WO2023121282A1 - 포스포에놀피루브산 카복실화효소를 코딩하는 유전자의 5'utr 변이 서열 및 이의 용도 - Google Patents

포스포에놀피루브산 카복실화효소를 코딩하는 유전자의 5'utr 변이 서열 및 이의 용도 Download PDF

Info

Publication number
WO2023121282A1
WO2023121282A1 PCT/KR2022/020937 KR2022020937W WO2023121282A1 WO 2023121282 A1 WO2023121282 A1 WO 2023121282A1 KR 2022020937 W KR2022020937 W KR 2022020937W WO 2023121282 A1 WO2023121282 A1 WO 2023121282A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleotide sequence
variant
utr
polynucleotide
encoding
Prior art date
Application number
PCT/KR2022/020937
Other languages
English (en)
French (fr)
Inventor
석주연
최수진
홍은수
이지선
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to CA3223003A priority Critical patent/CA3223003A1/en
Priority to CN202280049518.7A priority patent/CN117980475A/zh
Priority to AU2022421911A priority patent/AU2022421911A1/en
Priority to EP22911915.1A priority patent/EP4349981A1/en
Publication of WO2023121282A1 publication Critical patent/WO2023121282A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/62—Carboxylic acid esters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/62—Carboxylic acid esters
    • C12P7/625—Polyesters of hydroxy carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01031—Phosphoenolpyruvate carboxylase (4.1.1.31)

