WO2023121055A1 - L-이소루신 생산 미생물 및 이를 이용한 l-이소루신 생산 방법 - Google Patents

L-이소루신 생산 미생물 및 이를 이용한 l-이소루신 생산 방법 Download PDF

Info

Publication number
WO2023121055A1
WO2023121055A1 PCT/KR2022/019684 KR2022019684W WO2023121055A1 WO 2023121055 A1 WO2023121055 A1 WO 2023121055A1 KR 2022019684 W KR2022019684 W KR 2022019684W WO 2023121055 A1 WO2023121055 A1 WO 2023121055A1
Authority
WO
WIPO (PCT)
Prior art keywords
isoleucine
microorganism
seq
glutamate dehydrogenase
polypeptide
Prior art date
Application number
PCT/KR2022/019684
Other languages
English (en)
French (fr)
Inventor
김희정
정기용
김희영
최우성
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to EP22911688.4A priority Critical patent/EP4435108A1/en
Priority to CA3242006A priority patent/CA3242006A1/en
Publication of WO2023121055A1 publication Critical patent/WO2023121055A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/01—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with NAD+ or NADP+ as acceptor (1.4.1)
    • C12Y104/01002—Glutamate dehydrogenase (1.4.1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
    • C12N9/0016—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with NAD or NADP as acceptor (1.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine

