WO2022164118A1 - 프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법 - Google Patents

프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법 Download PDF

Info

Publication number
WO2022164118A1
WO2022164118A1 PCT/KR2022/000984 KR2022000984W WO2022164118A1 WO 2022164118 A1 WO2022164118 A1 WO 2022164118A1 KR 2022000984 W KR2022000984 W KR 2022000984W WO 2022164118 A1 WO2022164118 A1 WO 2022164118A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
strain
seq
sequence
present application
Prior art date
Application number
PCT/KR2022/000984
Other languages
English (en)
French (fr)
Inventor
이하윤
김주은
이지혜
김경림
이희석
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to MX2023009027A priority Critical patent/MX2023009027A/es
Priority to AU2022211934A priority patent/AU2022211934A1/en
Priority to CA3206397A priority patent/CA3206397A1/en
Priority to EP22746145.6A priority patent/EP4303301A1/en
Priority to CN202280012955.1A priority patent/CN116917473A/zh
Priority to JP2023545938A priority patent/JP2024506841A/ja
Publication of WO2022164118A1 publication Critical patent/WO2022164118A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C12Y402/01051—Prephenate dehydratase (4.2.1.51)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • the present application relates to a variant of prephenate dehydratase and a method for producing branched-chain amino acids using the same.
  • L-amino acid is a basic structural unit of protein and is used as an important material for pharmaceutical raw materials, food additives, animal feed, nutrients, pesticides, and disinfectants. Therefore, the industrial production of amino acids has become an economically important industrial process.
  • Branched-chain amino acids refer to three types of valine, leucine, and isoleucine, and are known to be mainly metabolized in muscles and used as an energy source during activity. As it is known that branched-chain amino acids play an important role in maintaining and increasing muscle during activity, its usage is increasing.
  • Another object of the present application is to provide a polynucleotide encoding the variant and a vector comprising the same.
  • Another object of the present application is to provide a microorganism of the genus Corynebacterium comprising at least one of the above variants, polynucleotides and vectors.
  • Another object of the present application is to provide a method for producing branched-chain amino acids, comprising the step of culturing the microorganism in a medium.
  • One aspect of the present application provides a prephenate dehydratase variant in which the amino acid corresponding to position 182 from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
  • the prephenate dehydratase variant is an amino acid different from the amino acid at position 182 from the N-terminus of the prephenate dehydratase of SEQ ID NO: 1 in the polypeptide or prephenate dehydratase having prephenate dehydratase activity means a variant substituted with .
  • prephenate dehydratase is an enzyme capable of catalyzing the following reaction.
  • the prephenate dehydratase of the present application may be a polypeptide having prephenate dehydratase activity or a prephenate dehydratase that is modified to prepare the prephenate dehydratase variant provided in the present application. Specifically, it may be a naturally occurring polypeptide or wild-type polypeptide, may be a mature polypeptide thereof, may include a mutant or functional fragment thereof, but may be a parent of the prephenate dehydratase mutant of the present application included without limitation.
  • the prephenate dehydratase may be, but is not limited to, the polypeptide of SEQ ID NO: 1. In one embodiment, about 60%, 70%, 75% of the polypeptide of SEQ ID NO: 1. 80%. It may be a polypeptide having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity, and is limited if it has the same or corresponding activity to the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 Without prephenate dehydratase is included in the scope.
  • the sequence of the prephenate dehydratase of the present application can be obtained from GenBank of NCBI, which is a known database. Specifically, it may be a polypeptide encoded by the pheA gene, but is not limited thereto.
  • variant refers to a polypeptide in which one or more amino acids are conservatively substituted and/or modified to be different from the amino acid sequence before mutation of the variant, but functions or properties are maintained. refers to Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation.
  • some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, have been removed.
  • Other variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein.
  • variant may be used interchangeably with terms such as mutant, modified, mutant polypeptide, mutated protein, mutant and mutant (in English, modified, modified polypeptide, modified protein, mutant, mutein, divergent, etc.) and, as long as it is a term used in a mutated sense, it is not limited thereto.
  • variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide.
  • a signal (or leader) sequence involved in protein translocation may be conjugated to the N-terminus of the mutant, either co-translationally or post-translationally.
  • the variants may also be conjugated with other sequences or linkers for identification, purification, or synthesis.
  • the variant provided in the present application may be a prephenate dehydratase variant in which the amino acid corresponding to position 182 from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
  • it is not limited thereto.
  • amino acid corresponding to position 182 from the N-terminus in the amino acid sequence of SEQ ID NO: 1 may be arginine.
  • the variant provided in the present application may include, but is not limited to, an amino acid corresponding to position 182 from the N-terminus in the amino acid sequence of SEQ ID NO: 1 with an amino acid other than arginine.
  • the "other amino acid” is not limited as long as it is an amino acid different from the amino acid before the substitution and the amino acid before the substitution.
  • the amino acid when it is expressed that 'a specific amino acid is substituted', it is obvious that the amino acid is substituted with an amino acid different from the amino acid before the substitution, even if it is not separately indicated that it is substituted with another amino acid.
  • the amino acid corresponding to position 182 in the amino acid sequence of SEQ ID NO: 1, which is a reference protein, is substituted with an amino acid different from the amino acid before the substitution among hydrophobic amino acids or aliphatic amino acids may be a mutant.
  • the variant may be a variant in which the amino acid corresponding to position 182 in the amino acid sequence of SEQ ID NO: 1 is substituted with one of a hydrophobic (non-polar) amino acid or an aliphatic amino acid.
  • the aliphatic amino acid may be, for example, an amino acid selected from the group consisting of glycine, alanine, valine, leucine, and isoleucine, but is not limited thereto.
  • the hydrophobic (non-polar) amino acid may be, for example, an amino acid selected from the group consisting of glycine, methionine, alanine, valine, leucine, isoleucine, proline, phenylalanine, tyrosine, and tryptophan, but is not limited thereto.
  • the variant of the present application may be a variant in which the amino acid corresponding to position 182 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid different from the amino acid before the substitution among amino acids having a small size, but is not limited thereto .
  • small amino acid includes glycine, alanine, serine, threonine, cysteine, valine, leucine, isoleucine, proline, and asparagine, which are relatively small amino acids among 20 amino acids, specifically It may mean glycine, alanine, serine, threonine, cysteine, valine, leucine, isoleucine and proline, but is not limited thereto, and more specifically, glycine, alanine, valine, leucine, isoleucine, serine, and threonine. and may refer to, for example, alanine, serine, and glycine, but is not limited thereto.
  • substitution with another amino acid in the variant of the present application may be a substitution with alanine, but is not limited thereto.
  • corresponding to refers to an amino acid residue at a listed position in a polypeptide, or to an amino acid residue that is similar, identical or homologous to a listed residue in a polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that refers to a specific sequence.
  • corresponding region generally refers to a similar or corresponding position in a related protein or reference protein.
  • any amino acid sequence is aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1.
  • a sequence alignment algorithm such as that described in this application can identify the position of an amino acid, or a position at which modifications, such as substitutions, insertions, or deletions, occur compared to a query sequence (also referred to as a "reference sequence").
  • Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277), etc., but is not limited thereto, and a sequence alignment program known in the art, a pairwise sequence comparison algorithm, etc. may be appropriately used.
  • the variant of the present application has about 60%, 70%, 75% of the polypeptide of SEQ ID NO: 1. 80%. It may have 85%, 90%, 95%, 96%, 97%, 98% or 99% or more sequence identity, and the amino acid corresponding to position 182 of SEQ ID NO: 1 may be substituted with another amino acid.
  • the variant of the present application has an amino acid sequence set forth in SEQ ID NO: 5 and at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5 %, 99.7%, or 99.9% or more of an amino acid sequence having homology or identity.
  • the variant of the present application may have, include, or consist of the amino acid sequence set forth in SEQ ID NO: 5, or essentially consist of the amino acid sequence.
  • the amino acid corresponding to position 182 based on the amino acid sequence of SEQ ID NO: 1 is alanine, and at least 70%, 75%, 80%, 85 with the amino acid sequence set forth in SEQ ID NO: 5 %, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or an amino acid sequence having at least 99.9% homology or identity.
  • variants having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added are also included within the scope of the present application. is self-evident
  • sequence additions or deletions naturally occurring mutations, silent mutations or conservation within the N-terminus, C-terminus and/or within the amino acid sequence that do not alter the function of the variants of the present application It is a case of having an enemy substitution.
  • conservative substitution means substituting an amino acid for another amino acid having similar structural and/or chemical properties. Such amino acid substitutions may generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of a sequence under moderate or high stringent conditions. It is apparent that hybridization also includes hybridization with polynucleotides containing common codons or codons taking codon degeneracy into account in the polynucleotide.
  • a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap open penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • the variant of the present application may have prephenate dehydratase activity.
  • the mutant of the present application may have an activity to increase the production of branched chain amino acids compared to the wild-type or unmutated prephenate dehydratase.
  • the mutant of the present application may have an activity to reduce the production level of by-products of the branched chain amino acid production pathway, compared to the wild-type or unmutated prephenate dehydratase.
  • the mutant of the present application may have a weakened activity compared to the wild-type or unmutated prephenate dehydratase.
  • Another aspect of the present application provides a polynucleotide encoding a variant of the present application.
  • polynucleotide refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are linked in a long chain by covalent bonds, and more specifically, encoding the variant. polynucleotide fragments.
  • the polynucleotide encoding the variant of the present application may include a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 5.
  • the polynucleotide of the present application may have or include the sequence of SEQ ID NO: 6.
  • the polynucleotide of the present application may consist of, or consist essentially of, the sequence of SEQ ID NO: 6.
  • the polynucleotides of the present application are various in the coding region within the range that does not change the amino acid sequence of the variants of the present application. Deformation can be made.
  • the polynucleotide of the present application has 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more homology or identity to the sequence of SEQ ID NO: 6 It has or contains a nucleotide sequence that is more than, 98% or more, and less than 100%, or has 70% or more, 75% or more, 80% or more, 85% or more, 90% or more of homology or identity with the sequence of SEQ ID NO: 6, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% of the nucleotide sequence may consist of or consist essentially of, but is not limited thereto.
  • the codon encoding the amino acid corresponding to position 182 of SEQ ID NO: 6 may be one of the codons encoding alanine.
  • the polynucleotide of the present application is a probe that can be prepared from a known gene sequence, for example, a sequence that can hybridize under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application, without limitation. may be included.
  • the "stringent condition” means a condition that enables specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • polynucleotides with high homology or identity 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or a condition in which polynucleotides having 99% or more homology or identity hybridize with each other and polynucleotides with lower homology or identity do not hybridize, or a washing condition of conventional Southern hybridization at 60°C, 1 ⁇ SSC, 0.1% SDS, specifically 60° C., 0.1 ⁇ SSC, 0.1% SDS, more specifically 68° C., 0.1 ⁇ SSC, 0.1% SDS at a salt concentration and temperature equivalent to one wash, specifically two to three times conditions can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other.
  • adenine is complementary to thymine
  • cytosine is complementary to guanine.
  • the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the overall sequence.
  • a polynucleotide having homology or identity to the polynucleotide of the present application can be detected using the hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60 °C, 63 °C, or 65 °C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • the appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (eg, J. Sambrook et al., supra).
  • Another aspect of the present application is to provide a vector comprising the polynucleotide of the present application.
  • the vector may be an expression vector for expressing the polynucleotide in a host cell, but is not limited thereto.
  • the "vector" of the present application refers to a DNA preparation comprising the nucleotide sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable expression control region (or expression control sequence) so that the target polypeptide can be expressed in a suitable host.
  • a suitable expression control region or expression control sequence
  • the expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the vector After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as a phage vector or a cosmid vector
  • pDC-based, pBR-based, and pUC-based plasmid vectors may be used.
  • pBluescript II-based pGEM-based, pTZ-based, pCL-based, pET-based and the like
  • pDC pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like
  • pDC pDCM2
  • pACYC177 pACYC184
  • pCL pECCG117
  • pUC19 pBR322
  • pMW118 pCC1BAC vectors and the like
  • a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion.
  • the insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted.
  • the selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. Markers to be given can be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
  • the term "transformation” refers to introducing a vector including a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell.
  • the polynucleotide includes DNA and/or RNA encoding a target polypeptide.
  • the polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the target variant of the present application and the polynucleotide sequence are functionally linked.
  • Another aspect of the present application provides a microorganism of the genus Corynebacterium comprising the variant of the present application, the polynucleotide of the present application, and the vector of the present application.
  • the microorganism of the present application may include a vector comprising the mutant polypeptide of the present application, a polynucleotide encoding the polypeptide, or the polynucleotide of the present application.
  • microorganism or “strain” includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially. As a result of which a specific mechanism is weakened or enhanced, it may be a microorganism including genetic modification for the production of a desired polypeptide, protein or product.
  • the strain of the present application includes a strain comprising any one or more of a mutant of the present application, a polynucleotide of the present application, and a vector including the polynucleotide of the present application; a strain modified to express a variant of the present application or a polynucleotide of the present application; a variant of the present application, or a strain expressing the polynucleotide of the present application (eg, a recombinant strain); Or it may be a strain having the mutant activity of the present application (eg, a recombinant strain), but is not limited thereto.
  • the strain of the present application may be a strain having branched chain amino acid production ability.
  • the strain of the present application is a mutant of the present application or a polynucleotide ( Alternatively, the vector including the polynucleotide) may be introduced and/or a microorganism to which branched chain amino acid production ability is imparted, but is not limited thereto.
  • the strain of the present application is transformed with a vector containing the polynucleotide of the present application or a polynucleotide encoding the variant of the present application, and expresses the variant of the present application as a cell or microorganism
  • the strains of the application may include all microorganisms capable of producing branched chain amino acids, including the variants of the present application.
  • the polynucleotide encoding the variant of the present application is introduced into a natural wild-type microorganism or a microorganism producing branched-chain amino acids, thereby expressing the prephenate dehydratase variant, thereby increasing branched-chain amino acid production capacity.
  • the recombinant strain having increased branched-chain amino acid production capacity is a microorganism having increased branched-chain amino acid production capacity compared to a native wild-type microorganism or a prephenate dehydratase unmodified microorganism (ie, a microorganism expressing a wild-type prephenate dehydratase).
  • a native wild-type microorganism or a prephenate dehydratase unmodified microorganism ie, a microorganism expressing a wild-type prephenate dehydratase.
  • a prephenate dehydratase unmodified microorganism ie, a microorganism expressing a wild-type prephenate dehydratase
  • the prephenate dehydratase unmodified microorganism which is the target strain for comparing whether the branched chain amino acid production capacity is increased
  • the prephenate dehydratase non-modified microorganism which is the target strain for comparing whether the branched chain amino acid production capacity is increased, may be CJL-8109, KCCM12739P (CA10-3101), or KCCM11201P, but is not limited thereto.
  • the recombinant strain may be about 1% or more, specifically about 3%, about 5% or more higher than the branched chain amino acid production capacity of the parent strain or unmodified microorganism before mutation, but the parent strain or unmodified microorganism before mutation. It is not limited thereto as long as it has an increased amount of + value compared to the production capacity of the microorganism.
  • the production of by-products generated in the branched chain amino acid production pathway is about 50% or less, specifically about 30% or less, about 10% or less compared to the parent strain or unmodified microorganism before mutation. There may be, or by-products may not be produced, but is not limited thereto.
  • branched chain amino acid refers to an amino acid having a branched alkyl group in the side chain, and includes valine, leucine and isoleucine.
  • the branched chain amino acid may be an L-branched chain amino acid, and the L-branched chain amino acid may be one or more selected from L-valine, L-leucine and L-isoleucine, but is limited thereto. not.
  • the by-products generated in the branched chain amino acid production pathway refer to substances other than branched chain amino acids, and specifically, aromatic amino acids, more specifically L-tyrosine and L-phenylalanine, may be one or more selected from have. However, it is not limited thereto.
  • the term "unmodified microorganism” does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a wild-type strain or a natural-type strain itself, or a genetic variation caused by natural or artificial factors. It may mean the strain before being changed.
  • the unmodified microorganism may refer to a strain in which the prephenate dehydratase variant of the present application is not introduced or before it is introduced.
  • the "unmodified microorganism” may be used interchangeably with "strain before modification", “microbe before modification”, “unmodified strain”, “unmodified strain”, "unmodified microorganism” or "reference microorganism”.
  • the microorganism of the present application is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium stationis ( Corynebacterium stationis ), Corynebacterium crudilactis ( Corynebacterium crudilactis ), Corynebacterium Deserti ( Corynebacterium deserti ), Corynebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium callunae , Corynebacterium singulare , Corynebacterium singulare , Corynebacterium halotolerans ( Corynebacterium halotolerans , Corynebacterium striatum , Corynebacterium ammoniagenes , Corynebacterium pollutisoli , Corynebacterium imitans, Corynebacterium imitans It may be Corynebacterium testudinoris or Coryne
