WO1997010365A1 - Expression monitoring by hybridization to high density oligonucleotide arrays - Google Patents

Expression monitoring by hybridization to high density oligonucleotide arrays Download PDF

Info

Publication number
WO1997010365A1
WO1997010365A1 PCT/US1996/014839 US9614839W WO9710365A1 WO 1997010365 A1 WO1997010365 A1 WO 1997010365A1 US 9614839 W US9614839 W US 9614839W WO 9710365 A1 WO9710365 A1 WO 9710365A1
Authority
WO
WIPO (PCT)
Prior art keywords
probes
hybridization
array
probe
nucleic acids
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1996/014839
Other languages
English (en)
French (fr)
Inventor
David J. Lockhart
Eugene L. Brown
Gordon Wong
Mark Chee
Thomas R. Gingeras
Michael P. Mittmann
Robert J. Lipshutz
Stephen P. A. Fodor
Chunwei Wang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Affymax Technologies NV
Original Assignee
Affymax Technologies NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=24108589&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1997010365(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to AU70734/96A priority Critical patent/AU7073496A/en
Priority to JP9512174A priority patent/JPH11512293A/ja
Priority to EP96931598A priority patent/EP0853679B1/en
Priority to AT96931598T priority patent/ATE231559T1/de
Priority to DE69625920T priority patent/DE69625920T2/de
Application filed by Affymax Technologies NV filed Critical Affymax Technologies NV
Priority to HK98115957.2A priority patent/HK1015416B/en
Priority to US08/772,376 priority patent/US6309822B1/en
Publication of WO1997010365A1 publication Critical patent/WO1997010365A1/en
Anticipated expiration legal-status Critical
Priority to US10/367,708 priority patent/US20030186296A1/en
Priority to US10/438,534 priority patent/US20030220748A1/en
Priority to US11/406,531 priority patent/US20080227653A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809Methods for determination or identification of nucleic acids involving differential detection
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N15/00Investigating characteristics of particles; Investigating permeability, pore-volume or surface-area of porous materials
    • G01N15/10Investigating individual particles
    • G01N15/14Optical investigation techniques, e.g. flow cytometry
    • G01N15/1429Signal processing
    • G01N15/1433Signal processing using image recognition