Definitions

  • the present application relates to a microorganism capable of producing L-isoleucine into which a gene encoding foreign glutamate dehydrogenase has been introduced, a method for producing L-isoleucine using the microorganism, and L-isoleucine including the microorganism It relates to a production composition.
  • L-isoleucine is a type of branched-chain amino acid among a total of 20 amino acids, and is classified as an essential amino acid and is used in animal feed, food additives, and medicine. Since L-isoleucine functions such as post-metabolic energy production, hemoglobin production, blood sugar control, muscle production and repair, it is increasingly used in animal feed as well as infusions, nutrients, and sports nutrients.
  • L-isoleucine For the production of L-isoleucine, Corynebacterium glutamicum and Escherichia coli are used as representative microorganisms. In these microorganisms, L-isoleucine shares a major biosynthetic pathway with other branched-chain amino acids, L-valine and L-leucine. Looking at the biosynthetic pathway of L-isoleucine, 2-ketobutyrate, which is produced from L-threonine, an amino acid derived from pyruvate and aspartic acid, produced during glycolysis It is used as a precursor to finally produce L-isoleucine.
  • L- glutamate is a precursor that provides an amine group in synthesizing amino acids including L- isoleucine.
  • amino acids it is essential to enhance the synthesis of L-glutamate, a precursor.
  • a side reaction that produces ⁇ -aminobutyric acid (AABA) as a by-product occurs through the dehydrogenation of 2-ketobutyrate, a substance (Microb Cell Fact. 2017 Mar 23;16(1 ):51), and thus, there is a problem in that the purity and biosynthetic efficiency of L-isoleucine are lowered.
  • AABA ⁇ -aminobutyric acid
  • the present inventors have proposed a microorganism capable of producing L-isoleucine into which a gene encoding foreign glutamate dehydrogenase has been introduced, a method for producing L-isoleucine using the microorganism, and an L-isoleucine containing the microorganism
  • the present application was completed by developing a composition for production.
  • One object of the present application is to introduce a gene encoding an exogenous glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales, which has the ability to produce L-isoleucine. to provide microbes.
  • Another object of the present application is to provide a method for producing L-isoleucine comprising culturing the microorganism in a medium.
  • Another object of the present application is to provide a composition for producing L-isoleucine containing the microorganism.
  • a microorganism capable of producing L-isoleucine into which a gene encoding foreign glutamate dehydrogenase of the present application has been introduced can produce L-isoleucine in high yield with less by-products, thereby producing L-isoleucine It can be usefully used for industrial production of leucine.
  • Bacillus subtilis Bacillus subtilis
  • Rhodospirillales derived from foreign glutamate dehydrogenase (Glutamate dehydrogenase) coding gene is introduced having L-isoleucine production ability provide microbes.
  • L-isoleucine refers to an L-amino acid with the chemical formula HO2CCH(NH2)CH(CH3)CH2CH3 corresponding to a branched-chain amino acid together with L-valine and L-leucine as one of the essential amino acids. .
  • strain or microorganism
  • strain includes both wild-type microorganisms and naturally or artificially genetically modified microorganisms, and causes such as insertion of foreign genes or enhancement or inactivation of endogenous gene activity.
  • a microorganism whose specific mechanism is attenuated or enhanced due to, it may be a microorganism containing genetic modification for the production of a desired polypeptide, protein or product.
  • microorganism having L-isoleucine-producing ability means that a microorganism having L-isoleucine-producing ability naturally or a parent strain without L-isoleucine-producing ability has L-isoleucine-producing ability. means a given microorganism.
  • the microorganism is a microorganism that produces L-isoleucine into which a gene encoding an exogenous glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales has been introduced. It may, but is not limited thereto.
  • the "L-isoleucine-producing microorganism” includes both wild-type microorganisms and naturally or artificially genetically modified microorganisms. More specifically, as a microorganism in which a specific mechanism is weakened or enhanced due to a cause such as insertion of an external gene or enhancement or inactivation of the activity of an endogenous gene, genetic mutation occurs for the production of desired L-isoleucine or L-isoleucine. - It may be a microorganism with enhanced isoleucine production activity.
  • the microorganism having the ability to produce L-isoleucine is a gene encoding an exogenous glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales. Introduced, characterized in that the desired L-isoleucine production ability is increased, and may be a genetically modified microorganism or a recombinant microorganism, but is not limited thereto.
  • the term "introduction" of activity means that the activity of a specific protein is expressed as a gene that the microorganism does not originally have is expressed in the microorganism, or the activity is increased or improved compared to the intrinsic activity or activity of the corresponding protein before modification. means to be active.
  • a polynucleotide encoding a specific protein may be introduced into a chromosome of a microorganism, or a vector including a polynucleotide encoding a specific protein may be introduced into a microorganism to exhibit its activity.
  • the recombinant strain with increased production capacity is about 1% or more, specifically about 1% or more, about 2%, compared to the L-isoleucine production capacity of the parent strain before mutation or the non-modified microorganism having the intrinsic activity of the gdh protein.
  • greater than or equal to about 3% greater than or equal to about 4%, greater than or equal to about 5%, greater than or equal to about 6%, greater than or equal to about 7%, greater than or equal to about 8%, greater than or equal to about 8.1%, greater than or equal to about 8.2%, or greater than or equal to about 8.3% It is not limited, and may be, for example, about 100% or less, about 50% or less, about 25% or less, about 20% or less, about 15% or less, or about 10% or less). It is not limited thereto as long as it has an increased amount of + value compared to the productivity of the modified microorganism.
  • the recombinant strain having increased production capacity has an L-isoleucine production capacity of about 1.01 times or more, about 1.02 times or more, about 1.03 times or more, about 1.04 times or more, about 1.05 times or more, about 1.06 times or more, about 1.07 times or more, or about 1.08 times or more (the upper limit is not particularly limited, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, about 1.5 times or less) or less than or equal to about 1.1 times) may be increased, but is not limited thereto.
  • the term "unmodified microorganism” does not exclude strains containing mutations that may occur naturally in microorganisms, and are wild-type strains or wild-type strains themselves, or are genetically modified by natural or artificial factors. It may mean a strain before change.
  • the non-modified microorganism may refer to a strain before introduction of the foreign glutamate dehydrogenase gene described herein.
  • the "unmodified microorganism” may be used interchangeably with "strain before transformation", “microorganism before transformation”, “non-mutated strain”, “unmodified strain”, “non-mutated microorganism” or "reference microorganism".
  • the microorganism of the present application may be a microorganism capable of producing L-isoleucine, and the type is not particularly limited.
  • the microorganism of the present application may be either a prokaryotic cell or a eukaryotic cell, but may specifically be a prokaryotic cell.
  • the prokaryotic cells are, for example, Corynebacterium genus, Escherichia genus, Erwinia genus, Seratia genus, Providencia genus, and Brevibacterium ( Brevibacterium ) It may include a microbial strain belonging to the genus, specifically Corynebacterium ( Corynebacterium ) It may be a microorganism of the genus.
  • microbes of the genus Corynebacterium may include all microorganisms of the genus Corynebacterium. Specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ( Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium efficiens ( Corynebacterium efficiens ) .
  • Corynebacterium striatum Corynebacterium striatum
  • Corynebacterium ammoniagenes Corynebacterium ammoniagenes
  • Corynebacterium pollutisoli Corynebacterium pollutisoli
  • Corynebacterium imitans Corynebacterium imitans
  • Corynebacterium testudino It may be Corynebacterium testudinoris or Corynebacterium flavescens , and more specifically Corynebacterium glutamicum.
  • glutamate dehydrogenase is an enzyme that synthesizes glutamate, a precursor of L-isoleucine biosynthesis, and in the present application, the “glutamate dehydrogenase” refers to “gdh”, “rocG “It can be mixed with
  • the terms "protein having glutamate dehydrogenase activity” and "gene encoding glutamate dehydrogenase” include any protein having the above glutamate dehydrogenase activity and any gene encoding the same. may be included without limitation.
  • the glutamate dehydrogenase is known in the art, and the protein and gene sequences of the glutamate dehydrogenase can be obtained from known databases, such as NCBI's GenBank, but are not limited thereto no.
  • L- glutamate is a precursor that provides an amine group in synthesizing amino acids including L- isoleucine.
  • amino acids it is essential to enhance the synthesis of L-glutamate, a precursor, but in the case of enhancing the glutamate dehydrogenase known to produce glutamate in L-isoleucine-producing microorganisms, isoleucine
  • a side reaction that generates ⁇ -aminobutyric acid (AABA) as a by-product occurs through the dehydrogenation of 2-ketobutyrate, an intermediate substance (Microb Cell Fact. 2017 Mar 23;16( 1): 51), and thus, there is a problem in that the purity and biosynthesis efficiency of L-isoleucine are lowered.
  • AABA ⁇ -aminobutyric acid
  • the microorganism having the ability to produce L-isoleucine of the present application is a by-product by introducing a gene encoding a foreign glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales. production may be reduced.
  • the by-product may be ⁇ -aminobutyric acid (AABA).
  • AABA ⁇ -aminobutyric acid
  • the decrease in the amount of by-product production may mean, but is not limited to, a decrease in the amount of ⁇ -aminobutyric acid (AABA) compared to the amount of L-isoleucine produced compared to the wild-type microorganism.
  • the protein having glutamate dehydrogenase activity may be from Bacillus subtilis or Rhodospirillales.
  • the glutamate dehydrogenase may have and/or include the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3, or may consist essentially of or consist of the amino acid sequence.
  • the glutamate dehydrogenase of the present application is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% of the amino acid sequence described in SEQ ID NO: 1 or SEQ ID NO: 3 %, 99%, 99.5%, 99.7% or 99.9% or more homologous or identical amino acid sequences.
  • an amino acid sequence having such homology or identity and exhibiting an efficacy corresponding to the glutamate dehydrogenase of the present application some of the sequences are deleted, modified, substituted, conservatively substituted, or glutamate dehydrogenase having an added amino acid sequence. It is obvious that Naise is also included within the scope of the present application.
  • polypeptide or protein comprising the amino acid sequence described in a specific sequence number', 'a polypeptide or protein consisting of the amino acid sequence described in a specific sequence number', or 'a polypeptide or protein having an amino acid sequence described in a specific sequence number'
  • a protein having an amino acid sequence in which some sequence is deleted, modified, substituted, conservatively substituted, or added can also be used in this application. is self-explanatory. For example, it is a case of adding a sequence that does not change the function of the protein, a naturally occurring mutation, a silent mutation thereof, or a conservative substitution to the N-terminus and/or C-terminus of the amino acid sequence. .
  • sequence additions or deletions for example, sequence additions or deletions, naturally occurring mutations, latent mutations (silent mutation) or conservative substitution.
  • conservative substitution means the substitution of one amino acid with another amino acid having similar structural and/or chemical properties. Such amino acid substitutions can generally occur based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues.
  • positively charged (basic) amino acids include arginine, lysine, and histidine
  • Negatively charged (acidic) amino acids include glutamic acid and aspartate
  • Aromatic amino acids include phenylalanine, tryptophan, and tyrosine
  • hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan.
  • amino acids can be classified into amino acids with electrically charged side chains and amino acids with uncharged side chains.
  • Amino acids with electrically charged side chains are astric acid, glutamic acid, lysine , Arginine, including histidine
  • amino acids with uncharged side chains can be further classified as nonpolar amino acids or polar amino acids, and nonpolar amino acids are glycine, alanine, valine, leucine, and isoleucine.
  • Tryptophan, proline, and polar amino acids can be classified as including serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • conservative substitutions have little or no effect on the activity of the resulting polypeptide.
  • conservative substitutions may have little or no effect on the activity of the protein or polypeptide.
  • glutamate dehydrogenase can include deletions or additions of amino acids that have minimal impact on the secondary structure and properties of the polypeptide.
  • a polypeptide may be conjugated with a signal (or leader) sequence at the N-terminus of a protein that is involved in protein transfer either co-translationally or post-translationally.
  • the polypeptide may also be conjugated with other sequences or linkers to allow identification, purification, or synthesis of the polypeptide.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences and can be expressed as a percentage.
  • the terms homology and identity are often used interchangeably.
  • Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms, together with default gap penalties established by the program used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of the sequence under moderate or high stringent conditions. It is obvious that hybridization also includes hybridization with polynucleotides containing common codons or codons in consideration of codon degeneracy in polynucleotides.
  • GAP program can define the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or 10 gap opening penalty, 0.5 gap extension penalty); and (3) no penalty for end gaps.
  • corresponding to refers to an amino acid residue at a recited position in a polypeptide, or an amino acid residue that is similar, identical, or homologous to a recited residue in a polypeptide. Identification of the amino acid at the corresponding position may be determining the specific amino acid in the sequence that references the specific sequence.
  • corresponding region generally refers to a similar or corresponding position in a related or reference protein.
  • any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1.
  • sequence alignment algorithms such as those described herein, can identify the location of amino acids, or locations where modifications such as substitutions, insertions, or deletions occur, compared to a query sequence (also referred to as a “reference sequence”).
  • Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277) may be used, but it is not limited thereto, and a sequence alignment program known in the art, a pairwise sequence comparison algorithm, and the like may be appropriately used.