  • the microorganism of the present application may further include a mutation to increase the branched chain amino acid production capacity.
  • the microorganism of the present application comprises altering the activity of one or more of isopropylmalate synthase, homoserine dehydrogenase, threonine dehydratase, branched-chain amino acid aminotransferase, and citrate synthase can do.
  • the microorganism of the present application is isopropylmalate synthase, homoserine dehydrogenase, branched amino acid aminotransferase and threonine dehi It may be a microorganism in which the activity of one or more of threonine dehydratase is further enhanced.
  • the present invention is not limited thereto, and a person skilled in the art may appropriately select additional modifications included in the microorganism according to the branched chain amino acid to be produced.
  • the term "enhancement" of a polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity.
  • the reinforcement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.
  • activation, enhancement, up-regulation, overexpression, and increase may include all of those exhibiting an activity that was not originally possessed, or exhibiting an improved activity compared to an intrinsic activity or an activity prior to modification.
  • the "intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before the transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification”.
  • Enhancement means the activity and/or concentration (expression) of a specific polypeptide originally possessed by the parent strain or unmodified microorganism prior to transformation. amount), which means improved.
  • the enrichment can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and/or concentration (expression amount) of the endogenous polypeptide. Whether or not the activity of the polypeptide is enhanced can be confirmed from the increase in the level of activity, expression level, or the amount of product excreted from the polypeptide.
  • the enhancement of the activity of the polypeptide can be applied by various methods well known in the art, and is not limited as long as it can enhance the activity of the target polypeptide compared to the microorganism before modification. Specifically, it may be one using genetic engineering and/or protein engineering well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (eg, Sitnicka et al. Functional Analysis of Genes. Advances in Cell). Biology 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • modification of the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide eg, modification of the polynucleotide sequence of the polypeptide gene to encode a polypeptide that has been modified to enhance the activity of the polypeptide;
  • the increase in the intracellular copy number of the polynucleotide encoding the polypeptide is achieved by introduction into the host cell of a vector to which the polynucleotide encoding the polypeptide is operably linked, which can replicate and function independently of the host it may be Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into a chromosome in a host cell.
  • the introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome in the host cell into the host cell, but is not limited thereto.
  • the vector is the same as described above.
  • Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence with strong activity is, for example, deletion, insertion, non-conservative or Conservative substitution or a combination thereof may result in a mutation in the sequence, or replacement with a sequence having a stronger activity.
  • the expression control region is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling the termination of transcription and translation.
  • the original promoter may be replaced with a strong promoter, but is not limited thereto.
  • Examples of known strong promoters include cj1 to cj7 promoter (US Pat. No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, etc., but is not limited thereto.
  • Modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a nucleotide sequence encoding another start codon having a higher expression rate of the polypeptide compared to the intrinsic start codon. It may be a substitution, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may include deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide;
  • a combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto.
  • the replacement may be specifically performed by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
  • the vector used may further include a selection marker for confirming whether or not the chromosome is inserted.
  • the selection marker is the same as described above.
  • the introduction of the foreign polynucleotide exhibiting the activity of the polypeptide may be the introduction of the foreign polynucleotide encoding the polypeptide exhibiting the same/similar activity as the polypeptide into a host cell.
  • the foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same/similar activity as the polypeptide.
  • the method used for the introduction can be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to generate a polypeptide and increase its activity.
  • Codon optimization of the polynucleotide encoding the polypeptide is codon-optimized so that the transcription or translation of the endogenous polynucleotide is increased in the host cell, or the transcription and translation of the foreign polynucleotide is optimized in the host cell. It may be that its codons are optimized so that the
  • Selecting an exposed site by analyzing the tertiary structure of the polypeptide and modifying or chemically modifying it is, for example, by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored to determine the degree of sequence similarity. Accordingly, it may be to determine a template protein candidate, check the structure based on this, and select an exposed site to be modified or chemically modified and modified or modified.
  • Such enhancement of the polypeptide activity is that the activity or concentration of the corresponding polypeptide is increased based on the activity or concentration of the polypeptide expressed in the wild-type or pre-modified microbial strain, or the amount of product produced from the polypeptide is increased.
  • the activity or concentration of the corresponding polypeptide is increased based on the activity or concentration of the polypeptide expressed in the wild-type or pre-modified microbial strain, or the amount of product produced from the polypeptide is increased.
  • it is not limited thereto.
  • Part or all of the polynucleotide in the microorganism of the present application is modified by (a) homologous recombination using a vector for chromosome insertion in the microorganism or genome editing using engineered nuclease (e.g., CRISPR-Cas9) and/or (b) It may be induced by light and/or chemical treatments such as, but not limited to, ultraviolet and radiation.
  • the method for modifying part or all of the gene may include a method by DNA recombination technology.
  • a part or all of the gene may be deleted.
  • the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
  • the term “attenuation” of polypeptide activity is a concept that includes both reduced or no activity compared to intrinsic activity.
  • the attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, attenuation, and the like.
  • the attenuation is when the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism due to mutation of the polynucleotide encoding the polypeptide, etc.
  • the overall polypeptide activity level and/or concentration (expression amount) in the cell is lower than that of the native strain due to (translation) inhibition, etc., when the expression of the polynucleotide is not made at all, and/or when the expression of the polynucleotide is Even if there is no activity of the polypeptide, it may also be included.
  • the "intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification”. "Inactivation, deficiency, reduction, downregulation, reduction, attenuation” of the activity of the polypeptide compared to the intrinsic activity means that the activity of the specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation is lowered.
  • Attenuation of the activity of such a polypeptide may be performed by any method known in the art, but is not limited thereto, and may be achieved by application of various methods well known in the art (eg, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
  • the attenuation of the polypeptide of the present application is
  • an antisense oligonucleotide eg, antisense RNA
  • an antisense oligonucleotide that complementarily binds to the transcript of said gene encoding the polypeptide
  • deletion of a part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide in which some nucleotides are deleted, or replacement with a marker gene.
  • the modification of the expression control region (or expression control sequence), deletion, insertion, non-conservative or conservative substitution, or a combination thereof, mutation in the expression control region (or expression control sequence) occurs, or weaker replacement with an active sequence.
  • the expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the base sequence modification encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a base encoding another start codon having a lower polypeptide expression rate than the intrinsic start codon It may be substituted with a sequence, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above is a deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide.
  • a combination thereof may result in a mutation in sequence, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto.
  • the expression of a gene may be inhibited or attenuated, but is not limited thereto.
  • antisense oligonucleotide eg, antisense RNA
  • antisense RNA an antisense oligonucleotide that complementarily binds to the transcript of the gene encoding the polypeptide
  • Weintraub, H. et al. Antisense-RNA as a molecular tool. for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
  • RTE reverse transcription engineering
  • variants, polynucleotides, vectors and branched chain amino acids are as described in other aspects.
  • Another aspect of the present application provides a method for producing branched-chain amino acids, comprising the step of culturing the microorganism of the genus Corynebacterium of the present application in a medium.
  • the term "cultivation” means growing the microorganisms of the genus Corynebacterium of the present application in appropriately controlled environmental conditions.
  • the culture process of the present application may be made according to a suitable medium and culture conditions known in the art. Such a culturing process can be easily adjusted and used by those skilled in the art according to the selected strain.
  • the culture may be a batch, continuous, and/or fed-batch, but is not limited thereto.
  • the term "medium” refers to a material in which nutrients required for culturing the microorganism of the genus Corynebacterium of the present application are mixed as a main component, and includes water essential for survival and development, as well as nutrients and development supplies, etc.
  • any medium and other culture conditions used for culturing the microorganisms of the genus Corynebacterium of the present application may be used without particular limitation as long as they are media used for culturing conventional microorganisms, but the genus Corynebacterium of the present application
  • the microorganisms can be cultured in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid and/or vitamin, etc. under aerobic conditions while controlling temperature, pH, and the like.
  • the culture medium for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology” by the American Society for Bacteriology (Washington D.C., USA, 1981)].
  • the carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, and the like; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine
  • organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract
  • the phosphorus may include potassium monobasic phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto.
  • potassium monobasic phosphate dipotassium phosphate
  • sodium-containing salt corresponding thereto.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, the present invention is not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium.
  • an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without injection of gas or without injection of gas to maintain anaerobic and microaerobic conditions, which are limited thereto it is not
  • the culture temperature may be maintained at 20 to 45° C., specifically, 25 to 40° C., and may be cultured for about 10 to 160 hours, but is not limited thereto.
  • the branched chain amino acids produced by the culture of the present application may be secreted into the medium or remain in the cells.
  • the branched chain amino acid production method of the present application includes the steps of preparing the microorganism of the genus Corynebacterium of the present application, preparing a medium for culturing the strain, or a combination thereof (regardless of the order, in any order) , for example, prior to the culturing step, may further include.
  • the method for producing branched-chain amino acids of the present application may further include recovering branched-chain amino acids from the culture medium (the culture medium) or the microorganism of the genus Corynebacterium of the present application.
  • the recovering step may be further included after the culturing step.
  • the recovery may be to collect the desired branched chain amino acids using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method, etc. .
  • a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method, etc. .
  • chromatography such as island chromatography, HPLC, or a combination thereof may be used, and a desired branched-chain amino acid may be recovered from a medium or a microorganism using a suitable method known in the art.
  • the method for producing branched chain amino acids of the present application may additionally include a purification step.
  • the purification may be performed using a suitable method known in the art.
  • the recovery step and the purification step are performed concurrently (or sequentially) regardless of the order, or simultaneously or in one step may be integrated and performed, but is not limited thereto.
  • Another aspect of the present application is a microorganism of the genus Corynebacterium comprising a variant of the present application, a polynucleotide encoding the variant, a vector including the polynucleotide or the polynucleotide of the present application; the culture medium; Or to provide a composition for producing branched chain amino acids comprising a combination of two or more of them.
  • composition of the present application may further include any suitable excipients commonly used in compositions for the production of branched chain amino acids, and these excipients include, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents. and the like, but is not limited thereto.
  • composition of the present application variants, polynucleotides, vectors, strains, media and branched chain amino acids are the same as those described in the other aspects above.
  • Another aspect of the present application is the prephenate dehydratase variant of the present application; a polynucleotide encoding the prephenate dehydratase variant; And it provides a use of a microorganism comprising at least one of the vectors comprising the polynucleotide, for producing branched chain amino acids.
  • Example 1-1 Construction of vectors containing pheA
  • a recombinant vector containing pheA was first prepared.
  • SEQ ID NO: 2 encoding the pheA protein (SEQ ID NO: 1, Uniprot ID: P10341) derived from subtype Corynebacterium glutamicum , Corynebacterium glutamicum ( Corynebacterium glutamicum )
  • SEQ ID NO: 3 chromosome of ATCC13032 wild strain
  • binding at 58°C for 30 seconds binding at 58°C for 30 seconds
  • polymerization with Pfu DNA polymerase at 72°C for 1 minute 25 times Repeat PCR method was performed.
  • the specific sequences of the primers used are shown in Table 1.
  • the amplification product was cloned into E. coli vector pCR2.1 using TOPO Cloning Kit (Invitrogen)
  • Example 1-2 pheA mutation library construction
  • a pheA mutation library was prepared using an error-prone PCR kit (clontech Diversify® PCR Random Mutagenesis Kit).
  • a PCR reaction was performed using SEQ ID NO: 3 and SEQ ID NO: 4 as primers under conditions in which 0 to 3 mutations per 1000 bp could occur. Specifically, after pre-heating at 94°C for 30 seconds, PCR reaction was performed by repeating the process of 94°C for 30 seconds and 68°C for 1 minute and 30 seconds 25 times (cycle).
  • the PCR product obtained at this time was used as a megaprimer (50 ⁇ 125ng) and the process was repeated 25 times for 50 seconds at 95°C, 50 seconds at 60°C, and 12 minutes at 68°C, followed by DpnI treatment, heat shock method to Escherichia coli DH5 ⁇ Transformed through LB and smeared on LB solid medium containing kanamycin (25 mg/L). After selecting 20 transformed colonies, plasmids were obtained and nucleotide sequences were analyzed. As a result, it was confirmed that mutations were introduced at different positions with a frequency of 2 mutations/kb. About 20,000 transformed E. coli colonies were taken and plasmids were extracted, and this was named 'pTOPO-pheA-library'.
  • Example 2-1 Selection of mutant strains with increased and reduced L-leucine and L-phenylalanine production
  • Fermentation potency was evaluated in the following manner for each colony in order to identify colonies in which L-leucine production was increased and L-phenylalanine production among aromatic amino acids was increased and decreased among the 10,000 secured colonies.
  • Badge type ingredient production medium Glucose 100g, (NH 4 ) 2 SO 4 40g, Soy Protein 2.5g, Corn Steep Solids 5g, Urea 3g, KH 2 PO 4 1g, MgSO 4 7H 2 O 0.5g, Biotin 100 ⁇ g, thiamine hydrochloride 1,000 ⁇ g, calcium-pantothenic acid 2000 ⁇ g, nicotinamide 3,000 ⁇ g, CaCO 3 30g; (based on 1 liter of distilled water), pH 7.0 nutrient medium Glucose 10g, broth 5g, polypeptone 10g, sodium chloride 2.5g, yeast extract 5g, agar 20g, urea 2g (based on 1 liter of distilled water)
  • Each colony was inoculated into a 250 ml corner-barpool flask containing 25 ug/ml kanamycin in 25 ml of autoclaved production medium (Table 2) using a platinum tooth, and then shaken at 30 ° C. for 60 hours at 200 rpm. cultured. After the end of the culture, L-leucine and L-phenylalanine among aromatic amino acids were measured by a method using high-performance liquid chromatography (HPLC, SHIMAZDU LC20A).
  • Corynebacterium glutamicum ATCC13032/pTOPO_pheA(mt)3891 having a mutation in the pheA gene improved L-leucine production by about 1.4 times compared to the parent strain, and L-phenylalanine by about 7 times It was confirmed that it was reduced.
  • Example 2-2 Increased L-leucine and L-phenylalanine production and confirmed mutations in reduced strains
  • Example 3-1 Construction of an insertion vector containing pheA mutations
  • an insertion vector was prepared.
  • a site directed mutagenesis method was used to construct a vector for introducing pheA(R182A) mutations.
  • primers of SEQ ID NOs: 7 and 8 and primer pairs of SEQ ID NOs: 9 and 10 were used and PCR was performed. Specifically, after denaturation at 94°C for 5 minutes, PCR was performed at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds 30 times, and then at 72°C for 5 minutes.
  • the specific sequences of the primers used are shown in Table 4.
  • the resultant PCR product was cloned by fusion of the homologous sequence of the terminal 15 base between the DNA fragments using the linear pDCM2 vector (Korean Patent Publication KR 10-2020-0136813 A) cut with SmaI restriction enzyme and the In-Fusion enzyme to clone pheA
  • a vector 'pDCM2-pheA(R182A)' was constructed in which amino acid 182 of the was replaced with alanine.
  • Flask fermentation titer was evaluated to evaluate the production capacity of the three strains L-leucine and aromatic amino acids prepared above.
  • Each of the parent strain Corynebacterium glutamicum ATCC13032 and the prepared ATCC13032_pheA_R182A were inoculated with 1 platinum in a 250 ml corner-barpool flask containing 25 ml of each production medium, and then at 30 ° C. for 60 hours at 200 rpm.
  • L-leucine was produced by shaking culture. After completion of the culture, the production of L-leucine, L-tyrosine and L-phenylalanine was measured by HPLC. The leucine concentration in the culture medium for each strain tested is shown in Table 5 below.
  • ATCC13032_pheA_R182A was confirmed that the yield of L- leucine was improved by about 1.5 times compared to the parent strain, Corynebacterium glutamicum ATCC13032.
  • ATCC13032_pheA_R182A decreased L-phenylalanine about 8 times.
  • Example 4 Confirmation of leucine and phenylalanine-producing ability of pheA selection mutants in leucine-producing strains
  • Example 4-1 Production of L-leucine producing strain CJL-8109
  • the pDCM2-leuA (P247C, R558H, G561D) vector containing the leuA gene mutation was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and a medium containing 25 mg/L of kanamycin A strain in which the vector was inserted into the chromosome was selected by recombination of the homologous sequence in The selected primary strain was again subjected to secondary cross-over, and a strain into which the leuA gene mutation was introduced was selected. Finally, whether or not the mutation of the transformed strain was introduced was determined by PCR using the primers of SEQ ID NO.
  • the ATCC13032_leuA_(P247C, R558H, G561D) strain transformed with the pDCM2-leuA(P247C, R558H, G561D) vector was named 'CJL-8105'.
  • a strain in which the ilvE mutant (V156A), a gene encoding branched-chain amino acid aminotransferase, was introduced was prepared.
  • the pDCM2-ilvE (V156A) vector containing the above ilvE gene mutation was transformed into Corynebacterium glutamicum CJL-8105 by electroporation and phased in a medium containing 25 mg/L of kanamycin.
