Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
  • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P11/00—Drugs for disorders of the respiratory system

Definitions

• This invention relates to generally to pulmonary disorders, and specifically to the use of oligonucleotides having at least one unmethylated CpG dinucleotide (CpG ODN) in the treatment of such disorders.
• CpG ODN unmethylated CpG dinucleotide
• Endotoxin is one of the primary mediators of inflammation released by Gram negative organisms and is an important cause of environmentally induced airway disease, such as ARDS. Inhaled endotoxin can cause airflow obstruction in previously unexposed subjects. Inhaled endotoxin is strongly associated with the development of acute decrements in airflow among cotton workers, wine confinement workers, and poultry workers. The concentration of endotoxin in the bioaerosol appears to be the most important occupational exposure associated with the development and progression of airway disease in agricultural workers (Schwartz, D.A., et al., Am. J. Respir. Crit. Care Med. 152:603-8, 1995).
• LPS lipopolysaccharide
• ARDS The acute respiratory distress syndrome
• ARDS represents a spectrum of responses to acute lung injury (ALl); these response occur as complications of a more widespread systemic response to acute inflammation or injury.
• ALl develops rapidly after a predisposing condition triggers a systemic inflammatory response and is most strongly associated with conditions that produced direct alveolar injury or direct injury via the pulmonary capillary bed, such as aspiration, diffuse infection, toxic inhalation, direct injury to the alveolar epithelium, or sepsis syndrome.
• ALl is the consequence of unregulated over-expression of usual systemic inflammatory responses to infection and/or injury.
• Injury involves the alveolar epithelium and the pulmonary capillary endothelium, and results in a complex cascade of events.
• Injury is produced by cellular events associated with neutrophils, macrophages, monocytes, and lymphocytes producing various cytokines, in turn producing cellular activation, chemotaxis, and adhesion.
• Gram-negative infections are a major cause of morbidity and mortality, especially in hospitalized and immunocompromised patients.
• Endotoxin is a heat stable bacterial toxin composed of lipopolysaccharides (LPS) released from the outer membrane of Gram-negative bacteria upon lysis (Shenep et al. , J. Infect. Dis., 150(3 ⁇ :380-388, 1984), and is a potent stimulator of the inflammatory response.
• LPS lipopolysaccharides
• oligonucleotides The uptake of oligonucleotides by B lymphocytes has been shown to be regulated by LPS-induced cell activation (Krieg, A.M., et al, Antisense Res. Devel. 1:161, 1991).
• Monocytes and neutrophils which ingest and kill microorganisms, play a key role in this process. Monocytes and neutrophils respond to endotoxin in vivo by releasing soluble proteins with microbicidal, proteolytic, opsonic, pyrogenic, complement-activating and tissue-damaging effects. These factors mediate many of the pathophysiological effects of endotoxin. For example, tumor necrosis factor
• TNF a cytokine released by endotoxin-stimulated monocytes, causes fever, shock, and alterations in glucose metabolism and is a potent stimulator of neutrophils.
• Other cytokines such as IL-1 , IL-6, and IL-8 also mediate many of the pathophysiologic effects of LPS, as well as other pathways involving endothelial cell activation by tissue factor, kininogen, nitric oxide and complement.
• Endotoxin-associated disorders result from extra-gastrointestinal exposure to LPS, e.g., administration of LPS-contaminated fluids, inhalation of LPS, or Gram-negative infections. Endotoxin-associated disorders can also result when the natural cellular barrier is injured and the normal Gram-negative flora breach this barrier. For example, endotoxin-associated disorders can occur (a) when there is ischemia of the gastrointestinal tract (e.g., following hemorrhagic shock or during certain surgical procedures), or (b) when systemic or local inflammation causes increased permeability of the gut or lung to endotoxin or Gram-negative organisms.
• endotoxin and the resulting inflammatory response may result, for example, in adult respiratory distress syndrome (ARDS), dust-induced airway disease, and exacerbation of asthma, in addition to endotoxemia, systemic inflammatory response syndrome (SIRS), sepsis syndrome, septic shock, disseminated intravascular coagulation (DIC), cardiac dysfunction, organ failure, liver failure (hepatobiliary dysfunction), brain failure (CNS dysfunction), renal failure, multi-organ failure and shock.
• ARDS adult respiratory distress syndrome
• SIRS systemic inflammatory response syndrome
• DIC disseminated intravascular coagulation
• cardiac dysfunction organ failure
• liver failure hepatobiliary dysfunction
• CNS dysfunction brain failure
• renal failure multi-organ failure and shock.
• PMB Polymyxin B
• Lipid A the most toxic and biologically active component of endotoxin.
• PMB inhibits endotoxin-mediated activation of neutrophil granule release in vitro and is a potential therapeutic agent for Gram-negative infections.
• this antibiotic has limited therapeutic use, and is generally used topically.
• MPSS methylprednisolone sodium succinate
• the present invention is based on the finding that nucleic acids containing at least one unmethylated cytosine-guanine (CpG) dinucleotide affect the immune response in a subject by activating natural killer cells (NK) or redirecting a subject's immune response from a Th2 to a Thl response by inducing monocytic and other cells to produce Thl cytokines.
• CpG cytosine-guanine
• NK natural killer cells
• These nucleic acids containing at least one unmethylated CpG can be used to treat pulmonary disorders having an immunologic component, such as asthma or environmentally induced airway disease.
• a method of treating a subject having or at risk of having an acute decrement in air flow by administering a therapeutically effective amount of nucleic acids containing at least one unmethylated CpG is provided.
• a method of treating a subject having or at risk of having an inflammatory response to lipopolysaccharide by administering a therapeutically effective amount of nucleic acids containing at least one unmethylated CpG is also provided.
• the invention also provides a method of modifying the level of a cytokine in a subject having or at risk of having inhaled lipopolysaccharide by administering a therapeutically effective nucleic acid containing at least one unmethylated CpG.
