WO2019190192A1 - 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법 - Google Patents

신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법 Download PDF

Info

Publication number
WO2019190192A1
WO2019190192A1 PCT/KR2019/003565 KR2019003565W WO2019190192A1 WO 2019190192 A1 WO2019190192 A1 WO 2019190192A1 KR 2019003565 W KR2019003565 W KR 2019003565W WO 2019190192 A1 WO2019190192 A1 WO 2019190192A1
Authority
WO
WIPO (PCT)
Prior art keywords
polynucleotide
seq
hisg
microorganism
atcc13869
Prior art date
Application number
PCT/KR2019/003565
Other languages
English (en)
French (fr)
Inventor
이지연
장진숙
김형준
윤병훈
최선형
최윤정
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to SG11202001730TA priority Critical patent/SG11202001730TA/en
Priority to AU2019243241A priority patent/AU2019243241B2/en
Priority to BR112020003867-9A priority patent/BR112020003867B1/pt
Priority to JP2020512734A priority patent/JP7089582B2/ja
Priority to CN201980004245.2A priority patent/CN111655860B/zh
Priority to US16/639,364 priority patent/US10961554B2/en
Priority to EP19776661.1A priority patent/EP3778901A4/en
Priority to CA3073177A priority patent/CA3073177C/en
Publication of WO2019190192A1 publication Critical patent/WO2019190192A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1077—Pentosyltransferases (2.4.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/14—Glutamic acid; Glutamine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/02—Pentosyltransferases (2.4.2)
    • C12Y204/02017—ATP phosphoribosyltransferase (2.4.2.17)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y306/00—Hydrolases acting on acid anhydrides (3.6)
    • C12Y306/01—Hydrolases acting on acid anhydrides (3.6) in phosphorus-containing anhydrides (3.6.1)
    • C12Y306/01031—Phosphoribosyl-ATP diphosphatase (3.6.1.31)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/55—Vector systems having a special element relevant for transcription from bacteria