Definitions

  • one mechanism of activating unregulated growth is to increase the number of genes coding for oncogene proteins or to increase the level of expression of these oncogenes (e.g. in response to cellular or environmental changes), and another is to lose genetic material or to decrease the level of expression of genes that code for tumor suppressors.
  • This model is supported by the losses and gains of genetic material associated with glioma progression (Mikkelson et al. J. Cellular Biochm. 46: 3-8 (1991)).
  • changes in the expression (transcription) levels of particular genes e.g. oncogenes or tumor suppressors
  • a viral infection is often characterized by the elevated expression of genes of the particular virus.
  • outbreaks of Herpes simplex, Epstein-Barr virus infections (e.g. infectious mononucleosis), cytomegalovirus, Varicella-zoster virus infections, parvovirus infections, human papillomavirus infections, etc. are all characterized by elevated expression of various genes present in the respective virus. Detection of elevated expression levels of characteristic viral genes provides an effective diagnostic of the disease state. In particular, viruses such as herpes simplex, enter quiescent states for periods of time only to erupt in brief periods of rapid replication.
  • Oligonucleotide probes have long been used to detect complementary nucleic acid sequences in a nucleic acid of interest (the "target" nucleic acid) and have been used to detect expression of particular genes (e.g. , a Northern Blot).
  • the oligonucleotide probe is tethered, i.e. , by covalent attachment, to a solid support, and arrays of oligonucleotide probes immobilized on solid supports have been used to detect specific nucleic acid sequences in a target nucleic acid. See, e.g. , PCT patent publication Nos.
  • oligonucleotide arrays could be used to reliably monitor message levels of a multiplicity of preselected genes in the presence of a large abundance of other (non-target) nucleic acids (e.g. , in a cDNA library, DNA reverse transcribed from an mRNA, mRNA used directly or amplified, or polymerized from a DNA template).
  • non-target nucleic acids e.g. , in a cDNA library, DNA reverse transcribed from an mRNA, mRNA used directly or amplified, or polymerized from a DNA template.
  • the prior art provided no rapid and effective method for identifying a set of oligonucleotide probes that maximize specific hybridization efficacy while minimizing cross-reactivity nor of using hybridization patterns (in particular hybridization patterns of a multiplicity of oligonucleotide probes in which multiple oligonucleotide probes are directed to each target nucleic acid) for quantification of target nucleic acid concentrations.
  • the present invention is premised, in part, on the discovery that microfabricated arrays of large numbers of different oligonucleotide probes (DNA chips) may effectively be used to not only detect the presence or absence of target nucleic acid sequences, but to quantify the relative abundance of the target sequences in a complex nucleic acid pool.
  • DNA chips DNA chips
  • relatively short oligonucleotide probes e.g. , 20 mer
  • this invention provides for a method of simultaneously monitoring the expression (e.g. detecting and or quantifying the expression) of a multiplicity of genes.
  • the levels of transcription for virtually any number of genes may be determined simultaneously.
  • at least about 10 genes, preferably at least about 100, more preferably at least about 1000 and most preferably at least about 10,000 different genes are assayed at one time.
  • the method involves providing a pool of target nucleic acids comprising mRNA transcripts of one or more of said genes, or nucleic acids derived from the mRNA transcripts; hybridizing the pool of nucleic acids to an array of oligonucleotide probes immobilized on a surface, where the array comprises more than 100 different oligonucleotides, each different oligonucleotide is localized in a predetermined region of said surface, each different oligonucleotide is attached to the surface through a single covalent bond, the density of the different oligonucleotides is greater than about 60 different oligonucleotides (where different oligonucleotides refers to oligonucleotides having different sequences) per 1 cm 2 , and the oligonucleotide probes are complementary to the mRNA transcripts or nucleic acids derived from the mRNA transcripts; and quantifying the hybridized nucleic acids in the array.
  • the method can additionally include a step of quantifying the hybridization of the target nucleic acids to the array.
  • the quantification preferably provides a measure of the levels of transcription of the genes.
  • the pool of target nucleic acids is one in which the concentration of the target nucleic acids (mRNA transcripts or nucleic acids derived from the mRNA transcripts) is proportional to the expression levels of genes encoding those target nucleic acids.
  • the array of oligonucleotide probes is a high density array comprising greater than about 100, preferably greater than about 1 ,000 more preferably greater than about 16,000 and most preferably greater than about 65,000 or 250,000 or even 1 ,000,000 different oligonucleotide probes.
  • Such high density arrays comprise a probe density of generally greater than about 60, more generally greater than about 100, most generally greater than about 600, often greater than about 1000, more often greater than about 5,000, most often greater than about 10,000, preferably greater than about 40,000 more preferably greater than about 100,000, and most preferably greater than about 400,000 different oligonucleotide probes per cm 2 (where different oligonucleotides refers to oligonucleotides having different sequences).
  • the oligonucleotide probes range from about 5 to about 50 nucleotides, preferably from about 5 to about 45 nucleotides, still more preferably from about 10 to about 40 nucleotides and most preferably from about 15 to about 40 nucleotides in length.
  • Particularly preferred arrays contain probes ranging from about 20 to about 25 oligonucleotides in length.
  • the array may comprise more than 10, preferably more than 50, more preferably more than 100, and most preferably more than 1000 oligonucleotide probes specific for each target gene.
  • the array comprises at least 10 different oligonucleotide probes for each gene.
  • the array may be fabricated on a surface of virtually any shape or even a multiplicity of surfaces.
  • the array may further comprise mismatch control probes. Where such mismatch controls are present, the quantifying step may comprise calculating the difference in hybridization signal intensity between each of the oligonucleotide probes and its corresponding mismatch control probe. The quantifying may further comprise calculating the average difference in hybridization signal intensity between each of the oligonucleotide probes and its corresponding mismatch control probe for each gene.
  • the probes present in the high density array can be oligonucleotide probes selected according to selection and optimization methods described below.
  • non-optimal probes may be included in the array, but the probes used for quantification (analysis) can be selected according to the optimization methods described below.
  • Oligonucleotide arrays for the practice of this invention are preferably chemically synthesized by parallel immobilized polymer synthesis methods, more preferably by light directed polymer synthesis methods. Chemically synthesized arrays are advantageous in that probe preparation does not require cloning, a nucleic acid amplification step, or enzymatic synthesis. Indeed, the preparation of the probes does not require handling of any biological materials.
  • the array includes test probes which are oligonucleotide probes each of which has a sequence that is complementary to a subsequence of one of the genes (or the mRNA or the corresponding antisense cRNA) whose expression is to be detected.
  • the array can contain normalization controls, mismatch controls and expression level controls as described herein.
  • the variation between different copies (within and/or between batches) of each array is less than 20% , more preferably less than about 10%, and most preferably less than about 5% where the variation is measured as the coefficient of variation in hybridization intensity averaged over at least 5 oligonucleotide probes for each gene whose expression the array is to detect.
  • the pool of nucleic acids may be labeled before, during, or after hybridization, although in a preferred embodiment, the nucleic acids are labeled before hybridization.
  • Fluorescence labels are particularly preferred, more preferably labeling with a single fluorophore, and, where fluorescence labeling is used, quantification of the hybridized nucleic acids is by quantification of fluorescence from the hybridized fluorescently labeled nucleic acid. Such quantification is facilitated by the use of a fluorescence microscope which can be equipped with an automated stage to permit automatic scanning of the array, and which can be equipped with a data acquisition system for the automated measurement recording and subsequent processing of the fluorescence intensity information.
  • hybridization is at low stringency (e.g. about 20 °C to about 50 °C, more preferably about 30 °C to about 40°C, and most preferably about 37°C and 6X SSPE-T or lower) with at least one wash at higher stringency.
  • Hybridization may include subsequent washes at progressively increasing stringency until a desired level of hybridization specificity is reached.
  • Quantification of the hybridization signal can be by any means known to one of skill in the art. However, in a particularly preferred embodiment, quantification is achieved by use of a confocal fluorescence microscope. Data is preferably evaluated by calculating the difference in hybridization signal intensity between each oligonucleotide probe and its corresponding mismatch control probe. It is particularly preferred that this difference be calculated and evaluated for each gene. Particularly preferred analytical methods are provided herein.
  • the pool of target nucleic acids can be the total poly A + mRNA isolated from a biological sample, or cDNA made by reverse transcription of the RNA or second strand cDNA or RNA transcribed from the double stranded cDNA intermediate.
  • the pool of target nucleic acids can be treated to reduce the complexity of the sample and thereby reduce the background signal obtained in hybridization.
  • a pool of mRNAs derived from a biological sample, is hybridized with a pool of oligonucleotides comprising the oligonucleotide probes present in the high density array.
  • the pool of hybridized nucleic acids is then treated with RNase A which digests the single stranded regions.
  • the remaining double stranded hybridization complexes are then denatured and the oligonucleotide probes are removed, leaving a pool of mRNAs enhanced for those mRNAs complementary to the oligonucleotide probes in the high density array.
  • a pool of mRNAs derived from a biological sample is hybridized with paired target specific oligonucleotides where the paired target specific oligonucleotides are complementary to regions flanking subsequences of the mRNAs complementary to the oligonucleotide probes in the high density array.
  • the pool of hybridized nucleic acids is treated with RNase H which digests the hybridized (double stranded) nucleic acid sequences.
  • the remaining single stranded nucleic acid sequences which have a length about equivalent to the region flanked by the paired target specific oligonucleotides are then isolated (e.g.
  • a third approach to background reduction involves eliminating or reducing the representation in the pool of particular preselected target mRNA messages (e.g., messages that are characteristically overexpressed in the sample). This method involves hybridizing an oligonucleotide probe that is complementary to the preselected target mRNA message to the pool of polyA + mRNAs denved from a biological sample. The oligonucleotide probe hybridizes with the particular preselected polyA + mRNA (message) to which it is complementary.
  • the pool of hyb ⁇ dized nucleic acids is treated with RNase H which digests the double stranded (hybridized) region thereby separating the message from its polyA + tail. Isolating or amplifying (e.g. , using an oligo dT column) the polyA + mRNA in the pool then provides a pool having a reduced or no representation of the preselected target mRNA message.
  • the methods of this invention can be used to monitor (detect and/or quantify) the expression of any desired gene of known sequence or subsequence. Moreover, these methods permit monito ⁇ ng expression of a large number of genes simultaneously and effect significant advantages in reduced labor, cost and time.
  • the simultaneous monito ⁇ ng of the expression levels of a multiplicity of genes permits effective comparison of relative expression levels and identification of biological conditions characte ⁇ zed by alterations of relative expression levels of va ⁇ ous genes.
  • Genes of particular interest for expression monitoring include genes involved in the pathways associated with va ⁇ ous pathological conditions (e.g. , cancer) and whose expression is thus indicative of the pathological condition.
  • Such genes include, but are not limited to the HER2 (c-erbB-2/neu) proto-oncogene in the case of breast cancer, receptor tyrosine kinases (RTKs) associated with the etiology of a number of tumors including carcinomas of the breast, liver, bladder, pancreas, as well as glioblastomas, sarcomas and squamous carcinomas, and tumor suppressor genes such as the P53 gene and other "marker" genes such as RAS, MSH2, MLH1 and BRCA1.
  • RTKs receptor tyrosine kinases
  • P53 gene and other "marker" genes such as RAS, MSH2, MLH1 and BRCA1.
  • Other genes of particular interest for expression monitoring are genes involved in the immune response (e.g. , interieukin genes), as well as genes involved in cell adhesion (e.g.
  • this invention provides a method of identifying genes that are effected by one or more drugs, or conversely, screening a number of drugs to identify those that have an effect on particular gene(s). This involves providing a pool of target nucleic acids from one or more cells contacted with the drug or drugs and hybridizing that pool to any of the high density oligonucleotide arrays described herein. The expression levels of the genes targeted by the probes in the array are determined and compared to expression levels of genes from "control" cells not exposed to the drug or drugs. The genes that are overexpressed or underexpressed in response to the drug or drugs are identified or conversely the drug or drugs that alter expression of one or more genes are identified.
  • this invention provide for a composition
  • a composition comprising any of the high density oligonucleotide arrays disclosed herein where the oligonucleotide probes are specifically hybridized to one or more fluorescently labeled nucleic acids (which are the transcription products of genes or derived from those transcription products) thereby forming a fluorescent array in which the fluorescence of the array is indicative of the transcription levels of the multiplicity of genes.
  • fluorescently labeled nucleic acids which are the transcription products of genes or derived from those transcription products
  • a hybridized array may be used as a reference, control, or standard (e.g. , provided in a kit) or may itself be a diagnostic array indicating the expression levels of a multiplicity of genes in a sample.
  • kits for simultaneously monitoring expression levels of a multiplicity of genes include an array of immobilized oligonucleotide probes complementary to subsequences of the multiplicity of target genes, as described herein.
  • the kit may also include instructions describing the use of the array for detection and/or quantification of expression levels of the multiplicity of genes.
  • the kit may additionally include one or more of the following: buffers, hybridization mix, wash and read solutions, labels, labeling reagents (enzymes etc.), "control" nucleic acids, software for probe selection, array reading or data analysis and any of the other materials or reagents described herein for the practice of the claimed methods.
  • this invention provides for a method of selecting a set of oligonucleotide probes, that specifically bind to a target nucleic acid (e.g. , a gene or genes whose expression is to be monitored or nucleic acids derived from the gene or its transcribed mRNA).
  • a target nucleic acid e.g. , a gene or genes whose expression is to be monitored or nucleic acids derived from the gene or its transcribed mRNA.
  • the method involves providing a high density array of oligonucleotide probes where the array comprises a multiplicity of probes wherein each probe is complementary to a subsequence of the target nucleic acid.
  • the target nucleic acid is then hybridized to the array of oligonucleotide probes to identify and select those probes where the difference in hybridization signal intensity between each probe and its mismatch control is detectable (preferably greater than about 10% of the background signal intensity, more preferably greater than about 20% of the background signal intensity and most preferably greater than about 50% of the background signal intensity).
  • the method can further comprise hybridizing the array to a second pool of nucleic acids comprising nucleic acids other than the target nucleic acids; and identifying and selecting probes having the lowest hybridization signal and where both the probe and its mismatch control have a hybridization intensity equal to or less than about 5 times the background signal intensity, preferably equal to or less than about 2 times the background signal intensity, more preferably equal to or less than about 1 times the background signal intensity, and most preferably equal or less than about half the background signal intensity.
  • the multiplicity of probes can include every different probe of length n that is complementary to a subsequence of the target nucleic acid.
  • the probes can range from about 10 to about 50 nucleotides in length.
  • the array is preferably a high density array as described above.
  • the hybridization methods, conditions, times, fluid volumes, detection methods are as herein .
  • the invention provides a computer-implemented method of monitoring expression of genes comprising the steps of: receiving input of hybridization intensities for a plurality of nucleic acid probes including pairs of perfect match probes and mismatch probes, the hybridization intensities indicating hybridization affinity between the plurality of nucleic acid probes and nucleic acids corresponding to a gene, and each pair including a perfect match probe that is perfectly complementary to a portion of the nucleic acids and a mismatch probe that differs from the perfect match probe by at least one nucleotide; comparing the hybridization intensities of the perfect match and mismatch probes of each pair; and indicating expression of the gene according to results of the comparing step.
  • the differences between the hybridization intensities of the perfect match and mismatch probes of each pair are calculated.
  • the invention provides a computer-implemented method for monitoring expression of genes comprising the steps of: receiving input of a nucleic acid sequence constituting a gene; generating a set of probes that are perfectly complementary to the gene; and identifying a subset of probes, including less than all of the probes in the set, for monitoring the expression of the gene.
  • Each probe of the set may be analyzed by criteria that specify characteristics indicative of low hybridization or high cross hybridization. The criteria may include if occurrences of a specific nucleotide in a probe crosses a threshold value, if the number of a specific nucleotide that repeats sequentially in a probe crosses a threshold value, if the length of a palindrome in a probe crosses a threshold value, and the like.
  • massively parallel screening refers to the simultaneous screening of at least about 100, preferably about 1000, more preferably about 10,000 and most preferably about 1 ,000,000 different nucleic acid hybridizations.
  • nucleic acid or “nucleic acid molecule” refer to a deoxyribonucleotide or ribonucleotide polymer in either single-or double-stranded form, and unless otherwise limited, would encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides.
  • an oligonucleotide is a single-stranded nucleic acid ranging in length from 2 to about 500 bases.
  • a "probe” is defined as an oligonucleotide capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation.
  • an oligonucleotide probe may include natural (i.e. A, G, C, or T) or modified bases (7-deazaguanosine, inosine, etc.).
  • the bases in oligonucleotide probe may be joined by a linkage other than a phosphodiester bond, so long as it does not interfere with hybridization.
  • oligonucleotide probes may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages.
  • target nucleic acid refers to a nucleic acid (often derived from a biological sample), to which the oligonucleotide probe is designed to specifically hybridize. It is either the presence or absence of the target nucleic acid that is to be detected, or the amount of the target nucleic acid that is to be quantified.
  • the target nucleic acid has a sequence that is complementary to the nucleic acid sequence of the corresponding probe directed to the target.
  • target nucleic acid may refer to the specific subsequence of a larger nucleic acid to which the probe is directed or to the overall sequence (e.g. , gene or mRNA) whose expression level it is desired to detect. The difference in usage will be apparent from context.
  • Subsequence refers to a sequence of nucleic acids that comprise a part of a longer sequence of nucleic acids.
  • Bind(s) substantially refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target polynucleotide sequence.
  • hybridizing specifically to refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g. , total cellular) DNA or RNA.
  • stringent conditions refers to conditions under which a probe will hybridize to its target subsequence, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
  • the Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. (As the target sequences are generally present in excess, at Tm, 50% of the probes are occupied at equilibrium).
  • stringent conditions will be those in which the salt concentration is at least about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g. , 10 to 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • perfect match probe refers to a probe that has a sequence that is perfectly complementary to a particular target sequence.
  • the test probe is typically perfectly complementary to a portion (subsequence) of the target sequence.
  • the perfect match (PM) probe can be a "test probe”, a "normalization control” probe, an expression level control probe and the like.
  • a perfect match control or perfect match probe is, however, distinguished from a “mismatch control” or “mismatch probe.
  • mismatch control or "mismatch probe” refer to probes whose sequence is deliberately selected not to be perfectly complementary to a particular target sequence. For each mismatch (MM) control in a high-density array there typically exists a corresponding perfect match (PM) probe that is perfectly complementary to the same particular target sequence.
  • the mismatch may comprise one or more bases. While the mismatch(s) may be locates anywhere in the mismatch probe, terminal mismatches are less desirable as a terminal mismatch is less likely to prevent hybridization of the target sequence. In a particularly preferred embodiment, the mismatch is located at or near the center of the probe such that the mismatch is most likely to destabilize the duplex with the target sequence under the test hybridization conditions.
  • background refers to hybridization signals resulting from non-specific binding, or other interactions, between the labeled target nucleic acids and components of the oligonucleotide array (e.g. , the oligonucleotide probes, control probes, the array substrate, etc.). Background signals may also be produced by intrinsic fluorescence of the array components themselves. A single background signal can be calculated for the entire array, or a different background signal may be calculated for each target nucleic acid. In a preferred embodiment, background is calculated as the average hybridization signal intensity for the lowest 5 % to 10% of the probes in the array, or, where a different background signal is calculated for each target gene, for the lowest 5% to 10% of the probes for each gene.
  • background may be calculated as the average hybridization signal intensity produced by hybridization to probes that are not complementary to any sequence found in the sample (e.g. probes directed to nucleic acids of the opposite sense or to genes not found in the sample such as bacterial genes where the sample is mammalian nucleic acids). Background can also be calculated as the average signal intensity produced by regions of the array that lack any probes at all.
  • Quantifying when used in the context of quantifying transcription levels of a gene can refer to absolute or to relative quantification.
  • Absolute quantification may be accomplished by inclusion of known concentration(s) of one or more target nucleic acids (e.g. control nucleic acids such as Bio B or with known amounts the target nucleic acids themselves) and referencing the hybridization intensity of unknowns with the known target nucleic acids (e.g. through generation of a standard curve).
  • target nucleic acids e.g. control nucleic acids such as Bio B or with known amounts the target nucleic acids themselves
  • relative quantification can be accomplished by comparison of hybridization signals between two or more genes, or between two or more treatments to quantify the changes in hybridization intensity and, by implication, transcription level.
  • the "percentage of sequence identity” or “sequence identity” is determined by comparing two optimally aligned sequences or subsequences over a comparison window or span, wherein the portion of the polynucleotide sequence in the comparison window may optionally comprise additions or deletions (i.e. , gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the percentage is calculated by determining the number of positions at which the identical subunit (e.g. nucleic acid base or amino acid residue) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
  • Percentage sequence identity when calculated using the programs GAP or BESTFIT is calculated using default gap weights.
  • Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch J. Mol. Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci.
  • CLUSTAL program are well described by Higgins and Sharp in Gene, 73: 237-244 (1988) and in CABIOS 5: 151-153 (1989)).
  • Fig. 1 shows a schematic of expression monitoring using oligonucleotide arrays.
  • Extracted poly (A) + RNA is converted to cDNA, which is then transcribed in the presence of labeled ribonucleotide triphosphates L is either biotin or a dye such as fluorescein.
  • L is either biotin or a dye such as fluorescein.
  • RNA is fragmented with heat in the presence of magnesium ions
  • Hybridizations are carried out in a flow cell that contains the two-dimensional DNA probe arrays.
  • RNA analysis software converts the scanned array images into text files in which the observed intensities at specific physical locations are associated with particular probe sequences
  • Fig. 2A shows a fluorescent image of a high density array containing over
  • oligonucleotide probes 16,000 different oligonucleotide probes.
  • the image was obtained following hybridization (15 hours at 40 C C) of biotin-labeled randomly fragmented sense RNA transcribed from the murine B cell (T10) cDNA library, and spiked at the level of 1 : 3,000 (50 pM equivalent to about 100 copies per cell) with 13 specific RNA targets.
  • the brightness at any location is indicative ofthe amount of labeled RNA hybridized to the particular oligonucleotide probe
  • Fig 2B shows a small portion ofthe array (the boxed region of Fig. 2 A) containing probes for EL-2 and IL-3 RNAS, For comparison, Fig.
  • 2C shows shown the same region ofthe array following hybridization with an unspiked TIO RNA samples (TIO cells do not express IL-2 and IL-3)
  • the variation in the signal intensity was highly reproducible and reflected the sequence dependence ofthe hybridization efficiencies
  • the central cross and the four comers ofthe array contain a control sequence that is complementary to a biotin-labeled oligonucleotide that was added to the hybridization solution at a constant concentration (50 pM).
  • the sha ⁇ ness ofthe images near the boundaries ofthe features was limited by the resolution ofthe reading device (11.25 ⁇ m) and not by the spatial resolution ofthe array synthesis.
  • the pixels in the border regions of each synthesis feature were systematically ignored in the quantitative analysis ofthe images
  • Fig. 3 provides a log/log plot ofthe hybridization intensity (average ofthe PM-MM intensity differences for each gene) versus concentration for 1 1 different RNA targets.
  • the hybridization signals were quantitatively related to target concentration The experiments were performed as described in the Examples herein and in Fig. 2
  • the ten 10 cytokine RNAs (plus bioB) were spiked into labeled TIO RNA at levels ranging from
  • RNAs from genes expressed in T10 cells were also detected at levels consistent with results obtained by probing cDNA libraries.
  • Fig. 4 shows cytokine mRNA levels in the murine 2D6 T helper cell line at different times following stimulation with PMA and a calcium ionophore Poly (A)" RNA was extracted at 0, 2, 6, and 24 hours following stimulation and converted to double stranded cDNA containing an RNA polymerase promoter
  • the cDNA pool was then transcribed in the presence of biotin labeled ribonucleotide triphosphates, fragmented, and hybridized to the oligonucleotide probe arrays for 2 and 22 hours
  • the fluorescence intensities were converted to RNA frequencies by comparison with the signals obtained for a bacterial RNA (biotin synthetase) spiked into the samples at known amounts prior to hybridization.
  • a signal of 50,000 corresponds to a frequency of approximately 1 : 100,000 to a frequency of 1 :5,000, and a signal of 100 to a frequency of 1 :50,000 RNAs for IL-2, IL-4, IL-6, and IL-12p40 were not detected above the level of approximately 1.200,000 in these experiments
  • the error bars reflect the estimated uncertainty (25 percent) in the level for a given RNA relative to the level for the same RNA at a different time point. The relative uncertainty estimate was based on the results of repeated spiking experiments, and on repeated measurements of IL-10, ⁇ -actin and GAPDH RNAs in preparations from both T10 and 2D6 cells (unstimulated).
  • Fig 5 shows a fluorescence image of an array containing over 63,000 different oligonucleotide probes for 118 genes The image was obtained following overnight hybridization of a labeled murine B cell RNA sample Each square synthesis region is 50 x 50 ⁇ m and contains 107 to 108 copies of a specific oligonucleotide The array was scanned at a resolution of 7.5 ⁇ m in approximately 15 minutes The bright rows indicate RNAs present at high levels.
  • RNAs were unambiguously detected based on quantitative evaluation ofthe hybridization patterns A total of 21 murine RNAs were detected at levels ranging from approximately 1.300,000 to 1 100
  • the cross in the center, the checkerboard in the corners, and the MUR-1 region at the top contain probes complementary to a labeled control oligonucleotide that was added to all samples
  • Fig 6 shows an example of a computer system used to execute the software of an embodiment ofthe present invention
  • Fig 7 shows a system block diagram of a typical computer system used to execute the software of an embodiment ofthe present invention
  • Fig 8 shows the high level flow of a process of monitoring the expression of a gene by comparing hybridization intensities of pairs of perfect match and mismatch probes.
  • Fig 9 shows the flow of a process of determining if a gene is expressed utilizing a decision matrix.
  • Figs. 10A and 10B show the flow of a process of determining the expression of a gene by comparing baseline scan data and experimental scan data
  • Fig. 11 shows the flow of a process of increasing the number of probes for monitoring the expression of genes after the number of probes has been reduced or pruned
  • This invention provides methods of monitoring (detecting and/or quantifying) the expression levels of one or more genes.
  • the methods involve hybridization of a nucleic acid target sample to a high density array of nucleic acid probes and then quantifying the amount of target nucleic acids hybridized to each probe in the array.
  • nucleic acid hybridization has been used for some time to determine the expression levels of various genes (e.g. , Northern Blot)
  • high density arrays are suitable for the quantification of the small variations in expression (transcription) levels of a gene in the presence of a large population of heterogenous nucleic acids.
  • the signal may be present at a concentration of less than about 1 in 1 ,000, and is often present at a concentration less than 1 in 10,000 more preferably less than about 1 in 50,000 and most preferably less than about 1 in 100,000, 1 in 300,000, or even 1 in 1 ,000,000.
  • oligonucleotide arrays having oligonucleotides as short as 10 nucleotides, more preferably 15 oligonucleotides and most preferably 20 or 25 oligonucleotides are used to specifically detect and quantify gene expression levels.
  • arrays containing longer oligonucleotides, as described herein, are also suitable.
  • the high density arrays used in the methods of this invention comprise chemically synthesized oligonucleotides.
  • chemically synthesized oligonucleotide arrays as opposed to, for example, blotted arrays of genomic clones, restriction fragments, oligonucleotides, and the like, offers numerous advantages. These advantages generally fall into four categories: 1) Efficiency of production;
  • the arrays are synthesized using methods of spatially addressed parallel synthesis (see, e.g. , Section V, below).
  • the oligonucleotides are synthesized chemically in a highly parallel fashion covalently attached to the array surface. This allows extremely efficient array production. For example, arrays containing tens (or even hundreds) of thousands of specifically selected 20 mer oligonucleotides are synthesized in fewer than 80 synthesis cycles.
  • the arrays are designed and synthesized based on sequence information alone.
  • the array preparation requires no handling of biological materials. There is no need for cloning steps, nucleic acid amplifications, cataloging of clones or amplification products, and the like.
  • the preferred chemical synthesis of expression monitoring arrays in this invention is thus more efficient blotting methods and permits the production of highly reproducible high-density arrays with relatively little labor and expense.
  • oligonucleotide arrays in the methods of this invention improves intra- and inter-array variability.
  • the oligonucleotide arrays preferred for this invention are made in large batches (presently 49 arrays per wafer with multiple wafers synthesized in parallel) in a highly controlled reproducible manner. This makes them suitable as general diagnostic and research tools permitting direct comparisons of assays performed anywhere in the world. Because of the precise control obtainable during the chemical synthesis the arrays of this invention show less than about 25%, preferably less than about 20% , more preferably less than about 15%, still more preferably less than about 10% , even more preferably less than about 5%.
  • array variation is assayed as the variation in hybridization intensity (against a labeled control target nucleic acid mixture) in one or more oligonucleotide probes between two or more arrays. More preferably, array variation is assayed as the variation in hybridization intensity (against a labeled control target nucleic acid mixture) measured for one or more target genes between two or more arrays.
  • chemically synthesized arrays also reduce variations in relative probe frequency inherent in spotting methods, particularly spotting methods that use cell-derived nucleic acids (e.g.
  • cDNAs Many genes are expressed at the level of thousands of copies per cell, while others are expressed at only a single copy per cell. A cDNA library will reflect this very large bias as will a cDNA library made from theis material. While normalization (adjustment of the amount of each different probe e.g. , by comparison to a reference cDNA) of the library will reduce the representation of over-expressed sequences, normalization has been shown to lessen the odds of selecting highly expressed cDNAs by only about a factor of 2 or 3. In contrast, chemical synthesis methods can insure that all oligonucleotide probes are represented in approximately equal concentrations. This decreases the inter-gene (intra-array) variability and permits direct comparison between characteristically overexpressed and underexpressed nucleic acids.
  • probes often prove ineffective for expression monitoring by hybridization. For example, certain subsequences of a particular target gene may be found in other regions of the genome and probes directed to these subsequences will cross-hybridize with the other regions and not provide a signal that is a meaningful measure of the expression level of the target gene. Even probes that show little cross reactivity may be unsuitable because they generally show poor hybridization due to the formation of structures that prevent effective hybridization. Finally, in sets with large numbers of probes, it is difficult to identify hybridization conditions that are optimal for all the probes in a set.
  • the use of large numbers of different probes to each target gene makes it possible to monitor expression of families of closely-related nucleic acids.
  • the probes may be selected to hybridize both with subsequences that are conserved across the family and with subsequences that differ in the different nucleic acids in the family.
  • hybridization with such arrays permits simultaneous monitoring of the various members of a gene family even where the various genes are approximately the same size and have high levels of homology. Such measurements are difficult or impossible with traditional hybridization methods.
  • the high density arrays contain such a large number of probes it is possible to provide numerous controls including, for example, controls for variations or mutations in a particular gene, controls for overall hybridization conditions, controls for sample preparation conditions, controls for metabolic activity of the cell from which the nucleic acids are derived and mismatch controls for non-specific binding or cross hybridization.
  • Blotted nucleic acids typically rely on ionic, electrostatic, and hydrophobic interactions to attach the blotted nucleic acids to the substrate. Bonds are formed at multiple points along the nucleic acid restricting degrees of freedom and interferign with the ability of the nucleic acid to hybridize to its complementary target.
  • the preferred arrays of this invention are chemically synthesized.
  • the oligonucleotide probes are attached to the substrate by a single terminal covalent bond.
  • the probes have more degrees of freedom and are capable of participating in complex interactions with their complementary targets. Consequently, the probe arrays of this invention show significantly higher hybridization efficiencies (10 times, 100 times, and even 1000 times more effecient) than blotted arrays. Less target oligonucleotide is used to produce a given signal thereby dramatically improving the signal to noise ratio. Consequently the methods of this invention permit detection of only a few copies of a nucleic acid in extremely complex nucleic acid mixtures.
  • Preferred high density arrays of this invention comprise greater than about 100, preferably greater than about 1000, more preferably greater than about 16,000 and most preferably greater than about 65,000 or 250,000 or even greater than about 1,000,000 different oligonucleotide probes.
  • the oligonucleotide probes range from about 5 to about 50 or about 5 to about 45 nucleotides, more preferably from about 10 to about 40 nucleotides and most preferably from about 15 to about 40 nucleotides in length. In particular preferred embodiments, the oligonucleotide probes are 20 or 25 nucleotides in length. It was a discovery of this invention that relatively short oligonucleotide probes sufficient to specifically hybridize to and distinguish target sequences.
  • the oligonucleotide probes are less than 50 nucleotides in length, generally less than 46 nucleotides, more generally less than 41 nucleotides, most generally less than 36 nucleotides, preferably less than 31 nucleotides, more preferably less than 26 nucleotides, and most preferably less than 21 nucleotides in length.
  • the probes can also be less than 16 nucleotides or less than even 11 nucleotides in length.
  • each different oligonucleotide probe sequence in the array is known. Moreover, the large number of different probes occupies a relatively small area providing a high density array having a probe density of generally greater than about 60, more generally greater than about 100, most generally greater than about 600, often greater than about 1000, more often greater than about
  • the small surface area of the array (often less than about 10 cm 2 , preferably less than about 5 cm 2 more preferably less than about 2 cm 2 , and most preferably less than about 1.6 cm 2 ) permits extremely uniform hybridization conditions (temperature regulation, salt content, etc.) while the extremely large number of probes allows massively parallel processing of hybridizations.
  • hybridization may be carried out in extremely small fluid volumes (e.g. , 250 ⁇ l or less, more preferably 100 ⁇ l or less, and most preferably 10 l or less). In small volumes, hybridization may proceed very rapidly. In addition, hybridization conditions are extremely uniform throughout the sample, and the hybridization format is amenable to automated processing.
  • extremely small fluid volumes e.g. , 250 ⁇ l or less, more preferably 100 ⁇ l or less, and most preferably 10 l or less.
  • This invention demonstrates that hybridization with high density oligonucleotide probe arrays provides an effective means of monitoring expression of a multiplicity of genes.
  • this invention provides for methods of sample treatment and array designs and methods of probe selection that optimize signal detection at extremely low concentrations in complex nucleic acid mixtures.
  • the expression monitoring methods of this invention may be used in a wide variety of circumstances including detection of disease, identification of differential gene expression between two samples (e.g. , a pathological as compared to a healthy sample), screening for compositions that upregulate or downregulate the expression of particular genes, and so forth.
  • the methods of this invention are used to monitor the expression (transcription) levels of nucleic acids whose expression is altered in a disease state.
  • a cancer may be characterized by the overexpression of a particular marker such as the HER2 (c-erbB-2/neu) proto-oncogene in the case of breast cancer.
  • HER2 c-erbB-2/neu
  • RTKs receptor tyrosine kinases
  • a cancer e.g. , colerectal, lung and breast
  • a tumor suppressor gene such as P53
  • the methods of this invention are used to monitor expression of various genes in response to defined stimuli, such as a drug.
  • the methods are particularly advantageous because they permit simultaneous monitoring of the expression of thousands of genes. This is especially useful in drug research if the end point description is a complex one, not simply asking if one particular gene is overexpressed or underexpressed.
  • the methods of this invention allow rapid determination of the particularly relevant genes.
  • the materials and methods of this invention are typically used to monitor the expression of a multiplicity of different genes simultaneously.
  • the invention provide for simultaneous monitoring of at least about 10, preferably at least about 100, more preferably at least about 1000, still more preferably at least about 10,000, and most preferably at least about 100,000 different genes.
  • the expression monitoring methods of this invention can also be used for gene discovery. Many genes that have been discovered to date have been classified into families based on commonality of the sequences. Because of the extremely large number of probes it is possible to place in the high density array, it is possible to include oligonucleotide probes representing known or parts of known members from every gene class.
  • the expression monitoring methods of this invention also allow the development of "dynamic" gene databases.
  • the Human Genome Project and commercial sequencing projects have generated large static databases which list thousands of sequences without regard to function or genetic interaction.
  • Expression analysis using the methods of this invention produces "dynamic" databases that define a gene's function and its interactions with other genes. Without the ability to monitor the expression of large numbers of genes simultaneously , however, the work of creating such a database is enormous.
  • the tedious nature of using DNA sequence analysis for determining an expression patte involves preparing a cDNA library from the RNA isolated from the cells of interest and then sequencing the library. As the DNA is sequenced, the operator lists the sequences that are obtained and counts them.
  • the methods of monitoring gene expression of this invention involve (1) providing a pool of target nucleic acids comprising RNA transcript(s) of one or more target gene(s), or nucleic acids derived from the RNA transcript(s); (2) hybridizing the nucleic acid sample to a high density array of probes (including control probes); and (3) detecting the hybridized nucleic acids and calculating a relative expression (transcription) level.
  • nucleic acid sample comprising mRNA transcript(s) of the gene or genes, or nucleic acids derived from the mRNA transcript(s).
  • a nucleic acid derived from an mRNA transcript refers to a nucleic acid for whose synthesis the mRNA transcript or a subsequence thereof has ultimately served as a template.
  • suitable samples include, but are not limited to, mRNA transcripts of the gene or genes, cDNA reverse transcribed from the mRNA, cRNA transcribed from the cDNA, DNA amplified from the genes, RNA transcribed from amplified DNA, and the like.
  • the nucleic acid sample is one in which the concentration of the mRNA transcript(s) of the gene or genes, or the concentration of the nucleic acids derived from the mRNA transcript(s), is proportional to the transcription level (and therefore expression level) of that gene.
  • the hybridization signal intensity be proportional to the amount of hybridized nucleic acid. While it is preferred that the proportionality be relatively strict (e.g.
  • a doubling in transcription rate results in a doubling in mRNA transcript in the sample nucleic acid pool and a doubling in hybridization signal
  • the proportionality can be more relaxed and even non-linear.
  • an assay where a 5 fold difference in concentration of the target mRNA results in a 3 to 6 fold difference in hybridization intensity is sufficient for most purposes.
  • appropriate controls can be run to correct for variations introduced in sample preparation and hybridization as described herein.
  • serial dilutions of "standard" target mRNAs can be used to prepare calibration curves according to methods well known to those of skill in the art. Of course, where simple detection of the presence or absence of a transcript is desired, no elaborate control or calibration is required.
  • such a nucleic acid sample is the total mRNA isolated from a biological sample.
  • biological sample refers to a sample obtained from an organism or from components (e.g. , cells) of an organism.
  • the sample may be of any biological tissue or fluid. Frequently the sample will be a "clinical sample” which is a sample derived from a patient.
  • samples include, but are not limited to, sputum, blood, blood cells (e.g., white cells), tissue or fine needle biopsy samples, urine, peritoneal fluid, and pleural fluid, or cells therefrom.
  • Biological samples may also include sections of tissues such as frozen sections taken for histological purposes.
  • the nucleic acid may be isolated from the sample according to any of a number of methods well known to those of skill in the art.
  • genomic DNA is preferably isolated.
  • expression levels of a gene or genes are to be detected, preferably RNA (mRNA) is isolated.
  • mRNA RNA
  • Methods of isolating total mRNA are well known to those of skill in the art. For example, methods of isolation and purification of nucleic acids are described in detail in Chapter 3 of Laboratory Techniques in Biochemistry and Molecular Biology: Hybridization With Nucleic Acid Probes, Part 1. Theory and Nucleic Acid Preparation, P. Tijssen, ed.
  • the total nucleic acid is isolated from a given sample using, for example, an acid guanidinium-phenol-chloroform extraction method and poly A + mRNA is isolated by oligo dT column chromatography or by using (dT)n magnetic beads (see, e.g. , Sambrook et al. , Molecular Cloning: A Laboratory Manual (2nd ed.), Vols. 1-3, Cold Spring Harbor Laboratory, (1989), or Current Protocols in Molecular Biology, F. Ausubel et al. , ed. Greene Publishing and Wiley-Interscience, New York (1987)).
  • Quantitative amplification involves simultaneously co-amplifying a known quantity of a control sequence using the same primers. This provides an intemal standard that may be used to calibrate the PCR reaction. The high density array may then include probes specific to the intemal standard for quantification of the amplified nucleic acid.
  • One preferred intemal standard is a synthetic AW 106 cRNA.
  • the AW106 cRNA is combined with RNA isolated from the sample according to standard techniques known to those of skill in the art.
  • the RNA is then reverse transcribed using a reverse transcriptase to provide copy DNA.
  • the cDNA sequences are then amplified (e.g. , by PCR) using labeled primers.
  • the amplification products are separated, typically by electrophoresis, and the amount of radioactivity (proportional to the amount of amplified product) is determined.
  • the amount of mRNA in the sample is then calculated by comparison with the signal produced by the known AW 106 RNA standard.
  • Detailed protocols for quantitative PCR are provided in PCR Protocols, A Guide to Methods and Applications , et al. , Academic Press, Inc. N.Y. , (1990).
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • the sample mRNA is reverse transcribed with a reverse transcriptase and a primer consisting of oligo dT and a sequence encoding the phage T7 promoter to provide single stranded DNA template.
  • the second DNA strand is polymerized using a DNA polymerase.
  • T7 RNA polymerase is added and RNA is transcribed from the cDNA template. Successive rounds of transcription from each single cDNA template results in amplified RNA.
  • Methods of in vitro polymerization are well known to those of skill in the art (see, e.g.
  • the direct transcription method described above provides an antisense (aRNA) pool.
  • aRNA antisense
  • the oligonucleotide probes provided in the array are chosen to be complementary to subsequences of the antisense nucleic acids.
  • the target nucleic acid pool is a pool of sense nucleic acids
  • the oligonucleotide probes are selected to be complementary to subsequences of the sense nucleic acids.
  • the probes may be of either sense as the target nucleic acids include both sense and antisense strands.
  • the protocols cited above include methods of generating pools of either sense or antisense nucleic acids. Indeed, one approach can be used to generate either sense or antisense nucleic acids as desired.
  • the cDNA can be directionally cloned into a vector (e.g. , Stratagene's p Bluscript II KS (+) phagemid) such that it is flanked by the T3 and T7 promoters. In vitro transcription with the T3 polymerase will produce RNA of one sense (the sense depending on the orientation of the insert), while in vitro transcription with the T7 polymerase will produce RNA having the opposite sense.
  • Other suitable cloning systems include phage lambda vectors designed for Cre- loxP plasmid subcloning (see e.g. , Palazzolo et al. , Gene, 88: 25-36 (1990)).
  • RNA polymerase e.g. about 2500 units/ ⁇ L for T7, available from Epicentre Technologies.
  • the hybridized nucleic acids are detected by detecting one or more labels attached to the sample nucleic acids.
  • the labels may be incorporated by any of a number of means well known to those of skill in the art.
  • the label is simultaneously inco ⁇ orated during the amplification step in the preparation of the sample nucleic acids.
  • PCR polymerase chain reaction
  • transcription amplification as described above, using a labeled nucleotide (e.g. fluorescein -labeled UTP and/or CTP) inco ⁇ orates a label into the transcribed nucleic acids.
  • a label may be added directly to the original nucleic acid sample (e.g. , mRNA, polyA mRNA, cDNA, etc.) or to the amplification product after the amplification is completed.
  • Means of attaching labels to nucleic acids are well known to those of skill in the art and include, for example nick translation or end- labeling (e.g. with a labeled RNA) by kinasing of the nucleic acid and subsequent attachment (ligation) of a nucleic acid linker joining the sample nucleic acid to a label (e.g. , a fluorophore).
  • Detectable labels suitable for use in the present invention include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
  • Useful labels in the present invention include biotin for staining with labeled streptavidin conjugate, magnetic beads (e.g. , DynabeadsTM), fluorescent dyes (e.g. , fluorescein, texas red, rhodamine, green fluorescent protein, and the like), radiolabels (e.g. , 3 H, 125 I, 35 S, 14 C, or 32 P), enzymes (e.g.
  • radiolabels may be detected using photographic film or scintillation counters
  • fluorescent markers may be detected using a photodetector to detect emitted light
  • Enzymatic labels are typically detected by providing the enzyme with a substrate and detecting the reaction product produced by the action of the enzyme on the substrate, and colorimetric labels are detected by simply visualizing the colored label.
  • the label may be added to the target (sample) nucleic acid(s) prior to, or after the hybridization.
  • so called “direct labels” are detectable labels that are directly attached to or incorporated into the target (sample) nucleic acid prior to hybridization.
  • the indirect label is attached to a binding moiety that has been attached to the target nucleic acid prior to the hybridization.
  • the target nucleic acid may be biotinylated before the hybridization.
  • an aviden-conjugated fluorophore will bind the biotin bearing hybrid duplexes providing a label that is easily detected.
  • Fluorescent labels are preferred and easily added during an in vitro transcription reaction.
  • fluorescein labeled UTP and CTP are incorporated into the RNA produced in an in vitro transcription reaction as described above.
  • the nucleic acid sample may be modified prior to hybridization to the high density probe array in order to reduce sample complexity thereby decreasing background signal and improving sensitivity of the measurement.
  • complexity reduction is achieved by selective degradation of background mRNA. This is accomplished by hybridizing the sample mRNA (e.g. , polyA + RNA) with a pool of DNA oligonucleotides that hybridize specifically with the regions to which the probes in the array specifically hybridize.
  • the pool of oligonucleotides consists of the same probe oligonucleotides as found on the high density array.
  • the pool of oligonucleotides hybridizes to the sample mRNA forming a number of double stranded (hybrid duplex) nucleic acids.
  • the hybridized sample is then treated with RNase A, a nuclease that specifically digests single stranded RNA.
  • the RNase A is then inhibited, using a protease and/or commercially available RNase inhibitors, and the double stranded nucleic acids are then separated from the digested single stranded RNA. This separation may be accomplished in a number of ways well known to those of skill in the art including, but not limited to, electrophoresis, and gradient centrifugation.
  • the pool of DNA oligonucleotides is provided attached to beads forming thereby a nucleic acid affinity column.
  • the hybridized DNA is removed simply by denaturing (e.g. , by adding heat or increasing salt) the hybrid duplexes and washing the previously hybridized mRNA off in an elution buffer.
  • the undigested mRNA fragments which will be hybridized to the probes in the high density array are then preferably end-labeled with a fluorophore attached to an RNA linker using an RNA ligase. This procedure produces a labeled sample RNA pool in which the nucleic acids that do not correspond to probes in the array are eliminated and thus unavailable to contribute to a background signal.
  • Another method of reducing sample complexity involves hybridizing the mRNA with deoxyoligonucleotides that hybridize to regions that border on either size the regions to which the high density array probes are directed.
  • Treatment with RNAse H selectively digests the double stranded (hybrid duplexes) leaving a pool of single- stranded mRNA corresponding to the short regions (e.g. , 20 mer) that were formerly bounded by the deoxyoligonucleotide probes and which correspond to the targets of the high density array probes and longer mRNA sequences that correspond to regions between the targets of the probes of the high density array.
  • the short RNA fragments are then separated from the long fragments (e.g.
  • sample complexity reduction involves the selective removal of particular (preselected) mRNA messages.
  • highly expressed mRNA messages that are not specifically probed by the probes in the high density array are preferably removed.
  • This approach involves hybridizing the poly A + mRNA with an oligonucleotide probe that specifically hybridizes to the preselected message close to the 3' (poly A) end. The probe may be selected to provide high specificity and low cross reactivity.
  • Treatment of the hybridized message/probe complex with RNase H digests the double stranded region effectively removing the polyA + tail from the rest of the message.
  • the sample is then treated with methods that specifically retain or amplify polyA + RNA (e.g. , an oligo dT column or (dT)n magnetic beads). Such methods will not retain or amplify the selected message(s) as they are no longer associated with a polyA + tail. These highly expressed messages are effectively removed from the sample providing a sample that has reduced background mRNA.
  • methods that specifically retain or amplify polyA + RNA e.g. , an oligo dT column or (dT)n magnetic beads.
  • the high density array will typically include a number of probes that specifically hybridize to the nucleic acid(s) expression of which is to be detected.
  • the array will include one or more control probes.
  • the high density array includes "test probes". These are oligonucleotides that range from about 5 to about 45 or 5 to about 50 nucleotides, more preferably from about 10 to about 40 nucleotides and most preferably from about 15 to about 40 nucleotides in length. In other particularly preferred embodiments the probes are 20 or 25 nucleotides in length. These oligonucleotide probes have sequences complementary to particular subsequences of the genes whose expression they are designed to detect. Thus, the test probes are capable of specifically hybridizing to the target nucleic acid they are to detect. In addition to test probes that bind the target nucleic acid(s) of interest, the high density array can contain a number of control probes. The control probes fall into three categories referred to herein as 1) Normalization controls; 2) Expression level controls; and 3) Mismatch controls.
  • Normalization controls are oligonucleotide probes that are perfectly complementary to labeled reference oligonucleotides that are added to the nucleic acid sample.
  • the signals obtained from the normalization controls after hybridization provide a control for variations in hybridization conditions, label intensity, "reading" efficiency and other factors that may cause the signal of a perfect hybridization to vary between arrays.
  • signals (e.g. , fluorescence intensity) read from all other probes in the array are divided by the signal (e.g. , fluorescence intensity) from the control probes thereby normalizing the measurements.
  • Virtually any probe may serve as a normalization control.
  • Preferred normalization probes are selected to reflect the average length of the other probes present in the array, however, they can be selected to cover a range of lengths.
  • the normalization control(s) can also be selected to reflect the (average) base composition of the other probes in the array, however in a preferred embodiment, only one or a few normalization probes are used and they are selected such that they hybridize well (i.e. no secondary structure) and do not match any target-specific probes.
  • Normalization probes can be localized at any position in the array or at multiple positions throughout the array to control for spatial variation in hybridization efficiently.
  • the normalization controls are located at the co ers or edges of the array as well as in the middle.
  • Expression level controls are probes that hybridize specifically with constitutively expressed genes in the biological sample. Expression level controls are designed to control for the overall health and metabolic activity of a cell. Examination of the covariance of an expression level control with the expression level of the target nucleic acid indicates whether measured changes or variations in expression level of a gene is due to changes in transcription rate of that gene or to general variations in health of the cell. Thus, for example, when a cell is in poor health or lacking a critical metabolite the expression levels of both an active target gene and a constitutively expressed gene are expected to decrease. The converse is also true.
  • the change may be attributed to changes in the metabolic activity of the cell as a whole, not to differential expression of the target gene in question.
  • the expression levels of the target gene and the expression level control do not covary, the variation in the expression level of the target gene is attributed to differences in regulation of that gene and not to overall variations in the metabolic activity of the cell.
  • Virtually any constitutively expressed gene provides a suitable target for expression level controls.
  • expression level control probes have sequences complementary to subsequences of constitutively expressed "housekeeping genes" including, but not limited to the ⁇ -actin gene, the transferrin receptor gene, the GAPDH gene, and the like.
  • Mismatch controls may also be provided for the probes to the target genes, for expression level controls or for normalization controls.
  • Mismatch controls are oligonucleotide probes identical to their corresponding test or control probes except for the presence of one or more mismatched bases.
  • a mismatched base is a base selected so that it is not complementary to the corresponding base in the target sequence to which the probe would otherwise specifically hybridize.
  • One or more mismatches are selected such that under appropriate hybridization conditions (e.g. stringent conditions) the test or control probe would be expected to hybridize with its target sequence, but the mismatch probe would not hybridize (or would hybridize to a significantly lesser extent).
  • Preferred mismatch probes contain a central mismatch.
  • a corresponding mismatch probe will have the identical sequence except for a single base mismatch (e.g. , substituting a G, a C or a T for an A) at any of positions 6 through 14 (the central mismatch).
  • Mismatch probes thus provide a control for non-specific binding or cross- hybridization to a nucleic acid in the sample other than the target to which the probe is directed. Mismatch probes thus indicate whether a hybridization is specific or not. For example, if the target is present the perfect match probes should be consistently brighter than the mismatch probes. In addition, if all central mismatches are present, the mismatch probes can be used to detect a mutation. Finally, it was also a discovery of the present invention that the difference in intensity between the perfect match and the mismatch probe (I(PM)-I(MM)) provides a good measure of the concentration of the hybridized material. 5) Sample preparation/amplification controls.
  • the high density array may also include sample preparation/amplification control probes. These are probes that are complementary to subsequences of control genes selected because they do not normally occur in the nucleic acids of the particular biological sample being assayed. Suitable sample preparation/amplification control probes include, for example, probes to bacterial genes (e.g. , Bio B) where the sample in question is a biological from a eukaryote.
  • sample preparation/amplification control probes include, for example, probes to bacterial genes (e.g. , Bio B) where the sample in question is a biological from a eukaryote.
  • RNA sample is then spiked with a known amount of the nucleic acid to which the sample preparation/amplification control probe is directed before processing. Quantification of the hybridization of the sample preparation/amplification control probe then provides a measure of alteration in the abundance of the nucleic acids caused by processing steps (e.g. PCR, reverse transcription, in vitro transcription, etc.).
  • processing steps e.g. PCR, reverse transcription, in vitro transcription, etc.
  • oligonucleotide probes in the high density array are selected to bind specifically to the nucleic acid target to which they are directed with minimal non-specific binding or cross-hybridization under the particular hybridization conditions utilized. Because the high density arrays of this invention can contain in excess of 1,000,000 different probes, it is possible to provide every probe of a characteristic length that binds to a particular nucleic acid sequence. Thus, for example, the high density array can contain every possible 20 mer sequence complementary to an IL-2 mRNA.
  • probes directed to these subsequences are expected to cross hybridize with occurrences of their complementary sequence in other regions of the sample genome.
  • other probes simply may not hybridize effectively under the hybridization conditions (e.g. , due to secondary structure, or interactions with the substrate or other probes).
  • the probes that show such poor specificity or hybridization efficiency are identified and may not be included either in the high density array itself (e.g. , during fabrication of the array) or in the post-hybridization data analysis.
  • expression monitoring arrays are used to identify the presence and expression (transcription) level of genes which are several hundred base pairs long. For most applications it would be useful to identify the presence, absence, or expression level of several thousand to one hundred thousand genes. Because the number of oligonucleotides per array is limited in a preferred embodiment, it is desired to include only a limited set of probes specific to each gene whose expression is to be detected.
  • probes as short as 15, 20, or 25 nucleotides are sufficient to hybridize to a subsequence of a gene and that, for most genes, there is a set of probes that performs well across a wide range of target nucleic acid concentrations.
  • this invention provides for a method of optimizing a probe set for detection of a particular gene.
  • this method involves providing a high density array containing a multiplicity of probes of one or more particular length(s) that are complementary to subsequences of the mRNA transcribed by the target gene.
  • the high density array may contain every probe of a particular length that is complementary to a particular mRNA.
  • the probes of the high density array are then hybridized with their target nucleic acid alone and then hybridized with a high complexity, high concentration nucleic acid sample that does not contain the targets complementary to the probes.
  • the probes are first hybridized with their target nucleic acid alone and then hybridized with RNA made from a cDNA library (e.g. , reverse transcribed polyA + mRNA) where the sense of the hybridized RNA is opposite that of the target nucleic acid (to insure that the high complexity sample does not contain targets for the probes).
  • a cDNA library e.g. , reverse transcribed polyA + mRNA
  • the probes that show a strong hybridization signal with their target and little or no cross-hybridization with the high complexity sample are preferred probes for use in the high density arrays of this invention.
  • the high density array may additionally contain mismatch controls for each of the probes to be tested. In a preferred embodiment, the mismatch controls contain a central mismatch. Where both the mismatch control and the target probe show high levels of hybridization (e.g. , the hybridization to the mismatch is nearly equal to or greater than the hybridization to the corresponding test probe), the test probe is preferably not used in the
  • optimal probes are selected according to the following method: First, as indicated above, an array is provided containing a multiplicity of oligonucleotide probes complementary to subsequences of the target nucleic acid.
  • the oligonucleotide probes may be of a single length or may span a variety of lengths ranging from 5 to 50 nucleotides.
  • the high density array may contain every probe of a particular length that is complementary to a particular mRNA or may contain probes selected from various regions of particular mRNAs.
  • the array also contains a mismatch control probe; preferably a central mismatch control probe.
  • the oligonucleotide array is hybridized to a sample containing target nucleic acids having subsequences complementary to the oligonucleotide probes and the difference in hybridization intensity between each probe and its mismatch control is determined. Only those probes where the difference between the probe and its mismatch control exceeds a threshold hybridization intensity (e.g. preferably greater than 10% of the background signal intensity, more preferably greater than 20% of the background signal intensity and most preferably greater than 50% of the background signal intensity) are selected. Thus, only probes that show a strong signal compared to their mismatch control are selected.
  • the probe optimization procedure can optionally include a second round of selection.
  • the oligonucleotide probe array is hybridized with a nucleic acid sample that is not expected to contain sequences complementary to the probes.
  • a sample of antisense RNA is provided.
  • other samples could be provided such as samples from organisms or cell lines known to be lacking a particular gene, or known for not expressing a particular gene. Only those probes where both the probe and its mismatch control show hybridization intensities below a threshold value (e.g.
  • n probes (where n is the number of probes desired for each target gene) that pass both selection criteria and have the highest hybridization intensity for each target gene are selected for incorporation into the array, or where already present in the array, for subsequent data analysis.
  • selection criterion could be used alone for selection of probes.
  • a palindrome score is the maximum number of complementary bases if the oligonucleotide is folded over at a point that maximizes self complementarity. Thus, for example a 20 mer that is perfectly self-complementary would have a palindrome score of 10.
  • a clumping score is the maximum number of three-mers of identical bases in a given sequence. Thus, for example, a run of 5 identical bases will produce a clumping score of 3 (bases 1-3, bases 2-4, and bases 3-5).
  • the probe was not a member of the subset of probes placed on the chip. For example, if a hypothetical probe was 5'-AGCTTTTTTCATGCATCTAT-3' the probe would not be synthesized on the chip because it has a run of four or more bases (i.e. , run of six).
  • a neural net can be trained to predict the hybridization and cross-hybridization intensities based on the sequence of the probe or on other probe properties. The neural net can then be used to pick an arbitrary number of the "best" probes. One such neural net was developed for selecting 20-mer probes. This neural net was produced a moderate (0.7) correlation between predicted intensity and measured intensity, with a better model for cross hybridization than hybridization Details of this neural net are provided in Example 6.
  • An analysis of variance (ANOVA) model may be built to model the intensities based on positions of consecutive base pairs. This is based on the theory that the melting energy is based on stacking energies of consecutive bases.
  • the annova model was used to find correlation between the a probe sequence and the hybridization and cross-hybridization intensities.
  • the inputs were probe sequences broken down into consecutive base pairs.
  • One model was made to predict hybridization, another was made to predict cross hybridization.
  • the output was the hybridization or crosshybridization intensity.
  • the resulting model assigned a component of the output intensity to each of the possible inputs, so to estimate the intensity for a given sequence one simply adds the intensities for each of it's 19 components.
  • the simplest pruning method is to line up a proposed probe with all known genes for the organism being monitored, then count the number of matching bases. For example, given a probe to gene 1 of an organism and gene 2 of an organism as follows probe from gene 1 aagcgcgatcgattatgctc
  • I M I M I gene 2 atctcggatcgatcggataagcgcgatcgattatgctcggcga
  • sequence alignment algorithms are well known to those of skill in the art and include, but are not limited to BLAST, or FASTA, or other gene matching programs such as those described above in the definitions section.
  • the cost of producing masks for a chip is approximately linearly related to the number of synthesis cycles In a normal set of genes the distribution of the number of cycles any probe takes to build approximates a Gausian distribution Because of this the mask cost can normally be reduced by 15% by throwing out about 3 percent ofthe probes
  • synthesis cycle pruning simply involves eliminating (not including) those probes those probes that require a greater number of synthesis cycles than the maximum number of synthesis cycles selected for preparation ofthe particular subject high density oligonucleotide array Since the typical synthesis of probes follows a regular pattem of bases put down (acgtacgtacgt ) counting the number of synthesis steps needed to build a probe is easy
  • Table 1 povides typical code for counting the number of synthesis cycles a probe will need Table 1.
  • the heuristic rules, neural net and annova model provide ways of pruning or reducing the number of probes for monitoring the expression of genes As these methods do not necessarily produce the same results, or produce entirely independent results, it may be advantageous to combine the methods. For example, probes may be pruned or reduced if more than one method (e.g., two out of three) indicate the probe will not likely produce good results. Then, synthesis cycle pruning may be performed to reduce costs. Fig.
  • 11 shows the flow of a process of increasing the number of probes for monitoring the expression of genes after the number of probes has been reduced or pruned
  • a user is able to specify the number of nucleic acid probes that should be placed on the chip to monitor the expression of each gene
  • the number of probes may be reduced to substantially less than the desired number of probes
  • the number of probes for monitoring multiple genes is reduced by the heuristic rules method, neural net, annova model, synthesis cycle pruning, or any other method, or combination of methods.
  • a gene is selected at step 404
  • the remaining probes for monitoring the selected gene do not number greater than 80% ofthe desired number of probes, a determination is made whether the remaining probes for monitoring the selected gene number greater than 40% (which may be varied or user defined) ofthe desired number of probes If yes, an "i" is appended to the end ofthe gene name to indicate that after pruning, the probes were incomplete at step 412
  • the number of probes is increased by loosening the constraints that rejected probes For example, the thresholds in the heuristic rules may be increased by 1. Therefore, if previously probes were rejected if they had four As in a row, the rule may be loosened to five As in a row.
  • the probes for monitoring the selected gene are not reduced by conflicts at all
  • a determination is then made whether the remaining probes for monitoring the selected gene number greater than 80% ofthe desired number of probes at step 430 If yes, an "f is appended to the end ofthe gene name at step 432 to indicate that the probes include the whole family of probes perfectly complementary to the gene
  • an error is reported at step 434 Any number of error handling procedures may be undertaken For example, an error message may be generated for the user and the probes for the gene may not be stored Alternatively, the user may be prompted to enter a new desired number of probes
  • oligonucleotide analogue array can be synthesized on a solid substrate by a variety of methods, including, but not limited to, light-directed chemical coupling, and mechanically directed coupling. See Pirrung et al , U.S. Patent No. 5,143,854 (see also PCT Application No. WO 90/15070) and Fodor et al , PCT Publication Nos.
  • WO 92/10092 and WO 93/09668 which disclose methods of forming vast arrays of peptides, oligonucleotides and other molecules using, for example, light-directed synthesis techniques. See also, Fodor et al , Science, 251, 767-77 (1991). These procedures for synthesis of polymer arrays are now referred to as VLSIPSTM procedures. Using the VLSIPSTM approach, one heterogenous array of polymers is converted, through simultaneous coupling at a number of reaction sites, into a different heterogenous array. See, U.S. Application Serial Nos. 07/796,243 and 07/980,523.
  • a glass surface is derivatized with a silane reagent containing a functional group, e.g. , a hydroxyl or amine group blocked by a photolabile protecting group.
  • a functional group e.g. , a hydroxyl or amine group blocked by a photolabile protecting group.
  • Photolysis through a photolithogaphic mask is used selectively to expose functional groups which are then ready to react with incoming 5'-photoprotected nudeoside phosphoramidites.
  • the phosphoramidites react only with those sites which are illuminated (and thus exposed by removal of the photolabile blocking group).
  • the phosphoramidites only add to those areas selectively exposed from the preceding step. These steps are repeated until the desired array of sequences have been synthesized on the solid surface. Combinatorial synthesis of different oligonucleotide analogues at different locations on the array is determined by the pattern of illumination during synthesis and the order of addition of coupling reagents.
  • Peptide nucleic acids are commercially available from, e.g. , Biosearch, Inc. (Bedford, MA) which comprise a polyamide backbone and the bases found in naturally occurring nucleosides. Peptide nucleic acids are capable of binding to nucleic acids with high specificity, and are considered "oligonucleotide analogues" for purposes of this disclosure.
  • a typical "flow channel” method applied to the compounds and libraries of the present invention can generally be described as follows. Diverse polymer sequences are synthesized at selected regions of a substrate or solid support by forming flow channels on a surface of the substrate through which appropriate reagents flow or in which appropriate reagents are placed. For example, assume a monomer "A" is to be bound to the substrate in a first group of selected regions. If necessary, all or part of the surface of the substrate in all or a part of the selected regions is activated for binding by, for example, flowing appropriate reagents through all or some of the channels, or by washing the entire substrate with appropriate reagents.
  • a reagent having the monomer A flows through or is placed in all or some of the channel(s).
  • the channels provide fluid contact to the first selected regions, thereby binding the monomer A on the substrate directly or indirectly (via a spacer) in the first selected regions.
  • a monomer B is coupled to second selected regions, some of which may be included among the first selected regions.
  • the second selected regions will be in fluid contact with a second flow channel(s) through translation, rotation, or replacement of the channel block on the surface of the substrate; through opening or closing a selected valve; or through deposition of a layer of chemical or photoresist.
  • a step is performed for activating at least the second regions.
  • the monomer B is flowed through or placed in the second flow channel(s), binding monomer B at the second selected locations.
  • the resulting sequences bound to the substrate at this stage of processing will be, for example, A, B, and AB. The process is repeated to form a vast array of sequences of desired length at known locations on the substrate.
  • monomer A can be flowed through some of the channels, monomer B can be flowed through other channels, a monomer C can be flowed through still other channels, etc.
  • monomer A can be flowed through some of the channels, monomer B can be flowed through other channels, a monomer C can be flowed through still other channels, etc.
  • many or all of the reaction regions are reacted with a monomer before the channel block must be moved or the substrate must be washed and/or reactivated.
  • the number of washing and activation steps can be minimized.
  • a protective coating such as a hydrophilic or hydrophobic coating (depending upon the nature of the solvent) is utilized over portions of the substrate to be protected, sometimes in combination with materials that facilitate wetting by the reactant solution in other regions. In this manner, the flowing solutions are further prevented from passing outside of their designated flow paths.
  • the "spotting" methods of preparing compounds and libraries of the present invention can be implemented in much the same manner as the flow channel methods. For example, a monomer A can be delivered to and coupled with a first group of reaction regions which have been appropriately activated.
  • a monomer B can be delivered to and reacted with a second group of activated reaction regions.
  • reactants are delivered by directly depositing (rather than flowing) relatively small quantities of them in selected regions.
  • the entire substrate surface can be sprayed or otherwise coated with a solution.
  • a dispenser moves from region to region, depositing only as much monomer as necessary at each stop.
  • Typical dispensers include a micropipette to deliver the monomer solution to the substrate and a robotic system to control the position of the micropipette with respect to the substrate.
  • the dispenser includes a series of tubes, a manifold, an array of pipettes, or the like so that various reagents can be delivered to the reaction regions simultaneously.
  • Nucleic acid hybridization simply involves providing a denatured probe and target nucleic acid under conditions where the probe and its complementary target can form stable hybrid duplexes through complementary base pairing. The nucleic acids that do not form hybrid duplexes are then washed away leaving the hybridized nucleic acids to be detected, typically through detection of an attached detectable label. It is generally recognized that nucleic acids are denatured by increasing the temperature or decreasing the salt concentration of the buffer containing the nucleic acids. Under low stringency conditions (e.g. , low temperature and/or high salt) hybrid duplexes (e.g. , DNA:DNA, RNA:RNA, or RNA:DNA) will form even where the annealed sequences are not perfectly complementary. Thus specificity of hybridization is reduced at lower stringency. Conversely, at higher stringency (e.g. , higher temperature or lower salt) successful hybridization requires fewer mismatches.
  • low stringency conditions e.g. , low temperature and/or high salt
  • hybridization conditions may be selected to provide any degree of stringency.
  • hybridization is performed at low stringency in this case in 6X SSPE-T at 37°C (0.005% Triton X- 100) to ensure hybridization and then subsequent washes are performed at higher stringency (e.g. , 1 X SSPE-T at 37°C) to eliminate mismatched hybrid duplexes.
  • Successive washes may be performed at increasingly higher stringency (e.g. , down to as low as 0.25 X SSPE-T at 37°C to 50°C) until a desired level of hybridization specificity is obtained.
  • Stringency can also be increased by addition of agents such as formamide.
  • Hybridization specificity may be evaluated by comparison of hybridization to the test probes with hybridization to the various controls that can be present (e.g. , expression level control, normalization control, mismatch controls, etc.).
  • the wash is performed at the highest stringency that produces consistent results and that provides a signal intensity greater than approximately 10% of the background intensity.
  • the hybridized array may be washed at successively higher stringency solutions and read between each wash. Analysis of the data sets thus produced will reveal a wash stringency above which the hybridization pattem is not appreciably altered and which provides adequate signal for the particular oligonucleotide probes of interest.
  • background signal is reduced by the use of a detergent (e.g. , C-TAB) or a blocking reagent (e.g. , sperm DNA, cot-1 DNA, etc.) during the hybridization to reduce non-specific binding.
  • a detergent e.g. , C-TAB
  • a blocking reagent e.g. , sperm DNA, cot-1 DNA, etc.
  • the hybridization is performed in the presence of about 0.5 mg/ml DNA (e.g. , herring sperm DNA).
  • the use of blocking agents in hybridization is well known to those of skill in the art (see, e.g. , Chapter 8 in P. Tijssen, supra. )
  • RNAs or DNAs are generally in the order of RNA: RNA > RNA:DNA > DNA:DNA, in solution.
  • Long probes have better duplex stability with a target, but poorer mismatch discrimination than shorter probes (mismatch discrimination refers to the measured hybridization signal ratio between a perfect match probe and a single base mismatch probe).
  • Shorter probes e.g. , 8-mers discriminate mismatches very well, but the overall duplex stability is low.
  • T m thermal stability
  • A-T duplexes have a lower T m than guanine- cytosine (G-C) duplexes, due in part to the fact that the A-T duplexes have 2 hydrogen bonds per base-pair, while the G-C duplexes have 3 hydrogen bonds per base pair.
  • oligonucleotide arrays in which there is a non-uniform distribution of bases, it is not generally possible to optimize hybridization for each oligonucleotide probe simultaneously.
  • TMAC1 salt tetramethyl ammonium chloride
  • Altered duplex stability conferred by using oligonucleotide analogue probes can be ascertained by following, e.g. , fluorescence signal intensity of oligonucleotide analogue arrays hybridized with a target oligonucleotide over time.
  • the data allow optimization of specific hybridization conditions at, e.g. , room temperature
  • Another way of verifying altered duplex stability is by following the signal intensity generated upon hybridization with time. Previous experiments using DNA targets and DNA chips have shown that signal intensity increases with time, and that the more stable duplexes generate higher signal intensities faster than less stable duplexes. The signals reach a plateau or "saturate" after a certain amount of time due to all of the binding sites becoming occupied. These data allow for optimization of hybridization, and determination of the best conditions at a specified temperature. Methods of optimizing hybridization conditions are well known to those of skill in the art (see, e.g. , Laboratory Techniques in Biochemistry and Molecular
  • Means of detecting labeled target (sample) nucleic acids hybridized to the probes of the high density array are known to those of skill in the art. Thus, for example, where a colorimetric label is used, simple visualization of the label is sufficient. Where a radioactive labeled probe is used, detection of the radiation (e.g with photographic film or a solid state detector) is sufficient.
  • the target nucleic acids are labeled with a fluorescent label and the localization of the label on the probe array is accomplished with fluorescent microscopy.
  • the hybridized array is excited with a light source at the excitation wavelength of the particular fluorescent label and the resulting fluorescence at the emission wavelength is detected.
  • the excitation light source is a laser appropriate for the excitation of the fluorescent label.
  • the confocal microscope may be automated with a computer-controlled stage to automatically scan the entire high density array.
  • the microscope may be equipped with a phototransducer (e.g. , a photomultiplier, a solid state array, a ccd camera, etc.) attached to an automated data acquisition system to automatically record the fluorescence signal produced by hybridization to each oligonucleotide probe on the array.
  • a phototransducer e.g. , a photomultiplier, a solid state array, a ccd camera, etc.
  • Such automated systems are described at length in U.S. Patent No: 5, 143,854, PCT Application 20 92/10092, and copending U.S.S.N. 08/195,889 filed on February 10, 1994.
  • Use of laser illumination in conjunction with automated confocal microscopy for signal detection permits detection at a resolution of better than about 100 ⁇ m, more preferably better than about 50 ⁇ m, and most preferably better than about 25 ⁇
  • hybridization signals will vary in strength with efficiency of hybridization, the amount of label on the sample nucleic acid and the amount of the particular nucleic acid in the sample.
  • nucleic acids present at very low levels e.g. , ⁇ IpM
  • ⁇ IpM the amount of label on the sample nucleic acid
  • concentration e.g. , ⁇ IpM
  • a threshold intensity value may be selected below which a signal is not counted as being essentially indistinguishable from background.
  • a lower threshold is chosen. Conversely, where only high expression levels are to be evaluated a higher threshold level is selected. In a preferred embodiment, a suitable threshold is about 10% above that of the average background signal.
  • the hybridization array is provided with normalization controls as described above in Section IV. A.2.
  • normalization controls are probes complementary to control sequences added in a known concentration to the sample. Where the overall hybridization conditions are poor, the normalization controls will show a smaller signal reflecting reduced hybridization. Conversely, where hybridization conditions are good, the normalization controls will provide a higher signal reflecting the improved hybridization.
  • Normalization of the signal derived from other probes in the array to the normalization controls thus provides a control for variations in hybridization conditions.
  • normalization is accomplished by dividing the measured signal from the other probes in the array by the average signal produced by the normalization controls. Normalization may also include correction for variations due to sample preparation and amplification. Such normalization may be accomplished by dividing the measured signal by the average signal from the sample preparation/amplfication control probes (e.g. , the Bio B probes). The resulting values may be multiplied by a constant value to scale the results.
  • the high density array can include mismatch controls.
  • the difference in hybridization signal intensity between the target specific probe and its corresponding mismatch control is a measure of the discrimination of the target-specific probe.
  • the signal of the mismatch probe is subtracted from the signal from its corresponding test probe to provide a measure of the signal due to specific binding of the test probe.
  • the concentration of a particular sequence can then be determined by measuring the signal intensity of each of the probes that bind specifically to that gene and normalizing to the normalization controls. Where the signal from the probes is greater than the mismatch, the mismatch is subtracted. Where the mismatch intensity is equal to or greater than its corresponding test probe, the signal is ignored.
  • the expression level of a particular gene can then be scored by the number of positive signals (either absolute or above a threshold value), the intensity of the positive signals (either absolute or above a selected threshold value), or a combination of both metrics (e.g. , a weighted average).
  • Fig. 6 illustrates an example of a computer system used to execute the software of an embodiment of the present invention.
  • a computer system 100 includes a monitor 102, screen 104, cabinet 106, keyboard 108, and mouse 110.
  • Mouse 110 may have one or more buttons such as mouse buttons 112.
  • Cabinet 106 houses a CD-ROM drive 114, a system memory and a hard drive (both shown in
  • FIG. 7 which may be utilized to store and retrieve software programs incorporating computer code that implements the invention, data for use with the invention, and the like.
  • a CD-ROM 116 is shown as an exemplary computer readable storage medium, other computer readable storage media including floppy disks, tape, flash memory, system memory, and hard drives may be utilized.
  • Cabinet 106 also houses familiar computer components (not shown) such as a central processor, system memory, hard disk, and the like.
  • Fig. 7 shows a system block diagram of computer system 100 used to execute the software of an embodiment of the present invention.
  • computer system 100 includes monitor 102 and keyboard 108.
  • Computer system 100 further includes subsystems such as a central processor 120, system memory 122, I/O controller 124, display adapter 126, removable disk 128 (e.g. , CD-ROM drive), fixed disk 130 (e.g. , hard drive), network interface 132, and speaker 134.
  • Other computer systems suitable for use with the present invention may include additional or fewer subsystems.
  • another computer system could include more than one processor 120 (i.e. , a multi-processor system) or a cache memory.
  • Arrows such as 136 represent the system bus architecture of computer system 100. However, these arrows are illustrative of any interconnection scheme serving to link the subsystems. For example, a local bus could be utilized to connect the central processor to the system memory and display adapter.
  • Computer system 100 shown in Fig. 7 is but an example of a computer system suitable for use with the present invention. Other configurations of subsystems suitable for use with the present invention will be readily apparent to one of ordinary skill in the art.
  • Fig. 8 shows a flowchart of a process of monitoring the expression of a gene.
  • the process compares hybridization intensities of pairs of perfect match and mismatch probes that are preferably covalently attached to the surface of a substrate or chip.
  • the nucleic acid probes have a density greater than about 60 different nucleic acid probes per 1 cm 2 of the substrate.
  • each mismatch probe includes at least one nucleotide mismatch from a perfect match probe. Accordingly, a mismatch probe and the perfect match probe from which it was derived make up a pair of probes. As mentioned earlier, the nucleotide mismatch is preferably near the center of the mismatch probe.
  • the probe lengths of the perfect match probes are typically chosen to exhibit high hybridization affinity with the target sequence.
  • the nucleic acid probes may be all 20-mers.
  • probes of varying lengths may also be synthesized on the substrate for any number of reasons including resolving ambiguities.
  • the target sequence is typically fragmented, labeled and exposed to a substrate including the nucleic acid probes as described earlier.
  • the hybridization intensities of the nucleic acid probes is then measured and input into a computer system.
  • the computer system may be the same system that directs the substrate hybridization or it may be a different system altogether.
  • any computer system for use with the invention should have available other details of the experiment including possibly the gene name, gene sequence, probe sequences, probe locations on the substrate, and the like.
  • the computer system receives input of hybridization intensities of the multiple pairs of perfect match and mismatch probes at step 202.
  • the hybridization intensities indicate hybridization affinity between the nucleic acid probes and the target nucleic acid (which corresponds to a gene).
  • Each pair includes a perfect match probe that is perfectly complementary to a portion of the target nucleic acid and a mismatch probe that differs from the perfect match probe by at least one nucleotide.
  • the computer system compares the hybridization intensities of the perfect match and mismatch probes of each pair. If the gene is expressed, the hybridization intensity (or affinity) of a perfect match probe of a pair should be recognizably higher than the corresponding mismatch probe. Generally, if the hybridizations intensities of a pair of probes are substantially the same, it may indicate the gene is not expressed. However, the determination is not based on a single pair of probes, the determination of whether a gene is expressed is based on an analysis of many pairs of probes. An exemplary process of comparing the hybridization intensities of the pairs of probes will be described in more detail in reference to Fig. 9.
  • the system After the system compares the hybridization intensity of the perfect match and mismatch probes, the system indicates expression of the gene at step 206.
  • the system may indicate to a user that the gene is either present (expressed), marginal or absent (unexpressed).
  • Fig. 9 shows a flowchart of a process of determining if a gene is expressed utilizing a decision matrix.
  • the computer system receives raw scan data of N pairs of perfect match and mismatch probes.
  • the hybridization intensities are photon counts from a fluorescein labeled target that has hybridized to the probes on the substrate.
  • the hybridization intensity of a perfect match probe will be designed "l ⁇ ” and the hybridization intensity of a mismatch probe will be designed "I ⁇ .
  • Hybridization intensities for a pair of probes is retrieved at step 254.
  • the background signal intensity is subtracted from each of the hybridization intensities of the pair at step 256. Background subtraction may also be performed on all the raw scan data at the same time.
  • the hybridization intensities of the pair of probes are compared to a difference threshold (D) and a ratio threshold (R). It is determined if the difference between the hybridization intensities of the pair (1 ⁇ - 1, ⁇ ) is greater than or equal to the difference threshold AND the quotient of the hybridization intensities of the pair (I pm / ! canal, vol,) is greater than or equal to the ratio threshold.
  • the difference thresholds are typically user defined values that have been determined to produce accurate expression monitoring of a gene or genes. In one embodiment, the difference threshold is 20 and the ratio threshold is 1.2.
  • NPOS is a value that indicates the number of pairs of probes which have hybridization intensities indicating that the gene is likely expressed. NPOS is utilized in a determination of the expression of the gene.
  • NNEG is a value that indicates the number of pairs of probes which have hybridization intensities indicating that the gene is likely not expressed.
  • NNEG like NPOS, is utilized in a determination of the expression of the gene.
  • LR log ratio value
  • IDIF intensity difference value
  • a decision matrix is utilized to indicate if the gene is expressed.
  • the gene expression is indicated as present (expressed), marginal or absent (not expressed).
  • the gene is indicated as expressed if the following expression is true: A and (X or Y) and (Q or R).
  • the gene is indicated as expressed if the following expression is true: B and X and Q.
  • present may be indicated as "P,” marginal as “M” and absent as “A” at step 274.
  • an average of ten times the LRs is computed at step 275. Additionally, an average of the IDIF values for the probes that incremented NPOS and NNEG is calculated. These values may be utilized for quantitative comparisons of this experiments with other experiments.
  • Quantitative measurements may be performed at step 276.
  • the current experiment may be compared to a previous experiment (e.g. , utilizing values calculated at step 270). Additionally, the experiment may be compared to hybridization intensities of RNA (such as from bacteria) present in the biological sample in a known quantity. In this manner, one may verify the correctness of the gene expression indication or call, modify threshold values, or perform any number of modifications of the preceding.
  • RNA such as from bacteria
  • Fig. 9 was described in reference to a single gene. However, the process may be utilized on multiple genes in a biological sample. Therefore, any discussion of the analysis of a single gene is not an indication that the process may not be extended to processing multiple genes.
  • Figs. IOA and 10B show the flow of a process of determining the expression of a gene by comparing baseline scan data and experimental scan data.
  • the baseline scan data may be from a biological sample where it is known the gene is expressed.
  • this scan data may be compared to a different biological sample to determine if the gene is expressed.
  • it may be determined how the expression of a gene or genes changes over time in a biological organism.
  • the computer system receives raw scan data of N pairs of perfect match and mismatch probes from the baseline.
  • the hybridization intensity of a perfect match probe from the baseline will be designed "I pm " and the hybridization intensity of a mismatch probe from the baseline will be designed "I TM ,.”
  • the background signal intensity is subtracted from each of the hybridization intensities of the pairs of baseline scan data at step 304.
  • the computer system receives raw scan data of N pairs of perfect match and mismatch probes from the experimental biological sample.
  • the hybridization intensity of a perfect match probes from the experiment will be designed “J pn ,” and the hybridization intensity of a mismatch probe from the experiment will be designed “J ⁇ . "
  • the background signal intensity is subtracted from each of the hybridization intensities of the pairs of experimental scan data at step 308.
  • the hybridization intensities of an I and J pair may be normalized at step 310.
  • the hybridization intensities of the I and J pairs may be divided by the hybridization intensity of control probes as discussed in Section II. A.2.
  • the hybridization intensities of the I and J pair of probes are compared to a difference threshold (DDIF) and a ratio threshold (RDIF). It is determined if the difference between the hybridization intensities of the one pair (J pm - J mm ) and the other pair (I pm - I ⁇ are greater than or equal to the difference threshold AND the quotient of the hybridization intensities of one pair (J pm - ⁇ personally_) and the other pair (1 ⁇ - 1, ⁇ ) are greater than or equal to the ratio threshold.
  • NINC is incremented at step 314.
  • NINC is a value that indicates the experimental pair of probes indicates that the gene expression is likely greater (or increased) than the baseline sample.
  • NINC is utilized in a determination of whether the expression of the gene is greater (or increased), less (or decreased) or did not change in the experimental sample compared to the baseline sample.
  • NDEC is incremented.
  • NDEC is a value that indicates the experimental pair of probes indicates that the gene expression is likely less (or decreased) than the baseline sample. NDEC is utilized in a determination of whether the expression of the gene is greater (or increased), less (or decreased) or did not change in the experimental sample compared to the baseline sample.
  • the values NPOS, NNEG and LR are calculated for each pair of probes. These values are calculated as discussed above in reference to Fig. 9. A suffix of either "B” or “E” has been added to each value in order to indicate if the value denotes the baseline sample or the experimental sample, respectively. If there are next pairs of hybridization intensities at step 322, they are processed in a similar manner as shown.
  • an absolute decision computation is performed for both the baseline and experimental samples at step 324.
  • the absolute decision computation is an indication of whether the gene is expressed, marginal or absent in each of the baseline and experimental samples. Accordingly, in a preferred embodiment, this step entails performing steps 272 and 274 from Fig. 9 for each of the samples. This being done, there is an indication of gene expression for each of the samples taken alone.
  • a decision matrix is utilized to determine the difference in gene expression between the two samples.
  • This decision matrix utilizes the values, N, NPOSB, NPOSE, NNEGB, NNEGE, NINC, NDEC, LRB, and LRE as they were calculated above.
  • the decision matrix performs different calculations depending on whether NINC is greater than or equal to NDEC. The calculations are as follows.
  • P2 NINC / N
  • P3 ((NPOSE - NPOSB) - (NNEGE - NNEGB)) / N
  • P4 10 * SUM(LRE - LRB) / N
  • P values in this case indicate the same ranges and will not be repeated for the sake of brevity.
  • the ranges generally indicate different changes in the gene expression between the two samples as shown below.
  • the gene expression change is indicated as decreased, marginal decrease or no change.
  • the following is a summary of the gene expression indications:
  • the IDIFB and IDIFE are calculated as the sum of all the IDIFs for each sample divided by N.
  • step 328 values for quantitative difference evaluation are calculated. An average of ((J pm - J, ⁇ ) - (I pm - 1, ⁇ )) for each of the pairs is calculated. Additionally, a quotient of the average of J pm - J.. ⁇ and the average of I pm - 1 ⁇ is calculated. These values may be utilized to compare the results with other experiments in step 330.
  • the methods of this invention may be used to monitor expression levels of a gene in a wide variety of contexts.
  • the drug will be administered to an organism, a tissue sample, or a cell.
  • Nucleic acids from the tissue sample, cell, or a biological sample from the organism and from an untreated organism tissue sample or cell are isolated as described above, hybridized to a high density probe array containing probes directed to the gene of interest and the expression levels of that gene are determined as described above.
  • a disease marker e.g. , P53, RTK, or HER2
  • comparison of the expression levels of the disease marker in the sample to disease markers from a healthy organism will reveal any deviations in the expression levels of the marker in the test sample as compared to the healthy sample. Correlation of such deviations with a pathological condition provides a diagnostic assay for that condition.
  • Example 1 First Generation Oligonucleotide Arrays Designed to Measure mRNA Levels for a Small Number of Murine Cvtokines.
  • RNA derived from the T10 cell line provided a good total RNA baseline mixture suitable for spiking with known quantities of RNA from the particular target genes.
  • mRNA derived from the 2D6 cell line provided a good positive control providing typical endogenously transcribed amounts of the RNA from the target genes.
  • the T10 cell line (B cells) was derived from the IL-6 dependent murine plasmacytoma line Tl 165 (Nordan et al. (1986) Science 233: 566-569) by selection in the presence of IL-11.
  • To prepare the directional cDNA library total cellular RNA was isolated from T10 cells using RNAStat ⁇ O (Tel-Test B), and poly (A) + RNA was selected using the PolyAtract kit (Promega, Madison, Wisconsin, USA).
  • First and second strand cDNA was synthesized according to Toole et al , (1984) Nature, 312: 342-347, except that 5-methyldeoxycytidine 5 'triphosphate (Pharmacia LKB, Piscataway, New Jersey, USA) was substituted for DCTP in both reactions.
  • IL-10 probes Actin was represented at a frequency of 1:3000, GAPDH at 1 ; 1000, and IL-10 at 1:35,000. Labeled sense and antisense TIO RNA samples were synthesized from NotI and Sfil cut CDNA libraries in in vitro transcription reactions as described above.
  • the 2D6 cell line is a murine IL-12 dependent T cell line developed by Fujiwara et al.
  • Cells were cultured in RPMI 1640 medium with 10% heat inactivated fetal calf serum (JRH Biosciences), 0.05 mM P-mercaptoethanol and recombinant murine IL-12 (100 units/mL, Genetics Institute, Cambridge, Massachusetts, USA).
  • JRH Biosciences heat inactivated fetal calf serum
  • P-mercaptoethanol recombinant murine IL-12 (100 units/mL, Genetics Institute, Cambridge, Massachusetts, USA).
  • cytokine induction cells were preincubated ovemight in IL-12 free medium and then resuspended (IO 6 cells/ml). After incubation for 0, 2, 6 and 24 hours in media containing 5 nM calcium ionophore A23187 (Sigma Chemical Co. , St. Louis Missouri, USA) and 100 nM 4-phorbol-12-myri
  • Labeled 2D6 mRNA was produced by directionally cloning the 2D6 cDNA with ⁇ ZipLox, Notl-Sall arms available from GibcoBRL in a manner similar to T10.
  • the linearized pZll library was transcribed with T7 to generate sense RNA as described above.
  • cytoplasmic RNA was extracted from cells by the method of Favaloro et al. , (1980) Meth. Enzym. , 65: 718-749, and poly (A) + RNA was isolated with an oligo dT selection step (PolyAtract, Promega, ). RNA was amplified using a modification of the procedure described by Eberwine et al. (1992) Proc. Natl. Acad. Sci. USA, 89: 3010-3014 (see also Van Gelder et al (1990) Science 87: 1663-1667).
  • RNA concentration was calculated using the conventional conversion that 1 OD is equivalent to 40 ⁇ g of RNA, and that 1 ⁇ g of cellular mRNA consists of 3 pmoles of RNA molecules.
  • mRNA was labeled directly by UV-induced crosslinking to a psoralen derivative linked to biotin (Schleicher & Schuell).
  • a high density array of 20 mer oligonucleotide probes was produced using VLSIPS technology.
  • the high density array included the oligonucleotide probes as listed in Table 2.
  • a central mismatch control probe was provided for each gene- specific probe resulting in a high density array containing over 16,000 different oligonucleotide probes.
  • Bacterial gene (sample Bio B 286 preparation/amplification control)
  • the high density array was synthesized on a planar glass slide.
  • the RNA transcribed from cDNA was hybridized to the high density oligonucleotide probe array(s) at low stringency and then washed under more stringent conditions.
  • the hybridization solutions contained 0.9 M NaCl, 60 mM NaH 2 PO 4 , 6 mM EDTA and 0.005 % Triton X-100 , adjusted to pH 7.6 (referred to as 6x SSPE-T).
  • the solutions contained 0.5 mg/ml unlabeled, degraded herring sperm DNA (Sigma Chemical Co., St. Louis, Missouri, USA).
  • RNA samples Prior to hybridization, RNA samples were heated in the hybridization solution to 9 "C for 10 minutes, placed on ice for 5 minutes, and allowed to equilibrate at room temperature before being placed in the hybridization flow cell, Following hybridization, the solution was removed, the arrays were washed with 6xSSPE-T at 22 °C for 7 minutes, and then washed with 0.5x SSPE-T at 40°C for 15 minutes.
  • the hybridized RNA was stained with a streptavidin-phycoerythrin conjugate (Molecular Probes, Inc. , Eugene, Oregon, USA) prior to reading.
  • Hybridized arrays were stained with 2 ⁇ g/ml streptavidinphycoerythrin in 6xSSPE-T at 40°C for 5 minutes.
  • the arrays were read using scanning confocal microscope (Molecular Dynamics, Sunnyvale, California, USA) modified for the purpose.
  • the scanner uses an argon ion laser as the excitation source, and the emission was detected with a photomultiplier tube through either a 530 nm bandpass filter (fluorescein) or a 560 nm longpass filter (phycoerythrin).
  • Nucleic acids of either sense or antisense orientations were used in hybridization experiments. Arrays with for either orientation (reverse complements of each other) were made using the same set of photolithographic masks by reversing the order of the photochemical steps and inco ⁇ orating the complementary nucleotide.
  • the quantitative analysis of the hybridization results involved counting the instances in which the perfect match probe (PM) was brighter than the corresponding mismatch probe (MM), averaging the differences (PM minus MM) for each probe family (i.e. , probe collection for each gene), and comparing the values to those obtained in a side-by-side experiment on an identically synthesized array with an unspiked sample (if applicable).
  • the advantage of the difference method is that signals from random cross hybridization contribute equally, on average, to the PM and MM probes while specific hybridization contributes more to the PM probes. By averaging the pairwise differences, the real signals add constructively while the contributions from cross hybridization tend to cancel.
  • the high density array of oligonucleotide probes was hybridized with the mixture of labeled RNAs transcribed from each of the target genes. Fluorescence intensity at each location on the high density array was determined by scanning the high density array with a laser illuminated scanning confocal fluorescence microscope connected to a data acquisition system.
  • Probes were then selected for further data analysis in a two-step procedure. First, in order to be counted, the difference in intensity between a probe and its corresponding mismatch probe had to exceed a threshold limit (50 counts, or about half background, in this case). This eliminated from consideration probes that did not hybridize well and probes for which the mismatch control hybridizes at an intensity comparable to the perfect match.
  • a threshold limit 50 counts, or about half background, in this case
  • the high density array was hybridized to a labeled RNA sample which, in principle, contains none of the sequences on the high density array.
  • the oligonucleotide probes were chosen to be complementary to the sense RNA.
  • an anti-sense RNA population should have been incapable of hybridizing to any of the probes on the array. Where either a probe or its mismatch showed a signal above a threshold value (100 counts above background) it was not included in subsequent analysis.
  • the signal for a particular gene was counted as the average difference (perfect match - mismatch control) for the selected probes for each gene.
  • the initial arrays contained more than 16,000 probes that were complementary to 12 murine mRNAs - 9 cytokines, 1 cytokine receptor, 2 constitutively expressed genes (5-actin and glyceraldehyde 3-phosphate dehydrogenase) - 1 rat cytokine and 1 bacterial gene (E. coli biotin synthetase, bioB) which serves as a quantitation reference.
  • the initial experiments with these relatively simple arrays were designed to determine whether short in situ synthesized oligonucleotides can be made to hybridize with sufficient sensitivity and specificity to quantitatively detect RNAs in a complex cellular RNA population.
  • the oligonucleotide arrays contained collections of pairs of probes for each of the RNAs being monitored. Each probe pair consisted of a 20-mer that was perfectly complementary (referred to as a perfect match, or PM probe) to a subsequence of a particular message, and a companion that was identical except for a single base difference in a central position.
  • PM probe perfect match
  • MM mismatch
  • RNA target samples were prepared from individual clones, cloned CDNA libraries, or directly from cellular mRNA as described above.
  • Target RNA for array hybridization was prepared by incorporating fluorescently labeled ribonucleotides in an in vitro transcription (IVT) reaction and then randomly fragmenting the RNA to an average size of 30 - 100 bases.
  • IVT in vitro transcription
  • Samples were hybridized to arrays in a self-contained flow cell (volume " 200 ⁇ L) for times ranging from 30 minutes to 22 hours. Fluorescence imaging of the arrays was accomplished with a scanning confocal microscope (Molecular Dynamics). The entire array was read at a resolution of 11.25 ⁇ m ( ⁇ 80-fold oversampling in each of the 100 x 100 ⁇ m synthesis regions) in less than 15 minutes, yielding a rapid and quantitative measure of each of the individual hybridization reactions.
  • the high density array described above was hybridized with 50 pM of the RNA sense strand of IL-2, IL-3, IL- 4, IL-6, Actin, GAPDH and Bio B or IL-10, IL-12p40, GM-CSF, IFN- ⁇ , TNF- ⁇ , mCTLA8 and Bio B.
  • the hybridized array showed strong specific signals for each of the test target nucleic acids with minimal cross hybridization.
  • RNA targets were spiked into labeled RNA derived from a representative cDNA library made from the murine B cell line TIO.
  • TIO murine B cell line
  • the spiked sample was treated to a series of procedures to mitigate differences between the library RNA and the added RNA.
  • the "spike” was added to the sample which was then heated to 37 G C and annealed. The sample was then frozen, thawed, boiled for 5 minutes, cooled on ice and allowed to return to room temperature before performing the hybridization.
  • Figure 2 A shows the results of an experiment in which 13 target RNAS were spiked into the total RNA pool at a level of 1:3000 (equivalent to a few hundred copies per cell). RNA frequencies are given as the molar amount of an individual RNA per mole of total RNA.
  • Figure 2B shows a small portion of the array (the boxed region of 2A) containing probes specific for interleukin-2 and interleukin-3 (IL-2 and IL-3,) RNA, and Figure 2C shows the same region in the absence of the spiked targets.
  • IL-2 and IL-3 interleukin-3
  • the hybridization signals are specific as indicated by the comparison between the spiked and unspiked images, and perfect match (PM) hybridizations are well discriminated from missmatches (MM) as shown by the pattem of alternating brighter rows (corresponding to PM probes) and darker rows (corresponding to MM probes).
  • PM perfect match
  • MM missmatches
  • the observed variation among the different perfect match hybridization signals was highly reproducible and reflects the sequence dependence of the hybridizations.
  • the perfect match (PM) probe was not significantly brighter than its mismatch (MM) partner because of cross-hybridization with other members of the complex RNA population. Because the pattems are highly reproducible and because detection does not depend on only a single. probe per RNA, infrequent cross hybridization of this type did not preclude sensitive and accurate detection of even low level RNAS.
  • FIG. 3 shows the results of experiments in which the ten cytokine RNAs were spiked together into 0.05 mg/ml of labeled RNA from the B cell (TIO) cDNA library at levels ranging from 1:300 to 1 :300,000.
  • TIO B cell
  • 1:300,000 is that of an mRNA present at less than a few copies per cell.
  • a frequency of 1 :300,000 corresponds to a concentration of approximately 0.5 picomolar and 0.1 femptomole ( " 6 x IO 7 molecules or about 30 picograms)of specific RNA.
  • Hybridizations were carried out in parallel at 40 °C for 15 to 16 hours.
  • the presence of each of the 10 cytokine RNAs was reproducibly detected above the background even at the lowest frequencies. Furthermore, the hybridization intensity was linearly related to RNA target concentration between 1 :300,000 and 1 :3000 ( Figure 3). Between 1:3000 and 1:300, the signals increased by a factor of 4 - 5 rather than 10 because the probe sites were beginning to saturate at the higher concentrations in the course of a 15 hour hybridization. The linear response range can be extended to higher concentrations by reducing the hybridization time. Short and long hybridizations can be combined to quantitatively cover more than a KX'-fold range in RNA concentration.
  • RNA samples were prepared that contained 0.05 mg/ml of sense RNA transcribed from the murine B cell CDNA library, plus combinations of the 10 cytokine RNAs each at a different concentration. Individual cytokine RNAs were spiked at one of the following levels: 0, 1 :300,000, 1 :30,000, 1:3000, or 1:300. The four samples plus an unspiked reference were hybridized to separate arrays for 15 hours at 40° C.
  • RNA target was determined by the patte of hybridization and how it differed from that of the unspiked reference, and the concentrations were detected by the intensities.
  • concentrations of each of the ten cytokines in the four blind samples were correctly determined, with no false positives or false negatives.
  • IL- 10 is expressed in the mouse B cells used to make the CDNA library, and was known to be present in the library at a frequency of 1:60,000 to 1:30,000.
  • an additional amount of IL-10 RNA (corresponding to a frequency of 1:300,000) was spiked into the sample.
  • the amount of the spiked IL-10 RNA was correctly determined, even though it represented an increase of only 10 - 20% above the intrinsic level.
  • the high density arrays of this invention were next used to monitor cytokine MRNA levels in murine T cells at different times following a biochemical stimulus.
  • Cells from the murine T helper cell line (2D6) were treated with the phorbol ester 4-phorbol-12-myristate 13-acetate (PMA) and a calcium ionophore.
  • PMA phorbol ester 4-phorbol-12-myristate 13-acetate
  • Poly (A) + MRNA was then isolated at 0, 2, 6 and 24 hours after stimulation.
  • Isolated mRNA (approximately 1 ⁇ g) was converted to labeled antisense RNA using a procedure that combines a double-stranded cDNA synthesis step with a subsequent in vitro transcription reaction. This RNA synthesis and labeling procedure amplifies the entire mRNA population by 20 to 50-fold in an apparently unbiased and reproducible fashion (Table 2).
  • the labeled antisense T-cell RNA from the four time points was then hybridized to DNA probe arrays for 2 and 22 hours.
  • a large increase in the ⁇ -interferon mRNA level was observed, along with significant changes in four other cytokine mRNAs (IL-3, IL-10, GM-CSF and TNF ⁇ ).
  • the cytokine messages were not induced with identical kinetics. Changes in cytokine mRNA levels of less than 1: 130,000 were unambiguously detected along with the very large changes observed for ⁇ -interferon.
  • RNA levels from the hybridization results is direct, with no additional control hybridizations, sample manipulation, amplification, cloning or sequencing.
  • the method is also efficient. Using current protocols, instrumentation and analysis software, a single user with a single scanner can read and analyze as many as 30 arrays in a day.
  • Figure 5 shows an array that contains over 65,000 different oligonucleotide probes (50 ⁇ m feature size) following hybridization with an entire murine B cell RNA population. Arrays of this complexity were read at a resolution of 7.5 lim in less than fifteen minutes. The array contains probes for 118 genes including 12 murine genes represented on the simpler array described above, 35 U.S.C. ⁇ 102() additional murine genes, three bacterial genes and one phage gene. There are approximately 300 probe pairs per gene, with the probes chosen using the selection rules described herein. The probes were chosen from the 600 bases of sequence at the 3' end of the translated region of each gene.
  • RNA samples from the T cell induction experiments were hybridized to these more complex 118-gene arrays, and similar results were obtained for the set of genes in common to both chip types. Expression changes were unambiguously observed for more than 20 other genes in addition to those shown in Figure 4.
  • hybridization results from the 118 gene chip were analyzed using ten different subsets of 20 probe pairs per gene. That is to say, the data were analyzed as if the arrays contained only 20 probe pairs per gene. The ten subsets of 20 pairs were chosen from the approximately 300 probe pairs per gene on the arrays. The initial probe selection was made utilizing the probe selection and pruning algorithms described above. The ten subjects of 20 pairs were then randomly chosen from those probes that survived selection and pruning. Labeled RNAs were spiked into the murine B cell RNA population at levels of 1:25,000, 1 :50,000 and 1 : 100,000.
  • Example 4 Scale Up tn Thousands of Genes
  • This high density array was successfully hybridized to a cDNA library using essentially the protocols described above.
  • Similar sets of high density arrays containing oligonucleotide probes to every known expressed sequence tag (EST) are in preparation
  • Example 5 Direct Scale up for the Simultaneous Monitoring of Tens of Thousands of RNAs.
  • RNAs monitored can be increased greatly by decreasing the number of probes per RNA and increasing the number of probes per array.
  • arrays containing as many as 400,000 probes in an area of 1.6 cm 2 (20 x 20 ⁇ m synthesis features) are currently synthesized and read.
  • Using 20 probe pairs per gene allows 10,000 genes to be monitored on a single array while maintaining the important advantages of probe redundancy.
  • a set of four such arrays could cover the more than 40,000 human genes for which there are expressed sequence tags (ESTS) in the public data bases, and new ESTs can be incorporated as they become available.
  • ESTS expressed sequence tags
  • a neural net can be trained to predict the hybridization and cross hybridization intensities of a probe based on the sequence of bases in the probe, or on other probe properties. The neural net can then be used to pick an arbitrary number ofthe "best" probes. When a neural net was trained to do this it produced a moderate (0 7) correlation between predicted intensity and measured intensity, with a better model for cross hybridization than hybridization
  • a ⁇ Input/output mapping The neural net was trained to identify the hybridization properties of 20-mer probes
  • the 20-mer probes were mapped to an eighty bit long input vector, with the first four bits representing the base in the first position ofthe probe, the next four bits representing the base in the second position, etc
  • the four bases were encoded as follows A 1000
  • the neural network produced two outputs, hybridization intensity, and crosshybridization intensity
  • the output was scaled linearly so that 95% ofthe outputs from the actual experiments fell in the range 0 to 1
  • the neural net was a backpropagation network with 80 input neurons, one hidden layer of 20 neurons, and an output layer of two neurons
  • Neural Works Professional 2 5 for a backprop network (Neural Works Professional is a product of NeuralWare, Pittsburgh Pennsylvania, USA)
  • the training set consisted of approximately 8000 examples of probes, and the associated hybridization and crosshybridization intensities P) Neural net weights,
  • Neural net weights are provided in two matrices; an 81 x 20 matrix (Table 3) (weights_l) and a 2 x 20 matrix Table 4 (weights_2).
  • Code for running the neural net is provided below in Table 5 (neural n.c) and Table 6 (lin alg.c). Table 5. Code for running the neural net (neural_n c)
  • #include ⁇ mem h> include "des_util h"
  • MaxNumLines (20) #define MaxLineSize (1024) short readNeuralNetWeights(matrix local *weightsl, matrix local *weights2
  • copiedLength > (MaxNumLines * MaxLineSize