  • intrinsic activity refers to the active state of a protein originally possessed by a microorganism in its natural state or prior to modification of the corresponding protein. This may be used interchangeably with “activation before transformation”.
  • the term "enhancement" of polypeptide activity means that the activity of the polypeptide is increased relative to the intrinsic activity.
  • the enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.
  • activation, enhancement, upregulation, overexpression, and increase may include those that exhibit an activity that was not originally possessed, or those that exhibit enhanced activity compared to intrinsic activity or activity before modification.
  • intrinsic activity refers to the activity of a specific polypeptide originally possessed by the parent strain or non-transformed microorganism before transformation when the character changes due to genetic mutation caused by natural or artificial factors.
  • activity before transformation and “Enhancement”, “upregulation”, “overexpression” or “increase” of the activity of a polypeptide compared to its intrinsic activity means the activity of a specific polypeptide originally possessed by the parent strain or non-transformed microorganism before transformation. And / or improved compared to the concentration (expression amount).
  • the enhancement can be achieved by introducing a foreign polypeptide or by enhancing the activity and/or concentration (expression level) of an endogenous polypeptide. Whether or not the activity of the polypeptide is enhanced can be confirmed from an increase in the activity level, expression level, or amount of a product released from the corresponding polypeptide.
  • Enhancement of the activity of the polypeptide can be applied by various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to the microorganism before transformation. Specifically, it may be using genetic engineering and / or protein engineering, which is well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • modification of the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide eg, modification of the polynucleotide sequence of the polypeptide gene to encode the modified polypeptide to enhance the activity of the polypeptide
  • It may be a combination of two or more selected from 1) to 8), but is not particularly limited thereto.
  • the increase in the intracellular copy number of the polynucleotide encoding the polypeptide is achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the corresponding polypeptide is operably linked. it may be Alternatively, it may be achieved by introducing one copy or two or more copies of a polynucleotide encoding the corresponding polypeptide into the chromosome of the host cell.
  • the introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome of the host cell into the host cell, but is not limited thereto.
  • the vector is as described above.
  • the expression control region may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating termination of transcription and translation.
  • the original promoter may be replaced with a strong promoter, but is not limited thereto.
  • Examples of known strong promoters include the CJ1 to CJ7 promoter (US Patent US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, etc., but are not limited thereto.
  • Modification of the nucleotide sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a nucleotide sequence encoding another initiation codon with a higher polypeptide expression rate than the endogenous initiation codon. It may be substituted, but is not limited thereto.
  • Modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may include deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide.
  • the combination thereof may be a sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto.
  • the replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
  • the vector used at this time may further include a selection marker for checking whether the chromosome is inserted.
  • the selectable marker is as described above.
  • Introduction of a foreign polynucleotide exhibiting the activity of the polypeptide may be introduction of a foreign polynucleotide encoding a polypeptide exhibiting the same/similar activity as the polypeptide into a host cell.
  • the foreign polynucleotide is not limited in origin or sequence as long as it exhibits the same/similar activity as the polypeptide.
  • the method used for the introduction can be performed by appropriately selecting a known transformation method by a person skilled in the art, and expression of the introduced polynucleotide in a host cell can generate a polypeptide and increase its activity.
  • the codon optimization of the polynucleotide encoding the polypeptide is codon optimization of the endogenous polynucleotide to increase transcription or translation in the host cell, or optimization of the transcription or translation of the foreign polynucleotide in the host cell. It may be that the codons of this have been optimized.
  • Analyzing the tertiary structure of the polypeptide to select and modify or chemically modify the exposed site for example, by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, depending on the degree of sequence similarity. It may be to determine a template protein candidate according to the method, confirm the structure based on this, and modify or modify an exposed portion to be chemically modified to be modified or modified.
  • Such enhancement of polypeptide activity is an increase in the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or unmodified microbial strain, or an increase in the amount of the product produced from the corresponding polypeptide. It may be, but is not limited thereto.
  • the microorganism is an exogenous microorganism having the activity of glutamate hydrogenase derived from Bacillus subtilis or Rhodospirillales to enhance glutamate dehydrogenase protein activity.
  • Polynucleotides can be incorporated.
  • polynucleotide is a polymer of nucleotides in which nucleotide monomers are covalently linked in a long chain shape, and is a DNA or RNA strand of a certain length or more, more specifically, encoding the variant means a polynucleotide fragment.
  • the polynucleotide according to the present application is characterized in that it is derived from Bacillus subtilis or Rhodospirillales , and specifically, the polynucleotide encodes the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 It may include a nucleotide sequence, and more specifically, a gene encoding the exogenous glutamate dehydrogenase derived from the Bacillus subtilus; and a gene encoding an exogenous glutamate dehydrogenase derived from Rhodospirillares; may have the nucleotide sequences of SEQ ID NOs: 2 and 4, respectively, but are not limited thereto.
  • the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4 can be obtained from a known database, such as NCBI's GenBank, but is not limited thereto.
  • the gene comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4 is a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4, a gene having the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or It may be used in combination with a polynucleotide, a gene consisting of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or a polynucleotide.
  • polynucleotides of the present application are various in the coding region within the range that does not change the amino acid sequence of the variants of the present application in consideration of codon degeneracy or preferred codons in organisms intended to express the variants of the present application. Transformations can be made.
  • the polynucleotide of the present application has 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more homology or identity with the sequence of SEQ ID NO: 2 or SEQ ID NO: 4 have or contain at least 97%, at least 98%, and less than 100% of the nucleotide sequence, or at least 70%, at least 75%, at least 80% homology or identity with the sequence of SEQ ID NO: 2 or SEQ ID NO: 4; 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and may consist essentially of, or consist essentially of, a base sequence that is less than 100%, but is not limited thereto.
  • the polynucleotide of the present application is not limited as long as it is a probe that can be prepared from a known gene sequence, for example, a sequence that can hybridize under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application.
  • the "stringent condition” means a condition that allows specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • polynucleotides with high homology or identity 70% or more, 75% or more, 6% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, Or a condition in which polynucleotides having 99% or more homology or identity hybridize and polynucleotides having lower homology or identity do not hybridize, or 60 ° C., which is a washing condition for normal southern hybridization, 1 ⁇ SSC, 0.1% SDS, specifically at 60°C, 0.1 ⁇ SSC, 0.1% SDS, more specifically at a salt concentration and temperature equivalent to 68°C, 0.1 ⁇ SSC, 0.1% SDS, washed once, specifically 2 to 3 times conditions can be enumerated.
  • 6 ° C. which is a washing condition for normal southern hybridization, 1 ⁇ SSC, 0.1% SDS, specifically at 60°C, 0.1 ⁇ SSC, 0.1% SDS, more specifically at a salt concentration and temperature equivalent to 68°C,
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine.
  • the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the entire sequence.
  • a polynucleotide having homology or identity to the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the above-described conditions.
  • the Tm value may be 60 ° C, 63 ° C or 65 ° C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • Appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, parameters well known in the art (e.g., J. Sambrook et al., supra).
  • the microorganism may include an expression vector for expressing the foreign polynucleotide in a host, so that the activity of the glutamate dehydrogenase protein is enhanced compared to the intrinsic activity, but is not limited thereto.
  • the vector of the present application may include a DNA product containing the nucleotide sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to express the target polypeptide in a suitable host.
  • the expression control region may include a promoter capable of initiating transcription, an arbitrary operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating termination of transcription and translation.
  • the vector After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can integrate into the genome itself.
  • Vectors used in the present application are not particularly limited, and any vectors known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors , pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, pSK-based, pSKH-based, pET-based, etc.
  • pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pSK, pSKH130, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used.
  • a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for chromosomal insertion into a cell. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • a selection marker for determining whether the chromosome is inserted may be further included.
  • the selectable marker is used to select cells transformed with a vector, that is, to determine whether a target nucleic acid molecule has been inserted, and can exhibit selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. markers may be used. In an environment treated with a selective agent, only cells expressing the selectable marker survive or exhibit other expression traits, so transformed cells can be selected.
  • the term "transformation” means introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide can be expressed in the host cell, it may be inserted into and located in the chromosome of the host cell or located outside the chromosome.
  • the polynucleotide includes DNA and/or RNA encoding a polypeptide of interest.
  • the polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a genetic construct containing all elements required for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.
  • operably linked means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates the transcription of the polynucleotide encoding the target variant of the present application.
  • Modification of some or all of the polynucleotides in the microorganism of the present application is (a) genome editing using homologous recombination or genetic scissors (engineered nuclease, e.g., CRISPR-Cas9) using a vector for chromosomal insertion into the microorganism and / or (b) It may be induced by light and/or chemical treatment, such as ultraviolet light and radiation, but is not limited thereto.
  • a method of modifying part or all of the gene may include a method using DNA recombination technology.
  • a part or all of a gene may be deleted by injecting a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene into the microorganism to cause homologous recombination.
  • the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
  • a microorganism of the genus Corynebacterium may additionally include an enzyme involved in an L-isoleucine biosynthetic pathway with enhanced activity.
  • enzyme involved in the L-isoleucine biosynthetic pathway includes aspartate kinase (lysC gene), aspartate- ⁇ -semialdehyde dehydrogenase (asd gene), homoserine dehydrogenase (hom gene), homoserine kinase (thrB gene), threonine synthase (thrC gene), threonine dehydratase ( threonine dehydratase (ilvA gene), aminotransferase (aminotransferase (ilvE gene)), etc. may be included, but are not limited thereto.
  • Another aspect of the present application provides a method for producing L-isoleucine comprising culturing the microorganism in a medium.
  • the microorganism, L-isoleucine, is as described above.
  • the gene encoding the exogenous glutamate dehydrogenase derived from the Bacillus subtilus; and a gene encoding an exogenous glutamate dehydrogenase derived from Rhodospirillares may have the nucleotide sequences of SEQ ID NOs: 2 and 4, respectively, but are not limited thereto.
  • the amount of L-isoleucine produced compared to ⁇ -aminobutyric acid may be reduced, but is not limited thereto.
  • the term "culture” means growing the microorganisms of the present application under appropriately controlled environmental conditions.
  • the culturing process of the present application may be performed according to appropriate media and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art according to the selected strain.
  • the culture may be batch, continuous and fed-batch, but is not limited thereto.
  • the term "medium” refers to a material in which nutrients necessary for culturing the microorganisms of the present application are mixed as main components, and supplies nutrients and growth factors, including water essential for survival and growth.
  • the medium and other culture conditions used for culturing the microorganisms of the present application can be any medium without particular limitation as long as it is a medium used for culturing ordinary microorganisms, but the microorganisms of the present application are suitable as carbon sources, nitrogen sources, personnel, and inorganic materials. It can be cultured while controlling temperature, pH, etc. under aerobic conditions in a conventional medium containing compounds, amino acids, and/or vitamins.
  • Examples of the carbon source in the present application include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, and maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sorghum pomace and corn steep liquor can be used, specifically glucose and sterilized pretreated molasses (i.e. converted to reducing sugar).
  • Carbohydrates such as molasses
  • other carbon sources in an appropriate amount may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, etc., organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine, etc.
  • organic nitrogen sources such as peptone, NZ-amine,
  • the number of persons may include monopotassium phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto.
  • the inorganic compound sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and amino acids, vitamins, and/or appropriate precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, it is not limited thereto.