Definitions

  • the present application relates to a novel promoter and a method for producing L-amino acid using the same, and more particularly, to a novel polynucleotide having a promoter activity, a vector including the same and Corynebacterium microorganisms, and L-amino acid using the microorganism. It relates to a production method, a method for producing a fermentation composition, and the fermentation composition.
  • L-amino acid is a basic structural unit of protein, and is used as an important material for pharmaceutical raw materials, food additives, animal feed, nutrition, pesticides, and fungicides.
  • L-glutamic acid is a representative amino acid produced by fermentation, and has one of the unique amino acids, which is widely used not only in the food field but also in the pharmaceutical field and other animal feed fields.
  • glycine is mainly used as a seasoning in the food industry to sweeten, and used with natural seasoning to enhance the taste. Furthermore, it is used also for antioxidant activity, buffering effect, etc., and it is used for sap, antacid, comprehensive amino acid preparation, and nutritional supplement in medicine.
  • the present inventors have made efforts to develop a method capable of simultaneously producing several amino acids, and have developed a novel polynucleotide having a promoter activity of the present application, which confirms that it is possible to improve glycine producing ability while maintaining the glutamic acid producing ability of the strain. This application was completed.
  • One object of the present application is the promoter activity, wherein the 53rd and 55th nucleotides of the nucleotide sequence represented by SEQ ID NO: 1 are substituted with T, or the 53rd and 55th nucleotides are substituted with T, and the 60th nucleotide is substituted with G. It is to provide a polynucleotide having a.
  • Another object of the present application is the polynucleotide; And it provides a vector comprising a gene encoding a target protein operably linked with the polynucleotide.
  • Another object of the present application is the polynucleotide; And it provides a microorganism of the genus Corynebacterium comprising a gene encoding a target protein operably linked to the polynucleotide.
  • Another object of the present application is to culture the microorganism of the genus Corynebacterium in a medium; And it provides a method for producing a target substance, comprising the step of recovering the target substance in the medium.
  • Another object of the present application is to provide a method for producing a fermentation composition comprising the step of fermenting the microorganism of the genus Corynebacterium in a medium.
  • Another object of the present application is to provide a fermentation composition prepared by the above method.
  • the novel promoter of the present application may be introduced into microorganisms producing amino acids to increase the amount of amino acids produced by the microorganisms.
  • the amino acid when the amino acid is prepared using the novel promoter, glycine, which has been previously produced by a synthetic method, may be produced by fermentation, and further, since glutamic acid and glycine may be simultaneously produced, the amino acid may be usefully produced.
  • glutamic acid and glycine may be simultaneously produced, the amino acid may be usefully produced.
  • by adjusting the amount of glutamic acid and the amount of glycine in the fermented product to improve the taste and palatability of the fermented product can be applied to the fermentation broth and seasoning material products using the same.
  • one embodiment of the present application is the 53th and 55th nucleotide of the nucleotide sequence represented by SEQ ID NO: 1 is replaced by T, the 53rd and 55th nucleotide is substituted by T and the 60th Provided are polynucleotides having promoter activity, wherein the nucleotides are substituted with G.
  • nucleotide sequence represented by SEQ ID NO: 1 may refer to a part of a promoter sequence of a gene encoding Phosphoribosyl-ATP pyrophosphatase (HisE).
  • the term "phosphoribosyl-ATP pyrophosphatase” is used to synthesize L-histidine from 5-phospho-alpha-D-ribose 1-diphosphate, Refers to an enzyme involved in the histidine synthesis pathway, and may be interchangeably named "HisE” herein.
  • the histidine synthesis pathway consists of a total of nine enzymes (HisG-HisE-HisI-HisA-HisH-HisB-HisC-HisN-HisD), and HisE is a step ATP phosphoribosyltransferase (HisG). After that, configure the second step.
  • promoter refers to a non-translated nucleotide sequence upstream of a coding region, i.e., a polymerase, comprising a binding site for polymerase and having a transcription initiation activity of the promoter gene into mRNA. DNA region that binds to initiate transcription of a gene.
  • the promoter may be located at the 5 'region of the mRNA transcription start site.
  • the target gene of the promoter may be a gene encoding phosphoibosyl-ATP pyrophosphatase (Phosphoribosyl-ATP pyrophosphatase), but is not limited thereto.
  • the polynucleotide having a promoter activity consisting of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 is "the polynucleotide”, “nucleotide sequence of the present application”, “polynucleotide of the present application” or “hisEG promoter” And the like, and all of the above-described terms may be used herein.
  • the nucleotide sequence represented by SEQ ID NO: 1, that is, the promoter sequence of the hisEG gene is mutated.
  • the mutation is 53 or 55 nucleotides of the sequence substituted with T, or 53
  • the fifth and 55th nucleotides may be substituted with T and the 60th nucleotides may be substituted with G.
  • the polynucleotide may be (consist of) consisting of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3.
  • mutation refers to a genetic or non-genetically stable phenotypic change, and may be used interchangeably with “mutation” herein.
  • the polynucleotide may have a mutated (increased or reduced) promoter activity compared to a polynucleotide that does not include the mutation. Therefore, the expression of the gene of interest linked to the polynucleotide and the activity of the protein encoded by the gene of interest can be regulated (increase or decrease), and further, the expression of genes other than the gene of interest can be controlled.
  • the polynucleotide may be for enhancing expression of the hisE gene.
  • the hisE and hisG genes are composed of operons, and the polynucleotide may further have a purpose for enhancing expression of hisG gene.
  • polynucleotide may be for increasing the amount of glycine produced.
  • the "HisG” is also referred to as "ATP phosphoribosyltransferase” in the present application, and means an enzyme involved in the histidine synthesis pathway.
  • the histidine synthesis pathway consists of a total of nine enzymes (HisG-HisE-HisI-HisA-HisH-HisB-HisC-HisN-HisD)
  • the HisG constitutes one step.
  • the polynucleotide of the present application can regulate the transcription of hisG gene as well as hisE.
  • the gene of interest may be a gene encoding phosphoribosyl-ATP pyrophosphatase, a gene encoding ATP phosphoribosyltransferase, or a combination thereof.
  • HisE and HisG are involved in histidine production, but there is no known association with glycine production and was first identified by the present inventors.
  • the increased activity of HisE and / or HisG enzyme due to the overexpression of HisE and / or hisG by such promoter mutation of the hisEG gene and thus the effect of increasing glycine production and maintaining glutamic acid production by the present inventors for the first time It was identified.
  • glutamic acid is a kind of amino acids are classified as non-essential amino acids. It is known as the most common excitatory neurotransmitter in the central nervous system, and because it is umami, its monosodium glutamate (MSG) has been widely used as a seasoning. Typically produced through fermentation of microorganisms that produce glutamic acid.
  • glycine is also an amino acid of sweet colorless crystals, also referred to as glycine. It is mainly used as food seasoning, and in medicine, it is also used as sap, antacid, comprehensive amino acid, and nutritional supplement.
  • the monochloroacetic acid method, the Strecker (Strecker) method, etc. are prepared through industrial synthesis methods, the synthesis method is produced by mixing the D- and L-type amino acids, there is an inconvenience that requires optical splitting. Therefore, there is a need to prepare glycine by fermentation which has various advantages such as mild reaction conditions, mass production in a short time, environmentally friendly processes, and biodegradable production materials.
  • polynucleotide may be composed of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3.
  • nucleotide sequence of the present application may be modified by conventionally known mutagenesis methods, such as direct evolution and site-directed mutagenesis.
  • the polynucleotide is at least 60% or more, specifically 70% or more, more specifically 80% or more, even more specifically 83% or more, 84% relative to the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3
  • Polynucleotides comprising nucleotide sequences having at least 88%, at least 90%, at least 93%, at least 95%, or at least 97% homology. If the sequence has homology with the sequence and is a polynucleotide sequence having a biological activity substantially the same as or corresponding to that of SEQ ID NO: 2 or SEQ ID NO: 3, a polynucleotide sequence in which some sequences are deleted, modified, substituted, or added is deleted. Obviously, it is also included within the scope of the present application.
  • homology means the degree to which a given nucleotide sequence corresponds and can be expressed in percentage.
  • homologous sequences thereof having the same or similar activity as a given nucleotide sequence are designated as "% homology”.
  • Homology to the nucleotide sequence is described, for example, in the algorithm BLAST by Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA by Pearson (Methods Enzymol., 183, 63, 1990). Based on this algorithm BLAST, a program called BLASTN or BLASTX has been developed (see http://www.ncbi.nlm.nih.gov).
  • stringent conditions is meant a condition that enables specific hybridization between polynucleotides. Such conditions are described specifically in the literature (eg, J. Sambrook et al., Homology). For example, genes with high homology, 60% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly specifically 99% or more homologous genes 60 ° C., 1 ⁇ SSC, 0.1% SDS, specifically 60 ° C., 0.1 ⁇ SSC, 0.1, which is a condition for hybridizing with each other and not having homologous genes with each other, or washing conditions for normal Southern hybridization.
  • Hybridization requires that two nucleotides have complementary sequences, although mismatch between bases is possible depending on the stringency of the hybridization.
  • the term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.
  • the present application may also include isolated polynucleotide fragments that are complementary to the entire sequence as well as substantially similar polynucleotide sequences.
  • polynucleotides having homology can be detected using hybridization conditions including hybridization steps at Tm values of 55 ° C. and using the conditions described above.
  • Tm value is 60 degreeC, 63 degreeC? Or 65 ° C., but is not limited thereto, and may be appropriately adjusted by those skilled in the art according to the purpose.
  • Appropriate stringency to hybridize polynucleotides depends on the length and degree of complementarity of the polynucleotides and variables are well known in the art (see Sambrook et al., Supra, 9.50-9.51, 11.7-11.8).
  • the expression consisting of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 occurs when the polynucleotide is linked to the target gene, such as the use of restriction enzymes, when the polynucleotide is used in connection with the target gene as a promoter.
  • the target gene such as the use of restriction enzymes
  • Additions and / or deletions of nucleotides, and / or mutations which may be present are not excluded.
  • the polynucleotide having a promoter activity consisting of the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3 is hybrid under stringent conditions with complementary sequences for all or part of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 And may comprise nucleotide sequences that have a promoter activity of the present application.
  • polynucleotide of the present application can be operably linked with the gene encoding the protein of interest.
  • gene expression control sequence refers to a sequence capable of expressing a gene of interest, including polynucleotides of the present application, operably linked thereto.
  • Those skilled in the art can try to enhance expression using mutations in gene expression control sequences, including promoters, for example, to enhance expression by mutations in the start codon sequence.
  • the start codon of the HisE enzyme may be substituted with ATG in GTG.
  • operatively linked in this application means that the polynucleotide having the promoter activity of the present application is functionally linked with said gene sequence to initiate and mediate transcription of the gene of interest. Operable linkages can be prepared using known genetic recombination techniques, and site-specific DNA cleavage and ligation can be made using, but are not limited to, cleavage and ligation enzymes in the art.
  • the gene expression control sequences of the present application may include any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a DNA for controlling termination of transcription and translation, in addition to a promoter for transcription of a gene. It may further include.
  • suitable regulatory sequences for prokaryotes may further include, but are not limited to, ribosomal binding sites in addition to the promoter.
  • Polynucleotides having the promoter activity of the present application can be constructed by the person skilled in the art as necessary for the regulation of gene expression as described above.
  • the target gene means a gene encoding a target protein to be controlled in microorganisms.
  • the gene may be a gene involved in the production of amino acids such as glutamic acid, glycine, and histidine, but is not limited thereto.
  • the gene may be a gene encoding histidine biosynthesis related enzyme, but is not limited thereto.
  • the gene may be a gene encoding HisE and / or HisG, but is not limited thereto.
  • the hisE gene and hisG gene may constitute an operon, and the polynucleotide of the present application may enhance the transcriptional activity of hisE and / or hisG.
  • the hisE and hisG may be an endogenous gene or a foreign gene, and may include a mutation for activity regulation.
  • the HisG may include a mutation for release of histidine feedback inhibition.
  • the sequence of the gene encoding HisE or HisG can be easily obtained by those skilled in the art through a known database such as GenBank of the National Institutes of Health.
  • the gene expression control sequences may increase the expression of genes encoding histidine biosynthesis related enzymes, specifically hisE and / or hisG.
  • Another aspect of the present application provides a vector comprising the polynucleotide and a gene encoding a target protein operably linked with the polynucleotide.
  • the polynucleotide is as described above.
  • the target protein may be Phosphoribosyl-ATP pyrophosphatase (HisE), ATP phosphoribosyltransferase (HTP), or a combination thereof.
  • HisE and HisG enzyme as the target protein may include a protein homologous thereto, and may be a protein in which some amino acids are mutated.
  • ATP phosphoribosyltransferase (HisG) may be the substitution of histidine (H) and glutamine (Q) for the 233th and 235th amino acids of the HisG amino acid sequence represented by SEQ ID NO. have.
  • vector refers to an artificial DNA molecule that carries a genetic material to enable expression of a gene of interest in a suitable host, the polynucleotide or a suitable gene expression control sequence; And a DNA preparation comprising a nucleotide sequence of a gene encoding a target protein operably linked thereto.
  • the vector used in the present application is not particularly limited as long as it can be expressed in the host cell, and any vector known in the art may be used to transform the host cell.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, ⁇ LB3, ⁇ BL4, ⁇ IXII, ⁇ ASHII, ⁇ APII, ⁇ t10, ⁇ t11, Charon4A, Charon21A, etc. can be used as a phage vector or cosmid vector, and pBR, pUC, and pBluescriptII systems as plasmid vectors.
  • pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used.
  • a vector for chromosome insertion in a host cell can replace an endogenous promoter in a chromosome with a polynucleotide having the promoter activity of the present application.
  • pECCG117, pDZ, pACYC177, pACYC184, pCL, pUC19, pBR322, pMW118, pCC1BAC, pCES208, pXMJ19 vectors and the like can be used, but are not limited thereto.
  • the insertion of the polynucleotide into the chromosome can be by any method known in the art, for example by homologous recombination.
  • the vector of the present application may be inserted into a chromosome by causing homologous recombination
  • the vector may further include a selection marker for confirming whether the chromosome is inserted.
  • Selection markers are used to screen for cells transformed with a vector, i.e. to confirm the insertion of polynucleotides, and to provide selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins. Markers can be used. In an environment in which a selective agent is treated, only cells expressing a selection marker survive or exhibit different expression traits, so that transformed cells can be selected.
  • the term "transformation” refers to introducing a vector comprising the polynucleotide or gene expression control sequence and the gene encoding the target protein into the host cell, such that the gene can be expressed in the host cell. . Furthermore, as long as the target gene can be expressed in the host cell, the transformed polynucleotide and the gene encoding the target protein include both of these cases regardless of whether they are located on or outside the chromosome of the host cell. can do.
  • the transformation method includes all methods of introducing the gene expression control sequence and the gene encoding the target protein into the cell, and may be performed by selecting a suitable standard technique as known in the art depending on the host cell. .
  • electroporation calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method and the like, but is not limited thereto.
  • polynucleotide provides a microorganism of the genus Corynebacterium comprising a gene encoding a target protein operably linked with the polynucleotide.
  • the gene encoding the polynucleotide and the target protein operably linked with the polynucleotide are as described above.
  • microorganism includes both wild-type microorganisms and microorganisms in which natural or artificial genetic modification has occurred, and a certain mechanism is weakened due to the insertion of an external gene or an enhanced or weakened activity of an endogenous gene.
  • the concept includes both microorganisms that have been enhanced or fortified.
  • the microorganism may include the polynucleotide, and specifically may include the polynucleotide and / or a gene operably linked with the polynucleotide and encoding a target protein.
  • the microorganism may include a vector including the polynucleotide or gene expression control sequence and the gene encoding the target protein, but is not limited thereto.
  • the polynucleotide, the gene encoding the target protein and the vector may be introduced into the microorganism by transformation, but are not limited thereto.
  • the microorganism is irrelevant whether the gene encoding the polynucleotide and the protein of interest is located on or outside the chromosome if the gene can be expressed.
  • the microorganism comprising the gene encoding the polynucleotide and the target protein may be one in which the amount of glutamic acid is maintained and the amount of glycine is increased.
  • the microorganism may be one in which the activity of HisE and / or HisG is enhanced.
  • the microorganism may be included without limitation as long as the microorganism having a polynucleotide having the promoter activity of the present application is introduced and can operate as a promoter.
  • the microorganism may be a microorganism of the genus Corynebacterium, and more specifically, Corynebacterium glutamicum ( Coynebacterium) glutamicum ) or Corynebacterium plavum flavum ), and most specifically Corynebacterium glutamicum, but is not limited thereto.