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US1996/014839 1989-06-07 1996-09-13 Expression monitoring by hybridization to high density oligonucleotide arrays Ceased WO1997010365A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
HK98115957.2A HK1015416B (en) 1995-09-15 1996-09-13 Expression monitoring by hybridization to high density oligonucleotide arrays
JP9512174A JPH11512293A (ja) 1995-09-15 1996-09-13 高密度オリゴヌクレオチドアレーに対するハイブリダイゼーションによる発現モニター
EP96931598A EP0853679B1 (en) 1995-09-15 1996-09-13 Expression monitoring by hybridization to high density oligonucleotide arrays
AT96931598T ATE231559T1 (de) 1995-09-15 1996-09-13 Expressionsnachweis durch hybridisierung an oligonukleotidarrays hoher belegungsdichte
DE69625920T DE69625920T2 (de) 1995-09-15 1996-09-13 Expressionsnachweis durch hybridisierung an oligonukleotidarrays hoher belegungsdichte
AU70734/96A AU7073496A (en) 1995-09-15 1996-09-13 Expression monitoring by hybridization to high density oligonucleotide arrays
US08/772,376 US6309822B1 (en) 1989-06-07 1996-12-23 Method for comparing copy number of nucleic acid sequences
US10/367,708 US20030186296A1 (en) 1989-06-07 2003-02-19 Expression monitoring by hybridization to high density oligonucleotide arrays
US10/438,534 US20030220748A1 (en) 1994-10-21 2003-05-15 Computer-aided techniques for analyzing biological sequences
US11/406,531 US20080227653A1 (en) 1989-06-07 2006-04-19 Expression monitoring by hybridization to high density oligonucleotide arrays