  • the pH of the culture may be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. to the culture in an appropriate manner during the culture of the microorganism.
  • an antifoaming agent such as a fatty acid polyglycol ester.
  • oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected without gas injection or nitrogen, hydrogen or carbon dioxide gas may be injected to maintain the anaerobic and non-aerobic state, but is limited thereto It doesn't work.
  • the temperature of the culture may be 25 °C to 40 °C, more specifically 28 °C to 37 °C, but is not limited thereto.
  • the culturing period may be continued until a desired production amount of a useful substance is obtained, and specifically may be 1 hour to 100 hours, but is not limited thereto.
  • L-isoleucine produced by the culture of the present application may be secreted into the medium or remain in the cells.
  • the L-isoleucine production method of the present application includes preparing the microorganism of the present application, preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example , Prior to the culturing step, it may be further included.
  • the L-isoleucine production method of the present application may further include a step of recovering L-isoleucine from the culture medium (culture medium) or microorganism.
  • the recovering step may be further included after the culturing step.
  • the recovery may be to collect the desired L-isoleucine using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method.
  • a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method.
  • various chromatography such as doe chromatography, HPLC, or these methods, and the desired L-isoleucine may be recovered from a medium or microorganism using a suitable method known in the art.
  • the method for producing L-isoleucine of the present application may additionally include a purification step.
  • the purification may be performed using suitable methods known in the art.
  • the recovery step and the purification step are performed continuously or discontinuously regardless of order, simultaneously or in one step. It may be performed in an integrated manner, but is not limited thereto.
  • Another aspect of the present application provides a composition for producing L-isoleucine containing the microorganism.
  • the microorganism, L-isoleucine, is as described above.
  • the gene encoding the exogenous glutamate dehydrogenase derived from the Bacillus subtilus; and a gene encoding an exogenous glutamate dehydrogenase derived from Rhodospirillares may have the nucleotide sequences of SEQ ID NOs: 2 and 4, respectively, but are not limited thereto.
  • the amount of L-isoleucine produced compared to ⁇ -aminobutyric acid may be reduced, but is not limited thereto.
  • composition of the present application may further include any suitable excipients commonly used in compositions for producing L-isoleucine, such excipients include, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffers, stabilizers, or isotonic agents. It may be a topic, etc., but is not limited thereto.
  • Another aspect of the present application is an L-isoform into which a gene encoding a foreign glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales of the present application is introduced. It is to provide a use of a microorganism having a leucine-producing ability for producing L-isoleucine.
  • Example 1 Construction of a recombinant vector for introduction of foreign glutamate dehydrogenase
  • NCgl2872 known as a gene encoding a transposon in Corynebacterium glutamicum, was used as an insertion site (Journal of Biotechnology 104, 5-25 Jorn Kalinowski et al, 2003).
  • a vector with NCgl2872 deletion and target gene insertion was constructed.
  • PCR was performed using the primer pair of SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively, using the chromosome of ATCC13032 as a template.
  • the polymerase for the PCR reaction was PfuUltraTM high-reliability.
  • DNA polymerase (Stratagene) was used, and PCR conditions were denatured at 95 ° C for 30 seconds; Denaturation at 55° C. for 30 seconds; and 72° C. for 1 minute polymerization, and denaturation, annealing, and polymerization under these conditions were repeated 28 times. As a result, DNA fragments of 623 bp and 620 bp, respectively, were obtained.
  • the obtained DNA product was purified using a PCR purification kit (QUIAGEN), and the heat-treated pDCM2 vector (Korean Patent Publication No.
  • the vector pDCM2 ⁇ N2872 for NCgl2872 deletion and target gene insertion was constructed by cloning according to the provided manual.
  • Corynebacterium glutamicum To prepare a strain into which foreign gdh having the gdh promoter of the parent strain, Corynebacterium glutamicum, was introduced, Corynebacterium glutamicum ATC13032, Escherichia coli, Bacillus subtilis, Rhodospirillares ( Rhodospirillales) and Mycobacterium smegmatis (Mycobacterium smegmatis) chromosomes as templates, respectively SEQ ID NO: 9 and SEQ ID NO: 10; or SEQ ID NO: 9 and SEQ ID NO: 11; or SEQ ID NO: 12 and SEQ ID NO: 13; or SEQ ID NO: 14 and SEQ ID NO: 15; or SEQ ID NO: 16 and SEQ ID NO: 17; Alternatively, PCR was performed using primers of SEQ ID NO: 18 and SEQ ID NO: 19; Primer sequences used to perform each of the PCRs are as shown in Table 1 below.
  • PfuUltraTM high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and PCR conditions were denatured at 95° C. for 30 seconds; Denaturation at 55° C. for 30 seconds; and 72° C. for 1 minute polymerization, and denaturation, annealing, and polymerization under these conditions were repeated 28 times.
  • PCR conditions were denatured at 95° C. for 30 seconds; Denaturation at 55° C. for 30 seconds; and 72° C. for 1 minute polymerization, and denaturation, annealing, and polymerization under these conditions were repeated 28 times.
  • a 519bp DNA fragment of the gdh promoter region a 1882bp DNA fragment of the Corynebacterium glutamicum ATC13032 gdh region including the promoter, a 1382bp DNA fragment of the gdh region of E.
  • SEQ ID NO: 9 and SEQ ID NO: 13 using the amplified promoter and the foreign gdh DNA fragment as templates; or SEQ ID NO: 9 and SEQ ID NO: 15; or SEQ ID NO: 9 and SEQ ID NO: 17;
  • PCR was performed with primers of SEQ ID NO: 9 and SEQ ID NO: 19; After denaturation at 95°C for 5 minutes under PCR conditions, denaturation at 95°C for 30 seconds; Annealing at 55° C. for 30 seconds; And after repeating 28 times of polymerization at 72° C. for 2 minutes, polymerization was performed at 72° C. for 5 minutes.
  • a 2Kb foreign gdh DNA fragment encoding foreign glutamate dehydrogenase with the Corynebacterium glutamicum ATC13032 gdh promoter was amplified.
  • the amplification product was purified using a PCR Purification kit (QUIAGEN) and used as an insert DNA fragment for vector construction.
  • the purified amplification product was treated with restriction enzyme smaI, and then the molar concentration (M) ratio of the pDCM2 ⁇ N2872 vector heat-treated at 65 ° C.
  • Example 2 Production of Corynebacterium genus strains having L-isoleucine production ability
  • Wild-type Corynebacterium glutamicum has the ability to produce L-isoleucine, but does not overproduce it. Therefore, in order to identify genetic traits that increase L-isoleucine-producing ability according to the purpose of the present application, strains with increased L-isoleucine-producing ability were intended to be utilized.
  • an L-isoleucine producing strain was developed from wild-type Corynebacterium glutamicum ATCC13032. Specifically, in order to overcome the feedback inhibition of threonine, a precursor of isoleucine, in the L-isoleucine biosynthetic pathway, the gene hom encoding homoserine dehydrogenase is mutated to obtain homoserine dehydrogenase The 407th amino acid of arginine was substituted with histidine (Korean Patent Registration No. 10-1996769). Specifically, the polynucleotide sequence encoding hom(R407H) is shown in SEQ ID NO: 20.
  • PCR was performed using the primers of SEQ ID NO: 23 and SEQ ID NO: 24, respectively.
  • Primer sequences used to perform each of the PCRs are shown in Table 2 below.
  • sequence number designation order 21 primer TCGAGCTCGGTACCCCGCTTTTGCACTCATCGAGC 22 primer CACGATCAGAGTGTGCATCATCAT 23 primer ATGATGATGCACATCTGATCGTG 24 primer CTCTAGAGGATCCCCGAGCATCTTCCAAAACCTTG
  • PfuUltraTM high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and PCR conditions were denatured at 95° C. for 30 seconds; Annealing at 55° C. for 30 seconds; and polymerization reaction 72 ° C. 1 minute polymerization reaction, and denaturation, annealing, and polymerization under these conditions were repeated 28 times. As a result, a 1000 bp DNA fragment of the 5' upper region and a 1000 bp DNA fragment of the 3' lower region were obtained, respectively, centering on the mutation of the hom gene.
  • PCR was performed with primers of SEQ ID NO: 21 and SEQ ID NO: 24 using the two amplified DNA fragments as templates. After denaturation at 95°C for 5 minutes under PCR conditions, denaturation at 95°C for 30 seconds; Annealing at 55° C. for 30 seconds; And after repeating 28 times of polymerization at 72° C. for 2 minutes, polymerization was performed at 72° C. for 5 minutes.
  • a 2 kb DNA fragment containing a mutation of the hom gene encoding a homoserine dehydrogenase mutant in which the 407th arginine is substituted with histidine was amplified.
  • the amplification product was purified using a PCR Purification kit (QUIAGEN) and used as an insert DNA fragment for vector construction. After treating the purified amplification product with restriction enzyme smaI, the molar concentration (M) ratio of the pDCM2 vector heat-treated at 65 ° C.
  • the prepared vector was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and a strain containing the hom (R407H) mutation on the chromosome was obtained through a secondary crossing process, which was transformed into Corynebacterium glutamicum It was named ATCC13032 hom (R407H).
  • ilvA a gene encoding L-threonine dehydratase, was mutated, Threonine, the 381st amino acid of L-threonine dehydratase (SEQ ID NO: 25), was substituted with alanine, and phenylalanine, the 383rd amino acid, was substituted with alanine.
  • Threonine the 381st amino acid of L-threonine dehydratase (SEQ ID NO: 25)
  • phenylalanine the 383rd amino acid
  • sequence number designation order 26 primer TCGAGCTCGGTACCCATGAGTGAAACATACGTGTC 27 primer GCGCTTGAGGTACTCtgcCAGCGcGATGTCATCATCCGG 28 primer CCGGATGATGACATCgCGCTGgcaGAGTACCTCAAGCGC 29 primer CTCTAGAGGATCCCCCGTCACCGACACCTCCACA
  • PfuUltraTM high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and PCR conditions were denatured at 95° C. for 30 seconds; Denaturation at 55° C. for 30 seconds; and 72° C. for 1 minute polymerization, and denaturation, annealing, and polymerization under these conditions were repeated 28 times. As a result, a 1126 bp DNA fragment at the 5' upper end and a 286 bp DNA fragment at the 3' lower end were obtained, respectively, centering on the mutation of the ilvA gene.
  • PCR was performed with primers of SEQ ID NO: 26 and SEQ ID NO: 29 using the two amplified DNA fragments as templates. After denaturation at 95°C for 5 minutes under PCR conditions, denaturation at 95°C for 30 seconds; Annealing at 55° C. for 30 seconds; And after repeating 28 times of polymerization at 72° C. for 2 minutes, polymerization was performed at 72° C. for 5 minutes.
  • a 1.4 kb DNA fragment containing a mutation in the ilvA gene encoding an L-threonine dehydratase variant in which the 381st threonine was substituted with alanine and the 383rd phenylalanine was substituted with alanine was amplified.
  • the amplification product was purified using a PCR Purification kit (QUIAGEN) and used as an insert DNA fragment for vector construction. After treating the purified amplification product with restriction enzyme smaI, the molar concentration (M) ratio of the pDCM2 vector heat-treated at 65 ° C.
  • the infusion cloning kit (Infusion A vector pDCM2-ilvA (T381A + F383A) for introducing the ilvA (T381A + F383A) mutation onto the chromosome was constructed by cloning using a cloning kit (TaKaRa) according to the provided manual.
  • the prepared vector was transformed into Corynebacterium glutamicum ATCC13032 hom (R407H) by electroporation, and a strain containing the ilvA (T381A + F383A) mutation on the chromosome was obtained through a secondary crossing process, which was It was named Nebacterium glutamicum CA10-3101.
  • the KCCM11248P/pECCG117-ilvA (T381A+F383A) strain introduced with the ilvA (T381A+F383A) mutation showed significantly higher L-isoleucine production than the KCCM11248P or KCCM11248P/pECCG117-ilvA (F383A) strain. increased, and it was confirmed that the L-threonine degradation rate was high. In other words, for the purpose of the present application, it was confirmed that the ilvA (T381A+F383A) mutation was introduced to increase L-isoleucine feedback release and activity.
  • Example 3 Production of L-isoleucine strains introduced with foreign gdh and evaluation of isoleucine-producing ability
  • Example 1 The vector prepared in Example 1 was transformed into Corynebacterium glutamicum CA10-3101 prepared in Example 2 by electroporation, and a strain into which foreign gdh was introduced on the chromosome through a secondary crossing process was obtained, and introduction was confirmed through SEQ ID NO: 30 and SEQ ID NO: 31.
  • Primer sequences used to perform the PCR are as shown in the table below.
  • sequence number designation order 30 primer AACTGATGCCTGAGGACAAG 31 primer GCTTGATACCGAAGCAAACC
  • CA10-3101 ⁇ N2872 was introduced as CA10-3135
  • CA10-3101 ⁇ N2872::Pn_gdh (C.gl) was introduced as CA10-3136
  • CA10-3101 ⁇ N2872::Pn_gdh (eco) The introduced strain was designated as CA10-3137
  • the strain introduced with CA10-3101 ⁇ N2872::Pn_rocG(B.su) was designated as CA10-3138
  • the strain introduced with CA10-3101 ⁇ N2872::Pn_gdh(rhodospirillales) was designated as CA10-3138.
  • the strain into which CA10-3101 ⁇ N2872::Pn_gdh (m.sm) was introduced was named CA10-3140.
  • each strain was evaluated for fermentation titer in the following manner.
  • L- isoleucine was prepared by inoculating the parent strain and the mutant strain in a 250 ml corner-bar pool flask containing 25 ml of isoleucine production medium, and culturing at 32° C. for 60 hours with shaking at 200 rpm.
  • composition of the production medium used in this example is as follows.
  • L-isoleucine concentration (g/L) AABA concentration (g/L) CA10-3101 (parent strain) 2.4 0.8 CA10-3135 2.5 1.6 CA10-3136 2.6 1.4 CA10-3137 2.5 1.7 CA10-3138 2.6 0.8 CA10-3139 2.5 0.7 CA10-3140 2.7 2.1
  • L-isoleucine was 8.3% for CA10-3136 and CA10-3138, 4.2% for CA10-3135, CA10-3137 and CA10-3139, and 12.5% for CA10-3140. % increase was confirmed.
  • AABA a by-product, increased by 100% in CA10-3135, 75% in CA10-3136, 112.5% in CA10-3137, and 162.5% in CA10-3140 compared to the parent strain. It was confirmed that it decreased by 12.5%.
  • Corynebacterium glutamicum CA10-3101 the rocG (b.su) and gdh (rhodospirillales) introduced strains (CA10-3138, CA10-3139) compared to the amount of L-isoleucine production in ⁇ -aminobutyric acid. It was confirmed that the production of ⁇ -aminobutyric acid (AABA) was reduced. In addition, it was confirmed that the production of L-isoleucine was equivalent to that of Corynebacterium glutamicum ATC13032 gdh introduced strain CA10-3135, but the production of ⁇ -aminobutyric acid (AABA) was reduced.
  • AABA ⁇ -aminobutyric acid
  • Example 4 Preparation and evaluation of foreign gdh fortified strain in L-isoleucine producing strain Corynebacterium glutamicum KCCM11248P strain
  • NTG N-Methyl-N'-nitro-N-nitrosoguanidine treated rocG (derived from b.su) and gdh (derived from rhodospirillales) effective for increasing L-isoleucine production capacity and reducing by-products confirmed in Example 3 above.
  • a microorganism into which a gene encoding an exogenous glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales of the present application has been introduced can improve the purity of L-isoleucine. It was confirmed that L-isoleucine can be produced in high yield by increasing the amount.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 출원은 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입된 L-이소루신 생산능을 가지는 미생물, 상기 미생물을 이용한 L-이소루신 생산방법 및 상기 미생물을 포함하는 L-이소루신 생산용 조성물에 관한 것이다.