  • Another aspect of the present application comprises the steps of culturing the Corynebacterium genus microorganisms in a medium; And it provides a method of producing a target substance, comprising the step of recovering the target substance in the medium.
  • the polynucleotides and microorganisms are as described above.
  • the target substance may be an amino acid.
  • the amino acid may be an L-form amino acid unless otherwise stated, and may be glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartate, asparagine, glutamic acid, or lysine.
  • amino acid may be, but is not limited to, glutamic acid, glycine, or a combination thereof.
  • the term "culture” refers to the growth of microorganisms under appropriately artificially controlled environmental conditions.
  • a method for producing a target substance using a microorganism including the polynucleotide may be performed using a method well known in the art.
  • the culture may be continuously cultured in a batch process, an injection batch or a repeated fed batch process, but is not limited thereto.
  • the medium used for cultivation must meet the requirements of the particular strain in an appropriate manner.
  • Culture media for Corynebacterium strains are known (eg, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).
  • Sugar sources that may be used in the medium include glucose and saccharose, lactose, fructose, maltose, starch, sugars and carbohydrates such as cellulose, soybean oil, sunflower oil, castor oil, coconut oil and the like, palmitic acid, stearic acid Fatty acids such as linoleic acid, alcohols such as glycerol, ethanol, and organic acids such as acetic acid. These materials can be used individually or as a mixture, but are not limited thereto.
  • Nitrogen sources that can be used include peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources can also be used individually or as a mixture, but are not limited thereto.
  • Personnel that can be used can include salts containing potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium.
  • the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate required for growth.
  • essential growth substances such as amino acids and vitamins can be used.
  • suitable precursors to the culture medium may be used. The above-mentioned raw materials may be added batchwise or continuously in a manner appropriate to the culture during the culturing process.
  • the pH of the culture can be adjusted by using a basic compound such as sodium hydroxide, potassium hydroxide, ammonia or an acid compound such as phosphoric acid or sulfuric acid in an appropriate manner.
  • a basic compound such as sodium hydroxide, potassium hydroxide, ammonia or an acid compound such as phosphoric acid or sulfuric acid in an appropriate manner.
  • antifoaming agents such as fatty acid polyglycol esters can be used to inhibit bubble generation.
  • Oxygen or an oxygen-containing gas eg, air may be injected into the culture to maintain aerobic conditions.
  • the temperature of the culture can usually be 20 ° C to 45 ° C, specifically 25 ° C to 40 ° C. Incubation time may be continued until the desired amount of the desired material is obtained, but may specifically be 10 to 160 hours.
  • Recovery of the desired material from the culture (medium) can be recovered separately by conventional methods known in the art.
  • methods such as centrifugation, filtration, chromatography, and crystallization may be used.
  • the supernatant obtained by removing the biomass by centrifuging the culture at low speed may be separated by ion exchange chromatography, but is not limited thereto.
  • cell separation and filtration from the culture (medium) may be performed and the desired material may be recovered without a separate purification process.
  • the recovery step may further comprise a purification process.
  • Another aspect of the present application provides a method of preparing a fermentation composition comprising the step of culturing the microorganism of the genus Corynebacterium in a medium.
  • Another aspect of the present application provides a fermentation composition prepared by the above method.
  • the polynucleotide and the microorganism are as described above, and the step of culturing the microorganism in the medium is also as described above.
  • the fermentation composition in the present application means a composition obtained by culturing the microorganism of the present application.
  • the fermentation composition may include a liquid or powder composition obtained after culturing the microorganism, and after an appropriate post-treatment process.
  • a suitable post-treatment step may include, for example, a culture step, a cell removal step, a concentration step, a filtration step, and a carrier mixing step of the microorganism, and may further include a drying step.
  • the post-treatment process may not include a purification process.
  • the fermentation composition may have an optimal taste by culturing the microorganism of the present application to include a composition with an increased content of glycine while maintaining a certain level of glutamic acid content.
  • the fermentation composition does not exclude seasoning products (eg, broth powder products, snack seasoning products, etc.) containing the composition in the liquid or powder form.
  • seasoning products eg, broth powder products, snack seasoning products, etc.
  • the fermentation composition as long as it includes a composition obtained by culturing the microorganism of the present application, and the case of further mixing the material obtained by the non-fermentation process and / or another material obtained by the non-natural process Do not exclude
  • Example 1-1 Random mutagenesis through UV irradiation
  • Example 1-2 Mutagenic strains Fermentation potency Experiment and strain selection
  • Each colony was subcultured in nutrient medium and then incubated for 5 hours in fermentation medium. Then, 25% Tween40 was added to each medium at 0.4% concentration, and each colony was incubated again for 32 hours.
  • Each colony was cultivated under these conditions to select mutant strains that produced L-glutamic acid equivalent to or greater than wild type Corynebacterium glutamicum (ATCC13869).
  • L-glutamic acid concentration was measured using YSI, and glycine concentration was measured using HPLC. The measured concentrations of L-glutamic acid and glycine are shown in Table 1.
  • the production of glutamic acid is equivalent to or higher than that of the wild-type strain, and the strains with increased glycine production are "ATCC13869-g3", “ATCC13869-g6", “ATCC13869-g10” and “ATCC13869-g20”. Were screened.
  • the genes of the ATCC13869-g3, ATCC13869-g6, ATCC13869-g10 and ATCC13869-g20 strains were sequenced and compared with the wild type strain.
  • the ATCC13869-g3 and ATCC13869-g10 strains contain the same mutation at a specific position in the promoter region of the gene encoding Phosphoribosyl-ATP pyrophosphatase (HisE). Confirmed. In addition, it was confirmed that the ATCC13869-g20 strain further includes one mutation in addition to the same mutation at a specific position of the promoter region of the gene encoding the HisE of the ATCC13869-g3 and ATCC13869-g10 strains.
  • HisE Phosphoribosyl-ATP pyrophosphatase
  • ATCC13869-g3 and ATCC13869-g10 contained mutations in which the 53rd nucleotide A in the sequence of the promoter region represented by SEQ ID NO: 1 was replaced with T and the 55th nucleotide G was replaced with T.
  • ATCC13869-g20 confirmed that the 53rd nucleotide A in the sequence of the promoter region represented by SEQ ID NO: 1 includes a mutation in which the 55th nucleotide G is replaced by T and the 60th nucleotide T by G.
  • the promoter region represented by SEQ ID NO: 1 was confirmed to be a sequence commonly included in Corynebacterium genus microorganism, more specifically, wild type Corynebacterium glutamicum (ATCC13032, ATCC13869, ATCC14067).
  • Example 3-1 Production of strains with mutations introduced
  • Example 2 it was intended to produce a variant strain. Specifically, introducing the mutation into wild-type Corynebacterium glutamicum (ATCC13869) (substituting the 53rd and 55th nucleotides of the polynucleotide sequence represented by SEQ ID NO: 1 with T, or the polynucleotide represented by SEQ ID NO: 1). In order to replace the 53rd and 55th nucleotides of the sequence with T and the 60th nucleotide with G), the reverse oligonucleotide containing the target mutation was designed to be 75-mer in length (SEQ ID NO: 4 or SEQ ID NO: 5).
  • oligonucleotides of SEQ ID NO: 4 or SEQ ID NO: 5 was subjected to the electropulse method in the Corynebacterium glutamicum wild type ATCC13869 strain and the ATCC13032 strain (Appl. Microbiol. Biothcenol., 1999, 52: 541-545) After transformation, 1 ml of the mixed liquid medium was added, followed by shaking culture at 160 rpm for 30 minutes at 30 ° C. Thereafter, the culture solution was incubated for 10 minutes on ice, centrifuged at 4000 rpm for 10 minutes at 4 ° C, and the supernatant was removed to secure cells.
  • the target mutation was introduced into the strain, and the strain into which the mutation was introduced was "ATCC13869 :: hisEG-pro-2mt", “ATCC13869 :: hisEG- pro-3mt "and” ATCC13032 :: hisEG-pro-2mt "and” ATCC13032 :: hisEG-pro-3mt ".
  • L-glutamic acid concentration and glycine concentration in each medium were measured.
  • the measured concentrations of L-glutamic acid and glycine are shown in Table 2 below.
  • wild-type Corynebacterium glutamicum ATCC13869 and ATCC13032 strains produced glycine at 122 and 73 mg / L, whereas ATCC13869 :: hisEG-pro-2mt and ATCC13032 :: hisEG-pro-2mt strains were 134, respectively. And it was confirmed that the production of 91 mg / L, it was confirmed that the concentration of glycine produced in the mutated strain compared to the wild type strain.
  • strains ATCC13869 :: hisEG-pro-3mt and ATCC13032 :: hisEG-pro-3mt produce glycine at 141 and 99 mg / L, respectively, resulting in ATCC13869 :: hisEG-pro-2mt and ATCC13032 :: hisEG-pro-2mt. It was confirmed that the produced glycine concentration was higher than that of the strain.
  • the mutations were found to significantly increase glycine production, while maintaining little effect on the L-glutamic acid production ability of the microorganism.
  • ATCC13869 hisEG-pro-2mt
  • ATCC13869 hisEG-pro-3mt strains were strained at the Korea Microorganism Conservation Center (KCCM), which is a depository under the Treaty of Budapest on February 28, 2018 and March 14, 2019.
  • International deposits under the names "CA02-9206” and “CA02-9215” have been assigned accession numbers "KCCM12226P” and "KCCM12457P”.
  • a gene replacement vector was prepared to replace the 60th nucleotide with G.
  • Gene fragments for constructing the vector was obtained by PCR using ATCC13869 genomic DNA as a template.
  • Poly of SEQ ID NOs: 6, 7, 8, 9, 10, and 11, based on information on the Corynebacterium glutamicum (ATCC13869) gene and surrounding sequences registered with the National Institutes of Health, NIH GenBank A primer containing nucleotides was prepared.
  • PCR conditions were 5 minutes denaturation at 95 °C, 95 °C 30 seconds denaturation, 55 °C 30 seconds annealing, 72 °C 1 min polymerization was repeated 30 times, and then polymerization was performed at 72 °C 5 minutes. More specifically, 500 bp polynucleotides amplified using the SEQ ID NOs: 6 and 7 primers and 500 bp polynucleotides amplified using the primers of SEQ ID NOs: 8 and 9 were obtained. The two gene fragments thus obtained were linked to a pDZ vector (Korean Patent No. 10-0924065 and International Publication No. 2008-033001) digested with restriction enzyme SalI by using an infusion enzyme.
  • pDZ vector Korean Patent No. 10-0924065 and International Publication No. 2008-033001
  • a substitution vector was produced and named "pDZ-hisE-pro-2mt".
  • a 500 bp polynucleotide amplified using the SEQ ID NOs: 6 and 11 primers and a 500 bp polynucleotide amplified using the primers of SEQ ID NOs: 10 and 9 were obtained.
  • the two gene fragments thus obtained were linked to a pDZ vector (Korean Patent No. 10-0924065 and International Publication No. 2008-033001) digested with restriction enzyme SalI by using an infusion enzyme.
  • a substitution vector was produced and named "pDZ-hisE-pro-3mt". Primer sequence information used for the vector production is shown in Table 3 below.
  • PDZ-hisE-pro-2mt and pDZ-hisE-pro-3mt which are the gene replacement vectors prepared in Example 4-1, were introduced into the KFCC11074 strain by electroporation, thereby introducing glutamic acid and glycine producing strains.
  • KFCC11074_Pro (2mt) _hisEG and "KFCC11074_Pro (3mt) _hisEG” were produced.
  • a strain prepared by transformation (Appl. Microbiol. Biotechnol., 1999, 52: 541-545), and a vector having a vector inserted on a chromosome by recombination of homologous sequences, 25 mg / L of kanamycin (kanamycin) It was selected from agar nutrient medium containing. The selected primary strain was subjected to second cross-over again, and strains in which two and three target mutations were introduced were selected, respectively. Variation (substitution) of the final transformed strain was confirmed by sequencing after PCR using primer pairs of SEQ ID NOs: 6 and 9.
  • the selected strains KFCC11074_Pro (2mt) _hisEG and KFCC11074_Pro (3mt) _hisEG were plated on nutrient medium and incubated at 30 ° C for 16 hours. Thereafter, 25 ml of autoclaved fermentation broth at 121 ° C. for 15 minutes was dispensed into a 250 ml shaking Erlenmeyer flask and incubated for 48 hours by inoculating strains cultured in a nutrient medium. Culture conditions were adjusted to 200 rpm, temperature 37 °C, pH 8.0.
  • the nutrition medium and fermentation medium composition is as follows.
  • the concentrations of glycine produced by the KFCC11074_Pro (2mt) _hisEG and KFCC11074_Pro (3mt) _hisEG strains were increased by 33 mg / L and 42 mg / L, respectively, compared to the glycine concentration produced by the KFCC11074.
  • Example 5-1 hisG Vector construction with feedback suppression mutation
  • hisE and hisG genes are composed of operons, and these genes are involved in histidine biosynthetic pathways.
  • HisG is subjected to feedback suppression by the product histidine, it was intended to confirm whether the glycine production capacity of the strain is increased when introducing a mutation in which feedback inhibition is released to increase the activity of HisG.
  • G233H and T235Q mutations (Schendzielorz et al., 2014) known in the literature were introduced into the hisG gene.
  • Gene replacement vectors were prepared to replace H and Q amino acids 233 and 235 of the hisG amino acid sequence represented by SEQ ID NO: 16, respectively.
  • Gene fragments for constructing the vector was obtained by PCR using ATCC13869 genomic DNA as a template. Based on the information on the Corynebacterium glutamicum (ATCC13869) gene and surrounding nucleotide sequences registered with Genebank of the US National Institutes of Health, a primer comprising polynucleotides of SEQ ID NOs: 12, 13, 14, and 15 was prepared. .
  • PCR conditions were 5 minutes denaturation at 95 °C, 95 °C 30 seconds denaturation, 55 °C 30 seconds annealing, 72 °C 1 min polymerization was repeated 30 times, and then polymerization was performed at 72 °C 5 minutes.
  • 722 bp polynucleotides amplified using the primers of SEQ ID NOs: 12 and 13 and 798 bp polynucleotides amplified using the primers of SEQ ID NOs: 14 and 15 were obtained.
  • the two gene fragments thus obtained were linked to pDZ vectors (Korean Patent No. 10-0924065 and International Publication No.
  • the gene replacement vector "pDZ-hisG (G233H / T235Q)" prepared in Example 5-1 was introduced into the KFCC11074 strain to prepare a strain "KFCC11074_hisG (G233H / T235Q)" whose HisG feedback inhibition was released.
  • the vector was introduced into the KFCC11074_Pro (2mt) _hisEG and KFCC11074_Pro (3mt) _hisEG strains, and the "KFCC11074_hisG (G233H / T235Q) _Pro (2mt) _hisEG” and "KFCC11074_hisG (G233H / T235) into which the mutation of the present application was introduced. (3mt) _hisEG "strain was produced.
  • the strain was produced through transformation (Appl. Microbiol. Biotechnol., 1999, 52: 541-545), and the strain into which the vector was inserted on the chromosome by recombination of homologous sequences was kanamycin 25 Screening was performed on agar nutrient medium containing mg / L. The selected primary strain was again cross-over, and the strain into which the target G233H / T235Q mutation was introduced was selected. Variation (substitution) of the final transformed strain was confirmed by sequencing after PCR using primer pairs of SEQ ID NOs: 12 and 15.
  • the concentration of glycine produced by the KFCC11074_hisG (G233H / T235Q) _Pro (2mt) _hisEG and KFCC11074_hisG (G233H / T235Q) _Pro (3mt) _hisEG strains was higher than that of KFCC11074_hisG (G233H / T235Q). It was found to increase significantly as mg / L and 337.5 mg / L.
  • the mutations were found to significantly increase glycine production, while maintaining little effect on the L-glutamic acid production ability of the microorganism. In addition, this effect was shown by the increase of hisE and hisG activity.
  • the strain comprising the nucleotide of the present application increased glycine production ability without significantly affecting the L-glutamic acid production ability. Therefore, it was intended to prepare a fermentation composition using a microorganism of the genus Corynebacterium comprising the nucleotide of the present application.
  • the glutamic acid which is basically a well-known seasoning material, is manufactured as a main ingredient, but the fermentation strain and the fermentation process are controlled to increase by-product components of other seasoning materials in order to increase the composition of rich flavor.
  • Example 6-1 Preparation of fermentation composition using 5L fermenter
  • Example 5 For the strain used in Example 5, to prepare a fermentation composition using a 5L fermenter.
  • Primary seed medium 1% glucose, 1% yeast extract, 1% peptone, 0.1% ammonium sulfate, 0.25% sodium chloride, 0.15% potassium phosphate monobasic, 0.15% potassium diphosphate, primary pH Seed media were prepared.
  • Secondary species 4.6% organic raw sugar with a purity of 98.5%, magnesium sulfate 0.05%, yeast extract 0.5%, potassium monophosphate 0.2%, iron sulfate 0.002%, biotin 1 mg / l, thiamine hydrochloride 2 mg / l and some
  • a secondary seed medium containing an antifoaming agent and having a pH of 7.2 was prepared.
  • Fermentation medium 4% organic raw sugar with a purity of 98.5%, magnesium sulfate 0.03%, yeast extract 1%, phosphoric acid 0.22%, potassium hydroxide 0.4%, biotin 0.2mg / l, thiamine hydrochloride 0.6mg / l, manganese sulfate 0.002%, sulfuric acid
  • a fermentation medium containing pH 0.002%, zinc sulfate 0.002%, copper sulfate 0.0006% and some antifoaming agent and having a pH of 7.4 was prepared.
  • 50 ml of the primary seed medium was dispensed into a 500 ml shaking Erlenmeyer flask and cooled by autoclaving at 121 ° C. for 20 minutes, and then inoculated with the strains at 200 rotations / minute and a temperature of 5 ° C. at 30 ° C. Shake culture was carried out for 7 hours.
  • 0.25L of the secondary seed medium was prepared in a 1.5L test fermenter, cooled by autoclaving at 121 ° C. for 20 minutes, inoculated with 50 ml of the primary seed culture solution, and then rotated at 900 revolutions / minute at 31.5 ° C. Incubated for 15 hours at.
  • 0.25L of the fermentation broth was prepared in a 5L test fermenter, cooled by autoclaving at 121 ° C. for 20 minutes, and then inoculated with 0.26 L of the secondary seed culture solution, and then rotated at 900 revolutions per minute at 30 to 34 ° C. Incubated at.
  • the pH of the fermentation broth during incubation of the Corynebacterium glutamicum was continuously adjusted using 28% ammonia water so as to be in the range of 7.0 to 7.4.
  • concentration of residual sugar was 0.5-1.5% during the cultivation, sterilized organic raw sugar was added at any time, and the culture was continued until the total sugar added was 30-34% of the fermentation broth.
  • the glutamic acid production between the two strains was not significantly different.
  • the content of glycine was significantly increased (0.2 g / L vs 3.2 g / L) without significant difference in glutamic acid production (64.2 g / L vs 73 g / L).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Seasonings (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 출원은 신규한 프로모터 및 이를 이용한 L-아미노산 생산 방법에 관한 것으로서, 보다 상세하게는 프로모터 활성을 가지는 신규 폴리뉴클레오티드, 이를 포함하는 벡터 및 코리네박테리움 속 미생물, 상기 미생물을 이용한 L-아미노산의 생산 방법, 발효 조성물의 제조 방법, 및 상기 발효 조성물에 관한 것이다.