Definitions

  • the present application relates to a variant gene encoding phosphoenolpyruvate carboxylase containing a variant 5'-untranslated region (5' Untranslated Region, 5'UTR), and a polyhydride containing the gene. It relates to a polyhydroxyalkanoate (PHA) producing microorganism and a PHA production method using the same.
  • PHA polyhydroxyalkanoate
  • PHA Polyhydroxyalkanoate
  • P3HB has properties similar to polypropylene, a synthetic resin used in automobile parts and home appliance parts, and has been studied commercially because it can be synthesized relatively easily by microorganisms. However, it has a brittle property due to high crystallinity and is difficult to process because it decomposes near the melting point. Therefore, research is being conducted to produce a PHA copolymer through blending of new materials or copolymerization of monomers.
  • P(3HB-co-4HB) (poly(3-hydroxybutyrate-co-4-hydroxybutyrate) copolymer is a material that has characteristics as an elastic body due to the addition of 4HB (4-hydroxybutyrate) monomer.
  • the physical properties of PHA change depending on the addition ratio, and since it can be used in the production of various products, it is attracting attention as a promising biodegradable polymer material.
  • the present inventors identified a variant gene encoding phosphoenolpyruvate carboxylase containing a variant 5'-untranslated region (5' Untranslated Region, 5'UTR), and included the gene.
  • the present application was completed by confirming that PHA was produced in a polyhydroxyalkanoate (PHA) producing microorganism.
  • PHA polyhydroxyalkanoate
  • One object of the present application is to provide a variant polynucleotide encoding a variant 5'-untranslated region (5'UTR) in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1 will be.
  • Another object of the present application is a mutant polynucleotide containing a nucleotide sequence encoding phosphoenolpyruvate carboxylase,
  • the variant polynucleotide further comprises a nucleotide sequence encoding a variant 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1, to provide a variant polynucleotide.
  • Another object of the present application is a mutant polynucleotide encoding a mutant 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1; Or a variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, and a variant polynucleotide further comprising a nucleotide sequence encoding the variant 5'UTR; To provide a microorganism for producing polyhydroxyalkanoate (PHA).
  • PHA polyhydroxyalkanoate
  • Another object of the present application is a mutant polynucleotide encoding a mutant 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1; Or a variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, and a variant polynucleotide further comprising a nucleotide sequence encoding the variant 5'UTR; It is to provide a PHA production method comprising the step of culturing a microorganism for use in a medium.
  • Another object of the present application is a mutant polynucleotide encoding a mutant 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1; Or a variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, and a variant polynucleotide further comprising a nucleotide sequence encoding the variant 5'UTR; for microorganisms; medium in which it was cultured; Or to provide a composition for producing PHA comprising a combination of two or more of them.
  • Another object of the present application is a mutant polynucleotide encoding a mutant 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1; Or a variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, further comprising a nucleotide sequence encoding the variant 5'UTR; to provide production use.
  • the 5' Untranslated Region (5'UTR) mutant sequence of the present application can be used to control the carbon flux of the TCA cycle, especially polyhydroxyalkanoate (PHA) producing microorganisms It is possible to provide PHA having desired physical properties by adjusting the content of 4-hydroxybutyrate (4HB).
  • PHA polyhydroxyalkanoate
  • One aspect of the present application provides a variant polynucleotide encoding a variant 5'-untranslated region (5'UTR) in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1 .
  • 5'-untranslated region 5' Untranslated Region, 5'UTR
  • 5'UTR 5' Untranslated Region
  • the translation of mRNA into protein begins with the binding of the 30S subunit of the ribosome to the 5'UTR.
  • 16S rRNA (16S ribosomal RNA) in the 30S subunit of the ribosome binds to RBS in the 5'UTR and tRNA recognizes and binds to the initiation codon (AUG) of mRNA
  • initiation codon AUG
  • the ribosome binding site of the 5'UTR and the initiation codon are approximately 6 to 8 nucleotides apart.
  • the 5'UTR may include a sequence complementary to the sequence at the 3' end of the 16S rRNA, that is, a sequence in which the Shine-Dalgarno sequence is conserved and the sequences before and after it are regulated.
  • the "5'UTR sequence is regulated" or “regulated 5'UTR” refers to a modification of one or more bases in the nucleotide sequence constituting the 5'UTR, and such modification includes substitution, addition, deletion or inversion of bases.
  • modification includes substitution, addition, deletion or inversion of bases.
  • the 5'UTR may include a ribosome binding site (RBS).
  • RBS ribosome binding site
  • ribosome binding site refers to a region (structure) present inside an mRNA chain to which ribosomes can directly bind and initiate translation, or a region that causes the region to be transcribed.
  • the ribosome recognizes and binds to the mRNA near the 5' upstream from the start codon (usually 'AUG') on the mRNA containing the open reading frame (ORF). It has RBS as a short sequence that makes it easy to do.
  • RBS has a sequence complementary to the sequence at the 3' end of 16S rRNA, which is referred to as a Shine-Dalgarno sequence.
  • the variant 5'UTR of the present application may be a 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1, which is a wild-type 5'UTR.
  • the nucleotide sequence of SEQ ID NO: 1 may be a 5'-untranslated region (5'UTR) of a gene encoding phosphoenolpyruvate carboxylase.
  • the 5'UTR of the present application may include, have, consist of, or essentially consist of the nucleotide sequence of SEQ ID NO: 1.
  • the nucleotide sequence of SEQ ID NO: 1 is at least 70%, 75%, 76%, 80%, 84%, 85%, 88%, 90%, 92%, 95%, 96%, It may include base sequences having 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or more homology or identity.
  • nucleotide sequence has such homology or identity and exhibits efficacy corresponding to the 5'UTR, it is obvious that some sequences are deleted, modified, substituted, conservatively substituted, or added nucleotide sequences are also included within the scope of the present application.
  • the 5'UTR in which one or more bases of the present application are mutated is a mutant RBS sequence in the 5'UTR, and may be used interchangeably with "mutant 5'UTR” or "mutant RBS-containing sequence".
  • the variant 5'UTR of the present application may be one in which one or more bases of the bases corresponding to positions 15 to 22 in the nucleotide sequence of SEQ ID NO: 1 are mutated.
  • the mutation may mean that a specific base is substituted with a base different from a base prior to substitution.
  • variant 5'UTR of the present application may include a nucleotide sequence described in any one selected from SEQ ID NO: 2 to SEQ ID NO: 12.
  • the variant 5'UTR of the present application has homology or identity with any one sequence selected from SEQ ID NO: 2 to SEQ ID NO: 12, compared to SEQ ID NO: 1 encoding the wild-type 5'UTR, SEQ ID NO: 2
  • Each variant sequence among 12 to 12 is fixed and is at least 70%, at least 75%, at least 76%, at least 80%, at least 84%, at least 85%, at least 88%, at least 90%, at least 92% different from the entire sequence, Has or comprises at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.7%, at least 99.9%, and less than 100% of the sequence, or SEQ ID NO: 2 to sequence 70% or more, 75% or more, 76% or more, 80% or more, 84% or more, 85% or more, 88% or more, 90% or more, 92% or more of homology or identity with any one sequence selected from number 12 , contains, has, consists of, or consists of
  • a nucleotide sequence has such homology or identity and exhibits an efficacy corresponding to the variant 5'UTR of the present application
  • a variant 5' UTR having a base sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added. It is obvious that UTRs are also included within the scope of the present application.
  • polynucleotide refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are connected in a long chain shape by covalent bonds.
  • mutant refers to a polynucleotide in which one or more nucleotides are modified and different from the nucleotide sequence of the variant polynucleotide before the mutation, but functions or properties are maintained.
  • variants can generally be identified by modifying one or more bases in the nucleotide sequence of the polynucleotide and evaluating the characteristics of the modified polynucleotide. That is, the ability of the mutated polynucleotide may be increased, unchanged, or decreased compared to the polynucleotide before mutation.
  • the variant polynucleotide is mixed with terms such as variant, modification, mutated polynucleotide, mutated gene, mutation and variant (in English, variant, modification, modified polynucleotide, modified gene, mutant, mutein, divergent, etc.) It can be used, and the term is not limited thereto as long as it is used in a mutated meaning.
  • the variant polynucleotide may be conjugated with other sequences or linkers to enable identification, purification, or synthesis.
  • corresponding to refers to a base at a position listed in a polynucleotide, or a base similar to, identical to, or homologous to a base listed in a polynucleotide. Identification of the bases of the corresponding positions may be determining the specific bases of the sequence that reference the specific sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related polynucleotide sequence or a reference polynucleotide sequence.
  • an arbitrary nucleotide sequence can be aligned with SEQ ID NO: 1, and based on this, each base of the nucleotide sequence can be numbered by referring to the numerical position of the base corresponding to the base of SEQ ID NO: 1.
  • sequence alignment algorithms such as those described herein, can identify the location of bases or locations where modifications, such as substitutions, insertions, or deletions occur, compared to a query sequence (also referred to as a “reference sequence”).
  • Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277) may be used, but it is not limited thereto, and a sequence alignment program known in the art, a pairwise sequence comparison algorithm, and the like may be appropriately used.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences and can be expressed as a percentage.
  • the terms homology and identity are often used interchangeably.
  • Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms, together with default gap penalties established by the program used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of the sequence under moderate or high stringent conditions. It is obvious that hybridization also includes hybridization with polynucleotides containing common codons or codons in consideration of codon degeneracy in polynucleotides.
  • GAP program can define the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or 10 gap opening penalty, 0.5 gap extension penalty); and (3) no penalty for end gaps.
  • the polynucleotide of the present application is a variant 5'UTR of the present application in consideration of codon degeneracy or a preferred codon in an organism intended to express a variant gene including the variant 5'UTR of the present application.
  • Various modifications may be made to the coding region within the range of not changing the nucleotide sequence of the variant gene including.
  • polynucleotide of the present application is included without limitation as long as it is a probe that can be prepared from a known gene sequence, for example, a sequence that can hybridize under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application.
  • stringent condition means a condition that allows specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • polynucleotides with high homology or identity 70% or more, 75% or more, 76% or more, 80% or more, 84% or more, 85% or more, 88% or more, 90% or more, 92% or more
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine.
  • the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the entire sequence.
  • a polynucleotide having homology or identity to the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the above-described conditions.
  • the Tm value may be 60 ° C, 63 ° C or 65 ° C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • Appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, parameters well known in the art (e.g., J. Sambrook et al., supra).
  • the variant polynucleotide encoding the variant 5'UTR of the present application may be one that regulates the translation of a polynucleotide encoding a target protein operably linked thereto into a protein.