Description

L-이소루신 생산 미생물 및 이를 이용한 L-이소루신 생산 방법
본 출원은 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입된 L-이소루신 생산능을 가지는 미생물, 상기 미생물을 이용한 L-이소루신 생산방법 및 상기 미생물을 포함하는 L-이소루신 생산용 조성물에 관한 것이다.
L-이소루신(L-isoleucine)은 총 20가지의 아미노산 중 분지쇄 아미노산 (branched-chain amino acid)의 한 종류로 필수아미노산으로 분류되어 동물 사료, 식품 첨가물 및 의약 분야에 사용된다. L-이소루신은 대사 후 에너지 생성, 헤모글로빈 생성, 혈당 조절, 근육 생성 및 보수 등의 기능을 하기 때문에 수액제, 영양제, 스포츠 영양제뿐만 아니라 동물 사료에도 사용이 증가되고 있다.
L-이소루신 생산을 위해서는 코리네박테리움 글루타미쿰 (Corynebacterium glutamicum)과 대장균 (Escherichia coli)이 대표적인 미생물로 이용되고 있다. 이 미생물들에서 L-이소루신은 다른 분지쇄 아미노산인 L-발린, L-류신과 주된 생합성 경로를 공유하고 있다. L-이소루신의 생합성 경로를 살펴보면 해당 과정 (Glycolysis)에서 생성되는 피루브산 (pyruvate)과 아스파르트산 (Aspartate, Aspartic acid) 유래 아미노산인 L-쓰레오닌으로부터 생성된 2-케토부티르산(2-ketobutyrate)이 전구체로 사용되어 최종적으로 L-이소루신이 생산된다.
L-아미노산 생산을 위해 다양한 미생물 및 이의 변이체를 이용하는 방법이 알려져 있다(미국 등록특허 제10113190호). 그러나, 변이체를 사용한 방법의 경우, L-이소루신을 제외한 부산물이 다수 생성되며, 이는 정제 단계에서 L-이소루신의 순도를 낮추는 문제점이 있다.
이와 관련하여, L-이소루신의 순도를 높이기 위해 L-이소루신 정제방법 등이 알려져 있으나(미국 등록특허 제6072083호), 상기 정제방법은 별도의 추가적인 정제 과정이 요구되는 단점이 있어, L-이소루신의 순도를 증가시키는 방법의 개발이 필요한 실정이다.
한편, L-글루타메이트는 L-이소루신을 포함한 아미노산을 합성하는데 있어 아민기를 제공하는 전구체이다. 아미노산을 생산하는데 있어서 전구체인 L-글루타메이트 합성 강화가 필수적이나, L-이소루신을 생산하는 미생물에서 글루타메이트를 생성하는 것으로 알려져 있는 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 강화하는 경우, 이소루신의 중간물질인 2-케토부티르산(2-ketobutyrate)의 탈수소반응을 통해 부산물인 α-아미노부티릭산(α-aminobutyric acid, AABA)을 생성하는 부반응이 일어나므로 (Microb Cell Fact. 2017 Mar 23;16(1):51), 이에 따라, L-이소루신 순도 및 생합성 효율이 낮아지는 문제점이 있다.
본 발명자들은 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입된 L-이소루신 생산능을 가지는 미생물, 상기 미생물을 이용한 L-이소루신 생산방법 및 상기 미생물을 포함하는 L-이소루신 생산용 조성물을 개발하여 본 출원을 완성하였다.
본 출원의 하나의 목적은 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래의 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입된 L-이소루신 생산능을 가지는 미생물을 제공하는 것이다.
본 출원의 다른 하나의 목적은 상기 미생물을 배지에서 배양하는 단계를 포함하는 L-이소루신의 생산 방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 미생물을 포함하는 L-이소루신 생산용 조성물을 제공하는 것이다.
본 출원의 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입된 L-이소루신 생산능을 가지는 미생물은, 부산물이 적게 생성되어 고수율로 L-이소루신을 생산할 수 있어 L-이소루신의 산업적 생산에 유용하게 활용될 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
본 출원의 하나의 양태는 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래의 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입된 L-이소루신 생산능을 가지는 미생물을 제공한다.
본 출원에서 용어, "L-이소루신"은 필수 아미노산의 하나로 구조적으로 L-발린, L-루신과 함께 분지쇄 아미노산에 해당하는 화학식 HO2CCH(NH2)CH(CH3)CH2CH3인 L-아미노산을 의미한다.
본 출원에서 용어, "균주(또는, 미생물)"는 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 폴리펩티드, 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
본 출원에서 용어, "L-이소루신 생산능을 가지는 미생물"이란, 자연적으로 L-이소루신의 생산능을 가지고 있는 미생물 또는 L-이소루신의 생산능이 없는 모균주에 L-이소루신의 생산능이 부여된 미생물을 의미한다. 구체적으로 상기 미생물은 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래의 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입된, L-이소루신을 생산하는 미생물일 수 있으나, 이에 제한되지 않는다.
구체적으로, 상기 "L-이소루신을 생산하는 미생물"은 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함한다. 더욱 구체적으로, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 L-이소루신 생산을 위하여 유전적 변이가 일어나거나 L-이소루신 생산 활성을 강화시킨 미생물일 수 있다. 본 출원의 목적상, 상기 L-이소루신 생산능을 가지는 미생물은 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래의 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입되어, 목적하는 L-이소루신 생산능이 증가된 것을 특징으로 하며, 유전적으로 변형된 미생물 또는 재조합 미생물일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, 활성의 "도입"은, 미생물이 본래 가지고 있지 않았던 유전자가 그 미생물내에서 발현됨에 따라 특정 단백질의 활성을 나타나게 되는 것 또는 해당 단백질의 내재적 활성 또는 변형 전 활성에 비하여 증가 또는 향상된 활성을 나타나게 되는 것을 의미한다. 예를 들어, 특정 단백질을 코딩하는 폴리뉴클레오티드가 미생물 내 염색체로 도입되거나, 특정 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터가 미생물 내로 도입되어 이의 활성이 나타나는 것일 수 있다.
일 예로, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 gdh 단백질의 내재적 활성을 가지는 비변형 미생물의 L-이소루신 생산능에 비하여 약 1% 이상, 구체적으로는 약 1% 이상, 약 2% 이상, 약 3% 이상, 약 4% 이상, 약 5% 이상, 약 6% 이상, 약 7% 이상, 약 8% 이상, 약 8.1% 이상, 약 8.2% 이상 또는 약 8.3% 이상 (상한값은 특별한 제한은 없으며, 예컨대, 약 100% 이하, 약 50% 이하, 약 25% 이하, 약 20% 이하, 약 15% 이하 또는 약 10% 이하일 수 있음) 증가된 것일 수 있으나, 변이 전 모균주 또는 비변형 미생물의 생산능에 비해 +값의 증가량을 갖는 한, 이에 제한되지 않는다. 다른 예에서, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물에 비하여, L-이소루신 생산능이 약 1.01배 이상, 약 1.02배 이상, 약 1.03배 이상, 약 1.04배 이상, 약 1.05배 이상, 약 1.06배 이상, 약 1.07배 이상 또는 약 1.08배 이상(상한값은 특별한 제한은 없으며, 예컨대, 약 10배 이하, 약 5배 이하, 약 3배 이하, 약 2배 이하, 약 1.5배 이하 또는 약 1.1배 이하일 수 있음) 증가된 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 본 명세서에 기재된 외래 글루타메이트 디하이드로게네이즈 유전자가 도입되기 전의 균주를 의미할 수 있다. 상기 "비변형 미생물"은 "변형 전 균주", "변형 전 미생물", "비변이 균주", "비변형 균주", "비변이 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
본 출원의 또 다른 일 예로, 본 출원의 미생물은 L-이소루신을 생산할 수 있는 미생물 일 수 있으며, 그 종류는 특별히 제한되지 않는다. 본 출원의 미생물은 원핵세포 또는 진핵세포 모두 가능하나, 구체적으로 원핵세포일 수 있다. 상기 원핵세포는, 일 예로 코리네박테리움(Corynebacterium) 속, 에스케리키아(Escherichia) 속, 어위니아(Erwinia) 속, 세라티아(Seratia) 속, 프로비덴시아(Providencia)속 및 브레비박테리움(Brevibacterium) 속에 속하는 미생물 균주를 포함할 수 있으며, 구체적으로 코리네박테리움(Corynebacterium) 속 미생물일 수 있다.
본 출원에서 "코리네박테리움 속 미생물"은 모든 코리네박테리움 속 미생물을 포함할 수 있다. 구체적으로, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있고, 더욱 구체적으로 코리네박테리움 글루타미쿰일 수 있다.
본 출원에서 용어, “글루타메이트 디하이드로게네이즈 (Glutamate dehydrogenase)"는 L-이소루신 생합성의 전구체인 글루타메이트를 합성하는 효소로서, 본 출원에서 상기 "글루타메이트 디하이드로게네이즈"는 "gdh", "rocG"와 혼용될 수 있다.
본 출원에서 용어, "글루타메이트 디하이드로게네이즈 활성을 가지는 단백질" 및 "글루타메이트 디하이드로게네이즈를 코딩하는 유전자"에는 상기와 같은 글루타메이트 디하이드로게네이즈 활성을 가지는 임의의 단백질 및 이를 코딩하는 임의의 유전자가 제한 없이 포함될 수 있다. 구체적으로, 상기 글루타메이트 디하이드로게네이즈는 당업계에 공지되어 있으며, 상기 글루타메이트 디하이드로게네이즈의 단백질 및 유전자 서열은 공지의 데이터베이스에서 얻을 수 있으며, 그 예로 NCBI의 GenBank 등이 있으나, 이에 제한되는 것은 아니다.
한편, L-글루타메이트는 L-이소루신을 포함한 아미노산을 합성하는데 있어 아민기를 제공하는 전구체이다. 아미노산을 생산하는데 있어서 전구체인 L-글루타메이트 합성 강화가 필수적이나, L-이소루신을 생산하는 미생물에서 글루타메이트를 생성하는 것으로 알려져 있는 상기 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 강화하는 경우, 이소루신의 중간물질인 2-케토부티르산(2-ketobutyrate)의 탈수소반응을 통해 부산물인 α-아미노부티릭산(α-aminobutyric acid, AABA)을 생성하는 부반응이 일어나므로 (Microb Cell Fact. 2017 Mar 23;16(1):51), 이에 따라, L-이소루신 순도 및 생합성 효율이 낮아지는 문제점이 있다.
본 출원의 L-이소루신 생산능을 가지는 미생물은 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래의 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입됨으로써, 부산물 생성량이 감소될 수 있다. 상기 부산물은 α-아미노부티릭산(α-aminobutyric acid, AABA)일 수 있다. 상기 부산물 생성량의 감소는, 야생형 미생물에 비해, L-이소루신 생성량 대비 α-아미노부티릭산(α-aminobutyric acid, AABA)의 생성량이 감소된 것을 의미할 수 있으나 이에 제한되지 않는다.
본 출원의 목적상, 상기 글루타메이트 디하이드로게네이즈 활성을 가지는 단백질은 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래일 수 있다. 구체적으로, 상기 글루타메이트 디하이드로게네이즈는 서열번호 1 또는 서열번호 3으로 기재된 아미노산 서열을 가지거나 및/또는 포함하거나, 상기 아미노산 서열로 필수적으로 이루어지거나(essentially consisting of), 구성될 수 있다.
또한, 본 출원의 글루타메이트 디하이드로게네이즈는 상기 서열번호 1 또는 서열번호 3으로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 글루타메이트 디하이드로게네이즈에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 글루타메이트 디하이드로게네이즈도 본 출원의 범위 내에 포함됨은 자명하다.
본 출원에서 '특정 서열번호로 기재된 아미노산 서열을 포함하는 폴리펩티드 또는 단백질', '특정 서열번호로 기재된 아미노산 서열로 이루어진 폴리펩티드 또는 단백질' 또는 '특정 서열번호로 기재된 아미노산 서열을 갖는 폴리펩티드 또는 단백질'라고 기재되어 있더라도, 해당 서열번호의 아미노산 서열로 이루어진 폴리펩티드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원에서 사용될 수 있음은 자명하다. 예를 들어, 상기 아미노산 서열 N-말단 그리고/또는 C-말단에 단백질의 기능을 변경하지 않는 서열 추가, 자연적으로 발생할 수 있는 돌연변이, 이의 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다.
예를 들어, 상기 아미노산 서열 N-말단, C-말단 그리고/또는 내부에 본 출원의 글루타메이트 디하이드로게네이즈의 기능을 변경하지 않는 서열 추가 또는 결실, 자연적으로 발생할 수 있는 돌연변이, 잠재성 돌연변이(silent mutation) 또는 보존적 치환을 가지는 경우이다.
본 출원에서 용어 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 예를 들면, 양으로 하전된 (염기성) 아미노산은 아르기닌, 라이신, 및 히스티딘을 포함하고; 음으로 하전된 (산성) 아미노산은 글루탐산 및 아스파테이트를 포함하고; 방향족 아미노산은 페닐알라닌, 트립토판 및 타이로신을 포함하고, 소수성 아미노산은 알라닌, 발린, 이소루신, 류신, 메티오닌, 페닐알라닌, 타이로신 및 트립토판을 포함한다. 또한, 아미노산은 전하를 띠는(electrically charged) 곁사슬을 갖는 아미노산과 전하를 띠지 않는(uncharged) 곁사슬을 갖는 아미노산으로 분류할 수 있으며, 전하를 띠는 곁사슬을 갖는 아미노산은 아스르트산, 글루탐산, 라이신, 아르기닌, 히스티딘을 포함하고, 전하를 띠지 않는 곁사슬을 갖는 아미노산은 다시 비극성(nonpolar) 아미노산 또는 극성 아미노산(polar)으로 분류할 수 있으며, 비극성 아미노산은 글리신, 알라닌, 발린, 류신, 이소루신. 메티오닌, 페닐알라닌. 트립토판, 프롤린, 극성 아미노산은 세린, 트레오닌, 시스테인, 타이로신, 아스파라긴, 글루타민을 포함하는 것으로 분류할 수 있다. 통상적으로, 보존성 치환은 생성된 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않는다. 통상적으로, 보존적 치환은 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
또한, 글루타메이트 디하이드로게네이즈는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 폴리펩티드는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이전(transfer)에 관여하는 단백질 N-말단의 시그널 (또는 리더)서열과 컨쥬게이트 할 수 있다. 또한 상기 폴리펩티드는 폴리펩티드를 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
본 출원에서 용어, '상동성(homology)' 또는 '동일성(identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지(Devereux, J., et al, Nucleic Acids Research 12: 387(1984)), BLASTP, BLASTN, FASTA(Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math(1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al.(1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358(1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티(또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
본 출원에서, 용어 "상응하는(corresponding to)"은, 폴리펩티드에서 열거되는 위치의 아미노산 잔기이거나, 또는 폴리펩티드에서 열거되는 잔기와 유사하거나 동일하거나 상동한 아미노산 잔기를 지칭한다. 상응하는 위치의 아미노산을 확인하는 것은 특정 서열을 참조하는 서열의 특정 아미노산을 결정하는 것일 수 있다. 본 출원에 사용된 "상응 영역"은 일반적으로 관련 단백질 또는 참조 (reference) 단백질에서의 유사하거나 대응되는 위치를 지칭한다.
예를 들어, 임의의 아미노산 서열을 서열번호 1과 정렬(align)하고, 이를 토대로 상기 아미노산 서열의 각 아미노산 잔기는 서열번호 1의 아미노산 잔기와 상응하는 아미노산 잔기의 숫자 위치를 참조하여 넘버링 할 수 있다. 예를 들어, 본 출원에 기재된 것과 같은 서열 정렬 알고리즘은, 쿼리 시퀀스("참조 서열"이라고도 함)와 비교하여 아미노산의 위치, 또는 치환, 삽입 또는 결실 등의 변형이 발생하는 위치를 확인할 수 있다.
이러한 정렬에는 예를 들어 Needleman-Wunsch 알고리즘(Needleman 및 Wunsch, 1970, J. Mol. Biol. 48: 443-453), EMBOSS 패키지의 Needleman 프로그램 (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) 등을 이용할 수 있으나, 이에 제한되지 않고 당업계에 알려진 서열 정렬 프로그램, 쌍 서열(pairwise sequence) 비교 알고리즘 등을 적절히 사용할 수 있다.