Description

신규한 프로모터 및 이를 이용한 L-아미노산 생산 방법
본 출원은 신규한 프로모터 및 이를 이용한 L-아미노산 생산 방법에 관한 것으로서, 보다 상세하게는 프로모터 활성을 가지는 신규 폴리뉴클레오티드, 이를 포함하는 벡터 및 코리네박테리움 속 미생물, 상기 미생물을 이용한 L-아미노산의 생산 방법, 발효 조성물의 제조 방법, 및 상기 발효 조성물에 관한 것이다.
L-아미노산은 단백질의 기본 구성단위로서, 약품 원료와 식품첨가제, 동물 사료, 영양제, 살충제, 살균제 등의 중요 소재로 사용된다. 그 중에서도, L-글루탐산은 발효에 의하여 생산되는 대표적인 아미노산으로, 특유의 독특한 맛(감칠맛)을 지니고 있어 식품 분야에서는 물론, 의약품 분야, 기타 동물 사료 분야 등에 널리 이용되고 있는 중요한 아미노산 중의 하나이다. 또한, 글라이신은 주로 단맛을 내어 식품공업에서 조미료로 사용되고, 천연조미료와 함께 사용하여 맛을 높인다. 나아가, 산화방지작용, 완충작용 등에도 이용되고 있으며, 의약 면에서는 수액, 제산제, 종합 아미노산제제, 영양 보급제로 이용되고 있다.
상기 아미노산을 생산하는 통상적인 방법으로는 주로 브레비박테리움(Brevibacterium)이나 코리네박테리움(Amino Acid Fermentation, Gakkai Shuppan Center: 195-215, 1986), 그 외에도 대장균(Escherichia coli), 고초균(Bacillus), 방선균(Streptomyces), 페니실리움(Penicillum) 속, 크렙시엘라(Klebsiella), 어위니아(Erwinia), 판토에아(Pantoea) 속 등의 미생물을 이용한 발효 방법이 있고(미국 특허 제3,220,929호, 제6,682,912호), 또한 모노클로로초산법, 스트렉커(Strecker)법 등의 합성법을 통한 공업적인 방법으로도 생산된다.
또한, 아미노산을 효율적으로 생산하기 위한 다양한 연구, 예를 들어, 아미노산 고효율 생산 미생물이나 발효공정 기술을 개발하기 위한 노력이 이루어지고 있다. 구체적으로, 코리네박테리움 속 균주에서 아미노산 생합성에 관여하는 효소를 암호화하는 유전자의 발현을 증가시키거나 또는 아미노산 생합성에 불필요한 유전자를 제거하는 것과 같은 목적 물질 특이적인 접근 방법이 개발되었고(한국 등록특허공보 제10-0924065호, 제1208480호), 이러한 방법 이외에 아미노산 생산에 관여하지 않는 유전자를 제거하는 방법, 아미노산 생산에 있어 구체적으로 기능이 알려지지 않은 유전자를 제거하는 방법 또한 활용되고 있다. 그러나, 여전히 효율적이고 높은 수율로 아미노산을 생산할 수 있는 방법에 대한 연구의 필요성이 대두되고 있다.
본 발명자들은 여러 개의 아미노산을 동시 생산할 수 있는 방법을 개발하기 위해 노력한 결과, 본 출원의 프로모터 활성을 갖는 신규 폴리뉴클레오티드를 개발하였고, 이는 균주의 글루탐산 생성능은 유지하면서 글라이신 생성능을 향상시킬 수 있음을 확인하여 본 출원을 완성하였다.
본 출원의 하나의 목적은 서열번호 1로 표시되는 뉴클레오티드 서열의 53번째 및 55번째 뉴클레오티드가 T로 치환되거나, 53번째 및 55번째 뉴클레오티드가 T로 치환되고 60번째 뉴클레오티드가 G로 치환된, 프로모터 활성을 가지는 폴리뉴클레오티드를 제공하는 것이다.
본 출원의 다른 하나의 목적은 상기 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드와 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자를 포함하는 벡터를 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드와 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자를 포함하는 코리네박테리움 속 미생물을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및 상기의 배지에서 목적 물질을 회수하는 단계를 포함하는, 목적 물질을 생산하는 방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 코리네박테리움 속 미생물을 배지에서 배양하여 발효하는 단계를 포함하는, 발효 조성물의 제조 방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 방법에 의해 제조된 발효 조성물을 제공하는 것이다.
본 출원의 신규 프로모터는 아미노산을 생산하는 미생물에 도입되어 미생물의 아미노산 생성량을 증가시킬 수 있다. 특히, 상기 신규 프로모터를 이용하여 아미노산을 제조하는 경우, 기존에 합성법으로 제조되던 글라이신을 발효법으로 생산할 수 있으며, 나아가 글루탐산과 글라이신을 동시 생산할 수 있으므로 아미노산 생산에 유용하게 활용될 수 있다. 또한, 발효물 내 글루탐산의 양과 글라이신의 양을 조절하여 발효물의 맛과 기호성을 개선시켜 발효액 및 이를 이용한 조미소재 제품에 적용시킬 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
상기와 같은 목적을 달성하기 위하여, 본 출원의 하나의 양태는 서열번호 1로 표시되는 뉴클레오티드 서열의 53번째 및 55번째 뉴클레오티드가 T로 치환되거나, 53번째 및 55번째 뉴클레오티드가 T로 치환되고 60번째 뉴클레오티드가 G로 치환된, 프로모터 활성을 가지는 폴리뉴클레오티드를 제공한다.
본 출원에서 용어 "서열번호 1로 표시되는 뉴클레오티드 서열"은 포스포리보실-ATP 피로포스파타제(Phosphoribosyl-ATP pyrophosphatase: HisE)를 코딩하는 유전자의 프로모터 서열의 일부를 의미할 수 있다.
이때, 상기 용어 "포스포리보실-ATP 피로포스파타제"는 5-포스포-알파-D-리보스 1-디포스페이트(5-phospho-alpha-D-ribose 1-diphosphate)로부터 L-히스티딘을 합성하는, 히스티딘 합성 경로에 관여하는 효소를 의미하며, 본 명세서에서 "HisE"로 혼용되어 명명될 수 있다. 상기 히스티딘 합성 경로는 총 9개의 효소로 이루어져 있는데(HisG-HisE-HisI-HisA-HisH-HisB-HisC-HisN-HisD), 상기 HisE는 1단계인 ATP 포스포리보실트랜스퍼라제(ATP phosphoribosyltransferase: HisG) 이후, 두 번째 단계를 구성한다.
본 출원에서 용어 "프로모터"는 폴리머라제(polymerase)에 대한 결합 부위를 포함하고 프로모터 목적 유전자의 mRNA로의 전사 개시 활성을 가지는, 코딩 영역의 상위(upstream)의 비 해독된 뉴클레오티드 서열, 즉 폴리머라제가 결합하여 유전자의 전사를 개시하도록 하는 DNA 영역을 의미한다. 상기 프로모터는 mRNA 전사 개시부위의 5' 부위에 위치할 수 있다. 이때, 상기 프로모터의 목적 유전자는 포스포리보실-ATP 피로포스파타제(Phosphoribosyl-ATP pyrophosphatase)를 코딩하는 유전자일 수 있으나, 이에 제한되지 않는다.
본 출원에서, 상기 서열번호 2 또는 서열번호 3의 뉴클레오티드 서열로 이루어지는 프로모터 활성을 갖는 폴리뉴클레오티드는 "상기 폴리뉴클레오티드", "본 출원의 뉴클레오티드 서열", "본 출원의 폴리뉴클레오티드" 또는 "hisEG 프로모터" 등으로 혼용되어 명명될 수 있으며, 본 명세서에서는 상기 기술된 용어가 모두 사용될 수 있다.
본 출원의 폴리뉴클레오티드는 상기 서열번호 1로 표시되는 뉴클레오티드 서열, 즉 hisEG 유전자의 프로모터 서열이 변이된 것이며, 구체적으로 상기 변이는 상기 서열의 53번째 및 55번째 뉴클레오티드가 T로 치환된 것이거나, 53번째 및 55번째 뉴클레오티드가 T로 치환되고 60번째 뉴클레오티드가 G로 치환된 것일 수 있다. 그에 따라, 상기 폴리뉴클레오티드는 서열번호 2 또는 서열번호 3의 뉴클레오티드 서열로 이루어지는 것(consist of)일 수 있다.
이때, 상기 용어 "변이"는 유전적 또는 비유전적으로 안정적인 표현형적 변화를 의미하며, 본 명세서에서 "돌연변이"와 혼용되어 명명될 수 있다.
구체적으로, 상기 폴리뉴클레오티드는 변이를 포함하지 않는 폴리뉴클레오티드에 비해 변이된(증가 또는 감소된) 프로모터 활성을 가질 수 있다. 따라서, 상기 폴리뉴클레오티드와 작동 가능하게 연결된 목적 유전자의 발현 및 상기 목적 유전자에 의해 코딩되는 단백질의 활성을 조절(증가 또는 감소)할 수 있으며, 나아가 목적 유전자 이외의 다른 유전자의 발현을 조절할 수 있다.
본 출원의 목적상, 상기 폴리뉴클레오티드는 hisE 유전자의 발현 강화를 위한 것일 수 있다. 또한, hisE 및 hisG 유전자는 오페론으로 구성되어 있는 바, 상기 폴리뉴클레오티드는 hisG 유전자의 발현 강화를 위한 목적을 추가로 가질 수 있다.
또한, 상기 폴리뉴클레오티드는 글라이신의 생성량 증가를 위한 것일 수 있다.
이때, 상기 "HisG"는 본 출원에서 "ATP 포스포리보실트랜스퍼라제(ATP phosphoribosyltransferase)"로도 명명되며, 히스티딘 합성 경로에 관여하는 효소를 의미한다. 히스티딘 합성 경로는 총 9개의 효소로 이루어져 있는데(HisG-HisE-HisI-HisA-HisH-HisB-HisC-HisN-HisD) 상기 HisG는 그 중 1단계를 구성한다.
또한, 상기 hisE 및 hisG 유전자는 오페론으로 구성되어 있으므로 본 출원의 폴리뉴클레오티드는 hisE 뿐만 아니라 hisG 유전자의 전사를 조절할 수 있다. 따라서, 목적 유전자는 포스포리보실-ATP 피로포스파타제를 코딩하는 유전자, ATP 포스포리보실트랜스퍼라제를 코딩하는 유전자, 또는 이들의 조합일 수 있다.
상기 HisE 및 HisG는 히스티딘 생성에 관여한다는 것이 알려져 있었으나, 글라이신 생성과의 연관성에 대해서는 공지된 바 없으며 본 발명자들에 의해 처음으로 규명되었다. 특히, 상기와 같은 hisEG 유전자의 프로모터 변이에 의한 HisE 및/또는 hisG의 과발현으로 인한 HisE 및/또는 HisG 효소의 활성 증가, 및 이에 따른 글라이신 생성량 증가 및 글루탐산 생성량 유지 효과는 본 발명자들에 의해 처음으로 규명되었다.
이때, 상기 용어, "글루탐산"(L-glutamic acid, L-glutamate)은 아미노산의 일종으로 비필수 아미노산으로 구분된다. 중추 신경계에서 가장 흔한 흥분성 신경 전달 물질로 알려져 있으며, 또한 감칠맛이 난다고 하여 이의 모노나트륨염(monosodium glutamate: MSG)이 조미료로 개발되어 널리 사용되고 있다. 일반적으로 글루탐산을 생산하는 미생물의 발효를 통해 제조된다.
또한, 상기 용어, "글라이신"(glycine)은 단맛이 나는 무색 결정의 아미노산으로, 글리신이라고도 한다. 식품 조미료로 주로 사용되며, 의약 면에서는 수액, 제산제, 종합 아미노산제제, 영양 보급제로도 이용되고 있다. 일반적으로 모노클로로초산법, 스트렉커(Strecker)법 등의 공업적인 합성법을 통해 제조되는데, 합성법은 D형 및 L형의 아미노산이 혼합되어 제조되므로 광학분할을 해야하는 불편함이 있다. 따라서, 반응조건이 온화하고 단시간에 대량생산이 가능하며 공정이 환경 친화적이며 생산물질이 생분해성이라는 등의 다양한 장점을 갖는 발효법으로 글라이신을 제조할 필요가 있다.
구체적으로, 상기 폴리뉴클레오티드는 서열번호 2 또는 서열번호 3의 뉴클레오티드 서열로 이루어지는 것일 수 있다.
또한, 본 출원의 뉴클레오티드 서열은 종래 알려진 돌연변이 유발법, 예를 들면 방향성 진화법(direct evolution) 및 부위특이적 돌연변이법(site-directed mutagenesis)등에 의하여 변형될 수 있다.
따라서, 상기 폴리뉴클레오티드는 상기 서열번호 2 또는 서열번호 3의 뉴클레오티드 서열에 대해서 적어도 60% 이상, 구체적으로는 70% 이상, 보다 구체적으로는 80% 이상, 보다 더 구체적으로는 83% 이상, 84% 이상, 88% 이상, 90% 이상, 93% 이상, 95% 이상, 또는 97% 이상의 상동성을 가지는 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드를 포함할 수 있다. 상기 서열과 상동성을 갖는 서열로서 실질적으로 서열번호 2 또는 서열번호 3의 뉴클레오티드 서열과 동일하거나 상응하는 생물학적 활성을 갖는 폴리뉴클레오티드 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 폴리뉴클레오티드 서열을 갖는 경우도 역시 본 출원의 범주에 포함됨은 자명하다.
본 출원에서 용어 "상동성"은 주어진 뉴클레오티드 서열과 일치하는 정도를 의미하며 백분율로 표시될 수 있다. 본 명세서에서, 주어진 뉴클레오티드 서열과 동일하거나 유사한 활성을 갖는 그의 상동성 서열이 "% 상동성"으로 표시된다. 상기 뉴클레오티드 서열에 대한 상동성은 예를 들면, 문헌에 의한 알고리즘 BLAST[참조: Karlin 및 Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873(1993)]나 Pearson에 의한 FASTA(참조: Methods Enzymol., 183, 63, 1990)를 사용하여 결정할 수 있다. 이러한 알고리즘 BLAST에 기초하여, BLASTN이나 BLASTX라고 불리는 프로그램이 개발되어 있다(참조: http://www.ncbi.nlm.nih.gov).
상기 "엄격한 조건"은 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성이 높은 유전자끼리, 60% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화의 세척 조건인 60℃, 1×SSC, 0.1% SDS, 구체적으로는 60℃, 0.1×SSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1×SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다. 혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 뉴클레오티드가 상보적 서열을 가질 것을 요구한다. 상기 용어 "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 폴리뉴클레오티드 서열뿐만 아니라 전체 서열에 상보적인 단리된 폴리뉴클레오티드 단편을 포함할 수 있다.
구체적으로, 상동성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃? 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다. 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra,9.50-9.51, 11.7-11.8 참조).
특히, 상기에서 서열번호 2 또는 서열번호 3의 뉴클레오티드 서열로 이루어진다(consist of)는 표현은 상기 폴리뉴클레오티드를 프로모터로서 목적 유전자에 연결하여 사용할 때, 제한효소 사용과 같이 목적 유전자에 연결하는 과정 중에 발생할 수 있는 뉴클레오티드의 추가, 및/또는 삭제, 및/또는 변이 등의 경우를 배제하지 않는다.
예를 들어, 서열번호 2 또는 서열번호 3으로 표시되는 뉴클레오티드 서열로 이루어진 프로모터 활성을 갖는 상기 폴리뉴클레오티드는, 서열번호 2 또는 서열번호 3의 뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화되어 본 출원의 프로모터 활성을 갖는 뉴클레오티드 서열도 포함할 수 있다.
나아가, 본 출원의 폴리뉴클레오티드는 목적 단백질을 코딩하는 유전자와 작동 가능하게 연결될 수 있다.
본 출원에서 용어 "유전자 발현 조절 서열"은 본 출원의 폴리뉴클레오티드를 포함하며, 이에 작동 가능하게 연결되어 있는 목적 유전자를 발현시킬 수 있는 서열을 의미한다.
당업자라면 프로모터를 포함한 유전자 발현 조절 서열의 변이를 이용하여 발현 강화를 시도해볼 수 있으며, 예컨대 개시코돈 서열의 변이에 의한 발현 강화를 시도할 수 있다. 하나의 예로서 HisE 효소의 개시코돈이 GTG에서 ATG로 치환된 것일 수 있다.
본 출원에서 용어 "작동 가능하게 연결된"(operatively linked)은 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드가 목적 유전자의 전사를 개시 및 매개하도록 상기 유전자 서열과 기능적으로 연결되어 있는 것을 의미한다. 작동 가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있으나, 이에 제한되지 않는다.
나아가, 본 출원의 유전자 발현 조절 서열은 유전자의 전사를 실시하기 위한 프로모터 외에 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열 및 전사 및 해독의 종결을 조절하는 DNA 등을 더 포함할 수 있다.
예를 들면, 원핵생물에 적합한 조절 서열은 프로모터 외에 리보좀 결합 부위를 더 포함할 수 있으나, 이에 제한되지 않는다. 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드는 통상의 당업자에 의해 필요에 따라 상기한 바와 같은 유전자 발현 조절을 위한 서열을 구성할 수 있다.
본 출원에서, 상기 목적 유전자는 미생물에서 발현을 조절하고자 하는 목적 단백질을 코딩하는 유전자를 의미한다.
예를 들면, 글루탐산, 글라이신, 및 히스티딘 등의 아미노산의 생산에 관여하는 유전자일 수 있으나, 이에 제한되는 것은 아니다. 구체적으로, 상기 유전자는 히스티딘 생합성 관련 효소를 코딩하는 유전자일 수 있으나, 이에 제한되는 것은 아니다. 더욱 구체적으로, 상기 유전자는 HisE 및/또는 HisG를 코딩하는 유전자일 수 있으나, 이에 제한되는 것은 아니다. 예를 들면, 상기 hisE 유전자 및 hisG 유전자는 오페론을 구성할 수 있으며, 본 출원의 폴리뉴클레오티드는 hisE 및/또는 hisG의 전사 활성을 강화시킬 수 있다. 또한, 상기 hisE 및 hisG는 내재적 유전자이거나 외래 유전자일 수 있으며, 활성 조절을 위한 변이를 포함하는 것일 수 있다. 예를 들면, 상기 HisG는 히스티딘 피드백 저해 해제를 위한 변이를 포함하는 것일 수 있다. 상기 HisE 또는 HisG를 코딩하는 유전자의 서열은 미국 국립보건원의 GenBank와 같은 공지의 데이터 베이스를 통하여 당업자가 용이하게 입수할 수 있다.
본 출원의 목적상, 상기 유전자 발현 조절 서열은 히스티딘 생합성 관련된 효소를 코딩하는 유전자, 구체적으로 hisE 및/또는 hisG의 발현을 증가시킬 수 있다.
본 출원의 또 다른 하나의 양태는 상기 폴리뉴클레오티드 및 상기 폴리뉴클레오티드와 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자를 포함하는 벡터를 제공한다.
상기 폴리뉴클레오티드는 앞서 설명한 바와 같다.
구체적으로, 상기 목적 단백질은 포스포리보실-ATP 피로포스파타제(Phosphoribosyl-ATP pyrophosphatase: HisE), ATP 포스포리보실트랜스퍼라제 (ATP phosphoribosyltransferase: HisG) 또는 이들의 조합일 수 있다. 상기 목적 단백질로서 HisE 및 HisG 효소는 이와 상동성이 있는 단백질을 포함할 수 있고, 일부 아미노산이 변이된 단백질일 수 있다. 하나의 예로서, ATP 포스포리보실트랜스퍼라제 (ATP phosphoribosyltransferase: HisG)는 서열번호 16으로 표시되는 HisG 아미노산 서열의 233번째 및 235번째 아미노산이 각각 히스티딘(H) 및 글루타민(Q)으로 치환된 것일 수 있다.