• the invention provides a pharmaceutical composition for treating a subject having or at risk of having an inflammatory response to inhaled lipopolysaccharide including a nucleic acid sequence containing at least one unmethylated CpG in a pharmacologically acceptable carrier.
• isolated nucleic acid sequences as set forth in SEQ ID NOS:2, 17, 18, 59-65 are provided.
• FIG. 1 is a flow chart showing the pathways to sepsis and acute lung injury.
• FIG. 2 is a graph plotting the concentration of cytokines (TNF- ⁇ , MIP-2, IL-10, IL-12, and IFN- ⁇ ) in the serum four hours after intravenous treatment with either an oligonucleotide containing embedded CpG motifs or an oligonucleotide without CpG motifs.
• Serum samples were obtained immediately following an inhalation challenge with E. coli LPS. Error bars show Standard Error (SE).
• FIG. 3 is a graph plotting the concentration of total cells and PMNs in the whole lung lavage fluid following inhalation challenge with Escherichia coli LPS. Thirty minutes, four hours and 12 hours prior to the inhalation challenge, mice were either treated with an oligonucleotide containing embedded CpG motifs or were treated with an oligonucleotide without CpG motifs. Error bars show SE.
• FIG. 4 is a graph showing the concentration of cytokines (TNF- ⁇ , MIP-2, and IL-12) in the whole lung lavage fluid following inhalation of E. coli LPS. Mice were pretreated with an oligonucleotide containing embedded CpG motifs or were pretreated with an oligonucleotide without CpG motifs four hours prior to inhalation challenge with LPS. Error bars show SE.
• FIG. 5 is an autoradiograph showing an RNase protection assay of the total mRNA isolated from lungs of mice exposed to E. coli LPS by inhalation. Mice were pretreated with an oligonucleotide containing embedded CpG motifs or were pretreated with an oligonucleotide without CpG motifs four hours prior to inhalation challenge with LPS. L32 encodes a ribosomal protein and was used to assess the concentration of RNA loaded onto the gel.
• FIG. 6 is a graph plotting the concentration of total cells and PMNs in the whole lung lavage fluid following inhalation of E. coli LPS. Mice were pretreated with an oligonucleotide containing embedded CpG motifs or were pretreated with an oligonucleotide without CpG motifs four hours prior to inhalation challenge with LPS. Error bars show SE.
• FIG. 7 is a graph showing the concentration of total cells and PMNs in the whole lung lavage fluid following inhalation of E. coli LPS.
• C57BL/6 mice and IL-10 knockout mice (C57BL/6-IL10 tmlC n ) were pretreated with either an oligonucleotide containing embedded CpG motifs or with intravenous saline four hours prior to inhalation challenge with LPS. Error bars show SE.
• FIG. 8 is a graph plotting lung lavage cell count over time.
• the graph shows that when the mice are initially injected intraperitoneally (i.p.) with Schistosoma mansoni eggs “egg,” which induces a Th2 immune response, and subsequently inhale Schistosoma mansoni egg antigen "SEA" (open circle), many inflammatory cells are present in the lungs. However, when the mice are initially given CpG ODN along with egg, the inflammatory cells in the lung are not as increased by subsequent inhalation of SEA (open triangles).
• FIG. 9 is a graph plotting lung lavage eosinophil count over time. Again, the graph shows that when the mice are initially injected with egg and subsequently inhale SEA (open circle), many eosinophils are present in the lungs. However, when the mice are initially given CpG ODN along with egg, the inflammatory cells in the lung are not as increased by subsequent inhalation of the SEA (open triangles).
• FIG. 10 is a bar graph plotting the effect on the percentage of macfophage, lymphocyte, neutrophil and eosinophil cells induced by exposure to saline alone; egg, then SEA; egg and CpG ODN, then SEA; and egg and control oligo, then SEA.
• mice are treated with the control oligo at the time of the initial exposure to the egg, there is little effect on the subsequent influx of eosinophils into the lungs after inhalation of SEA.
• mice inhale the eggs on days 14 or 21 they develop an acute inflammatory response in the lungs.
• giving a CpG oligo along with the eggs at the time of initial antigen exposure on days 0 and 7 almost completely abolishes the increase in eosinophils when the mice inhale the egg antigen on day 14.
• FIG. 11 is a bar graph plotting eosinophil count in response to injection of various amounts of the protective oligo SEQ ID NO: 10.
• FIG. 12 is a graph plotting interleukin 4 (IL-4) production (pg/ml) in mice over time in response to injection of egg, then SEA (open diamond); egg and CpG ODN, then SEA (open circle); or saline, then saline (open square).
• the graph shows that the resultant inflammatory response correlates with the levels of the Th2 cytokine IL-4 in the lung.
• FIG. 13 is a bar graph plotting interleukin 12 (IL-12) production (pg/ml) in mice over time in response to injection of saline; egg, then SEA; or CpG ODN and egg, then SEA.
• the graph shows that administration of an oligonucleotide containing an unmethylated CpG motif can actually redirect the cytokine response of the lung to production of IL-12, indicating a Thl type of immune response.
• IL-12 interleukin 12
• FIG. 14 is a bar graph plotting interferon gamma (IFN- ⁇ production (pg/ml) in mice over time in response to injection of saline; egg, then saline; or CpG ODN and egg, then SEA.
• the graph shows that administration of an oligonucleotide containing an unmethylated CpG motif can also redirect the cytokine response of the lung to production of IFN- ⁇ , indicating a Thl type of immune response.
• oligodeoxyribonucleotides are able to enter cells in a process which is sequence, temperature, and energy independent (Jaroszewski and Cohen, Ad. Drug Del. Rev. 6:235, 1991).
• An "oligodeoxyribonycleotide" as used herein is a deoxyribonucleic acid sequence from about 3-50 bases in length.
• Lymphocyte oligodeoxyribonucleotide uptake has been shown to be regulated by cell activation (Krieg, A.M., et al., Antisense Research and Development ⁇ j.161 , 1991).
• the present invention is based on the finding that certain ohgonucleotides (ODN) containing at least one unmethylated cytosine- guanine (CpG) dinucleotide activate the immune response.
• ODN ohgonucleotides
• CpG unmethylated cytosine- guanine
• the invention provides a method for treating a subject having or at risk of having an acute decrement in air flow by administering a therapeutically effective amount of a nucleic acid sequence containing at least one unmethylated CpG.
• nucleic acid or "oligonucleotide” refers to a polymeric form of nucleotides at least five bases in length.