  • a strain in which the vector was inserted into the chromosome by recombination of the homologous sequence was selected.
  • the selected primary strain was again subjected to secondary cross-over, and a strain into which the mutation of the ilvE gene was introduced was selected. Finally, whether the transformation of the transformed strain was introduced by PCR (94 ° C 5 minutes, 94 ° C 30 seconds / 55 ° C 30 seconds / 72 ° C 90 seconds 30 times using the primers of SEQ ID NO: 13 and SEQ ID NO: 14 in Table 7) Repeat, 72 ° C. 5 min) was performed and the nucleotide sequence was analyzed to confirm that the V156A mutation was introduced.
  • the strain transformed with the pDCM2-ilvE (V156A) vector was named 'CJL-8108'.
  • a strain in which the gltA mutant (M312I; SEQ ID NO: 25) with weakened citrate synthase activity was introduced was prepared.
  • the pDCM2-gltA (M312I) vector containing the above gltA gene mutation was transformed into Corynebacterium glutamicum CJL-8108 by electroporation, and the phase was grown in a medium containing 25 mg/L of kanamycin.
  • a strain in which the vector was inserted into the chromosome by recombination of the homologous sequence was selected.
  • the selected primary strain was again subjected to secondary cross-over, and a strain into which the gltA gene mutation was introduced was selected. Finally, whether the transformation of the transformed strain was introduced was determined by PCR using the primers of SEQ ID NO: 15 and SEQ ID NO: 16 in Table 8 (after 94 °C 5 min, 94 °C 30 sec/55 °C 30 sec/72 °C 90 sec 30 times Repeat, 72°C for 5 minutes) and nucleotide sequence analysis to confirm that the M312I mutation was introduced.
  • the strain transformed with the pDCM2-gltA(M312I) vector was named 'CJL-8109'.
  • the strain CJL-8109 a leucine-producing strain, was transformed with the pDCM2-pheA (R182A) vector prepared in Example 3-1, and the vector was inserted into the chromosome by recombination of the homologous sequence, containing 25 mg/L of kanamycin. Selected in one medium. The selected primary strain was again subjected to secondary cross-over, and a strain into which the mutation of the target gene was introduced was selected. Finally, the introduction of the pheA gene mutation into the transformed strain was confirmed by performing PCR using the primers of SEQ ID NO: 3 and SEQ ID NO: 4 and then analyzing the nucleotide sequence to confirm that the pheA mutation was introduced into the strain.
  • CJL8109_pheA_R182A was named CA13-8116, and it was deposited with the Korea Center for Conservation of Microorganisms (KCCM), an international depository under the Budapest Treaty, as of January 22, 2021, and was given the deposit number KCCM12943P.
  • KCCM Korea Center for Conservation of Microorganisms
  • Flask culture was carried out in the same manner as in Example 2, and leucine production was measured by a method using HPLC after completion of the culture, and the culture results are shown in Table 9 below.
  • the L-leucine-producing strain Corynebacterium glutamicum CA13-8116 having additional R182A mutation in the pheA gene produced L-leucine compared to the parent strain, Corynebacterium glutamicum ATCC13032. It was confirmed that the performance was improved about 4 times. In addition, it was confirmed that the L-leucine-producing strain Corynebacterium CA13-8116 improved the L-leucine production ability by about 1.2 times compared to the parent strain, Corynebacterium glutamicum CJL-8109. CA13-8116 showed a decrease in L-phenylalanine production capacity by about 5.4 times compared to the parent strain, Corynebacterium glutamicum CJL-8109.
  • amino acid at position 182 in the amino acid sequence of the pheA protein is an important position for increasing L-leucine production.
  • Example 5 Confirmation of leucine and phenylalanine-producing ability of pheA selection mutants in isoleucine-producing strains
  • Example 5-1 Production of L-isoleucine producing strain CA10-3101 strain
  • a strain producing L-isoleucine was developed from wild-type Corynebacterium glutamicum ATCC13032. Specifically, to resolve feedback inhibition of threonine, a precursor of isoleucine in the biosynthetic pathway, arginine, the 407th amino acid of hom, a gene encoding homoserine dehydrogenase, was substituted with histidine (US 2020-0340022 A1). Specifically, using the primers of SEQ ID NO: 17 and SEQ ID NO: 18 or SEQ ID NO: 19 and SEQ ID NO: 20 using the chromosome of Corynebacterium glutamicum ATCC13032 as a template to produce strains introduced with hom (R407H) mutations PCR was performed respectively. The primer sequences used herein are shown in Table 10 below.
  • PCR As a polymerase for the PCR reaction, PfuUltraTM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C, 30 seconds; annealing 55° C., 30 seconds; and the polymerization reaction at 72° C. for 1 minute was repeated 28 times. As a result, a 1000 bp DNA fragment at the 5' upper end and a 1000 bp DNA fragment at the 3' lower end were obtained centering on the hom gene mutation. Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NO: 17 and SEQ ID NO: 20.
  • PCR conditions were repeated 28 times of denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.
  • a 2 kb DNA fragment containing a mutation in the hom gene encoding a homoserine dehydrogenase mutant in which arginine at position 407 was substituted with histidine was amplified.
  • the amplification product was purified using a PCR purification kit (QIAGEN) and used as an insert DNA fragment for vector construction. After the purified amplification product was treated with restriction enzyme smaI, the molar concentration (M) ratio of the pDCM2 vector and the inserted DNA fragment that was the amplification product, which was heat-treated at 65° C. for 20 minutes, was 1:2, and the infusion cloning kit (Infusion).
  • a vector pDCM2-R407H for introducing a hom(R407H) mutation onto a chromosome was constructed by cloning using the Cloning Kit, TaKaRa) according to the provided manual.
  • the constructed vector was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and a strain containing hom (R407H) mutation was obtained on the chromosome through a secondary crossover process, which was Corynebacterium glutamicum. It was named ATCC13032 hom (R407H).
  • ilvA variants which are genes encoding L-threonine dehydratase
  • primers of SEQ ID NO: 21 and SEQ ID NO: 22 or SEQ ID NO: 23 and SEQ ID NO: 24 using the chromosome of Corynebacterium glutamicum ATCC13032 as a template to produce strains into which ilvA (T381A, F383A) mutations are introduced PCR was performed using The primer sequences used herein are shown in Table 11 below.
  • PCR As a polymerase for the PCR reaction, PfuUltraTM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C, 30 seconds; annealing 55° C., 30 seconds; and the polymerization reaction at 72° C. for 1 minute was repeated 28 times. As a result, a 1126 bp DNA fragment at the 5' upper end and a 286 bp DNA fragment at the 3' lower end were obtained, respectively, centering on the mutation of the ilvA gene. Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NO: 21 and SEQ ID NO: 24.
  • PCR conditions were repeated 28 times of denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.
  • a 1.4 kb DNA fragment containing a mutation in the ilvA gene encoding a threonine dehydratase variant in which threonine at position 381 was substituted with alanine and phenylalanine at position 383 with alanine was amplified.
  • the amplification product was purified using a PCR purification kit (QIAGEN) and used as an insert DNA fragment for vector construction. After the purified amplification product was treated with restriction enzyme smaI, the molar concentration (M) ratio of the pDCM2 vector and the inserted DNA fragment that was the amplification product, which was heat-treated at 65° C.
  • a vector pDCM2-ilvA (T381A, F383A) for introducing ilvA (T381A, F383A) mutations onto a chromosome was constructed by cloning using the Cloning Kit, TaKaRa) according to the provided manual.
  • the constructed vector was transformed into Corynebacterium glutamicum ATCC13032 hom (R407H) by electroporation, and a strain containing ilvA (T381A, F383A) mutation was obtained on the chromosome through a secondary crossover process, and this It was named Nebacterium glutamicum CA10-3101.
  • the strain CA10-3101 which is an L-isoleucine-producing strain, was transformed with the pDCM2-pheA (R182A) vector prepared in Example 3-1, and the strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was 25 mg/L of kanamycin. was selected in a medium containing The selected primary strain was again subjected to secondary cross-over, and a strain into which the mutation of the target gene was introduced was selected. Finally, the introduction of the pheA mutation into the transformed strain was confirmed by performing PCR using the primers of SEQ ID NO: 3 and SEQ ID NO: 4 in Table 1 and then analyzing the nucleotide sequence to confirm that the pheA mutation was introduced into the strain.
  • L-isoleucine and L-phenylalanine production capacity of the prepared CA10-3101_pheA_R182A and ATCC13032, CA10-3101 strains were evaluated.
  • L-isoleucine was prepared by inoculating the parent strain and the pheA mutant into a 250 ml corner-barpool flask containing 25 ml of isoleucine production medium, and then culturing with shaking at 32° C. for 60 hours at 200 rpm.
  • the composition of the production medium used in this example is as follows.
  • Glucose 10% yeast extract 0.2%, ammonium sulfate 1.6%, potassium monophosphate 0.1%, magnesium sulfate 0.1%, iron sulfate 10mg/L, manganese sulfate 10mg/L, biotin 200 ⁇ g/l , pH 7.2
  • the L-isoleucine-producing strain having an additional R182A mutation in the pheA gene showed an approximately 1.1-fold improvement in L-isoleucine-producing ability compared to the parent strain, Coryne glutamicum CA10-3101, CA10-3101_pheA_R182A The strain was confirmed that the by-product L-phenylalanine was reduced.
  • amino acid at position 182 in the amino acid sequence of the pheA protein is an important position for increasing L-isoleucine production.
  • the selected mutation In order to confirm whether the selected mutation has an effect on the representative branched chain amino acid L-valine such as leucine, the selected mutation was introduced in KCCM11201P, a valine-producing strain of Corynebacterium, and an experiment was conducted to confirm the valine and phenylalanine production ability. did. Specific experiments are as follows.
  • Example 6-1 Introduction and evaluation of pheA variants in KCCM11201P strain
  • Corynebacterium glutamicum KCCM11201P (US 8465962 B2) strain, which is an L-valine producing strain, was used.
  • the strain KCCM11201P a valine-producing strain, was transformed with the pDCM2-pheA (R182A) vector prepared in Example 3-1 above, and the vector was inserted into the chromosome by recombination of the homologous sequence in a medium containing 25 mg/L of kanamycin. was selected from The selected primary strain was again subjected to secondary cross-over, and a strain into which the mutation of the target gene was introduced was selected.
  • the produced strain was named KCCM11201P-pheA (R182A), respectively.
  • valine-producing ability of the KCCM11201P-pheA (R182A) strain prepared above was evaluated. Flask culture was carried out in the same manner as in Example 2, and valine production was measured by the method using HPLC after completion of the culture, and the culture results are shown in Table 13 below.
  • the L-valine-producing strain Corynebacterium glutamicum KCCM11201P-pheA (R182A) having an additional R182A mutation in the pheA gene is L compared to the parent strain, Corynebacterium glutamicum KCCM11201P.
  • the valine production capacity was improved by about 1.1 times.
  • KCCM11201P-pheA (R182A) had a 5.36-fold decrease in L-phenylalanine production capacity compared to the parent strain, Corynebacterium glutamicum KCCM11201P. From the above results, it can be confirmed that the amino acid at position 182 in the amino acid sequence of the pheA protein is an important position for increasing L-valine production.
  • Reference Example 1-1 Construction of an insertion vector containing a gltA mutation
  • a site directed mutagenesis method was used to construct a vector for introducing gltA (M312I; SEQ ID NO: 25) mutations.
  • PCR was performed using the primer pair of SEQ ID NOs: 27 and 28, and the primer pair of SEQ ID NOs: 29 and 30 using the chromosome of the Corynebacterium glutamicum wild type as a template.
  • PCR was repeated 30 times at 94°C for 30 seconds, at 55°C for 30 seconds, and at 72°C for 1 minute and 30 seconds, followed by polymerization at 72°C for 5 minutes.
  • the resultant gene fragment was cloned by ligating the homologous sequence of the 15 bases at the ends between the DNA fragments using a linear pDCM2 vector digested with SmaI restriction enzyme and an In-Fusion enzyme and cloning. Methionine, the 312th amino acid, was replaced with isoleucine.
  • a vector pDCM2-gltA (M312I) was constructed.
  • the pDCM2-gltA (M312I) vector prepared in Reference Example 1-1 was transformed into the wild-type ATCC13032, and the strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was selected in a medium containing 25 mg/L of kanamycin. .
  • the selected primary strain was again subjected to secondary cross-over, and a strain into which the mutation of the target gene was introduced was selected.
  • Whether the gltA gene mutation was introduced in the final transformed strain was determined by performing PCR using the primers of SEQ ID NO: 15 and SEQ ID NO: 16 (Example 4-1, Table 8) and then analyzing the nucleotide sequence to determine the mutation (sequence) in the strain. No. 26) was introduced.
  • the produced strain was named ATCC13032_gltA_M312I.
  • Flask fermentation titer was evaluated to evaluate the leucine-producing ability of the prepared ATCC13032_gltA_M312I strain.
  • Each of the parent strain Corynebacterium glutamicum ATCC13032 and the prepared ATCC13032_gltA_M312I was inoculated with 1 platinum in a 250 ml corner-barpool flask containing 25 ml of each production medium, and then shaken at 30° C. for 60 hours at 200 rpm. Cultured to produce leucine. After the end of the culture, the production of leucine was measured by HPLC. The leucine concentration in the culture medium for each strain tested is shown in Table 15 below.
  • ilvA which is a gene encoding threonine dehydratase (SEQ ID NO: 31)
  • BamHI restriction enzyme sites were inserted at both ends of the primers (SEQ ID NO: 33 and SEQ ID NO: 34) for amplification from the promoter site (about 300 bp at the top of the start codon) to the terminator site (about 100 bp at the bottom of the stop codon).
  • primers SEQ ID NO: 35 and SEQ ID NO: 36 for introducing the F383A mutation into ilvA were used.
  • the primer sequences used herein are shown in Table 16 below.
  • PCR was performed using the primers of SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36 using the chromosome of wild type Corynebacterium glutamicum ATCC 13032 as a template. PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 90 seconds, followed by polymerization at 72°C for 5 minutes.
  • PCR was performed with primers of SEQ ID NO: 35 and SEQ ID NO: 36.
  • an ilvA mutant gene plasmid was prepared using a random mutagenesis kit (Agilent Technologies, USA). PCR was performed using the primers of SEQ ID NO: 35 and SEQ ID NO: 36 using the ilvA (F383A) chromosome of Reference Example 2-1 as a template. PCR conditions were repeated 30 times of denaturation at 95° C. for 2 minutes, denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 90 seconds, followed by polymerization at 72° C. for 10 minutes.
  • a DNA fragment of 1531 bp, an ilvA mutant capable of encoding L-threonine dehydratase having additional random mutations in addition to the mutation in which the 383th phenylalanine was substituted with an alanine was amplified.
  • the pECCG117 vector and the ilvA mutant DNA fragment were treated with a restriction enzyme BamHI, ligated using a DNA conjugation enzyme, and then cloned to obtain a plasmid group.
  • pECCG117-ilvA F383A was introduced into the wild-type Corynebacterium glutamicum ATCC13032 hom (R407H) strain, and the strain into which the prepared plasmid was introduced was named ATCC13032 hom (R407H)/pECCG117-ilvA (F383A).
  • the mutant plasmid group obtained in Reference Example 2-2 was introduced into the Corynebacterium glutamicum ATCC13032 hom (R407H) strain, and the apoptosis rate was 70% as a result of plated on minimal medium.
  • Primers of SEQ ID NO: 21 and SEQ ID NO: 24 were prepared to introduce ilvA mutants (T381A, F383A) into the wild-type strain.
  • PCR was performed using the primers of SEQ ID NO: 21 and SEQ ID NO: 24 using the plasmid DNA extracted from the CJILE-301 strain as a template.
  • PfuUltraTM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were denaturation 95°C, 30 seconds; annealing 55° C., 30 seconds; and the polymerization reaction at 72° C. for 2 minutes was repeated 28 times.
  • the amplification product was purified using a PCR purification kit and used as an insert DNA fragment for vector construction. After the purified amplification product was treated with restriction enzyme smaI, the molar concentration (M) ratio of the pDCM2 vector and the inserted DNA fragment that was the amplification product, which was heat-treated at 65° C. for 20 minutes, was 1:2, and an infusion cloning kit was used. By cloning according to the provided manual, a vector pDCM2-T381A_F383A for introducing T381A and F383A mutations onto a chromosome was constructed.
  • the constructed vector was transformed into Corynebacterium glutamicum ATCC13032 hom (R407H) by electroporation, and a strain containing ilvA (T381A, F383A; SEQ ID NO: 37) mutation on the chromosome through a secondary crossover process was obtained. obtained, and named it CA10-3101.
  • the strain CA10-3101 was internationally deposited with the Korea Microorganism Conservation Center (KCCM), an international depository under the Budapest Treaty, as of May 27, 2020, and was given a deposit number as KCCM12739P.
  • KCCM Korea Microorganism Conservation Center
  • the KCCM12739P strain was inoculated into a 250 ml corner-barpool flask containing 25 ml of isoleucine production medium, and then cultured with shaking at 32° C. for 60 hours at 200 rpm to prepare L-isoleucine.
  • the composition of the used production medium is as follows.
  • Glucose 10% yeast extract 0.2%, ammonium sulfate 1.6%, potassium monophosphate 0.1%, magnesium sulfate 0.1%, iron sulfate 10 mg/L, manganese sulfate 10 mg/L, biotin 200 ⁇ g/L , pH 7.2
  • the ilvA (T381A, F383A) mutation is an effective mutation to increase isoleucine production.
  • the pDCM2-leuA (R558H, G561D) vector containing the leuA gene mutation known from KR 10-2018-0077008 A was transformed into Corynebacterium glutamicum ATCC13032 by electroporation and kanamycin 25 mg/L
  • a strain in which the vector was inserted into the chromosome was selected by recombination of the homologous sequence in a medium containing The selected primary strain was again subjected to secondary cross-over, and a strain into which the leuA gene mutation was introduced was selected. Finally, whether the mutation was introduced into the transformed strain was determined by PCR using the primers of SEQ ID NO.
  • the ATCC13032_leuA_(R558H, G561D) strain transformed with the pDCM2-leuA(R558H, G561D) vector was named 'CJL-8100'.
  • a vector was prepared for introducing the P247C mutation into CJL-8100, an L-leucine-producing strain in which two mutations (R558H, G561D) were introduced into LeuA.
  • PCR was performed using the primer pairs of SEQ ID NOs: 39 and 40, and primers of SEQ ID NOs: 41 and 42 using the CJL-8100 strain chromosome as a template. After denaturing at 94°C for 5 minutes, PCR was repeated 30 times for 30 seconds at 94°C, 30 seconds at 55°C, and 1 minute and 30 seconds at 72°C, followed by polymerization at 72°C for 5 minutes.
  • the resulting PCR product was cloned by fusion of the homologous sequence of the terminal 15 base between the DNA fragments using the In-Fusion enzyme and the pDCM2 vector on the line cut with SmaI restriction enzyme, and arginine, the 558th amino acid in the LeuA amino acid sequence of the wild-type strain.
  • This vector pDCM2-leuA is substituted with histidine and contains a leuA mutation encoding a LeuA variant in which glycine at the 561th amino acid is substituted with aspartic acid, and proline (Pro) at the 247th amino acid of LeuA is substituted with cysteine (Cys) (P247C, R558H, G561D) were prepared.
  • the strain CJL-8100 an L-leucine-producing strain, was transformed with the pDCM2-leuA (P247C, R558H, G561D) vector prepared in Reference Example 3-2, and the vector was inserted into the chromosome by recombination of the homologous sequence. Selection was made in a medium containing 25 mg/L of kanamycin. The selected primary strain was again subjected to secondary cross-over, and a strain into which the mutation of the target gene was introduced was selected.
  • the 1673th nucleotide, G, of the leuA gene in the chromosome of the strain was substituted with A, GC, the 1682th and 1683th nucleotides, was substituted with AT, and the 739th and 740th nucleotides CC were substituted with TG and LeuA LeuA in which arginine, the 558th amino acid of the protein, is substituted with histidine, glycine at the 561th amino acid is substituted with aspartic acid, and proline (Pro) at the 247th amino acid is substituted with cysteine (Cys) It was confirmed that the leuA mutation encoding the variants (P247C, R558H, G561D) was introduced into the strain.
  • CJL8100_leuA_P247C was named 'CA13-8105', and it was deposited with the Korean Culture Center of Microorganisms (KCCM), an international depository under the Budapest Treaty, on April 29, 2020, and was given a deposit number KCCM12709P.
  • KCCM Korean Culture Center of Microorganisms
  • the amino acid sequence of the LeuA mutant (P247C, R558H, G561D) including the above three mutations and the nucleotide sequence of the leuA mutant encoding it are as shown in SEQ ID NO: 46 and SEQ ID NO: 47, respectively.
  • the L-leucine producing strain Corynebacterium glutamicum CJL8100
  • the CA13-8105 strain which additionally introduced the leuA_P247C mutation in the CJL8100 strain, improved the L-leucine production ability by about 150% compared to the parent strain CJL8100.
  • the leuA (R558H, G561D, P247C) mutation is an effective mutation for increasing leucine production.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 출원은 프리페네이트 탈수 효소 변이체에 관한 것이다.