  • the target protein may be phosphoenolpyruvate carboxylase, but is not limited thereto, and the polynucleotide encoding the variant 5'UTR of the present application is a protein of polynucleotides encoding various target proteins. It can be used universally for the purpose of controlling translation.
  • variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, wherein the variant polynucleotide comprises one or more bases in the nucleotide sequence of SEQ ID NO: 1
  • variant polynucleotide further comprising a nucleotide sequence encoding a variant 5'UTR in which a mutation is mutated.
  • variant polynucleotide the nucleotide sequence of SEQ ID NO: 1 and the variant 5'UTR are as described above.
  • phosphoenolpyruvate carboxylase is an enzyme that promotes the addition of bicarbonate to phosphorenol pyruvate to form oxaloacetate, a 4-carbon compound, and inorganic phosphate, It has a major effect on the carbon flux into the circuit, and the expression level of the ppc gene encoding it can affect the 4-hydroxybutyrate (4HB) content of polyhydroxyalkanoate (PHA) produced from microorganisms.
  • amino acid sequence of the phosphoenolpyruvate carboxylase can be obtained from a known database such as NCBI's Genebank.
  • the phosphoenolpyruvate carboxylase of the present application may be derived from a microorganism, but is not limited thereto.
  • the phosphoenolpyruvate carboxylase may include, have, consist of, or consist essentially of the amino acid sequence set forth in SEQ ID NO: 26.
  • the amino acid sequence of SEQ ID NO: 26 is at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or It may include amino acid sequences having 99.9% or more homology or identity.
  • it is an amino acid sequence having such homology or identity and exhibiting an efficacy corresponding to the protein comprising the amino acid sequence of SEQ ID NO: 26, a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added. It is obvious that it is also included within the scope of the present application.
  • sequence additions or deletions naturally occurring mutations, silent mutations, or conservations to the amino acid sequence N-terminus, C-terminus, and/or within that do not alter the function of the protein of the present application. This is the case with redundant substitution.
  • the "conservative substitution” refers to the substitution of one amino acid with another amino acid having similar structural and/or chemical properties. Such amino acid substitutions can generally occur based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.
  • the gene encoding phosphoenolpyruvate carboxylase may be a ppc gene.
  • the nucleotide sequence of the ppc gene can be obtained from a known database, such as NCBI's Genebank.
  • the ppc gene of the present application may be derived from a microorganism, but is not limited thereto.
  • the polynucleotide encoding the phosphoenolpyruvate carboxylase of the present application may include a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 27.
  • the polynucleotide of the present application may have or include the sequence of SEQ ID NO: 27.
  • the polynucleotide of the present application may consist of or essentially consist of the sequence of SEQ ID NO: 27.
  • the phosphoenolpyruvate carboxylase may be encoded by a polynucleotide represented by the nucleotide sequence of SEQ ID NO: 27.
  • the polynucleotide of the present application does not change the amino acid sequence of the phosphoenolpyruvate carboxylase in consideration of codon degeneracy or codons preferred in organisms intended to express the phosphoenolpyruvate carboxylase of the present application.
  • Various modifications may be made to the coding region within a range not specified.
  • the polynucleotide of the present application has 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% homology or identity with the sequence of SEQ ID NO: 27. %, 99.7% or 99.9% or more of the base sequence.
  • a variant polynucleotide comprising a nucleotide sequence encoding a phosphoenolpyruvate carboxylase of the present application contains a nucleotide sequence encoding a phosphoenolpyruvate carboxylase and is a wild type 5'
  • a polynucleotide further comprising a nucleotide sequence encoding UTR the content of 4-hydroxybutyrate (4HB) monomer of polyhydroxyalkanoate (PHA) produced therefrom can be controlled.
  • the 4HB monomer content of the PHA produced therefrom is controlled in the range of 3 to 21% by weight based on the total weight of PHA.
  • the mutant polynucleotide containing the nucleotide sequence encoding phosphoenolpyruvate carboxylase of the present application has a 4HB monomer content of PHA produced therefrom of about 21% by weight or less based on the total weight of PHA, specifically, 20.3 wt% or less, 20 wt% or less, 19 wt% or less, 18.7 wt% or less, 18 wt% or less, 17 wt% or less, 16 wt% or less, 15 wt% or less, 14 wt% or less, 13.9 wt% or less, 13 wt% or less, 12 wt% or less, 11.6 wt% or less, 11 wt% or less, 10.7 wt% or less, 10 wt% or less, 9 wt% or less, 8.3 wt% or less, 8 wt% or less, 7 wt% or less, 6 wt% or less, 5 wt
  • polyhydroxyalkanoate is a polyester-based natural polymer that accumulates in microorganisms. It is a biodegradable material, does not generate toxic waste, and is environmentally friendly with characteristics such as thermoplasticity and elasticity. known as polymers.
  • PHA polyhydroxyalkanoate
  • the most representative known material is P3HB (poly-3-hydroxybutyrate) polymerized using 3HB (3-hydroxybutyrate) monomer, and P (3HB- co-4HB) (poly(3-hydroxybutyrate-co-4-hydroxybutyrate) copolymers also exist, but are not limited thereto.
  • the PHA specifically includes a 4HB monomer, but is different from 4HB.
  • PHA copolymer further comprising the above monomers, or further comprising 2, 3, 4, 5, 6 or more monomers different from each other. More specifically, while including the 4HB monomer , Monomers that may be further included as monomers different from the 4HB include 2-hydroxybutyrate, lactic acid, glycolic acid, 3HB (3-hydroxybutyrate), 3HP (3-hydroxypropionate), 3HV (3-hydroxyvalerate), 3HH ( 3-hydroxyhexanoate), 3Hep(3-hydroxyheptanoate), 3HO(3-hydroxyoctanoate), 3HN(3-hydroxyoctanoate), 3HD(3-hydroxydecanoate), 3HDd(3-hydroxyundecanoate), 4HV(4-hydroxyvalerate), 5HV(5 -hydroxyvalerate) and 6HH (6-hydroxyhexanoate) may be one or more monomers selected from the group consisting of.
  • the crystallinity (crystallinity) of PHA may vary depending on the addition ratio of the 4HB monomer, and more specifically, when the content of the 4HB monomer is increased, the crystallinity is lowered, so that the PHA exhibits amorphous properties rather than semi-crystalline properties, thereby improving processability. Since this may be lowered, it is important to maintain the processability of PHA by maintaining an appropriate 4HB monomer content.
  • the variant polynucleotide containing the nucleotide sequence encoding the phosphoenolpyruvate carboxylase of the present application is adjusted so that the 4HB monomer content of the PHA is included in the range of 3 to 21% by weight based on the total weight of the PHA, thereby improving processability.
  • PHA having this excellent semi-crystalline physical property can be prepared.
  • Another aspect of the present application is a mutant polynucleotide encoding a mutant 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1;
  • a variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, further comprising a nucleotide sequence encoding the variant 5'UTR; Or to provide a vector containing it.
  • variant polynucleotide the nucleotide sequence of SEQ ID NO: 1 and the variant 5'UTR are as described above.
  • the vector may be an expression vector for expressing a desired polynucleotide in a host cell, but is not limited thereto.
  • the vector of the present application is an expression control region (or expression control sequence) suitable for expressing a target polynucleotide, that is, a variant polynucleotide further comprising a nucleotide sequence encoding the variant 5'UTR of the present application in a suitable host.
  • a target polynucleotide that is, a variant polynucleotide further comprising a nucleotide sequence encoding the variant 5'UTR of the present application in a suitable host.
  • the expression control region may include a promoter capable of initiating transcription, an arbitrary operator sequence for regulating such transcription, a sequence encoding a suitable RBS, and a sequence regulating termination of transcription and translation. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can integrate into the genome itself.
  • Vectors used in the present application are not particularly limited, and any vectors known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors , pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, pET-based, etc. can be used.
  • pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used.
  • a target polynucleotide may be inserted into a chromosome through a vector for chromosomal insertion into a cell. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • a selection marker for determining whether the chromosome is inserted may be further included.
  • the selectable marker is used to select cells transformed with a vector, that is, to determine whether a target nucleic acid molecule has been inserted, and can exhibit selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. markers may be used. In an environment treated with a selective agent, only cells expressing the selectable marker survive or exhibit other expression traits, so transformed cells can be selected.
  • the term "transformation” means introducing a vector containing a target polynucleotide into a host cell or microorganism so that the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may be inserted into and located in the chromosome of the host cell or located outside the chromosome.
  • the polynucleotide includes DNA and/or RNA encoding a polypeptide of interest.
  • the polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a genetic construct containing all elements required for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.
  • operably linked in the above means a promoter sequence that initiates and mediates the expression of a variant polynucleotide further comprising a nucleotide sequence encoding the desired variant 5'UTR of the present application and the mutation It means that the nucleotide sequence of the variant polynucleotide further comprising the nucleotide sequence encoding the 5'UTR is functionally linked.
  • the nucleotide sequence encoding the variant 5'UTR that is, the variant polynucleotide encoding the variant 5'UTR, translates the polynucleotide encoding the target protein operably linked thereto into a protein.
  • the target protein may be phosphoenolpyruvate carboxylase, but is not limited thereto, and is universal for the purpose of regulating the translation of polynucleotides encoding various target proteins into proteins. can be used as
  • Another aspect of the present application is a mutant polynucleotide encoding a mutant 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1; Or a variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, and a variant polynucleotide further comprising a nucleotide sequence encoding the variant 5'UTR; To provide a microorganism for producing hydroxy alkanoate.
  • the microorganism of the present application includes a mutant polynucleotide encoding a mutant 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1 of the present application;
  • a variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, further comprising a nucleotide sequence encoding the variant 5'UTR; Or a vector containing them; It may include any one or more selected from among.
  • microorganism includes both wild-type microorganisms and naturally or artificially genetically modified microorganisms, and causes such as insertion of foreign genes or enhancement or inactivation of endogenous gene activity.
  • a microorganism whose specific mechanism is attenuated or enhanced due to, it may be a microorganism containing genetic modification for the expression of a desired polynucleotide.
  • the microorganism may be a microorganism of the genus Escherichia . Specifically, the microorganism may be Escherichia coli .
  • the strain of the present application may have the ability to produce PHA.
  • the strain of the present application is a mutant nucleic acid molecule that can be transcribed into a mutant 5'UTR of the present application into a natural wild-type microorganism, an unmodified microorganism, or a microorganism that produces PHA; Or a mutant gene encoding a phosphoenolpyruvate carboxylase containing a mutant nucleic acid molecule that can be transcribed into a mutant 5'UTR; may be a recombinant strain introduced.
  • the term "unmodified microorganism” does not exclude strains containing mutations that may occur naturally in microorganisms, and are wild-type strains or wild-type strains themselves, or are genetically modified by natural or artificial factors. It may mean a strain before change.
  • the non-modified microorganism may include a mutant polynucleotide encoding the mutant 5'UTR described herein; Or a variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, further comprising a nucleotide sequence encoding the variant 5'UTR; is not introduced or introduced It may mean the previous strain.