• the nucleotides of the invention can be deoxyribonucleotides, ribonucleotides, or modified forms of either nucleotide. Generally, double-stranded molecules are more stable in vivo, while single-stranded molecules have increased activity.
• the nucleic acid molecule can include the use of phosphorothioate or phosphorodithioate rather than phosphodiesterase linkages within the backbone of the molecule, or methylphosphorothioate terminal linkages (Krieg, A.M., et al. , Antisense and Nucl Acid Drug Dev 6:133-9, 1996; Boggs, R.T., et al, Antisense and Nucl Acid Drug Dev, 7:461- 71, 1997).
• the phosphate backbone modification can occur at the 5' end of the nucleic acid, for example at the first two nucleotides of the 5' end of the nucleic acid.
• the phosphate backbone modification may occur at the 3' end of the nucleic acid, for example at the last five nucleotides of the 3' end of the nucleic acid.
• International Patent Application WO 95/26204 entitled “Immune stimulation by phosphorothioate oligonucleotide analogs” reports the nonsequence-specific immunostimulatory effect of phosphorothioate modified ohgonucleotides.
• Nontraditional bases such as inosine and queosine, as well as acetyl-, thio- and similarly modified forms of adenine, cytidine, guanine, thymine, and uridine can also be included, which are not as easily recognized by endogenous endonucleases.
• Other stabilized nucleic acid molecules include: nonionic DNA analogs, such as alkyl- and aryl-phosphonates (in which the charged oxygen moiety is alkylated).
• Nucleic acid molecules which contain a diol, such as tetrahyleneglycol or hexaethyleneglycol, at either or both termini are also included.
• the term "oligonucleotide” includes both single and double-stranded forms of DNA.
• CpG or "CpG motif refers to a nucleic acid having a cytosine followed by a guanine linked by a phosphate bond.
• methylated CpG refers to the methylation of the cytosine on the pyrimidine ring, usually occurring the 5-position of the pyrimidine ring.
• unmethylated CpG refers to the absence of methylation of the cytosine on the pyrimidine ring. Methylation, partial removal, or removal of an unmethylated CpG motif in an oligonucleotide of the invention is believed to reduce its effect.
• Methylation or removal of all unmethylated CpG motifs in an oligonucleotide substantially reduces its effect.
• the effect of methylation or removal of a CpG motif is "substantial" if the effect is similar to that of an oligonucleotide that does not contain a CpG motif.
• the CpG oligonucleotide is in the range of about 8 to 30 bases in size.
• the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage, S.L., and Caruthers, M.H., 7et. Let. 22:1859, 1981); nucleoside H-phosphonate method (Garegg et ⁇ /., Tet. Let. 27:4051-4054, 1986; Froehler et al, Nucl Acid. Res. 14:5399-5407, 1986, ; Garegg et al, Tet.
• Ohgonucleotides can be prepared from existing nucleic acid sequences (e.g., genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
• nucleic acids are preferably relatively resistant to degradation- (e.g., via endo-and exo-nucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation.
• nucleic acid stabilization can be accomplished via phosphate backbone modifications.
• a preferred stabilized nucleic acid has at least a partial phosphorothioate modified backbone.
• Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries.
• Aryl-and alkyl-phosphonates can be made, e.g., as described in U.S. Patent No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Patent No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (Uhlmann, E. and Peyman, A., Chem. Rev. 90:544, 1990; Goodchild, J., Bioconjugate Chem. 1:165, 1990).
• nucleic acids may be associated with a molecule that results in higher affinity binding to target cell (e.g., B-cell, monocytic cell and natural killer (NK) cell) surfaces and/or increased cellular uptake by target cells to form a "nucleic acid delivery complex.”
• target cell e.g., B-cell, monocytic cell and natural killer (NK) cell
• Nucleic acids can be ionically or covalently associated with appropriate molecules using techniques which are well known in the art. A variety of coupling or cross-linking agents can be used, e.g., protein A, carbodiimide, and N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP).
• SPDP N-succinimidyl-3-(2-pyridyldithio) propionate
• Nucleic acids can alternatively be encapsulated in liposomes or virosomes using well-known techniques.
• nucleic acid sequences useful in the methods of the invention are represented by the formula:
• N,X,CGX 2 N 2 3' (SEQ ID NO:l) wherein at least one nucleotide separates consecutive CpGs;
• X is adenine, guanine, or thymidine;
• X 2 is cytosine or thymine,
• N is any nucleotide and
• + N is from about 0-
• N, and Nj do not contain a CCGG quadmer or more than one CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.
• nucleic acids of any size can be used in the invention if CpGs are present, as larger nucleic acids are degraded into ohgonucleotides inside cells.
• Preferred synthetic ohgonucleotides do not include a CCGG quadmer or more than one CCG or CGG trimer at or near the 5 ' or 3' terminals and/or the consensus mitogenic CpG motif is not a palindrome.
• a "palindromic sequence” or “palindrome” means an inverted repeat (i.e., a sequence such as ABCDEE'D'C'B'A', in which A and A' are bases capable of forming the usual Watson-Crick base pairs.
• An exemplary nucleic acid sequence of the invention is:
• the method of the invention includes the use of an oligonucleotide which contains a CpG motif represented by the formula:
• N 5' N 1 X,X 2 CGX 3 X 4 N 2 3* (SEQ ID NO:3) wherein at least one nucleotide separates consecutive CpGs;
• XjX 2 is selected from the group consisting of GpT, GpG, GpA, ApT and ApA;
• X 3 X 4 is selected from the group consisting of TpT or CpT;
• N is any nucleotide and N, + N 2 is from about 0-26 bases.
• N, and N 2 do not contain a CCGG quadmer or more than one CCG or CGG trimer.
• CpG ODN are also preferably in the range of 8 to 30 bases in length, but may be of any size (even many kb long) if sufficient motifs are present, since such larger nucleic acids are degraded into ohgonucleotides inside of cells.
• Preferred synthetic ohgonucleotides of this formula do not include a CCGG quadmer or more than one CCG or CGG trimer at or near the 5' and/or 3' terminals and/or the consensus mitogenic CpG motif is not a palindrome.
• Other CpG ohgonucleotides can be assayed for efficacy using methods described herein.