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US08/529,115 1995-09-15
US08/529,115 US6040138A (en) 1995-09-15 1995-09-15 Expression monitoring by hybridization to high density oligonucleotide arrays

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US08/531,137 Continuation-In-Part US5974164A (en) 1994-10-21 1995-10-16 Computer-aided visualization and analysis system for sequence evaluation

Related Child Applications (4)

Application Number Title Priority Date Filing Date
US08/529,115 A-371-Of-International US6040138A (en) 1989-06-07 1995-09-15 Expression monitoring by hybridization to high density oligonucleotide arrays
US08/772,376 Continuation-In-Part US6309822B1 (en) 1989-06-07 1996-12-23 Method for comparing copy number of nucleic acid sequences
US08/828,952 Continuation-In-Part US6600996B2 (en) 1994-10-21 1997-03-28 Computer-aided techniques for analyzing biological sequences
US10/438,534 Continuation-In-Part US20030220748A1 (en) 1994-10-21 2003-05-15 Computer-aided techniques for analyzing biological sequences

Publications (1)

Publication Number Publication Date
WO1997010365A1 true WO1997010365A1 (en) 1997-03-20

Family

ID=24108589

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/014839 Ceased WO1997010365A1 (en) 1989-06-07 1996-09-13 Expression monitoring by hybridization to high density oligonucleotide arrays

Country Status (8)

Country Link
US (6) US6040138A (https=)
EP (1) EP0853679B1 (https=)
JP (1) JPH11512293A (https=)
AT (1) ATE231559T1 (https=)
AU (1) AU7073496A (https=)
CA (1) CA2232047A1 (https=)
DE (1) DE69625920T2 (https=)
WO (1) WO1997010365A1 (https=)

Cited By (355)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998020161A1 (en) * 1996-11-06 1998-05-14 Smithkline Beecham Corporation Methods for identifying genes essential to the growth of an organism
WO1998058052A3 (en) * 1997-06-19 1999-06-10 Incyte Pharma Inc Disease associated protein kinases
WO1999032660A1 (en) * 1997-12-19 1999-07-01 Affymetrix Exploiting genomics in the search for new drugs
WO1999037817A1 (en) * 1998-01-26 1999-07-29 Schering Aktiengesellschaft Gene expression methods for screening compounds
WO1999049774A2 (en) 1998-03-31 1999-10-07 Genzyme Corporation Methods for the diagnosis and treatment of lung cancer
US5965352A (en) * 1998-05-08 1999-10-12 Rosetta Inpharmatics, Inc. Methods for identifying pathways of drug action
US6013440A (en) * 1996-03-11 2000-01-11 Affymetrix, Inc. Nucleic acid affinity columns
WO1999048916A3 (en) * 1998-03-27 2000-01-20 Univ Leland Stanford Junior Hypoxia-inducible human genes, proteins, and uses thereof
WO2000004188A3 (en) * 1998-07-15 2000-05-18 Chiron Corp Methods and compositions for comparing and normalizing assays
US6083697A (en) * 1996-11-14 2000-07-04 Affymetrix, Inc. Chemical amplification for the synthesis of patterned arrays
WO2000039580A1 (en) * 1998-12-23 2000-07-06 University Of Sydney An assay to detect a binding partner
EP1026260A1 (en) * 1999-02-02 2000-08-09 VYSIS, Inc. Simultaneous measurement of gene expression and genomic abnormalities using nucleic acid microarrays
US6110426A (en) * 1994-06-17 2000-08-29 The Board Of Trustees Of The Leland Stanford Junior University Methods for fabricating microarrays of biological samples
US6132969A (en) * 1998-06-19 2000-10-17 Rosetta Inpharmatics, Inc. Methods for testing biological network models
WO2000022093A3 (en) * 1998-09-23 2000-11-23 Cleveland Clinic Foundation Novel interferon stimulated and repressed genes
WO2000077257A1 (en) * 1999-06-11 2000-12-21 Clingenix, Inc. Gene specific arrays and the use thereof
US6165709A (en) * 1997-02-28 2000-12-26 Fred Hutchinson Cancer Research Center Methods for drug target screening
US6185561B1 (en) 1998-09-17 2001-02-06 Affymetrix, Inc. Method and apparatus for providing and expression data mining database
US6187535B1 (en) 1998-02-18 2001-02-13 Institut Pasteur Fast and exhaustive method for selecting a prey polypeptide interacting with a bait polypeptide of interest: application to the construction of maps of interactors polypeptides
US6197517B1 (en) 1999-05-21 2001-03-06 Rosetta Inpharmatics, Inc. Essential genes of yeast as targets for antifungal agents, herbicides, insecticides and anti-proliferative drugs
US6200803B1 (en) 1999-05-21 2001-03-13 Rosetta Inpharmatics, Inc. Essential genes of yeast as targets for antifungal agents, herbicides, insecticides and anti-proliferative drugs
US6203987B1 (en) 1998-10-27 2001-03-20 Rosetta Inpharmatics, Inc. Methods for using co-regulated genesets to enhance detection and classification of gene expression patterns
US6203989B1 (en) 1998-09-30 2001-03-20 Affymetrix, Inc. Methods and compositions for amplifying detectable signals in specific binding assays
WO2001023614A1 (en) * 1999-09-28 2001-04-05 Affymetrix, Inc. Methods and computer software products for multiple probe gene expression analysis
US6222093B1 (en) 1998-12-28 2001-04-24 Rosetta Inpharmatics, Inc. Methods for determining therapeutic index from gene expression profiles
US6221597B1 (en) 1999-05-21 2001-04-24 Rosetta Inpharmatics, Inc. Essential genes of yeast as targets for antifungal agents, herbicides, insecticides and anti-proliferative drugs
US6225047B1 (en) 1997-06-20 2001-05-01 Ciphergen Biosystems, Inc. Use of retentate chromatography to generate difference maps
US6229911B1 (en) 1997-07-25 2001-05-08 Affymetrix, Inc. Method and apparatus for providing a bioinformatics database
US6232066B1 (en) 1997-12-19 2001-05-15 Neogen, Inc. High throughput assay system
US6238869B1 (en) 1997-12-19 2001-05-29 High Throughput Genomics, Inc. High throughput assay system
US6262216B1 (en) 1998-10-13 2001-07-17 Affymetrix, Inc. Functionalized silicon compounds and methods for their synthesis and use
US6300063B1 (en) 1995-11-29 2001-10-09 Affymetrix, Inc. Polymorphism detection
WO2001023426A3 (en) * 1999-09-30 2001-11-01 Varian Associates Hypoxia-related human genes, proteins, and uses thereof
US6326489B1 (en) 1997-08-05 2001-12-04 Howard Hughes Medical Institute Surface-bound, bimolecular, double-stranded DNA arrays
WO2000055370A3 (en) * 1999-03-15 2002-01-10 Vistagen Inc Bar coding and indentifying nucleic acids using a limited number of probes and low stringency conditions
WO2002002804A1 (en) * 2000-06-30 2002-01-10 Aros Applied Biotechnology Aps Gene expression in biological conditions
US6346423B1 (en) 1999-07-16 2002-02-12 Agilent Technologies, Inc. Methods and compositions for producing biopolymeric arrays
WO2000065095A3 (en) * 1999-04-23 2002-02-21 Clontech Lab Inc Methods and compositions for performing array based hybridization assays
US6370478B1 (en) 1998-12-28 2002-04-09 Rosetta Inpharmatics, Inc. Methods for drug interaction prediction using biological response profiles
WO2001042512A3 (en) * 1999-11-24 2002-07-04 Incyte Genomics Inc Normalization controls and duplex probes for quantitative hybridization reactions
US6420108B2 (en) 1998-02-09 2002-07-16 Affymetrix, Inc. Computer-aided display for comparative gene expression
US6432360B1 (en) 1997-10-10 2002-08-13 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6453241B1 (en) 1998-12-23 2002-09-17 Rosetta Inpharmatics, Inc. Method and system for analyzing biological response signal data
US6468476B1 (en) 1998-10-27 2002-10-22 Rosetta Inpharmatics, Inc. Methods for using-co-regulated genesets to enhance detection and classification of gene expression patterns
US6485944B1 (en) 1997-10-10 2002-11-26 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6489096B1 (en) 1998-10-15 2002-12-03 Princeton University Quantitative analysis of hybridization patterns and intensities in oligonucleotide arrays
US6489159B1 (en) 1998-01-07 2002-12-03 Clontech Laboratories, Inc. Polymeric arrays and methods for their use in binding assays
US6498245B2 (en) 1999-11-29 2002-12-24 Nisshinbo Industries, Inc. Nucleic acid-immobilized substrate
EP1186673A3 (en) * 2000-09-11 2003-03-26 Agilent Technologies, Inc. (a Delaware corporation) Calibration of molecular array data
US6548021B1 (en) 1997-10-10 2003-04-15 President And Fellows Of Harvard College Surface-bound, double-stranded DNA protein arrays
US20030096232A1 (en) 1997-12-19 2003-05-22 Kris Richard M. High throughput assay system
US6656682B1 (en) 1999-06-21 2003-12-02 Nisshinbo Industries, Inc. Nucleic acid-immobilized substrate
EP1041385A3 (en) * 1999-03-30 2004-01-02 Fuji Photo Film Co., Ltd. Method and apparatus for detecting an organism-originated substance
US6716579B1 (en) 1999-06-11 2004-04-06 Narayan Baidya Gene specific arrays, preparation and use
US6725230B2 (en) * 2000-07-18 2004-04-20 Aegis Analytical Corporation System, method and computer program for assembling process data of multi-database origins using a hierarchical display
EP1418244A1 (en) * 1997-12-19 2004-05-12 Affymetrix, Inc. Exploiting genomics in the search for new drugs
WO2004044236A1 (en) 2002-11-14 2004-05-27 Genomics Research Partners Pty Ltd Status determination
EP1285089A4 (en) * 2000-04-25 2004-07-07 Affymetrix Inc METHODS FOR MONITORING THE EXPRESSION OF ALTERNATIVE SPLICE GENES
GB2397376A (en) * 2000-02-04 2004-07-21 Aeomica Inc Human genome-derived single exon nucleic acid probes for analysis of gene expression in human heart
US6800439B1 (en) 2000-01-06 2004-10-05 Affymetrix, Inc. Methods for improved array preparation
US6801859B1 (en) 1998-12-23 2004-10-05 Rosetta Inpharmatics Llc Methods of characterizing drug activities using consensus profiles
US6806361B1 (en) 2000-03-17 2004-10-19 Affymetrix, Inc. Methods of enhancing functional performance of nucleic acid arrays
EP1086205A4 (en) * 1998-06-19 2004-11-17 Rosetta Inpharmatics Inc METHOD FOR MONITORING DISEASE CONDITIONS AND THERAPIES USING GENE EXPRESSION PROFILES
US6824866B1 (en) 1999-04-08 2004-11-30 Affymetrix, Inc. Porous silica substrates for polymer synthesis and assays
US6826296B2 (en) 1997-07-25 2004-11-30 Affymetrix, Inc. Method and system for providing a probe array chip design database
GB2378754B (en) * 2000-02-04 2004-12-01 Aeomica Inc Human genome-derived single exon nucleic acid probes useful for analysis of gene expression in human breast and BT 474 cells
US6833450B1 (en) 2000-03-17 2004-12-21 Affymetrix, Inc. Phosphite ester oxidation in nucleic acid array preparation
US6844433B2 (en) 1998-07-31 2005-01-18 Affymetrix, Inc. Nucleic acid labeling compounds
US6846635B1 (en) 1999-07-30 2005-01-25 Large Scale Proteomics Corp. Microarrays and their manufacture
US6849462B1 (en) 1991-11-22 2005-02-01 Affymetrix, Inc. Combinatorial strategies for polymer synthesis
EP1060395A4 (en) * 1998-02-04 2005-02-09 Invitrogen Corp MICROSYSTEMS AND THEIR IMPLEMENTATION
US6858711B2 (en) 1996-01-23 2005-02-22 Affymetrix, Inc. Labeling reagents
US6864050B2 (en) 1999-07-30 2005-03-08 Affymetrix, Inc. Single-phase amplification of nucleic acids
US6864059B2 (en) 1996-01-23 2005-03-08 Affymetrix, Inc. Biotin containing C-glycoside nucleic acid labeling compounds
US6887665B2 (en) 1996-11-14 2005-05-03 Affymetrix, Inc. Methods of array synthesis
US6913882B2 (en) 1999-12-22 2005-07-05 Affymetrix, Inc. Methods of screening for B cell activity modulators
US6919211B1 (en) 1989-06-07 2005-07-19 Affymetrix, Inc. Polypeptide arrays
WO2005012574A3 (en) * 2003-04-29 2005-08-04 Genvault Corp Biological bar-code
US6927032B2 (en) 1995-09-15 2005-08-09 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US6950752B1 (en) 1998-10-27 2005-09-27 Rosetta Inpharmatics Llc Methods for removing artifact from biological profiles
US6953663B1 (en) 1995-11-29 2005-10-11 Affymetrix, Inc. Polymorphism detection
US6955915B2 (en) 1989-06-07 2005-10-18 Affymetrix, Inc. Apparatus comprising polymers
US6965020B2 (en) 1996-01-23 2005-11-15 Affymetrix, Inc. Nucleic acid labeling compounds
WO2005111246A1 (en) * 2004-05-11 2005-11-24 Wyeth Oligonucleotide arrays to monitor gene expression and methods for making and using same
US6969589B2 (en) 2001-03-30 2005-11-29 Perlegen Sciences, Inc. Methods for genomic analysis
WO2005118806A2 (en) 2004-05-28 2005-12-15 Ambion, Inc. METHODS AND COMPOSITIONS INVOLVING MicroRNA
WO2005111242A3 (en) * 2004-05-10 2006-01-26 Parallele Bioscience Inc Digital profiling of polynucleotide populations
US7005259B1 (en) 2000-06-01 2006-02-28 Affymetrix, Inc. Methods for array preparation using substrate rotation
US7068830B2 (en) 1997-07-25 2006-06-27 Affymetrix, Inc. Method and system for providing a probe array chip design database
WO2005111212A3 (en) * 2004-04-29 2006-08-03 Genvault Corp Biological bar code
US7087732B2 (en) 1989-06-07 2006-08-08 Affymetrix, Inc. Nucleotides and analogs having photoremovable protecting groups
US7091033B2 (en) 2000-07-21 2006-08-15 Phase-1 Molecular Toxicology, Inc. Array of toxicologically relevant canine genes and uses thereof
EP1200820A4 (en) * 1999-07-16 2006-08-23 Rosetta Inpharmatics Inc DEVELOPMENT OF ITERATIVE GENESONES AND DETAILED EXPRESSION PROFILING MINT FLEXIBLE IN-SITU SYNTHESIS ARRAYS
US7115726B2 (en) 2001-03-30 2006-10-03 Perlegen Sciences, Inc. Haplotype structures of chromosome 21
EP1717249A1 (en) 1998-03-12 2006-11-02 Georgetown University Peptides containing a cholesterol recognition sequence and their uses
WO2006007534A3 (en) * 2004-07-01 2006-11-16 Ambion Inc System and method for processing results of a complex genetic test
EP1731620A1 (en) 2005-06-07 2006-12-13 Institut National De La Sante Et De La Recherche Medicale (Inserm) Method for the diagnosis of immune graft tolerance
US7176297B2 (en) 2002-04-08 2007-02-13 Affymetrix, Inc. Photoactivatable silane compounds and methods for their synthesis and use
US7179638B2 (en) 1999-07-30 2007-02-20 Large Scale Biology Corporation Microarrays and their manufacture by slicing
EP1762628A1 (en) 2005-09-13 2007-03-14 Eppendorf Array Technologies SA Detection method of homologous sequences differing by one base on a microarray
EP1690947A3 (en) * 2005-02-14 2007-04-11 Canon Kabushiki Kaisha Base sequence for control probe and method of designing the same
WO2007059839A1 (de) * 2005-11-28 2007-05-31 Advalytix Ag Verfahren, vorrichtung und kit zur untersuchung von makromolekülen in einer probe
WO2006112709A3 (en) * 2005-04-18 2007-07-26 Dsm Ip Assets Bv Biochip and process for the production of a biochip
US7282327B2 (en) 1996-01-23 2007-10-16 Affymetrix, Inc. Nucleic acid labeling compounds
US7291463B2 (en) 1996-01-23 2007-11-06 Affymetrix, Inc. Nucleic acid labeling compounds
US7319933B2 (en) 2003-03-21 2008-01-15 Hoffmann-La Roche Inc. Gene transcription assay method
US7321829B2 (en) 1999-05-19 2008-01-22 Eppendorf Array Technologies (E.A.T.) Method for the identification and/or the quantification of a target compound obtained from a biological sample upon chips
US7323298B1 (en) 1994-06-17 2008-01-29 The Board Of Trustees Of The Leland Stanford Junior University Microarray for determining the relative abundances of polynuceotide sequences
US7329496B2 (en) 1990-12-06 2008-02-12 Affymetrix, Inc. Sequencing of surface immobilized polymers utilizing microflourescence detection
US7335474B2 (en) 2003-09-12 2008-02-26 Perlegen Sciences, Inc. Methods and systems for identifying predisposition to the placebo effect
US7338763B2 (en) 2004-06-02 2008-03-04 Eppendorf Array Technologies S.A. Method and kit for the detection and/or quantification of homologous nucleotide sequences on arrays
US7344831B2 (en) * 1999-07-09 2008-03-18 Agilent Technologies, Inc. Methods for controlling cross-hybridization in analysis of nucleic acid sequences
WO2008036776A2 (en) 2006-09-19 2008-03-27 Asuragen, Inc. Mir-15, mir-26, mir -31,mir -145, mir-147, mir-188, mir-215, mir-216 mir-331, mmu-mir-292-3p regulated genes and pathways as targets for therapeutic intervention
US7363165B2 (en) 2000-05-04 2008-04-22 The Board Of Trustees Of The Leland Stanford Junior University Significance analysis of microarrays
US7378236B1 (en) 1994-06-17 2008-05-27 The Board Of Trustees Of The Leland Stanford Junior University Method for analyzing gene expression patterns
US7413852B2 (en) 1996-12-31 2008-08-19 High Throughput Genomics Multiplexed diagnostic and therapeutics
EP1179180B2 (en) 1999-05-19 2008-08-20 Eppendorf Array Technologies Method for the identification and/or the quantification of a target compound
US7423143B2 (en) 1996-01-23 2008-09-09 Affymetrix. Inc. Nucleic acid labeling compounds
US7468243B2 (en) 2001-03-12 2008-12-23 Affymetrix, Inc. 2-aminopyrimidin-4-one nucleic acid labeling compounds
US7476519B2 (en) * 2002-07-19 2009-01-13 Joseph Monforte Strategies for gene expression analysis
US7498407B2 (en) 2001-11-09 2009-03-03 Georgetown University Vascular endothelial cell growth inhibitor, VEGI-192a
US7537897B2 (en) 2006-01-23 2009-05-26 Population Genetics Technologies, Ltd. Molecular counting
US7608395B2 (en) 2005-09-15 2009-10-27 Baylor Research Institute Systemic lupus erythematosus diagnostic assay
US7632652B2 (en) 2003-06-24 2009-12-15 Ventana Medical Systems, Inc. Enzyme-catalyzed metal deposition for the enhanced in situ detection of immunohistochemical epitopes and nucleic acid sequences
US7642064B2 (en) 2003-06-24 2010-01-05 Ventana Medical Systems, Inc. Enzyme-catalyzed metal deposition for the enhanced detection of analytes of interest
US7691330B1 (en) 1991-11-22 2010-04-06 Affymetrix, Inc. Combinatorial strategies for polymer synthesis
WO2010062706A2 (en) 2008-10-30 2010-06-03 Caris Mpi, Inc. Methods for assessing rna patterns
WO2010096658A1 (en) 2009-02-19 2010-08-26 The Cleveland Clinic Foundation Corin as a marker for heart failure
US7785790B1 (en) 1997-10-10 2010-08-31 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US7807352B2 (en) 2001-06-30 2010-10-05 Enzo Life Sciences, Inc. Process for producing two or more copies of nucleic acids in a library, and process for detecting or quantifiying more than one nucleic acid in a library
US7822555B2 (en) 2002-11-11 2010-10-26 Affymetrix, Inc. Methods for identifying DNA copy number changes
US7829313B2 (en) 2000-03-24 2010-11-09 Eppendorf Array Technologies Identification and quantification of a plurality of biological (micro)organisms or their components
EP2251418A1 (en) 2004-10-07 2010-11-17 Argos Therapeutics, Inc. Mature dendritic cell compositions and methods for culturing same
EP2253721A1 (en) 2007-02-26 2010-11-24 INSERM (Institut National de la Santé et de la Recherche Medicale) Method for predicting the occurence of lung metastasis in breast cancer patients
EP2281889A1 (en) 2004-11-12 2011-02-09 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US7894998B2 (en) * 2002-06-26 2011-02-22 Agilent Technologies, Inc. Method for identifying suitable nucleic acid probe sequences for use in nucleic acid arrays
US7897359B2 (en) 2006-07-26 2011-03-01 Leland Standford Junior Univsersity Cell cycle regulation and differentiation
WO2011025736A1 (en) 2009-08-22 2011-03-03 The Board Of Trustees Of The Leland Stanford Junior University Imaging and evaluating embryos, oocytes, and stem cells
WO2011068829A1 (en) 2009-12-02 2011-06-09 The Board Of Trustees Of The Leland Stanford Junior University Biomarkers for determining an allograft tolerant phenotype
US7962291B2 (en) 2005-09-30 2011-06-14 Affymetrix, Inc. Methods and computer software for detecting splice variants
WO2011073629A2 (en) 2009-12-17 2011-06-23 Ucl Business Plc Cancer diagnosis and treatment
EP2340890A1 (en) 2003-04-03 2011-07-06 Fluidigm Corporation Microfluidic devices and methods of using same
US8003375B2 (en) 1998-03-11 2011-08-23 Exonhit Therapeutics S.A. Qualitative differential screening
EP2360234A1 (en) 2001-11-30 2011-08-24 Fluidigm Corporation Microfluidic device and methods of using same
WO2011109398A2 (en) 2010-03-02 2011-09-09 President And Fellows Of Harvard College Methods and compositions for treatment of angelman syndrome and autism spectrum disorders
WO2011108930A1 (en) 2010-03-04 2011-09-09 Interna Technologies Bv A MiRNA MOLECULE DEFINED BY ITS SOURCE AND ITS DIAGNOSTIC AND THERAPEUTIC USES IN DISEASES OR CONDITIONS ASSOCIATED WITH EMT
US8017321B2 (en) 2004-01-23 2011-09-13 The Regents Of The University Of Colorado, A Body Corporate Gefitinib sensitivity-related gene expression and products and methods related thereto
EP2365098A2 (en) 2002-06-20 2011-09-14 Affymetrix, Inc. Antireflective coatings for high-resolution photolithographic synthesis of dna array
EP2371453A1 (en) 2005-03-18 2011-10-05 Fluidigm Corporation Microfluidic device
US8041512B2 (en) * 2003-12-26 2011-10-18 Canon Kabushiki Kaisha Method of acquiring a set of specific elements for discriminating sequence
WO2011133539A2 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company Combined energy and topical composition application for regulating the condition of mammalian skin
WO2011133538A1 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company Genetic signatures and gene chips associated with administration of electrically conducted radio frequency current to skin and methods and treatments relating thereto
WO2011139721A1 (en) 2010-04-27 2011-11-10 The Regents Of The University Of California Cancer biomarkers and methods of use thereof
US8078409B2 (en) * 2005-07-26 2011-12-13 Sysmex Corporation External quality control method, external quality control computer, preprocessing device, and nucleic acid detecting device
WO2012005572A1 (en) 2010-07-06 2012-01-12 Interna Technologies Bv Mirna and its diagnostic and therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated braf pathway
EP2416270A2 (en) 2005-12-09 2012-02-08 Baylor Research Institute Module-level analysis of peripheral blood leukocyte transcriptional profiles
US8140148B2 (en) 1998-01-20 2012-03-20 Boston Scientific Scimed Ltd. Readable probe array for in vivo use
WO2012037378A2 (en) 2010-09-15 2012-03-22 Almac Diagnostics Limited Molecular diagnostic test for cancer
US8143009B2 (en) 2000-06-14 2012-03-27 Vistagen, Inc. Toxicity typing using liver stem cells
EP2442109A1 (en) 2006-07-14 2012-04-18 The Regents of the University of California Cancer biomarkers and methods of use thereof
WO2012068400A2 (en) 2010-11-17 2012-05-24 Asuragen, Inc. Mirnas as biomarkers for distinguishing benign from malignant thyroid neoplasms
US8211652B2 (en) 2008-01-29 2012-07-03 University of Pittsburgh—of the Commonwealth System of Higher Education FSTL-1 as a biomaker of inflammation
EP2474617A1 (en) 2011-01-11 2012-07-11 InteRNA Technologies BV Mir for treating neo-angiogenesis
EP2487240A1 (en) 2006-09-19 2012-08-15 Asuragen, Inc. Micrornas differentially expressed in pancreatic diseases and uses thereof
WO2012116185A1 (en) 2011-02-23 2012-08-30 The Board Of Trustees Of The Leland Stanford Junior University Methods of detecting aneuploidy in human embryos
EP2506172A1 (en) 2006-11-03 2012-10-03 Baylor Research Institute Diagnosis of metastatic melanoma and monitoring indicators of immunosuppression through blood leukocyte microarray analysis
WO2012131594A1 (en) 2011-03-28 2012-10-04 Novartis Ag Markers associated with cyclin-dependent kinase inhibitors
US8288128B2 (en) 2004-11-18 2012-10-16 Eppendorf Array Technologies S.A. Real-time quantification of multiple targets on a micro-array
WO2012158238A2 (en) 2011-02-28 2012-11-22 University Of Iowa Research Foundation Anti-müllerian hormone changes in pregnancy and prediction ofadverse pregnancy outcomes and gender
WO2013003112A1 (en) 2011-06-27 2013-01-03 The Jackson Laboratory Methods and compositions for treatment of cancer and autoimmune disease
EP2546359A1 (en) 2005-12-08 2013-01-16 Novartis AG Effects of inhibitors of FGFR3 on gene transcription
WO2013040251A2 (en) 2011-09-13 2013-03-21 Asurgen, Inc. Methods and compositions involving mir-135b for distinguishing pancreatic cancer from benign pancreatic disease
WO2013063519A1 (en) 2011-10-26 2013-05-02 Asuragen, Inc. Methods and compositions involving mirna expression levels for distinguishing pancreatic cysts
WO2013063544A1 (en) 2011-10-27 2013-05-02 Asuragen, Inc. Mirnas as diagnostic biomarkers to distinguish benign from malignant thyroid tumors
EP2604703A2 (en) 2005-03-14 2013-06-19 The Board of Trustees of Leland Stanford Junior University Methods and compositions for evaluating graft survival in a solid organ transplant recipient
WO2013087789A1 (en) 2011-12-13 2013-06-20 Glykos Finland Ltd. Antibody isoform arrays and methods thereof
EP2631301A1 (en) 2008-08-18 2013-08-28 The Board of Trustees of the Leland Stanford Junior University Methods and compositions for determining a graft tolerant phenotype in a subject
US8586312B2 (en) 1998-08-24 2013-11-19 Affymetrix, Inc. Methods of using an array of pooled probes in genetic analysis
WO2014007623A1 (en) 2012-07-03 2014-01-09 Interna Technologies B.V. Diagnostic portfolio and its uses
US8628924B2 (en) 2009-07-21 2014-01-14 Gen-Probe Incorporated Methods and compositions for quantitative amplification and detection over a wide dynamic range
WO2014011398A1 (en) 2012-07-09 2014-01-16 Novartis Ag Biomarkers associated with cdk inhibitors
WO2014020502A2 (en) 2012-07-31 2014-02-06 Novartis Ag Markers associated with human double minute 2 inhibitors
US8658379B2 (en) 2008-01-29 2014-02-25 University of Pittsburgh—of the Commonwealth System of Higher Education Follistatin-like protein-1 as a biomarker for sepsis
WO2014055117A1 (en) 2012-10-04 2014-04-10 Asuragen, Inc. Diagnostic mirnas for differential diagnosis of incidental pancreatic cystic lesions
WO2014062635A1 (en) 2012-10-19 2014-04-24 Novartis Ag Markers for acute lymphoblastic leukemia
US8741584B2 (en) 2010-08-05 2014-06-03 University of Pittsburgh—of the Commonwealth System of Higher Education Follistatin-like protein-1 as a biomarker for inflammatory disorders
WO2014087156A1 (en) 2012-12-03 2014-06-12 Almac Diagnostics Limited Molecular diagnostic test for cancer
US8815510B2 (en) 2003-04-11 2014-08-26 Affymetrix, Inc. Combinatorial affinity selection
US8835358B2 (en) 2009-12-15 2014-09-16 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
WO2014141038A2 (en) 2013-03-11 2014-09-18 Irm Llc Markers associated with wnt inhibitors
WO2014145612A1 (en) 2013-03-15 2014-09-18 Ajay Goel Tissue and blood-based mirna biomarkers for the diagnosis, prognosis and metastasis-predictive potential in colorectal cancer
WO2014151551A1 (en) 2013-03-15 2014-09-25 Baylor Research Institute Ulcerative colitis (uc)-associated colorectal neoplasia markers
WO2014159239A2 (en) 2013-03-14 2014-10-02 Novartis Ag Antibodies against notch 3
WO2014159242A1 (en) 2013-03-14 2014-10-02 Novartis Ag Notch 3 mutants and uses thereof
WO2014176047A1 (en) 2013-04-25 2014-10-30 Novartis Ag Markers for ezh2 inhibitors
WO2015021080A2 (en) 2013-08-05 2015-02-12 Twist Bioscience Corporation De novo synthesized gene libraries
US9068948B2 (en) 2002-03-12 2015-06-30 Enzo Life Sciences, Inc. Processes for detection of nucleic acids
WO2015120130A1 (en) 2014-02-07 2015-08-13 Novartis Ag Impact of genetic factors on disease progression and response to anti-c5 antibody in geographic atrophy
WO2016025510A1 (en) 2014-08-12 2016-02-18 Rappolee Daniel A Systems and methods to detect stem cell stress and uses thereof
EP2990487A1 (en) 2008-05-08 2016-03-02 Asuragen, INC. Compositions and methods related to mirna modulation of neovascularization or angiogenesis
EP2993473A1 (en) 2007-01-30 2016-03-09 Pharmacyclics, Inc. Methods for determining cancer resistance to histone deacetylase inhibitors
WO2016038550A1 (en) 2014-09-11 2016-03-17 Novartis Ag Inhibition of prmt5 to treat mtap-deficiency-related diseases
US9315857B2 (en) 2009-12-15 2016-04-19 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse label-tags
US9353405B2 (en) 2002-03-12 2016-05-31 Enzo Life Sciences, Inc. Optimized real time nucleic acid detection processes
WO2016089883A1 (en) 2014-12-01 2016-06-09 Novartis Ag Compositions and methods for diagnosis and treatment of prostate cancer
WO2016094897A1 (en) 2014-12-12 2016-06-16 The Jackson Laboratory Compositions and methods relating to the treatment of cancer, autoimmune disease, and neurodegenerative disease
US9388459B2 (en) 2002-06-17 2016-07-12 Affymetrix, Inc. Methods for genotyping
US9434994B2 (en) 2004-05-27 2016-09-06 The Regents Of The University Of Colorado, A Body Corporate Methods for prediction of clinical outcome to epidermal growth factor receptor inhibitors by non-small cell lung cancer patients
WO2017013436A1 (en) 2015-07-21 2017-01-26 Almac Diagnostics Limited Gene signature for immune therapies in cancer
US9567646B2 (en) 2013-08-28 2017-02-14 Cellular Research, Inc. Massively parallel single cell analysis
US9582877B2 (en) 2013-10-07 2017-02-28 Cellular Research, Inc. Methods and systems for digitally counting features on arrays
US9598731B2 (en) 2012-09-04 2017-03-21 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US9670529B2 (en) 2012-02-28 2017-06-06 Population Genetics Technologies Ltd. Method for attaching a counter sequence to a nucleic acid sample
US9670536B2 (en) 2010-09-21 2017-06-06 Population Genetics Technologies Ltd. Increased confidence of allele calls with molecular counting
US9677067B2 (en) 2015-02-04 2017-06-13 Twist Bioscience Corporation Compositions and methods for synthetic gene assembly
US9727810B2 (en) 2015-02-27 2017-08-08 Cellular Research, Inc. Spatially addressable molecular barcoding
US9752191B2 (en) 2009-07-09 2017-09-05 The Scripps Research Institute Gene expression profiles associated with chronic allograft nephropathy
US9760675B2 (en) 2007-05-18 2017-09-12 Affymetrix, Inc. System, method, and computer software product for genotype determination using probe array data
US9777312B2 (en) 2001-06-30 2017-10-03 Enzo Life Sciences, Inc. Dual polarity analysis of nucleic acids
US9790543B2 (en) 2007-10-23 2017-10-17 Roche Sequencing Solutions, Inc. Methods and systems for solution based sequence enrichment
WO2017181367A1 (en) 2016-04-20 2017-10-26 Ldx Prognostics Limited Co. Methods and compositions for prognosing preterm birth
WO2017197573A1 (en) 2016-05-17 2017-11-23 Ldx Prognostics Limited Co. Methods and compositions for providing preeclampsia assessment
US9895673B2 (en) 2015-12-01 2018-02-20 Twist Bioscience Corporation Functionalized surfaces and preparation thereof
US9902992B2 (en) 2012-09-04 2018-02-27 Guardant Helath, Inc. Systems and methods to detect rare mutations and copy number variation
US9920366B2 (en) 2013-12-28 2018-03-20 Guardant Health, Inc. Methods and systems for detecting genetic variants
US9981239B2 (en) 2015-04-21 2018-05-29 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US10053688B2 (en) 2016-08-22 2018-08-21 Twist Bioscience Corporation De novo synthesized nucleic acid libraries
WO2018163051A1 (en) 2017-03-06 2018-09-13 Novartis Ag Methods of treatment of cancer with reduced ubb expression
EP3404116A1 (en) 2013-03-15 2018-11-21 The University of Chicago Methods and compositions related to t-cell activity
WO2019016772A2 (en) 2017-07-21 2019-01-24 Novartis Ag COMPOSITIONS AND METHODS FOR TREATING CANCER
US10202641B2 (en) 2016-05-31 2019-02-12 Cellular Research, Inc. Error correction in amplification of samples
WO2019051465A1 (en) 2017-09-11 2019-03-14 Cyteir Therapeutics, Inc. RAD51 INHIBITORS
EP3456331A1 (en) 2006-02-08 2019-03-20 Genzyme Corporation Gene therapy for niemann-pick disease type a
US10260097B2 (en) 2011-06-02 2019-04-16 Almac Diagnostics Limited Method of using a gene expression profile to determine cancer responsiveness to an anti-angiogenic agent
US10280468B2 (en) 2014-02-07 2019-05-07 Almac Diagnostics Limited Molecular diagnostic test for predicting response to anti-angiogenic drugs and prognosis of cancer
WO2019086603A1 (en) 2017-11-03 2019-05-09 Interna Technologies B.V. Mirna molecule, equivalent, antagomir, or source thereof for treating and/or diagnosing a condition and/or a disease associated with neuronal deficiency or for neuronal (re)generation
US10301677B2 (en) 2016-05-25 2019-05-28 Cellular Research, Inc. Normalization of nucleic acid libraries
WO2019104155A2 (en) 2017-11-22 2019-05-31 The University Of Chicago Chemical probe-dependent evaluation of protein activity and uses thereof
US10338066B2 (en) 2016-09-26 2019-07-02 Cellular Research, Inc. Measurement of protein expression using reagents with barcoded oligonucleotide sequences
US10417457B2 (en) 2016-09-21 2019-09-17 Twist Bioscience Corporation Nucleic acid based data storage
US10443100B2 (en) 2014-05-22 2019-10-15 The Scripps Research Institute Gene expression profiles associated with sub-clinical kidney transplant rejection
WO2019213276A1 (en) 2018-05-02 2019-11-07 Novartis Ag Regulators of human pluripotent stem cells and uses thereof
WO2019213660A2 (en) 2018-05-04 2019-11-07 The Broad Institute, Inc. Compositions and methods for modulating cgrp signaling to regulate innate lymphoid cell inflammatory responses
RU2709815C1 (ru) * 2019-05-14 2019-12-23 Федеральное бюджетное учреждение науки "Нижегородский научно-исследовательский институт эпидемиологии и микробиологии им. академика И.Н. Блохиной" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека Способ поиска молекулярных маркеров патологического процесса для дифференциальной диагностики, мониторинга и таргетной терапии
WO2020036926A1 (en) 2018-08-17 2020-02-20 Cellecta, Inc. Multiplex preparation of barcoded gene specific dna fragments
WO2020077135A1 (en) 2018-10-10 2020-04-16 Dana-Farber Cancer Institute, Inc. Modulating resistance to bcl-2 inhibitors
US10640763B2 (en) 2016-05-31 2020-05-05 Cellular Research, Inc. Molecular indexing of internal sequences
US10669570B2 (en) 2017-06-05 2020-06-02 Becton, Dickinson And Company Sample indexing for single cells
US10669304B2 (en) 2015-02-04 2020-06-02 Twist Bioscience Corporation Methods and devices for de novo oligonucleic acid assembly
US10697010B2 (en) 2015-02-19 2020-06-30 Becton, Dickinson And Company High-throughput single-cell analysis combining proteomic and genomic information
US10696965B2 (en) 2017-06-12 2020-06-30 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US10704085B2 (en) 2014-03-05 2020-07-07 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10722880B2 (en) 2017-01-13 2020-07-28 Cellular Research, Inc. Hydrophilic coating of fluidic channels
WO2020176654A1 (en) 2019-02-27 2020-09-03 Madera Therapeutics, LLC Use of caseinolytic protease p function as a biomarker of drug response to imipridone-like agents
WO2020186101A1 (en) 2019-03-12 2020-09-17 The Broad Institute, Inc. Detection means, compositions and methods for modulating synovial sarcoma cells
WO2020186235A1 (en) 2019-03-14 2020-09-17 The Broad Institute, Inc. Compositions and methods for modulating cgrp signaling to regulate intestinal innate lymphoid cells
WO2020191079A1 (en) 2019-03-18 2020-09-24 The Broad Institute, Inc. Compositions and methods for modulating metabolic regulators of t cell pathogenicity
WO2020191069A1 (en) 2019-03-18 2020-09-24 The Broad Institute, Inc. Modulation of type 2 immunity by targeting clec-2 signaling
WO2020198298A1 (en) 2019-03-25 2020-10-01 Cyteir Therapeutics, Inc. Combinations of rad51 and parp inhibitors
WO2020210521A2 (en) 2019-04-12 2020-10-15 The Regents Of The University Of California Compositions and methods for increasing muscle mass and oxidative metabolism
US10822643B2 (en) 2016-05-02 2020-11-03 Cellular Research, Inc. Accurate molecular barcoding
US10844373B2 (en) 2015-09-18 2020-11-24 Twist Bioscience Corporation Oligonucleic acid variant libraries and synthesis thereof
WO2020257752A1 (en) 2019-06-21 2020-12-24 Cyteir Therapeutics, Inc. Methods of using rad51 inhibitors for treatment of pancreatic cancer
US10894242B2 (en) 2017-10-20 2021-01-19 Twist Bioscience Corporation Heated nanowells for polynucleotide synthesis
US10894959B2 (en) 2017-03-15 2021-01-19 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
US10907274B2 (en) 2016-12-16 2021-02-02 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
WO2021030627A1 (en) 2019-08-13 2021-02-18 The General Hospital Corporation Methods for predicting outcomes of checkpoint inhibition and treatment thereof
US10936953B2 (en) 2018-01-04 2021-03-02 Twist Bioscience Corporation DNA-based digital information storage with sidewall electrodes
US10941396B2 (en) 2012-02-27 2021-03-09 Becton, Dickinson And Company Compositions and kits for molecular counting
EP3825416A2 (en) 2014-05-22 2021-05-26 The Scripps Research Institute Gene expression profiles associated with sub-clinical kidney transplant rejection
EP3825417A2 (en) 2014-05-22 2021-05-26 The Scripps Research Institute Tissue molecular signatures of kidney transplant rejections
EP3825418A2 (en) 2014-05-22 2021-05-26 The Scripps Research Institute Molecular signatures for distinguishing liver transplant rejections or injuries
WO2021127610A1 (en) 2019-12-20 2021-06-24 EDWARD Via COLLEGE OF OSTEOPATHIC MEDICINE Cancer signatures, methods of generating cancer signatures, and uses thereof
US11104951B2 (en) 2014-05-22 2021-08-31 The Scripps Research Institute Molecular signatures for distinguishing liver transplant rejections or injuries
WO2021178531A1 (en) 2020-03-03 2021-09-10 Cyteir Therapeutics, Inc. The rad51 inhibitor compound 67a (2301085-06-1) at a specific dosage for treating cancer
US11124823B2 (en) 2015-06-01 2021-09-21 Becton, Dickinson And Company Methods for RNA quantification
US11164659B2 (en) 2016-11-08 2021-11-02 Becton, Dickinson And Company Methods for expression profile classification
US11177020B2 (en) 2012-02-27 2021-11-16 The University Of North Carolina At Chapel Hill Methods and uses for molecular tags
US11242569B2 (en) 2015-12-17 2022-02-08 Guardant Health, Inc. Methods to determine tumor gene copy number by analysis of cell-free DNA
EP3947727A1 (en) 2019-04-05 2022-02-09 Board of Regents, The University of Texas System Methods and applications for cell barcoding
WO2022032228A1 (en) 2020-08-07 2022-02-10 The Broad Institute, Inc. Therapeutic targeting of phosphate dysregulation in cancer via the xpr1:kidins220 protein complex
US11247988B2 (en) 2019-03-12 2022-02-15 Cyteir Therapeutics, Inc. RAD51 inhibitors
US11306351B2 (en) 2005-12-21 2022-04-19 Affymetrix, Inc. Methods for genotyping
US11319583B2 (en) 2017-02-01 2022-05-03 Becton, Dickinson And Company Selective amplification using blocking oligonucleotides
US11332776B2 (en) 2015-09-11 2022-05-17 Becton, Dickinson And Company Methods and compositions for library normalization
US11332738B2 (en) 2019-06-21 2022-05-17 Twist Bioscience Corporation Barcode-based nucleic acid sequence assembly
US11365409B2 (en) 2018-05-03 2022-06-21 Becton, Dickinson And Company Molecular barcoding on opposite transcript ends
US11371076B2 (en) 2019-01-16 2022-06-28 Becton, Dickinson And Company Polymerase chain reaction normalization through primer titration
US11377676B2 (en) 2017-06-12 2022-07-05 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US11390914B2 (en) 2015-04-23 2022-07-19 Becton, Dickinson And Company Methods and compositions for whole transcriptome amplification
US11397882B2 (en) 2016-05-26 2022-07-26 Becton, Dickinson And Company Molecular label counting adjustment methods
US11407837B2 (en) 2017-09-11 2022-08-09 Twist Bioscience Corporation GPCR binding proteins and synthesis thereof
WO2022192419A2 (en) 2021-03-09 2022-09-15 Massachusetts Institute Of Technology Methods of treating inflammatory bowel disease (ibd) with anti- tnf-blockade
US11492660B2 (en) 2018-12-13 2022-11-08 Becton, Dickinson And Company Selective extension in single cell whole transcriptome analysis
US11492665B2 (en) 2018-05-18 2022-11-08 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US11492727B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for GLP1 receptor
US11492728B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for antibody optimization
US11512347B2 (en) 2015-09-22 2022-11-29 Twist Bioscience Corporation Flexible substrates for nucleic acid synthesis
US11535882B2 (en) 2015-03-30 2022-12-27 Becton, Dickinson And Company Methods and compositions for combinatorial barcoding
US11543411B2 (en) 2014-12-05 2023-01-03 Prelude Corporation DCIS recurrence and invasive breast cancer
US11550939B2 (en) 2017-02-22 2023-01-10 Twist Bioscience Corporation Nucleic acid based data storage using enzymatic bioencryption
US11608497B2 (en) 2016-11-08 2023-03-21 Becton, Dickinson And Company Methods for cell label classification
US11639517B2 (en) 2018-10-01 2023-05-02 Becton, Dickinson And Company Determining 5′ transcript sequences
US11649497B2 (en) 2020-01-13 2023-05-16 Becton, Dickinson And Company Methods and compositions for quantitation of proteins and RNA
US11661625B2 (en) 2020-05-14 2023-05-30 Becton, Dickinson And Company Primers for immune repertoire profiling
US11661631B2 (en) 2019-01-23 2023-05-30 Becton, Dickinson And Company Oligonucleotides associated with antibodies
WO2023114507A1 (en) 2021-12-17 2023-06-22 Tango Therapeutics, Inc. Crystalline form of n-(6-amino-5-methylpyridin-3-yl)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide, pharmaceutical compositions and methods of use thereof
WO2023146987A1 (en) 2022-01-26 2023-08-03 Tango Therapeutics, Inc. Compounds and methods of use
WO2023146990A1 (en) 2022-01-26 2023-08-03 Tango Therapeutics, Inc. Compounds and methods of use
WO2023146989A1 (en) 2022-01-26 2023-08-03 Tango Therapeutics, Inc. Compounds and methods of use
WO2023146991A1 (en) 2022-01-26 2023-08-03 Tango Therapeutics, Inc. Compounds and methods of use
US11739443B2 (en) 2020-11-20 2023-08-29 Becton, Dickinson And Company Profiling of highly expressed and lowly expressed proteins
US11773441B2 (en) 2018-05-03 2023-10-03 Becton, Dickinson And Company High throughput multiomics sample analysis
US11773436B2 (en) 2019-11-08 2023-10-03 Becton, Dickinson And Company Using random priming to obtain full-length V(D)J information for immune repertoire sequencing
US11793787B2 (en) 2019-10-07 2023-10-24 The Broad Institute, Inc. Methods and compositions for enhancing anti-tumor immunity by targeting steroidogenesis
US11821900B2 (en) 2018-09-14 2023-11-21 Prelude Corporation Method of selection for treatment of subjects at risk of invasive breast cancer
US11844800B2 (en) 2019-10-30 2023-12-19 Massachusetts Institute Of Technology Methods and compositions for predicting and preventing relapse of acute lymphoblastic leukemia
WO2024030659A1 (en) 2022-08-05 2024-02-08 Tango Therapeutics, Inc. An hdac inhibitor for treating cancer with a modified stk11 activity or expression
WO2024028794A1 (en) 2022-08-02 2024-02-08 Temple Therapeutics BV Methods for treating endometrial and ovarian hyperproliferative disorders
US11913065B2 (en) 2012-09-04 2024-02-27 Guardent Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11932901B2 (en) 2020-07-13 2024-03-19 Becton, Dickinson And Company Target enrichment using nucleic acid probes for scRNAseq
US11932849B2 (en) 2018-11-08 2024-03-19 Becton, Dickinson And Company Whole transcriptome analysis of single cells using random priming
US11939622B2 (en) 2019-07-22 2024-03-26 Becton, Dickinson And Company Single cell chromatin immunoprecipitation sequencing assay
US11946095B2 (en) 2017-12-19 2024-04-02 Becton, Dickinson And Company Particles associated with oligonucleotides
US11957695B2 (en) 2018-04-26 2024-04-16 The Broad Institute, Inc. Methods and compositions targeting glucocorticoid signaling for modulating immune responses
US11965208B2 (en) 2019-04-19 2024-04-23 Becton, Dickinson And Company Methods of associating phenotypical data and single cell sequencing data
WO2024091551A1 (en) 2022-10-25 2024-05-02 Tango Therapeutics, Inc. Crystalline forms, pharmaceutical compositions and methods of use thereof
US11981922B2 (en) 2019-10-03 2024-05-14 Dana-Farber Cancer Institute, Inc. Methods and compositions for the modulation of cell interactions and signaling in the tumor microenvironment
WO2024124044A1 (en) 2022-12-07 2024-06-13 The Brigham And Women’S Hospital, Inc. Compositions and methods targeting sat1 for enhancing anti¬ tumor immunity during tumor progression
US12071617B2 (en) 2019-02-14 2024-08-27 Becton, Dickinson And Company Hybrid targeted and whole transcriptome amplification
US12091777B2 (en) 2019-09-23 2024-09-17 Twist Bioscience Corporation Variant nucleic acid libraries for CRTH2
WO2024192141A1 (en) 2023-03-13 2024-09-19 Dana-Farber Cancer Institute, Inc. Treatment of cancers having a drug-resistant mesenchymal cell state
WO2024226838A2 (en) 2023-04-25 2024-10-31 The Brigham And Women's Hospital, Inc. Treatment of autoimmune diseases having a pathogenic t cell state
WO2024233605A1 (en) 2023-05-08 2024-11-14 Tango Therapeutics, Inc. Compounds and their use against cancer
WO2024233665A1 (en) 2023-05-08 2024-11-14 Tango Therapeutics, Inc. Compounds and their use against cancer
US12153043B2 (en) 2020-02-25 2024-11-26 Becton, Dickinson And Company Bi-specific probes to enable the use of single-cell samples as single color compensation control
US12157913B2 (en) 2020-06-02 2024-12-03 Becton, Dickinson And Company Oligonucleotides and beads for 5 prime gene expression assay
US12165747B2 (en) 2020-01-23 2024-12-10 The Broad Institute, Inc. Molecular spatial mapping of metastatic tumor microenvironment
US12173282B2 (en) 2019-09-23 2024-12-24 Twist Bioscience, Inc. Antibodies that bind CD3 epsilon
US12188010B2 (en) 2020-01-29 2025-01-07 Becton, Dickinson And Company Barcoded wells for spatial mapping of single cells through sequencing
US12195725B2 (en) 2019-10-03 2025-01-14 Dana-Farber Cancer Institute, Inc. Compositions and methods for modulating and detecting tissue specific TH17 cell pathogenicity
US12357959B2 (en) 2018-12-26 2025-07-15 Twist Bioscience Corporation Highly accurate de novo polynucleotide synthesis
WO2025166308A1 (en) 2024-01-31 2025-08-07 Tango Therapeutics, Inc. Crystalline forms, pharmaceutical compositions and methods of use thereof
WO2025166186A1 (en) 2024-01-31 2025-08-07 Tango Therapeutics, Inc. Crystalline forms, pharmaceutical compositions and methods of use thereof
US12392771B2 (en) 2020-12-15 2025-08-19 Becton, Dickinson And Company Single cell secretome analysis
US12391940B2 (en) 2020-07-31 2025-08-19 Becton, Dickinson And Company Single cell assay for transposase-accessible chromatin
US12402610B2 (en) 2018-11-09 2025-09-02 The Broad Institute, Inc. Methods and compositions for modulating innate lymphoid cell pathogenic effectors
US12421557B2 (en) 2019-08-16 2025-09-23 The Broad Institute, Inc. Methods for predicting outcomes and treating colorectal cancer using a cell atlas
WO2025202871A1 (en) 2024-03-27 2025-10-02 Pfizer Inc. Methods for identifying biomarkers of treatment response and use thereof with a cdk4 inhibitor
WO2025217297A1 (en) 2024-04-09 2025-10-16 Tango Therapeutics, Inc. Prmt5 inhibitors for use in methods of treating mta-accumulating cancer
WO2025217209A2 (en) 2024-04-08 2025-10-16 Tango Therapeutics, Inc. Crystalline forms of hdac inhibitor and uses thereof
WO2025248505A1 (en) 2024-05-31 2025-12-04 Wayne State University Methods for treating endometrial and ovarian hyperproliferative disorders
US12570750B2 (en) 2019-12-09 2026-03-10 Twist Bioscience Corporation Antibodies that bind adenosine A2A receptors and methods of use thereof to treat cancer and neurological diseases
WO2026073277A1 (en) 2024-09-30 2026-04-02 Tango Therapeutics, Inc. Substituted piperidine-diones inactivating hbs1l
US12606859B2 (en) 2020-01-13 2026-04-21 Becton, Dickinson And Company Cell capture using DU-containing oligonucleotides