  • the "unmodified microorganism” may be used interchangeably with “strain before transformation”, “microorganism before transformation”, “non-mutated strain”, “unmodified strain”, “non-mutated microorganism” or “reference microorganism”.
  • the strains of this application are polyhydes produced therefrom compared to strains expressing a gene encoding a phosphoenolpyruvate carboxylase comprising a nucleic acid molecule capable of being transcribed into a wild-type 5'UTR.
  • the 4HB monomer content of hydroxy alkanoate may be adjusted to be included in the range of 3 to 21% by weight based on the total weight of PHA.
  • the activity of some proteins in the PHA biosynthetic pathway may be additionally enhanced or weakened.
  • the variant polynucleotide, the nucleotide sequence of SEQ ID NO: 1, the variant 5'UTR and PHA, etc. are as described in the other embodiments.
  • Another aspect of the present application is a mutant polynucleotide encoding a mutant 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1; Or a variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, and a variant polynucleotide further comprising a nucleotide sequence encoding the variant 5'UTR; It provides a method for producing PHA, comprising the step of culturing a microorganism for use in a culture medium.
  • the PHA production method of the present application includes a mutant polynucleotide encoding a mutant 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1 of the present application; A variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, further comprising a nucleotide sequence encoding the variant 5'UTR; Or a vector containing them; It may include culturing a microorganism containing any one or more selected from the medium.
  • the term "culture” means growing the microorganism of the present application under appropriately controlled environmental conditions.
  • the culture process of the present application may be performed according to suitable media and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art according to the selected microorganism.
  • the culture may be batch, continuous and/or fed-batch, but is not limited thereto.
  • the term "medium” refers to a material in which nutrients necessary for culturing the microorganisms of the present application are mixed as main components, and supplies nutrients and growth factors, including water essential for survival and growth.
  • the medium and other culture conditions used for culturing the microorganisms of the present application can be any medium without particular limitation as long as it is a medium used for culturing ordinary microorganisms, but the microorganisms of the present application are suitable as carbon sources, nitrogen sources, personnel, and inorganic materials. It can be cultured while controlling temperature, pH, etc. under aerobic conditions in a conventional medium containing compounds, amino acids, and/or vitamins.
  • Examples of the carbon source in the present application include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, and maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sorghum pomace and corn steep liquor can be used, specifically glucose and sterilized pretreated molasses (i.e. converted to reducing sugar).
  • Carbohydrates such as molasses
  • other carbon sources in an appropriate amount may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, etc., organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine, etc.
  • organic nitrogen sources such as peptone, NZ-amine,
  • the number of persons may include monopotassium phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto.
  • the inorganic compound sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and amino acids, vitamins, and/or appropriate precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, it is not limited thereto.
  • the pH of the medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid and the like to the medium in an appropriate manner during the cultivation of the microorganism of the present application.
  • an antifoaming agent such as a fatty acid polyglycol ester.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without gas injection or nitrogen, hydrogen or carbon dioxide gas may be injected to maintain the anaerobic and non-aerobic state. It is not.
  • the culture temperature may be maintained at 20 to 45 ° C, specifically 25 to 40 ° C, and may be cultured for about 10 to 160 hours, but is not limited thereto.
  • PHA produced by the culture of the present application may be secreted into the medium or remain in the cells.
  • the PHA production method of the present application includes preparing the microorganism of the present application, preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, the culture Prior to the step of doing, it may be further included.
  • the PHA production method of the present application may further include a step of recovering PHA from the culture medium (culture medium) or strain.
  • the recovering step may be further included after the culturing step.
  • the recovery may be to collect the desired PHA using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method.
  • a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method.
  • centrifugation, filtration, treatment with a precipitating agent for crystallized proteins salting out method
  • extraction sonic disruption
  • ultrafiltration dialysis
  • molecular sieve chromatography gel filtration
  • adsorption chromatography ion exchange chromatography
  • affinity Various types of chromatography, such as chromatography, HPLC, or a combination thereof may be used, and the desired PHA may be recovered from a medium or microorganism using a suitable method known in the art.
  • the PHA production method of the present application may additionally include a purification step.
  • the purification may be performed using suitable methods known in the art.
  • the recovery step and the purification step are performed continuously or discontinuously regardless of order, or performed simultaneously or integrated into one step. It may be, but is not limited thereto.
  • a mutant gene encoding a phosphoenolpyruvate carboxylase containing a mutant nucleic acid molecule that can be transcribed into a mutant 5'UTR expressed by a strain of the present application is a wild-type 5'UTR.
  • the 4HB monomer content of polyhydroxy alkanoate produced therefrom is 3 to 21 weight based on the total weight of PHA. It can be adjusted to include %.
  • the variant polynucleotide, the nucleotide sequence of SEQ ID NO: 1, the variant 5'UTR and PHA, etc. are as described in the other embodiments.
  • Another aspect of the present application is a mutant polynucleotide encoding a mutant 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1; Or a variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, and a variant polynucleotide further comprising a nucleotide sequence encoding the variant 5'UTR; for microorganisms; medium in which it was cultured; Or to provide a composition for producing PHA comprising a combination of two or more of them.
  • composition of the present application may further include any suitable excipient commonly used in compositions for producing PHA, such an excipient may be, for example, a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffer, a stabilizer, or an isotonic agent. However, it is not limited thereto.
  • Another aspect of the present application is a mutant polynucleotide encoding a mutant 5'UTR in which one or more bases are mutated in the nucleotide sequence of SEQ ID NO: 1; Or a variant polynucleotide comprising a nucleotide sequence encoding phosphoenolpyruvate carboxylase, further comprising a nucleotide sequence encoding the variant 5'UTR; Provides production use.
  • variant polynucleotide the nucleotide sequence of SEQ ID NO: 1, the variant 5'UTR and PHA, etc. are as described in the other embodiments.
  • Example 1 Encoding phosphoenolpyruvate carboxylase ppc Library construction and screening for introducing mutations in the 5'-untranslated region (5'UTR) of the gene
  • a template vector for constructing a 5'UTR mutation library of the ppc gene was constructed in the following manner.
  • the 5'-UTR sequence of the wild-type ppc gene was amplified using the chromosome of Escherichia coli MG1655 as a template and the primer pair of SEQ ID NOs: 13 and 14.
  • PCR conditions were repeated 25 times: denaturation at 95°C for 20 seconds, annealing at 56°C for 40 seconds, and extension at 72°C for 30 seconds.
  • a fluorescent protein to be expressed under the promoter was amplified using a primer pair of SEQ ID NOs: 15 and 16.
  • a template vector was constructed by cloning the two amplified products and the pCL1920 vector treated with BamH1 restriction enzyme (NEB) by assembly method.
  • NEB BamH1 restriction enzyme
  • the randomized sequence was amplified from the prepared template vector using a pair of primers of SEQ ID NOs: 13 and 17. PCR conditions were repeated 25 times: denaturation at 95°C for 20 seconds, annealing at 56°C for 40 seconds, and elongation at 72°C for 30 seconds. The remaining sequences of the template vector were amplified using the primer pair of SEQ ID NOs: 18 and 19, and a library vector was obtained by cloning the amplified two fragments in an assembly method. PCR conditions were repeated 25 times: denaturation at 95°C for 20 seconds, annealing at 56°C for 40 seconds, and elongation at 72°C for 3 minutes. E.
  • coli DH5 ⁇ was used for cloning, and LB medium containing 75 mg/L of Spectinomycin was used for strain selection.
  • Spectinomycin was used for strain selection.
  • AccuPower ® ProFi Taq PCR PreMix (Bioneer) was used for DNA amplification.
  • a single colony obtained by transforming the constructed library vector into E. coli MG1655 was inoculated into a 96-well plate containing 500 ⁇ L of LB medium supplemented with 75 mg/L of spectinomycin and cultured at 37° C. for 16 hours. .
  • the saturated culture was inoculated with a 1/100 dilution in 500 ⁇ L of a polyhydroxyalkanoate (PHA) production medium (US 10323261 B2), and fluorescence was measured after the cells were sufficiently saturated in the culture medium.
  • PHA polyhydroxyalkanoate
  • a template vector having the 5'-UTR sequence of the wild-type ppc gene was used as a control. Fluorescence and OD 600 were measured using a multilabel plate reader (PerkinElmer), and the measured fluorescence values were normalized by dividing by OD 600 .
  • sequence number sequence name Sequence (5' -> 3') 13 primer 1 CGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGTCGGATGCGATACTTGCGCATC 14 primer 2 CTCCAGTGAAAAGTTCTTCTCCTTTACTGACATTACTACGCAATGCGGAATATTG 15 primer 3 GAACAATATTCCGCATTGCGTAGTAATGTCAGTAAAGGAGAAGAACTTTTCACTG 16 primer 4 GACCATGATTACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGCTCAAATGCCTGAGGTTTCAG 17 primer 5 GCGGAATATTGTTCGTTCATATTNNNNNNNNNACCCCATC 18 primer 6 ATGAACGAACAATATTCCGC 19 primer 7 CCCGGGTACCGAGCTCGAATTCAC
  • PHA-co-4HB poly(3-hydroxybutyrate-co-4-hydroxybutyrate) production strain
  • a PHA production strain into which the mutant RBS sequence identified in Example 1 was introduced was prepared.
  • PHA was produced.
  • (3HB-co-4HB) a P (3HB-co-4HB) production strain producing about 20% of 4HB content was used (US 10323261 B2).
  • PCR conditions were denaturation at 95°C for 20 seconds, annealing at 56°C for 40 seconds, and elongation at 72°C for 30 seconds, and repeated 25 times using a linear DNA fragment containing a selectable marker.
  • the att-Kan R -att DNA fragment was amplified using the primer pair of SEQ ID NOs: 22 and 23.
  • the PCR conditions were denaturation at 95 ° C for 20 seconds, annealing at 56 ° C for 40 seconds, elongation at 72 ° C 2 This was repeated 25 times.
  • overlap PCR was performed using the primer pair of SEQ ID NOs: 24 and 25.
  • the PCR conditions were denaturation 95 ° C. for 20 seconds, annealing 56 ° C.
  • the amplified DNA was transformed into a PHA-producing strain, and the RBS mutation was introduced in a selection medium containing 50 mg/L of kanamycin.
  • AccuPower® ProFi Taq PCR PreMix (Bioneer) was used.
  • sequence number sequence name Sequence (5' -> 3') 20 primer 8 CTTGATGGTTTCTCCCAGCACTTTGCCGAGCATACTGACATTACTACGCAATGCGGAATATTG 21 primer 9 CATAGCTGTGAAGCAGCTCCAGCCTACACTTAACATTTCCATAAGTTACG 22 primer 10 CTTATGGAAATGTTAAGTGTAGGCTGGAGCTGCTTC 23 primer 11 AATAATGTCGGATGCGATACTTGCGCATCTTATCCGACCTACACCTTTGGTGTTACTTGGGGCGATTTTATGGGAATTAGCCATGGTCC 24 primer 12 CTTGATGGTTTCTCCCAGCAC 25 primer 13 AATAATGTCGGATGCGATACTTG
  • the 4HB content of the PHA-producing strains each introducing a mutant sequence is shown in Table 5 below.
  • the 4HB content in the PHA was 21.2%, whereas in the case of the mutant strains having the mutant RBS sequence, the 4HB content in the PHA decreased from 20.3% to 3.2%. Therefore, it was confirmed that the content of the PHA monomer can be effectively controlled by introducing the mutant RBS sequence into the PHA-producing strain.
  • the Pppc_v10 strain was named CB02-6588 and deposited with the Korean Culture Center of Microorganisms (KCCM), an international depository under the Budapest Treaty, on December 9, 2022. It was assigned the number KCCM13300P.
  • KCCM Korean Culture Center of Microorganisms