• a prolonged effect can be obtained using stabilized ohgonucleotides, where the oligonucleotide incorporates a phosphate backbone modification (e.g., a phosphorothioate or phosphorodithioate modification). More particularly, the phosphate backbone modification occurs at the 5' end of the nucleic acid for example, at the first two nucleotides of the 5' end of the nucleic acid. Further, the phosphate backbone modification may occur at the 3' end of the nucleic acid for example, at the last five nucleotides of the 3' end of the nucleic acid.
• a phosphate backbone modification e.g., a phosphorothioate or phosphorodithioate modification.
• the phosphate backbone modification occurs at the 5' end of the nucleic acid for example, at the first two nucleotides of the 5' end of the nucleic acid.
• the phosphate backbone modification may occur at the 3' end of the
• Preferred nucleic acids containing an unmethylated CpG ' have a relatively high stimulation with regard to B cell, monocyte, and/or natural killer cell responses (e.g., induction of cytokines, proliferative responses, lytic responses, among others).
• the "stimulation index" is a measure of a CpG ODN to effect an immune response which can be tested in various immune cell assays.
• the stimulation of the immune response can be assayed by measuring various immune parameters, e.g., measuring the antibody- forming capacity, number of lymphocyte subpopulations, mixed leukocyte response assay, lymphocyte proliferation assay.
• the stimulation of the immune response can also be measured in an assay to determine resistance to infection or tumor growth. Methods for measuring a stimulation index are well known to one of skill in the art.
• one assay is the incorporation of 3 H uridine in a murine B cell culture, which has been contacted with a 20 ⁇ M of oligonucleotide for 20h at 37°C and has been pulsed with 1 ⁇ Ci of 3 H uridine; and harvested and counted 4h later.
• the induction of secretion of a particular cytokine can also be used to assess the stimulation index.
• the CpG ODN for use in vivo, for example to treat a subject having or at risk of having an acute decrement in air flow in response to endotoxin, it is important that the CpG ODN be capable of effectively inducing cytokine secretion by monocytic cells and/or Natural Killer (NK) cell lytic activity.
• the stimulation index of the CpG ODN with regard to B-cell proliferation is at least about 5, preferably at least about 10, more preferably at least about 15 and most preferably at least about 20, while recognizing that there are differences in the stimulation index among individuals.
• the CpG ODN of the invention stimulate cytokine production (e.g., IL-6, IL-12, IFN- ⁇ , TNF- ⁇ and GM-CSF).
• cytokine production e.g., IL-6, IL-12, IFN- ⁇ , TNF- ⁇ and GM-CSF.
• Exemplary sequences include:
• the CpG ODN of the invention are also useful for stimulating natural killer cell (NK) lytic activity in a subject such as a human.
• NK natural killer cell
• Specific, but nonlimiting examples of such sequences include: "
• TCGTCGTTGTCGTTGTCGTTGTCGTT (SEQ ID NO:7), TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:6),
• TGTCGTTGTCGTTGTCGTT (SEQ ID NO:l 1)
• TCGTCGTCGTCGTT (SEQ ID NO: 12).
• nucleic acid sequences of the invention are also useful for stimulating B cell proliferation. Specific, but nonlimiting examples of such sequences include:
• TCCTGTCGTTTTTTGTCGTT (SEQ IDNO:14), TCGTCGCTGTCTGCCCTTCTT (SEQ IDNO:15),
• Preferred CpG ODN can effect at least about ' 500 pg/ml of TNF- ⁇ , 15 pg/ml IFN- ⁇ , 70 pg/ml of GM-CSF 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on the therapeutic indication.
• These cytokines can be measured by assays well known in the art.
• the ODNs listed above or other preferred CpG ODN can effect at least about 10%, more preferably at least about 15% and most preferably at least about 20% YAC-1 cell specific lysis or at least about 30%, more preferably at least about 35%, and most preferably at least about 40% 2C11 cell specific lysis, in assays well known in the art (see Example 4).
• lung function and pulmonary function are used interchangeably and shall be interpreted to mean physically measurable operations of a lung including but not limited to inspiratory flow rate, expiratory flow rate, and lung volume. Methods of quantitatively determining pulmonary function are used to measure lung function. Methods of measuring pulmonary function most commonly employed in clinical practice involve timed measurement of inspiratory and expiratory maneuvers to measure specific parameters. For example, forced vital capacity (FVC) measures the total volume in liters exhaled by a patient forcefully from a deep initial inspiration.
• FVC forced vital capacity
• This parameter when evaluated in conjunction with the forced expired volume in one second (FEV,), allows bronchoconstriction to be quantitatively evaluated.
• a problem with forced vital capacity determination is that the forced vital capacity maneuver (i.e., forced exhalation from maximum inspiration to maximum expiration) is largely technique dependent. In other words, a given patient may produce different FVC values during a sequence of consecutive FVC maneuvers. The FEF 25-75 or forced expiratory flow determined over the midportion of a forced exhalation maneuver tends to be less technique dependent than the FVC. Similarly, the FEV, tends to be less technique dependent than FVC.
• the flow in liters per minute measured over differing portions of the expiratory cycle can be useful in determining the status of a patient's pulmonary function.
• the peak expiratory flow taken as the highest air flow rate in liters per minute during a forced maximal exhalation, is well correlated with overall pulmonary function in a patient with asthma and other respiratory diseases.
• asthma refers to a disorder of the respiratory system characterized by inflammation, narrowing of the airways and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively associated with atopic or allergic symptoms.
• terapéuticaally effective amount is meant the quantity of a compound according to the invention necessary to prevent, to cure or at least partially arrest symptoms in a subject.
• a subject is any mammal, preferably a human. Amounts effective for therapeutic use will, of course, depend on the severity of the disease and the weight and general state of the subject. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of particular disorders. Various considerations are described, e.g., in Gilman et al, eds., Goodman And Gilman's: The Pharmacological Bases of Therapeutics. 8th ed., Pergamon Press, 1990; and Remington's Pharmaceutical Sciences. 17th ed., Mack Publishing Co., Easton, Pa., 1990, each of which is herein incorporated by reference.