Families Citing this family (576)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6589726B1 (en) 1991-09-04 2003-07-08 Metrigen, Inc. Method and apparatus for in situ synthesis on a solid support
US20030134291A1 (en) * 1993-06-25 2003-07-17 Affymetrix, Inc. Polymorphism detection
US6379897B1 (en) 2000-11-09 2002-04-30 Nanogen, Inc. Methods for gene expression monitoring on electronic microarrays
US8236493B2 (en) * 1994-10-21 2012-08-07 Affymetrix, Inc. Methods of enzymatic discrimination enhancement and surface-bound double-stranded DNA
US6600996B2 (en) * 1994-10-21 2003-07-29 Affymetrix, Inc. Computer-aided techniques for analyzing biological sequences
US20030220748A1 (en) * 1994-10-21 2003-11-27 Affymetrix, Inc., A California Corporation Computer-aided techniques for analyzing biological sequences
US6720140B1 (en) * 1995-06-07 2004-04-13 Invitrogen Corporation Recombinational cloning using engineered recombination sites
US6143557A (en) * 1995-06-07 2000-11-07 Life Technologies, Inc. Recombination cloning using engineered recombination sites
US20040180364A1 (en) * 2003-01-08 2004-09-16 Affymetrix, Inc. Methods for analyzing global regulation of coding and non-coding RNA transcripts involving low molecular weight RNAs
US20050136420A1 (en) * 2000-05-19 2005-06-23 Affymetrix, Inc. Methods and computer software products for identifying transcribed regions of a genome
US6852487B1 (en) 1996-02-09 2005-02-08 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
EP1736554B1 (en) 1996-05-29 2013-10-09 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
US6391550B1 (en) 1996-09-19 2002-05-21 Affymetrix, Inc. Identification of molecular sequence signatures and methods involving the same
WO1998012354A1 (en) 1996-09-19 1998-03-26 Affymetrix, Inc. Identification of molecular sequence signatures and methods involving the same
NO972006D0 (no) * 1997-04-30 1997-04-30 Forskningsparken I Aas As Ny metode for diagnose av sykdommer
CN101125873A (zh) * 1997-10-24 2008-02-20 茵维特罗根公司 利用具重组位点的核酸进行重组克隆
US7351578B2 (en) 1999-12-10 2008-04-01 Invitrogen Corp. Use of multiple recombination sites with unique specificity in recombinational cloning
EP1025217B1 (en) * 1997-10-24 2006-10-04 Invitrogen Corporation Recombinational cloning using nucleic acids having recombination sites
JP2001521754A (ja) * 1997-10-30 2001-11-13 コールド スプリング ハーバー ラボラトリー Dna識別のためのプローブアレイ及びプローブアレイの使用方法
US6218114B1 (en) * 1998-03-27 2001-04-17 Academia Sinica Methods for detecting differentially expressed genes
US6979728B2 (en) * 1998-05-04 2005-12-27 Baylor College Of Medicine Articles of manufacture and methods for array based analysis of biological molecules
US20040199544A1 (en) * 2000-11-02 2004-10-07 Affymetrix, Inc. Method and apparatus for providing an expression data mining database
EP2119788A1 (en) 1999-03-02 2009-11-18 Life Technologies Corporation Compositions and methods for use in recombinational cloning of nucleic acids
US7005256B1 (en) * 1999-03-10 2006-02-28 Cold Spring Harbor Laboratory Gene chip technology for determining memory genes
AU3875200A (en) * 1999-03-11 2000-09-28 Orion Genomics, Llc Genome chips and optical transcript mapping
JP3957118B2 (ja) * 1999-05-18 2007-08-15 富士フイルム株式会社 試験片およびこの試験片からの画像情報読取装置
US6713255B1 (en) * 1999-06-07 2004-03-30 Fuji Photo Film Co., Ltd. DNA chip, PNA chip, and their preparation methods
WO2001002452A1 (en) * 1999-07-02 2001-01-11 Symyx Technologies, Inc. Polymer brushes for immobilizing molecules to a surface or substrate, where the polymers have water-soluble or water-dispersible segments and probes bonded thereto
US7371516B1 (en) 1999-07-16 2008-05-13 Rosetta Inpharmatics Llc Methods for determining the specificity and sensitivity of oligonucleo tides for hybridization
US7209836B1 (en) * 1999-07-16 2007-04-24 Perkinelmer Las, Inc. Method and system for automatically creating crosstalk-corrected data of a microarray
EP1200625A1 (en) * 1999-07-16 2002-05-02 Rosetta Inpharmatics Inc. Methods for determining the specificity and sensitivity of oligonucleotides for hybridization
US6420105B1 (en) * 1999-08-13 2002-07-16 University Of Kentucky Research Foundation Method for analyzing molecular expression or function in an intact single cell
US7062076B1 (en) 1999-08-27 2006-06-13 Iris Biotechnologies, Inc. Artificial intelligence system for genetic analysis
EP1208238B1 (en) * 1999-08-27 2008-11-12 Matrix Technologies Corporation Methods of immobilizing ligands on solid supports
JP2003508853A (ja) 1999-08-27 2003-03-04 アイリス・バイオ・テクノロジーズ・インコーポレイテッド 遺伝子分析用人工知能システム
AU2246601A (en) 1999-08-30 2001-04-10 Illumina, Inc. Methods for improving signal detection from an array
US6358557B1 (en) * 1999-09-10 2002-03-19 Sts Biopolymers, Inc. Graft polymerization of substrate surfaces
US7211390B2 (en) * 1999-09-16 2007-05-01 454 Life Sciences Corporation Method of sequencing a nucleic acid
US7244559B2 (en) * 1999-09-16 2007-07-17 454 Life Sciences Corporation Method of sequencing a nucleic acid
US6271002B1 (en) 1999-10-04 2001-08-07 Rosetta Inpharmatics, Inc. RNA amplification method
WO2001027327A2 (en) 1999-10-08 2001-04-19 Protogene Laboratories, Inc. Method and apparatus for performing large numbers of reactions using array assembly
US6607885B1 (en) 1999-10-15 2003-08-19 E. I. Du Pont De Nemours And Company Method for high-density microarray medicated gene expression profiling
AU1465801A (en) * 1999-11-03 2001-05-14 Oncotech, Inc. Methods for cancer prognosis and diagnosis
US6274321B1 (en) * 1999-12-03 2001-08-14 The Regents Of The University Of California High throughput functional screening of cDNAs
EP2210948A3 (en) * 1999-12-10 2010-10-06 Life Technologies Corporation Use of multiple recombination sites with unique specificity in recombinational cloning
US20050164290A1 (en) * 2000-01-13 2005-07-28 Affymetrix, Inc. Computer software for sequence selection
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
US7582420B2 (en) 2001-07-12 2009-09-01 Illumina, Inc. Multiplex nucleic acid reactions
US8076063B2 (en) * 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US20050214825A1 (en) * 2000-02-07 2005-09-29 John Stuelpnagel Multiplex sample analysis on universal arrays
US6770441B2 (en) * 2000-02-10 2004-08-03 Illumina, Inc. Array compositions and methods of making same
AU2001241586A1 (en) * 2000-02-17 2001-08-27 Prolx Pharmaceuticals, Lp Dna arrays for determining drug selectivity
US20020111746A1 (en) * 2000-03-15 2002-08-15 Wei-Min Liu Systems and computer software products for gene expression analysis
US6884578B2 (en) * 2000-03-31 2005-04-26 Affymetrix, Inc. Genes differentially expressed in secretory versus proliferative endometrium
US7157564B1 (en) 2000-04-06 2007-01-02 Affymetrix, Inc. Tag nucleic acids and probe arrays
US6571005B1 (en) * 2000-04-21 2003-05-27 The Regents Of The University Of California Feature extraction and normalization algorithms for high-density oligonucleotide gene expression array data
EP1366182A2 (en) * 2000-05-04 2003-12-03 Syngenta Participations AG Assay for nucleic acid analysis
US7682837B2 (en) * 2000-05-05 2010-03-23 Board Of Trustees Of Leland Stanford Junior University Devices and methods to form a randomly ordered array of magnetic beads and uses thereof
US20020120409A1 (en) * 2000-05-19 2002-08-29 Affymetrix, Inc. Methods for gene expression analysis
CA2378854A1 (en) * 2000-05-19 2001-11-29 Affymetrix, Inc. Methods and computer software products for transcriptional annotation
US7244560B2 (en) * 2000-05-21 2007-07-17 Invitrogen Corporation Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
DE10025384A1 (de) * 2000-05-24 2002-02-21 Microdiscovery Gmbh Quantitative Messung von Molekülmengen im komplexen Gemischen
US7003403B1 (en) 2000-06-15 2006-02-21 The United States Of America As Represented By The Department Of Health And Human Services Quantifying gene relatedness via nonlinear prediction of gene
US20030064372A1 (en) * 2000-06-22 2003-04-03 Bodnar Jackie S. Gene and sequence variation associated with lipid disorder
US20070141434A1 (en) * 2000-06-26 2007-06-21 Joshi Ashok V Sanitizing Device and Associated Method Using Electrochemically Produced Sanitizing Agents
US7846733B2 (en) * 2000-06-26 2010-12-07 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
EP1356094B1 (en) * 2000-06-26 2010-01-13 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
US6706474B1 (en) * 2000-06-27 2004-03-16 Board Of Trustees Of The University Of Illinois Nucleic acid enzyme biosensors for ions
US6913879B1 (en) 2000-07-10 2005-07-05 Telechem International Inc. Microarray method of genotyping multiple samples at multiple LOCI
JP2002142765A (ja) * 2000-07-14 2002-05-21 Tosoh Corp 新規ゲノム解析法
US20050181421A1 (en) * 2000-08-03 2005-08-18 Affymetrix, Inc. Methods of array synthesis
US7198924B2 (en) * 2000-12-11 2007-04-03 Invitrogen Corporation Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
EP1573634A2 (en) 2000-08-22 2005-09-14 Affymetrix, Inc. System method, and computer software product for controlling biological microarray scanner
WO2002016647A1 (en) * 2000-08-24 2002-02-28 Aviva Biosciences Corporation Methods and compositions for identifying nucleic acid molecules using nucleolytic activities and hybridization
US7807447B1 (en) 2000-08-25 2010-10-05 Merck Sharp & Dohme Corp. Compositions and methods for exon profiling
US6713257B2 (en) 2000-08-25 2004-03-30 Rosetta Inpharmatics Llc Gene discovery using microarrays
US20020164634A1 (en) * 2000-08-26 2002-11-07 Perlegen Sciences, Inc. Methods for reducing complexity of nucleic acid samples
JP3537752B2 (ja) * 2000-09-01 2004-06-14 日立ソフトウエアエンジニアリング株式会社 バイオチップを用いたハイブリダイゼーション反応の実験結果表示方法及び実験誤差評価方法
US7108969B1 (en) 2000-09-08 2006-09-19 Affymetrix, Inc. Methods for detecting and diagnosing oral cancer
GB0022978D0 (en) 2000-09-19 2000-11-01 Oxford Glycosciences Uk Ltd Detection of peptides
EP2333543B1 (en) 2000-09-26 2018-01-10 Health Research, Incorporated Analysis of hiv-1 coreceptor use in the clinical care of hiv-1 infected patients
EP1330547A4 (en) * 2000-10-04 2005-01-19 Univ Leland Stanford Junior RENATURATION, REASSOCIATION, ASSOCIATION AND HYBRIDIZATION OF NUCLEIC ACID MOLECULES
US6368806B1 (en) * 2000-10-05 2002-04-09 Pioneer Hi-Bred International, Inc. Marker assisted identification of a gene associated with a phenotypic trait
US20020095585A1 (en) * 2000-10-18 2002-07-18 Genomic Health, Inc. Genomic profile information systems and methods
CA2426540A1 (en) * 2000-10-20 2002-07-25 Biocardia, Inc. Leukocyte expression profiling
US6998234B2 (en) * 2000-11-03 2006-02-14 Oncotech, Inc. Methods for cancer prognosis and diagnosis relating to tumor vascular endothelial cells
US7033761B2 (en) * 2000-11-14 2006-04-25 Shafer David A Expression miniarrays and uses thereof
US7117095B2 (en) 2000-11-21 2006-10-03 Affymetrix, Inc. Methods for selecting nucleic acid probes
AU2002241520A1 (en) * 2000-11-28 2003-03-03 University Of Cincinnati Blood assessment of injury
WO2002046753A1 (en) * 2000-12-06 2002-06-13 Takara Bio Inc. Functional dna array
US7197400B2 (en) * 2000-12-12 2007-03-27 Affymetrix, Inc. System and computer software products for comparative gene expression analysis
WO2002048402A2 (en) 2000-12-13 2002-06-20 Nugen Technologies, Inc. Methods and compositions for generation of multiple copies of nucleic acid sequences and methods of detection thereof
US6391592B1 (en) * 2000-12-14 2002-05-21 Affymetrix, Inc. Blocker-aided target amplification of nucleic acids
US6448387B1 (en) * 2000-12-18 2002-09-10 Monsanto Technology, Llc Polymeric arrays adapted for high expressing polynucleotides
US20030003450A1 (en) * 2000-12-21 2003-01-02 Affymetrix, Inc. Computer software products for gene expression analysis using linear programming
AU2002246978A1 (en) * 2001-01-10 2002-07-24 Symyx Technologies, Inc. Polymer brushes for immobilizing molecules to a surface
EP2327794A3 (en) * 2001-01-25 2011-09-14 TM Bioscience Corporation Polynucleotides for use as tags and tag complements, manufacture and use thereof
AU2002253878A1 (en) * 2001-01-25 2002-08-06 Gene Logic, Inc. Gene expression profiles in breast tissue
US7226737B2 (en) * 2001-01-25 2007-06-05 Luminex Molecular Diagnostics, Inc. Polynucleotides for use as tags and tag complements, manufacture and use thereof
CA2438832A1 (en) * 2001-02-23 2002-09-06 Elan Pharmaceuticals, Inc. Transgenic knockouts of bace-1
JP2002262876A (ja) * 2001-03-07 2002-09-17 Ngk Insulators Ltd 高感度な核酸のハイブリダイゼーション方法、及びその方法を用いた遺伝子解析方法
JP4542312B2 (ja) 2001-03-09 2010-09-15 ニューゲン テクノロジーズ, インコーポレイテッド Rna配列の増幅のための方法および組成物
WO2002072789A2 (en) * 2001-03-12 2002-09-19 Irm, Llc. Genomics-driven high speed cellular assays, development thereof, and collections of cellular reporters
US20030104410A1 (en) * 2001-03-16 2003-06-05 Affymetrix, Inc. Human microarray
US7047141B2 (en) * 2001-03-22 2006-05-16 Ge Healthcare Bio-Sciences Ab Ratio-based oligonucleotide probe selection
US7563618B2 (en) * 2001-03-23 2009-07-21 Geron Corporation Oligonucleotide conjugates
US20020142305A1 (en) * 2001-03-27 2002-10-03 Koei Chin Methods for diagnosing and monitoring ovarian cancer by screening gene copy numbers
ATE366923T1 (de) * 2001-03-28 2007-08-15 Clondiag Chip Tech Gmbh Vorrichtung zur referenzierung von fluoreszenzsignalen
US6596489B2 (en) * 2001-03-30 2003-07-22 Applied Gene Technologies Methods and compositions for analyzing nucleotide sequence mismatches using RNase H
AU2002254524A1 (en) * 2001-04-06 2002-10-21 The Government Of The United States Of America, Represented By The Secretary, Department Of Health A Use of semenogelin in the diagnosis, prognosis and treatment of cancer
US20030148339A1 (en) * 2001-05-07 2003-08-07 Hrissi Samartzidou Artificial genes for use as controls in gene expression analysis systems
CA2446531A1 (en) * 2001-05-07 2002-11-14 Amersham Biosciences Corp Design of artificial genes for use as controls in gene expression analysis systems
US7138506B2 (en) 2001-05-09 2006-11-21 Genetic Id, Na, Inc. Universal microarray system
US20040014086A1 (en) * 2001-05-11 2004-01-22 Regulome Corporation Regulome arrays
EP1451344A4 (en) * 2001-05-21 2005-03-23 Invitrogen Corp COMPOSITIONS AND METHODS FOR USE IN ISOLATING NUCLEIC ACID MOLECULES
US7235358B2 (en) 2001-06-08 2007-06-26 Expression Diagnostics, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US6905827B2 (en) * 2001-06-08 2005-06-14 Expression Diagnostics, Inc. Methods and compositions for diagnosing or monitoring auto immune and chronic inflammatory diseases
US6696256B1 (en) 2001-06-08 2004-02-24 Pandmics, Inc. Method, array and kit for detecting activated transcription factors by hybridization array
US20040214166A1 (en) * 2001-06-08 2004-10-28 Xianqiang Li Method for identifying a disease state based on a detected mixture of activated transcription factors
US6924113B2 (en) 2001-06-08 2005-08-02 Panomics, Inc. Method and kit for isolating DNA probes that bind to activated transcription factors
US6821737B2 (en) 2001-06-08 2004-11-23 Panomics, Inc. Method for screening for drug candidates for modulating transcription factor activity
US7981842B2 (en) 2001-06-08 2011-07-19 Panomics, Inc. Method for detecting transcription factor-protein interactions
US7026121B1 (en) * 2001-06-08 2006-04-11 Expression Diagnostics, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US20030104426A1 (en) * 2001-06-18 2003-06-05 Linsley Peter S. Signature genes in chronic myelogenous leukemia
US20050175989A1 (en) * 2001-06-20 2005-08-11 Ching-Yu Lin Method and detector for identifying subtypes of human papilloma viruses
US6855538B2 (en) * 2001-06-27 2005-02-15 The Regents Of The University Of California High-efficiency microarray printing device
US7402286B2 (en) * 2001-06-27 2008-07-22 The Regents Of The University Of California Capillary pins for high-efficiency microarray printing device
US6691042B2 (en) 2001-07-02 2004-02-10 Rosetta Inpharmatics Llc Methods for generating differential profiles by combining data obtained in separate measurements
US7297553B2 (en) * 2002-05-28 2007-11-20 Nanosphere, Inc. Method for attachment of silylated molecules to glass surfaces
WO2003006676A2 (en) * 2001-07-13 2003-01-23 Nanosphere, Inc. Method for immobilizing molecules onto surfaces
GB0117631D0 (en) * 2001-07-19 2001-09-12 Syngenta Ltd Improvements in or relating to organic compounds
US7348140B1 (en) 2001-07-25 2008-03-25 Acadia Pharmaceuticals, Inc. Clinical indications for genotyping polymorphic variants of G-protein coupled receptors
US7297778B2 (en) 2001-07-25 2007-11-20 Affymetrix, Inc. Complexity management of genomic DNA
WO2003083040A2 (en) * 2001-07-30 2003-10-09 Sts Biopolymers, Inc. Graft polymer matrices
WO2003016574A1 (en) * 2001-08-16 2003-02-27 Zhifeng Shao Analysis of gene expression profiles using sequential hybridization
US20030175740A1 (en) * 2001-08-16 2003-09-18 Mullinax Rebecca Lynn Compositions and methods comprising control nucleic acid
US20080026367A9 (en) * 2001-08-17 2008-01-31 Perlegen Sciences, Inc. Methods for genomic analysis
ATE420351T1 (de) * 2001-08-31 2009-01-15 Gen Probe Inc Sonden mit affinitätsverschiebung zur quantifizierung von analytenpolynukleotiden
US20050147984A1 (en) * 2001-08-31 2005-07-07 Clondiag Chip Technologies Gmbh Interaction detection on several probe arrays
WO2003021229A2 (en) * 2001-09-05 2003-03-13 The Brigham And Women's Hospital, Inc. Diagnostic and prognostic tests
US7622260B2 (en) * 2001-09-05 2009-11-24 The Brigham And Women's Hospital, Inc. Diagnostic and prognostic tests
US20060188875A1 (en) * 2001-09-18 2006-08-24 Perlegen Sciences, Inc. Human genomic polymorphisms
US7192705B2 (en) 2001-09-19 2007-03-20 United States Of America, Represented By The Secretary, Department Of Health And Human Services Transductin-1 and applications to hereditary deafness
US20040009489A1 (en) * 2001-09-28 2004-01-15 Golub Todd R. Classification of lung carcinomas using gene expression analysis
US20030108925A1 (en) * 2001-10-05 2003-06-12 U.S. Epa Genetic testing for male factor infertility
US20040053232A1 (en) * 2001-10-05 2004-03-18 Perlegen Sciences, Inc. Haplotype structures of chromosome 21
CA2463725A1 (en) * 2001-10-12 2003-11-06 Spectral Genomics, Inc. Compilations of nucleic acids and arrays and methods of using them
US7439346B2 (en) * 2001-10-12 2008-10-21 Perkinelmer Las Inc. Nucleic acids arrays and methods of use therefor
WO2003033742A1 (en) * 2001-10-17 2003-04-24 University Of Utah Research Foundation Methods for identifying differentially expressed genes by multivariate analysis of microarry data
AU2002349976A1 (en) * 2001-10-17 2003-04-28 Advanced Research And Technology Institute Methods for predicting transcription levels
US20040126762A1 (en) * 2002-12-17 2004-07-01 Morris David W. Novel compositions and methods in cancer
AU2002365032A1 (en) * 2001-10-24 2003-06-10 Amersham Biosciences (Sv) Corp Artificial genes for use as controls in gene expression analysis systems
DE10155055A1 (de) * 2001-11-09 2003-05-28 Friz Biochem Gmbh Fluoreszenz-Quenchen zur Detektion von Nukleinsäure-Oligomer-Hybridisierungsereignissen bei hohen Salz-Konzentrationen
US20040023237A1 (en) * 2001-11-26 2004-02-05 Perelegen Sciences Inc. Methods for genomic analysis
US20030099952A1 (en) * 2001-11-26 2003-05-29 Roland Green Microarrays with visible pattern detection
TW200408407A (en) * 2001-11-30 2004-06-01 Dana Farber Cancer Inst Inc Methods and compositions for modulating the immune system and uses thereof
US20040197778A1 (en) * 2002-12-26 2004-10-07 Sagres Discovery, Inc. Novel compositions and methods in cancer
US20060040262A1 (en) * 2002-12-27 2006-02-23 Morris David W Novel compositions and methods in cancer
US6670122B2 (en) * 2001-12-03 2003-12-30 Affymetrix, Inc. Method for detecting transcription templates
CA2469561A1 (en) * 2001-12-11 2003-06-19 Thomas R. Gingeras Methods for determining transcriptional activity
KR100442839B1 (ko) * 2001-12-15 2004-08-02 삼성전자주식회사 최적 탐침 설계를 위한 탐침의 점수화 및 선택에 관한 방법
WO2003053586A1 (en) * 2001-12-19 2003-07-03 Affymetrix, Inc. Array plates and method for constructing array plates
US20030124542A1 (en) * 2001-12-28 2003-07-03 Spectral Genomics, Inc. Methods for mapping the chromosomal loci of genes expressed by a cell
US20030170700A1 (en) * 2002-01-09 2003-09-11 Lynx Therapeutics, Inc. Secreted and cell surface polypeptides affected by cholesterol and uses thereof
US20030166026A1 (en) * 2002-01-09 2003-09-04 Lynx Therapeutics, Inc. Identification of specific biomarkers for breast cancer cells
US20030143547A1 (en) * 2002-01-24 2003-07-31 Xianqiang Li Method for identifying multiple activated transcription factors
US7418351B2 (en) * 2002-01-31 2008-08-26 Rosetta Inpharmatics Llc Methods for analysis of measurement errors in measured signals
US20030149593A1 (en) * 2002-02-04 2003-08-07 Msc Healthcare (S) Pte. Ltd. Health-care system
US7499806B2 (en) 2002-02-14 2009-03-03 Illumina, Inc. Image processing in microsphere arrays
AU2003225589A1 (en) 2002-02-22 2003-09-09 The Government Of The United States Of America, As Represented By The Secretary, Dept. Of Health And Brother of the regulator of imprinted sites (boris)
DE10208794A1 (de) * 2002-02-28 2003-09-04 Degussa Bioactives Gmbh Verfahren zum Sortieren einsträngiger Nucleinsäuren
US20030233197A1 (en) * 2002-03-19 2003-12-18 Padilla Carlos E. Discrete bayesian analysis of data
EP1501855A4 (en) * 2002-03-21 2006-02-22 Sagres Discovery Inc NEW COMPOSITIONS AND METHODS FOR CANCER
US20030186220A1 (en) * 2002-03-28 2003-10-02 Jizhong Zhou Detecting microorganisms using whole genomic DNA or RNA microarray
US20030195431A1 (en) * 2002-04-10 2003-10-16 Sukhatme Vikas P. Observation of effects of body fluids on indicator cells for disease diagnosis
US7687256B2 (en) * 2002-04-11 2010-03-30 Spire Corporation Surface activated biochip
US8383342B2 (en) 2002-04-24 2013-02-26 The University Of North Carolina At Greensboro Compositions, products, methods and systems to monitor water and other ecosystems
US8048623B1 (en) 2002-04-24 2011-11-01 The University Of North Carolina At Greensboro Compositions, products, methods and systems to monitor water and other ecosystems
US9126165B1 (en) 2002-04-24 2015-09-08 The University Of North Carolina At Greensboro Nucleic acid arrays to monitor water and other ecosystems
US20040023275A1 (en) * 2002-04-29 2004-02-05 Perlegen Sciences, Inc. Methods for genomic analysis
US20040009512A1 (en) * 2002-05-02 2004-01-15 Manuel Ares Arrays for detection of products of mRNA splicing
WO2003094841A2 (en) * 2002-05-06 2003-11-20 Functional Genetics, Inc. Mammalian genes involed in rapamycin resistance and tumorgenesis: annexin xiii genes
US20040018522A1 (en) * 2002-05-09 2004-01-29 Brigham And Women's Hospital, Inc. Identification of dysregulated genes in patients with multiple sclerosis
US7534560B2 (en) * 2002-05-10 2009-05-19 The Board Of Trustees Of The University Of Illinois Simple catalytic DNA biosensors for ions based on color changes
US6890719B2 (en) 2002-05-10 2005-05-10 The Board Of Trustess Of The University Of Illinois Fluorescence based biosensor
US7569343B2 (en) * 2002-06-28 2009-08-04 Rosetta Inpharmatics Llc Methods to assess quality of microarrays
US7504215B2 (en) 2002-07-12 2009-03-17 Affymetrix, Inc. Nucleic acid labeling methods
JP2005532829A (ja) * 2002-07-18 2005-11-04 インヴィトロジェン コーポレーション 組換え部位を含むウイルスベクター
AU2003265525A1 (en) * 2002-08-15 2004-03-19 Functional Genetics, Inc. Mammalian genes involved in rapamycin resistance and tumorgenesis: rapr7 genes
US20060099676A1 (en) * 2002-08-15 2006-05-11 Limin Li Mammalian genes involved in rapamycin resistance and tumorgenesis: rapr6 genes
US20060147924A1 (en) * 2002-09-11 2006-07-06 Ramsing Neils B Population of nucleic acids including a subpopulation of lna oligomers
US7595883B1 (en) 2002-09-16 2009-09-29 The Board Of Trustees Of The Leland Stanford Junior University Biological analysis arrangement and approach therefor
AU2003282885A1 (en) 2002-09-30 2004-04-23 Nimblegen Systems, Inc. Parallel loading of arrays
WO2004031351A2 (en) * 2002-10-01 2004-04-15 Nimblegen Systems, Inc. Microarrays having multiple oligonucleotides in single array features
US20040259105A1 (en) * 2002-10-03 2004-12-23 Jian-Bing Fan Multiplex nucleic acid analysis using archived or fixed samples
US20040067492A1 (en) * 2002-10-04 2004-04-08 Allan Peng Reverse transcription on microarrays
US9453251B2 (en) 2002-10-08 2016-09-27 Pfenex Inc. Expression of mammalian proteins in Pseudomonas fluorescens
US20040161424A1 (en) * 2002-10-08 2004-08-19 Xenoport Human organic solute transporters
US20050003369A1 (en) * 2002-10-10 2005-01-06 Affymetrix, Inc. Method for depleting specific nucleic acids from a mixture
US6863822B2 (en) * 2002-10-16 2005-03-08 Anthony Pipes Method and apparatus for parallel desalting
US20040219565A1 (en) 2002-10-21 2004-11-04 Sakari Kauppinen Oligonucleotides useful for detecting and analyzing nucleic acids of interest
AU2003284921A1 (en) * 2002-10-22 2004-05-13 Iconix Pharmaceuticals, Inc. Reticulocyte depletion signatures
US20040235008A1 (en) * 2002-11-14 2004-11-25 Affymetrix, Inc. Methods and compositions for profiling transcriptionally active sites of the genome
GB0227238D0 (en) * 2002-11-21 2002-12-31 Diagenic As Product and method
US8323897B2 (en) 2002-12-04 2012-12-04 Applied Biosystems, Llc Multiplex amplification of polynucleotides
US7396645B1 (en) 2002-12-17 2008-07-08 Entelos, Inc. Cholestasis signature
US7778782B1 (en) 2002-12-17 2010-08-17 Entelos, Inc. Peroxisome proliferation activated receptor alpha (PPARα) signatures
US7422854B1 (en) 2002-12-20 2008-09-09 Entelos, Inc. Cholesterol reduction signature
US7519519B1 (en) 2002-12-20 2009-04-14 Entelos, Inc. Signature projection score
US7996155B2 (en) 2003-01-22 2011-08-09 Microsoft Corporation ANOVA method for data analysis
EP1592708A2 (en) 2003-02-14 2005-11-09 Sagres Discovery, Inc. Therapeutic gpcr targets in cancer
US7767387B2 (en) * 2003-06-13 2010-08-03 Sagres Discovery, Inc. Therapeutic targets in cancer
US7192703B2 (en) 2003-02-14 2007-03-20 Intel Corporation, Inc. Biomolecule analysis by rolling circle amplification and SERS detection
US20070218071A1 (en) * 2003-09-15 2007-09-20 Morris David W Novel therapeutic targets in cancer
US20060183132A1 (en) * 2005-02-14 2006-08-17 Perlegen Sciences, Inc. Selection probe amplification
US20090124514A1 (en) * 2003-02-26 2009-05-14 Perlegen Sciences, Inc. Selection probe amplification
EP1604040B1 (en) * 2003-03-07 2010-10-13 Rubicon Genomics, Inc. Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process
US8206913B1 (en) 2003-03-07 2012-06-26 Rubicon Genomics, Inc. Amplification and analysis of whole genome and whole transcriptome libraries generated by a DNA polymerization process
US7612185B2 (en) * 2003-03-07 2009-11-03 The Board Of Trustees Of The University Of Illinois Nucleic acid biosensors
US6970240B2 (en) * 2003-03-10 2005-11-29 Applera Corporation Combination reader
FR2852317B1 (fr) 2003-03-13 2006-08-04 Biopuces a sondes et leurs methodes d'utilisation
EP1606419A1 (en) 2003-03-18 2005-12-21 Quantum Genetics Ireland Limited Systems and methods for improving protein and milk production of dairy herds
US20040185451A1 (en) * 2003-03-21 2004-09-23 Leproust Eric M. Methods for detecting the presence of a nucleic acid analyte in a sample
WO2004085614A2 (en) * 2003-03-21 2004-10-07 The Mclean Hospital Corporation Nucleic acid molecules that are differentially regulated in a bipolar disorder and uses thereof
JP2006523465A (ja) 2003-04-14 2006-10-19 ニューゲン テクノロジーズ, インコーポレイテッド ランダムにプライミングされる複合プライマーを用いる大規模増幅
US7892745B2 (en) * 2003-04-24 2011-02-22 Xdx, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US20060177825A1 (en) * 2003-04-29 2006-08-10 Mcdonald John F Global analysis of transposable elements as molecular markers of the developmental potential of stem cells
US20040229224A1 (en) * 2003-05-13 2004-11-18 Perlegen Sciences, Inc. Allele-specific expression patterns
WO2005018534A2 (en) * 2003-05-16 2005-03-03 Rosetta Inpharmatics, Llc Methods and compositions for rna interference
EP1480155A3 (en) * 2003-05-19 2008-12-03 Canon Kabushiki Kaisha Information processing apparatus, information processing method, storage medium and program
DE10322912A1 (de) * 2003-05-21 2004-12-16 Bayer Technology Services Gmbh Verfahren zum Nachweis von Nukleinsäuren
CA2526810A1 (en) * 2003-05-23 2005-04-21 Cold Spring Harbor Laboratory Virtual representations of nucleotide sequences
US20050014168A1 (en) * 2003-06-03 2005-01-20 Arcturus Bioscience, Inc. 3' biased microarrays
US20050221310A1 (en) * 2003-06-06 2005-10-06 Gene Ogic, Inc. Methods for enhancing gene expression analysis
CA2528109A1 (en) * 2003-06-06 2005-01-13 Gene Logic, Inc. Methods for enhancing gene expression analysis
EP3305919A1 (en) 2003-06-10 2018-04-11 The Trustees of Boston University Detection methods for disorders of the lung
US20050064462A1 (en) * 2003-06-17 2005-03-24 Bernd Stein Methods, compositions, and kits for predicting the effect of compounds on hot flash symptoms
WO2005028615A2 (en) * 2003-06-26 2005-03-31 Invitrogen Corporation Methods and compositions for detecting promoter activity and expressing fusion proteins
US20050100911A1 (en) * 2003-08-06 2005-05-12 Perlegen Sciences, Inc. Methods for enriching populations of nucleic acid samples
US20050064483A1 (en) * 2003-08-28 2005-03-24 Baylor College Of Medicine Gene expression profiling technology for treatment evaluation of multiple sclerosis
EP2157524A3 (en) 2003-09-03 2010-12-08 GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Methods for identifying, diagnosing, and predicting survival of lymphomas
US8131475B2 (en) 2003-09-03 2012-03-06 The United States Of America As Represented By The Secretary, Department Of Health And Human Services Methods for identifying, diagnosing, and predicting survival of lymphomas
US7108979B2 (en) * 2003-09-03 2006-09-19 Agilent Technologies, Inc. Methods to detect cross-contamination between samples contacted with a multi-array substrate
US7964344B2 (en) * 2003-09-17 2011-06-21 Canon Kabushiki Kaisha Stable hybrid
US20070281896A1 (en) * 2003-09-30 2007-12-06 Morris David W Novel compositions and methods in cancer
EP1524320A1 (en) * 2003-10-15 2005-04-20 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Rapid determination and quantification of mycoplasma contamination using DNA chip technology
WO2005038052A2 (en) * 2003-10-15 2005-04-28 Altana Pharma Ag Method for identifying interferon mimics
US20050227251A1 (en) 2003-10-23 2005-10-13 Robert Darnell Method of purifying RNA binding protein-RNA complexes
US20050239104A1 (en) * 2003-11-04 2005-10-27 Ferea Tracy L Microarray controls
WO2005047546A2 (en) * 2003-11-05 2005-05-26 Wisconsin Alumni Research Foundation Diagnostic and prognostic methods and compositions for seizure- and plasticity-related disorders
US8304189B2 (en) * 2003-12-01 2012-11-06 Life Technologies Corporation Nucleic acid molecules containing recombination sites and methods of using the same
US7824857B2 (en) * 2003-12-02 2010-11-02 Musc Foundation For Research Development Methods and compositions for diagnosing epithelial cell cancer
EP1541696A1 (en) * 2003-12-09 2005-06-15 Institut Pasteur A DNA macro-array for staphylococcus aureus identification and typing
JP4508632B2 (ja) * 2003-12-25 2010-07-21 キヤノン株式会社 核酸検出方法及び液組成物
US7485419B2 (en) * 2004-01-13 2009-02-03 The Board Of Trustees Of The University Of Illinois Biosensors based on directed assembly of particles
CA2553545A1 (en) * 2004-01-15 2005-08-04 Cigdem F. Dogulu Method evolved for recognition of thrombophilia (mert)
EP1564306B1 (en) 2004-02-17 2013-08-07 Affymetrix, Inc. Methods for fragmenting and labeling DNA
MXPA06009452A (es) 2004-02-19 2007-03-15 Univ Alberta Polimorfismos del promotor de leptin y sus usos.
WO2005084254A2 (en) * 2004-02-27 2005-09-15 Musc Foundation For Research Development Enhanced detection of rna using a panel of truncated gene-specific primers for reverse transcription
US7166433B2 (en) * 2004-03-03 2007-01-23 The United States Of America As Represented By The Department Of Health And Human Services Transductin-1 and transductin-2 and applications to hereditary deafness
WO2005084134A2 (en) * 2004-03-04 2005-09-15 Dena Leshkowitz Quantifying and profiling antibody and t cell receptor gene expression
US7881872B2 (en) * 2004-03-12 2011-02-01 Microsoft Corporation Methods of analyzing multi-channel profiles
ATE549625T1 (de) 2004-03-24 2012-03-15 Tripath Imaging Inc Verfahren und zusammensetzungen zum nachweis einer zervixerkrankung
US7468249B2 (en) * 2004-05-05 2008-12-23 Biocept, Inc. Detection of chromosomal disorders
WO2005117943A2 (en) * 2004-05-27 2005-12-15 Vertex Pharmaceuticals Incorporated Biomarkers for monitoring inhibition of impdh pathway
GB0412301D0 (en) * 2004-06-02 2004-07-07 Diagenic As Product and method
JP4794832B2 (ja) * 2004-07-02 2011-10-19 キヤノン株式会社 核酸検出用プローブセット及び担体
US8965710B2 (en) * 2004-07-02 2015-02-24 The United States Of America, As Represented By The Secretary Of The Navy Automated sample-to-microarray apparatus and method
WO2006017150A2 (en) 2004-07-09 2006-02-16 University Of Pittsburgh - Of The Commonwealth System Of Higher Educatiion Identification of markers in lung and breast cancer
US20060024677A1 (en) 2004-07-20 2006-02-02 Morris David W Novel therapeutic targets in cancer
US8603824B2 (en) 2004-07-26 2013-12-10 Pfenex, Inc. Process for improved protein expression by strain engineering
WO2006029184A2 (en) * 2004-09-08 2006-03-16 Expression Diagnostics, Inc. Genes useful for diagnosing and monitoring inflammation related disorders
US20060073506A1 (en) 2004-09-17 2006-04-06 Affymetrix, Inc. Methods for identifying biological samples
US20080268437A1 (en) * 2004-09-27 2008-10-30 Wan Ji Method of Targeted and Comprehensive Sequencing Using High-Density Oligonucleotide Array
AU2005335216A1 (en) * 2004-10-05 2007-02-15 Wyeth Probe arrays for detecting multiple strains of different species
EP1645640B1 (en) 2004-10-05 2013-08-21 Affymetrix, Inc. Method for detecting chromosomal translocations
EP1529849A3 (en) * 2004-10-06 2005-11-02 De Ceuster NV Reliable method for assessing and reporting the risks of disease, contamination and losses caused by one or more microorganisms in a matrix or environment
US8173367B2 (en) * 2004-10-18 2012-05-08 Sherri Boucher In situ dilution of external controls for use in microarrays
US7682782B2 (en) 2004-10-29 2010-03-23 Affymetrix, Inc. System, method, and product for multiple wavelength detection using single source excitation
JP2006126204A (ja) 2004-10-29 2006-05-18 Affymetrix Inc ポリマーアレイを製造するための自動化方法
US20060094026A1 (en) * 2004-11-03 2006-05-04 Yi Lu Nucleic acid enzyme light-up sensor utilizing invasive DNA
US20090088328A1 (en) * 2004-11-23 2009-04-02 Quest Diagnostics Investments Incorporated Microarray Quality Control
US20060160114A1 (en) * 2004-12-02 2006-07-20 Oncotech, Inc. Reagents and methods for predicting drug resistance
CA2638753A1 (en) 2004-12-08 2006-06-15 Sirion Therapeutics, Inc. Methods, assays and compositions for treating retinol-related diseases
US20060166222A1 (en) * 2005-01-21 2006-07-27 Yi Lu Nucleic acid enzyme ligation sensor
EP1851332A4 (en) * 2005-01-21 2010-05-26 Gene Express Inc METHOD AND COMPOSITIONS FOR THE EVALUATION OF NUCLEIC ACIDS
CA2601922C (en) * 2005-02-18 2020-11-24 Monogram Biosciences, Inc. Methods and compositions for determining anti-hiv drug susceptibility and replication capacity of hiv
US8178291B2 (en) 2005-02-18 2012-05-15 Monogram Biosciences, Inc. Methods and compositions for determining hypersusceptibility of HIV-1 to non-nucleoside reverse transcriptase inhibitors
US20080234265A1 (en) * 2005-03-11 2008-09-25 The Regents Of The University Of Colorado Histone Deacetylase Inhibitors Sensitize Cancer Cells to Epidermal Growth Factor Inhibitors
WO2006102497A2 (en) * 2005-03-22 2006-09-28 The Board Of Trustees Of The Leland Stanford Junior University Methods and compositions for diagnosis, monitoring and development of therapeutics for treatment of atherosclerotic disease
US20060246576A1 (en) * 2005-04-06 2006-11-02 Affymetrix, Inc. Fluidic system and method for processing biological microarrays in personal instrumentation
AU2006235276A1 (en) 2005-04-07 2006-10-19 Novartis Vaccines And Diagnostics Inc. CACNA1E in cancer diagnosis, detection and treatment
EP1871911A2 (en) 2005-04-07 2008-01-02 Chiron Corporation Cancer-related genes (prlr)
US20100035244A1 (en) 2005-04-14 2010-02-11 The Trustees Of Boston University Diagnostic for lung disorders using class prediction
EP1885889A4 (en) * 2005-05-11 2010-01-20 Expression Diagnostics Inc METHOD FOR MONITORING THE OPERATING STATUS OF TRANSPLANTS OVER GENLISTS
US20070072175A1 (en) * 2005-05-13 2007-03-29 Biogen Idec Ma Inc. Nucleotide array containing polynucleotide probes complementary to, or fragments of, cynomolgus monkey genes and the use thereof
JP2006322741A (ja) * 2005-05-17 2006-11-30 Canon Inc プローブアレイを用いたハイブリダイゼーションデータ処理方法
WO2006125117A2 (en) 2005-05-18 2006-11-23 Novartis Ag Methods for diagnosis and treatment of diseases having an autoimmune and/or inflammatory component
EP2458018A3 (en) 2005-05-27 2012-07-25 Monogram BioSciences, Inc. Methods and compositions for determining resistance of HIV-1 to protease inhibitors
WO2006133267A2 (en) 2005-06-06 2006-12-14 Monogram Biosciences, Inc. Methods and compositions for determining altered susceptibility of hiv-1 to anti-hiv drugs
US9506121B2 (en) * 2005-06-06 2016-11-29 Monogram Biosciences, Inc. Methods for determining resistance or susceptibility to HIV entry inhibitors
US20070072205A1 (en) * 2005-06-09 2007-03-29 Yi Lu Nanomaterial error correction
CN1908189A (zh) * 2005-08-02 2007-02-07 博奥生物有限公司 体外辅助鉴定肠型胃癌及其分化程度的方法与专用试剂盒
US20070029205A1 (en) * 2005-08-08 2007-02-08 Shoou-Aaey Chen Method of surface treatment for metal and nonmetal surfaces
US7892734B2 (en) * 2005-08-11 2011-02-22 The Board Of Trustees Of The University Of Illinois Aptamer based colorimetric sensor systems
WO2007030759A2 (en) * 2005-09-07 2007-03-15 Nugen Technologies, Inc. Improved nucleic acid amplification procedure
CN102622746B (zh) 2005-09-21 2016-05-25 卢米尼克斯股份有限公司 图像数据处理的方法和系统
US20070134690A1 (en) * 2005-10-07 2007-06-14 Baylor Research Institute Diagnosis of systemic onset juvenile idiopathic arthritis through blood leukocyte microarray analysis
CA2624896C (en) 2005-10-07 2017-11-07 Callida Genomics, Inc. Self-assembled single molecule arrays and uses thereof
US20070092904A1 (en) * 2005-10-19 2007-04-26 Biogen Idec Ma Inc. Method for preparing limiting quantities of nucleic acids
US20070092903A1 (en) * 2005-10-24 2007-04-26 Fulmer-Smentek Stephanie B One-color microarray analysis methods, reagents and kits
US20080311585A1 (en) * 2005-11-02 2008-12-18 Affymetrix, Inc. System and method for multiplex liquid handling
US8075852B2 (en) * 2005-11-02 2011-12-13 Affymetrix, Inc. System and method for bubble removal
US20080038714A1 (en) * 2005-11-02 2008-02-14 Affymetrix, Inc. Instrument to Pneumatically Control Lab Cards and Method Thereof
US20070099288A1 (en) * 2005-11-02 2007-05-03 Affymetrix, Inc. Microfluidic Methods, Devices, and Systems for Fluid Handling
US8007267B2 (en) * 2005-11-02 2011-08-30 Affymetrix, Inc. System and method for making lab card by embossing
WO2007142692A2 (en) * 2005-11-14 2007-12-13 The Government Of The Usa, As Represented By The Secretary Of The Navy Automated sample-to-microarray system
US20070128611A1 (en) * 2005-12-02 2007-06-07 Nelson Charles F Negative control probes
US7634363B2 (en) 2005-12-07 2009-12-15 Affymetrix, Inc. Methods for high throughput genotyping
US20090215055A1 (en) * 2005-12-13 2009-08-27 Erasmus University Medical Center Rotterdam Genetic Brain Tumor Markers
JP4890936B2 (ja) * 2005-12-13 2012-03-07 岩手県 25塩基を超えるタグを固定化したアレイ(SuperSAGE−Array)による遺伝子発現解析
US20070212710A1 (en) * 2005-12-30 2007-09-13 Affymetrix, Inc. Competitive hybridization of dna probes and method of using the same
EP1989326A4 (en) 2006-01-17 2009-09-30 Health Research Inc BIO-HETERODUPLEX TRACKING TEST
WO2007084767A2 (en) * 2006-01-20 2007-07-26 University Of South Florida Methods for profiling transcriptosomes
EP2363711A1 (en) 2006-01-27 2011-09-07 Tripath Imaging, Inc. Methods for identifying patients with an increased likelihood of having ovarian cancer and compositions therefor
WO2007097876A2 (en) * 2006-02-15 2007-08-30 Agilent Technologies, Inc. Normalization probes for comparative genome hybridization arrays
WO2007103541A2 (en) 2006-03-09 2007-09-13 The Trustees Of Boston University Diagnostic and prognostic methods for lung disorders using gene expression profiles from nose epithelial cells
US7799554B2 (en) * 2006-03-16 2010-09-21 The Board Of Trustees Of The University Of Illinois Lateral flow devices
EP2389947A1 (en) 2006-03-23 2011-11-30 Novartis AG Anti-tumor cell antigen antibody therapeutics
EP2007909A4 (en) * 2006-04-07 2011-01-26 Xdx Inc EXPRESSION OF NUCLEIC ACID IN RESPONSE TO STEROIDS AND PREDICTION OF DISEASE ACTIVITY
EP2010917B1 (en) 2006-04-10 2012-06-27 Trustees of Boston University Melanoma biomarker and methods of uses
US20080070268A1 (en) * 2006-04-21 2008-03-20 Wyeth Differential expression profiling analysis of cell culture phenotypes and the uses thereof
US8383338B2 (en) * 2006-04-24 2013-02-26 Roche Nimblegen, Inc. Methods and systems for uniform enrichment of genomic regions
KR100772897B1 (ko) * 2006-05-02 2007-11-05 삼성전자주식회사 향상된 잡음률을 나타내는 올리고머 프로브 어레이 및 그제조 방법
US10522240B2 (en) 2006-05-03 2019-12-31 Population Bio, Inc. Evaluating genetic disorders
US7702468B2 (en) 2006-05-03 2010-04-20 Population Diagnostics, Inc. Evaluating genetic disorders
WO2007136797A1 (en) * 2006-05-18 2007-11-29 The Mclean Hospital Corporation Methods for diagnosis and prognosis of psychotic disorders
RU2008150483A (ru) 2006-05-22 2010-06-27 Клиникал Дженомикс Пти Лтд (Au) Способ выявления
US7759062B2 (en) * 2006-06-09 2010-07-20 Third Wave Technologies, Inc. T-structure invasive cleavage assays, consistent nucleic acid dispensing, and low level target nucleic acid detection
EP2589668A1 (en) 2006-06-14 2013-05-08 Verinata Health, Inc Rare cell analysis using sample splitting and DNA tags
WO2007147079A2 (en) 2006-06-14 2007-12-21 Living Microsystems, Inc. Rare cell analysis using sample splitting and dna tags
US7629124B2 (en) * 2006-06-30 2009-12-08 Canon U.S. Life Sciences, Inc. Real-time PCR in micro-channels
EP2520935A3 (en) 2006-08-09 2013-02-13 Homestead Clinical Corporation Organ-specific proteins and methods of their use
WO2008021431A2 (en) * 2006-08-14 2008-02-21 Xdx, Inc. Methods and compositions for diagnosing and monitoring the status of transplant rejection and immune disorders
WO2008021115A2 (en) * 2006-08-14 2008-02-21 The Brigham And Women's Hospital, Inc. Diagnostic tests using gene expression ratios
US20080118910A1 (en) * 2006-08-31 2008-05-22 Milligan Stephen B Control nucleic acid constructs for use with genomic arrays
US7985542B2 (en) * 2006-09-07 2011-07-26 Institut Pasteur Genomic morse code
WO2008048986A2 (en) * 2006-10-17 2008-04-24 Children's Hospital Medical Center Gene array technique for predicting response in inflammatory bowel diseases
US9845494B2 (en) 2006-10-18 2017-12-19 Affymetrix, Inc. Enzymatic methods for genotyping on arrays
US20080102452A1 (en) * 2006-10-31 2008-05-01 Roberts Douglas N Control nucleic acid constructs for use in analysis of methylation status
EP2450456A3 (en) 2006-11-02 2012-08-01 Yale University Assessment of oocyte competence
US8148067B2 (en) * 2006-11-09 2012-04-03 Xdx, Inc. Methods for diagnosing and monitoring the status of systemic lupus erythematosus
US8293684B2 (en) * 2006-11-29 2012-10-23 Exiqon Locked nucleic acid reagents for labelling nucleic acids
US20080131878A1 (en) * 2006-12-05 2008-06-05 Asuragen, Inc. Compositions and Methods for the Detection of Small RNA
WO2008073920A2 (en) * 2006-12-08 2008-06-19 Asuragen, Inc. Mir-21 regulated genes and pathways as targets for therapeutic intervention
DK2104737T3 (da) * 2006-12-08 2013-05-27 Asuragen Inc Funktioner og formål for let-7 mikro-RNAer
WO2008073915A2 (en) * 2006-12-08 2008-06-19 Asuragen, Inc. Micrornas differentially expressed in leukemia and uses thereof
EP2104734A2 (en) * 2006-12-08 2009-09-30 Asuragen, INC. Mir-20 regulated genes and pathways as targets for therapeutic intervention
CA2671270A1 (en) * 2006-12-29 2008-07-17 Asuragen, Inc. Mir-16 regulated genes and pathways as targets for therapeutic intervention
US8415461B2 (en) * 2007-01-19 2013-04-09 The Board Of Trustees Of The University Of Illinois Amphiphilic substances and functionalized lipid vesicles including the same
WO2008106115A2 (en) 2007-02-26 2008-09-04 Monogram Biosciences, Inc. Compositions and methods for determining whether a subject would benefit from co-receptor inhibitor therapy
US20080207960A1 (en) * 2007-02-28 2008-08-28 Eric Lin Methods, compositions, and kits for post-hybridization processing of arrays
US20080268442A1 (en) * 2007-04-24 2008-10-30 Igd Intel, Llc Method and system for preparing a blood sample for a disease association gene transcript test
US8058415B2 (en) 2007-04-24 2011-11-15 The Board Of Trustees Of The University Of Illinois Aptamer- and nucleic acid enzyme-based systems for simultaneous detection of multiple analytes
JP5444553B2 (ja) 2007-04-27 2014-03-19 フェネックス インコーポレイテッド 微生物宿主を迅速にスクリーニングして、異種タンパク質発現の収率および/または質が改善されている特定の株を同定する方法
US9580719B2 (en) 2007-04-27 2017-02-28 Pfenex, Inc. Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins
US9096849B2 (en) * 2007-05-21 2015-08-04 The United States Of America, As Represented By The Secretary Of The Navy Solid phase for capture of nucleic acids
US20090232893A1 (en) * 2007-05-22 2009-09-17 Bader Andreas G miR-143 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
JP2010529966A (ja) * 2007-06-08 2010-09-02 アシュラジェン インコーポレイテッド 治療的介入の標的としてmiR−34によって調節される遺伝子および経路
WO2008157299A2 (en) * 2007-06-15 2008-12-24 Wyeth Differential expression profiling analysis of cell culture phenotypes and uses thereof
WO2009009662A1 (en) * 2007-07-10 2009-01-15 University Of South Florida Method of predicting non-response to first line chemotherapy
US8409800B2 (en) * 2007-07-16 2013-04-02 The Board Of Trustees Of The University Of Illinois Nucleic acid based fluorescent sensor for copper detection
US8568690B2 (en) * 2007-07-31 2013-10-29 The Board Of Trustees Of The University Of Illinois MRI contrast agents and high-throughput screening by MRI
US8367416B2 (en) 2007-08-10 2013-02-05 The Board Of Trustees Of The University Of Illinois Nucleic acid based fluorescent sensor for mercury detection
US8361714B2 (en) * 2007-09-14 2013-01-29 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
US9388457B2 (en) * 2007-09-14 2016-07-12 Affymetrix, Inc. Locus specific amplification using array probes
US8716190B2 (en) 2007-09-14 2014-05-06 Affymetrix, Inc. Amplification and analysis of selected targets on solid supports
US20090186015A1 (en) * 2007-10-18 2009-07-23 Latham Gary J Micrornas differentially expressed in lung diseases and uses thereof
WO2009052573A1 (en) 2007-10-23 2009-04-30 Clinical Genomics Pty. Ltd. A method of diagnosing neoplasms
CN110079598A (zh) 2007-10-23 2019-08-02 临床基因组学有限公司 诊断新生物的方法–ii
US8135545B2 (en) 2007-11-09 2012-03-13 Iverson Genetic Diagnostics, Inc. System and method for collecting data regarding broad-based neurotoxin-related gene mutation association
US20090125244A1 (en) * 2007-11-09 2009-05-14 Igd Intel Llc Broad-based neurotoxin-related gene mutation association from a gene transcript test
DE102007055386B4 (de) * 2007-11-20 2015-07-16 Boehringer Ingelheim Vetmedica Gmbh Verfahren zur Kalibrierung eines Sensorelements
US8071562B2 (en) * 2007-12-01 2011-12-06 Mirna Therapeutics, Inc. MiR-124 regulated genes and pathways as targets for therapeutic intervention
WO2009075799A2 (en) * 2007-12-05 2009-06-18 The Wistar Institute Of Anatomy And Biology Method for diagnosing lung cancers using gene expression profiles in peripheral blood mononuclear cells
WO2009086215A2 (en) * 2007-12-21 2009-07-09 Wyeth Pathway analysis of cell culture phenotypes and uses thereof
WO2009086156A2 (en) * 2007-12-21 2009-07-09 Asuragen, Inc. Mir-10 regulated genes and pathways as targets for therapeutic intervention
ES2990227T3 (es) * 2008-01-17 2024-11-29 Sequenom Inc Composiciones y procedimientos de análisis de ácido nucleico de secuencia única
US20090263803A1 (en) * 2008-02-08 2009-10-22 Sylvie Beaudenon Mirnas differentially expressed in lymph nodes from cancer patients
US20090203531A1 (en) * 2008-02-12 2009-08-13 Nurith Kurn Method for Archiving and Clonal Expansion
JP5683964B2 (ja) 2008-03-11 2015-03-11 ナショナル キャンサー センター Snpアレイを用いた染色体、遺伝子または特定ヌクレオチド配列のコピー数測定方法
GB2470672B (en) 2008-03-21 2012-09-12 Nugen Technologies Inc Methods of RNA amplification in the presence of DNA
EP2271757A2 (en) * 2008-03-26 2011-01-12 Asuragen, INC. Compositions and methods related to mir-16 and therapy of prostate cancer
GB0809069D0 (en) 2008-05-19 2008-06-25 Univ Leuven Kath Gene signatures
WO2009126726A1 (en) * 2008-04-08 2009-10-15 Asuragen, Inc Methods and compositions for diagnosing and modulating human papillomavirus (hpv)
WO2009137369A1 (en) * 2008-05-03 2009-11-12 Tufts Medical Center, Inc. Neonatal salivary genomics
DK2297359T3 (en) 2008-05-30 2014-02-24 Univ Utah Res Found Gene expression profiles to predict the outcome of breast cancer
US20100105039A1 (en) * 2008-06-03 2010-04-29 Yi Lu Label-free colorimetric detection
US20110195064A1 (en) * 2008-06-06 2011-08-11 The United States Of America, As Represented By The Secretary, Department Of Health And Human Serv Survival predictor for diffuse large b cell lymphoma
US8255167B2 (en) 2008-08-14 2012-08-28 Regeneron Pharmaceuticals, Inc. Non-hypergeometric overlap probability
US8583380B2 (en) 2008-09-05 2013-11-12 Aueon, Inc. Methods for stratifying and annotating cancer drug treatment options
US9186128B2 (en) 2008-10-01 2015-11-17 Covidien Lp Needle biopsy device
US11298113B2 (en) 2008-10-01 2022-04-12 Covidien Lp Device for needle biopsy with integrated needle protection
US9782565B2 (en) 2008-10-01 2017-10-10 Covidien Lp Endoscopic ultrasound-guided biliary access system
US8968210B2 (en) 2008-10-01 2015-03-03 Covidien LLP Device for needle biopsy with integrated needle protection
US9332973B2 (en) 2008-10-01 2016-05-10 Covidien Lp Needle biopsy device with exchangeable needle and integrated needle protection
US8062893B2 (en) 2008-10-10 2011-11-22 The Board Of Trustees Of The University Of Illinois Fluorescent sensor for mercury
US20100112643A1 (en) * 2008-11-04 2010-05-06 The Government Of The United States Of America, As Represented By The Secretary Of The Navy Method for direct capture of ribonucleic acid
WO2010054233A1 (en) 2008-11-08 2010-05-14 The Wistar Institute Of Anatomy And Biology Biomarkers in peripheral blood mononuclear cells for diagnosing or detecting lung cancers
US20100179213A1 (en) * 2008-11-11 2010-07-15 Mirna Therapeutics, Inc. Methods and Compositions Involving miRNAs In Cancer Stem Cells
EP2192197A1 (en) 2008-11-27 2010-06-02 Vereniging voor christelijk hoger onderwijs, wetenschappelijk onderzoek en patiëntenzorg Predicting clinical response to treatment with a soluble tnf-antagonist or tnf, or a tnf receptor agonist
US8530167B2 (en) 2009-02-09 2013-09-10 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Diagnostic and therapeutic uses of GNPTAB, GNPTG, and NAGPA in stuttering
EP2408905B1 (en) 2009-03-16 2017-05-10 Pangu Biopharma Limited Compositions and methods comprising histidyl-trna synthetase splice variants having non-canonical biological activities
CN102449143B (zh) 2009-03-31 2017-11-14 Atyr医药公司 包含具有非常规生物活性的天冬氨酰‑tRNA合成酶的组合物和方法
CA2763199A1 (en) 2009-05-29 2010-12-02 The Regents Of The Univeristy Of California B cell signature associated with tolerance in transplant recipients
HUE026447T2 (en) 2009-10-16 2016-05-30 Novartis Ag Pharmacodynamic tumor response biomarkers
EP2496944A2 (en) 2009-11-05 2012-09-12 Novartis AG Biomarkers predictive of progression of fibrosis
US8501122B2 (en) 2009-12-08 2013-08-06 Affymetrix, Inc. Manufacturing and processing polymer arrays
US20110152109A1 (en) * 2009-12-21 2011-06-23 Gardner Shea N Biological sample target classification, detection and selection methods, and related arrays and oligonucleotide probes
CN102713632B (zh) 2009-12-23 2015-10-07 希尔氏宠物营养品公司 用于诊断和治疗犬肾脏病症的组合物和方法
JP2013519869A (ja) 2010-02-10 2013-05-30 ノバルティス アーゲー 筋肉成長のための方法および化合物
JP5197661B2 (ja) * 2010-03-15 2013-05-15 キヤノン株式会社 核酸検出用プローブ担体
US8383793B2 (en) 2010-04-15 2013-02-26 St. Jude Children's Research Hospital Methods and compositions for the diagnosis and treatment of cancer resistant to anaplastic lymphoma kinase (ALK) kinase inhibitors
US8980253B2 (en) 2010-04-26 2015-03-17 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of cysteinyl-tRNA synthetase
CA2797362C (en) 2010-04-27 2020-12-08 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of isoleucyl trna synthetases
WO2011139853A2 (en) 2010-04-28 2011-11-10 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of alanyl trna synthetases
CA2800557A1 (en) 2010-04-29 2011-11-03 Medical Prognosis Institute A/S Methods and devices for predicting treatment efficacy
CA2797393C (en) 2010-04-29 2020-03-10 Pangu Biopharma Limited Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of valyl trna synthetases
CA2797374C (en) 2010-04-29 2021-02-16 Pangu Biopharma Limited Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of asparaginyl trna synthetases
CN103096912A (zh) 2010-05-03 2013-05-08 Atyr医药公司 与苯丙氨酰-α-tRNA合成酶的蛋白片段相关的治疗、诊断和抗体组合物的创新发现
CN103140233B (zh) 2010-05-03 2017-04-05 Atyr 医药公司 与甲硫氨酰‑tRNA合成酶的蛋白片段相关的治疗、诊断和抗体组合物的发现
US8961961B2 (en) 2010-05-03 2015-02-24 a Tyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related protein fragments of arginyl-tRNA synthetases
JP6008844B2 (ja) 2010-05-04 2016-10-19 エータイアー ファーマ, インコーポレイテッド p38MULTI−tRNA合成酵素複合体のタンパク質フラグメントに関連した治療用、診断用および抗体組成物の革新的発見
EP2568996B1 (en) 2010-05-14 2017-10-04 aTyr Pharma, Inc. Therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-beta-trna synthetases
CN103096914B (zh) 2010-05-17 2015-08-12 Atyr医药公司 与亮氨酰-tRNA合成酶的蛋白片段相关的治疗、诊断和抗体组合物的创新发现
CA2800375C (en) 2010-05-27 2021-03-09 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glutaminyl-trna synthetases
EP2390346A1 (en) 2010-05-28 2011-11-30 Universiteit Twente Osteoarthrosis markers
EP2575857B1 (en) 2010-06-01 2018-01-24 aTyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of lysyl-trna synthetases
CN107898791A (zh) 2010-06-03 2018-04-13 药品循环有限责任公司 布鲁顿酪氨酸激酶(btk)抑制剂的应用
CA2801107A1 (en) 2010-06-07 2011-12-15 F. Hoffman-La Roche Ag Gene expression markers for predicting response to interleukin-6 receptor-inhibiting monoclonal antibody drug treatment
EP2593125B1 (en) 2010-07-12 2017-11-01 aTyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glycyl-trna synthetases
US8815156B2 (en) 2010-07-19 2014-08-26 Andalyze, Inc. Sensor housing and reagent chemistry
CN103392182B (zh) 2010-08-02 2017-07-04 众有生物有限公司 用于发现遗传疾病中致病突变的系统和方法
EP2603227B1 (en) 2010-08-12 2017-10-04 Fate Therapeutics, Inc. Improved hematopoietic stem and progenitor cell therapy
ES2704303T3 (es) 2010-08-24 2019-03-15 Dana Farber Cancer Inst Inc Procedimientos para la predicción de una respuesta contra el cáncer
AU2011293294B2 (en) 2010-08-25 2016-03-24 Pangu Biopharma Limited Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of Tyrosyl-tRNA synthetases
WO2012068170A2 (en) 2010-11-15 2012-05-24 Jau-Nan Lee Generation of neural stem cells from human trophoblast stem cells
CA2819538A1 (en) 2010-11-30 2012-06-07 Vereniging Voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek En Patientenzorg Method for prognosticating the clinical response of a patient to b-lymphocyte inhibiting or depleting therapy in interferon driven diseases such as sle.
CA2819378A1 (en) 2010-12-02 2012-06-07 Katholieke Universiteit Leuven, K.U.Leuven R&D Irak-related interventions and diagnosis
JP5808825B2 (ja) 2011-02-24 2015-11-10 ヒルズ・ペット・ニュートリシャン・インコーポレーテッド ネコの腎障害を診断および治療する組成物および方法
WO2012119129A1 (en) 2011-03-02 2012-09-07 Berg Biosystems, Llc Interrogatory cell-based assays and uses thereof
WO2012119077A1 (en) 2011-03-02 2012-09-07 Morphotek Inc. Co -administration of eribulin and farletuzumab for the treatment of breast cancer
AU2012229123B2 (en) 2011-03-15 2017-02-02 British Columbia Cancer Agency Branch Methods of treating breast cancer with anthracycline therapy
US10184942B2 (en) 2011-03-17 2019-01-22 University Of South Florida Natriuretic peptide receptor as a biomarker for diagnosis and prognosis of cancer
EP2686441B1 (en) 2011-03-18 2019-05-08 Eisai R&D Management Co., Ltd. Methods and uses for predicting response to eribulin
US9777332B2 (en) 2011-03-31 2017-10-03 St. Jude Children's Research Hospital Methods and compositions for identifying minimal residual disease in acute lymphoblastic leukemia
CA2836836A1 (en) 2011-06-01 2012-12-06 Medical Prognosis Institute A/S Methods and devices for prognosis of cancer relapse
RU2593952C2 (ru) 2011-06-15 2016-08-10 Хилл'С Пет Ньютришн, Инк. Композиции и способы для диагностики и мониторинга гипертиреоза у животных семейства кошачьих
EP4563709A3 (en) 2011-06-17 2025-09-03 Myriad Genetics, Inc. Methods and materials for assessing allelic imbalance
US20140275211A1 (en) 2011-06-21 2014-09-18 Alnylam Pharmaceuticals, Inc. Assays and methods for determining activity of a therapeutic agent in a subject
CA2851388C (en) 2011-10-10 2023-11-21 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
KR101979287B1 (ko) 2011-10-18 2019-08-28 루미넥스 코포레이션 이미지 데이터를 처리하기 위한 방법 및 시스템
US10100092B2 (en) 2011-11-03 2018-10-16 Vca, Inc. Compositions and methods to detect various infectious organisms
WO2013067451A2 (en) 2011-11-04 2013-05-10 Population Diagnostics Inc. Methods and compositions for diagnosing, prognosing, and treating neurological conditions
WO2013075065A1 (en) 2011-11-18 2013-05-23 Memorial Sloan-Kettering Cancer Center 2-hydroxyglutarate as a biomarker for chronic hypoxia
CA2857597A1 (en) 2011-11-30 2013-06-06 AbbVie Deutschland GmbH & Co. KG Methods and compositions for determining responsiveness to treatment with a tnf-alpha inhibitor
US8748097B1 (en) 2011-12-02 2014-06-10 President And Fellows Of Harvard College Identification of agents for treating calcium disorders and uses thereof
CN104039823A (zh) 2011-12-19 2014-09-10 希尔氏宠物营养品公司 用于诊断和治疗伴侣动物的甲状腺机能亢进的组合物和方法
US9850541B2 (en) 2011-12-19 2017-12-26 Valley Health System Methods and kits for detecting subjects at risk of having cancer
CN107267598B (zh) 2011-12-21 2022-03-25 美瑞德生物工程公司 用于评估杂合性丢失的方法与材料
JP6012767B2 (ja) 2012-02-07 2016-10-25 ヴィブラント ホールディングス リミテッド ライアビリティ カンパニー 基板、ペプチドアレイ、および方法
US10407724B2 (en) 2012-02-09 2019-09-10 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
MX356107B (es) 2012-02-16 2018-05-15 Atyr Pharma Inc Histidil-arnt sintetasas para tratar enfermedades autoinmunes e inflamatorias.
AU2013222414B2 (en) 2012-02-21 2018-02-15 Cytonics Corporation Systems, compositions, and methods for transplantation
WO2013130347A1 (en) 2012-02-23 2013-09-06 The Children's Hospital Corporation Methods for predicting anti-cancer response
MX375673B (es) 2012-04-02 2025-03-06 Berg Llc Ensayos basados en interrogatorios celulares y usos de los mismos.
EP2834371B1 (en) 2012-04-05 2019-01-09 The Regents of The University of California Gene expression panel for breast cancer prognosis
AU2013266419B2 (en) 2012-05-22 2018-09-27 British Columbia Cancer Agency Branch NANO46 genes and methods to predict breast cancer outcome
ES2658867T3 (es) 2012-06-07 2018-03-12 Institut Curie Métodos para detectar la inactivación de la ruta de recombinación homóloga (BRCA1/2) en tumores humanos
EP2861989A4 (en) 2012-06-15 2016-03-02 Univ Wayne State BIOMARK TEST FOR PREDICTING OR EARLY IDENTIFICATION OF PRE-LAMPSY AND / OR HELLP SYNDROME
EP3339861B8 (en) 2012-06-15 2023-11-01 Genesis Theranostix Korlatolt Felelossegu Tarsasag Biomarker test for prediction or early detection of preeclampsia
JP2015524397A (ja) 2012-07-20 2015-08-24 ラトローブ ユニヴァーシティ 診断及び処置の方法
CN104704129A (zh) 2012-07-24 2015-06-10 药品循环公司 与对布鲁顿酪氨酸激酶(btk)抑制剂的抗性相关的突变
EP3626309B1 (en) 2012-08-13 2023-03-08 The Rockefeller University Lxrbeta agonist for the treatment of cancer
EP2895621B1 (en) 2012-09-14 2020-10-21 Population Bio, Inc. Methods and compositions for diagnosing, prognosing, and treating neurological conditions
US10233495B2 (en) 2012-09-27 2019-03-19 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10006909B2 (en) 2012-09-28 2018-06-26 Vibrant Holdings, Llc Methods, systems, and arrays for biomolecular analysis
EP3736022A3 (en) 2012-10-31 2021-01-20 The Rockefeller University Treatment and diagnosis of colon cancer
US10286376B2 (en) 2012-11-14 2019-05-14 Vibrant Holdings, Llc Substrates, systems, and methods for array synthesis and biomolecular analysis
US10260103B2 (en) 2012-11-27 2019-04-16 Pontificia Universidad Catolica De Chile Compositions and methods for diagnosing thyroid tumors
CN113604423B (zh) 2012-11-30 2025-06-03 艾克塞利瑞提德生物技术公司 通过调节mir-124分化干细胞的方法
WO2014113804A1 (en) 2013-01-21 2014-07-24 Abbvie Inc. Anti-tnf and anti-il17 combination therapy biomarkers for inflammatory disease
EP2956771B1 (en) 2013-02-15 2020-04-08 Vibrant Holdings, LLC Methods and compositions for amplified electrochemiluminescence detection
CA2902068C (en) 2013-02-28 2023-10-03 Caprion Proteomics Inc. Tuberculosis biomarkers and uses thereof
WO2014160080A1 (en) 2013-03-14 2014-10-02 Children's Medical Center Corporation Cancer diagnosis, treatment selection and treatment
WO2014195032A1 (en) 2013-06-07 2014-12-11 Medical Prognosis Institute A/S Methods and devices for predicting treatment efficacy of fulvestrant in cancer patients
CA2922806A1 (en) 2013-08-28 2015-03-05 Cytonics Corporation Systems, compositions, and methods for transplantation and treating conditions utilizing a composition comprising a wild-type or a variant a2m polypeptide or portion thereof
EP3044332A1 (en) 2013-09-09 2016-07-20 British Columbia Cancer Agency Branch Methods and kits for predicting outcome and methods and kits for treating breast cancer with radiation therapy
WO2015051122A2 (en) 2013-10-02 2015-04-09 The Board Of Trustees Of The Leland Stanford Junior University Wnt compositions and methods for purification
US10607717B2 (en) 2013-11-06 2020-03-31 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Method for subtyping lymphoma types by means of expression profiling
DK2891722T3 (en) 2013-11-12 2019-01-07 Population Bio Inc METHODS AND COMPOSITIONS FOR DIAGNOSTICING, PROGRAMMING AND TREATMENT OF ENDOMETRIOSIS
EP3080292B1 (en) 2013-12-09 2022-02-02 Institut Curie Methods for detecting inactivation of the homologous recombination pathway (brca1/2) in human tumors
DK3110973T3 (da) 2014-02-27 2019-05-13 Univ Leuven Kath Oxidativt stress og kardiovaskulære sygdomshændelser
US10704097B2 (en) 2014-02-27 2020-07-07 Katholieke Universiteit Leuven Oxidative stress and cardiovascular disease events
EP3110971B1 (en) 2014-02-27 2019-05-08 The Broad Institute Inc. T cell balance gene expression and methods of use thereof
WO2015143400A1 (en) 2014-03-20 2015-09-24 Pharmacyclics, Inc. Phospholipase c gamma 2 and resistance associated mutations
US20170029896A1 (en) * 2014-04-10 2017-02-02 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Prognostic kits, arrays compositions and methods for predicting interferon treatment efficacy in a subject
US10829819B2 (en) 2014-05-30 2020-11-10 Genecentric Therapeutics, Inc. Methods for typing of lung cancer
EP3149210B1 (en) 2014-06-02 2020-08-05 Valley Health System Method for lung cancer diagnosis
US20160000936A1 (en) 2014-06-10 2016-01-07 Abbvie Inc. Biomarkers for inflammatory disease and methods of using same
CA2954764A1 (en) 2014-07-15 2016-01-21 Ontario Institute For Cancer Research Methods and devices for predicting anthracycline treatment efficacy
EP4234711B1 (en) 2014-08-15 2025-05-28 Myriad Genetics, Inc. Methods and materials for assessing homologous recombination deficiency
GB2558326B (en) 2014-09-05 2021-01-20 Population Bio Inc Methods and compositions for inhibiting and treating neurological conditions
WO2016085876A1 (en) 2014-11-25 2016-06-02 The Broad Institute Inc. Clonal haematopoiesis
EP3224381B1 (en) 2014-11-25 2019-09-04 The Brigham and Women's Hospital, Inc. Method of identifying a person having a predisposition to or afflicted with a cardiometabolic disease
SG10202009095VA (en) 2014-11-26 2020-10-29 Accelerated Biosciences Corp Induced hepatocytes and uses thereof
SG10202012249YA (en) 2014-12-08 2021-01-28 Berg Llc Use of markers including filamin a in the diagnosis and treatment of prostate cancer
SG11201704425TA (en) 2014-12-12 2017-06-29 Medivation Prostate Therapeutics Inc Method for predicting response to breast cancer therapeutic agents and method of treatment of breast cancer
USRE50172E1 (en) 2014-12-19 2024-10-15 Vrije Universiteit Brussel In vitro maturation of a mammalian cumulus oocyte complex
EP3262193A2 (en) 2015-02-26 2018-01-03 The Broad Institute Inc. T cell balance gene expression, compositions of matters and methods of use thereof
EP3328440A4 (en) 2015-07-28 2019-01-16 Otonomy, Inc. TREATMENT WITH REDUCED TRK-B AND TRK-C ANTAGONISTS
EP3362580B1 (en) 2015-10-18 2021-02-17 Affymetrix, Inc. Multiallelic genotyping of single nucleotide polymorphisms and indels
WO2017136892A1 (en) 2016-02-11 2017-08-17 La Trobe University Method of diagnosis
WO2017140659A1 (en) 2016-02-15 2017-08-24 F. Hoffmann-La Roche Ag System and method for targeted depletion of nucleic acids
US10472666B2 (en) * 2016-02-15 2019-11-12 Roche Sequencing Solutions, Inc. System and method for targeted depletion of nucleic acids
ES3039958T3 (en) 2016-04-04 2025-10-27 Sinopia Biosciences Inc Treating levodopa-induced dyskinesia using trapidil
JP7075896B2 (ja) 2016-04-20 2022-05-26 アメリカ合衆国 マントル細胞リンパ腫の評価及びそれに関連する方法
CN109790583B (zh) 2016-05-17 2023-08-25 基因中心治疗公司 对肺腺癌亚型分型的方法
US11041214B2 (en) 2016-05-17 2021-06-22 Genecentric Therapeutics, Inc. Methods for subtyping of lung squamous cell carcinoma
EP3260552A1 (en) 2016-06-20 2017-12-27 Istituto Europeo di Oncologia (IEO) Methods and kits comprising gene signatures for stratifying breast cancer patients
WO2018013883A1 (en) 2016-07-14 2018-01-18 Caprion Proteomics Inc. Biomarkers of latent tuberculosis infection
US11725232B2 (en) 2016-10-31 2023-08-15 The Hong Kong University Of Science And Technology Compositions, methods and kits for detection of genetic variants for alzheimer's disease
US20180195115A1 (en) 2016-12-22 2018-07-12 Illumina, Inc. Arrays with quality control tracers
US10240205B2 (en) 2017-02-03 2019-03-26 Population Bio, Inc. Methods for assessing risk of developing a viral disease using a genetic test
US20200131576A1 (en) 2017-04-25 2020-04-30 The Brigham And Women's Hospital, Inc. IL-8, IL-6, IL-1 Beta and TET2 and DNMT3A in Atherosclerosis
US10538808B2 (en) 2017-05-26 2020-01-21 Vibrant Holdings, Llc Photoactive compounds and methods for biomolecule detection and sequencing
EP3638814B8 (en) 2017-06-14 2023-06-21 The United States of America, as Represented by The Secretary, Department of Health and Human Services Method for determining lymphoma type
US20200113852A1 (en) 2017-06-22 2020-04-16 Triact Therapeutics, Inc. Methods of patient selection and treating trxr- or prdx-overexpressed cancers
US11433074B2 (en) 2017-06-22 2022-09-06 Triact Therapeutics, Inc. Methods of treating glioblastoma
US11739386B2 (en) 2017-07-21 2023-08-29 Genecentric Therapeutics, Inc. Methods for determining response to PARP inhibitors
EP3665199A4 (en) 2017-08-07 2021-08-11 Genecentric Therapeutics, Inc. METHOD OF SUBTYPING PLATE EPITHELIAL CARCINOMA OF THE HEAD AND NECK
WO2019030718A1 (en) * 2017-08-11 2019-02-14 Glaxosmithkline Biologicals Sa RNA IDENTIFICATION METHOD USING H RNA DIGESTION AND SIZE FRACTIONATION
US11628144B2 (en) 2017-09-29 2023-04-18 Triact Therapeutics, Inc. Iniparib formulations and uses thereof
EP3713575A4 (en) 2017-11-21 2021-08-25 Rgenix, Inc. POLYMORPHS AND THEIR USES
JP6995604B2 (ja) * 2017-12-15 2022-01-14 東洋鋼鈑株式会社 一塩基多型検出用プローブの設計方法及びプローブセット
CA3090912A1 (en) 2018-02-13 2019-08-22 Genecentric Therapeutics, Inc. Methods for subtyping of bladder cancer
EP3752604B1 (en) 2018-03-16 2023-10-04 Gopath Laboratories LLC Methods for personalized detection of the recurrence of cancer or metastasis and/or evaluation of treatment response
EP3790985B1 (en) 2018-05-09 2026-04-15 Vibrant Holdings, LLC Methods of synthesizing a polynucleotide array using photactivated agents
EP3802847A4 (en) 2018-05-29 2022-03-09 Centrillion Technologies, Inc. INCREASING THE EFFICIENCY OF PHOTOCHEMICAL REACTIONS ON SUBSTRATES
DE24173683T1 (de) 2018-08-08 2024-11-07 Pml Screening, Llc Verfahren zur beurteilung des risikos der entwicklung einer viruserkrankung unter verwendung eines genetischen tests
WO2020049106A1 (en) 2018-09-05 2020-03-12 Max-Delbrück-Centrum Für Molekulare Medizin In Der Helmholtz-Gemeinschaft A method for engineering synthetic cis-regulatory dna
CA3115922A1 (en) 2018-10-09 2020-04-16 Genecentric Therapeutics, Inc. Detecting cancer cell of origin
WO2020104482A1 (en) 2018-11-20 2020-05-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for predicting metastatic potential in patients suffering from sdhb-mutated paraganglioma
EP3660172A1 (en) 2018-11-28 2020-06-03 Bioscreening and Diagnostics LLC Method for detection of traumatic brain injury (tbi)
MX2021007562A (es) 2018-12-20 2021-09-28 Auransa Inc Analogos de pentamidina y usos para estos.
JP2022512058A (ja) 2018-12-21 2022-02-02 イルミナ インコーポレイテッド ヌクレアーゼを利用したrna枯渇
EP3908668A4 (en) 2019-01-11 2022-11-09 University of Virginia Patent Foundation COMPOSITIONS AND METHODS FOR PREDICTING THE DECREASE IN LUNG FUNCTION IN IDIOPATHIC LUNG FIBROSIS
WO2020223576A1 (en) 2019-04-30 2020-11-05 Chondrial Therapeutics, Inc. Frataxin-sensitive markers for determining effectiveness of frataxin replacement therapy
US12018279B2 (en) 2019-10-18 2024-06-25 The Trustees Of The University Of Pennsylvania Micro-engineered models of the human eye and methods of use
HUE067466T2 (hu) 2019-12-13 2024-10-28 Inspirna Inc Fémsók és alkalmazásuk
EP4121534A1 (en) 2020-03-18 2023-01-25 Alnylam Pharmaceuticals, Inc. Compositions and methods for treating subjects having a heterozygous alanine-glyoxylate aminotransferase gene (agxt) variant
CN121550230A (zh) 2020-03-26 2026-02-24 希诺皮亚生物科学公司 同位素标记的曲匹地尔衍生物
EP3907301A1 (en) 2020-05-08 2021-11-10 Istituto Europeo di Oncologia S.r.l. Methods and kits for determining the risk of breast cancer recurrence
WO2022047359A1 (en) 2020-08-31 2022-03-03 Berg Llc Protein biomarkers for pancreatic cancer
US12467917B2 (en) 2021-03-16 2025-11-11 California Institute Of Technology Reconstructing human early embryogenesis in vitro with pluripotent stem cells
EP4320443A1 (en) 2021-04-06 2024-02-14 BPGbio, Inc. Protein markers for the prognosis of breast cancer progression
EP4320441A1 (en) 2021-04-06 2024-02-14 BPGbio, Inc. Protein markers for estrogen receptor (er)-positive-like and estrogen receptor (er)-negative-like breast cancer
WO2022216841A1 (en) 2021-04-06 2022-10-13 Berg Llc Protein markers for estrogen receptor (er)-positive luminal a(la)-like and luminal b1 (lb1)-like breast cancer
GB202107883D0 (en) 2021-06-02 2021-07-14 Orph Pharma Ip Company Ltd Biomarkers and method for classifying subjects following viral exposure
US20250305055A1 (en) 2021-12-22 2025-10-02 Cornell University Prognostic/predictive breast cancer signature
US20250201335A1 (en) 2022-03-18 2025-06-19 Ludwig Institute For Cancer Research Ltd Methods and systems for analyzing chromatins
EP4505182A1 (en) 2022-04-06 2025-02-12 Larimar Therapeutics, Inc. Frataxin-sensitive markers for monitoring frataxin replacement therapy
WO2023240201A1 (en) 2022-06-08 2023-12-14 Larimar Therapeutics, Inc. Frataxin-sensitive markers for monitoring progression and treatment of leigh syndrome
WO2025155991A2 (en) 2024-01-19 2025-07-24 Bpgbio, Inc. Predictive biomarkers for response to coenzyme q10 treatment in pancreatic cancer
WO2025212475A2 (en) 2024-04-03 2025-10-09 Mars, Incorporated Compositions and methods to detect infectious organisms
WO2026044153A1 (en) 2024-08-21 2026-02-26 Bpgbio, Inc. Use of biomarkers in the diagnosis of pancreatic cancer