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 변이형 5'-비번역부위(5' Untranslated Region, 5'UTR)를 포함하는 포스포에놀피루브산 카복실화효소(phosphoenolpyruvate carboxylase)를 코딩하는 변이형 유전자, 상기 유전자를 포함하는 폴리히드록시 알카노에이트(polyhydroxyalkanoate, PHA) 생산 미생물 및 이를 이용한 PHA 생산방법에 관한 것이다.

Description

포스포에놀피루브산 카복실화효소를 코딩하는 유전자의 5'UTR 변이 서열 및 이의 용도
본 출원은 변이형 5'-비번역부위(5' Untranslated Region, 5'UTR)를 포함하는 포스포에놀피루브산 카복실화효소(phosphoenolpyruvate carboxylase)를 코딩하는 변이형 유전자, 상기 유전자를 포함하는 폴리히드록시 알카노에이트(polyhydroxyalkanoate, PHA) 생산 미생물 및 이를 이용한 PHA 생산방법에 관한 것이다.
석유계 난분해성 플라스틱 축적으로 인한 환경 오염 문제가 대두되면서 이를 대체하기 위한 생분해성 바이오 플라스틱이 주목 받고 있다. 바이오 플라스틱 소재 중 하나인 폴리히드록시 알카노에이트(polyhydroxyalkanoate, PHA)는 미생물 내에 축적되는 폴리에스테르계 천연 고분자로, 생분해성 소재일 뿐만 아니라 유독성 폐기물 발생도 없으며 열가소성, 탄성등의 특징을 갖는 친환경 고분자로 알려져 있다. PHA 중에서 가장 대표적으로 알려진 물질은 3HB(3-hydroxybutyrate) 단량체를 이용해 중합된 P3HB(poly-3-hydroxybutyrate)이다. P3HB는 자동차 부품, 가전 부품 등에 사용되는 합성 수지인 폴리프로필렌과 비슷한 물성을 가지고 있고, 미생물이 비교적 쉽게 합성할 수 있어 상업적으로 생산 연구가 많이 이루어져 왔다. 하지만, 높은 결정화도(crystallinity) 때문에 부서지기 쉬운 특성을 가지고 있고, 녹는점 부근에서 분해가 되기 때문에 가공이 어렵다는 한계가 있다. 따라서, 새로운 소재의 블렌딩 혹은 단량체의 공중합을 통해서 PHA 공중합체(copolymer)를 생산하고자 하는 연구가 진행되고 있다. 그 중에서도, P(3HB-co-4HB) (poly(3-hydroxybutyrate-co-4-hydroxybutyrate) 공중합체는 4HB(4-hydroxybutyrate) 단량체의 첨가로 인해 탄성체로서의 특징을 갖는 소재이다. 이 4HB 단량체의 첨가 비율에 따라 PHA의 물성이 달라지게 되고, 이는 다양한 제품의 생산에 활용될 수 있기 때문에 유망한 생분해성 고분자 소재로서 각광받고 있다.
본 발명자들은 변이형 5'-비번역부위(5' Untranslated Region, 5'UTR)를 포함하는 포스포에놀피루브산 카복실화효소(phosphoenolpyruvate carboxylase)를 코딩하는 변이형 유전자를 규명하고, 상기 유전자를 포함하는 폴리히드록시 알카노에이트(polyhydroxyalkanoate, PHA) 생산 미생물에서 PHA가 생산됨을 확인함으로써 본 출원을 완성하였다.
본 출원의 하나의 목적은 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5'-비번역부위(5' Untranslated Region, 5'UTR)를 코딩하는, 변이형 폴리뉴클레오티드를 제공하는 것이다.
본 출원의 다른 하나의 목적은 포스포에놀피루브산 카복실화효소(phosphoenolpyruvate carboxylase)를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로,
상기 변이형 폴리뉴클레오티드는 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는, 변이형 폴리뉴클레오티드를 제공하는 것이다.
본 출원의 또 하나의 목적은 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;를 포함하는, 폴리히드록시 알카노에이트(polyhydroxyalkanoate, PHA) 생산용 미생물을 제공하는 것이다.
본 출원의 또 하나의 목적은 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;를 포함하는, PHA 생산용 미생물을 배지에서 배양하는 단계를 포함하는, PHA 생산방법을 제공하는 것이다.
본 출원의 또 하나의 목적은 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5'UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5'UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;를 포함하는, PHA 생산용 미생물; 이를 배양한 배지; 또는 이들 중 2 이상의 조합을 포함하는 PHA 생산용 조성물을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5'UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5'UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;를 포함하는 미생물의 PHA 생산 용도를 제공하는 것이다.
본 출원의 5'-비번역부위(5' Untranslated Region, 5'UTR) 변이 서열은 TCA 회로의 탄소 유량을 조절하기 위해 활용될 수 있으며, 특히 폴리히드록시 알카노에이트(polyhydroxyalkanoate, PHA) 생산 미생물의 4HB(4-hydroxybutyrate) 함량을 조절하여 목적하는 물성을 갖는 PHA를 제공할 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
본 출원의 하나의 양태는 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5'-비번역부위(5' Untranslated Region, 5'UTR)를 코딩하는, 변이형 폴리뉴클레오티드를 제공한다.
본 출원에서 용어, "5'-비번역부위(5' Untranslated Region, 5'UTR)"는 mRNA 전사체의 5'-말단에 존재하지만 아미노산으로 번역되지 않는 영역을 의미한다. mRNA가 단백질로 번역되는 과정은, 리보솜의 30S 서브유닛이 5'UTR에 결합하는 것으로 시작된다. 구체적으로, 리보솜의 30S 서브유닛 내의 16S rRNA(16S ribosomal RNA)가 5'UTR 중 RBS에 결합하고, tRNA가 mRNA 의 개시코돈(AUG)을 인식하여 결합하면 단백질로의 번역이 시작된다. 5'UTR의 리보솜 결합 부위와 개시코돈은 대략 6 내지 8 뉴클레오티드 거리에 존재하는 것으로 알려져 있다.
본 출원에 있어서, 5'UTR은 16S rRNA 의 3' 말단의 서열과 상보적인 서열, 즉 샤인-달가노 서열이 보존되어 있으며 그 앞뒤의 서열이 조절된 서열을 포함할 수 있다.
상기 "5'UTR 서열이 조절된" 또는 "조절된 5'UTR"이란, 5'UTR을 구성하는 염기서열 중 하나 이상의 염기가 변형된 것을 말하며, 이러한 변형에는 염기의 치환, 부가, 결실 또는 역위를 포함할 수 있다. 대표적인 예시로, 5'UTR에서 샤인-달가노 서열은 보존되어 있으며, 그 앞뒤에 존재하는 염기서열에서 하나 이상의 염기가 치환, 부가, 결실 또는 역위 등으로 변형된 서열을 포함할 수 있다.
상기 5'UTR은 리보솜 결합 부위(ribosome binding site, RBS)를 포함할 수 있다.
본 출원에서 용어, "리보솜 결합 부위(ribosome binding site, RBS)"는 mRNA 사슬의 내부에 존재하는, 리보솜이 직접 결합하고 또한 번역을 개시할 수 있는 영역(구조), 또는 전사됨으로써 그 영역을 일으키는 DNA 사슬의 영역(구조)를 의미한다. 대부분의 원핵생물은 열린 읽기틀(open reading frame; ORF)을 포함하고 있는 mRNA 상의 개시코돈(start codon, 대개 'AUG')으로부터 5' 방향 상류(upstream)쪽 가까운 곳에 리보솜이 mRNA을 인지하고 결합하기 쉽도록 하는 짧은 서열로서 RBS를 보유하고 있다. RBS에는 16S rRNA 의 3' 말단의 서열과 상보적인 서열이 존재하는데, 이를 샤인-달가노(Shine-Dalgarno) 서열이라 한다.
본 출원의 변이형 5'UTR은 야생형 5'UTR인 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된 5'UTR일 수 있다.
본 출원에 있어서, 서열번호 1의 염기서열은 포스포에놀피루브산 카복실화효소(phosphoenolpyruvate carboxylase)를 코딩하는 유전자의 5'-비번역부위(5' Untranslated Region, 5'UTR)일 수 있다. 본 출원의 5'UTR은 상기 서열번호 1의 염기서열을 포함하거나, 가지거나, 이루어지거나, 상기 염기서열로 필수적으로 이루어질(essentially consisting of) 수 있다.
상기 서열번호 1의 염기서열은 서열번호 1로 기재된 염기서열과 적어도 70%, 75%, 76%, 80%, 84%, 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 염기서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 5'UTR에 상응하는 효능을 나타내는 염기서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 염기서열도 본 출원의 범위 내에 포함됨은 자명하다.
구체적으로, 본 출원의 하나 이상의 염기가 변이된 5'UTR은 5'UTR 내 RBS 서열이 변이된 것으로서, "변이형 5'UTR" 또는 "변이형 RBS 포함 서열"과 혼용될 수 있다.
보다 구체적으로, 본 출원의 변이형 5'UTR은 서열번호 1의 염기서열에서 15번째 내지 22번째에 상응하는 위치의 염기 중 어느 하나 이상의 염기가 변이된 것일 수 있다. 일 예로, 상기 변이는 특정 염기가 치환 전 염기와 다른 염기로 치환된 것을 의미할 수 있다.
보다 더욱 구체적으로, 본 출원의 변이형 5'UTR은 서열번호 2 내지 서열번호 12 중 선택되는 어느 하나로 기재된 염기서열을 포함할 수 있다.
또한, 본 출원의 변이형 5'UTR은 서열번호 2 내지 서열번호 12 중 선택되는 어느 하나의 서열과 상동성 또는 동일성이, 야생형 5’UTR을 코딩하는 서열번호 1과 비교하여 변이된 서열번호 2 내지 12 중 각각의 변이 서열은 고정되고 전체 서열과는 70% 이상, 75% 이상, 76% 이상, 80% 이상, 84% 이상, 85% 이상, 88% 이상, 90% 이상, 92% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 99.5% 이상, 99.7% 이상, 99.9% 이상, 및 100% 미만인 염기서열을 가지거나 포함하거나, 또는 서열번호 2 내지 서열번호 12 중 선택되는 어느 하나의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 76% 이상, 80% 이상, 84% 이상, 85% 이상, 88% 이상, 90% 이상, 92% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 99.5% 이상, 99.7% 이상, 99.9% 이상, 및 100% 미만인 염기서열을 포함하거나, 가지거나, 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다.
또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 변이형 5'UTR에 상응하는 효능을 나타내는 염기서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 염기서열을 갖는 변이형 5'UTR도 본 출원의 범위 내에 포함됨은 자명하다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥을 의미한다.
본 출원에서 용어, "변이형"은 하나 이상의 염기가 변형(modification)되어 상기 변이형 폴리뉴클레오티드의 변이 전 염기서열과 상이하나 기능(functions) 또는 특성(properties)이 유지되는 폴리뉴클레오티드를 지칭한다. 이러한 변이형은 일반적으로 상기 폴리뉴클레오티드의 염기서열 중 하나 이상의 염기를 변형하고, 상기 변형된 폴리뉴클레오티드의 특성을 평가하여 동정(identify)될 수 있다. 즉, 변이형 폴리뉴클레오티드의 능력은 변이 전 폴리뉴클레오티드에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 상기 변이형 폴리뉴클레오티드는 변이형, 변형, 변이된 폴리뉴클레오티드, 변이된 유전자, 변이 및 변이체 등의 용어(영문 표현으로는 variant, modification, modified polynucleotide, modified gene, mutant, mutein, divergent 등)가 혼용되어 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다.
상기 변이형 폴리뉴클레오티드는 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
본 출원에서, 용어 "상응하는(corresponding to)"은, 폴리뉴클레오티드에서 열거되는 위치의 염기이거나, 또는 폴리뉴클레오티드에서 열거되는 염기와 유사하거나 동일하거나 상동한 염기를 지칭한다. 상응하는 위치의 염기를 확인하는 것은 특정 서열을 참조하는 서열의 특정 염기를 결정하는 것일 수 있다. 본 출원에 사용된 "상응 영역"은 일반적으로 관련 폴리뉴클레오티드 서열 또는 참조 (reference) 폴리뉴클레오티드 서열에서의 유사하거나 대응되는 위치를 지칭한다.
예를 들어, 임의의 염기서열을 서열번호 1과 정렬(align)하고, 이를 토대로 상기 염기서열의 각 염기는 서열번호 1의 염기와 상응하는 염기의 숫자 위치를 참조하여 넘버링 할 수 있다. 예를 들어, 본 출원에 기재된 것과 같은 서열 정렬 알고리즘은, 쿼리 시퀀스("참조 서열"이라고도 함)와 비교하여 염기의 위치, 또는 치환, 삽입 또는 결실 등의 변형이 발생하는 위치를 확인할 수 있다.
이러한 정렬에는 예를 들어 Needleman-Wunsch 알고리즘 (Needleman 및 Wunsch, 1970, J. Mol. Biol. 48: 443-453), EMBOSS 패키지의 Needleman 프로그램 (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) 등을 이용할 수 있으나, 이에 제한되지 않고 당업계에 알려진 서열 정렬 프로그램, 쌍 서열(pairwise sequence) 비교 알고리즘 등을 적절히 사용할 수 있다.