Description

프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
본 출원은 프리페네이트 탈수 효소 (Prephenate dehydratase) 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법에 관한 것이다.
L-아미노산은 단백질의 기본 구성단위로서, 약품 원료와 식품첨가제, 동물 사료, 영양제, 살충제, 살균제 등의 중요 소재로 사용된다. 따라서 아미노산을 산업적으로 생산하는 것은 경제적으로 중요한 산업 공정이 되어 왔다.
아미노산을 효율적으로 생산하기 위한 다양한 연구, 예를 들어, 아미노산 고효율 생산 미생물이나 발효공정 기술을 개발하기 위한 노력이 이루어지고 있다. 구체적으로, 코리네박테리움 속 균주에서 아미노산 생합성에 관여하는 효소를 암호화하는 유전자의 발현을 증가시키거나 또는 아미노산 생합성에 불필요한 유전자를 제거하는 것과 같은 목적 물질 특이적인 접근 방법이 개발되었고(US 9109242 B2, US 8030036 B2), 이러한 방법 이외에 아미노산 생산에 관여하지 않는 유전자를 제거하는 방법, 아미노산 생산에 있어 구체적으로 기능이 알려지지 않은 유전자를 제거하는 방법 또한 활용되고 있다.
분지쇄 아미노산(branched-chain amino acid)은 발린, 류신, 이소류신의 3종을 지칭하며, 주로 근육에서 대사되어 활동 시에 에너지원으로 사용된다고 알려져 있다. 분지쇄 아미노산이 활동 시 근육 유지 및 증량에 중요한 역할을 한다고 알려지면서 그 사용량이 증가하고 있다.
본 출원의 목적은 서열번호 1의 아미노산 서열에서 N-말단으로부터 182번 위치에 상응하는 아미노산이 다른 아미노산으로 치환된, 프리페네이트 탈수 효소 변이체를 제공하는 것이다.
본 출원의 다른 목적은 상기 변이체를 코딩하는 폴리뉴클레오티드 및 이를 포함하는 벡터를 제공하는 것이다.
본 출원의 또 다른 목적은 상기 변이체, 폴리뉴클레오티드 및 벡터 중 하나 이상을 포함하는 코리네박테리움 속 미생물을 제공하는 것이다.
본 출원의 또 다른 목적은 상기 미생물을 배지에서 배양하는 단계를 포함하는, 분지쇄 아미노산 생산 방법을 제공하는 것이다.
본 출원의 프리페네이트 탈수 효소 변이체를 이용하는 경우, 이를 이용하지 않는 경우에 비해 고수율의 분지쇄 아미노산 생산이 가능하다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
본 출원의 하나의 양태는 서열번호 1의 아미노산 서열에서 N-말단으로부터 182번 위치에 상응하는 아미노산이 다른 아미노산으로 치환된, 프리페네이트 탈수 효소 (prephenate dehydratase) 변이체를 제공한다.
상기 프리페네이트 탈수 효소 변이체는, 프리페네이트 탈수 효소 활성을 갖는 폴리펩티드 또는 프리페네이트 탈수 효소에서, 서열번호 1의 프리페네이트 탈수 효소의 N-말단으로부터 182번 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 변이체를 의미한다.
본 출원에서, "프리페네이트 탈수 효소 (prephenate dehydratase)"는 다음의 반응을 촉매할 수 있는 효소이다.
prephenate ↔ phenylpyruvate + H2O + CO2
본 출원의 프리페네이트 탈수 효소는 본 출원에서 제공하는 프리페네이트 탈수 효소 변이체를 제조하기 위해 변형이 가해지는 프리페네이트 탈수 효소 또는 프리페네이트 탈수 효소 활성을 갖는 폴리펩티드일 수 있다. 구체적으로, 자연적으로 발생하는 폴리펩티드 또는 야생형 폴리펩티드일 수 있고, 이의 성숙 폴리펩티드일 수 있으며, 이의 변이체 또는 기능적 단편을 포함할 수 있으나 본 출원의 프리페네이트 탈수 효소 변이체의 모체(parent)가 될 수 있는 한 제한 없이 포함된다.
본 출원에서 상기 프리페네이트 탈수 효소는 이에 제한되지는 않으나, 서열번호 1의 폴리펩티드일 수 있다. 일 구현예로, 서열번호 1의 폴리펩티드와 약 60%, 70%, 75%. 80%. 85%, 90%, 95%, 96%, 97%, 98% 또는 99% 이상의 서열 동일성을 갖는 폴리펩티드일 수 있으며, 서열번호 1의 아미노산 서열로 이루어진 폴리펩티드와 동일 혹은 상응하는 활성을 가지는 경우라면 제한 없이 프리페네이트 탈수 효소 범위에 포함된다.
본 출원의 프리페네이트 탈수 효소는 공지의 데이터 베이스인 NCBI의 GenBank에서 그 서열을 얻을 수 있다. 구체적으로 pheA 유전자에 의해 코딩되는 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
본 출원에서, "변이체"는 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)되어 상기 변이체의 변이 전 아미노산 서열과 상이하나 기능(functions) 또는 특성(properties)이 유지되는 폴리펩티드를 지칭한다. 이러한 변이체는 일반적으로 상기 폴리펩티드의 아미노산 서열 중 하나 이상의 아미노산을 변형하고, 상기 변형된 폴리펩티드의 특성을 평가하여 동정(identify)될 수 있다. 즉, 변이체의 능력은 변이 전 폴리펩티드에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 또한, 일부 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이체를 포함할 수 있다. 다른 변이체는 성숙 단백질(mature protein)의 N- 및/또는 C-말단으로부터 일부분이 제거된 변이체를 포함할 수 있다. 상기 용어 "변이체"는 변이형, 변형, 변이형 폴리펩티드, 변이된 단백질, 변이 및 변이체 등의 용어(영문 표현으로는 modification, modified polypeptide, modified protein, mutant, mutein, divergent 등)가 혼용되어 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다.
또한, 변이체는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 변이체의 N-말단에는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이동(translocation)에 관여하는 시그널(또는 리더) 서열이 컨쥬게이트 될 수 있다. 또한 상기 변이체는 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
본 출원에서 제공하는 변이체는 서열번호 1의 아미노산 서열에서 N-말단으로부터 182번 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 프리페네이트 탈수 효소 변이체일 수 있다. 그러나 이에 제한되지 않는다.
상기 서열번호 1의 아미노산 서열에서 N-말단으로부터 182번 위치에 상응하는 아미노산은 아르기닌일 수 있다.
본 출원에서 제공하는 변이체는, 서열번호 1의 아미노산 서열에서 N-말단으로부터 182번 위치에 상응하는 아미노산이 아르기닌 외의 아미노산으로의 치환을 포함할 수 있으나 이에 제한되지 않는다.
상기 "다른 아미노산"은 치환 전 아미노산과 치환 전의 아미노산과 다른 아미노산이면 제한되지 않는다. 한편, 본 출원에서 '특정 아미노산이 치환되었다'고 표현하는 경우, 다른 아미노산으로 치환되었다고 별도로 표기하지 않더라도 치환 전의 아미노산과 다른 아미노산으로 치환되는 것임은 자명하다.
일 구현예로 본 출원의 변이체는 참조(reference) 단백질인 서열번호 1의 아미노산 서열에서 182번 위치에 상응하는 아미노산이 소수성(hydrophobic) 아미노산 또는 지방족(Aliphatic) 아미노산 중 치환 전 아미노산과 다른 아미노산으로 치환된 변이체일 수 있다.
구체적으로 상기 변이체는 서열번호 1의 아미노산 서열에서 182번 위치에 상응하는 아미노산이 소수성(비극성) 아미노산 또는 지방족 아미노산 중 하나의 아미노산으로 치환된 변이체일 수 있다. 상기 지방족 아미노산은 예를 들어, 글리신, 알라닌, 발린, 류신, 및 이소류신으로 이루어지는 군에서 선택되는 아미노산일 수 있으나, 이에 제한되지 않는다. 상기 소수성(비극성) 아미노산은 예를 들어, 글리신, 메티오닌, 알라닌, 발린, 류신, 이소류신, 프롤린, 페닐알라닌, 티로신, 및 트립토판으로 이루어지는 군에서 선택되는 아미노산일 수 있으나, 이에 제한되지 않는다.
일 구현예로 본 출원의 변이체는 서열번호 1의 아미노산 서열에서 182번 위치에 상응하는 아미노산이 크기(size)가 작은 아미노산 중 치환 전 아미노산과 다른 아미노산으로 치환된 변이체일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어 "크기가 작은 아미노산"은 20종 아미노산 중 상대적으로 크기가 작은 아미노산인 글리신, 알라닌, 세린, 트레오닌, 시스테인, 발린, 류신, 이소류신, 프롤린, 및 아스파라긴을 포함하는 것으로, 구체적으로는 글리신, 알라닌, 세린, 트레오닌, 시스테인, 발린, 류신, 이소류신 및 프롤린을 의미할 수 있으나, 이에 제한되지 않으며, 보다 구체적으로는 글리신, 알라닌, 발린, 류신, 이소류신, 세린, 및 트레오닌을 의미하는 것일 수 있고, 일 예로 알라닌, 세린, 글리신을 지칭하는 것일 수 있으나 이에 제한되지 않는다.
보다 구체적으로, 본 출원의 변이체에서 다른 아미노산으로의 치환은 알라닌으로의 치환일 수 있으나, 이에 제한되지 않는다.
본 출원에서, 용어 "상응하는(corresponding to)"은, 폴리펩티드에서 열거되는 위치의 아미노산 잔기이거나, 또는 폴리펩티드에서 열거되는 잔기와 유사하거나 동일하거나 상동한 아미노산 잔기를 지칭한다. 상응하는 위치의 아미노산을 확인하는 것은 특정 서열을 참조하는 서열의 특정 아미노산을 결정하는 것일 수 있다. 본 출원에 사용된 "상응 영역"은 일반적으로 관련 단백질 또는 참조 (reference) 단백질에서의 유사하거나 대응되는 위치를 지칭한다.
예를 들어, 임의의 아미노산 서열을 서열번호 1과 정렬(align)하고, 이를 토대로 상기 아미노산 서열의 각 아미노산 잔기는 서열번호 1의 아미노산 잔기와 상응하는 아미노산 잔기의 숫자 위치를 참조하여 넘버링 할 수 있다. 예를 들어, 본 출원에 기재된 것과 같은 서열 정렬 알고리즘은, 쿼리 시퀀스("참조 서열"이라고도 함)와 비교하여 아미노산의 위치, 또는 치환, 삽입 또는 결실 등의 변형이 발생하는 위치를 확인할 수 있다.
이러한 정렬에는 예를 들어 Needleman-Wunsch 알고리즘 (Needleman 및 Wunsch, 1970, J. Mol. Biol. 48: 443-453), EMBOSS 패키지의 Needle 프로그램 (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) 등을 이용할 수 있으나, 이에 제한되지 않고 당업계에 알려진 서열 정렬 프로그램, 쌍 서열(pairwise sequence) 비교 알고리즘 등을 적절히 사용할 수 있다.
일 구현예로, 본 출원의 변이체는 서열번호 1의 폴리펩티드와 약 60%, 70%, 75%. 80%. 85%, 90%, 95%, 96%, 97%, 98% 또는 99% 이상의 서열 동일성을 가지고, 서열번호 1의 182번 위치에 상응하는 아미노산이 다른 아미노산으로 치환된 것일 수 있다.
일 구현예로, 본 출원의 변이체는 서열번호 5로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다.
구체적으로, 본 출원의 변이체는 서열번호 5로 기재된 아미노산 서열을 가지거나(having), 포함하거나(comprising), 이루어지거나(consisting of), 상기 아미노산 서열로 필수적으로 이루어질(essentially consisting of) 수 있다.
일 구현예로, 본 출원의 변이체는 서열번호 1의 아미노산 서열을 기준으로 182번 위치에 상응하는 아미노산이 알라닌이고, 상기 서열번호 5로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 변이체에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 변이체도 본 출원의 범위 내에 포함됨은 자명하다.
예를 들어, 상기 아미노산 서열 N-말단, C-말단 그리고/또는 내부에 본 출원의 변이체의 기능을 변경하지 않는 서열 추가 또는 결실, 자연적으로 발생할 수 있는 돌연변이, 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다.
상기 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
본 출원에서 용어, '상동성 (homology)' 또는 '동일성 (identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
일 구현예로, 본 출원의 변이체는 프리페네이트 탈수 효소 활성을 가질 수 있다. 일 구현예로, 본 출원의 변이체는 야생형 혹은 비변이 프리페네이트 탈수 효소에 비해, 분지쇄 아미노산 생산능이 증가하도록 하는 활성을 가질 수 있다. 일 구현예로, 본 출원의 변이체는 야생형 혹은 비변이 프리페네이트 탈수 효소에 비해, 분지쇄 아미노산 생산경로의 부산물 생산수준이 감소하도록 하는 활성을 가질 수 있다. 일 구현예로, 본 출원의 변이체는 야생형 혹은 비변이 프리페네이트 탈수 효소에 비해, 약화된 활성을 가지는 것일 수 있다. 그러나 이에 제한되지 않는다.
본 출원의 다른 하나의 양태는 본 출원의 변이체를 코딩하는 폴리뉴클레오티드를 제공한다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이체를 코딩하는 폴리뉴클레오티드 단편을 의미한다.
본 출원의 변이체를 코딩하는 폴리뉴클레오티드는 서열번호 5로 기재된 아미노산 서열을 코딩하는 염기서열을 포함할 수 있다. 본 출원의 일 예로, 본 출원의 폴리뉴클레오티드는 서열번호 6의 서열을 가지거나 포함할 수 있다. 또한, 본 출원의 폴리뉴클레오티드는 서열번호 6의 서열로 이루어지거나, 필수적으로 구성될 수 있다.
본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 출원의 변이체를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 본 출원의 변이체의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 출원의 폴리뉴클레오티드는 서열번호 6의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열을 가지거나 포함하거나, 또는 서열번호 6의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다.
이때, 상기 상동성 또는 동일성을 갖는 서열에서, 서열번호 6의 182번 위치에 상응하는 아미노산을 코딩하는 코돈은, 알라닌을 코딩하는 코돈 중 하나일 수 있다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화할 수 있는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1ХSSC, 0.1% SDS, 구체적으로 60℃, 0.1ХSSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1ХSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
본 출원의 또 다른 하나의 양태는 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 제공하는 것이다. 상기 벡터는 상기 폴리뉴클레오티드를 숙주세포에서 발현시키기 위한 발현 벡터일 수 있으나, 이에 제한되지 않는다.
본 출원의 "벡터"는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 포함하는 DNA 제조물을 포함할 수 있다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDC계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 표적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 폴리펩티드가 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 변이체를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이체, 본 출원의 폴리뉴클레오티드 및 본 출원의 벡터를 포함하는, 코리네박테리움 속 미생물을 제공한다.
본 출원의 미생물은 본 출원의 변이형 폴리펩티드, 상기 폴리펩티드를 암호화하는 폴리뉴클레오티드, 또는 본 출원의 폴리뉴클레오티드를 포함하는 벡터를 포함할 수 있다.
본 출원에서 용어, "미생물" 또는 "균주"는 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 폴리펩티드, 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
본 출원의 균주는 본 출원의 변이체, 본 출원의 폴리뉴클레오티드 및 본 출원의 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하는 균주; 본 출원의 변이체 또는 본 출원의 폴리뉴클레오티드를 발현하도록 변형된 균주; 본 출원의 변이체, 또는 본 출원의 폴리뉴클레오티드를 발현하는 균주 (예컨대, 재조합 균주); 또는 본 출원의 변이체 활성을 갖는 균주 (예컨대, 재조합 균주)일 수 있으나, 이에 제한되지 않는다.
본 출원의 균주는 분지쇄 아미노산 생산능을 가진 균주일 수 있다.
본 출원의 균주는 자연적으로 프리페네이트 탈수 효소 또는 분지쇄 아미노산 생산능을 가지고 있는 미생물, 또는 프리페네이트 탈수 효소 또는 분지쇄 아미노산 생산능이 없는 모균주에 본 출원의 변이체 또는 이를 코딩하는 폴리뉴클레오티드 (또는 상기 폴리뉴클레오티드를 포함하는 벡터)가 도입되거나 및/또는 분지쇄 아미노산 생산능이 부여된 미생물일 수 있으나 이에 제한되지 않는다.
일 예로, 본 출원의 균주는 본 출원의 폴리뉴클레오티드 또는 본 출원의 변이체를 코딩하는 폴리뉴클레오티드를 포함하는 벡터로 형질전환되어, 본 출원의 변이체를 발현하는 세포 또는 미생물로서, 본 출원의 목적상 본 출원의 균주는 본 출원의 변이체를 포함하여 분지쇄 아미노산을 생산할 수 있는 미생물을 모두 포함할 수 있다. 예를 들어, 본 출원의 균주는 천연의 야생형 미생물 또는 분지쇄 아미노산을 생산하는 미생물에 본 출원의 변이체를 코딩하는 폴리뉴클레오티드가 도입됨으로써 프리페네이트 탈수 효소 변이체가 발현되어, 분지쇄 아미노산 생산능이 증가된 재조합 균주일 수 있다. 상기 분지쇄 아미노산 생산능이 증가된 재조합 균주는, 천연의 야생형 미생물 또는 프리페네이트 탈수 효소 비변형 미생물 (즉, 야생형 프리페네이트 탈수 효소를 발현하는 미생물)에 비하여 분지쇄 아미노산 생산능이 증가된 미생물일 수 있으나, 이에 제한되는 것은 아니다.
일 예로, 상기 분지쇄 아미노산 생산능의 증가 여부를 비교하는 대상 균주인, 프리페네이트 탈수 효소 비변형 미생물은 코리네박테리움 글루타미쿰 ATCC13032 균주 일 수 있다. 다른 예로, 상기 분지쇄 아미노산 생산능의 증가 여부를 비교하는 대상 균주인, 프리페네이트 탈수 효소 비변형 미생물은 CJL-8109, KCCM12739P(CA10-3101), KCCM11201P 일 수 있으나, 이에 제한되지 않는다.
일 예로, 상기 재조합 균주는 변이 전 모균주 또는 비변형 미생물의 분지쇄 아미노산 생산능에 비하여 약 1% 이상, 구체적으로는 약 3%, 약 5% 이상 높아진 것일 수 있으나, 변이 전 모균주 또는 비변형 미생물의 생산능에 비해 +값의 증가량을 갖는 한, 이에 제한되지 않는다.
다른 예로, 상기 재조합 균주는 변이 전 모균주 또는 비변형 미생물에 비하여 분지쇄 아미노산 생산 경로에서 생성되는 부산물의 생산량이 약 50% 이하, 구체적으로는 약 30% 이하, 약 10% 이하로 낮아진 것일 수 있고, 또는 부산물이 생산되지 않는 것일 수 있으나, 이에 제한되지 않는다.
상기 용어 "약(about)"은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
본 출원에서 "분지쇄 아미노산" 은 곁사슬에 분지알킬기가 있는 아미노산을 말하며, 발린, 류신 및 이소류신을 포함한다. 구체적으로, 본 출원에서 상기 분지쇄 아미노산은 L-분지쇄 아미노산일 수 있고, 상기 L-분지쇄 아미노산은 L-발린, L-류신 및 L-이소류신 중에서 선택되는 1 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 분지쇄 아미노산 생산 경로에서 생성되는 부산물은, 분지쇄 아미노산 이외의 물질을 의미하며, 구체적으로는 방향족(aromatic) 아미노산, 보다 구체적으로는 L-타이로신 및 L-페닐알라닌 중에서 선택되는 1 이상일 수 있다. 그러나 이에 제한되지 않는다.
본 출원에서 용어, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 본 출원의 프리페네이트 탈수 효소 변이체가 도입되지 않거나 도입되기 전의 균주를 의미할 수 있다. 상기 "비변형 미생물"은 "변형 전 균주", "변형 전 미생물", "비변이 균주", "비변형 균주", "비변이 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
일 구현예로, 본 출원의 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 스테이셔니스(Corynebacterium stationis), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있다.