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989010977A1 (en) * 1988-05-03 1989-11-16 Isis Innovation Limited Analysing polynucleotide sequences
WO1990004652A1 (en) * 1988-10-24 1990-05-03 Dnax Research Institute Of Molecular And Cellular Biology, Inc. Dna sequencing by multiple mixed oligonucleotide probes
WO1990015070A1 (en) * 1989-06-07 1990-12-13 Affymax Technologies N.V. Very large scale immobilized peptide synthesis
WO1992010588A1 (en) * 1990-12-06 1992-06-25 Affymax Technologies N.V. Sequencing by hybridization of a target nucleic acid to a matrix of defined oligonucleotides
US5202231A (en) * 1987-04-01 1993-04-13 Drmanac Radoje T Method of sequencing of genomes by hybridization of oligonucleotide probes
WO1995000530A1 (en) * 1993-06-25 1995-01-05 Affymax Technologies N.V. Hybridization and sequencing of nucleic acids
WO1995011995A1 (en) * 1993-10-26 1995-05-04 Affymax Technologies N.V. Arrays of nucleic acid probes on biological chips
EP0717113A2 (en) * 1994-10-21 1996-06-19 Affymax Technologies N.V. Computer-aided visualization and analysis system for nucleic acid sequence evaluation
EP0721016A2 (en) * 1994-10-21 1996-07-10 Affymax Technologies N.V. Nucleic acid library arrays, methods for synthesizing them and methods for sequencing and sample screening using them