본 출원에서 용어, "내재적" 활성은 본래 미생물이 천연의 상태 또는 해당 단백질의 변형 이전에 가지고 있는 단백질의 활성 상태를 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다.
본 출원에서 용어, 폴리펩티드 활성의 "강화"는, 폴리펩티드의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 활성화(activation), 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 활성화, 강화, 상향조절, 과발현, 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 “내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "강화", "상향조절", "과발현" 또는 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성 및/또는 농도(발현량)에 비하여 향상된 것을 의미한다.
상기 강화는 외래의 폴리펩티드를 도입하거나, 내재적인 폴리펩티드의 활성 강화 및/또는 농도(발현량)를 통해 달성할 수 있다. 상기 폴리펩티드의 활성의 강화 여부는 해당 폴리펩티드의 활성 정도, 발현량 또는 해당 폴리펩티드로부터 배출되는 산물의 양의 증가로부터 확인할 수 있다.
상기 폴리펩티드의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 폴리펩티드의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드의 강화는
1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가;
2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역의 변형(예를 들어, 발현조절영역 내 변이 발생, 더욱 강한 활성을 갖는 서열로의 교체, 또는 더욱 강한 활성을 갖는 서열 삽입);
3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
4) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드의 아미노산 서열의 변형;
5) 폴리펩티드 활성이 강화도록 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열의 변형 (예를 들어, 폴리펩티드의 활성이 강화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 폴리뉴클레오티드 서열의 변형);
6) 폴리펩티드의 활성을 나타내는 외래 폴리펩티드 또는 이를 코딩하는 외래 폴리뉴클레오티드의 도입;
7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
보다 구체적으로,
상기 1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터의 숙주세포 내로의 도입에 의해 달성되는 것일 수 있다. 또는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 숙주세포 내의 염색체 내에 1 카피 또는 2 카피 이상 도입에 의해 달성되는 것일 수 있다. 상기 염색체 내에 도입은 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다. 상기 벡터는 전술한 바와 같다.
상기 2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역(또는 발현조절서열)을 활성이 강력한 서열로 교체는, 예를 들면, 상기 발현조절영역의 활성을 더욱 강화하도록 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 가지는 서열로의 교체일 수 있다. 상기 발현조절영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 그리고 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 일 예로, 본래의 프로모터를 강력한 프로모터로 교체시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터, yccA 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 높은 다른 개시코돈을 코딩하는 염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 폴리펩티드의 활성을 강화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 증가하도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 상기 교체는 구체적으로 상동재조합에 의하여 폴리뉴클레오티드를 염색체내로 삽입함으로써 수행될 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 전술한 바와 같다.
상기 6) 폴리펩티드의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 상기 폴리펩티드와 동일/유사한 활성을 나타내는 폴리펩티드를 코딩하는 외래 폴리뉴클레오티드의 숙주세포 내 도입일 수 있다. 상기 외래 폴리뉴클레오티드는 상기 폴리펩티드와 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한이 없다. 상기 도입에 이용되는 방법은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 폴리펩티드가 생성되어 그 활성이 증가될 수 있다.
상기 7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩티드의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 폴리펩티드 활성의 강화는, 상응하는 폴리펩티드의 활성 또는 농도 발현량이 야생형이나 변형 전 미생물 균주에서 발현된 폴리펩티드의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩티드로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 본 출원의 목적상, 상기 미생물은 글루타메이트 디하이드로게네이즈 단백질 활성을 강화시키기 위해 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래의 글루타메이트 하이드로게네이즈의 활성을 가지는 외래 폴리뉴클레오티드를 도입시킬 수 있다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이체를 코딩하는 폴리뉴클레오티드 단편을 의미한다.
본 출원에 따른 폴리뉴클레오티드는 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래인 것을 특징으로 하며, 구체적으로, 상기 폴리뉴클레오티드는 서열번호 1 또는 서열번호 3의 아미노산 서열을 코딩하는 염기 서열을 포함할 수 있으며, 보다 구체적으로는 상기 바실러스 서브틸러스 유래의 외래 글루타메이트 디하이드로게네이즈를 코딩하는 유전자; 및 로도스피릴라레스 유래의 외래 글루타메이트 디하이드로게네이즈를 코딩하는 유전자;는 각각 서열번호 2 및 4의 뉴클레오티드 서열을 갖는 것일 수 있으나, 이에 제한되는 것은 아니다. 상기 서열번호 2 또는 서열번호 4의 염기 서열은 공지의 데이터베이스에서 얻을 수 있으며, 그 예로 NCBI의 GenBank 등이 있으나, 이에 제한되는 것은 아니다.
본 출원에서, 상기 서열번호 2 또는 서열번호 4의 염기 서열을 포함하는 유전자는 서열번호 2 또는 서열번호 4의 염기 서열을 포함하는 폴리뉴클레오티드, 서열번호 2 또는 서열번호 4의 염기 서열을 가지는 유전자 또는 폴리뉴클레오티드, 서열번호 2 또는 서열번호 4의 염기 서열로 이루어지는 유전자 또는 폴리뉴클레오티드와 혼용하여 사용될 수 있다.
본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 출원의 변이체를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 본 출원의 변이체의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 출원의 폴리뉴클레오티드는 서열번호 2 또는 서열번호 4의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열을 가지거나 포함하거나, 또는 서열번호 2 또는 서열번호 4의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화할 수 있는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 6% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1ХSSC, 0.1% SDS, 구체적으로 60℃, 0.1ХSSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1ХSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
본 출원의 목적상, 상기 미생물은 상기 외래 폴리뉴클레오티드를 숙주에서 발현시키기 위한 발현 벡터를 포함함으로써, 상기 글루타메이트 디하이드로게네이즈 단백질 활성이 내재적 활성에 비해 강화된 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 벡터는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 포함하는 DNA 제조물을 포함할 수 있다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계, pSK계, pSKH계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pSK, pSKH130, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 표적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 폴리펩티드가 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 변이체를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 미생물에서 폴리뉴클레오티드의 일부 또는 전체의 변형은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위 (engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오티드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
한편, 본 출원의 구체적 실시양태에서 코리네박테리움 속 미생물은 추가적으로 활성이 강화된 L-이소루신 생합성 경로에 관여하는 효소를 포함할 수 있다.
본 출원에서 용어 "L-이소루신 생합성 경로에 관여하는 효소"에는 아스파르테이트 키나아제(aspartate kinase, lysC 유전자), 아스파르테이트-β-세미알데히드 디하이드로게나아제(aspartate-β-semialdehyde dehydrogenase, asd 유전자), 호모세린 디하이드로게나아제(homoserine dehydrogenase, hom 유전자), 호모세린 키나아제(homoserine kinase, thrB 유전자), 쓰레오닌 신타아제(threonine synthase, thrC 유전자), 쓰레오닌 디하이드라타아제(threonine dehydratase, ilvA 유전자), 아미노트랜스퍼라제(aminotransferase, ilvE 유전자) 등이 포함될 수 있으나, 이로 제한되는 것은 아니다.
본 출원의 다른 하나의 양태는 상기 미생물을 배지에서 배양하는 단계를 포함하는 L-이소루신의 생산 방법을 제공한다.
상기 미생물, L-이소루신에 대해서는 전술한 바와 같다.
구체적으로, 상기 바실러스 서브틸러스 유래의 외래 글루타메이트 디하이드로게네이즈를 코딩하는 유전자; 및 로도스피릴라레스 유래의 외래 글루타메이트 디하이드로게네이즈를 코딩하는 유전자;는 각각 서열번호 2 및 4의 뉴클레오티드 서열을 갖는 것일 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 상기 방법은 L-이소루신 생성량 대비 α-아미노부티릭산(α-aminobutyric acid, AABA)의 생성량이 감소되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배양"은 본 출원의 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양 조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및 유가식 일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 본 출원의 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
본 출원에서는 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배양물에 적절한 방식으로 첨가하여, 배양물의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으나, 이에 제한되지 않는다.
배양물의 온도는 25℃내지 40℃일 수 있으며, 보다 구체적으로는 28℃ 내지 37℃일 수 있으나 이에 제한되지 않는다. 배양 기간은 원하는 유용 물질의 생성량이 수득될 때까지 계속될 수 있으며, 구체적으로는 1 시간 내지 100 시간일 수 있으나 이에 제한되지 않는다.
본 출원의 배양에 의하여 생산된 L-이소루신은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 L-이소루신 생산 방법은, 본 출원의 미생물을 준비하는 단계, 상기 미생물을 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 L-이소루신 생산 방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 미생물로부터 L-이소루신을 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 L-이소루신을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-이소루신을 회수할 수 있다.
또한, 본 출원의 L-이소루신 생산 방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 L-이소루신 생산 방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 연속적 또는 비연속적으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 또 다른 하나의 양태는 상기 미생물을 포함하는 L-이소루신 생산용 조성물을 제공한다.
상기 미생물, L-이소루신에 대해서는 전술한 바와 같다.
구체적으로, 상기 바실러스 서브틸러스 유래의 외래 글루타메이트 디하이드로게네이즈를 코딩하는 유전자; 및 로도스피릴라레스 유래의 외래 글루타메이트 디하이드로게네이즈를 코딩하는 유전자;는 각각 서열번호 2 및 4의 뉴클레오티드 서열을 갖는 것일 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 상기 방법은 L-이소루신 생성량 대비 α-아미노부티릭산(α-aminobutyric acid, AABA)의 생성량이 감소되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 조성물은 L-이소루신 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 또 다른 하나의 양태는 본 출원의 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래의 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입된 L-이소루신 생산능을 가지는 미생물의 L-이소루신 생산 용도를 제공하는 것이다.
이하 본 출원을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase) 도입을 위한 재조합 벡터 제작
코리네박테리움 글루타미쿰 염색체 내에 외래 gdh 과발현 벡터를 삽입하기 위해 코리네박테리움 글루타미쿰에서 트랜스포존을 코딩하는 유전자로 알려진 NCgl2872를 삽입 site로 이용하였다(Journal of Biotechnology 104, 5-25 Jorn Kalinowski et al, 2003). NCgl2872 유전자를 외래 gdh로 치환하기 위하여 NCgl2872 결손 및 타겟 유전자 삽입 벡터를 제작하였다. 벡터를 제작하기 위해 ATCC13032의 염색체를 주형으로 하여 서열번호 5 와 서열번호 6, 서열번호 7 과 서열번호 8의 프라이머 쌍을 이용하여 PCR을 각각 수행하였다 PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 95℃ 30초 변성; 55℃ 30초 변성; 및 72℃ 1분 중합반응이며, 이러한 조건의 변성, 어닐링, 및 중합반응을 28회 반복하였다. 그 결과 각각 623bp, 620bp의 DNA 단편을 수득하였다. 수득한 DNA 산물을 PCR 정제 키트(PCR Purification kit, QUIAGEN)를 사용하여 정제하고, 열처리한 pDCM2 벡터(대한민국 공개특허 제10-2020-0136813호)와 인퓨전 클로닝 키트(Infusion Cloning Kit, TaKaRa)를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 NCgl2872 결손 및 타겟 유전자 삽입용 벡터 pDCM2△N2872을 제작하였다.
모균주인 코리네박테리움 글루타미쿰의 gdh 프로모터를 가진 외래 gdh가 도입된 균주를 제작하기 위해 코리네박테리움 글루타미쿰 ATC13032, 대장균, 바실러스 서브틸러스(Bacillus subtilis), 로도스피릴라레스(Rhodospirillales) 및 미코박테리움 스메그마티스(Mycobacterium smegmatis)의 염색체를 각각 주형으로 하여 각각 서열번호 9 및 서열번호 10; 또는 서열번호 9 및 서열번호 11; 또는 서열번호 12 및 서열번호 13; 또는 서열번호 14 및 서열번호 15; 또는 서열번호 16 및 서열번호 17; 또는 서열번호 18 및 서열번호 19;의 프라이머를 이용하여 PCR을 각각 수행하였다. 상기 각각의 PCR을 수행하기 위해 사용된 프라이머 서열은 하기 표 1에 나타낸 바와 같다.
서열번호 명칭 서열
5 primer tgaattcgagctcggtacccAGGCGCAGGGCCGGG
6 primer gggCAACGCCCACACGCAGCG
7 primer AgggGCCCCGCTGAAGTCATC
8 primer gactctagaggatccccGCAGATCCAGTCCATCCC