본 출원의 미생물은 분지쇄 아미노산 생산능을 증가하도록 하는 변이를 추가로 더 포함할 수 있다.
일 구현예로, 본 출원의 미생물은 이소프로필말레이트 신타제, 호모세린 디하이드로게나제, 쓰레오닌 디하이드라타제, 분지쇄 아미노산 아미노트랜스퍼라제, 시트레이트 신타아제 중 하나 이상의 활성 변경을 포함할 수 있다.
일 구현예로, 본 출원의 미생물은 이소프로필말레이트 신타제(isopropylmalate synthase), 호모세린 디하이드로게나제(homoserine dehydrogenase), 분지쇄 아미노산 아미노트랜스퍼라제(branched amino acid aminotransferase) 및 쓰레오닌 디하이드라타제(threonine dehydratase) 중 하나 이상의 활성이 추가적으로 강화된 미생물일 수 있다.
그러나 전술한 내용에 제한되지 않고, 생산하고자 하는 분지쇄 아미노산에 따라 당업자는 미생물이 포함하는 추가적인 변형을 적절히 선택할 수 있다.
본 출원에서 용어, 폴리펩티드 활성의 "강화"는, 폴리펩티드의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 활성화(activation), 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 활성화, 강화, 상향조절, 과발현, 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "강화", "상향조절", "과발현" 또는 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성 및/또는 농도(발현량)에 비하여 향상된 것을 의미한다.
상기 강화는 외래의 폴리펩티드를 도입하거나, 내재적인 폴리펩티드의 활성 강화 및/또는 농도(발현량)를 통해 달성할 수 있다. 상기 폴리펩티드의 활성의 강화 여부는 해당 폴리펩티드의 활성 정도, 발현량 또는 해당 폴리펩티드로부터 배출되는 산물의 양의 증가로부터 확인할 수 있다.
상기 폴리펩티드의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 폴리펩티드의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드의 강화는
1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가;
2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역을 활성이 강력한 서열로 교체;
3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
4) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드의 아미노산 서열의 변형;
5) 폴리펩티드 활성이 강화도록 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열의 변형 (예를 들어, 폴리펩티드의 활성이 강화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 폴리뉴클레오티드 서열의 변형);
6) 폴리펩티드의 활성을 나타내는 외래 폴리펩티드 또는 이를 코딩하는 외래 폴리뉴클레오티드의 도입;
7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
보다 구체적으로,
상기 1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터의 숙주세포 내로의 도입에 의해 달성되는 것일 수 있다. 또는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 숙주세포 내의 염색체 내에 1 카피 또는 2 카피 이상 도입에 의해 달성되는 것일 수 있다. 상기 염색체 내에 도입은 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다. 상기 벡터는 전술한 바와 같다.
상기 2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역(또는 발현조절서열)을 활성이 강력한 서열로 교체는, 예를 들면, 상기 발현조절영역의 활성을 더욱 강화하도록 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 가지는 서열로의 교체일 수 있다. 상기 발현조절영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 그리고 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 일 예로, 본래의 프로모터를 강력한 프로모터로 교체시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 cj1 내지 cj7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터, yccA 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 높은 다른 개시코돈을 코딩하는 염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 폴리펩티드의 활성을 강화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 증가하도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 상기 교체는 구체적으로 상동재조합에 의하여 폴리뉴클레오티드를 염색체내로 삽입함으로써 수행될 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 전술한 바와 같다.
상기 6) 폴리펩티드의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 상기 폴리펩티드와 동일/유사한 활성을 나타내는 폴리펩티드를 코딩하는 외래 폴리뉴클레오티드의 숙주세포 내 도입일 수 있다. 상기 외래 폴리뉴클레오티드는 상기 폴리펩티드와 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한이 없다. 상기 도입에 이용되는 방법은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 폴리펩티드가 생성되어 그 활성이 증가될 수 있다.
상기 7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩티드의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 폴리펩티드 활성의 강화는, 상응하는 폴리펩티드의 활성 또는 농도 발현량가 야생형이나 변형 전 미생물 균주에서 발현된 폴리펩티드의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩티드로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 미생물에서 폴리뉴클레오티드의 일부 또는 전체의 변형은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위 (engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오티드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, 폴리펩티드 활성의 "약화" 는 내재적 활성에 비하여 활성이 감소되거나 또는 활성이 없는 것을 모두 포함하는 개념이다. 상기 약화는 불활성화(inactivation), 결핍(deficiency), 하향조절(down-regulation), 감소(decrease), 저하(reduce), 감쇠(attenuation) 등의 용어와 혼용될 수 있다.
상기 약화는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드의 변이 등으로 폴리펩티드 자체의 활성이 본래 미생물이 가지고 있는 폴리펩티드의 활성에 비해 감소 또는 제거된 경우, 이를 코딩하는 폴리뉴클레오티드의 유전자의 발현 저해 또는 폴리펩티드로의 번역(translation) 저해 등으로 세포 내에서 전체적인 폴리펩티드 활성 정도 및/또는 농도(발현량)가 천연형 균주에 비하여 낮은 경우, 상기 폴리뉴클레오티드의 발현이 전혀 이루어지지 않은 경우, 및/또는 폴리뉴클레오티드의 발현이 되더라도 폴리펩티드의 활성이 없는 경우 역시 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주, 야생형 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "불활성화, 결핍, 감소, 하향조절, 저하, 감쇠"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성에 비하여 낮아진 것을 의미한다.
이러한 폴리펩티드의 활성의 약화는, 당업계에 알려진 임의의 방법에 의하여 수행될 수 있으나 이로 제한되는 것은 아니며, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다(예컨대, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드의 약화는
1) 폴리펩티드를 코딩하는 유전자 전체 또는 일부의 결손;
2) 폴리펩티드를 코딩하는 유전자의 발현이 감소하도록 발현조절영역(또는 발현조절서열)의 변형;
3) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 구성하는 아미노산 서열의 변형(예컨대, 아미노산 서열 상의 1 이상의 아미노산의 삭제/치환/부가);
4) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 코딩하는 유전자 서열의 변형 (예를 들어, 폴리펩티드의 활성이 제거 또는 약화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 핵산염기 서열 상의 1 이상의 핵산염기의 삭제/치환/부가);
5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입;
7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가;
8) 폴리펩티드를 코딩하는 유전자 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE); 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
예컨대,
상기 1) 폴리펩티드를 코딩하는 상기 유전자 일부 또는 전체의 결손은, 염색체 내 내재적 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드 전체의 제거, 일부 뉴클레오티드가 결실된 폴리뉴클레오티드로의 교체 또는 마커 유전자로 교체일 수 있다.
또한, 상기 2) 발현조절영역(또는 발현조절서열)의 변형은, 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절영역(또는 발현조절서열) 상의 변이 발생, 또는 더욱 약한 활성을 갖는 서열로의 교체일 수 있다. 상기 발현조절영역에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 낮은 다른 개시코돈을 코딩하는 염기서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은 폴리펩티드의 활성을 약화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 약한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 없도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 예를 들면, 폴리뉴클레오티드 서열 내 변이를 도입하여 종결 코돈을 형성시킴으로써, 유전자의 발현을 저해하거나 약화시킬 수 있으나, 이에 제한되지 않는다.
상기 6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입은 예를 들어 문헌 [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986]을 참고할 수 있다.
상기 7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가는 mRNA 번역을 불가능하게 하거나 속도를 저하시키는 것일 수 있다.
상기 8) 폴리펩티드를 코딩하는 유전자서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE)는 상기 폴리펩티드를 코딩하는 유전자의 전사체에 상보적인 안티센스 뉴클레오티드를 만들어 활성을 약화하는 것일 수 있다.
본 출원의 미생물에서, 변이체, 폴리뉴클레오티드, 벡터 및 분지쇄 아미노산에 대해서는 다른 양태에서 기재한 바와 같다.
본 출원의 다른 하나의 양태는 본 출원의 코리네박테리움 속 미생물을 배지에서 배양하는 단계를 포함하는, 분지쇄 아미노산 생산 방법을 제공한다.
본 출원에서, 용어 "배양"은 본 출원의 코리네박테리움 속 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및/또는 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 본 출원의 코리네박테리움 속 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 코리네박테리움 속 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 코리네박테리움 속 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
구체적으로, 코리네박테리움 속 미생물에 대한 배양 배지는 문헌["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)]에서 찾아 볼 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 본 출원의 코리네박테리움 속 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
본 출원의 배양에서 배양온도는 20 내지 45℃, 구체적으로는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 배양에 의하여 생산된 분지쇄 아미노산은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 분지쇄 아미노산 생산방법은, 본 출원의 코리네박테리움 속 미생물을 준비하는 단계, 상기 균주를 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 분지쇄 아미노산 생산방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 본 출원의 코리네박테리움 속 미생물로부터 분지쇄 아미노산을 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 분지쇄 아미노산을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 분지쇄 아미노산을 회수할 수 있다.
또한, 본 출원의 분지쇄 아미노산 생산방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 분지쇄 아미노산 생산방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 이시적(또는 연속적)으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 방법에서, 변이체, 폴리뉴클레오티드, 벡터 및 미생물 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 변이체, 상기 변이체를 코딩하는 폴리뉴클레오타이드, 상기 폴리뉴클레오타이드를 포함하는 벡터 또는 본 출원의 폴리뉴클레오티드를 포함하는 코리네박테리움 속 미생물; 이를 배양한 배지; 또는 이들 중 2 이상의 조합을 포함하는 분지쇄 아미노산 생산용 조성물을 제공하는 것이다.
본 출원의 조성물은 분지쇄 아미노산 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 조성물에서, 변이체, 폴리뉴클레오티드, 벡터, 균주, 배지 및 분지쇄 아미노산 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 프리페네이트 탈수 효소 변이체; 상기 프리페네이트 탈수 효소 변이체를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 미생물의, 분지쇄 아미노산 생산 용도를 제공한다.
본 출원의 용도에서, 변이체, 폴리뉴클레오티드, 벡터 및 미생물 등은 상기 다른 양태에서 기재한 바와 같다.
이하 본 출원을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다.
실시예 1: pheA 변이 발굴
실시예 1-1. pheA를 포함하는 벡터 제작
프리페네이트 탈수 효소의 활성을 가지는 pheA 변이 라이브러리를 제작하기 위해 우선 pheA를 포함하는 재조합 벡터를 제작하였다. 아생형 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum) 유래의 pheA 단백질 (서열번호 1, Uniprot ID: P10341)을 암호화하는 pheA 유전자 (서열번호 2)를 증폭하기 위하여, 코리네 박테리움 글루타미쿰 (Corynebacterium glutamicum) ATCC13032 야생주의 염색체를 주형으로 서열번호 3 및 4의 프라이머를 이용하여 94℃에서 1 분간 변성, 58℃에서 30 초간 결합, 72℃에서 1 분간 Pfu DNA 중합효소로 중합하는 조건을 25 회 반복하는 PCR방법을 수행하였다. 사용한 프라이머의 구체적인 서열은 표 1에 기재하였다. 상기 증폭산물을 TOPO Cloning Kit (Invitrogen)를 이용하여 대장균 벡터 pCR2.1에 클로닝하여 'pCR- pheA'를 얻었다.
서열번호 서열(5'->3')
서열번호 3 TTGAGGTCCTTGGCTGG
서열번호 4 CGCAACACGATGGAGCTG
실시예 1-2. pheA 변이 라이브러리 제작
상기 실시 예 1-1에서 제작된 벡터를 기반으로 error-prone PCR kit (clontech Diversify® PCR Random Mutagenesis Kit)를 이용하여 pheA 변이 라이브러리를 제작하였다. 1000bp 당 0 내지 3개의 변이가 발생할 수 있는 조건에서, 서열번호 3 및 서열번호 4을 프라이머로 하여 PCR 반응을 수행하였다. 구체적으로, 94℃에서 30초 동안 프리-히팅(pre-heating) 후, 94℃에서 30초, 68℃에서 1분 30초의 과정을 25회(cycle) 반복하여 PCR 반응을 수행하였다. 이 때 얻어진 PCR 산물을 megaprimer (50~125ng) 로 하여 95℃에서 50초, 60℃에서 50초, 68℃에서 12분의 과정을 25회 반복 수행한 후 DpnI 처리하여, 대장균 DH5α에 열 충격방법을 통해 형질 전환하여 카나마이신 (25 mg/L) 이 포함된 LB 고체배지에 도말 하였다. 형질전환 된 콜로니 20종을 선별한 후 플라스미드를 획득하여 염기서열을 분석한 결과 2 mutations/kb 빈도로 서로 다른 위치에 변이가 도입된 것을 확인하였다. 약 20,000개의 형질전환 된 대장균 콜로니를 취하여 플라스미드를 추출하였고, 이를'pTOPO- pheA-library'로 명명하였다.
실시예 2: 제작한 라이브러리 평가 및 변이체 선별
실시예 2-1. L-류신 및 L-페닐알라닌 생산량 증가 및 저감된 변이 균주 선별
상기 실시예 1-2에서 제작된 pTOPO-pheA-library를 야생형 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum) ATCC13032 에 전기천공법으로 형질 전환한 후, 카나마이신 25mg/L를 함유한 영양배지(표 2)에 도말하여 변이 유전자가 삽입된 균주 10,000개의 콜로니를 선별하였다. 선별된 각 콜로니를 ATCC13032/pTOPO_pheA(mt)1부터 ATCC13032/ pTOPO_pheA(mt) 10,000 로 명명하였다.
확보된 10,000개의 콜로니 중 L-류신 생산이 늘어나며 방향족 아미노산 중 L-페닐알라닌 생산량이 증가 및 저감되는 콜로니를 확인하기 위해 각각의 콜로니에 대해 하기와 같은 방법으로 발효 역가 평가를 진행하였다.
배지 종류 성분
생산배지 포도당 100g, (NH4)2SO4 40g, 대두 단백질(Soy Protein) 2.5g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3g, KH2PO4 1g, MgSO4·7H2O 0.5g, 바이오틴 100㎍, 티아민 염산염 1,000㎍, 칼슘-판토텐산 2000㎍, 니코틴아미드 3,000㎍, CaCO3 30g; (증류수 1리터 기준), pH 7.0
영양배지 포도당 10g, 육즙 5g, 폴리펩톤 10g, 염화나트륨 2.5g, 효모엑기스 5g, 한천 20g, 유레아 2g (증류수 1리터 기준)
가압 살균한 생산배지 (표2) 25 ㎖에 25 ug/ml의 카나마이신을 함유하는 250 ㎖ 코너-바풀 플라스크에 각 콜로니를 백금이를 이용하여 접종한 후, 30 ℃에서 60 시간 동안 200 rpm으로 진탕 배양하였다. 배양 종료 후 고속 액체 크로마토그래피 (HPLC, SHIMAZDU LC20A)를 이용한 방법에 의해 L-류신 및 방향족 아미노산 중 L-페닐알라닌을 측정하였다.
확보된 10,000개의 콜로니 중 야생형 코리네박테리움 글루타미쿰 균주(ATCC13032) 대비 L-류신 생산능이 가장 향상되며 L-페닐알라닌 생산량이 저감된 균주 (ATCC13032/pTOPO_pheA(mt)3891) 1종을 선별하였다. 선별된 균주에서 생산된 L-류신(Leu) 및 L-페닐알라닌(Phe)의 농도는 아래 표 3과 같다.