• An oligonucleotide containing at least one unmethylated CpG can be used alone to activate the immune response or can be administered in combination with another therapeutic modality, either a drug or a surgical procedure.
• another therapeutic modality either a drug or a surgical procedure.
• the oligonucleotide containing at least one unmethylated CpG can be administered before, after, and/or simultaneously with the other therapeutic modality.
• the oligonucleotide containing at least one unmethylated CpG can have an additional efficacy (e.g. , through antisense or other means) in addition to its ability to activate the immune response.
• the invention further provides a method of treating a subject having or at risk of having an inflammatory response to LPS by administering to the subject a therapeutically effective amount of a nucleic acid sequence containing at least one unmethylated CpG.
• diseases which can be associated with Gram-negative bacterial infections or endotoxemia include bacterial meningitis, neonatal sepsis, cystic fibrosis, inflammatory bowel disease and liver cirrhosis, Gram-negative pneumonia, Gram-negative abdominal abscess, hemorrhagic shock and disseminated intravascular coagulation.
• Subjects who are leukopenic or neutropenic, including subjects treated with chemotherapy or immunocompromised subjects (for example with AIDS), are particularly susceptible to bacterial infection and the subsequent effects of endotoxin.
• lipopolysaccharide or "LPS” is meant a compound composed of a heteropolysaccharide (which contains somatic O antigen) covalently bound to a phospholipid moiety (lipid a).
• LPS is a major component of the cell wall of Gram-negative bacteria.
• endotoxin is meant a heat-stable toxin associated with the outer membranes of certain Gram-negative bacteria, including the enterobacteria, brucellae, neisseriae, and vibrios. Endotoxin, normally released upon disruption of the bacterial cells, is composed of lipopolysaccharide molecules (LPS) and any associated proteins.
• endotoxin When injected in large quantities endotoxin produces hemorrhagic shock and severe diarrhea; smaller amounts cause fever, altered resistance to bacterial infection, leukopenia followed by leukocytosis, and numerous other biologic effects. Endotoxin is a type of "bacterial pyrogen,” which is any fever-raising bacterial product.
• endotoxin "LPS,” and “lipopolysaccharide” as used herein are essentially synonymous.
• the invention further provides a method of treating a subject having or at risk of having an inflammatory response to LPS.
• LPS produces an inflammatory response in normal and asthmatic patients.
• inflammatory response is meant an accumulation of white blood cells, either systemically or locally at the site of inflammation.
• the inflammatory response may be measured by many methods well known in the art, such as the number of white blood cells (WBC), the number of polymorphonuclear neutophils (PMN), a measure of the degree of PMN activation, such as luminal enhanced-chemiluminescence, or a measure of the amount of cytokines present.
• WBC white blood cells
• PMN polymorphonuclear neutophils
• a measure of the degree of PMN activation such as luminal enhanced-chemiluminescence
• cytokines a measure of the amount of cytokines present.
• cytokine is used as a generic name for a diverse group of soluble proteins and peptides which act as humoral regulators at nano- to picomolar concentrations and which, either under normal or pathological conditions, modulate the functional activities of individual cells and tissues. These proteins also mediate interactions between cells directly and regulate processes taking place in the extracellular environment. Examples of cytokines include, but are not limited to, TNF- ⁇ , IL-10, IL-12, interferon- ⁇ . Importantly, interferon- ⁇ is a key cytokine mediating LPS-induced inflammation (e.g., Ozmen, L., et al, J. Exp. Med. 180:907-915, 1994).
• interferon- ⁇ is induced by IL-12 derived from macrophage/monocyte/dendritic cells, (e.g., Balanchard, D.K., et al, J. Immunol 136:963-970, 1986), and IL-10 inhibits interferon- ⁇ via a macrophage-dependent step in which IL-12 production is inhibited (D'Andrea, a., et al, J. Exp. Med. 178:1041-1048, 1993).
• IL-12 derived from macrophage/monocyte/dendritic cells
• nucleic acids containing unmethylated CpG could reduce the inflammatory response to LPS by increasing the production and response of IL-10, or by modulating the response of a factor which in turn increase the production and response ofIL-10 or IL-6.
• the invention further provides a method of modulating the level of a cytokine altered in response to inhaled LPS.
• modulate envisions the suppression of expression of a particular cytokine when it is overexpressed, or augmentation of the expression of a particular cytokine when it is underexpressed. Modulation of a particular cytokine can occur locally or systemically. It is believed that the CpG ohgonucleotides do not directly activate purified NK cells, but rather render them competent to respond to IL-12 with a marked increase in their IFN- ⁇ production. By inducing IL-12 production and the subsequent increased IFN- ⁇ secretion by NK cells, the immunostimulatory nucleic acids also promote a Thl type immune response. No direct activation of proliferation or cytokine secretion by highly purified T cells has been found. Cytokine profiles determine T cell regulatory and effector functions in immune responses.
• Cytokines also play a role in directing the T cell response.
• Helper (CD4 + ) T cells orchestrate the immune response of mammals through production of soluble factors that act on other immune system cells, including other T cells.
• Most mature CD4 + T helper cells express one of two cytokine profiles: Thl or Th2.
• Thl cells secrete IL-2, IL-3, IFN- ⁇ , TNF- ⁇ , GM-CSF and high levels of TNF- ⁇ .
• Th2 cells express IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-13, GM-CSF and low levels of TNF- ⁇ .
• the Thl subset promotes delayed-type hypersensitivity, cell-mediated immunity, and immunoglobulin class switching to IgG 2a .
• the Th2 subset induces humoral immunity by activating B cells, promoting antibody production, and inducing class switching to IgG, and IgE.
• IL-12 and IFN- ⁇ are positive Thl and negative Th2 regulators.
• IL-12 promotes IFN- ⁇ production, and IFN- ⁇ provides positive feedback for IL-12.
• IL-4 and IL-10 appear to be required for the establishment of the Th2 cytokine profile and to down-regulate Thl cytokine production; the effects of IL-4 are in some cases dominant over those of IL-12.
• IL-13 was shown to inhibit expression of inflammatory cytokines, including IL-12 and TNF- ⁇ by LPS-induced monocytes, in a way similar to IL-4.