본 출원에서 용어, '상동성 (homology)' 또는 '동일성 (identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ET AL.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 출원의 변이형 5'UTR을 포함하는 변이형 유전자를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 본 출원의 변이형 5'UTR을 포함하는 변이형 유전자의 염기서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화할 수 있는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 76% 이상, 80% 이상, 84%이상, 85% 이상, 88% 이상, 90% 이상, 92% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 99.5% 이상, 99.7% 이상, 99.8% 이상, 또는 99.9%이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1ХSSC, 0.1% SDS, 구체적으로 60℃, 0.1ХSSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1ХSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
본 출원의 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드는, 이와 작동가능하게 연결된 목적 단백질을 코딩하는 폴리뉴클레오티드의 단백질로의 번역을 조절하는 것일 수 있다.
일 예로, 상기 목적 단백질은 포스포에놀피루브산 카복실화효소일 수 있으나, 이에 제한되지 않으며, 본 출원의 변이형 5’UTR을 코딩하는 폴리뉴클레오티드는 다양한 목적 단백질을 코딩하는 폴리뉴클레오티드의 단백질로의 번역을 조절하기 위한 목적으로 범용적으로 사용할 수 있다.
본 출원의 다른 하나의 양태는 포스포에놀피루브산 카복실화효소(phosphoenolpyruvate carboxylase)를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 폴리뉴클레오티드는 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는, 변이형 폴리뉴클레오티드를 제공한다.
상기 변이형 폴리뉴클레오티드, 서열번호 1의 염기서열 및 변이형 5’UTR은 전술한 바와 같다.
본 출원에서 용어, "포스포에놀피루브산 카복실화효소(phosphoenolpyruvate carboxylase)"은 포스포레놀 피루베이트에 중탄산염의 첨가를 촉진하여 4-탄소 화합물인 옥살로아세테이트와 무기 인산염을 형성하는 효소로서, TCA 회로로의 탄소 유량에 주요하게 영향을 미치며 이를 코딩하는 ppc 유전자의 발현량은 미생물로부터 생산되는 폴리히드록시 알카노에이트(polyhydroxyalkanoate, PHA)의 4HB(4-hydroxybutyrate) 함량에 영향을 미칠 수 있다.
상기 포스포에놀피루브산 카복실화효소의 아미노산 서열은 공지의 데이터베이스인 NCBI의 Genebank 등에서 얻을 수 있다.
일 예로, 본 출원의 포스포에놀피루브산 카복실화효소는 미생물로부터 유래하는 것일 수 있으나, 이에 제한되지 않는다.
본 출원에 있어서, 포스포에놀피루브산 카복실화효소는 서열번호 26으로 기재된 아미노산 서열을 포함하거나, 가지거나, 이루어지거나, 상기 아미노산 서열로 필수적으로 이루어질 수 있다.
본 출원에 있어서, 상기 서열번호 26의 아미노산 서열은 이와 적어도 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 상기 서열번호 26의 아미노산 서열을 포함하는 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 범위 내에 포함됨은 자명하다.
예를 들어, 상기 아미노산 서열 N-말단, C-말단 그리고/또는 내부에 본 출원의 단백질의 기능을 변경하지 않는 서열 추가 또는 결실, 자연적으로 발생할 수 있는 돌연변이, 잠재성 돌연변이(silent mutation) 또는 보존적 치환을 가지는 경우이다.
상기 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
본 출원에 있어서, 포스포에놀피루브산 카복실화효소를 코딩하는 유전자는 ppc 유전자일 수 있다.
상기 ppc 유전자의 염기서열은 공지의 데이터베이스인 NCBI의 Genebank 등에서 얻을 수 있다.
일 예로, 본 출원의 ppc 유전자는 미생물로부터 유래하는 것일 수 있으나, 이에 제한되지 않는다.
본 출원의 포스포에놀피루브산 카복실화효소를 코딩하는 폴리뉴클레오티드는 서열번호 27로 기재된 아미노산 서열을 코딩하는 염기서열을 포함할 수 있다. 본 출원의 일 예로, 본 출원의 폴리뉴클레오티드는 서열번호 27의 서열을 가지거나 포함할 수 있다. 또한, 본 출원의 폴리뉴클레오티드는 서열번호 27의 서열로 이루어지거나, 필수적으로 구성될 수 있다. 구체적으로, 상기 포스포에놀피루브산 카복실화효소는 서열번호 27의 염기서열로 기재된 폴리뉴클레오티드에 의해 코딩되는 것일 수 있다.
본 출원의 폴리뉴클레오티드는 코돈의 축퇴성 또는 본 출원의 포스포에놀피루브산 카복실화효소를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 포스포에놀피루브산 카복실화효소의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 출원의 폴리뉴클레오티드는 서열번호 27의 서열과 상동성 또는 동일성이 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상인 염기서열을 포함할 수 있다.
본 출원의 목적상, 본 출원의 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드는, 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하고 야생형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 폴리뉴클레오티드와 비교하여, 이로부터 생산되는 폴리히드록시 알카노에이트(polyhydroxyalkanoate, PHA)의 4HB(4-hydroxybutyrate) 단량체 함량이 조절될 수 있다.
일 예로, 본 출원의 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드는 이로부터 생산되는 PHA의 4HB 단량체 함량이 PHA 총 중량 기준 3 내지 21 중량% 함량 범위로 조절되는 것일 수 있다. 그 예로, 본 출원의 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드는 이로부터 생산되는 PHA의 4HB 단량체 함량이 PHA 총 중량 기준 약 21 중량% 이하, 구체적으로는 20.3 중량% 이하, 20 중량% 이하, 19 중량% 이하, 18.7 중량% 이하, 18 중량% 이하, 17 중량% 이하, 16 중량% 이하, 15 중량% 이하, 14 중량% 이하, 13.9 중량% 이하, 13 중량% 이하, 12 중량% 이하, 11.6 중량% 이하, 11 중량% 이하, 10.7 중량% 이하, 10 중량% 이하, 9 중량% 이하, 8.3 중량% 이하, 8 중량% 이하, 7 중량% 이하, 6 중량% 이하, 5 중량% 이하, 4 중량% 이하 또는 3.2 중량% 이하일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "폴리히드록시 알카노에이트(polyhydroxyalkanoate, PHA)"는 미생물 내에 축적되는 폴리에스테르계 천연 고분자로, 생분해성 소재일 뿐만 아니라 유독성 폐기물 발생도 없으며 열가소성, 탄성등의 특징을 갖는 친환경 고분자로 알려져 있다. PHA 중에서 가장 대표적으로 알려진 물질은 3HB(3-hydroxybutyrate) 단량체를 이용해 중합된 P3HB(poly-3-hydroxybutyrate)이며, 4HB(4-hydroxybutyrate) 단량체 첨가에 따라 탄성체로서의 특징을 갖도록 제조된 P(3HB-co-4HB) (poly(3-hydroxybutyrate-co-4-hydroxybutyrate) 공중합체도 존재하나 이에 국한되지 않는다. 본 출원에 있어서, 상기 PHA는 구체적으로는 4HB 단량체를 포함하면서, 상기 4HB와 상이한 1개 이상의 단량체를 추가로 포함하거나, 서로 상이한 2개, 3개, 4개, 5개, 6개 또는 그 이상의 단량체를 추가로 포함하는 PHA 공중합체일 수 있다. 보다 구체적으로는 상기 4HB 단량체를 포함하면서, 상기 4HB와 상이한 단량체로서 추가로 포함할 수 있는 단량체로는 2-하이드록시부티레이트, 젖산, 글리콜산, 3HB(3-hydroxybutyrate), 3HP(3-hydroxypropionate), 3HV(3-hydroxyvalerate), 3HH(3-hydroxyhexanoate), 3HHep(3-hydroxyheptanoate), 3HO(3-hydroxyoctanoate), 3HN(3-hydroxyoctanoate), 3HD(3-hydroxydecanoate), 3HDd(3-hydroxyundecanoate), 4HV(4-hydroxyvalerate), 5HV(5-hydroxyvalerate) 및 6HH(6-hydroxyhexanoate)로 이루어진 군에서 선택된 1종 이상의 단량체일 수 있다.
특히, 4HB 단량체의 첨가 비율에 따라 PHA의 물성이 달라지게 되고, 이는 다양한 제품의 생산에 활용될 수 있기 때문에 4HB 단량체의 비율을 조절할 수 있을 경우 산업적으로 유용할 수 있다.
구체적으로는, 4HB 단량체의 첨가 비율에 따라 PHA의 결정화도(결정성)가 달라질 수 있으며, 보다 구체적으로는, 4HB 단량체의 함량이 높아지는 경우 결정화도가 낮아져 PHA가 반결정성보다 비결정성의 물성을 나타내어 가공성이 낮아질 수 있는바, 적정한 4HB 단량체의 함량을 유지하여 PHA의 가공성을 유지하는 것이 중요하다.
이에, 본 출원의 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드는 PHA의 4HB 단량체 함량이 PHA 총 중량을 기준으로 3 내지 21 중량%로 포함되도록 조절함으로써, 가공성이 우수한 반결정성의 물성을 갖는 PHA를 제조할 수 있다.
본 출원의 또 하나의 양태는 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드; 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드; 또는 이를 포함하는 벡터를 제공하는 것이다.
상기 변이형 폴리뉴클레오티드, 서열번호 1의 염기서열 및 변이형 5’UTR은 전술한 바와 같다.
상기 벡터는 목적하는 폴리뉴클레오티드를 숙주세포에서 발현시키기 위한 발현 벡터일 수 있으나, 이에 제한되지 않는다.
본 출원의 벡터는 적합한 숙주 내에서 목적 폴리뉴클레오티드, 즉 본 출원의 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리뉴클레오티드의 염기서열을 포함하는 DNA 제조물을 포함할 수 있다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 RBS를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 목적 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 목적 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 목적하는 본 출원의 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드의 발현을 개시 및 매개하도록 하는 프로모터 서열과 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드의 염기서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원에 있어서, 상기 변이형 5’UTR을 코딩하는 염기서열, 즉 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드는, 이와 작동가능하게 연결된 목적 단백질을 코딩하는 폴리뉴클레오티드의 단백질로의 번역을 조절하는 것일 수 있고, 일 예로 상기 목적 단백질은 포스포에놀피루브산 카복실화효소일 수 있으나, 이에 제한되지 않으며, 다양한 목적 단백질을 코딩하는 폴리뉴클레오티드의 단백질로의 번역을 조절하기 위한 목적으로 범용적으로 사용할 수 있다.
본 출원의 또 하나의 양태는 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;를 포함하는, 폴리히드록시 알카노에이트 생산용 미생물을 제공하는 것이다.
본 출원의 미생물은 본 출원의 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드; 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드; 또는 이를 포함하는 벡터; 중 선택되는 어느 하나 이상을 포함할 수 있다.
본 출원에서 용어, "미생물(또는, 균주)"는 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 폴리뉴클레오티드의 발현을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다. 상기 미생물은 에스케리키아(Escherichia) 속 미생물일 수 있다. 구체적으로는 상기 미생물은 대장균(Escherichia coli) 일 수 있다.
본 출원의 균주는 PHA 생산능을 가질 수 있다.
본 출원의 균주는 천연의 야생형 미생물, 비변형 미생물 또는 PHA를 생산하는 미생물에 본 출원의 변이형 5'UTR로 전사될 수 있는 변이형 핵산분자; 또는 변이형 5'UTR로 전사될 수 있는 변이형 핵산분자를 포함하는 포스포에놀피루브산 카복실화효소를 코딩하는 변이형 유전자;가 도입된 재조합 균주일 수 있다.
본 출원에서 용어, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 본 명세서에 기재된 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;가 도입되지 않거나 도입되기 전의 균주를 의미할 수 있다. 상기 "비변형 미생물"은 "변형 전 균주", "변형 전 미생물", "비변이 균주", "비변형 균주", "비변이 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
본 출원의 목적상, 본 출원의 균주는, 야생형 5'UTR로 전사될 수 있는 핵산분자를 포함하는 포스포에놀피루브산 카복실화효소를 코딩하는 유전자를 발현하는 균주에 비해 이로부터 생산되는 폴리히드록시 알카노에이트의 4HB 단량체 함량이 PHA 총 중량을 기준으로 3 내지 21 중량%로 포함되도록 조절될 수 있다.
다른 하나의 예로, 본 출원의 재조합 미생물은, PHA 생합성 경로 내 단백질 일부의 활성이 추가적으로 강화되거나, 또는 약화될 수 있다.
본 출원의 미생물에서, 상기 변이형 폴리뉴클레오티드, 서열번호 1의 염기서열, 변이형 5’UTR 및 PHA 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 하나의 양태는 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;를 포함하는, PHA 생산용 미생물을 배지에서 배양하는 단계를 포함하는, PHA 생산방법을 제공한다.