Family Cites Families (134)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3730844A (en) 1971-08-27 1973-05-01 Purdue Research Foundation Polynucleotide analysis
FR2353856A1 (fr) 1976-06-02 1977-12-30 Chateau Guy Ruban destine a servir de support a une reaction par exemple chimique ou biochimique, et procede d'analyse le mettant en oeuvre
US4500707A (en) 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4327073A (en) 1980-04-07 1982-04-27 Huang Henry V Automated method for quantitative analysis of biological fluids
US4711955A (en) 1981-04-17 1987-12-08 Yale University Modified nucleotides and methods of preparing and using same
EP0063810B1 (en) 1981-04-29 1986-03-05 Ciba-Geigy Ag New devices and kits for immunological analysis
US4373071A (en) 1981-04-30 1983-02-08 City Of Hope Research Institute Solid-phase synthesis of polynucleotides
FI63596C (fi) 1981-10-16 1983-07-11 Orion Yhtymae Oy Mikrobdiagnostiskt foerfarande som grundar sig pao skiktshybridisering av nukleinsyror och vid foerfarandet anvaenda kombinationer av reagenser
US4483920A (en) 1982-05-17 1984-11-20 Hahnemann University Immobilization of message RNA directly from cells onto filter material
US4556643A (en) 1982-07-26 1985-12-03 Agracetus Assay method and probe for polynucleotide sequences
DE3301833A1 (de) 1983-01-20 1984-07-26 Gesellschaft für Biotechnologische Forschung mbH (GBF), 3300 Braunschweig Verfahren zur simultanen synthese mehrerer oligonocleotide an fester phase
US4994373A (en) 1983-01-27 1991-02-19 Enzo Biochem, Inc. Method and structures employing chemically-labelled polynucleotide probes
US4591570A (en) 1983-02-02 1986-05-27 Centocor, Inc. Matrix of antibody-coated spots for determination of antigens
US4584277A (en) 1983-04-05 1986-04-22 Syntex (U.S.A.) Inc. Fluorescent multiparameter particle analysis
GB8314523D0 (en) 1983-05-25 1983-06-29 Lowe C R Diagnostic device
US4542102A (en) 1983-07-05 1985-09-17 Molecular Diagnostics, Inc. Coupling of nucleic acids to solid support by photochemical methods
US4987065A (en) 1983-07-05 1991-01-22 Enzo Biochem, Inc. In vivo labelling of polynucleotide sequences
US4677054A (en) 1983-08-08 1987-06-30 Sloan-Kettering Institute For Cancer Research Method for simple analysis of relative nucleic acid levels in multiple small samples by cytoplasmic dot hybridization
DE3481060D1 (de) 1983-09-02 1990-02-22 Molecular Biosystems Inc Oligonukleotid-polymer-tragsystem.
US4849513A (en) 1983-12-20 1989-07-18 California Institute Of Technology Deoxyribonucleoside phosphoramidites in which an aliphatic amino group is attached to the sugar ring and their use for the preparation of oligonucleotides containing aliphatic amino groups
US4613566A (en) 1984-01-23 1986-09-23 President And Fellows Of Harvard College Hybridization assay and kit therefor
FI71768C (fi) 1984-02-17 1987-02-09 Orion Yhtymae Oy Foerbaettrade nykleinsyrareagenser och foerfarande foer deras framstaellning.
GB8405437D0 (en) 1984-03-01 1984-04-04 Amersham Int Plc Detecting polynucleotide sequences
US4704353A (en) 1984-04-27 1987-11-03 Molecular Devices Corporation Photoresponsive redox detection and discrimination
US4670380A (en) 1984-05-23 1987-06-02 Molecular Diagnostics, Inc. Assays utilizing labeled nucleic acid probes
IL75464A (en) 1984-06-12 1990-08-31 Orgenics Ltd Method and apparatus for multi-analyte assay
US4755458A (en) 1984-08-30 1988-07-05 Enzo Biochem, Inc. Composition and method for the detection of the presence of a polynucleotide sequence of interest
US4820630A (en) 1984-11-23 1989-04-11 Digene Diagnostics, Incorporated Assay for nucleic acid sequences, particularly genetic lesions, using interactive labels
US5064754A (en) 1984-12-14 1991-11-12 Mills Randell L Genomic sequencing method
US4670379A (en) 1984-12-19 1987-06-02 E. I. Du Pont De Nemours And Company Polynucleotide hydridization assays employing catalyzed luminescence
US5026840A (en) 1985-01-10 1991-06-25 Molecular Diagnostics, Inc. Photochemical nucleic acid-labeling reagent having a polyalklamine spacer
US4767700A (en) 1985-02-15 1988-08-30 Beckman Research Institute Of The City Of Hope Detection of particular nucleotide sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
NZ215865A (en) 1985-04-22 1988-10-28 Commw Serum Lab Commission Method of determining the active site of a receptor-binding analogue
FR2583772B1 (fr) 1985-06-20 1987-08-28 Roussel Uclaf Nouveaux supports, la preparation de ces supports, les intermediaires nouveaux obtenus, leur application a la synthese d'oligonucleotides et les nouveaux nucleosides et oligonucleotides relies aux supports ainsi obtenus
FR2584090B1 (fr) 1985-06-27 1987-08-28 Roussel Uclaf Nouveaux supports, leur preparation et les intermediaires obtenus, leur application a la synthese d'oligonucleotides et les nouveaux nucleosides et oligonucleotides relies aux supports ainsi obtenus
JPS63500400A (ja) 1985-08-05 1988-02-12 レエイクスニフエルシテイト レイデン 標識高分子、その製法および免疫学または免疫細胞化学検定に対する使用
US4868104A (en) 1985-09-06 1989-09-19 Syntex (U.S.A.) Inc. Homogeneous assay for specific polynucleotides
US4868105A (en) 1985-12-11 1989-09-19 Chiron Corporation Solution phase nucleic acid sandwich assay
EP0232967B1 (en) 1986-01-10 1993-04-28 Amoco Corporation Competitive homogeneous assay
US5447841A (en) 1986-01-16 1995-09-05 The Regents Of The Univ. Of California Methods for chromosome-specific staining
US4855225A (en) 1986-02-07 1989-08-08 Applied Biosystems, Inc. Method of detecting electrophoretically separated oligonucleotides
US4868103A (en) 1986-02-19 1989-09-19 Enzo Biochem, Inc. Analyte detection by means of energy transfer
US5348855A (en) 1986-03-05 1994-09-20 Miles Inc. Assay for nucleic acid sequences in an unpurified sample
NO870613L (no) 1986-03-05 1987-09-07 Molecular Diagnostics Inc Deteksjon av mikroorganismer i en prŸve inneholdende nukleinsyre.
US4925785A (en) 1986-03-07 1990-05-15 Biotechnica Diagnostics, Inc. Nucleic acid hybridization assays
US4728591A (en) 1986-03-07 1988-03-01 Trustees Of Boston University Self-assembled nanometer lithographic masks and templates and method for parallel fabrication of nanometer scale multi-device structures
CA1284931C (en) 1986-03-13 1991-06-18 Henry A. Erlich Process for detecting specific nucleotide variations and genetic polymorphisms present in nucleic acids
US5310893A (en) 1986-03-31 1994-05-10 Hoffmann-La Roche Inc. Method for HLA DP typing
US5256549A (en) 1986-03-28 1993-10-26 Chiron Corporation Purification of synthetic oligomers
US5153319A (en) 1986-03-31 1992-10-06 University Patents, Inc. Process for preparing polynucleotides
US4981783A (en) * 1986-04-16 1991-01-01 Montefiore Medical Center Method for detecting pathological conditions
US5021550A (en) 1986-10-07 1991-06-04 Thomas Jefferson University Method for preventing deletion sequences in solid phase synthesis
US5028525A (en) 1986-11-24 1991-07-02 Regents Of The University Of California Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ
US5252974A (en) * 1986-12-24 1993-10-12 Zdzislaw Gulczynski Encoder with error correction particularly for flash analog-to-digital converters
AU601021B2 (en) 1987-03-11 1990-08-30 Molecular Diagnostics, Inc. Assay for necleic acid sequences in a sample
JPS63223557A (ja) 1987-03-13 1988-09-19 Nec Corp 半導体バイオセンサの製造方法
US6270961B1 (en) 1987-04-01 2001-08-07 Hyseq, Inc. Methods and apparatus for DNA sequencing and DNA identification
US5525464A (en) 1987-04-01 1996-06-11 Hyseq, Inc. Method of sequencing by hybridization of oligonucleotide probes
US5100777A (en) 1987-04-27 1992-03-31 Tanox Biosystems, Inc. Antibody matrix device and method for evaluating immune status
SE458968B (sv) 1987-06-16 1989-05-22 Wallac Oy Biospecifikt analysfoerfarande foer flera analyter i vilket ingaar partikelraekning och maerkning med fluorescerande maerksubstanser
US4874500A (en) 1987-07-15 1989-10-17 Sri International Microelectrochemical sensor and sensor array
US4921805A (en) 1987-07-29 1990-05-01 Life Technologies, Inc. Nucleic acid capture method
US4923901A (en) 1987-09-04 1990-05-08 Millipore Corporation Membranes with bound oligonucleotides and peptides
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US4988617A (en) 1988-03-25 1991-01-29 California Institute Of Technology Method of detecting a nucleotide change in nucleic acids
IL89964A0 (en) 1988-04-15 1989-12-15 Montefiore Med Center Method for determining malignant progression,cdna,polypeptides encoded thereby and pharmaceutical compositions containing the same
US5700637A (en) * 1988-05-03 1997-12-23 Isis Innovation Limited Apparatus and method for analyzing polynucleotide sequences and method of generating oligonucleotide arrays
JP2897959B2 (ja) * 1988-05-20 1999-05-31 エフ.ホフマン―ラ ロシュ アクチェンゲゼルシャフト 固定化された配列特異的プローブ
US5013669A (en) 1988-06-01 1991-05-07 Smithkline Diagnostics, Inc. Mass producible biologically active solid phase devices
US5204268A (en) 1988-06-02 1993-04-20 Fuji Photo Film Co., Ltd. Method and apparatus for applying liquid samples
JPH03505966A (ja) * 1988-07-14 1991-12-26 ベイラー カレッジ オブ メディシン 生物高分子の固相組立及び再構築方法
US5188963A (en) 1989-11-17 1993-02-23 Gene Tec Corporation Device for processing biological specimens for analysis of nucleic acids
US4992383A (en) 1988-08-05 1991-02-12 Porton Instruments, Inc. Method for protein and peptide sequencing using derivatized glass supports
US5185243A (en) 1988-08-25 1993-02-09 Syntex (U.S.A.) Inc. Method for detection of specific nucleic acid sequences
GB8822228D0 (en) 1988-09-21 1988-10-26 Southern E M Support-bound oligonucleotides
US5389512A (en) 1988-10-07 1995-02-14 Hoffman-La Roche Inc. Method for determining the relative amount of a viral nucleic acid segment in a sample by the polymerase chain reaction
US5200051A (en) 1988-11-14 1993-04-06 I-Stat Corporation Wholly microfabricated biosensors and process for the manufacture and use thereof
US5489507A (en) 1988-11-30 1996-02-06 Perkin-Elmer Corporation DNA detection by color complementation
US5047524A (en) 1988-12-21 1991-09-10 Applied Biosystems, Inc. Automated system for polynucleotide synthesis and purification
US5200312A (en) 1989-01-30 1993-04-06 The United States Of America As Represented By The Secretary Of The Navy Membrane based dot immunoassay and method of use
EP0392546A3 (en) 1989-04-14 1991-09-11 Ro Institut Za Molekularnu Genetiku I Geneticko Inzenjerstvo Process for determination of a complete or a partial contents of very short sequences in the samples of nucleic acids connected to the discrete particles of microscopic size by hybridization with oligonucleotide probes
US5242974A (en) 1991-11-22 1993-09-07 Affymax Technologies N.V. Polymer reversal on solid surfaces
US6040138A (en) 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US6309822B1 (en) * 1989-06-07 2001-10-30 Affymetrix, Inc. Method for comparing copy number of nucleic acid sequences
US5744101A (en) 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
US5141813A (en) 1989-08-28 1992-08-25 Clontech Laboratories, Inc. Multifunctional controlled pore glass reagent for solid phase oligonucleotide synthesis
US5232829A (en) 1989-09-29 1993-08-03 Hoffmann-La Roche Inc. Detection of chlamydia trachomatis by polymerase chain reaction using biotin labelled lina primers and capture probes
US5252743A (en) 1989-11-13 1993-10-12 Affymax Technologies N.V. Spatially-addressable immobilization of anti-ligands on surfaces
US5215882A (en) 1989-11-30 1993-06-01 Ortho Diagnostic Systems, Inc. Method of immobilizing nucleic acid on a solid surface for use in nucleic acid hybridization assays
US5091652A (en) 1990-01-12 1992-02-25 The Regents Of The University Of California Laser excited confocal microscope fluorescence scanner and method
DK43590A (da) * 1990-02-19 1991-08-20 Ole Schou Nielsen Anordning ved paa stolper anbragte skilte
ES2116977T3 (es) 1990-05-11 1998-08-01 Microprobe Corp Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente.
US5252296A (en) 1990-05-15 1993-10-12 Chiron Corporation Method and apparatus for biopolymer synthesis
DE4024545A1 (de) 1990-08-02 1992-02-06 Boehringer Mannheim Gmbh Verfahren und vorrichtung zum dosierten zufuehren einer biochemischen analysefluessigkeit auf ein target
US5173260A (en) * 1990-09-17 1992-12-22 Eastman Kodak Company Beads fused to a test device support
US5474895A (en) 1990-11-14 1995-12-12 Siska Diagnostics Inc. Non-isotopic detection of nucleic acids using a polystyrene support-based sandwich hybridization assay and compositions useful therefor
DE69132531T2 (de) * 1990-12-06 2001-09-13 Affymetrix, Inc. (N.D.Ges.D.Staates Delaware) Verbindungen und ihre Verwendung in einer binären Synthesestrategie
RU1794088C (ru) * 1991-03-18 1993-02-07 Институт Молекулярной Биологии Ан@ Ссср Способ определени нуклеотидной последовательности ДНК и устройство дл его осуществлени
US5422241A (en) * 1991-07-03 1995-06-06 Ambion, Inc. Methods for the recovery of nucleic acids from reaction mixtures
US5556748A (en) 1991-07-30 1996-09-17 Xenopore Corporation Methods of sandwich hybridization for the quantitative analysis of oligonucleotides
WO1993004199A2 (en) 1991-08-20 1993-03-04 Scientific Generics Limited Methods of detecting or quantitating nucleic acids and of producing labelled immobilised nucleic acids
US5474796A (en) 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
US5605662A (en) 1993-11-01 1997-02-25 Nanogen, Inc. Active programmable electronic devices for molecular biological analysis and diagnostics
US5326691A (en) 1991-11-21 1994-07-05 John Hozier Micro-libraries and methods of making and manipulating them methods for generating and analyzing micro-libraries
US5412087A (en) 1992-04-24 1995-05-02 Affymax Technologies N.V. Spatially-addressable immobilization of oligonucleotides and other biological polymers on surfaces
FR2684688B1 (fr) 1991-12-04 1994-03-18 Bertin Et Cie Procede de selection d'au moins un crible de mutations, son application a un procede d'identification rapide d'alleles de systemes polymorphes et dispositif pour sa mise en óoeuvre.
WO1993017126A1 (en) * 1992-02-19 1993-09-02 The Public Health Research Institute Of The City Of New York, Inc. Novel oligonucleotide arrays and their use for sorting, isolating, sequencing, and manipulating nucleic acids
JPH05236997A (ja) 1992-02-28 1993-09-17 Hitachi Ltd ポリヌクレオチド捕捉用チップ
ATE173767T1 (de) 1992-04-03 1998-12-15 Perkin Elmer Corp Proben zusammensetzung und verfahren
JP3311752B2 (ja) 1992-07-02 2002-08-05 ソイニ,エルッキ 生体特異的多変数検定法
US6114114A (en) * 1992-07-17 2000-09-05 Incyte Pharmaceuticals, Inc. Comparative gene transcript analysis
US5795714A (en) 1992-11-06 1998-08-18 Trustees Of Boston University Method for replicating an array of nucleic acid probes
US5837832A (en) * 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
US5512430A (en) 1993-07-13 1996-04-30 Hri Research, Inc. Diagnostic array for virus infection
RU2041261C1 (ru) * 1993-08-11 1995-08-09 Институт молекулярной биологии им.В.А.Энгельгардта РАН Способ изготовления матрицы для детектирования мисматчей
RU2041263C1 (ru) * 1993-08-11 1995-08-09 Геннадий Моисеевич Ершов Способ микродозирования водных растворов веществ на носитель и устройство для его осуществления
RU2041262C1 (ru) * 1993-08-11 1995-08-09 Институт молекулярной биологии им.В.А.Энгельгардта РАН Способ иммобилизации водорастворимых биоорганических соединений на капиллярно-пористый носитель
US5472842A (en) 1993-10-06 1995-12-05 The Regents Of The University Of California Detection of amplified or deleted chromosomal regions
US5610287A (en) 1993-12-06 1997-03-11 Molecular Tool, Inc. Method for immobilizing nucleic acid molecules
US5578832A (en) 1994-09-02 1996-11-26 Affymetrix, Inc. Method and apparatus for imaging a sample on a device
EP0743989B1 (en) 1994-02-14 2007-03-21 Smithkline Beecham Corporation Methed of identifying differentially expressed genes
US6015880A (en) 1994-03-16 2000-01-18 California Institute Of Technology Method and substrate for performing multiple sequential reactions on a matrix
WO1995030774A1 (en) * 1994-05-05 1995-11-16 Beckman Instruments, Inc. Oligonucleotide repeat arrays
US5571639A (en) * 1994-05-24 1996-11-05 Affymax Technologies N.V. Computer-aided engineering system for design of sequence arrays and lithographic masks
US5501954A (en) * 1994-06-13 1996-03-26 Genzyme Corporation Method of detecting cellular material
US5807522A (en) * 1994-06-17 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods for fabricating microarrays of biological samples
US5556752A (en) 1994-10-24 1996-09-17 Affymetrix, Inc. Surface-bound, unimolecular, double-stranded DNA
US5830645A (en) 1994-12-09 1998-11-03 The Regents Of The University Of California Comparative fluorescence hybridization to nucleic acid arrays
US5690894A (en) * 1995-05-23 1997-11-25 The Regents Of The University Of California High density array fabrication and readout method for a fiber optic biosensor
US5545531A (en) 1995-06-07 1996-08-13 Affymax Technologies N.V. Methods for making a device for concurrently processing multiple biological chip assays
US20020042048A1 (en) 1997-01-16 2002-04-11 Radoje Drmanac Methods and compositions for detection or quantification of nucleic acid species