• the IL-12 p40 homodimer binds to the IL-12 receptor and antagonizes IL-12 biological activity; thus it blocks the pro-Thl effects of IL-12.
• the invention may be used to treat individuals who are "at risk” of developing a acute decrement in airflow or who are at risk of LPS exposure. These individuals may be identified by any diagnostic means, or by epidemiological evidence such as exposure data. These individuals may be treated by a method of the invention prior to, at the time of, or after the actual onset of the clinical appearance.
• the "clinical appearance" can be any sign or symptom of the disorder.
• This invention further provides administering to a subject having or at risk of having an inflammatory response to inhaled LPS, a therapeutically effective dose of a pharmaceutical composition containing the compounds of the present invention and a pharmaceutically acceptable carrier.
• administering the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan.
• compositions according to the invention are in general administered topically, intravenously, orally, parenterally or as implants, and even rectal use is possible in principle.
• suitable solid or liquid pharmaceutical preparation forms are, for example, granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, aerosols, drops or injectable solution in ampule form and also preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above.
• the pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of present methods for drug delivery, see Langer, Science 249:1527-1533, 1990, which is incorporated herein by reference.
• the pharmaceutical compositions are preferably prepared and administered in dose units.
• Solid dose units are tablets, capsules and suppositories.
• different daily doses are necessary. Under certain circumstances, however, higher or lower daily doses may be appropriate.
• the administration of the daily dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administration of subdivided doses at specific intervals.
• compositions according to the invention may be administered locally or systemically.
• therapeutically effective dose is meant the quantity of a compound according to the invention necessary to prevent, to cure or at least partially arrest the symptoms of the disorder and its complications. Amounts effective for this use will, of course, depend on the severity of the disease and the weight and general state of the patient. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of particular disorders.
• mice were intravenously treated with 20 base pair (bp) ohgonucleotides containing CpG motifs (CpG oligo) or 20 bp ohgonucleotides without embedded CpG motifs (non CpG oligo) 30 min, 4 hours, or 12 hours prior to a 4 hour inhalation challenge with E. coli LPS (1.5 ⁇ g/m 3 ).
• bp base pair
• ohgonucleotides containing CpG motifs CpG oligo
• 20 bp ohgonucleotides without embedded CpG motifs non CpG oligo
• IL-10 knockout mice with CpG oligos and then performed a similar inhalation challenge with E. coli LPS. Immediately post inhalation challenge, all mice were sacrificed, blood samples were obtained, whole lung lavage was performed, and lungs were harvested for mRNA analysis.
• mice C3H/HeBFEJ, C57BL/6, and C57BL/6-I110 ,mlCgn male mice (Jackson Laboratories, Bar Harbor, ME) were obtained at 6 weeks of age and used within 2 weeks. All animal care and housing requirements set forth by the National Institutes of Health Committee on Care and Use of Laboratory Animals of the Institute of Laboratory Animal Resources were followed, and animal protocols were reviewed and approved by the Institutional Ani lal Care and Use Committee. Mice were maintained in wood-chip bedding (Northeastern Product, Warrensberg, NY), with food (Formulab Chow 5008, PMI, Richmond, IN) and water supplied ad libitum.
• Oligonucleotides Twenty base pair ohgonucleotides were synthesized with and without the embedded CpG motifs (Oligos etc., Wilsonville, OR). These oligonucleotides contained a nuclease-resistant phosphorothioate-modified backbone, and were purified by two rounds of ethanol precipitation prior to use. The CpG dinucleotide was flanked by two 5' purines and two 3' pyrimidines to enhance the stimulatory effect of the oligonucleotide.
• the "nonstimulatory" oligonucleotide was identical to the stimulatory oligonucleotide except that the two embedded CpG motifs were modified, one appearing as an ApG motif and the other appearing as a GpC motif.
• the two synthesized oligonucleotides had the following sequences: CpG Oligonucleotide: ATAATCGACGTTCAAGCAAG (SEQ ID NO:
• Non-CpG oligonucleotide ATAATAGAGCTTCAAGCAAG
• Endotoxin was purchased as lyopholized purified E. coli 0111 :B4 lipopolysaccharide (LPS) (Sigma Chemical Co., St. Louis, MO, PN# L2630) and had a specified activity of 1.3 x 10 6 ng/mg and protein content less than 3%. Endotoxin Assay.
• LPS solution LPS aerosol
• oligonucleotides were assayed using the chromogenic Limulus amebocyte lysate (LAL) assay (QCL-1000, Whittaker Bioproducts, Inc., Walkersville, MD) with sterile, pyrogen- free labware and a temperature controlled microplate block and microplate reader (405 nm).
• LAL chromogenic Limulus amebocyte lysate
• the LPS solution was serially diluted in pyrogen-free water and assayed.
• the airborne concentration of LPS was assessed by sampling 0.30 m 3 of air drawn from the exposure chamber through 47 mm binder-free glass microfiber filters (EPM-2000, Whatman Intl.
• LPS aerosols were generated into a glass 20 L exposure chamber using a PITT#1 nebulizer supplied with extract by a syringe pump. Liquid feed rates ranged from 0.0027 to 0.21 ml/min. HEPA-filtered air was supplied to the nebulizer at flow rates ranging from 10 to 17 L/min. Mixing within the chamber was aided by a magnetically coupled rotor. The chamber atmosphere was exchanged at 1 change/min. LPS concentrations were determined by sampling the total chamber outflow. Particle size distributions were determined with an Aerodynamic Particle Sizer (TSI, Inc., St. Paul, MN) and gravimetrically with a Marble personal cascade impactor and Mylar media (Thorne, P.S., Am. J. Ind. Med. 25:109-112, 1997) by sampling within the exposure chamber.
• mice were euthanized, the chest was opened, and lungs were lavaged in situ via PE-90 tubing inserted into the exposed trachea. A pressure of 25 cm H 2 O was used to wash the lungs with 6.0 ml of sterile pyrogen free saline. Following whole lung lavage, the lungs were isolated and frozen in liquid nitrogen and stored at -70°C.
• the cells were then washed once more and resuspended in RP medium so that the final concentration gave a cell count of 1 x 10 6 cells/ml.