본 출원의 PHA 생산방법은 본 출원의 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드; 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드; 또는 이를 포함하는 벡터; 중 선택되는 어느 하나 이상을 포함하는 미생물을 배지에서 배양하는 단계를 포함할 수 있다.
본 출원에서, 용어 "배양"은 본 출원의 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 미생물에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및/또는 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 본 출원의 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 본 출원의 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
본 출원의 배양에서 배양온도는 20 내지 45℃, 구체적으로는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 배양에 의하여 생산된 PHA는 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 PHA 생산방법은, 본 출원의 미생물을 준비하는 단계, 상기 미생물을 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 PHA 생산방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 균주로부터 PHA를 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 PHA를 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 PHA를 회수할 수 있다.
또한, 본 출원의 PHA 생산방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 PHA 생산방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 연속적 또는 비연속적으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 목적상, 본 출원의 균주가 발현하는, 변이형 5'UTR로 전사될 수 있는 변이형 핵산분자를 포함하는 포스포에놀피루브산 카복실화효소를 코딩하는 변이형 유전자는, 야생형 5'UTR로 전사될 수 있는 핵산분자를 포함하는 포스포에놀피루브산 카복실화효소를 코딩하는 유전자에 비해 이로부터 생산되는 폴리히드록시 알카노에이트의 4HB 단량체 함량이 PHA 총 중량을 기준으로 3 내지 21 중량%로 포함되도록 조절될 수 있다.
본 출원의 방법에서, 상기 변이형 폴리뉴클레오티드, 서열번호 1의 염기서열, 변이형 5’UTR 및 PHA 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 하나의 양태는 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;를 포함하는, PHA 생산용 미생물; 이를 배양한 배지; 또는 이들 중 2 이상의 조합을 포함하는 PHA 생산용 조성물을 제공하는 것이다.
본 출원의 조성물은 PHA 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 또 하나의 양태는 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;를 포함하는 미생물의 PHA 생산 용도를 제공한다.
상기 변이형 폴리뉴클레오티드, 서열번호 1의 염기서열, 변이형 5’UTR 및 PHA 등은 상기 다른 양태에서 기재한 바와 같다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 하기 실시예는 본 출원을 예시하기 위한 바람직한 실시양태에 불과한 것이며 따라서, 본 출원의 권리범위를 이에 한정하는 것으로 의도되지는 않는다. 한편, 본 명세서에 기재되지 않은 기술적인 사항들은 본 출원의 기술 분야 또는 유사 기술 분야에서 숙련된 통상의 기술자이면 충분히 이해하고 용이하게 실시할 수 있다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 출원이 속하는 기술 분야의 수준 및 본 출원의 내용이 보다 명확하게 설명된다.
실시예 1: 포스포에놀피루브산 카복실화효소(phosphoenolpyruvate carboxylase)를 코딩하는 ppc 유전자의 5'-비번역부위(5' Untranslated Region, 5'UTR) 내 변이를 도입하기 위한 라이브러리 제작 및 스크리닝
ppc 유전자의 5'UTR 변이 라이브러리 제작을 위한 주형 벡터를 다음과 같은 방법으로 제작하였다. 대장균(Escherichia coli) MG1655의 염색체를 주형으로 하고 서열번호 13 및 14의 프라이머 쌍을 이용하여 야생형 ppc 유전자의 5'-UTR 서열을 증폭하였다. PCR 조건은 변성(denaturation) 95℃ 20초, 어닐링(annealing) 56℃ 40초, 신장(extension) 72℃ 30초를 25회 반복 수행하였다. 형광 기반의 스크리닝을 위해서, 프로모터 하위에서 발현될 형광 단백질을 서열번호 15 및 16의 프라이머 쌍을 이용해서 증폭하였다. PCR 조건은 변성 95℃ 20초, 어닐링 56℃ 40초, 신장 72℃ 1분을 25회 반복 수행하였다. 두 개의 증폭된 산물과 BamH1 제한효소(NEB)가 처리된 pCL1920 벡터를 assembly 방식으로 클로닝하여 주형 벡터를 제작하였다.
해당 벡터를 이용하여 ppc 유전자의 5'UTR 변이 라이브러리를 제작하기 위해 서열번호 13 및 17의 프라이머 쌍을 이용하여 상기 제작한 주형 벡터로부터 랜덤화된 서열을 증폭하였다. PCR 조건은 변성 95℃ 20초, 어닐링 56℃ 40초, 신장 72℃ 30초를 25회 반복 수행하였다. 서열번호 18 및 19의 프라이머 쌍을 이용하여 주형 벡터의 나머지 서열을 증폭하였으며, 증폭된 두 개의 조각을 assembly 방식으로 클로닝함으로써 라이브러리 벡터를 수득하였다. PCR 조건은 변성 95℃ 20초, 어닐링 56℃ 40초, 신장 72℃ 3분을 25회 반복 수행하였다. 클로닝을 위해 E. coli DH5α를 이용했으며, 균주 선별을 위해 스펙티노마이신(Spectinomycin) 75mg/L가 포함되어 있는 LB 배지를 이용하였다. DNA 증폭을 위해서는 AccuPower® ProFi Taq PCR PreMix(Bioneer)를 이용하였다.
상기 구축된 라이브러리 벡터를 E. coli MG1655에 형질전환하여 얻어진 단일 콜로니들을 스펙티노마이신 75 mg/L가 첨가된 500μL의 LB 배지가 담겨있는 96-웰 플레이트에 접종하여 37℃에서 16시간 동안 배양하였다. 포화된 배양액을 폴리히드록시 알카노에이트(polyhydroxyalkanoate, PHA) 생산 배지(US 10323261 B2) 500μL에 1/100 희석하여 접종하였으며, 배양액 내에 세포가 충분히 포화된 후 형광을 측정하였다. 이 때, 야생형 ppc 유전자의 5'-UTR 서열을 갖는 주형 벡터를 대조군으로 하였다. 형광과 OD600은 multilabel plate reader(PerkinElmer)를 이용하여 측정하였으며, 측정된 형광값은 OD600으로 나누어 정규화하였다.
그 결과, 총 11 종의 발현량이 서로 다른 균체를 확인하였고, 각 균체들의 플라스미드를 분리하여 각각을 Vector ver.1 부터 Vector ver.11까지 명명한 후, 시퀀싱하여 변이 서열을 확인하였다.
상기에서 사용된 플라스미드는 하기 표 1에, 프라이머 서열은 하기 표 2에 나타내었다.
상기에서 확인한 Vector ver.1 부터 Vector ver.11까지의 변이 서열은 하기 표 3에 나타내었다.
플라스미드 이름 유전형
주형 벡터 pCL1920-Pppc-gfp, SpR
라이브러리 벡터 pCL1920-Pppc*-gfp, SpR
Vector ver.1 pCL1920-Pppc_v1-gfp, SpR
Vector ver.2 pCL1920-Pppc_v2-gfp, SpR
Vector ver.3 pCL1920-Pppc_v3-gfp, SpR
Vector ver.4 pCL1920-Pppc_v4-gfp, SpR
Vector ver.5 pCL1920-Pppc_v5-gfp, SpR
Vector ver.6 pCL1920-Pppc_v6-gfp, SpR
Vector ver.7 pCL1920-Pppc_v7-gfp, SpR
Vector ver.8 pCL1920-Pppc_v8-gfp, SpR
Vector ver.9 pCL1920-Pppc_v9-gfp, SpR
Vector ver.10 pCL1920-Pppc_v10-gfp, SpR
Vector ver.11 pCL1920-Pppc_v11-gfp, SpR
서열번호 서열명 서열(5' -> 3')
13 primer 1 CGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGTCGGATGCGATACTTGCGCATC
14 primer 2 CTCCAGTGAAAAGTTCTTCTCCTTTACTGACATTACTACGCAATGCGGAATATTG
15 primer 3 GAACAATATTCCGCATTGCGTAGTAATGTCAGTAAAGGAGAAGAACTTTTCACTG
16 primer 4 GACCATGATTACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGCTCAAATGCCTGAGGTTTCAG
17 primer 5 GCGGAATATTGTTCGTTCATATTNNNNNNNNNACCCCATC
18 primer 6 ATGAACGAACAATATTCCGC
19 primer 7 CCCGGGTACCGAGCTCGAATTCAC
서열번호 명칭 5'-UTR 서열(5' -> 3')
1 Pppc (WT) GATAAGATGGGGTGTCTGGGGTAAT
2 Pppc_v1 GATAAGATGGGGTGTCGGGGGTAAT
3 Pppc_v2 GATAAGATGGGGTGTCTGAGGGAAT
4 Pppc_v3 GATAAGATGGGGTGTCGGAGGGAAT
5 Pppc_v4 GATAAGATGGGGTGTATGGGGGAAT
6 Pppc_v5 GATAAGATGGGGTGGCGGACGTAAT
7 Pppc_v6 GATAAGATGGGGTGTCTGGGGGAAT
8 Pppc_v7 GATAAGATGGGGTGTCGGGGGGAAT
9 Pppc_v8 GATAAGATGGGGTGGAGGACGGAAT
10 Pppc_v9 GATAAGATGGGGTGGCGGGGGGAAT
11 Pppc_v10 GATAAGATGGGGTGGATGGGGGAAT
12 Pppc_v11 GATAAGATGGGGTGTCGGGCGTAAT
실시예 2: 변이 서열 도입 균주 제작 및 생산된 PHA 내 단량체 함량 분석
P(3HB-co-4HB) (poly(3-hydroxybutyrate-co-4-hydroxybutyrate) 생산 균주를 기반으로 상기 실시예 1에서 확인된 변이 RBS 서열이 도입된 PHA 생산 균주를 제작하였다. 모균주로 P(3HB-co-4HB) 내 4HB 함량을 약 20% 수준으로 생산하는 P(3HB-co-4HB) 생산 균주를 이용하였다(US 10323261 B2). 먼저, 서열이 확인된 변이 서열들을 서열번호 20 및 21의 프라이머 쌍을 이용하여 각각 증폭하였다. PCR 조건은 변성 95℃ 20초, 어닐링 56℃ 40초, 신장 72℃ 30초이며, 25회 반복 수행하였다. 선별 마커를 포함하는 선형의 DNA 단편을 이용하여 유전자 재조합을 수행하기 위해, att-KanR-att DNA 조각을 서열번호 22 및 23의 프라이머 쌍을 이용하여 증폭하였다. PCR 조건은 변성 95℃ 20초, 어닐링 56℃ 40초, 신장 72℃ 2분을 25회 반복 수행하였다. 이것을 앞서 증폭한 서열과 연결시키기 위해 서열번호 24 및 25의 프라이머 쌍을 이용하여 오버랩 PCR(overlap PCR)을 수행하였다. PCR 조건은 변성 95℃ 20초, 어닐링 56℃ 40초, 신장 72℃ 2분 15초를 25회 반복 수행하였다. 이렇게 증폭된 DNA를 PHA 생산 균주에 형질전환시킨 후 카나마이신(Kanamycin) 50 mg/L가 포함된 선별 배지에서 RBS 변이가 도입된 균주들을 선별하였다. DNA 증폭을 위해서는 AccuPower® ProFi Taq PCR PreMix(Bioneer)를 이용하였다.
상기에서 프라이머 서열은 하기 표 4에 나타내었다.
서열번호 서열명 서열(5' -> 3')
20 primer 8 CTTGATGGTTTCTCCCAGCACTTTGCCGAGCATACTGACATTACTACGCAATGCGGAATATTG
21 primer 9 CATAGCTGTGAAGCAGCTCCAGCCTACACTTAACATTTCCATAAGTTACG
22 primer 10 CTTATGGAAATGTTAAGTGTAGGCTGGAGCTGCTTC
23 primer 11 AATAATGTCGGATGCGATACTTGCGCATCTTATCCGACCTACACCTTTGGTGTTACTTGGGGCGATTTTATGGGAATTAGCCATGGTCC
24 primer 12 CTTGATGGTTTCTCCCAGCAC
25 primer 13 AATAATGTCGGATGCGATACTTG
RBS 변이가 도입된 균주 11종의 PHA 생산능을 평가하기 위해서, LB 배지에 접종해 충분히 포화될 때까지 배양하였다. 이후, 5% 포도당을 포함하는 PHA 생산 배지 25ml을 함유하는 250ml 코너-바플 플라스크에 균주를 각각 접종한 후, 37℃에서 5시간, 35℃에서 43시간 동안 230 rpm으로 진탕 배양하였다. 배양 완료 후, 기체 크로마토그래피를 이용하여 세포 내 PHA 함량 및 상기 PHA 내 4HB 함량을 분석하였다. 구체적인 배양 조건 및 분석 조건은 기 사용된 조건을 참고하였다(US 10323261 B2).
변이 서열이 각각 도입된 PHA 생산 균주의 4HB 함량은 하기 표 5에 나타내었다.
서열명 PHA (mg) 4HB 함량 (중량%)
Pppc 12.3 21.2%
Pppc_v1 11.9 20.3%
Pppc_v2 12.8 13.9%
Pppc_v3 13.8 18.7%
Pppc_v4 13.5 12.0%
Pppc_v5 7.7 8.3%
Pppc_v6 9.8 11.6%
Pppc_v7 12.1 10.7%
Pppc_v8 12.9 16.0%
Pppc_v9 13.2 9.0%
Pppc_v10 14.2 5.0%
Pppc_v11 11.3 3.2%
상기 표 5와 같이, 야생형 RBS 서열을 갖는 대조군 균주의 경우 PHA 내 4HB 함량이 21.2%인 반면, 변이 RBS 서열을 갖는 변이 균주들의 경우, PHA 내 4HB 함량이 20.3%부터 3.2% 수준까지 감소하였다. 따라서, PHA 생산 균주에 변이 RBS 서열을 도입함으로써, PHA 단량체의 함량을 효과적으로 조절할 수 있음을 확인하였다.
상기 변이 RBS 서열이 도입된 균주 11종 중 Pppc_v10 균주를 CB02-6588로 명명한 후 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean CultureCenter of Microorganisms, KCCM)에 2022년 12월 9일자로 기탁하여 기탁번호 KCCM13300P를 부여 받았다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2022020937-appb-img-000001
Figure WO-DOC-PAGE-