본 출원에서 용어 "벡터"는 적합한 숙주 내에서 목적 유전자를 발현시킬 수 있도록 유전 물질을 보유하는 인위적 DNA 분자로서, 상기 폴리뉴클레오티드 또는 적합한 유전자 발현 조절 서열; 및 이에 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자의 뉴클레오티드 서열을 포함하는 DNA 제조물을 의미한다.
본 출원에서 사용되는 벡터는 숙주세포 내에서 발현 가능한 것이면 특별히 제한되지 않으며, 당업계에 알려진 임의의 벡터를 이용하여 숙주세포를 형질전환시킬 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다.
예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, λLB3, λBL4, λⅨII, λASHII, λAPII, λt10, λt11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다.
또한, 숙주세포 내 염색체 삽입용 벡터를 통해 염색체 내에 내재적 프로모터를 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드로 교체시킬 수 있다. 예를 들면, pECCG117, pDZ, pACYC177, pACYC184, pCL, pUC19, pBR322, pMW118, pCC1BAC, pCES208, pXMJ19 벡터 등을 사용할 수 있으나, 이에 제한되지 않는다.
또한, 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있다.
본 출원의 벡터는 상동재조합을 일으켜서 염색체 내로 삽입될 수 있으므로 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 폴리뉴클레오티드의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 상기 폴리뉴클레오티드 또는 유전자 발현 조절 서열 및 목적 단백질을 코딩하는 유전자를 포함하는 벡터를 숙주세포 내에 도입하여, 숙주세포 내에서 상기 유전자가 발현할 수 있도록 하는 것을 의미한다. 나아가, 숙주세포 내에서 목적 유전자가 발현될 수 있기만 한다면, 형질전환된 상기 폴리뉴클레오티드 및 목적 단백질을 코딩하는 유전자는, 숙주세포의 염색체 상에 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두의 경우를 포함할 수 있다.
상기 형질전환하는 방법은 상기 유전자 발현 조절 서열 및 목적 단백질을 코딩하는 유전자를 세포 내로 도입하는 모든 방법을 포함하며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법(electroporation), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 상기 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드와 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자를 포함하는, 코리네박테리움 속 미생물을 제공한다.
상기 폴리뉴클레오티드 및 상기 폴리뉴클레오티드와 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자는 앞서 설명한 바와 같다.
본 출원에서 용어 "미생물"은 야생형 미생물이나, 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 약화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물을 모두 포함하는 개념이다.
본 출원에서, 상기 미생물은 상기 폴리뉴클레오티드를 포함할 수 있고, 구체적으로 상기 폴리뉴클레오티드 및/또는 상기 폴리뉴클레오티드와 작동 가능하게 연결되고 목적 단백질을 코딩하는 유전자를 포함할 수 있다. 또는, 상기 미생물은 상기 폴리뉴클레오티드 또는 유전자 발현 조절 서열 및 목적 단백질을 코딩하는 유전자를 포함하는 벡터를 포함할 수 있으나, 이에 제한되지 않는다. 또한, 상기 폴리뉴클레오티드, 상기 목적 단백질을 코딩하는 유전자 및 벡터는 형질전환에 의해 상기 미생물에 도입될 수 있으나, 이에 제한되지 않는다. 나아가, 상기 미생물은 상기 유전자가 발현될 수 있다면, 상기 폴리뉴클레오티드 및 목적 단백질을 코딩하는 유전자가, 염색체 상에 위치하거나 염색체 외에 위치하는 것과는 무관하다.
본 출원의 목적상, 상기 폴리뉴클레오티드 및 목적 단백질을 코딩하는 유전자를 포함하는 미생물은 글루탐산의 생성량이 유지되고, 글라이신의 생성량이 증가된 것일 수 있다.
예를 들어, 상기 미생물은 HisE 및/또는 HisG의 활성이 강화된 것일 수 있다.
본 출원에서 상기 미생물은 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드가 도입되어 프로모터로 작동할 수 있는 미생물이라면 제한 없이 포함될 수 있다.
구체적으로, 상기 미생물은 코리네박테리움 속 미생물일 수 있으며, 더욱 구체적으로는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum) 또는 코리네박테리움 플라붐(Corynebacterium flavum)일 수 있고, 가장 구체적으로 코리네박테리움 글루타미쿰일 수 있으나, 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 상기 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및 상기의 배지에서 목적 물질을 회수하는 단계를 포함하는, 목적 물질을 생산하는 방법을 제공한다.
상기 폴리뉴클레오티드 및 미생물은 앞서 설명한 바와 같다.
본 출원에서, 상기 목적 물질은 아미노산일 수 있다. 구체적으로, 상기 아미노산은 다른 언급이 없는 한 L-형태의 아미노산일 수 있으며, 글라이신, 알라닌, 발린, 로이신, 아이소로이신, 트레오닌, 세린, 시스테인, 글루타민, 메치오닌, 아스파라트산, 아스파라긴, 글루탐산, 라이신, 알지닌, 히스티딘, 페닐알라닌, 티로신, 트립토판, 프롤린, 및 이들의 조합으로 구성된 군으로부터 선택될 수 있으나, 이에 제한되지 않는다.
더욱 구체적으로, 상기 아미노산은 글루탐산, 글라이신 또는 이들의 조합일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어 "배양"은 미생물을 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다. 본 출원에서 상기 폴리뉴클레오티드를 포함하는 미생물을 이용하여 목적 물질을 생산하는 방법은 당업계에 널리 알려져 있는 방법을 이용하여 수행할 수 있다. 구체적으로, 상기 배양은 배치 공정, 주입 배치 또는 반복 주입 배치 공정(fed batch or repeated fed batch process)에서 연속식으로 배양할 수 있으나, 이에 제한되는 것은 아니다. 배양에 사용되는 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 한다. 코리네박테리움 균주에 대한 배양 배지는 공지되어 있다(예를 들면, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).
배지 중에서 사용될 수 있는 당원으로는 포도당, 사카로즈, 유당, 과당, 말토즈, 전분, 셀룰로즈와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있으며, 이에 제한되는 것은 아니다.
사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함된다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있으며, 이에 제한되는 것은 아니다.
사용될 수 있는 인원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨을 함유하는 염이 포함될 수 있다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있다. 마지막으로, 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장 물질이 사용될 수 있다. 또한, 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기된 원료들은 배양과정에서 배양물에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있다.
상기 미생물의 배양 중 수산화나트륨, 수산화칼륨, 암모니아와 같은 기초 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다. 또한, 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 호기 상태를 유지하기 위해 배양물 내로 산소 또는 산소-함유 기체(예, 공기)를 주입할 수 있다.
배양물(배지)의 온도는 보통 20℃ 내지 45℃, 구체적으로는 25℃ 내지 40℃일 수 있다. 배양 시간은 원하는 목적 물질의 생성량이 얻어질 때까지 계속할 수 있으나, 구체적으로는 10 내지 160시간일 수 있다.
배양물(배지)로부터의 목적 물질의 회수는 당업계에 알려진 통상적인 방법에 의하여 분리되어 회수될 수 있다. 이러한 분리 방법에는, 원심분리, 여과, 크로마토그래피 및 결정화 등의 방법이 이용될 수 있다. 예를 들면, 배양물을 저속 원심분리하여 바이오매스를 제거하고 얻어진 상등액을, 이온교환 크로마토그래피를 통하여 분리할 수 있으나, 이에 제한되는 것은 아니다. 또 다른 방법으로, 배양물(배지)로부터 균체 분리 및 여과 공정을 수행하고, 별도의 정제 공정 없이 목적 물질을 회수할 수도 있다. 또 다른 방법으로, 상기 회수 단계는 정제 공정을 추가로 포함할 수 있다.
본 출원의 또 다른 하나의 양태는 상기 코리네박테리움 속 미생물을 배지에서 배양하여 발효하는 단계를 포함하는, 발효 조성물의 제조 방법을 제공한다.
본 출원의 또 다른 하나의 양태는 상기 방법에 의해 제조된 발효 조성물을 제공한다.
상기 폴리뉴클레오티드 및 미생물은 앞서 설명한 바와 같으며, 상기 미생물을 배지에서 배양하는 단계 역시 앞서 설명한 바와 같다.
본 출원에서 용어 "상기 발효 조성물"은, 본 출원의 미생물을 배양하여 수득된 조성물을 의미한다. 나아가, 상기 발효 조성물은 상기 미생물을 배양한 후, 적절한 후처리공정을 거친 후 수득된 액상 또는 분말 형태의 조성물을 포함할 수 있다. 이 때, 적절한 후처리공정은, 예를 들어, 상기 미생물의 배양 공정, 균체 제거 공정, 농축 공정, 여과 공정, 및 담체 혼합 공정을 포함할 수 있으며, 추가적으로 건조 공정을 더 포함할 수도 있다. 경우에 따라서, 상기 후처리공정은 정제 공정을 포함하지 않을 수 있다. 상기 발효 조성물은 본 출원의 미생물을 배양함으로써 일정 수준의 글루탐산 함량을 유지하면서 글라이신의 함량이 증가된 조성물을 포함함에 따라 최적의 맛을 낼 수 있다.
또한, "상기 발효 조성물"은 상기의 액상 또는 분말 형태의 조성물이 포함된 조미소재 제품(예를 들어, 육수용 분말 제품, 스낵 시즈닝 제품 등)을 배제하지 않는다. 나아가, "상기 발효 조성물"은 본 출원의 미생물을 배양하여 수득된 조성물을 포함하기만 한다면, 비발효 공정으로 수득된 물질 및/또는 비천연 공정으로 수득된 또 다른 물질을 추가로 혼합한 경우를 배제하지 않는다.
이하 본 출원을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예에 국한되는 것은 아니다.
실시예 1. 글라이신 생성능 증가 변이주 선별
실시예 1-1. UV 조사를 통한 무작위 돌연변이 유발
발효의 목적 산물인 글라이신의 생성능이 향상된 변이 균주를 선별하기 위하여, 먼저 야생형 코리네박테리움 글루타미쿰(Corynebacterium glutamicum, ATCC13869)을 한천을 포함하는 영양배지에 도말하여 30℃에서 16시간 동안 배양하였다. 이렇게 획득한 수백 개의 콜로니를 실온에서 UV를 조사하여 균주 내 게놈상에 무작위 돌연변이를 유발시켰다.
실시예 1-2. 돌연변이 유발 균주 발효역가 실험 및 균주 선별
이후, 무작위 돌연변이가 유발된 상기 돌연변이 균주들을 대상으로 발효 역가 실험을 실시하였다.
각각의 콜로니를 영양배지에서 계대 배양한 후, 발효배지에서 5시간 배양하였다. 그런 다음, 각각의 배지에 25% 트윈40(tween40)를 0.4% 농도로 추가하였으며, 각각의 콜로니를 다시 32시간 동안 배양하였다.
영양배지 :
포도당 1%, 육즙 0.5%, 폴리펩톤 1%, 염화나트륨 0.25%, 효모엑기스 0.5%, 한천 2%, 유레아 0.2%, pH 7.2
발효배지 :
원당 6%, 탄산칼슘 5%, 황산암모늄 2.25%, 일인산칼륨 0.1%, 황산마그네슘 0.04%, 황산철 10 mg/L, 바이오틴 0.3 mg/L, 티아민 염산염 0.2 mg/L
상기 조건에서 각각의 콜로니를 배양하여, 야생형 코리네박테리움 글루타미쿰(ATCC13869)과 동등하거나 그 이상의 L-글루탐산을 생산하는 돌연변이 균주들이 선별되었다. 또한, 선별한 돌연변이 균주들에 대하여, YSI를 이용하여 L-글루탐산 농도를 측정하였고, HPLC를 이용하여 글라이신 농도를 측정하였다. 측정한 L-글루탐산 및 글라이신의 농도는 표 1에 나타내었다.
균주명 L-글루탐산(g/L) L-글라이신(mg/L)
ATCC13869 14.0 119
ATCC13869-g1 13.2 102
ATCC13869-g2 9.6 35
ATCC13869 -g3 13.9 121
ATCC13869-g4 13.3 110
ATCC13869-g5 12.7 101
ATCC13869 -g6 14.8 132
ATCC13869-g7 2.1 7
ATCC13869-g8 8.4 75
ATCC13869-g9 13.5 115
ATCC13869 -g10 14.2 143
ATCC13869-g11 12.6 108
ATCC13869-g12 13.7 103
ATCC13869-g13 10.1 82
ATCC13869-g14 14.2 105
ATCC13869-g15 13.5 100
ATCC13869-g16 7.2 67
ATCC13869-g17 12.8 101
ATCC13869-g18 13.0 99
ATCC13869-g19 11.9 82
ATCC13869 -g20 14.0 152
ATCC13869-g21 13.8 111
ATCC13869-g22 9.7 120
ATCC13869-g23 13.2 114
ATCC13869-g24 13.3 114
표 1을 참고하여, 야생형 균주에 비하여 글루탐산의 생산량이 동등 수준 또는 그 이상이며, 글라이신 생산량이 증가한 균주로서 "ATCC13869-g3", "ATCC13869-g6", "ATCC13869-g10" 및 "ATCC13869-g20"을 선별하였다.
실시예 2. 유전자 시퀀싱을 통한 변이 확인
상기 돌연변이 균주의 유전자 변이를 확인하기 위하여, 상기 ATCC13869-g3, ATCC13869-g6, ATCC13869-g10 및 ATCC13869-g20 균주의 유전자들을 시퀀싱하여 야생형 균주와 비교하였다.
그 결과, 상기 ATCC13869-g3 및 ATCC13869-g10 균주가 포스포리보실-ATP 피로포스파타제(Phosphoribosyl-ATP pyrophosphatase: HisE)를 코딩하는 유전자의 프로모터 영역(promoter region)의 특정 위치에 동일한 변이를 포함하고 있음을 확인하였다. 또한, ATCC13869-g20 균주의 경우 ATCC13869-g3 및 ATCC13869-g10 균주의 HisE를 코딩하는 유전자의 프로모터 영역의 특정 위치에 동일한 변이 외에 하나의 변이를 더 포함하고 있음을 확인하였다.
구체적으로, ATCC13869-g3 및 ATCC13869-g10는 서열번호 1로 표시되는 프로모터 영역의 서열 내 53번째 뉴클레오티드 A가 T로, 55번째 뉴클레오티드 G가 T로 치환된 변이를 포함하고 있음을 확인하였다. ATCC13869-g20는 서열번호 1로 표시되는 프로모터 영역의 서열 내 53번째 뉴클레오티드 A가 T로, 55번째 뉴클레오티드 G가 T로, 60번째 뉴클레오티드 T가 G로 치환된 변이를 포함하고 있음을 확인하였다. 서열번호 1로 표시되는 상기 프로모터 영역은 코리네박테리움 속 미생물, 보다 구체적으로, 야생형 코리네박테리움 글루타미쿰(ATCC13032, ATCC13869, ATCC14067)에 공통적으로 포함된 서열임을 확인하였다.
따라서, 이하 실시예 3 및 4에서는, 상기 변이가 코리네박테리움 속 미생물의 글루탐산 및 글라이신 생성량에 영향을 미치는지 확인하고자 하였다.
실시예 3. 변이가 도입된 균주 제작 및 글라이신 생산량 확인
실시예 3-1. 변이가 도입된 균주 제작
상기 실시예 2를 통해 확인한 변이가 도입된, 변이 균주를 제작하고자 하였다. 구체적으로, 상기 변이를 야생형 코리네박테리움 글루타미쿰(ATCC13869)에 도입(서열번호 1로 표시되는 폴리뉴클레오티드 서열의 53번째와 55번째 뉴클레오티드를 T로 치환, 혹은 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 53번째와 55번째 뉴클레오티드를 T로 치환 및 60번째 뉴클레오티드를 G로 치환)하기 위하여, 타겟 변이를 포함하는 역방향의 올리고뉴클레오티드를 75-머(mer)의 길이로 디자인하였다(서열번호 4 혹은 서열번호 5).
구체적으로, 상기 서열번호 4 혹은 서열번호 5의 올리고뉴클레오티드 30 ㎍을 코리네박테리움 글루타미쿰 야생형 ATCC13869 균주와 ATCC13032 균주에 전기펄스법(Appl. Microbiol. Biothcenol., 1999, 52: 541-545)으로 형질전환하고 복합액체배지를 1 ml 첨가하여, 30℃에서 30분 동안, 160 rpm으로 진탕 배양하였다. 이후, 배양액을 얼음에서 10분간 인큐베이션(incubation)하고, 4℃에서 10분 동안 4000 rpm으로 원심분리한 후 상등액을 제거하여 균체를 확보하였다. 이후, 4℃의 10% 글리세롤 용액을 1 ml 첨가하고 혼합한 후, 4℃에서 10분 동안 4000 rpm으로 원심분리하고 상등액을 제거하여 균체를 세척하였다. 이와 같이 균체를 1회 더 세척하고, 4℃의 10% 글리세롤 용액을 0.1 ml 첨가하여 다음 형질전환을 위한 균주를 준비하였다. 이후, 상기와 같은 전기펄스법으로 서열번호 4 혹은 서열번호 5의 올리고뉴클레오티드를 이용하여 형질전환하는 과정을 10회 반복한 후, 복합평판배지에 도말하여 콜로니를 확보하였다(Nat. Protoc., 2014 Oct; 9(10): 2301-16).
상기 확보한 콜로니의 유전자 서열 분석을 수행한 결과, 균주에 상기의 타겟 변이가 도입된 것을 확인하였으며, 변이가 도입된 상기 균주를 "ATCC13869::hisEG-pro-2mt", "ATCC13869::hisEG-pro-3mt" 및 "ATCC13032::hisEG-pro-2mt", "ATCC13032::hisEG-pro-3mt"로 명명하였다.
실시예 3-2. 글라이신 생산량 확인
상기 실시예 3-1을 통해 제작한 변이 균주 ATCC13869::hisEG-pro-2mt, ATCC13869::hisEG-pro-3mt 및 ATCC13032::hisEG-pro-2mt, ATCC13032::hisEG-pro-3mt 와 이들의 각 야생형 코리네박테리움 글루타미쿰(ATCC13869 및 ATCC13032)은 각각 실시예 1-2와 동일한 방법으로 배양하였다.
배양이 완료된 후, 각 배지 내 L-글루탐산 농도 및 글라이신 농도를 측정하였다. 측정한 L-글루탐산 및 글라이신의 농도는 하기 표 2에 나타내었다.
균주명 L-글루탐산(g/L) L-글라이신(mg/L)
ATCC13869 14.2 122