9 primer CTGCGTGTGGGCGTTGcccTACCAATTCCATTTGAGGGC
10 primer GATTTCCTCGTTCCCA
11 primer ATGACTTCAGCGGGGCcccTTAGATGACGCCCTGTGCCA
12 primer GATGGGAACGAGGAAATCATGGATCAGACATATTCTCT
13 primer GATGACTTCAGCGGGGCcccTTAAATCACACCCTGCGCC
14 primer GATGGGAACGAGGAAATCATGTCAGCAAAGCAAGTCTC
15 primer GATGACTTCAGCGGGGCcccTTAGACCCATCCGCGGAA
16 primer GATGGGAACGAGGAAATCATGTCTAAAAGCCACAGCGG
17 primer GATGACTTCAGCGGGGCcccTTAAACCACACCTTCCGC
18 primer GATGGGAACGAGGAAATCATGAGCGAACTACACCCCAA
19 primer GATGACTTCAGCGGGGCcccTCAGATGAGCCCGAGTGCG
PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 95℃ 30초 변성; 55℃ 30초 변성; 및 72℃ 1분 중합반응이며, 이러한 조건의 변성, 어닐링, 및 중합반응을 28회 반복하였다. 그 결과, gdh 프로모터 부위의 519bp DNA 단편, 프로모터를 포함한 코리네박테리움 글루타미쿰 ATC13032 gdh 부위의 1882bp DNA 단편, 대장균의 gdh 부위의 1382bp DNA 단편, 바실러스 서브틸러스 gdh(rocG) 부위의 1313bp DNA 단편, Rhodospirillales gdh 부위의 1424bp DNA 단편, Mychobacterium smegmatis gdh 부위의 1388bp DNA 단편을 각각 수득하였다.
증폭된 프로모터와 외래 gdh DNA 절편을 주형으로 하여 서열번호 9 및 서열번호 13; 또는 서열번호 9 및 서열번호 15; 또는 서열번호 9 및 서열번호 17; 또는 서열번호 9 및 서열번호 19;의 프라이머로 PCR을 수행하였다. PCR 조건으로 95℃에서 5분간 변성 이후, 95℃ 30초 변성; 55℃ 30초 어닐링; 및 72℃ 2분 중합을 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과 코리네박테리움 글루타미쿰 ATC13032 gdh 프로모터를 가지고 외래 글루타메이트 디하이드로게네이즈를 코딩하는 2Kb의 외래 gdh DNA 단편이 증폭되었다. 증폭 산물을 PCR 정제 키트(PCR Purification kit, QUIAGEN)를 사용하여 정제하고, 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다. 정제한 증폭 산물을 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDCM2△N2872 벡터와 상기 증폭 산물인 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하고, 인퓨전 클로닝 키트(Infusion Cloning Kit, TaKaRa)를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 외래 gdh를 염색체상에 도입하기 위한 벡터 pDCM2△N2872::Pn_gdh(c.gl), pDCM2△N2872::Pn_gdh(E.coli), pDCM2△N2872::Pn_rocG(B.su), pDCM2△N2872::Pn_gdh(rhodospirillales), pDCM2△N2872::Pn_gdh(m.sm)를 제작하였다.
실시예 2: L-이소루신 생산능을 갖는 코리네박테리움 속 균주 제작
야생형의 코리네박테리움 글루타미쿰은 L-이소루신을 생산하는 능력은 있으나, 과량 생산하지는 않는다. 이에, 본 출원의 목적에 따라 L-이소루신 생산능을 증가시키는 유전 형질을 확인하기 위하여, L-이소루신 생산능이 증가된 균주를 활용하고자 하였다.
먼저, 야생형 코리네박테리움 글루타미쿰 ATCC13032로부터 L-이소루신 생산 균주를 개발하였다. 구체적으로, L-이소루신 생합성 경로에서 이소루신의 전구체인 쓰레오닌의 피드백 저해 해소를 위해, 호모세린 디하이드로게나제(homoserine dehydrogenase)를 코딩하는 유전자 hom를 변이하여, 호모세린 디하이드로게나제의 407번째 아미노산인 아르기닌을 히스티딘으로 치환하였다(대한민국 등록특허 제10-1996769호). 구체적으로, hom(R407H)를 코딩하는 폴리뉴클레오티드 서열은 서열번호 20에 나타내었다.
구체적으로, hom(R407H) 변이가 도입된 균주들을 제작하기 위해 코리네박테리움 글루타미쿰 ATCC13032의 염색체를 주형으로 하여 서열번호 21 및 서열번호 22; 또는 서열번호 23 및 서열번호 24의 프라이머를 이용하여 PCR을 각각 수행하였다. 상기 각각의 PCR을 수행하기 위해 사용된 프라이머 서열은 하기 표 2에 나타낸 바와 같다.
서열번호 명칭 서열
21 primer TCGAGCTCGGTACCCCGCTTTTGCACTCATCGAGC
22 primer CACGATCAGATGTGCATCATCAT
23 primer ATGATGATGCACATCTGATCGTG
24 primer CTCTAGAGGATCCCCGAGCATCTTCCAAAACCTTG
PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 95℃ 30초 변성; 55℃ 30초 어닐링; 및 중합반응 72℃ 1분 중합반응이며, 이러한 조건의 변성, 어닐링, 및 중합반응을 28회 반복하였다. 그 결과, hom 유전자의 변이를 중심으로 5' 상단 부위의 1000 bp DNA 단편과 3' 하단 부위의 1000 bp의 DNA 단편을 각각 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 21 및 서열번호 24의 프라이머로 PCR을 수행하였다. PCR 조건으로 95℃ 5분간 변성 이후, 95℃ 30초 변성; 55℃ 30초 어닐링; 및 72℃ 2분 중합을 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과, 407번째 아르기닌이 히스티딘으로 치환된 호모세린 디하이드로게나제 변이체를 코딩하는 hom 유전자의 변이를 포함하는 2 kb의 DNA 단편이 증폭되었다. 증폭 산물을 PCR 정제 키트(PCR Purification kit, QUIAGEN)를 사용하여 정제하고 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다. 정제한 증폭 산물을 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDCM2 벡터와 상기 증폭 산물인 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하고, 인퓨전 클로닝 키트(Infusion Cloning Kit, TaKaRa)를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 hom(R407H) 변이를 염색체상에 도입하기 위한 벡터 pDCM2-R407H를 제작하였다.
제작된 벡터를 전기천공법으로 코리네박테리움 글루타미쿰 ATCC13032에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 hom(R407H) 변이를 포함하는 균주를 얻었으며, 이를 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H)로 명명하였다.
제작한 ATCC13032 hom(R407H) 균주에 L-이소루신에 대한 피드백 해제와 활성을 증가시키기 위해, L-쓰레오닌 디하이드라타아제(L-threonine dehydratase)를 코딩하는 유전자인 ilvA를 변이하여, L-쓰레오닌 디하이드라타아제(서열번호 25)의 381번째 아미노산인 쓰레오닌을 알라닌으로 치환 및 383번째 아미노산인 페닐알라닌을 알라닌으로 치환하였다. 또한, ilvA(T381A+F383A)가 도입된 균주를 제작하였다.
구체적으로, 상기 ilvA(T381A+F383A) 변이가 도입된 균주들을 제작하기 위해 코리네박테리움 글루타미쿰 ATCC13032의 염색체를 주형으로 하여 서열번호 26 및 서열번호 27; 또는 서열번호 28 및 서열번호 29의 프라이머를 이용하여 PCR을 각각 수행하였다. 상기 각각의 PCR을 수행하기 위해 사용된 프라이머 서열은 하기 표 3에 나타낸 바와 같다.
서열번호 명칭 서열
26 primer TCGAGCTCGGTACCCATGAGTGAAACATACGTGTC
27 primer GCGCTTGAGGTACTCtgcCAGCGcGATGTCATCATCCGG
28 primer CCGGATGATGACATCgCGCTGgcaGAGTACCTCAAGCGC
29 primer CTCTAGAGGATCCCCCGTCACCGACACCTCCACA
PCR 반응을 위한 중합효소로는 PfuUltraTM 고-신뢰 DNA 폴리머라제(Stratagene)를 사용하였으며, PCR 조건은 95℃ 30초 변성; 55℃ 30초 변성; 및 72℃ 1분 중합반응이며, 이러한 조건의 변성, 어닐링, 및 중합반응을 28회 반복하였다. 그 결과, ilvA 유전자의 변이를 중심으로 5' 상단 부위의 1126 bp DNA 단편과 3' 하단 부위의 286 bp의 DNA 단편을 각각 수득하였다.
증폭된 두 가지의 DNA 절편을 주형으로 하여, 서열번호 26 및 서열번호 29의 프라이머로 PCR을 수행하였다. PCR 조건으로 95℃에서 5분간 변성 이후, 95℃ 30초 변성; 55℃ 30초 어닐링; 및 72℃ 2분 중합을 28회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다.
그 결과, 381번째 쓰레오닌이 알라닌으로 및 383번째 페닐알라닌이 알라닌으로 치환된 L-쓰레오닌 디하이드라타아제 변이체를 코딩하는 ilvA 유전자의 변이를 포함하는 1.4 kb의 DNA 단편이 증폭되었다. 증폭 산물을 PCR 정제 키트(PCR Purification kit, QUIAGEN)를 사용하여 정제하고, 벡터 제작을 위한 삽입 DNA 단편으로 사용하였다. 정제한 증폭 산물을 제한효소 smaI으로 처리한 후, 65℃에서 20분간 열처리한 pDCM2 벡터와 상기 증폭 산물인 삽입 DNA 단편의 몰농도(M) 비율이 1:2가 되도록 하고, 인퓨전 클로닝 키트(Infusion Cloning Kit, TaKaRa)를 사용하여 제공된 매뉴얼에 따라 클로닝함으로써 ilvA(T381A+F383A) 변이를 염색체상에 도입하기 위한 벡터 pDCM2-ilvA(T381A+F383A)를 제작하였다.
제작된 벡터를 전기천공법으로 코리네박테리움 글루타미쿰 ATCC13032 hom(R407H)에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 ilvA(T381A+F383A) 변이를 포함하는 균주를 얻었으며, 이를 코리네박테리움 글루타미쿰 CA10-3101이라 명명하였다.
참고로, 상기 ilvA(T381A+F383A)을 L-이소루신 생산 균주에 도입하는 것이 L-이소루신에 대한 피드백 해제와 활성을 증가시켜 L-이소루신 생산성 효율을을 증가시키는 것인지 확인하기 위해, 다음과 같은 실험을 수행하였다. 구체적으로, NTG(N-Methyl-N'-nitro-N-nitrosoguanidine) 처리된 L-이소루신 생산 균주인 KCJI-38(KCCM11248P, 대한민국 등록특허 제10-1335789호) 균주에 상기 ilvA(T381A+F383A) 변이를 전기펄스법으로 도입한 KCCM11248P/pECCG117-ilvA(T381A+F383A) 균주 배양액 중의 L-이소루신 및 L-쓰레오닌 농도를 측정한 결과를 하기 표 4에 나타내었다.
균주명 L-이소루신(g/L) L-쓰레오닌(g/L)
KCCM11248P 1.5 0.5
KCCM11248P/pECCG117-ilvA(F383A) 2.8 0.6
KCCM11248P/pECCG117-ilvA(T381A+F383A) 4.0 0.0
상기 표 3에 나타난 바와 같이, ilvA(T381A+F383A) 변이를 도입한 KCCM11248P/pECCG117-ilvA(T381A+F383A) 균주는 KCCM11248P 또는 KCCM11248P/pECCG117-ilvA(F383A) 균주에 비해 L-이소루신 생산이 현저히 증가하고, L-쓰레오닌 분해율이 높은 것을 확인하였다. 다시 말해서, 본 출원의 목적상 ilvA(T381A+F383A) 변이는 L-이소루신에 대한 피드백 해제와 활성을 증가시키기 위해 도입한 것임이 확인되었다.
실시예 3: 외래 gdh가 도입된 L-이소루신 균주 제작 및 이소루신 생산능 평가
상기 실시예 1에서 제작된 벡터를 전기천공법으로 상기 실시예 2에서 제작한 코리네박테리움 글루타미쿰 CA10-3101에 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 외래 gdh가 도입된 균주를 얻었으며, 서열번호 30 및 서열번호 31을 통해 도입여부를 확인하였다. 상기 PCR을 수행하기 위해 사용된 프라이머 서열은 하기 표 에 나타낸 바와 같다.
서열번호 명칭 서열
30 primer AACTGATGCCTGAGGACAAG
31 primer GCTTGATACCGAAGCAAACC
CA10-3101△N2872가 도입된 균주를 CA10-3135로, CA10-3101△N2872::Pn_gdh(C.gl)가 도입된 균주를 CA10-3136로, CA10-3101△N2872::Pn_gdh(eco)가 도입된 균주를 CA10-3137로, CA10-3101△N2872::Pn_rocG(B.su)가 도입된 균주를 CA10-3138로, CA10-3101△N2872::Pn_gdh(rhodospirillales)가 도입된 균주를 CA10-3139로, CA10-3101△N2872::Pn_gdh(m.sm)가 도입된 균주를 CA10-3140로 명명하였다.
제작된 6종의 균주의 L-이소루신 생산성 증가 및 부산물 α-아미노부티릭산(α-aminobutyric acid, AABA)의 저감효과를 확인하기 위해 각각의 균주를 하기와 같은 방법으로 발효역가 평가를 진행하였다. 이소루신 생산배지 25㎖을 함유하는 250 ㎖ 코너-바풀 플라스크에 모균주 및 상기 변이주를 접종한 후, 32℃에서 60시간동안 200 rpm으로 진탕 배양하여 L-이소루신을 제조하였다.
본 실시예 에서 사용한 생산배지의 조성은 하기와 같다.
<생산배지>
포도당 10%, 효모추출물 0.2%, 황산암모늄 1.6%, 제1인산칼륨 0.1%, 황산마그네슘7수염 0.1%, 황산철7수염 10mg/ℓ, 황산망간1수염 10 mg/ℓ, 비오틴 200 ㎍/ℓ, pH 7.2
배양종료 후, 액체고속크로마토그래피(HPLC)를 이용하여 L-이소루신, α-아미노부티릭산(AABA) 생산량을 측정하였고, 농도는 하기 표 6에 나타내었다.
L-이소루신 농도
(g/L)		 AABA 농도
(g/L)
CA10-3101(모균주) 2.4 0.8
CA10-3135 2.5 1.6
CA10-3136 2.6 1.4
CA10-3137 2.5 1.7
CA10-3138 2.6 0.8
CA10-3139 2.5 0.7
CA10-3140 2.7 2.1
그 결과, 상기 표 6에 나타난 바와 같이, 모균주 대비 L-이소루신은 CA10-3136, CA10-3138은 8.3%, CA10-3135, CA10-3137, CA10-3139은 4.2%, CA10-3140은 12.5% 증가함을 확인하였다. 부산물인 AABA는 모균주 대비 CA10-3135은 100%, CA10-3136은 75%, CA10-3137은 112.5%, CA10-3140은 162.5% 증가하였으며, CA10-3138은 모균주와 동일하며, CA10-3139은 12.5% 감소하였음을 확인하였다.
이에 따라, 모균주인 코리네박테리움 글루타미쿰 CA10-3101 대비 rocG(b.su) 및 gdh(rhodospirillales) 도입주(CA10-3138, CA10-3139)에서 L-이소루신 생성량 대비 α-아미노부티릭산(α-aminobutyric acid, AABA)의 생성량이 감소된 것을 확인하였다. 또한 코리네박테리움 글루타미쿰 ATC13032 gdh 도입주 CA10-3135 대비 L-이소루신 생성량은 동등 수준이나 α-아미노부티릭산(α-aminobutyric acid, AABA)의 생성량이 감소된 것을 확인하였다. 따라서, 다양한 외래 gdh 유전자 중 rocG(b.su) 및 gdh(rhodospirillales) 유래의 글루타메이트 디하이드로게네이즈를 코딩하는 유전자가 도입되는 경우, L-이소루신 생산은 유지하면서 부산물을 감소시켜 L-이소루신의 발효 순도를 높일 수 있음을 확인하였다.
실시예 4: L-이소루신 생산 균주 코리네박테리움 글루타미쿰 KCCM11248P 균주에서 외래 gdh 강화주의 제작 및 평가
상기 실시예 3에서 확인한 L-이소루신 생산능 증가 및 부산물의 감소에 효과적인 rocG (b.su 유래) 및 gdh(rhodospirillales 유래)를 NTG(N-Methyl-N'-nitro-N-nitrosoguanidine) 처리된 L-이소루신 생산균주인 KCJI-38(KCCM11248P, 대한민국 등록특허 제10-1335789호) 균주에 전기펄스법으로 도입한 후 카나마이신 25mg/L를 함유한 선별배지에 도말하여 형질전환하고, 2차 교차 과정을 거쳐 염색체 상에서 외래 gdh 도입주를 획득하였다. 그 후 상기 실시예 3과 동일한 방법으로 배양액 중의 L-이소루신과 부산물 농도를 측정하고, 그 결과를 하기 표 7에 나타내었다.
L-이소루신 농도
(g/L)		 AABA 농도
(g/L)
KCCM11248P (모균주) 1.4 0.7
KCCM11248P△N2872::Pn_gdh(C.gl) 1.6 1.4
KCCM11248P△N2872::Pn_ rocG(B.su) 1.6 0.7
KCCM11248P △N2872::Pn_gdh(rhodospirillales) 1.7 0.6
상기 표 7에 나타난 바와 같이, 모균주인 KCCM11248P 대비 rocG(b.su) 및 gdh(rhodospirillales) 도입주에서 부산물 AABA가 감소함을 확인하였다. 구체적으로는 L-이소루신의 농도와 AABA의 농도 모두 증가하는 KCCM11248P△N2872::Pn_gdh(C.gl) 균주와 달리 KCCM11248P△N2872::Pn_rocG(B.su), KCCM11248P△N2872::Pn_gdh(rhodospirillales) 균주의 경우에는 L-이소루신 생산성을 유지하며 부산물인 AABA가 감소하였고, L-이소루신의 발효 순도를 높일 수 있음이 확인되었다.
이에 따라, 본 출원의 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래의 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입된 미생물이 L-이소루신의 순도를 증가시켜 고수율로 L-이소루신을 생산할 수 있음을 확인하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.