균주명 Leu (g/L) Phe (g/L)
ATCC13032 0.87 1.85
ATCC13032/pTOPO_pheA(mt)3891 1.25 0.26
상기 표 3에 나타난 바와 같이, pheA 유전자에 변이가 있는 코리네박테리움 글루타미쿰 ATCC13032/pTOPO_pheA(mt)3891 은 모균주 대비 L-류신 생산량이 약 1.4배 향상되고, L-페닐알라닌이 약 7배 저감됨을 확인하였다.
실시예 2-2. L-류신 및 L-페닐알라닌 생산량 증가 및 저감된 균주의 변이 확인
선별된 변이 균주 ATCC13032/pTOPO_pheA(mt)3891의 pheA 유전자 변이를 확인하기 위하여, 표 1에 기재된 서열번호 3 과 서열번호 4 의 프라이머를 이용하여 각 변이 균주의 DNA를 주형으로 하여 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃에서 1분 30초를 30회 반복한 후, 72℃에서 5분의 조건으로 PCR을 수행하고 DNA시퀀싱을 진행하였다.
시퀀싱 결과, ATCC13032/pTOPO_pheA(mt)3891 균주는 pheA 유전자의 544-546번째, 뉴클레오티드인 CGC가 GCG로 치환되어 있음을 확인하였다. 이는 pheA 단백질의 182번째 아미노산인 아르기닌이 알라닌으로 치환된 변이체(이하, R182A)를 암호화할 수 있음을 의미한다. pheA 변이체 (R182A)의 아미노산 서열 및 이를 암호화하는 pheA 변이체의 염기서열은 서열번호 5 및 6와 같다.
따라서, 이하 실시예에서는, 상기 변이(R182A)가 코리네 박테리움 속 미생물의 L-류신 및 방향족 아미노산 생산에 영향을 미치는지 확인하고자 하였다.
실시예 3: 선별된 변이 균주의 L-류신 및 L-페닐알라닌 생산능 확인
실시예 3-1. pheA 변이를 포함하는 삽입 벡터 제작
상기 실시 예 2에서 선별된 변이를 균주 내로 도입하기 위해 삽입용 벡터를 제작하고자 하였다. pheA(R182A)변이 도입용 벡터 제작은 위치 지정 돌연변이 생성 (Site directed mutagenesis) 방법을 사용하였다. 코리네박테리움 글루타미쿰 야생형의 염색체를 주형으로 R182A 변이를 생성하기 위해 서열번호 7 및 8의 프라이머, 서열번호 9 및 10의 프라이머 쌍을 이용하였고 PCR을 수행하였다. 구체적으로, 94℃에서 5분간 변성 후에 94℃에서 30초, 55℃에서 30초, 72℃에서 1분 30초를 30회 반복한 후, 72℃에서 5분의 조건으로 PCR을 수행하였다. 사용한 프라이머의 구체적인 서열은 표 4에 기재하였다.
서열번호 서열(5'->3')
서열번호 7 GTGAATTCGAGCTCGGTACCCGTGGCATGGATGAAAAG
서열번호 8 TTGGACAGCAACGAAGCGGGTcgcGGCGCCACGGAC
서열번호 9 GTCGCCGACGTCCGTGGCGCCgcgACCCGCTTCGTTG
서열번호 10 GGTCGACTCTAGAGGATCCCCGTGGCTGTCCATGATTC
그 결과 얻어진 PCR 산물을 SmaI 제한효소로 절단시킨 선상의 pDCM2 벡터(한국공개특허 KR 10-2020-0136813 A)와 In-Fusion 효소를 이용해 DNA 단편 간의 말단 15 base의 상동서열을 fusion 시켜 클로닝하여 pheA의 182번 아미노산을 알라닌으로 치환하는 벡터 'pDCM2-pheA(R182A)'를 제작하였다.
실시예 3-2. ATCC13032 균주 내 변이체 도입 및 평가
상기 실시예 3-1에서 제작한 pDCM2-pheA(R182A)벡터를 ATCC13032에 전기천공법으로 형질전환하고 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신(kanamycin) 25 mg/L를 함유한 배지에서 선별하였다. 선별된 1차 균주는 다시 2차 교차(cross-over)를 거쳐, 목표 유전자의 변이가 도입된 균주를 선정하였다. 최종적으로 형질전환된 균주의 pheA 유전자 변이 도입의 여부는 서열번호 3와 서열번호 4의 프라이머를 이용하여 PCR을 수행한 후 염기서열을 분석함으로써 균주 내 변이가 도입 되었음을 확인하였다. 제작된 균주는 총 3종이며, ATCC13032_pheA_R182A로 명명하였다.
상기 제작된 총 3종의 균주 L-류신 및 방향족 아미노산 생산능을 평가하기 위해 플라스크 발효 역가 평가를 진행하였다. 각각의 생산배지 25 ㎖을 함유하는 250 ㎖ 코너-바풀 플라스크에 모균주인 코리네박테리움 글루타미쿰 ATCC13032 및 상기 제작한 ATCC13032_pheA_R182A을 각각 1백금이 접종한 후, 30 ℃에서 60 시간 동안 200 rpm으로 진탕 배양하여 L-류신을 생산하였다. 배양종료 후 HPLC로 L-류신, L-타이로신 및 L-페닐알라닌의 생산량을 측정하였다. 실험한 각 균주에 대한 배양액 중의 류신 농도는 아래 표 5와 같다.
균주명 Leu (g/L) Phe (g/L)
ATCC13032 0.87 1.85
ATCC13032 _pheA_R182A 1.27 0.22
상기 표 5에 나타난 바와 같이, ATCC13032_pheA_R182A는 모균주인 코리네박테리움 글루타미쿰 ATCC13032 에 비해 L-류신의 수율이 약 1.5배 향상됨을 확인하였다. ATCC13032_pheA_R182A는 L-페닐알라닌이 약 8배 감소 되었다.
실시예 4: 류신 생산주에서 pheA 선별 변이의 류신 및 페닐알라닌 생산능 확인
코리네박테리움 속 야생형의 균주는 류신을 생산하더라도 아주 극미량이 생산될 뿐이다. 이에 ATCC13032 유래의 류신 생산 균주를 제작하고, 선별한 변이를 도입하여 류신 및 페닐알라닌 생산능을 확인 하는 실험을 진행하였다. 구체적인 실험은 다음과 같다.
실시예 4-1. L-류신 생산주 CJL-8109 균주 제작
고농도의 L-류신 생산을 위한 균주로서 (1) leuA 유전자의 1673 번째 뉴클레오티드인 G가 A로 치환되어 LeuA 단백질의 558 번째 아미노산인 알지닌이 히스티딘으로 치환되는 변이(R558H)와 (2) leuA 유전자의 1682 번째, 1683 번째 뉴클레오티드인 GC가 AT로 치환되어 561 번째 아미노산인 글리신이 아스파르트산으로 치환되는 변이(G561D)와 (3) leuA 유전자의 739번째, 740번째 뉴클레오티드인 CC 가 TG 로 치환되어 247번째 아미노산인 프롤린이 시스테인으로 치환되는 변이 (P247C) 를 포함하는 ATCC13032 유래의 균주를 제조하였다.
구체적으로 상기의 leuA 유전자 변이를 포함하는 pDCM2-leuA(P247C, R558H, G561D) 벡터를 코리네박테리움 글루타미쿰 ATCC13032 에 전기천공법으로 형질전환하고 카나마이신(kanamycin) 25 mg/L를 함유한 배지에서 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주를 선별하였다. 선별된 1차 균주는 다시 2차 교차(cross-over)를 거쳐, leuA 유전자의 변이가 도입된 균주를 선정하였다. 최종적으로 형질전환된 균주의 변이 도입 여부는 표 6의 서열번호 11과 서열번호 12의 프라이머를 이용하여 PCR(94℃ 5분 후, 94℃ 30초/55℃ 30초/72℃ 90초 30회 반복, 72℃ 5분)을 수행하고 염기서열을 분석하여 P247C, R558H, G561D 변이가 도입된 것을 확인하였다. pDCM2-leuA(P247C, R558H, G561D) 벡터로 형질 전환된 ATCC13032_leuA_(P247C, R558H, G561D) 균주를 'CJL-8105'으로 명명하였다.
서열번호 서열(5'->3')
서열번호 11 TATGCTTCACCACATGACTTC
서열번호 12 AAATCATTTGAGAAAACTCGAGG
제작한 CJL-8105 균주에 L-류신 생산능을 높여주기 위해 분지쇄 아미노산 아미노트랜스퍼라제 (branched-chain amino acid aminotransferase)를 코딩하는 유전자인 ilvE 변이체 (V156A)가 도입된 균주를 제작하였다. (대한민국 등록특허 KR 10-2143964 B1). 구체적으로 상기의 ilvE 유전자 변이를 포함하는 pDCM2-ilvE(V156A) 벡터를 코리네박테리움 글루타미쿰 CJL-8105에 전기천공법으로 형질전환하고 카나마이신(kanamycin) 25 mg/L를 함유한 배지에서 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주를 선별하였다. 선별된 1차 균주는 다시 2차 교차(cross-over)를 거쳐, ilvE 유전자의 변이가 도입된 균주를 선정하였다. 최종적으로 형질전환된 균주의 변이 도입 여부는 표 7의 서열번호 13와 서열번호 14의 프라이머를 이용하여 PCR(94℃ 5분 후, 94℃ 30초/55℃ 30초/72℃ 90초 30회 반복, 72℃ 5분)을 수행하고 염기서열을 분석하여 V156A 변이가 도입된 것을 확인하였다. pDCM2-ilvE(V156A) 벡터로 형질전환된 균주를 'CJL-8108'로 명명하였다.
서열번호 서열(5'->3')
13 GTCACCCGATCGTCTGAAG
14 GTCTTAAAACCGGTTGAT
제작한 CJL-8108 균주에 L-류신 생산능을 높여주기 위해 시트레이트 신타아제 (Citrate Synthase) 활성을 약화시킨 gltA 변이체 (M312I; 서열번호 25)가 도입된 균주를 제작하였다. 구체적으로 상기의 gltA 유전자 변이를 포함하는 pDCM2-gltA(M312I) 벡터를 코리네박테리움 글루타미쿰 CJL-8108에 전기천공법으로 형질전환하고 카나마이신(kanamycin) 25 mg/L를 함유한 배지에서 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주를 선별하였다. 선별된 1차 균주는 다시 2차 교차(cross-over)를 거쳐, gltA 유전자의 변이가 도입된 균주를 선정하였다. 최종적으로 형질전환된 균주의 변이 도입 여부는 표 8의 서열번호 15와 서열번호 16의 프라이머를 이용하여 PCR (94℃ 5분 후, 94℃ 30초/55℃ 30초/72℃ 90초 30회 반복, 72℃ 5분)을 수행하고 염기서열을 분석하여 M312I 변이가 도입된 것을 확인하였다. pDCM2-gltA(M312I) 벡터로 형질전환된 균주를 'CJL-8109'로 명명하였다.
서열번호 서열(5'->3')
15 CAATGCTGGCTGCGTACGC
16 CTCCTCGCGAGGAACCAACT
실시예 4-2. CJL-8109 균주 내 pheA 변이체 도입 및 평가
류신 생산 균주인 CJL-8109을 상기 실시예 3-1에서 제작한 pDCM2-pheA(R182A)벡터로 형질전환하고 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신 25mg/L를 함유한 배지에서 선별하였다. 선별된 1차 균주는 다시 2차 교차(cross-over)를 거쳐, 목표 유전자의 변이가 도입된 균주를 선정하였다. 최종적으로 형질 전환된 균주의 pheA 유전자 변이 도입의 여부는 서열번호 3과 서열번호 4의 프라이머를 이용하여 PCR을 수행한 후 염기서열을 분석함으로써 균주 내 pheA 변이가 도입 되었음을 확인하였다. 제작된 CJL8109_pheA_R182A를 CA13-8116로 명명하고 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(KCCM)에 2021년 01월 22일자로 국제기탁하여 기탁번호 KCCM12943P를 부여받았다.
상기 제작된 CA13-8116및 ATCC13032, CJL-8109 균주의 류신 생산능을 평가하였다. 실시예 2와 같은 방식으로 플라스크 배양을 진행하였고 배양 종료 후 HPLC를 이용한 방법에 의해 류신 생산량을 측정하였으며, 배양 결과는 하기 표 9과 같다.
균주명 Leu (g/L) Phe (g/L)
ATCC13032 0.87 1.87
ATCC13032_leuA_(P247C, R558H, G561D)_ilvE(V156A)_gltA(M312I) : CJL-8109 2.77 1.67
CJL8109_pheA_R182A: CA13-8116 3.76 0.31
상기 표 9에 나타난 바와 같이, pheA 유전자에 R182A변이가 추가로 있는 L-류신 생산균주 코리네박테리움 글루타미쿰 CA13-8116은 모균주인 코리네박테리움 글루타미쿰 ATCC13032에 비해 L-류신 생산능이 약 4 배 향상됨을 확인하였다. 또한 L-류신 생산균주 코리네박테리움 CA13-8116은 모균주인 코리네박테리움 글루타미쿰 CJL-8109에 비해 L-류신 생산능이 약 1.2 배 향상됨을 확인하였다. CA13-8116는 모균주인 코리네박테리움 글루타미쿰 CJL-8109에 비해 L-페닐알라닌 생산능이 약 5.4배 감소 되었다.
상기 결과를 통해 pheA 단백질의 아미노산 서열 중 182번째 위치의 아미노산이 L-류신 생산 증가에 중요한 위치임을 확인할 수 있다.
실시예 5: 이소류신 생산주에서 pheA 선별 변이의 류신 및 페닐알라닌 생산능 확인
류신과 대표적인 분지쇄 아미노산인 이소류신에 대하여도 선별된 변이가 효과를 나타내는지를 확인하고자 코리네박테리움 속 이소류신 생산 균주에 도입하여 이소류신 생산능을 확인 하는 실험을 진행하였다. 구체적인 실험은 다음과 같다.
실시예 5-1. L-이소류신 생산주 CA10-3101 균주 제작
야생형 코리네 박테리움 글루타미쿰 ATCC13032로부터 L-이소류신 생산 균주를 개발하였다. 구체적으로, 생합성 경로에서 이소류신의 전구체인 쓰레오닌의 피드백 저해 해소를 위해 호모세린 디하이드로게나제를 코딩하는 유전자인 hom의 407번째 아미노산인 아르기닌(Arginine)을 히스티딘(Histidine)으로 치환하였다 (US 2020-0340022 A1). 구체적으로, hom(R407H) 변이가 도입된 균주들을 제작하기 위해 코리네박테리움 글루타미쿰 ATCC13032의 염색체를 주형으로 하여 서열번호 17 및 서열번호 18 혹은 서열번호 19 및 서열번호 20의 프라이머를 이용하여 PCR을 각각 수행하였다. 여기에서 사용된 프라이머 서열은 하기 표 10과 같다.
서열번호 서열(5'->3')
서열번호 17 TCGAGCTCGGTACCCCGCTTTTGCACTCATCGAGC
서열번호 18 CACGATCAGATGTGCATCATCAT
서열번호 19 ATGATGATGCACATCTGATCGTG
서열번호 20 CTCTAGAGGATCCCCGAGCATCTTCCAAAACCTTG
PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 1분을 28회 반복하였다. 그 결과, hom 유전자의 변이를 중심으로 5' 상단 부위의 1000 bp DNA 단편과 3' 하단 부위의 1000 bp의 DNA 단편을 각각 수득하였다. 증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 17및 서열번호 20의 프라이머로 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 2분 중합을 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과, 407번째 아르기닌이 히스티딘으로 치환된 호모세린 디하이드로게나제 변이체를 코딩하는 hom 유전자의 변이를 포함하는 2 kb의 DNA 단편이 증폭되었다. 증폭 산물을 PCR 정제 키트(PCR Purification kit, QIAGEN)를 사용해 정제하여 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다. 정제한 증폭 산물을 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDCM2 벡터와 상기 증폭 산물인 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하고, 인퓨전 클로닝 키트(Infusion Cloning Kit, TaKaRa)를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 hom(R407H) 변이를 염색체상에 도입하기 위한 벡터 pDCM2-R407H를 제작하였다.
제작된 벡터를 전기천공법으로 코리네박테리움 글루타미쿰 ATCC13032에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 hom(R407H) 변이를 포함하는 균주를 얻었으며, 이를 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H)로 명명하였다.
제작한 ATCC13032 hom(R407H) 균주에 L-이소류신에 피드백 해제와 활성을 높여주기 위해 L-쓰레오닌 디하이드라타제를 코딩하는 유전자인 ilvA 변이체(T381A, F383A)가 도입된 균주를 제작하였다. 더 구체적으로, ilvA(T381A, F383A) 변이가 도입된 균주들을 제작하기 위해 코리네박테리움 글루타미쿰 ATCC13032의 염색체를 주형으로 하여 서열번호 21 및 서열번호 22 혹은 서열번호 23 및 서열번호 24의 프라이머를 이용하여 PCR을 각각 수행하였다. 여기에서 사용된 프라이머 서열은 하기 표 11과 같다.
서열번호 서열(5'->3')
서열번호 21 TCGAGCTCGGTACCCATGAGTGAAACATACGTGTC
서열번호 22 GCGCTTGAGGTACTCtgcCAGCGcGATGTCATCATCCGG
서열번호 23 CCGGATGATGACATCgCGCTGgcaGAGTACCTCAAGCGC
서열번호 24 CTCTAGAGGATCCCCCGTCACCGACACCTCCACA
PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 1분을 28회 반복하였다. 그 결과, ilvA 유전자의 변이를 중심으로 5' 상단 부위의 1126 bp DNA 단편과 3' 하단 부위의 286 bp의 DNA 단편을 각각 수득하였다. 증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 21 및 서열번호 24의 프라이머로 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 2분 중합을 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과, 381번째 쓰레오닌이 알라닌으로, 383번째 페닐알라닌이 알라닌으로 치환된 쓰레오닌 디하이드라타제 변이체를 코딩하는 ilvA 유전자의 변이를 포함하는 1.4 kb의 DNA 단편이 증폭되었다. 증폭 산물을 PCR 정제 키트(PCR Purification kit, QIAGEN)를 사용해 정제하여 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다. 정제한 증폭 산물을 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDCM2 벡터와 상기 증폭 산물인 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하고, 인퓨전 클로닝 키트(Infusion Cloning Kit, TaKaRa)를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 ilvA(T381A, F383A) 변이를 염색체상에 도입하기 위한 벡터 pDCM2- ilvA(T381A, F383A) 를 제작하였다.
제작된 벡터를 전기천공법으로 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H) 에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 ilvA(T381A, F383A) 변이를 포함하는 균주를 얻었으며, 이를 코리네박테리움 글루타미쿰 CA10-3101이라 명명하였다.
실시예 5-2. CA10-3101 균주 내 pheA 변이체 도입 및 평가
L-이소류신 생산 균주인 CA10-3101을 상기 실시예 3-1에서 제작한 pDCM2-pheA(R182A)벡터로 형질전환하고 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신 25mg/L를 함유한 배지에서 선별하였다. 선별된 1차 균주는 다시 2차 교차(cross-over)를 거쳐, 목표 유전자의 변이가 도입된 균주를 선정하였다. 최종적으로 형질 전환된 균주의 pheA 유전자 변이 도입의 여부는 표 1의 서열번호 3과 서열번호 4의 프라이머를 이용하여 PCR을 수행한 후 염기서열을 분석함으로써 균주 내 pheA 변이가 도입 되었음을 확인하였다.
상기 제작된 CA10-3101_pheA_R182A 및 ATCC13032, CA10-3101 균주의 L-이소류신 및 L-페닐알라닌 생산능을 평가하였다. 이소류신 생산배지 25 ㎖을 함유하는 250 ㎖ 코너-바풀 플라스크에 모균주 및 상기 pheA 변이주를 접종한 후, 32℃에서 60시간동안 200 rpm으로 진탕 배양하여 L-이소류신을 제조하였다. 본 실시예 에서 사용한 생산배지의 조성은 하기와 같다.
<생산배지>
포도당 10%, 효모추출물 0.2%, 황산암모늄 1.6%, 제1인산칼륨 0.1%, 황산마그네슘7수염 0.1%, 황산철7수염 10mg/ℓ, 황산망간1수염 10 mg/ℓ, 비오틴 200 ㎍/ℓ, pH 7.2
배양종료 후, 액체고속크로마토그래피(HPLC)를 이용하여 L-이소류신 및 L-페닐알라닌의 생산량을 측정하였고, 실험한 각 균주에 대한 배양액 중의 L-이소류신과 부산물의 농도는 하기 표 12에 나타내었다.
　 L-이소류신 농도 (g/L) L-Phe 농도
(g/L)
ATCC13032 0.0 1.2
CA10-3101(모균주) 2.5 0.6
CA10-3101_pheA_R182A 3.0 0.2
상기 표 12 에 나타난 바와 같이, pheA 유전자에 R182A변이가 추가로 있는 L-이소류신 생산균주는 모균주인 코리네 글루타미쿰 CA10-3101에 비해 L-이소류신 생산능이 약 1.1 배 향상되었으며, CA10-3101_pheA_R182A 균주는 부산물인 L-페닐알라닌이 감소됨을 확인하였다.