ATCC13869::hisEG-pro-2mt 14.0 134
ATCC13869::hisEG-pro-3mt 14.3 141
ATCC13032 9.1 73
ATCC13032::hisEG-pro-2mt 9.4 91
ATCC13032::hisEG-pro-3mt 9.3 99
표 2에 나타낸 바와 같이, 변이가 도입된 코리네박테리움 글루타미쿰 ATCC13869::hisEG-pro-2mt, ATCC13869::hisEG-pro-3mt 및 ATCC13032::hisEG-pro-2mt, ATCC13032::hisEG-pro-3mt 균주가 생산한 L-글루탐산의 농도는, 야생형 코리네박테리움 글루타미쿰 ATCC13869 및 ATCC13032 균주가 생산한 L-글루탐산 농도와 유사함을 확인하였다.
반면에, 야생형 코리네박테리움 글루타미쿰 ATCC13869 및 ATCC13032 균주는 글라이신을 각각 122 및 73 mg/L로 생산하였으나, ATCC13869::hisEG-pro-2mt 및 ATCC13032::hisEG-pro-2mt 균주는 각각 134 및 91 mg/L 생산함을 확인하여, 야생형 균주에 비하여 변이된 균주에서 생산된 글라이신 농도가 더 높음을 확인하였다. 또한 ATCC13869::hisEG-pro-3mt 및 ATCC13032::hisEG-pro-3mt 균주는 글라이신을 각각 141 및 99 mg/L로 생산하여, ATCC13869::hisEG-pro-2mt 및 ATCC13032::hisEG-pro-2mt 균주에 비해서도 생산된 글라이신 농도가 더 높음을 확인하였다.
즉, 상기 변이들은 미생물의 L-글루탐산 생성능에는 별다른 영향을 미치지 않고 유지하면서, 글라이신 생성능을 현저하게 증가시킨다는 것을 확인하였다.
한편, 상기 ATCC13869::hisEG-pro-2mt 및 ATCC13869::hisEG-pro-3mt 균주는 2018년 2월 28일 및 2019년 3월 14일자로 부다페스트 조약 하의 기탁기관인 한국미생물보존센터(KCCM)에 균주명 "CA02-9206" 및 "CA02-9215"로 국제 기탁하여 "KCCM12226P" 및 "KCCM12457P"의 기탁번호를 부여받았다.
실시예 4. 변이가 도입된 KFCC11074의 글루탐산 및 글라이신 생성량 확인
실시예 4-1. 변이가 도입된 벡터 제작
야생형 균주 이외에, 글루탐산 생산능이 증가된 균주에서도 상기 변이가 동일한 효과를 나타내는지 확인하기 위하여, 글루탐산 생산 균주로 알려진 KFCC11074 균주(한국 등록특허공보 제10-0292299호)에 변이를 도입하고자 하였다.
구체적으로, 상기 균주가 포함하는 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 53번째 및 55번째 뉴클레오티드를 T로 치환, 혹은 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 53번째 및 55번째 뉴클레오티드를 T로 치환 및 60번째 뉴클레오티드를 G로 치환하기 위하여 유전자 치환 벡터를 제작하였다. 벡터를 제작하기 위한 유전자 단편은 ATCC13869 게노믹 DNA를 주형으로 PCR을 통하여 획득하였다. 미국 국립보건원 진뱅크(NIH GenBank)에 등록되어 있는 코리네박테리움 글루타미쿰(ATCC13869) 유전자 및 주변 염기서열에 대한 정보를 바탕으로, 서열번호 6, 7, 8, 9, 10 및 11의 폴리뉴클레오티드를 포함하는 프라이머를 제작하였다.
PCR의 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 1분 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다. 보다 구체적으로, 서열번호 6 및 7 프라이머를 이용하여 증폭한 500bp의 폴리뉴클레오티드와 서열번호 8 및 9의 프라이머를 이용하여 증폭한 500bp의 폴리뉴클레오티드를 얻었다. 상기 수득한 두 유전자 단편을 제한효소 SalI으로 절단한 pDZ 벡터(대한민국 등록특허 제10-0924065호 및 국제 공개특허 제2008-033001호)에 인퓨전 효소를 이용하여 연결함으로써 hisE 프로모터를 포함하는 하나의 유전자 치환 벡터를 제작하였고, 이를 "pDZ-hisE-pro-2mt"로 명명하였다. 또한 서열번호 6 및 11 프라이머를 이용하여 증폭한 500bp의 폴리뉴클레오티드와 서열번호 10 및 9의 프라이머를 이용하여 증폭한 500bp의 폴리뉴클레오티드를 얻었다. 상기 수득한 두 유전자 단편을 제한효소 SalI으로 절단한 pDZ 벡터(대한민국 등록특허 제10-0924065호 및 국제 공개특허 제2008-033001호)에 인퓨전 효소를 이용하여 연결함으로써 hisE 프로모터를 포함하는 하나의 유전자 치환 벡터를 제작하였고, 이를 "pDZ-hisE-pro-3mt"로 명명하였다. 상기의 벡터 제작을 위해 사용된 프라이머 서열 정보는 하기 표 3에 나타내었다.
서열번호 프라이머 명 5' 서열 3'
6 hisE-pro-2mt-AF GATCCTCTAGAGTCGACTTCGACGAATCCCTCG
7 hisE-pro-2mt-AR CGGTACATTATACCACACAACAGTTATCAATG
8 hisE-pro-2mt-BF GTGGTATAATGTACCGAGTGAAGACATTTGAC
9 hisE-pro-2mt-BR ATGCCTGCAGGTCGACTGATACCCAAATCGAG
10 hisE-pro-3mt-AR CGGTCCATTATACCACACAACAGTTATCAATG
11 hisE-pro-3mt-BF GTGGTATAATGGACCGAGTGAAGACATTTGAC
실시예 4-2. 변이가 도입된 KFCC11074의 제작 및 글루탐산 및 글라이신 생성량 확인
상기 실시예 4-1을 통해 제작한 유전자 치환 벡터인 pDZ-hisE-pro-2mt 및 pDZ-hisE-pro-3mt를 KFCC11074 균주에 일렉트로포레이션법으로 도입하여, 변이가 도입된 글루탐산 및 글라이신 생산 균주 "KFCC11074_Pro(2mt)_hisEG" 및 "KFCC11074_Pro(3mt)_hisEG"를 제작하였다.
구체적으로, 형질전환(Appl. Microbiol.Biotechnol., 1999, 52: 541-545)을 통해 제작하였으며, 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주를 카나마이신(kanamycin) 25 mg/L를 함유한 한천 영양배지에서 선별하였다. 선별한 1차 균주를 다시 2차 교차(cross-over)를 거쳐, 타겟 변이 2개 및 3개가 도입된 균주를 각각 선별하였다. 최종 형질전환된 균주의 변이(치환) 여부는 서열번호 6 및 9의 프라이머 쌍을 이용하여 PCR을 수행한 후 시퀀싱을 통해 확인하였다.
이후, 선별한 균주 KFCC11074_Pro(2mt)_hisEG 및 KFCC11074_Pro(3mt)_hisEG를 영양배지에 도말하여 30℃에서 16시간 배양하였다. 이후 121℃에서 15분간 가압 살균된 발효배지 25 ml을 250 ml 진탕용 삼각플라스크에 분주하고 영양배지에서 배양된 균주를 접종하여 48시간 배양하였다. 배양 조건은 회전 수 200rpm, 온도 37℃, pH8.0으로 조절하였다. 상기 영양배지와 발효배지 조성은 다음과 같다.
영양배지 :
포도당 1%, 육즙 0.5%, 폴리펩톤 1%, 염화나트륨 0.25%, 효모엑기스 0.5%, 한천 2%, 유레아 0.2%, pH 7.2
발효배지 :
원당 6%, 탄산칼슘 5%, 황산암모늄 2.25%, 일인산칼륨 0.1%, 황산마그네슘 0.04%, 황산철 10 mg/L, 바이오틴 0.3 mg/L, 티아민 염산염 0.2 mg/L
배양 종료 후, HPLC를 이용한 방법을 통해 L-글루탐산 및 글라이신 생산량을 측정하였으며, 측정 결과는 하기 표 4에 나타내었다.
균주명 L-글루탐산(g/L) L-글라이신(mg/L)
KFCC11074 11.8 170
KFCC11074_Pro(2mt)_hisEG 11.7 203
KFCC11074_Pro(3mt)_hisEG 12.0 212
표 4에 나타낸 바와 같이, 변이가 도입된 코리네박테리움 글루타미쿰 KFCC11074_Pro(2mt)_hisEG 및 KFCC11074_Pro(3mt)_hisEG 균주가 생산한 L-글루탐산의 농도는, 변이가 도입되지 않은 코리네박테리움 글루타미쿰 KFCC11074 균주가 생산한 L-글루탐산 농도와 유사함을 확인하였다.
반면에, 상기 KFCC11074_Pro(2mt)_hisEG 및 KFCC11074_Pro(3mt)_hisEG 균주가 생산한 글라이신의 농도는, 상기 KFCC11074가 생산한 글라이신 농도 대비 각각 33 mg/L 및 42 mg/L 증가함을 확인하였다.
즉, 상기 변이는 미생물의 L-글루탐산 생성능에는 별다른 영향을 미치지 않고 유지하면서, 글라이신 생성능을 현저하게 증가시킨다는 것을 확인하였다.
실시예 5. HisG 피드백 억제 해제 변이 도입된 균주 제작 및 글루탐산 및 글라이신 생성량 확인
실시예 5-1. hisG 피드백 억제 해제 변이가 도입된 벡터 제작
상기 실시예 1-1 내지 4-2를 통해 hisEG 유전자의 프로모터 내 변이에 의하여 균주의 글라이신 생성능이 증가됨을 확인한바, 글라이신 생성능 증가에 대한 효과를 극대화하기 위해 균주에 히스티딘 피드백 억제를 해제한 변이를 도입하였고, 이의 글라이신 생산능을 확인하였다.
한편, hisE와 hisG 유전자는 오페론으로 구성되어있으며 이들 유전자는 히스티딘 생합성 경로에 관여하는 유전자이다. 특히 상기 HisG는 생산물인 히스티딘에 의해 피드백 억제를 받으므로, 피드백 억제가 해제된 변이를 도입하여 HisG 의 활성을 증가시키는 경우, 균주의 글라이신 생산능이 증가되는지 확인하고자 하였다.
구체적으로, hisG 유전자에 문헌상 알려진 G233H 및 T235Q 변이(Schendzielorz et al., 2014)를 도입하고자 하였다. 서열번호 16로 표시되는 hisG 아미노산 서열의 233번째 및 235번째 아미노산을 각각 H와 Q로 치환하기 위하여, 유전자 치환 벡터를 제작하였다. 벡터를 제작하기 위한 유전자 단편은 ATCC13869 게노믹 DNA를 주형으로 PCR을 통하여 획득하였다. 미국 국립보건원 진뱅크에 등록되어 있는 코리네박테리움 글루타미쿰(ATCC13869) 유전자 및 주변 염기서열에 대한 정보를 바탕으로, 서열번호 12, 13, 14 및 15의 폴리뉴클레오티드를 포함하는 프라이머를 제작하였다.
PCR의 조건은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 1분 중합을 30회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다. 서열번호 12 및 13의 프라이머를 이용하여 증폭된 722bp의 폴리뉴클레오티드와 서열번호 14 및 15의 프라이머를 이용하여 증폭된 798bp의 폴리뉴클레오티드를 얻었다. 상기 수득한 두 유전자 단편을 제한효소 SalI으로 절단한 pDZ 벡터(대한민국 등록특허 제10-0924065호 및 국제 공개특허 제2008-033001호)에 인퓨전 효소를 이용하여 연결함으로써 hisG(G233H/T235Q) 변이를 포함하는 폴리뉴클레오티드가 포함된, 하나의 1.5kbp 유전자 치환 벡터를 제작하였고, 이를 "pDZ-hisG(G233H/T235Q)"로 명명하였다. 상기의 벡터 제작을 위해 사용된 프라이머 서열 정보는 하기 표 5에 나타내었다.
서열번호 프라이머 명 5' 서열 3'
12 hisG(G233H/T235Q)-AF GATCCTCTAGAGTCGACCCCAAACAAGGGCTCGC
13 hisG(G233H/T235Q)-AR CGTGCCAGTGGGGATACCTGTGGGTGGG
14 hisG(G233H/T235Q)-BF AACCCCAGGCCTATCCCACCCACAGGTATC
15 hisG(G233H/T235Q)-BR ATGCCTGCAGGTCGACGCAAGGTTGGCAACAAC
실시예 5-2. HisG 피드백 억제 해제 변이 도입된 hisE 프로모터 변이 균주 제작 및 평가
상기 실시예 5-1을 통해 제작한 유전자 치환 벡터 "pDZ-hisG(G233H/T235Q)"를 KFCC11074 균주에 도입하여 HisG 피드백 억제가 해제된 "KFCC11074_hisG(G233H/T235Q)" 균주를 제작하였다. 또한, 상기 벡터를 KFCC11074_Pro(2mt)_hisEG 와 KFCC11074_Pro(3mt)_hisEG 균주에 도입하여, 본 출원의 변이가 도입된 "KFCC11074_hisG(G233H/T235Q)_Pro(2mt)_hisEG"와 "KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG" 균주를 제작하였다.
구체적으로, 상기 균주는 형질전환(Appl. Microbiol.Biotechnol., 1999, 52: 541-545)을 통해 제작되었으며, 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주를 카나마이신(kanamycin) 25 mg/L를 함유한 한천 영양배지에서 선별하였다. 선별한 1차 균주를 다시 2차 교차(cross-over)를 거쳐, 타겟 G233H/T235Q 변이가 도입된 균주를 선별하였다. 최종 형질전환된 균주의 변이(치환) 여부는 서열번호 12 및 15의 프라이머 쌍을 이용하여 PCR을 수행한 후 시퀀싱을 통해 확인하였다.
이후, 선별한 균주 KFCC11074_hisG(G233H/T235Q), KFCC11074_hisG(G233H/T235Q)_Pro(2mt)_hisEG 및 KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG를 실시예 4-2와 동일한 방법으로 배양하고, 배양이 완료된 후 각 배지 내 L-글루탐산 농도 및 글라이신 농도를 측정하였다. 측정한 L-글루탐산 및 글라이신의 농도는 하기 표 6에 나타내었다.
균주명 L-글루탐산 (g/L) L-글라이신 (mg/L)
KFCC11074_hisG(G233H/T235Q) 10.3 445.7
KFCC11074_hisG(G233H/T235Q)_Pro(2mt)_hisEG 10.1 760.0
KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG 10.3 783.2
표 6에 나타낸 바와 같이, hisEG 프로모터 변이가 도입된 코리네박테리움 글루타미쿰 KFCC11074_hisG(G233H/T235Q)_Pro(2mt)_hisEG와 KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG 균주가 생산한 L-글루탐산의 농도는, HisG 피드백 억제가 해제된 변이만 도입된 KFCC11074_hisG(G233H/T235Q) 균주가 생산한 L-글루탐산 농도와 유사함을 확인하였다.
반면에, 상기 KFCC11074_hisG(G233H/T235Q)_Pro(2mt)_hisEG와 KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG 균주가 생산한 글라이신의 농도는, 상기 KFCC11074_hisG(G233H/T235Q)가 생산한 글라이신 농도 대비 314.3mg/L 및 337.5mg/L 로서 현저히 증가함을 확인하였다.
즉, 상기 변이들은 미생물의 L-글루탐산 생성능에는 별다른 영향을 미치지 않고 유지하면서, 글라이신 생성능을 현저하게 증가시킨다는 것을 확인하였다. 또한, 이러한 효과는 hisE와 hisG의 활성 증가에 의해 나타남을 알 수 있었다.
실시예 6. 조미소재 제품 제조를 위한 발효 조성물 제조
상기와 같이 본 출원의 뉴클레오티드를 포함하는 균주가 L-글루탐산 생성능에 별다른 영향을 미치지 않으면서 글라이신 생성능이 증가됨을 확인하였다. 따라서, 본 출원의 뉴클레오티드를 포함하는 코리네박테리움 속 미생물을 이용한 발효 조성물을 제조하고자 하였다.
예시적으로, 기본적으로 잘 알려진 조미료 소재인 글루탐산을 주성분으로 하여 제조하되, 풍부한 맛의 구성을 높이기 위해서 다른 조미료 소재 부산물 성분을 증가시키고자 발효균주 및 발효과정을 조절하였다.
실시예 6-1. 5L 발효조를 이용한 발효 조성물 제조
구체적으로, 실시예 5에서 이용한 균주에 대하여, 5L 발효조를 이용한 발효 조성물을 제조하고자 하였다.
배양 배지의 제조에 사용된 성분은 모두 식품 등급에 해당하는 성분만을 사용하였다.
1차 종배지: 포도당 1%, 효모추출물 1%, 펩톤 1%, 황산암모늄 0.1%, 염화나트륨 0.25%, 인산제1칼륨 0.15%, 인산제2칼륨 0.15% 를 함유하며, pH가 8.0인 1차 종배지를 제조하였다.
2차 종배지: 순도 98.5%의 유기농 원당 4.6%, 황산마그네슘 0.05%, 효모추출물 0.5%, 인산제1칼륨 0.2%, 황산철 0.002%, 비오틴 1mg/l, 티아민염산염 2 mg/l 및 약간의 소포제를 함유하며, pH가 7.2인 2차 종배지를 제조하였다.
발효 배지: 순도 98.5%의 유기농 원당 4%, 황산마그네슘 0.03%, 효모추출물 1%, 인산 0.22%, 수산화칼륨 0.4%, 비오틴 0.2mg/l, 티아민염산염 0.6mg/l, 황산망간 0.002%, 황산철 0.002%, 황산아연 0.002%, 황산구리 0.0006% 및 약간의 소포제를 함유하며, pH가 7.4인 발효 배지를 제조하였다.
상기 1차 종배지 50 ml를 500 ml 용량의 진탕용 삼각플라스크에 분주하고 121℃에서 20분간 가압 살균하여 냉각시킨 다음, 상기 균주를 각각 접종하여 회전수 200회/분, 온도 30℃에서 5~7시간 동안 진탕 배양하였다.
상기 2차 종배지를 1.5L 용량의 시험 발효조에 0.25L 조제하고 121℃에서 20분간 가압 살균하여 냉각시킨 다음, 상기 1차 종배양액을 50 ml 접종한 후, 회전수 900회/분, 31.5℃에서 15시간 동안 배양하였다.
상기 발효 배지를 5 L 용량의 시험 발효조에 0.25L 조제하고 121℃에서 20분간 가압 살균하여 냉각시킨 다음, 상기 2차 종배양액 0.26 L를 접종한 후, 회전수 900회/분, 30~34℃에서 배양하였다.
상기 조건으로 배양하면서 상기 코리네박테리움 글루타미쿰의 배양 중 발효액의 pH가 7.0~7.4의 범위가 되도록 28% 암모니아수를 사용하여 계속 조절하였다. 배양 중 잔당의 농도가 0.5~1.5%로 되면 살균된 유기농 원당을 수시로 투입하여 첨가된 당의 합계가 발효액량 대비 30~34%가 될 때까지 계속 배양하였다.
균주명 분석 결과 (g/l)
주요 성분 부산물
고형분 글루탐산 글라이신 아미노산 유기산 잔류당 이온
KFCC11074 140.2 64.2 0.18 11.5 3.5 12.0 11.1
KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG 147.3 59.0 2.43 16.4 2.7 15.1 10.7
그 결과, 상기 표 7에 나타난 바와 같이, 양 균주 간의 글루탐산 생산량은 크게 차이가 없으면서도, 변이가 도입된 코리네박테리움 글루타미쿰 KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG 균주가 생산한 발효액 내 글라이신의 함량이 현저히 증가함을 확인하였다.
3kL 발효조를 이용한 발효 조성물의 경우에도, 양 균주 간의 글루탐산 생산량은 크게 차이가 없으면서도, 변이가 도입된 코리네박테리움 글루타미쿰 KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG 균주는 KFCC11074 균주와 비교하여, 글루탐산 생산량에 큰 차이가 없으면서도(64.2 g/L vs 73 g/L) 글라이신의 함량이 현저히 증가(0.2 g/L vs 3.2 g/L) 함을 확인하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2019003565-appb-I000001
Figure PCTKR2019003565-appb-I000002

