变体及其在l-甲硫氨酸合成中的应用
CN113215124A (zh) * 2021-04-27 2021-08-06 浙江工业大学 一种o-琥珀酰巯基转移酶在l-甲硫氨酸合成中的应用
WO2023121282A1 (ko) * 2021-12-24 2023-06-29 씨제이제일제당 (주) 포스포에놀피루브산 카복실화효소를 코딩하는 유전자의 5'utr 변이 서열 및 이의 용도

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100905381B1 (ko) * 2006-07-28 2009-06-30 씨제이제일제당 (주) Ｌ-메치오닌 전구체 생산 균주 및 상기 ｌ-메치오닌전구체로부터의 ｌ-메치오닌 및 유기산의 생산방법
US20090298137A1 (en) * 2005-10-31 2009-12-03 Basf Ag Microorganism and process for the preparation of l-methionine
US20100009416A1 (en) * 2006-05-24 2010-01-14 Oskar Zelder Process for the Preparation of L-Methionine
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
KR101250651B1 (ko) * 2010-12-21 2013-04-03 씨제이제일제당 (주) 신규 ｏ-아세틸호모세린 설피드릴라제 또는 변이체 및 이를 이용한 메치오닌 전환 방법
KR101783170B1 (ko) 2016-08-31 2017-09-29 씨제이제일제당 (주) 신규 프로모터 및 이의 용도
US20180223319A1 (en) * 2015-08-07 2018-08-09 Evonik Degussa Gmbh Protein thiocarboxylate-dependent l-methionine production by fermentation
US20180355389A1 (en) 2015-10-13 2018-12-13 Cj Cheiljedang Corporation O-acetylhomoserine sulfhydrylase variant and method for producing l-methionine using same
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030049804A1 (en) * 1999-06-25 2003-03-13 Markus Pompejus Corynebacterium glutamicum genes encoding metabolic pathway proteins
US20040043953A1 (en) * 2000-12-22 2004-03-04 Markus Pompejus Genes of corynebacterium
MX2008000480A (es) * 2005-07-18 2008-03-07 Basf Ag Microorganismos recombinantes que producen metionina.
ES2575906T3 (es) * 2007-04-11 2016-07-04 Cj Cheiljedang Corporation Composiciones y métodos de producir metionina
KR20120108844A (ko) * 2011-03-25 2012-10-05 씨제이제일제당 (주) 신규 ｏ-아세틸호모세린 설피드릴라아제 또는 변이체 및 이를 이용한 메치오닌 전환 방법

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
US20090298137A1 (en) * 2005-10-31 2009-12-03 Basf Ag Microorganism and process for the preparation of l-methionine
US20100009416A1 (en) * 2006-05-24 2010-01-14 Oskar Zelder Process for the Preparation of L-Methionine
KR100905381B1 (ko) * 2006-07-28 2009-06-30 씨제이제일제당 (주) Ｌ-메치오닌 전구체 생산 균주 및 상기 ｌ-메치오닌전구체로부터의 ｌ-메치오닌 및 유기산의 생산방법
US20100184164A1 (en) 2006-07-28 2010-07-22 Cj Cheiljedang Corporation Microorganism Producing L-Methionine Precursor And Method Of Producing L-Methionine And Organic Acid From The L-Methionine Precursor
KR101250651B1 (ko) * 2010-12-21 2013-04-03 씨제이제일제당 (주) 신규 ｏ-아세틸호모세린 설피드릴라제 또는 변이체 및 이를 이용한 메치오닌 전환 방법
US20130273614A1 (en) 2010-12-21 2013-10-17 Cj Cheiljedang Corporation Novel o-acetylhomoserine sulfhydrylase or mutant protein thereof, and method for converting to methionine using the same
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US20180223319A1 (en) * 2015-08-07 2018-08-09 Evonik Degussa Gmbh Protein thiocarboxylate-dependent l-methionine production by fermentation
US20180355389A1 (en) 2015-10-13 2018-12-13 Cj Cheiljedang Corporation O-acetylhomoserine sulfhydrylase variant and method for producing l-methionine using same
KR101783170B1 (ko) 2016-08-31 2017-09-29 씨제이제일제당 (주) 신규 프로모터 및 이의 용도
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof

Non-Patent Citations (22)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
ATSCHUL, S. F. ET AL., JMOLEC BIOL, vol. 215, 1990, pages 403
CARILLO ET AL., SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
GENE, vol. 145, 1994, pages 69 - 73
GRIBSKOV ET AL., NUCL. ACIDS RES, vol. 14, 1986, pages 6745
HWANG BJ ET AL., J BACTERIOL, vol. 184, no. 5, 2002, pages 1277 - 1286
J. BIOTECHNOL., vol. 103, 2003, pages 51 - 65
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
KROMER JO ET AL., J BACTERIOL, vol. 188, no. 2, 2006, pages 609 - 618
KROMER JO ET AL., JBACTERIOL, vol. 188, no. 2, 2006, pages 609 - 618
NAKASHIMA N ET AL.: "Bacterial cellular engineering by genome editing and gene silencing", INT JMOL SCI., vol. 15, no. 2, 2014, pages 2773 - 2793, XP055376889, DOI: 10.3390/ijms15022773
NEEDLEMAN ET AL., JMOL BIOL, vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET, vol. 16, 2000, pages 276 - 277, XP004200114, DOI: 10.1016/S0168-9525(00)02024-2
SAMBROOK ET AL., MOLECULAR CLONING, 2012
See also references of EP4032981A4
SITNICKA ET AL.: "Functional Analysis of Genes", ADVANCES IN CELL BIOLOGY, vol. 2, 2010, pages 1 - 16
VAN DER REST ET AL., APPL MICROBIOL BIOTECHNOL, vol. 52, 1999, pages 541 - 545
YEOM HJ ET AL., J MICROBIOL BIOTECHNOL, vol. 14, no. 2, 2004, pages 373 - 378
YEOM HJ ET AL., J MICROBIOLBIOTECHNOL, vol. 14, no. 2, 2004, pages 373 - 378