• the cells which were present in 10-12 ⁇ l of the 1 x 10 6 ml cell suspension were spun for 5 minutes onto a glass slide using a special filter card using a cytocentrifuge (Cytospin-2; Shanden Southern, Sewickley, PA). Staining was carried out using a Diff Quick Stain Set (Harleco, Gibbstown, NY). The slide was then dried, one drop of optically clear immersion oil was put on the slide over the cells and a coverslip was placed on top.
• TNF- ⁇ The limit for detection for TNF- ⁇ is 5.1 pg/ml, MIP-2 is 1.5 pg/ml, IL-6 is 10 pg/ml, IL-10 is 10 pg/ml, IL-12 is 5 pg/ml, and IFN- ⁇ is 10 pg/ml.
• RNA STAT-60 Tri-Test B; Friendswood, TX.
• the composition of RNA STAT-60 includes phenol and guanidinium thiocyanate in a monophase solution.
• the lung parenchyma was homogenized in the RNA STAT-60 using a polytron homogenizer.
• RNA Equivalent amounts of RNA were examined, as judged by the amount of L32, which encodes an ubiquitously expressed ribosome subunit protein (Rajchel, A., et al, Nucl. Acid. Res. 16:2347, 1987) in each sample.
• L32 which encodes an ubiquitously expressed ribosome subunit protein (Rajchel, A., et al, Nucl. Acid. Res. 16:2347, 1987) in each sample.
• Commercially available probes were used to detect TNF- ⁇ , MIP-2, IL-6, IL-10, IL-12, and IFN- ⁇ .
• CpG oligonucleotides resulted in a systemic inflammatory response.
• ODN CpG oligonucleotides
• intravenous treatment with CpG ODN did not affect the concentration of peripheral white blood cells; compared to non-CpG ODN, treatment with CpG ODN prior to LPS inhalation resulted in a higher concentration of PMNs 30 min, 4 hours, and 12 hours after injection.
• intravenous treatment with CpG oligonucleotides also affected the concentration of cytokines in the serum.
• CpG ODN Compared to non-CpG ODN, CpG ODN resulted in an increase in the concentration of MIP-2, IL-10, and IL-12 in the serum of mice following LPS inhalation (FIG. 1). These differences were most pronounced 30 min and 4 hours after intravenous administration but were still present 12 hours after exposure to CpG containing oligonucleotides. No differences were observed for the serum concentration of TNF- ⁇ , IL-6, and IFN- ⁇ at any of the time points in mice pre-treated with either oligonucleotide and then exposed to LPS (data not shown for IL-6).
• Pretreatment with CpG containing oligonucleotides reduced the pulmonary response to inhaled LPS.
• Animals pretreated with CpG oligonucleotides at 0.5, 4, and 12 hours had a reduced concentration of cells in the lavage fluid following inhalation challenge with LPS (FIG. 2).
• this effect appeared to be time dependent since pretreatment with oligonucleotide at 0.5 and 4 hours resulted in a reduced percentage of lavage PMNs while pretreatment with the oligonucleotide 12 hours prior to the inhalation challenge did not affect the percentage of lavage PMNs (FIG. 2).
• results from the RNase protection assay indicate that total lung mRNA concentrations for TNF- ⁇ , MIP-2, IL-6, IL-10, and IFN- ⁇ are similar in mice pretreated with the CpG and non-CpG containing oligonucleotide (FIG. 4). These results also demonstrate that mRNA IL-12 appears to be upregulated in the lung only from mice pretreated with CpG containing oligonucleotides.
• the CpG motifs were methylated.
• mice were pretreated with the indicated oligonucleotide and then challenged through the airways with LPS as described above. A saline challenge was used as a control. The lungs of the mice were lavaged, and the number of cell per ml, number of polymorphonuclear cells (PMN) per ml, and the percentage of polymo ⁇ honuclear cells in the airways was determined (see Table 1).
• IL-10 Since endogenous and exogenous IL-10 are known to suppress the inflammatory response to LPS (Cassatella, M.A., et al, J. Exp. Med. 178:2207, 1993; Berg, D.J., et al, J. Clin. Invest. 96:2339-2347, 1995), IL-10 might play a critical role in mediating the immunosuppressive effects of CpG oligonucleotides. To pursue this hypothesis, IL-10 knockout (C57BL/6-I110 tmlCgn ) mice and C57BL/6 control mice were pretreated with CpG containing oligonucleotides and then an inhalation challenge with E.
• CpG containing oligonucleotides significantly reduced the total cellularity and the concentration of PMNs in the lavage fluid in both C57BL/6 and mice with a disrupted IL-10 gene (C57BL/6- Importantly, the immunosuppressive effects of CpG ohgonucleotides were equally effective in mice with a disrupted IL-10 gene compared to wild type mice.
• Phosphodiester ODN were purchased from Operon Technologies (Alameda, CA). Phosphorothioate ODN were purchased from the DNA core facility, University of Iowa, or from The Midland Certified Reagent Company (Midland TX). E. coli (strain B) DNA and calf thymus DNA were purchased from Sigma (St. Louis, MO). All DNA and ODN were purified by extraction with phenol:chloroform:isoamyl alcohol (25:24:1) and/or ethanol precipitation. The LPS level in ODN was less than 12.5 ng/mg and E. coli and calf thymus DNA contained less than 2.5 ng of LPS/mg of DNA by Limulus assay.
• Virus-free, 4-6 week old, DBA/2, C57BL/6 (B6) and congenitally athymic B ALB/C mice were obtained on contract through the Veterans Affairs from the National Cancer Institute (Bethesda, MD). C57BL/6 SCID mice were bred in the SPF barrier facility at the University of Iowa Animal Care Unit.
• PBMC peripheral blood mononuclear leukocytes
• Human or murine cells were cultured at 5 x 10 6 /well, at 37 ° C in a 5% CO 2 humidified atmosphere in 24-well plates with medium alone or with CpG or non-CpG ODN at the indicated concentrations, or with E. coli or calf thymus (50 ⁇ g/ml) at 37 ° C for 24 hr. All cultures were harvested at 18 hr. and the cells were used as effectors in a standard 4 hr. 51 Cr-release assay against K562 (human) or YAC-1 (mouse) target cells as previously described. For calculation of lytic units (LU), 1 LU was defined as the number of cells needed to effect 30% specific lysis. Where indicated, neutralizing antibodies against
• IFN- ⁇ Lee Biomolecular, San Diego, CA
• IL-12 Pharmingen
• isotype controls were added at the initiation of cultures to a concentration of 10 ⁇ g/ml.
• 10 ⁇ g of each of the 4 MAB (or isotype controls) were added simultaneously.
• Recombinant human IL-2 was used at a concentration of 100 U/ml.
• NK activity peaked around 18 hrs. after addition of the ODN.
• the data indicates that the murine NK response is dependent on the prior activation of monocytes by CpG DNA, leading to the production of IL-12, TNF- ⁇ , and IFN.