Claims (14)

  1. 서열번호 1로 표시되는 뉴클레오티드 서열의 53번째 및 55번째 뉴클레오티드가 T로 치환되거나, 53번째 및 55번째 뉴클레오티드가 T로 치환되고 60번째 뉴클레오티드가 G로 치환된, 프로모터 활성을 가지는 폴리뉴클레오티드.
  2. 제1항에 있어서, 상기 폴리뉴클레오티드는, 서열번호 2 또는 서열번호 3의 뉴클레오티드 서열로 이루어지는, 폴리뉴클레오티드.
  3. 제1항 또는 제2항에 있어서, 상기 폴리뉴클레오티드는 목적 단백질을 코딩하는 유전자와 작동 가능하게 연결되는, 폴리뉴클레오티드.
  4. 제1항 또는 제2항의 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드와 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자를 포함하는 벡터.
  5. 제4항에 있어서, 상기 목적 단백질은 포스포리보실-ATP 피로포스파타제(Phosphoribosyl-ATP pyrophosphatase: HisE), ATP 포스포리보실트랜스퍼라제(ATP phosphoribosyltransferase: HisG) 또는 이들의 조합인, 벡터.
  6. 제1항의 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드와 작동 가능하게 연결된 목적 단백질을 코딩하는 유전자를 포함하는, 코리네박테리움 속 미생물.
  7. 제6항에 있어서, 상기 폴리뉴클레오티드는 서열번호 2 또는 서열번호 3의 뉴클레오티드 서열로 이루어지는, 코리네박테리움 속 미생물.
  8. 제7항에 있어서, 상기 목적 단백질은 포스포리보실-ATP 피로포스파타제(Phosphoribosyl-ATP pyrophosphatase: HisE), ATP 포스포리보실트랜스퍼라제(ATP phosphoribosyltransferase: HisG) 또는 이들의 조합인, 코리네박테리움 속 미생물.
  9. 제8항에 있어서, 상기 ATP 포스포리보실트랜스퍼라제(ATP phosphoribosyltransferase: HisG)는 서열번호 16로 표시되는 HisG 아미노산 서열의 233번째 및 235번째 아미노산이 각각 히스티딘(H) 및 글루타민(Q)으로 치환된, 코리네박테리움 속 미생물.
  10. 제6항 내지 제9항 중 어느 한 항에 있어서, 상기 코리네박테리움 속 미생물은, 코리네박테리움 글루타미쿰인, 미생물.
  11. 제6항 내지 제9항 중 어느 한 항의 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및 상기의 배지에서 목적 물질을 회수하는 단계;를 포함하는 목적 물질을 생산하는 방법.
  12. 제11항에 있어서, 상기 목적 물질은 아미노산인, 방법.
  13. 제6항 내지 제9항 중 어느 한 항의 코리네박테리움 속 미생물을 배지에서 배양하여 발효하는 단계를 포함하는, 발효 조성물의 제조 방법.
  14. 제13항의 방법에 의해 제조된 발효 조성물.
PCT/KR2019/003565 2018-03-27 2019-03-27 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법 WO2019190192A1 (ko)

Priority Applications (8)