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113088503A (zh) * 2021-04-27 2021-07-09 浙江工业大学 一种o-琥珀酰巯基转移酶突变体及其在l-甲硫氨酸合成中的应用
CN113215124A (zh) * 2021-04-27 2021-08-06 浙江工业大学 一种o-琥珀酰巯基转移酶在l-甲硫氨酸合成中的应用
CN113088503B (zh) * 2021-04-27 2023-01-10 浙江工业大学 一种o-琥珀酰巯基转移酶突变体及其在l-甲硫氨酸合成中的应用
WO2023121282A1 (ko) * 2021-12-24 2023-06-29 씨제이제일제당 (주) 포스포에놀피루브산 카복실화효소를 코딩하는 유전자의 5'utr 변이 서열 및 이의 용도

Also Published As

Publication number Publication date
US20230212623A1 (en) 2023-07-06
JP7450712B2 (ja) 2024-03-15
KR102377500B1 (ko) 2022-03-23
KR20210050324A (ko) 2021-05-07
ZA202205485B (en) 2024-01-31
EP4032981A4 (en) 2023-05-17
EP4032981A1 (en) 2022-07-27
CN114729379A (zh) 2022-07-08
JP2022553354A (ja) 2022-12-22
BR112022007907A2 (pt) 2022-07-26

Similar Documents

Publication Publication Date Title
WO2021085999A1 (ko) 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법
WO2021125896A1 (ko) 내막 단백질의 변이체 및 이를 이용한 목적 산물 생산 방법
WO2019164348A1 (ko) 신규 l-트립토판 배출 단백질 및 이를 이용한 l-트립토판을 생산하는 방법
WO2021150029A1 (ko) Nadp 의존적 글리세르알데하이드-3-포스페이트 디하이드로지나제를 포함하는 미생물을 이용하여 ｌ-아미노산을 생산하는 방법
WO2017069578A1 (ko) L-이소루신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용하여 l-이소루신을 생산하는 방법
WO2021049866A1 (ko) L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2020226341A1 (ko) L-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산을 생산하는 방법
WO2021060696A1 (ko) 디하이드로디피콜린산 리덕타제 변이형 폴리펩티드 및 이를 이용한 l-쓰레오닌 생산방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2022124708A1 (ko) 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법
WO2021045472A1 (ko) 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법
WO2022035011A1 (ko) 퓨트레신 생산 미생물 및 이를 이용한 퓨트레신 생산방법
WO2021261733A1 (ko) L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법
WO2022050671A1 (ko) L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022164118A1 (ko) 프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2020263041A1 (ko) 황 함유 아미노산 또는 그 유도체 제조방법
WO2020263043A1 (ko) 황 함유 아미노산 또는 그 유도체의 제조방법
WO2021153866A1 (ko) 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법
WO2021060701A1 (ko) 메조 디아미노피멜레이트 디하이드로게네이즈 변이형 폴리펩타이드 및 이를 이용한 l-쓰레오닌 생산방법
WO2016195439A1 (ko) O-아세틸-호모세린을 생산하는 미생물 및 이를 이용하여 o-아세틸-호모세린을 생산하는 방법
WO2023191263A1 (ko) O-아세틸 호모세린 생산 미생물 및 이를 이용한 o-아세틸 호모세린 또는 l-메치오닌 생산 방법
WO2023191264A1 (ko) O-아세틸 호모세린 생산 미생물 및 이를 이용한 o-아세틸 호모세린 또는 l-메치오닌 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20883239

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022523724

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020883239

Country of ref document: EP

Effective date: 20220420

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022007907

Country of ref document: BR

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112022007907

Country of ref document: BR

Free format text: COM BASE NA PORTARIA 405 DE 21/12/2020, SOLICITA-SE QUE SEJA APRESENTADO, EM ATE 60 (SESSENTA) DIAS, NOVO CONTEUDO DE LISTAGEM DE SEQUENCIA POIS O CONTEUDO APRESENTADO NA PETICAO NO 870220035353 DE 26/04/2022 POSSUI INFORMACOES DIVERGENTES AO PEDIDO EM QUESTAO. DEVERA SER INCLUIDO O CAMPO 140 / 141 UMA VEZ QUE O DEPOSITANTE JA POSSUI O NUMERO DO PEDIDO NO BRASIL

REG Reference to national code

Ref country code: BR

Ref legal event code: B01Y

Ref document number: 112022007907

Country of ref document: BR

Kind code of ref document: A2

Free format text: ANULADA A PUBLICACAO CODIGO 1.5 NA RPI NO 2688 DE 12/07/2022 POR TER SIDO INDEVIDA.

ENP Entry into the national phase

Ref document number: 112022007907

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220426