상기 결과를 통해 pheA 단백질의 아미노산 서열 중 182번째 위치의 아미노산이 L-이소류신 생산 증가에 중요한 위치임을 확인할 수 있다.
실시예 6: 발린 생산주에서 pheA 선별 변이의 발린 및 페닐알라닌 생산능 확인
류신과 같은 대표적인 분지쇄 아미노산 L-발린에 대하여도 선별된 변이가 효과를 나타내는지를 확인하고자 코리네박테리움 속 발린 생산 균주 KCCM11201P에서도 선별한 변이를 도입하여 발린 및 페닐알라닌 생산능을 확인 하는 실험을 진행하였다. 구체적인 실험은 다음과 같다.
실시예 6-1. KCCM11201P 균주 내 pheA 변이체 도입 및 평가
해당 변이가 L-발린 생산능 증가에 효과가 있는지를 확인하기 위하여 L-발린 생산 균주인 코리네박테리움 글루타미쿰 KCCM11201P(US 8465962 B2) 균주를 이용하였다. 발린 생산 균주인 KCCM11201P를 상기 실시예 3-1에서 제작한 pDCM2-pheA(R182A) 벡터로 형질전환하고 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신 25mg/L를 함유한 배지에서 선별하였다. 선별된 1차 균주는 다시 2차 교차(cross-over)를 거쳐, 목표 유전자의 변이가 도입된 균주를 선정하였다. 최종적으로 형질 전환된 균주의 pheA 유전자 변이 도입의 여부는 표 1의 서열번호 3과 서열번호 4의 프라이머를 이용하여 PCR을 수행한 후 염기서열을 분석함으로써 균주 내 pheA 변이가 도입 되었음을 확인하였다. 제작된 균주를 KCCM11201P - pheA(R182A)로 각각 명명하였다.
상기 제작된 KCCM11201P - pheA(R182A) 균주의 발린 생산능을 평가하였다. 실시예 2와 같은 방식으로 플라스크 배양을 진행하였고 배양 종료 후 HPLC를 이용한 방법에 의해 발린 생산량을 측정하였으며, 배양 결과는 하기 표 13과 같다.
균주명 Val (g/L) Phe (mg/L)
KCCM11201P 2.60 146.62
KCCM11201P - pheA(R182A) 2.86 27.33
상기 표 13에 나타난 바와 같이, pheA 유전자에 R182A 변이가 추가로 있는 L-발린 생산균주 코리네박테리움 글루타미쿰 KCCM11201P - pheA(R182A) 은 모균주인 코리네박테리움 글루타미쿰 KCCM11201P에 비해 L-발린 생산능이 약 1.1배 향상됨을 확인하였다. KCCM11201P - pheA(R182A)은 모균주인 코리네박테리움 글루타미쿰 KCCM11201P에 비해 L-페닐알라닌 생산능이 5.36배 감소됨을 확인하였다. 상기 결과를 통해 pheA 단백질의 아미노산 서열 중 182번째 위치의 아미노산이 L-발린 생산 증가에 중요한 위치임을 확인할 수 있다.
참고예 1: gltA(M312I) 변이의 류신 생산에 대한 효과 확인
참고예 1-1. gltA 변이를 포함하는 삽입 벡터 제작
gltA(M312I; 서열번호 25) 변이 도입용 벡터 제작은 위치 지정 돌연변이 생성(Site directed mutagenesis) 방법을 사용하였다.
코리네박테리움 글루타미쿰 야생형의 염색체를 주형으로 서열번호 27 및 28의 프라이머 쌍, 서열번호 29 및 30의 프라이머 쌍을 이용하여 PCR을 수행하였다.
PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다. 그 결과 얻어진 유전자 단편을 SmaI 제한효소로 절단시킨 선상의 pDCM2 벡터와 인퓨전(In-Fusion) 효소를 이용해 DNA 단편간의 말단 15개 염기의 상동서열을 결합시켜 클로닝하여 312번째 아미노산인 메티오닌을 이소류신으로 치환하는 벡터 pDCM2-gltA(M312I)를 제작하였다.
서열번호 프라이머 서열(5'->3')
27 gltA M312I Up F GTGAATTCGAGCTCGGTACCCGCGGGAATCCTGCGTTACCGC
28 gltA M312I Up R TGTAAACGCGGTGTCCGAAGCCGATGAGGCGGACGCCGTCTT
29 gltA M312I Down F AAGACGGCGTCCGCCTCATCGGCTTCGGACACCGCGTTTACA
30 gltA M312I Down R GGTCGACTCTAGAGGATCCCCTTAGCGCTCCTCGCGAGGAAC
참고예 1-2. ATCC13032 균주 내 변이체 도입 및 평가
상기 참고예 1-1에서 제작한 pDCM2-gltA(M312I)벡터를 야생형 ATCC13032에 형질전환하고 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신 25mg/L를 함유한 배지에서 선별하였다. 선별된 1차 균주는 다시 2차 교차(cross-over)를 거쳐, 목표 유전자의 변이가 도입된 균주를 선정하였다. 최종 형질전환된 균주의 gltA 유전자 변이 도입의 여부는 서열번호 15 및 서열번호 16(실시예 4-1, 표 8)의 프라이머를 이용하여 PCR을 수행한 후 염기서열을 분석함으로써 균주 내 변이(서열번호 26)가 도입되었음을 확인하였다. 제작된 균주는 ATCC13032_gltA_M312I로 명명하였다.
상기 제작된 ATCC13032_gltA_M312I 균주의 류신 생산능을 평가하기 위해 플라스크 발효역가 평가를 진행하였다. 생산배지를 각각 25 ㎖ 함유하는 250 ㎖ 코너-바풀 플라스크에 모균주인 코리네박테리움 글루타미쿰 ATCC13032 및 상기 제작한 ATCC13032_gltA_M312I을 각각 1백금이 접종한 후, 30℃에서 60 시간 동안 200 rpm으로 진탕 배양하여 류신을 생산하였다. 배양종료 후 HPLC로 류신의 생산량을 측정하였다. 실험한 각 균주에 대한 배양액 중의 류신 농도는 하기 표 15과 같다.
- 생산배지: 포도당 100 g, (NH4)2SO4 40 g, 대두 단백질(Soy Protein) 2.5 g, 옥수수 침지고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1,000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3,000 ㎍, CaCO3 30 g (증류수 1리터 기준), pH 7.0
균주명 류신 (g/L)
ATCC13032 0.87
ATCC13032_gltA_M312I 1.25
이로부터 gltA의 M312I 치환이 류신 생산증가에 유효한 변이임을 확인하였다.
참고예 2: ilvA(T381A, F383A) 변이의 이소류신 생산에 대한 효과 확인
참고예 2-1: pECCG117-ilvA(F383A) 제작
쓰레오닌 디하이드라타제(서열번호 31)를 코딩하는 유전자인 ilvA(서열번호 32)를 증폭하기 위하여, 기보고된 F383A 변이가 도입된 ilvA 서열(World J Microbiol Biotechnol (2015) 31:1369-1377)에 근거하여 프로모터 부위(개시코돈 상단 약 300bp)로부터 터미네이터 부위(종결코돈 하단 약 100bp)까지 증폭하기 위한 프라이머(서열번호 33 및 서열번호 34)의 양 말단에 BamHI 제한 효소 부위를 삽입하였다. 또한, ilvA에 F383A 변이를 도입하기 위한 프라이머(서열번호 35 및 서열번호 36)를 사용하였다. 여기에서 사용된 프라이머 서열은 하기 표 16과 같다.
서열번호 명칭 서열
33 primer1 ggatccGACTGAGCCTGGGCAACTGG
34 primer2 ggatccCCGTCACCGACACCTCCACA
35 primer3 ACATCACGCTGgcaGAGTACCTCAA
36 primer4 TTGAGGTACTCtgcCAGCGTGATGT
야생형 코리네박테리움 글루타미쿰(wild type Corynebacterium glutamicum) ATCC 13032의 염색체를 주형으로 하여 서열번호 33 및 서열번호 34, 서열번호 35 및 서열번호 36의 프라이머를 이용하여 PCR을 수행하였다. PCR 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 90초 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과, ilvA 유전자의 변이를 중심으로 5' 상단 부위의 1460 bp의 DNA 단편과 3' 하단 부위의 276 bp DNA 단편을 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 35 및 서열번호 36의 프라이머로 PCR을 수행하였다.
그 결과, 383번째 페닐알라닌이 알라닌으로 치환된 ilvA 변이를 포함하는 1531 bp의 DNA 단편이 증폭되었다. pECCG117(대한민국 등록특허 제10-0057684호) 벡터와 ilvA DNA 단편을 제한 효소 BamHI으로 처리하고, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드를 획득하였고 이를 pECCG117-ilvA(F383A)라 명명하였다.
참고예 2-2: pECCG117-ilvA(F383A)에 무작위 변이 추가 도입
L-쓰레오닌 디하이드라타제를 코딩하는 유전자의 변이체를 얻기 위해 무작위 돌연변이 키트(random mutagenesis kit, Agilent Technologies, 미국)를 이용하여 ilvA 변이체 유전자 플라스미드를 제조하였다. 참고예 2-1의 ilvA(F383A) 염색체를 주형으로 하여 서열번호 35 및 서열번호 36의 프라이머를 이용하여 PCR을 수행하였다. PCR 조건은 95℃에서 2분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 90초 중합을 30회 반복한 후, 72℃에서 10분간 중합반응을 수행하였다.
그 결과, 383번째 페닐알라닌이 알라닌으로 치환된 변이 외에 추가적인 무작위 변이를 가진 L-쓰레오닌 디하이드라타제를 암호화할 수 있는 ilvA 변이체인 1531 bp의 DNA 단편이 증폭되었다. pECCG117 벡터와 ilvA 변이체 DNA 단편을 제한 효소 BamHI으로 처리하고, DNA 접합 효소를 이용하여 연결한 후, 클로닝함으로써 플라스미드군을 획득하였다.
참고예 2-3: CJILE-301 균주 제작
야생형 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H) 균주에 pECCG117-ilvA(F383A)를 도입하였고, 제작한 플라스미드를 도입한 균주는 ATCC13032 hom(R407H)/pECCG117-ilvA(F383A)로 명명하였다. 또한 참고예 2-2에서 얻어진 변이체 플라스미드군을 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H) 균주에 도입하였고, 최소배지에 도말하여 사멸율을 구해본 결과 사멸율은 70 %였으며 생존한 세포들을 종배지에 접종 배양, 최종적으로 ATCC13032 hom(R407H)/pECCG117-ilvA(F383A) 대조군보다 우수한 이소류신 생산능을 나타내는 변이주를 선별하여 코리네박테리움 글루타미쿰 CJILE-301(Corynebacterium glutamicum, CJILE-301)로 명명하였다.
CJILE-301균주로부터 플라스미드를 분리하여 ilvA 유전자를 시퀀싱 한 결과, ilvA 유전자의 1141번째 염기서열이 A에서 G로 치환되어 ilvA 단백질의 383번째 F가 A로 치환된 변이 외에 추가로 381번째 T가 A로 치환된 변이 단백질을 암호화할 수 있음을 확인하였으며 이는 서열번호 38으로 나타내었다.
참고예 2-4: ilvA 변이체(T381A, F383A) 도입
ilvA 변이체(T381A, F383A)를 야생형 균주로 도입하기 위하여 서열번호 21 및 서열번호 24 (실시예 5-1, 표 11)의 프라이머를 제작하였다.
ilvA 변이체(T381A, F383A)가 도입된 균주를 제작하기 위해 CJILE-301 균주로부터 추출한 플라스미드 DNA를 주형으로 서열번호 21 및 서열번호 24의 프라이머를 사용하여 PCR을 수행하였다.
PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 변성 95℃, 30초; 어닐링 55℃, 30초; 및 중합반응 72℃, 2분을 28회 반복하였다.
그 결과, 1311bp인 ilvA 유전자의 약 100bp 터미네이터 부위를 포함한 1411bp의 유전자 단편을 각각 수득하였다.
증폭 산물을 PCR 정제 키트를 사용하여 정제하고, 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다. 정제한 증폭 산물을 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDCM2벡터와 상기 증폭 산물인 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하고 인퓨전 클로닝 키트를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 T381A, F383A 변이를 염색체상에 도입하기 위한 벡터 pDCM2-T381A_F383A를 제작하였다.
제작된 벡터를 전기천공법에 의해 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H)에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 ilvA(T381A, F383A; 서열번호 37) 변이를 포함하는 균주를 얻었으며, 이를 CA10-3101으로 명명하였다.
상기 균주 CA10-3101은 2020년 5월 27일자로 부다페스트 조약하의 국제기탁기관인 한국미생물보존센터(KCCM)에 국제기탁하여 KCCM12739P로 기탁번호를 부여받았다.
상기 KCCM12739P 균주를 이소류신 생산배지 25 ㎖을 함유하는 250 ㎖ 코너-바풀 플라스크에 접종한 후, 32℃에서 60시간 동안 200 rpm으로 진탕 배양하여 L-이소류신을 제조하였다. 사용한 생산배지의 조성은 하기와 같다.
<생산배지>
포도당 10%, 효모추출물 0.2%, 황산암모늄 1.6%, 제1인산칼륨 0.1%, 황산마그네슘7수염 0.1%, 황산철7수염 10mg/L, 황산망간1수염 10 mg/L, 비오틴 200 ㎍/L, pH 7.2
배양종료 후, 고성능액체크로마토그래피(high-performance liquid chromatography, HPLC)를 이용하여 배양액 중의 L-이소류신과 L-쓰레오닌 농도를 측정하고, 그 결과를 하기 표 17에 나타내었다.
균주명 L-이소류신 (g/L) L-쓰레오닌(g/L)
ATCC13032 hom(R407H) 0.0 3.8
ATCC13032 hom(R407H) ilvA(WT) 0.0 3.7
CA10-3101(ATCC13032 hom(R407H) ilvA(T381A, F383A)) 3.3 0.0
상기 표 17에 나타난 바와 같이, 모균주인 코리네박테리움 글루타미쿰 ATCC 13032 hom(R407H)은 L-이소류신을 생산하지 못하였으나 ATCC13032 hom(R407H) ilvA(T381A, F383A) 변이주는 3.9 g/L의 농도로 L-이소류신을 생산하여, 모균주에 비해 L-이소류신 생산성이 현저하게 증가한 것을 확인하였다.
이로부터 ilvA(T381A, F383A) 변이가 이소류신 생산증가에 유효한 변이임을 확인하였다.
참고예 3: leuA(P247C, R558H, G561D)의 류신 생산에 대한 효과 확인
참고예 3-1. CJL-8100 균주 제작
KR 10-2018-0077008 A 에 공지된 leuA 유전자 변이를 포함하는 pDCM2-leuA(R558H, G561D) 벡터를 코리네박테리움 글루타미쿰 ATCC13032에 전기천공법으로 형질전환하고 카나마이신(kanamycin) 25 mg/L를 함유한 배지에서 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주를 선별하였다. 선별된 1차 균주는 다시 2차 교차(cross-over)를 거쳐, leuA 유전자의 변이가 도입된 균주를 선정하였다. 최종적으로 형질전환된 균주의 변이 도입 여부는 서열번호 39와 서열번호 43의 프라이머를 이용하여 PCR(94℃ 5분 후, 94℃ 30초/55℃ 30초/72℃ 90초 30회 반복, 72℃ 5분)을 수행하고 염기서열을 분석하여 R558H, G561D 변이가 도입된 것을 확인하였다. pDCM2-leuA(R558H, G561D) 벡터로 형질전환된 ATCC13032_leuA_(R558H, G561D) 균주를 'CJL-8100'으로 명명하였다.
이하 참고예 3에서 사용한 프라이머 서열을 표 18에 나타내었다.
서열번호 서열(5'->3')
서열번호 39 AACACGACCGGCATCCCGTCGC
서열번호 40 AAATCATTTGAGAAAACTCGAGG
서열번호 41 GTGAATTCGAGCTCGGTACCCAAATCATTTGAGAAAACTCGAGGC
서열번호 42 GGTGATCATCTCAACGGTGGAACACAGGTTGATGATCATTGGGTT
서열번호 43 AACCCAATGATCATCAACCTGTGTTCCACCGTTGAGATGATCACC
서열번호 44 GGTCGACTCTAGAGGATCCCCAAGAAGGCAACATCGGACAGC
서열번호 45 ATCCATTCAATGGAGTCTGCG
참고예 3-2. leuA 변이를 포함하는 삽입 벡터 제작
LeuA에 2개의 변이(R558H, G561D)가 도입된 L-류신 생산 균주인 CJL-8100에 P247C 변이를 도입하기 위한 벡터를 제작하였다.
CJL-8100 균주의 염색체를 주형으로 서열번호 39 및 40의 프라이머, 서열번호 41 및 42의 프라이머 쌍을 이용하여 PCR을 수행하였다. PCR은 94℃에서 5분간 변성 후, 94℃에서 30초, 55℃에서 30초, 72℃ 에서 1분 30초를 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다. 그 결과 얻어진 PCR 산물을 SmaI 제한효소로 절단시킨 선상의 pDCM2 벡터와 In-Fusion 효소를 이용해 DNA 단편 간의 말단 15 base의 상동서열을 fusion 시켜 클로닝하여, 야생형 균주의 LeuA 아미노산 서열에서 558 번째 아미노산인 아르기닌이 히스티딘으로 치환되고, 561 번째 아미노산인 글리신이 아스파르트산으로 치환된 LeuA 변이체를 암호화하는 leuA변이를 포함하고, LeuA의 247 번째 아미노산인 프롤린(Pro)을 시스테인(Cys)으로 치환하는 벡터 pDCM2-leuA(P247C, R558H, G561D)를 제작하였다.
참고예 3-3. CJL-8100 균주 내 LeuA 변이체(P247C) 도입 및 평가
L-류신 생산 균주인 CJL-8100을 상기 참고예 3-2에서 제작한 pDCM2-leuA(P247C, R558H, G561D) 벡터로 형질전환하고 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신(kanamycin) 25 mg/L를 함유한 배지에서 선별하였다. 선별된 1차 균주는 다시 2차 교차(cross-over)를 거쳐, 목표 유전자의 변이가 도입된 균주를 선정하였다. 최종적으로 형질전환된 균주의 leuA유전자 변이 도입의 여부는 서열번호 39과 서열번호 45의 프라이머를 이용하여 PCR(94℃ 5분 후, 94℃ 30초/55℃ 30초/72℃ 90초 30회반복, 72℃ 5분)을 수행한 후 염기서열을 분석하였다. 염기서열 분석 결과, 균주 염색체 내 leuA 유전자의 1673 번째 뉴클레오티드인 G가 A로 치환되고, 1682 번째, 1683 번째 뉴클레오티드인 GC가 AT로 치환되었으며, 739번째, 740번째 뉴클레오티드인 CC가 TG로 치환되어 LeuA 단백질의 558 번째 아미노산인 알지닌이 히스티딘으로 치환되고, 561 번째 아미노산인 글리신이 아스파르트산으로 치환되고, 247 번째 아미노산인 프롤린(Pro)이 시스테인(Cys)으로 치환된 LeuA 변이체(P247C, R558H, G561D)를 암호화하는 leuA 변이가 균주 내에 도입된 것을 확인하였다. 제작된 CJL8100_leuA_P247C 를 'CA13-8105'로 명명하고 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean Culture Center of Microorganisms, KCCM)에 2020년 4월 29일자로 기탁하여 기탁번호 KCCM12709P를 부여 받았다.
상기 총 3종의 변이를 포함하는 LeuA 변이체(P247C, R558H, G561D)의 아미노산 서열 및 이를 암호화하는 leuA 변이체의 염기 서열은 각각 서열번호 46 및 서열번호 47과 같다.
ATCC13032, 제작된 CJL-8100, 및 CA13-8105 균주의 L-류신의 생산능을 평가하였다. 구체적으로, 실시예 2-1과 같은 방식으로 플라스크 배양을 진행하였고, 배양 종료 후 HPLC를 이용하여, 모균주 및 변이 균주의 L-류신 생산량을 측정하여 그 결과를 표 19에 기재하였다.
균주명 L-류신 (g/L)
ATCC13032 0.87
ATCC13032_leuA_(R558H, G561D) : CJL-8100 2.71
CJL8100_leuA_P247C: CA13-8105 3.52
상기 표 19에 나타난 바와 같이, L-류신 생산 균주인 코리네박테리움 글루타미쿰 CJL8100은 모균주인 ATCC13032에 비해 L-류신 생산능이 약 130 % 향상되었다. CJL8100 균주 내 leuA_P247C 변이를 추가적으로 도입한 CA13-8105 균주는 모균주인 CJL8100 대비 L-류신 생산능이 약 150 % 향상되었다.
이로부터 leuA(R558H, G561D, P247C) 변이가 류신 생산 증가에 유효한 변이임을 확인하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2022000984-appb-img-000001
Figure PCTKR2022000984-appb-img-000002
Figure PCTKR2022000984-appb-img-000003