Application Number Priority Date Filing Date Title
SG11202001730TA SG11202001730TA (en) 2018-03-27 2019-03-27 A novel promoter and a method for producing l-amino acid using the same
AU2019243241A AU2019243241B2 (en) 2018-03-27 2019-03-27 A Novel Promoter And A Method For Producing L-Amino Acid Using The Same
BR112020003867-9A BR112020003867B1 (pt) 2018-03-27 2019-03-27 Polinucleotídeo que tem atividade de promotor, vetor, micro-organismo do gênero corynebacterium, métodos de produção de uma substância-alvo e preparação de uma composição fermentada, e, composição fermentada
JP2020512734A JP7089582B2 (ja) 2018-03-27 2019-03-27 新規なプロモーター及びこれを用いたｌ－アミノ酸の生産方法
CN201980004245.2A CN111655860B (zh) 2018-03-27 2019-03-27 新型启动子及利用其生产l-氨基酸的方法
US16/639,364 US10961554B2 (en) 2018-03-27 2019-03-27 Promoter and a method for producing L-amino acid using the same
EP19776661.1A EP3778901A4 (en) 2018-03-27 2019-03-27 NEW PROMOTER AND PROCESS FOR THE PRODUCTION OF L-AMINO ACID USING THE PROMOTER
CA3073177A CA3073177C (en) 2018-03-27 2019-03-27 A novel promoter and a method for producing l-amino acid using the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20180035156 2018-03-27
KR10-2018-0035156 2018-03-27

Publications (1)

Publication Number Publication Date
WO2019190192A1 true WO2019190192A1 (ko) 2019-10-03

Family

ID=68060246

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/KR2019/003565 WO2019190192A1 (ko) 2018-03-27 2019-03-27 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
PCT/KR2019/003568 WO2019190193A1 (ko) 2018-03-27 2019-03-27 글라이신 생산능이 증가된 미생물 및 이를 이용한 발효 조성물 생산 방법

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/003568 WO2019190193A1 (ko) 2018-03-27 2019-03-27 글라이신 생산능이 증가된 미생물 및 이를 이용한 발효 조성물 생산 방법

Country Status (13)

Country Link
US (2) US11661616B2 (ko)
EP (3) EP3778900A4 (ko)
JP (3) JP7125477B2 (ko)
KR (3) KR102137806B1 (ko)
CN (2) CN111655860B (ko)
AR (2) AR115302A1 (ko)
AU (2) AU2019243241B2 (ko)
BR (2) BR112020003467B8 (ko)
CA (2) CA3073180C (ko)
MY (1) MY202021A (ko)
SG (2) SG11202001753TA (ko)
TW (3) TWI746953B (ko)
WO (2) WO2019190192A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4056695A4 (en) * 2021-01-26 2023-01-11 CJ CheilJedang Corporation NEW PHOSPHORIBOSYLTRANSFERASE ATP VARIANT, AND METHOD FOR PRODUCING L-VALINE USING THE SAME

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102137806B1 (ko) * 2018-03-27 2020-07-27 씨제이제일제당 주식회사 글라이신 생산능이 증가된 미생물 및 이를 이용한 발효 조성물 생산 방법
KR20220094257A (ko) * 2020-12-28 2022-07-06 대상 주식회사 히스티딘에 의한 피드백 억제가 감소된 atp-prt 변이체 및 이를 발현하는 히스티딘 생산 균주
KR102433200B1 (ko) * 2020-12-28 2022-08-19 대상 주식회사 히스티딘에 의한 피드백 억제가 감소된 atp-prt 변이체 및 이를 발현하는 히스티딘 생산 균주
CN113994003B (zh) * 2021-05-07 2022-10-14 Cj第一制糖株式会社 新型启动子及其用途
KR102377745B1 (ko) * 2021-05-12 2022-03-23 씨제이제일제당 주식회사 신규 프로모터 및 이의 용도
WO2023013655A1 (ja) * 2021-08-02 2023-02-09 味の素株式会社 食品の風味を改善する方法
CN116254242B (zh) * 2022-12-21 2024-01-30 江南大学 一种atp磷酸核苷转移酶突变体及产l-组氨酸的谷氨酸棒杆菌

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3220929A (en) 1964-02-10 1965-11-30 Kyowa Hakko Kogyo Kk Microbiological production of amino acid by reductive amination
US6682912B2 (en) 1998-03-18 2004-01-27 Ajinomoto Co., Inc. L-glutamic acid-producing bacterium and method for producing L-glutamic acid
WO2008033001A1 (en) 2006-09-15 2008-03-20 Cj Cheiljedang Corporation A corynebacteria having enhanced l-lysine productivity and a method of producing l-lysine using the same
KR101208480B1 (ko) 2003-07-29 2012-12-05 아지노모토 가부시키가이샤 말산 효소 활성이 감쇠된 에스케리키아 세균을 사용하는ｌ-라이신 또는 ｌ-트레오닌의 생산방법
KR20130130377A (ko) * 2012-05-22 2013-12-02 백광산업 주식회사 코리네형 세균 유래 ｓｏｄ 유전자의 프로모터 변이체 및 상기 프로모터 변이체를 이용한 Ｌ-라이신의 생산 방법
KR20150143699A (ko) * 2014-02-14 2015-12-23 인스티튜트 오브 마이크로바이올로지, 차이니즈 아카데미 오브 사이언스즈 L-아미노산을 생산하는 재조합균, 이의 구성 방법 및 l-아미노산 생산 방법
KR20160072278A (ko) * 2014-12-12 2016-06-23 한국외국어대학교 연구산학협력단 합성 글루탐산 탈수소효소 프로모터를 이용한 목적단백질의 생산 방법

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100292299B1 (ko) 1999-03-22 2001-06-01 손경식 글루탐산 생산 미생물 및 이를 이용한 글루탐산 생산방법
US6984512B1 (en) * 1999-08-02 2006-01-10 Archer-Daniels-Midland Company Bacterial strains, methods of preparing the same and use thereof in fermentation processes for L-lysine production
DE60042552D1 (de) * 1999-08-02 2009-08-27 Archer Daniels Midland Co Metabolische manipulation der produktion von aminosäuren
DE10044831A1 (de) * 2000-03-01 2002-04-04 Forschungszentrum Juelich Gmbh Verbessertes Verfahren zur mikrobiellen Herstellung von L-Serin sowie ein dazu geeigneter genetisch veränderter Mikroorganismus
JP2009165355A (ja) * 2006-04-28 2009-07-30 Ajinomoto Co Inc Ｌ−アミノ酸を生産する微生物及びｌ−アミノ酸の製造法
DE102012016716A1 (de) * 2012-08-22 2014-02-27 Forschungszentrum Jülich GmbH Verfahren zur Herstellung von Vektoren enthaltend ein für in seiner feedback-Inhibierung gemindertes oder ausgeschaltetes Enzym kodierendes Gen und deren Verwendung für die Herstellung von Aminosäuren und Nukleotiden
WO2015060391A1 (ja) * 2013-10-23 2015-04-30 味の素株式会社 目的物質の製造法
KR101904666B1 (ko) * 2017-08-02 2018-11-29 씨제이제일제당 (주) Atp 포스포리보실기 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
KR102137806B1 (ko) * 2018-03-27 2020-07-27 씨제이제일제당 주식회사 글라이신 생산능이 증가된 미생물 및 이를 이용한 발효 조성물 생산 방법

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3220929A (en) 1964-02-10 1965-11-30 Kyowa Hakko Kogyo Kk Microbiological production of amino acid by reductive amination
US6682912B2 (en) 1998-03-18 2004-01-27 Ajinomoto Co., Inc. L-glutamic acid-producing bacterium and method for producing L-glutamic acid
KR101208480B1 (ko) 2003-07-29 2012-12-05 아지노모토 가부시키가이샤 말산 효소 활성이 감쇠된 에스케리키아 세균을 사용하는ｌ-라이신 또는 ｌ-트레오닌의 생산방법
WO2008033001A1 (en) 2006-09-15 2008-03-20 Cj Cheiljedang Corporation A corynebacteria having enhanced l-lysine productivity and a method of producing l-lysine using the same
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
KR20130130377A (ko) * 2012-05-22 2013-12-02 백광산업 주식회사 코리네형 세균 유래 ｓｏｄ 유전자의 프로모터 변이체 및 상기 프로모터 변이체를 이용한 Ｌ-라이신의 생산 방법
KR20150143699A (ko) * 2014-02-14 2015-12-23 인스티튜트 오브 마이크로바이올로지, 차이니즈 아카데미 오브 사이언스즈 L-아미노산을 생산하는 재조합균, 이의 구성 방법 및 l-아미노산 생산 방법
KR20160072278A (ko) * 2014-12-12 2016-06-23 한국외국어대학교 연구산학협력단 합성 글루탐산 탈수소효소 프로모터를 이용한 목적단백질의 생산 방법

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
"Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
APPL. MICROBIOL. BIOTECHNOL., vol. 52, 1999, pages 541 - 545
DATABASE NUCLEOTIDE 27 December 2017 (2017-12-27), ANONYMOUS: "Corynebacteriurn glutamicum strain HA chromosome, complete genome", XP055639596, retrieved from NCBI Database accession no. CP025534 *
KARLINALTSCHUL, PRO. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873
KULIS-HORN, R. K. ET AL.: "Histidine biosynthesis, its regulation and biotechnological application in Corynebacterium glutamicum", MICROB. BIOTECHNOL., vol. 7, no. 1, 2014, pages 5 - 25, XP055367989, doi:10.1111/1751-7915.12055 *
NAT. PROTOC., vol. 9, no. 10, October 2014 (2014-10-01), pages 2301 - 16
PEARSON, METHODS ENZYMOL., vol. 183, 1990, pages 63

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4056695A4 (en) * 2021-01-26 2023-01-11 CJ CheilJedang Corporation NEW PHOSPHORIBOSYLTRANSFERASE ATP VARIANT, AND METHOD FOR PRODUCING L-VALINE USING THE SAME

Also Published As

Publication number Publication date
JP2022105171A (ja) 2022-07-12
CA3073180A1 (en) 2019-10-03
AR115301A1 (es) 2020-12-23
KR102137806B1 (ko) 2020-07-27
US10961554B2 (en) 2021-03-30
CA3073177A1 (en) 2019-10-03
AU2019243242A1 (en) 2020-03-12
TW201942360A (zh) 2019-11-01
TWI716841B (zh) 2021-01-21
CA3073177C (en) 2022-12-13
AU2019243241B2 (en) 2022-12-01
JP7089582B2 (ja) 2022-06-22
KR102028554B1 (ko) 2019-10-04
CN111433366B (zh) 2024-01-09
BR112020003467B8 (pt) 2024-01-16
KR20190113649A (ko) 2019-10-08
CN111433366A (zh) 2020-07-17
US20210002655A1 (en) 2021-01-07
TW201945535A (zh) 2019-12-01
CN111655860A (zh) 2020-09-11
EP3778900A1 (en) 2021-02-17
BR112020003867B1 (pt) 2022-04-12
JP2021517802A (ja) 2021-07-29
WO2019190193A1 (ko) 2019-10-03
AU2019243242B2 (en) 2023-04-13
US11661616B2 (en) 2023-05-30
KR102150041B1 (ko) 2020-08-31
JP7125477B2 (ja) 2022-08-24
SG11202001753TA (en) 2020-03-30
TW202117002A (zh) 2021-05-01
AR115302A1 (es) 2020-12-23
EP3778900A4 (en) 2021-12-22
SG11202001730TA (en) 2020-03-30
CA3073180C (en) 2024-03-12
EP3778901A1 (en) 2021-02-17
BR112020003867A2 (pt) 2020-10-27
AU2019243241A1 (en) 2020-03-12
TWI746953B (zh) 2021-11-21
BR112020003467A2 (pt) 2020-08-25
BR112020003467B1 (pt) 2023-08-15
CN111655860B (zh) 2023-10-03
JP2021515537A (ja) 2021-06-24
US20200248217A1 (en) 2020-08-06
EP3778901A4 (en) 2021-12-22
MY202021A (en) 2024-03-29
EP4130281A1 (en) 2023-02-08
KR20200090693A (ko) 2020-07-29

Similar Documents

Publication Publication Date Title
WO2019190192A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2020027362A1 (ko) 신규 아데닐로석시네이트 신세타아제 및 이를 이용한 퓨린 뉴클레오티드 생산방법
WO2019160301A1 (ko) 시트레이트 신타아제의 활성이 약화된 변이형 폴리펩타이드 및 이를 이용한 l-아미노산 생산방법
WO2019117673A2 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
WO2019147078A1 (ko) 퓨린 뉴클레오티드를 생산하는 코리네박테리움 속 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2019231159A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2014148743A1 (ko) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법
WO2019172702A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2015199396A1 (ko) O-아세틸 호모세린을 생산하는 미생물 및 상기 미생물을 이용하여 o-아세틸 호모세린을 생산하는 방법
WO2020130236A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2016208854A1 (ko) 퓨트레신 또는 오르니틴 생산 미생물 및 이를 이용한 퓨트레신 또는 오르니틴 생산방법
WO2016148490A1 (ko) 피루브산 디하이드로게나아제 변이체, 이를 포함하는 미생물 및 이를 이용한 l-아미노산 생산 방법
WO2019147059A1 (ko) L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2019135639A1 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
WO2019164346A1 (ko) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
WO2020196993A1 (ko) 변이형 포스포리보실피로포스페이트 아미도트랜스퍼라아제 및 이를 이용한 퓨린 뉴클레오티드 제조방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2019013532A2 (ko) 아세토하이드록시산 신타아제 변이체, 이를 포함하는 미생물 또는 이를 이용하는 l-분지쇄 아미노산 생산 방법
WO2015156583A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2021177731A1 (ko) 글루타민 신테타아제 변이형 폴리펩티드 및 이를 이용한 l-글루타민 생산 방법
WO2018230977A1 (ko) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
WO2021060696A1 (ko) 디하이드로디피콜린산 리덕타제 변이형 폴리펩티드 및 이를 이용한 l-쓰레오닌 생산방법
WO2022239953A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2021045472A1 (ko) 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19776661

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3073177

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020512734

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020003867

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2019243241

Country of ref document: AU

Date of ref document: 20190327

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 112020003867

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200227

ENP Entry into the national phase

Ref document number: 2019776661

Country of ref document: EP

Effective date: 20201027