• Immune activation by CpG motifs may depend on bases flanking the CpG, and the number and spacing of the CpGs present within an ODN. Although a single CpG in an ideal base context can be a very strong and useful immune activator, superior effects can be seen with ODN containing several CpGs with the appropriate spacing and flanking bases.
• the optimal CpG motif is TGACGTT.
• ODN must be administered to a subject in a form that protects them against nuclease degradation.
• Methods to accomplish this with phosphodiester ODN are well known in the art and include encapsulation in lipids or delivery systems such as nanoparticles. This protection can also be achieved using chemical substitutions to the DNA such as modified DNA backbones including those in which the internucleotide linkages are nuclease resistant. Some modifications may confer additional desirable properties such as increasing cellular uptake.
• the phosphodiester linkage can be modified via replacement of one of the nonbridging oxygen atoms with a sulfur, which constitutes phosphorothioate DNA.
• Phosphorothioate ODN have enhanced cellular uptake (Krieg et al.
• NK activation correlates strongly with in vivo adjuvant effects, the identification of phosphorothioate ODN that will activate human NK cells is very important.
• ODN 1840 which contained 2 copies of the TGTCGTT motif, had significant NK lytic activity (Table 4).
• ODN 1982 serving as a control. Sample results are shown in Table 5.
• ODNs with internal CpG motifs are generally less potent stimulators than those in which a GTCGCT motif immediately follows the 5' TC (e.g., ODN 1967 and 1968).
• ODN 1968 which has a second GTCGTT motif in its 3' half, was consistently more stimulatory than ODN 1967, which lacks this second motif.
• ODN 1967 was slightly more potent than ODN 1968 in experiments 1 and 3, but not in experiment 2.
• ODN 2005 which has a third GTCGTT motif, induced slightly higher NK activity on average than 1968.
• ODN 2006 in which the spacing between the GTCGTT motifs was increased by the addition of two Ts between each motif, was slightly superior to ODN 2005 and to ODN 2007, in which only one of the motifs had the addition of the spacing two Ts.
• the minimal acceptable spacing between CpG motifs is one nucleotide as long as the ODN has two pyrimidines (preferably T) at the 3' end (e.g., ODN 2015).
• T pyrimidines
• PBMC peripheral blood mononuclear cells
• Results are representative of 6 separate experiments; each experiment represents a different donor.
• CpG DNA can directly activate highly purified B cells and monocytic cells. There are many similarities in the mechanism through which CpG DNA activates these cell types. For example, both require NFkB activation as explained further below.
• oligo 1668 with the best mouse B cell motif, is a strong inducer of both B cell and natural killer (NK) cell activation, while oligo 1758 is a weak B cell activator, but still induces excellent NK responses (Table 8).
• CpG dinucleotides are underlined; oligonucleotides were synthesized with phosphorothioate modified backbones to improve their nuclease resistance.
• Schistosoma mansoni eggs contain an antigen (Schistosoma mansoni egg antigen (SEA)) that induces a Th2 immune response (e.g., production of IgE antibody).
• SEA Schostosoma mansoni egg antigen
• mice were then treated with oligonucleotides (30 ⁇ g in 200 ⁇ l saline by i.p. injection), which either contained an unmethylated CpG motif, i.e.,
• Soluble SEA (lO ⁇ g in25 ⁇ l of saline) was administered by intranasal instillation on days 14 and 21. Saline was used as a control.
• mice were sacrificed at various times after airway challenge.
• Whole lung lavage was performed to harvest airway and alveolar inflammatory cells.
• Cytokine levels were measured from lavage fluid by ELISA.
• RNA was isolated from whole lung for Northern analysis and RT-PCR studies using CsCl gradients. Lungs were inflated and perfused with 4% paraformaldehyde for histologic examination.
• FIG. 7 shows that when the mice are initially injected with the eggs i.p., and then inhale the egg antigen (open circle), many inflammatory cells are present in the lungs. However, when the mice are initially given a nucleic acid containing an unmethylated CpG motif along with the eggs, the inflammatory cells in the lung are not increased by subsequent inhalation of the egg antigen (open triangles).
• FIG. 8 shows that the same results are obtained when only eosinophils present in the lung lavage are measured.
• Eosinophils are the type of inflammatory cell most closely associated with asthma.
• FIG. 9 shows that when the mice are treated with a control oligo at the time of the initial exposure to the egg, there is little effect on the subsequent influx of eosinophils into the lungs after inhalation of SEA.
• mice inhale the eggs on days 14 or 21 they develop an acute inflammatory response in the lungs.
• giving a CpG oligo along with the eggs at the time of initial antigen exposure on days 0 and 7 almost completely abolishes the increase in eosinophils when the mice inhale the egg antigen on day 14.
• FIG. 10 shows that very low doses of oligonucleotide ( ⁇ lO ⁇ g) can give this protection.
• FIG. 11 shows that the resultant inflammatory response correlates with the levels of the Th2 cytokine IL-4 in the lung.
• FIG. 12 shows that administration of an oligonucleotide containing an unmethylated CpG motif can actually redirect the cytokine response of the lung to production of 11-12, indicating a Thl type of immune response.
• FIG. 13 shows that administration of an oligonucleotide containing an unmethylated CpG motif can also redirect the cytokine response of the lung to production of IFN- ⁇ , indicating a Thl type of immune response.

Landscapes

• Chemical & Material Sciences (AREA)
• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Biotechnology (AREA)
• Pharmacology & Pharmacy (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Animal Behavior & Ethology (AREA)
• Medicinal Chemistry (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Pulmonology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Priority Applications (4)

Applications Claiming Priority (2)

Publications (1)

Family

ID=21905269

Family Applications (1)

Country Status (6)

Cited By (125)

Families Citing this family (246)

Family Cites Families (30)

• 1998
  • 1998-02-25 WO PCT/US1998/003678 patent/WO1998037919A1/en not_active Ceased
  • 1998-02-25 CA CA002281838A patent/CA2281838A1/en not_active Abandoned
  • 1998-02-25 AU AU66674/98A patent/AU738513B2/en not_active Ceased
  • 1998-02-25 US US09/030,701 patent/US6214806B1/en not_active Expired - Fee Related
  • 1998-02-25 JP JP53781098A patent/JP2001513776A/ja not_active Ceased
  • 1998-02-25 EP EP98908714A patent/EP1039935A4/en not_active Withdrawn

Non-Patent Citations (5)