Claims (15)

  1. 서열번호 1의 아미노산 서열에서 N-말단으로부터 182번 위치에 상응하는 아미노산이 다른 아미노산으로 치환된, 프리페네이트 탈수 효소 (prephenate dehydratase) 변이체.
  2. 제1항에 있어서, 상기 변이체는 서열번호 1의 아미노산 서열에서 N-말단으로부터 182번 위치에 상응하는 아미노산이 아르기닌 외의 아미노산으로의 치환을 포함하는, 프리페네이트 탈수 효소 변이체.
  3. 제1항에 있어서, 상기 다른 아미노산으로의 치환은 비극성(nonpolar) 아미노산 또는 크기가 작은 아미노산으로의 치환인 것인, 프리페네이트 탈수 효소 변이체.
  4. 제1항에 있어서, 상기 다른 아미노산은 알라닌(Ala)인 것인, 프리페네이트 탈수 효소 변이체.
  5. 제1항에 있어서, 상기 프리페네이트 탈수 효소는 서열번호 5와 99% 이상 상동성 또는 동일성을 갖는 것인, 프리페네이트 탈수 효소 변이체.
  6. 제1항에 있어서, 상기 프리페네이트 탈수 효소 변이체는 서열번호 1의 프리페네이트 탈수 효소에 비해 약화된 활성을 갖는 것인, 프리페네이트 탈수 효소 변이체.
  7. 제1항 내지 제6항 중 어느 한 항의 프리페네이트 탈수 효소 변이체를 코딩하는 폴리뉴클레오티드.
  8. 제7항의 폴리뉴클레오티드를 포함하는 벡터.
  9. 제1항 내지 제6항 중 어느 한 항의 프리페네이트 탈수 효소 변이체; 상기 프리페네이트 탈수 효소 변이체를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 1 이상을 포함하는 코리네박테리움 속 미생물.
  10. 제9항에 있어서, 상기 미생물은 코리네박테리움 글루타미쿰인 것인, 미생물.
  11. 제9항에 있어서, 상기 미생물은 분지쇄 아미노산 생산용인 것인, 코리네박테리움 속 미생물.
  12. 제11항에 있어서, 상기 분지쇄 아미노산은 L-류신, L-이소류신 및 L-발린 중 선택되는 1 이상인 것인, 코리네박테리움 속 미생물.
  13. 제9항의 미생물을 배지에서 배양하는 단계를 포함하는, 분지쇄 아미노산 생산 방법.
  14. 제13항에 있어서, 상기 방법은 분지쇄 아미노산을 미생물 또는 배지로부터 회수하는 단계를 더 포함하는, 분지쇄 아미노산 생산 방법.
  15. 제13항에 있어서, 상기 분지쇄 아미노산은 L-류신, L-이소류신 및 L-발린 중 선택되는 1 이상인 것인, 분지쇄 아미노산 생산 방법.
PCT/KR2022/000984 2021-02-01 2022-01-19 프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법 WO2022164118A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
MX2023009027A MX2023009027A (es) 2021-02-01 2022-01-19 Variante de prefenato deshidratasa y procedimiento de produccion de aminoácidos de cadena ramificada utilizando la misma.
AU2022211934A AU2022211934A1 (en) 2021-02-01 2022-01-19 Prephenate dehydratase variant and method for producing branched-chain amino acid using same
CA3206397A CA3206397A1 (en) 2021-02-01 2022-01-19 Prephenate dehydratase variant and method of producing branched-chain amino acids using the same
EP22746145.6A EP4303301A1 (en) 2021-02-01 2022-01-19 Prephenate dehydratase variant and method for producing branched-chain amino acid using same
CN202280012955.1A CN116917473A (zh) 2021-02-01 2022-01-19 预苯酸脱水酶变体以及使用其生产支链氨基酸的方法
JP2023545938A JP2024506841A (ja) 2021-02-01 2022-01-19 プレフェナート脱水酵素変異体及びそれを用いた分岐鎖アミノ酸生産方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210014077A KR102527096B1 (ko) 2021-02-01 2021-02-01 프리페네이트 탈수 효소 (Prephenate dehydratase) 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
KR10-2021-0014077 2021-02-01

Publications (1)

Publication Number Publication Date
WO2022164118A1 true WO2022164118A1 (ko) 2022-08-04

Family

ID=82653618

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/000984 WO2022164118A1 (ko) 2021-02-01 2022-01-19 프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법

Country Status (8)

Country Link
EP (1) EP4303301A1 (ko)
JP (1) JP2024506841A (ko)
KR (1) KR102527096B1 (ko)
CN (1) CN116917473A (ko)
AU (1) AU2022211934A1 (ko)
CA (1) CA3206397A1 (ko)
MX (1) MX2023009027A (ko)
WO (1) WO2022164118A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117757704A (zh) * 2022-12-19 2024-03-26 元素驱动(杭州)生物科技有限公司 一种提高支链氨基酸（bcaa）产量的方法及菌株构建

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240031779A (ko) 2022-09-01 2024-03-08 현대모비스 주식회사 배터리 전압 측정 장치 및 이의 제어 방법

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH05344881A (ja) * 1992-06-15 1993-12-27 Ajinomoto Co Inc 発酵法によるｌ−フェニルアラニンの製造法
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
US8030036B2 (en) 2003-07-29 2011-10-04 Ajinomoto Co., Inc. Method for producing L-lysine or L-threonine
US8465962B2 (en) 2011-08-16 2013-06-18 Cj Cheiljedang Corporation Microorganism having enhanced L-valine productivity and method for producing L-valine using the same
US9109242B2 (en) 2006-09-15 2015-08-18 Cj Cheiljedang Corporation Corynebacteria having enhanced L-lysine productivity and a method of producing L-lysine using the same
KR101830002B1 (ko) * 2016-10-11 2018-02-19 대상 주식회사 부기질의 공급 강화를 통한 l-트립토판이 과발현되는 균주 및 이를 이용하는 l-트립토판의 제조 방법
KR20180077008A (ko) 2016-12-28 2018-07-06 씨제이제일제당 (주) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof
KR102143964B1 (ko) 2019-12-06 2020-08-12 씨제이제일제당 주식회사 신규한 분지쇄 아미노산 아미노트랜스퍼라제 변이체 및 이를 이용한 류신 생산방법
US20200340022A1 (en) 2018-12-21 2020-10-29 Cj Cheiljedang Corporation Modified homoserine dehydrogenase and method for producing homoserine or l-amino acid derived from homoserine using the same
KR20200136813A (ko) 2020-03-17 2020-12-08 씨제이제일제당 (주) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH05344881A (ja) * 1992-06-15 1993-12-27 Ajinomoto Co Inc 発酵法によるｌ−フェニルアラニンの製造法
US8030036B2 (en) 2003-07-29 2011-10-04 Ajinomoto Co., Inc. Method for producing L-lysine or L-threonine
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
US9109242B2 (en) 2006-09-15 2015-08-18 Cj Cheiljedang Corporation Corynebacteria having enhanced L-lysine productivity and a method of producing L-lysine using the same
US8465962B2 (en) 2011-08-16 2013-06-18 Cj Cheiljedang Corporation Microorganism having enhanced L-valine productivity and method for producing L-valine using the same
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof
KR101830002B1 (ko) * 2016-10-11 2018-02-19 대상 주식회사 부기질의 공급 강화를 통한 l-트립토판이 과발현되는 균주 및 이를 이용하는 l-트립토판의 제조 방법
KR20180077008A (ko) 2016-12-28 2018-07-06 씨제이제일제당 (주) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
US20200340022A1 (en) 2018-12-21 2020-10-29 Cj Cheiljedang Corporation Modified homoserine dehydrogenase and method for producing homoserine or l-amino acid derived from homoserine using the same
KR102143964B1 (ko) 2019-12-06 2020-08-12 씨제이제일제당 주식회사 신규한 분지쇄 아미노산 아미노트랜스퍼라제 변이체 및 이를 이용한 류신 생산방법
KR20200136813A (ko) 2020-03-17 2020-12-08 씨제이제일제당 (주) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
"Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
ATSCHUL, S. F., J MOLEC BIOL, vol. 215, 1990, pages 403
CARILLO: "SIAM J Applied Math", vol. 48, 1988, pages: 1073
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
JENNIFER NELMS, EDWARDS R MARK, WARWICK JULIA, FOTHERINGHAM IAN: "Novel Mutations in the pheA Gene of Eschenichia coli K-12 Which Result in Highly Feedback Inhibition-Resistant Variants of Chorismate Mutase/Prephenate Dehydratase", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 58, no. 1, 1 August 1992 (1992-08-01), pages 2592 - 2598, XP055596013, DOI: 10.1128/aem.58.8.2592-2598.1992 *
NAKASHIMA N ET AL.: "Bacterial cellular engineering by genome editing and gene silencing", INT J MOL SCI, vol. 15, no. 2, 2014, pages 2773 - 2793, XP055376889, DOI: 10.3390/ijms15022773
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET, vol. 16, 2000, pages 276 - 277, XP004200114, DOI: 10.1016/S0168-9525(00)02024-2
SAMBROOK ET AL., MOLECULAR CLONING, 2012
SHIH-KUANG HSU, LONG-LIU LIN, HSUEH-HSIA LO, WEN-HWEI HSU: "Mutational analysis of feedback inhibition and catalytic sites of prephenate dehydratase from Corynebacterium glutamicum", ARCHIVES OF MICROBIOLOGY, vol. 181, no. 3, 1 March 2004 (2004-03-01), pages 237 - 244, XP055082373, ISSN: 03028933, DOI: 10.1007/s00203-004-0649-5 *
SITNICKA ET AL.: "Functional Analysis of Genes", ADVANCES IN CELL BIOLOGY, vol. 50-51, 2010, pages 1 - 16
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482
WEINTRAUB, H ET AL.: "Antisense-RNA as a molecular tool for genetic analysis", REVIEWS - TRENDS IN GENETICS, vol. 1, no. 1, 1986
WORLD J MICROBIOL BIOTECHNOL, vol. 31, 2015, pages 1369 - 1377
ZHANG SHENG, WILSON DAVID B., GANEM BRUCE: "Probing the Catalytic Mechanism of Prephenate Dehydratase by Site-Directed Mutagenesis of the Escherichia coli P-Protein Dehydratase Domain", BIOCHEMISTRY, vol. 39, no. 16, 1 April 2000 (2000-04-01), pages 4722 - 4728, XP055954095, ISSN: 0006-2960, DOI: 10.1021/bi9926680 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117757704A (zh) * 2022-12-19 2024-03-26 元素驱动(杭州)生物科技有限公司 一种提高支链氨基酸（bcaa）产量的方法及菌株构建

Also Published As

Publication number Publication date
AU2022211934A1 (en) 2023-08-17
EP4303301A1 (en) 2024-01-10
MX2023009027A (es) 2023-10-19
KR102527096B1 (ko) 2023-04-28
CN116917473A (zh) 2023-10-20
KR20220110992A (ko) 2022-08-09
JP2024506841A (ja) 2024-02-15
CA3206397A1 (en) 2022-08-04

Similar Documents

Publication Publication Date Title
WO2020204427A1 (ko) 신규 l-트립토판 배출 단백질 변이체 및 이를 이용한 l-트립토판을 생산하는 방법
WO2019164348A1 (ko) 신규 l-트립토판 배출 단백질 및 이를 이용한 l-트립토판을 생산하는 방법
WO2017069578A1 (ko) L-이소루신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용하여 l-이소루신을 생산하는 방법
WO2021150029A1 (ko) Nadp 의존적 글리세르알데하이드-3-포스페이트 디하이드로지나제를 포함하는 미생물을 이용하여 ｌ-아미노산을 생산하는 방법
WO2017014532A1 (ko) 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법
WO2021125896A1 (ko) 내막 단백질의 변이체 및 이를 이용한 목적 산물 생산 방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2021049866A1 (ko) L-쓰레오닌 배출 단백질의 변이체 및 이를 이용한 l-쓰레오닌 생산 방법
WO2021060696A1 (ko) 디하이드로디피콜린산 리덕타제 변이형 폴리펩티드 및 이를 이용한 l-쓰레오닌 생산방법
WO2022163951A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022164118A1 (ko) 프리페네이트 탈수 효소 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
WO2019164351A1 (ko) 마이코스포린 유사 아미노산을 생산하는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산방법
WO2020226341A1 (ko) L-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산을 생산하는 방법
WO2022050671A1 (ko) L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
WO2022225075A1 (ko) 신규한 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2021261733A1 (ko) L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법
WO2022124708A1 (ko) 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022231036A1 (ko) 신규한 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2021045472A1 (ko) 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법
WO2022163981A1 (ko) Arog 알돌라아제 변이체 및 이를 이용한 분지쇄 아미노산 생산 방법
WO2021153866A1 (ko) 시트레이트 신타아제의 활성이 약화된 신규한 변이형 폴리펩티드 및 이를 이용한 l-아미노산 생산 방법
WO2021060701A1 (ko) 메조 디아미노피멜레이트 디하이드로게네이즈 변이형 폴리펩타이드 및 이를 이용한 l-쓰레오닌 생산방법
WO2022231042A1 (ko) 신규한 변이체 및 이를 이용한 l-발린 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22746145

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3206397

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2023545938

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: MX/A/2023/009027

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 202280012955.1

Country of ref document: CN

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023015367

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2022746145

Country of ref document: EP

Effective date: 20230802

ENP Entry into the national phase

Ref document number: 2022211934

Country of ref document: AU

Date of ref document: 20220119

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112023015367

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230731

NENP Non-entry into the national phase

Ref country code: DE