Claims (12)

  1. 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래의 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입된, L-이소루신 생산능을 가지는 미생물.
  2. 제1항에 있어서, 상기 바실러스 서브틸러스 유래의 외래 글루타메이트 디하이드로게네이즈를 코딩하는 유전자; 및 로도스피릴라레스 유래의 외래 글루타메이트 디하이드로게네이즈를 코딩하는 유전자는 각각 서열번호 2 및 4의 뉴클레오티드 서열을 갖는 것인, 미생물.
  3. 제1항에 있어서, 상기 미생물은 L-이소루신 생성량 대비 α-아미노부티릭산(α-aminobutyric acid, AABA)의 생성량이 감소된 것인, 미생물.
  4. 제1항에 있어서, 상기 미생물은 코리네박테리움(Corynebacterium) 속 미생물인 것인, 미생물.
  5. 제4항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)인 것인, 미생물.
  6. 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래의 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입된 L-이소루신 생산능을 가지는 미생물을 배지에서 배양하는 단계를 포함하는, L-이소루신의 생산 방법.
  7. 제6항에 있어서, 상기 배양된 미생물 또는 배양 배지로부터 L-이소루신을 회수하는 단계를 추가로 포함하는, 방법.
  8. 제6항에 있어서, 상기 바실러스 서브틸러스 유래의 외래 글루타메이트 디하이드로게네이즈를 코딩하는 유전자; 및 로도스피릴라레스 유래의 외래 글루타메이트 디하이드로게네이즈를 코딩하는 유전자는 각각 서열번호 2 및 4의 뉴클레오티드 서열을 갖는 것인, 방법.
  9. 제6항에 있어서, 상기 방법은 L-이소루신 생성량 대비 α-아미노부티릭산(α-aminobutyric acid, AABA)의 생성량이 감소되는 것인, 방법.
  10. 바실러스 서브틸러스(Bacillus subtilis) 또는 로도스피릴라레스(Rhodospirillales) 유래의 외래 글루타메이트 디하이드로게네이즈(Glutamate dehydrogenase)를 코딩하는 유전자가 도입된 L-이소루신 생산능을 가지는 미생물을 포함하는, L-이소루신 생산용 조성물.
  11. 제10항에 있어서, 상기 바실러스 서브틸러스 유래의 외래 글루타메이트 디하이드로게네이즈를 코딩하는 유전자; 및 로도스피릴라레스 유래의 외래 글루타메이트 디하이드로게네이즈를 코딩하는 유전자는 각각 서열번호 2 및 4의 뉴클레오티드 서열을 갖는 것인, 조성물.
  12. 제11항에 있어서, 상기 조성물은 L-이소루신 생성량 대비 α-아미노부티릭산(α-aminobutyric acid, AABA)의 생성량이 감소되는 것인, 조성물.
PCT/KR2022/019684 2021-12-21 2022-12-06 L-이소루신 생산 미생물 및 이를 이용한 l-이소루신 생산 방법 WO2023121055A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP22911688.4A EP4435108A1 (en) 2021-12-21 2022-12-06 L-isoleucine-producing microorganism and l-isoleucine producing method using same
CA3242006A CA3242006A1 (en) 2021-12-21 2022-12-06 L-isoleucine-producing microorganism and l-isoleucine producing method using same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0184151 2021-12-21
KR1020210184151A KR20230094761A (ko) 2021-12-21 2021-12-21 L-이소루신 생산 미생물 및 이를 이용한 l-이소루신 생산 방법

Publications (1)

Publication Number Publication Date
WO2023121055A1 true WO2023121055A1 (ko) 2023-06-29

Family

ID=86903014

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/019684 WO2023121055A1 (ko) 2021-12-21 2022-12-06 L-이소루신 생산 미생물 및 이를 이용한 l-이소루신 생산 방법

Country Status (4)

Country Link
EP (1) EP4435108A1 (ko)
KR (1) KR20230094761A (ko)
CA (1) CA3242006A1 (ko)
WO (1) WO2023121055A1 (ko)

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6072083A (en) 1997-02-26 2000-06-06 Ajinomoto Co., Inc. Method for purifying branched chain amino acids
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
KR101335789B1 (ko) 2012-01-13 2013-12-02 씨제이제일제당 (주) Ｌ-이소루신을 생산하는 미생물 및 이를 이용한 ｌ-이소루신 제조방법
JP2016202182A (ja) * 2015-04-22 2016-12-08 味の素株式会社 ｃｙｃＡ遺伝子を過剰発現した腸内細菌科の細菌を用いたＬ−イソロイシンの製造方法
KR20170047725A (ko) * 2015-10-23 2017-05-08 씨제이제일제당 (주) L-이소루신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용하여 l-이소루신을 생산하는 방법
KR101751967B1 (ko) * 2015-10-29 2017-06-30 대상 주식회사 부산물의 생성이 감소된 이소루이신 생산능 변이 균주
US10113190B2 (en) 2013-06-03 2018-10-30 Evonik Degussa Gmbh Method for producing L-leucine, L-valine, L-isoleucine, α-ketoisovalerate, α-keto-beta-methylvalerate, or α-ketoisocaproate using recombinant Corynebacteria that contain the ilvBN operon which can be induced by propionate
CN109536428A (zh) * 2018-12-07 2019-03-29 武汉远大弘元股份有限公司 一种产l-异亮氨酸的基因工程菌及其构建方法和应用
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
KR101996769B1 (ko) 2018-12-21 2019-10-01 씨제이제일제당 (주) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof
JP2020115860A (ja) * 2019-01-28 2020-08-06 味の素株式会社 Ｌ−アミノ酸の製造法
KR20200136813A (ko) 2020-03-17 2020-12-08 씨제이제일제당 (주) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6072083A (en) 1997-02-26 2000-06-06 Ajinomoto Co., Inc. Method for purifying branched chain amino acids
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
KR101335789B1 (ko) 2012-01-13 2013-12-02 씨제이제일제당 (주) Ｌ-이소루신을 생산하는 미생물 및 이를 이용한 ｌ-이소루신 제조방법
US10113190B2 (en) 2013-06-03 2018-10-30 Evonik Degussa Gmbh Method for producing L-leucine, L-valine, L-isoleucine, α-ketoisovalerate, α-keto-beta-methylvalerate, or α-ketoisocaproate using recombinant Corynebacteria that contain the ilvBN operon which can be induced by propionate
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
JP2016202182A (ja) * 2015-04-22 2016-12-08 味の素株式会社 ｃｙｃＡ遺伝子を過剰発現した腸内細菌科の細菌を用いたＬ−イソロイシンの製造方法
KR20170047725A (ko) * 2015-10-23 2017-05-08 씨제이제일제당 (주) L-이소루신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용하여 l-이소루신을 생산하는 방법
KR101751967B1 (ko) * 2015-10-29 2017-06-30 대상 주식회사 부산물의 생성이 감소된 이소루이신 생산능 변이 균주
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof
CN109536428A (zh) * 2018-12-07 2019-03-29 武汉远大弘元股份有限公司 一种产l-异亮氨酸的基因工程菌及其构建方法和应用
KR101996769B1 (ko) 2018-12-21 2019-10-01 씨제이제일제당 (주) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
JP2020115860A (ja) * 2019-01-28 2020-08-06 味の素株式会社 Ｌ−アミノ酸の製造法
KR20200136813A (ko) 2020-03-17 2020-12-08 씨제이제일제당 (주) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Non-Patent Citations (18)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
ATSCHUL, [S.] [F., J MOLEC BIOL, vol. 215, 1990, pages 403
BOERMANN, E.R. ET AL.: "Molecular analysis of the Corynebacterium glutamicum gdh gene encoding glutamate dehydrogenase", MOLECULAR MICROBIOLOGY, WILEY-BLACKWELL PUBLISHING LTD, GB, vol. 6, no. 3, 1 February 1992 (1992-02-01), GB , pages 317 - 326, XP000864663, ISSN: 0950-382X, DOI: 10.1111/j.1365-2958.1992.tb01474.x *
CARILLO, SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
JORN KALINOWSKI ET AL., JOURNAL OF BIOTECHNOLOGY, vol. 104, 2003, pages 5 - 25
MICROB CELL FACT., vol. 16, no. 1, 23 March 2017 (2017-03-23), pages 51
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET., vol. 16, 2000, pages 276 - 277, XP004200114, DOI: 10.1016/S0168-9525(00)02024-2
SAMBROOK ET AL., MOLECULAR CLONING, 2012
SITNICKA ET AL., FUNCTIONAL ANALYSIS OF GENES. ADVANCES IN CELL BIOLOGY., vol. 2, 2010, pages 1 - 16
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482
WANG YING-YU, ZHANG FENG, XU JIAN-ZHONG, ZHANG WEI-GUO, CHEN XIU-LAI, LIU LI-MING: "Improvement of l-Leucine Production in Corynebacterium glutamicum by Altering the Redox Flux", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 20, no. 8, pages 2020, XP055786913, DOI: 10.3390/ijms20082020 *

Also Published As

Publication number Publication date
KR20230094761A (ko) 2023-06-28
EP4435108A1 (en) 2024-09-25
CA3242006A1 (en) 2023-06-29

Similar Documents

Publication Publication Date Title
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022231368A1 (ko) 신규한 글루타메이트 합성 효소 서브 유니트 알파 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022225322A1 (ko) 신규한 f0f1 atp 합성효소 서브유닛 알파 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022216088A1 (ko) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
WO2022163939A1 (ko) 신규한 mfs 트랜스포터 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163922A1 (ko) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225319A1 (ko) 신규한 l-세린 암모니아 분해 효소 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225320A1 (ko) 신규한 포스포글리세린산 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022149865A2 (ko) GlxR 단백질 변이체 또는 이를 이용한 쓰레오닌 생산방법
WO2021101000A1 (ko) 아세토하이드록시산 신타제 신규 변이체 및 이를 포함하는 미생물
WO2023121055A1 (ko) L-이소루신 생산 미생물 및 이를 이용한 l-이소루신 생산 방법
WO2022163941A1 (ko) 신규한 스퍼미딘 신타아제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154188A1 (ko) 신규한 폴리케타이드 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154189A1 (ko) 신규한 피토엔 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163930A1 (ko) 신규한 2-숙시닐-5-엔도피루빌-6-하이드록시-3-사이클로헥센-1-카복실레이트 신타아제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163940A1 (ko) 신규한 갈락토사이드 o-아세틸트랜스퍼라제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163937A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163938A1 (ko) 신규한 리보뉴클레아제 p 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163919A1 (ko) 신규한 우레아제 부속 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154173A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-라이신 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22911688

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 12024551498

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: 3242006

Country of ref document: CA

Ref document number: 2401004118

Country of ref document: TH

WWE Wipo information: entry into national phase

Ref document number: 2022911688

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2022911688

Country of ref document: EP

Effective date: 20240621

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112024012675

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2024117494

Country of ref document: RU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 112024012675

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20240620