Claims (13)

  1. 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5'-비번역부위(5' Untranslated Region, 5'UTR)를 코딩하는, 변이형 폴리뉴클레오티드.
  2. 포스포에놀피루브산 카복실화효소(phosphoenolpyruvate carboxylase)를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로,
    상기 변이형 폴리뉴클레오티드는 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는, 변이형 폴리뉴클레오티드.
  3. 제1항 또는 제2항에 있어서, 상기 변이형 5’UTR은 서열번호 1의 염기서열에서 15번째 내지 22번째에 상응하는 위치의 염기 중 어느 하나 이상의 염기가 변이된 것인, 변이형 폴리뉴클레오티드.
  4. 제1항 또는 제2항에 있어서, 상기 변이형 5’UTR은 서열번호 2 내지 12 중 선택되는 어느 하나 이상의 염기서열을 포함하는 것인, 변이형 폴리뉴클레오티드.
  5. 제1항에 있어서, 상기 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드는, 이와 작동가능하게 연결된 목적 단백질을 코딩하는 폴리뉴클레오티드의 단백질로의 번역을 조절하는 것인, 변이형 폴리뉴클레오티드.
  6. 제5항에 있어서, 상기 목적 단백질은 포스포에놀피루브산 카복실화효소인 것인, 변이형 폴리뉴클레오티드.
  7. 제2항에 있어서, 상기 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드는, 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하고 야생형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 폴리뉴클레오티드와 비교하여, 이로부터 생산되는 폴리히드록시 알카노에이트(polyhydroxyalkanoate)의 4HB(4-hydroxybutyrate) 단량체 함량이 PHA 총 중량 기준 3 내지 21 중량% 함량 범위로 조절되는 것인, 변이형 폴리뉴클레오티드.
  8. 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;를 포함하는, 폴리히드록시 알카노에이트 생산용 미생물.
  9. 제8항에 있어서, 상기 미생물로부터 생산되는 폴리히드록시 알카노에이트의 4HB 단량체 함량이 PHA 총 중량 기준 3 내지 21 중량% 함량 범위로 조절되는 것인, 미생물.
  10. 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5’UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;를 포함하는, 폴리히드록시 알카노에이트 생산용 미생물을 배지에서 배양하는 단계를 포함하는, 폴리히드록시 알카노에이트 생산방법.
  11. 제10항에 있어서, 상기 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드는, 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하고 야생형 5’UTR을 코딩하는 염기서열을 추가로 포함하는 폴리뉴클레오티드와 비교하여, 이로부터 생산되는 폴리히드록시 알카노에이트의 4HB 단량체 함량이 PHA 총 중량 기준 3 내지 21 중량% 함량 범위로 조절되는 것인, 방법.
  12. 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5'UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5'UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;를 포함하는, PHA 생산용 미생물; 이를 배양한 배지; 또는 이들 중 2 이상의 조합을 포함하는 PHA 생산용 조성물.
  13. 서열번호 1의 염기서열에서 하나 이상의 염기가 변이된, 변이형 5'UTR을 코딩하는 변이형 폴리뉴클레오티드; 또는 포스포에놀피루브산 카복실화효소를 코딩하는 염기서열을 포함하는 변이형 폴리뉴클레오티드로, 상기 변이형 5'UTR을 코딩하는 염기서열을 추가로 포함하는 변이형 폴리뉴클레오티드;를 포함하는 미생물의 PHA 생산 용도.
PCT/KR2022/020937 2021-12-24 2022-12-21 포스포에놀피루브산 카복실화효소를 코딩하는 유전자의 5'utr 변이 서열 및 이의 용도 WO2023121282A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA3223003A CA3223003A1 (en) 2021-12-24 2022-12-21 5'utr variant sequence of gene encoding phosphoenolpyruvate carboxylase, and uses thereof
CN202280049518.7A CN117980475A (zh) 2021-12-24 2022-12-21 编码磷酸烯醇丙酮酸羧化酶的基因的5’utr变体序列及其用途
AU2022421911A AU2022421911A1 (en) 2021-12-24 2022-12-21 5'utr variant sequence of gene encoding phosphoenolpyruvate carboxylase, and uses thereof
EP22911915.1A EP4349981A1 (en) 2021-12-24 2022-12-21 5'utr variant sequence of gene encoding phosphoenolpyruvate carboxylase, and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0187237 2021-12-24
KR20210187237 2021-12-24

Publications (1)

Publication Number Publication Date
WO2023121282A1 true WO2023121282A1 (ko) 2023-06-29

Family

ID=86903051

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/020937 WO2023121282A1 (ko) 2021-12-24 2022-12-21 포스포에놀피루브산 카복실화효소를 코딩하는 유전자의 5'utr 변이 서열 및 이의 용도

Country Status (7)

Country Link
EP (1) EP4349981A1 (ko)
KR (1) KR20230098486A (ko)
CN (1) CN117980475A (ko)
AU (1) AU2022421911A1 (ko)
CA (1) CA3223003A1 (ko)
TW (1) TW202346595A (ko)
WO (1) WO2023121282A1 (ko)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010082176A (ko) * 1998-08-18 2001-08-29 올리버 피 피플즈 유전자 변형된 미생물의 폴리하이드록시알카노에이트 생성체
KR20110023703A (ko) * 2009-08-28 2011-03-08 씨제이제일제당 (주) Ｏ-아세틸-호모세린 생산 균주 및 이를 이용하여 ｏ-아세틸 호모세린을 생산하는 방법
US20140193868A1 (en) * 2005-08-09 2014-07-10 Julia Sabirova Extracellular polyhydroxyalkanoates produced by genetically engineered microorganisms
US10323261B2 (en) 2012-10-10 2019-06-18 Cj Cheiljedang Corporation Polyhydroxyalkanoate copolymer compositions and methods of making the same
US20200347417A1 (en) * 2012-03-29 2020-11-05 Newlight Technologies, Inc Polyhydroxyalkanoate production methods and materials and microorganisms used in same
WO2021085999A1 (ko) * 2019-10-28 2021-05-06 씨제이제일제당 (주) 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010082176A (ko) * 1998-08-18 2001-08-29 올리버 피 피플즈 유전자 변형된 미생물의 폴리하이드록시알카노에이트 생성체
US20140193868A1 (en) * 2005-08-09 2014-07-10 Julia Sabirova Extracellular polyhydroxyalkanoates produced by genetically engineered microorganisms
KR20110023703A (ko) * 2009-08-28 2011-03-08 씨제이제일제당 (주) Ｏ-아세틸-호모세린 생산 균주 및 이를 이용하여 ｏ-아세틸 호모세린을 생산하는 방법
US20200347417A1 (en) * 2012-03-29 2020-11-05 Newlight Technologies, Inc Polyhydroxyalkanoate production methods and materials and microorganisms used in same
US10323261B2 (en) 2012-10-10 2019-06-18 Cj Cheiljedang Corporation Polyhydroxyalkanoate copolymer compositions and methods of making the same
WO2021085999A1 (ko) * 2019-10-28 2021-05-06 씨제이제일제당 (주) 외래 metZ 유전자에 의해 코딩되는 단백질이 도입된 L-메티오닌 생산 미생물 및 이를 이용한 L-메티오닌 생산방법

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
ATSCHUL, S. F. ET AL., J MOLEC BIOL, vol. 215, 1990, pages 403
AUSUBEL, F. M. ET AL.: "Current Protocols in Molecular Biology", JOHN WILEY & SONS, INC.
CARILLO ET AL., SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET., vol. 16, 2000, pages 276 - 277, XP004200114, DOI: 10.1016/S0168-9525(00)02024-2
SAMBROOK, J. ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482

Also Published As

Publication number Publication date
AU2022421911A1 (en) 2024-01-25
EP4349981A1 (en) 2024-04-10
CA3223003A1 (en) 2023-06-29
KR20230098486A (ko) 2023-07-04
TW202346595A (zh) 2023-12-01
CN117980475A (zh) 2024-05-03

Similar Documents

Publication Publication Date Title
WO2022231368A1 (ko) 신규한 글루타메이트 합성 효소 서브 유니트 알파 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022225322A1 (ko) 신규한 f0f1 atp 합성효소 서브유닛 알파 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225319A1 (ko) 신규한 l-세린 암모니아 분해 효소 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163922A1 (ko) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163920A1 (ko) 신규한 시스테인 설피네이트 디설피나제 변이체 및 이를 이용한 l-발린 생산 방법
WO2023121282A1 (ko) 포스포에놀피루브산 카복실화효소를 코딩하는 유전자의 5'utr 변이 서열 및 이의 용도
WO2022154181A1 (ko) 신규한 1,4-알파-글루칸-분지 효소 변이체 및 이를 이용한 imp 생산 방법
WO2022225320A1 (ko) 신규한 포스포글리세린산 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225321A1 (ko) 신규한 f0f1 atp 합성효소 서브유닛 감마 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022215800A1 (ko) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022158645A1 (ko) 신규한 데옥시구아노신트리포스페이트 트리포스포하이드로레이즈 변이체 및 이를 이용한 l-트립토판 생산 방법
WO2022163930A1 (ko) 신규한 2-숙시닐-5-엔도피루빌-6-하이드록시-3-사이클로헥센-1-카복실레이트 신타아제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163926A1 (ko) 신규한 프롤린 탈수소효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163929A1 (ko) 신규한 펩티딜-디펩티다제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163921A1 (ko) 신규한 스퍼미딘 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163924A1 (ko) 신규한 5,10-메틸렌테트라하이드로폴레이트 리덕타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163925A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154188A1 (ko) 신규한 폴리케타이드 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163932A1 (ko) 신규한 알데하이드 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154189A1 (ko) 신규한 피토엔 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154192A1 (ko) 신규한 알데하이드 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163919A1 (ko) 신규한 우레아제 부속 단백질 변이체 및 이를 이용한 l-발린 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22911915

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 3223003

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2022421911

Country of ref document: AU

Ref document number: AU2022421911

Country of ref document: AU

Ref document number: 806825

Country of ref document: NZ

ENP Entry into the national phase

Ref document number: 2023579637

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2022911915

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 202280049518.7

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2022911915

Country of ref document: EP

Effective date: 20240105

ENP Entry into the national phase

Ref document number: 2022421911

Country of ref document: AU

Date of ref document: 20221221

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2401001073

Country of ref document: TH