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5202231A (en) * 1987-04-01 1993-04-13 Drmanac Radoje T Method of sequencing of genomes by hybridization of oligonucleotide probes
WO1989010977A1 (en) * 1988-05-03 1989-11-16 Isis Innovation Limited Analysing polynucleotide sequences
WO1990004652A1 (en) * 1988-10-24 1990-05-03 Dnax Research Institute Of Molecular And Cellular Biology, Inc. Dna sequencing by multiple mixed oligonucleotide probes
WO1990015070A1 (en) * 1989-06-07 1990-12-13 Affymax Technologies N.V. Very large scale immobilized peptide synthesis
WO1992010588A1 (en) * 1990-12-06 1992-06-25 Affymax Technologies N.V. Sequencing by hybridization of a target nucleic acid to a matrix of defined oligonucleotides
WO1995000530A1 (en) * 1993-06-25 1995-01-05 Affymax Technologies N.V. Hybridization and sequencing of nucleic acids
WO1995011995A1 (en) * 1993-10-26 1995-05-04 Affymax Technologies N.V. Arrays of nucleic acid probes on biological chips
EP0717113A2 (en) * 1994-10-21 1996-06-19 Affymax Technologies N.V. Computer-aided visualization and analysis system for nucleic acid sequence evaluation
EP0721016A2 (en) * 1994-10-21 1996-07-10 Affymax Technologies N.V. Nucleic acid library arrays, methods for synthesizing them and methods for sequencing and sample screening using them

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
D.J. LOCKHART ET AL.: "Expression monitoring by hybridization to high-density oligonucleotide arrays", NATURE BIOTECHNOLOGY, vol. 14, no. 13, December 1996 (1996-12-01), NATURE PUBL. CO.,NEW YORK, US, pages 1675 - 1680, XP002022521 *
LIPSHUTZ, R. J. ET AL: "Using oligonucleotide probe arrays to access genetic diversity", BIOTECHNIQUES (1995), 19(3), 442-7 CODEN: BTNQDO;ISSN: 0736-6205, 1995, XP000541924 *
M. CHEE ET AL.: "Accessing genetic information with high-density DNA arrays", SCIENCE, vol. 274, 25 October 1996 (1996-10-25), AAAS,WASHINGTON,DC,US, pages 610 - 614, XP002022508 *
SCHENA, MARK ET AL: "Parallel human genome analysis: microarray-based expression monitoring of 1000 genes", PROC. NATL. ACAD. SCI. U. S. A. (1996), 93(20), 10614-10619 CODEN: PNASA6;ISSN: 0027-8424, 1 October 1996 (1996-10-01), XP002022507 *

Cited By (684)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6919211B1 (en) 1989-06-07 2005-07-19 Affymetrix, Inc. Polypeptide arrays
US6955915B2 (en) 1989-06-07 2005-10-18 Affymetrix, Inc. Apparatus comprising polymers
US7087732B2 (en) 1989-06-07 2006-08-08 Affymetrix, Inc. Nucleotides and analogs having photoremovable protecting groups
US7459275B2 (en) 1990-12-06 2008-12-02 Affymetrix, Inc. Sequencing of surface immobilized polymers utilizing microfluorescence detection
US7329496B2 (en) 1990-12-06 2008-02-12 Affymetrix, Inc. Sequencing of surface immobilized polymers utilizing microflourescence detection
US6864101B1 (en) 1991-11-22 2005-03-08 Affymetrix, Inc. Combinatorial strategies for polymer synthesis
US6849462B1 (en) 1991-11-22 2005-02-01 Affymetrix, Inc. Combinatorial strategies for polymer synthesis
US7691330B1 (en) 1991-11-22 2010-04-06 Affymetrix, Inc. Combinatorial strategies for polymer synthesis
US7736906B2 (en) 1991-11-22 2010-06-15 Affymetrix, Inc. Combinatorial strategies for polymer synthesis
US7323298B1 (en) 1994-06-17 2008-01-29 The Board Of Trustees Of The Leland Stanford Junior University Microarray for determining the relative abundances of polynuceotide sequences
US7378236B1 (en) 1994-06-17 2008-05-27 The Board Of Trustees Of The Leland Stanford Junior University Method for analyzing gene expression patterns
US7442499B2 (en) 1994-06-17 2008-10-28 The Board Of Trustees Of The Leland Stanford Junior University Substrates comprising polynucleotide microarrays
US6110426A (en) * 1994-06-17 2000-08-29 The Board Of Trustees Of The Leland Stanford Junior University Methods for fabricating microarrays of biological samples
US6927032B2 (en) 1995-09-15 2005-08-09 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US7674587B2 (en) 1995-11-29 2010-03-09 Affymetrix, Inc. Polymorphism detection
US6953663B1 (en) 1995-11-29 2005-10-11 Affymetrix, Inc. Polymorphism detection
US6586186B2 (en) 1995-11-29 2003-07-01 Affymetrix, Inc. Polymorphism detection
US8095323B2 (en) 1995-11-29 2012-01-10 Affymetrix, Inc. Polymorphism detection
US6300063B1 (en) 1995-11-29 2001-10-09 Affymetrix, Inc. Polymorphism detection
US7282327B2 (en) 1996-01-23 2007-10-16 Affymetrix, Inc. Nucleic acid labeling compounds
US6965020B2 (en) 1996-01-23 2005-11-15 Affymetrix, Inc. Nucleic acid labeling compounds
US7423143B2 (en) 1996-01-23 2008-09-09 Affymetrix. Inc. Nucleic acid labeling compounds
US7291463B2 (en) 1996-01-23 2007-11-06 Affymetrix, Inc. Nucleic acid labeling compounds
US6858711B2 (en) 1996-01-23 2005-02-22 Affymetrix, Inc. Labeling reagents
US6864059B2 (en) 1996-01-23 2005-03-08 Affymetrix, Inc. Biotin containing C-glycoside nucleic acid labeling compounds
US6440677B2 (en) 1996-03-11 2002-08-27 Affymetrix, Inc. Nucleic acid affinity columns
US6280950B1 (en) 1996-03-11 2001-08-28 Affymetrix, Inc. Nucleic acid affinity columns
US6828104B2 (en) 1996-03-11 2004-12-07 Affymetrix, Inc. Nucleic acid affinity columns
US6013440A (en) * 1996-03-11 2000-01-11 Affymetrix, Inc. Nucleic acid affinity columns
WO1998020161A1 (en) * 1996-11-06 1998-05-14 Smithkline Beecham Corporation Methods for identifying genes essential to the growth of an organism
US6083697A (en) * 1996-11-14 2000-07-04 Affymetrix, Inc. Chemical amplification for the synthesis of patterned arrays
US6887665B2 (en) 1996-11-14 2005-05-03 Affymetrix, Inc. Methods of array synthesis
US7413852B2 (en) 1996-12-31 2008-08-19 High Throughput Genomics Multiplexed diagnostic and therapeutics
US6461807B1 (en) 1997-02-28 2002-10-08 Fred Hutchinson Cancer Research Center Methods for drug target screening
US7122312B1 (en) 1997-02-28 2006-10-17 Fred Hutchinson Cancer Research Center Methods for drug target screening
US6165709A (en) * 1997-02-28 2000-12-26 Fred Hutchinson Cancer Research Center Methods for drug target screening
US6207148B1 (en) 1997-06-19 2001-03-27 Incyte Pharmaceuticals, Inc. Disease associated protein kinases
WO1998058052A3 (en) * 1997-06-19 1999-06-10 Incyte Pharma Inc Disease associated protein kinases
US7112453B2 (en) 1997-06-20 2006-09-26 Ciphergen Biosystems, Inc. Retentate chromatography and protein chip arrays with applications in biology and medicine
US6818411B2 (en) 1997-06-20 2004-11-16 Ciphergen Biosystems, Inc. Retentate chromatography and protein chip arrays with applications in biology and medicine
US6881586B2 (en) 1997-06-20 2005-04-19 Ciphergen Biosystems, Inc. Retentate chromatography and protein chip arrays with applications in biology and medicine
US6225047B1 (en) 1997-06-20 2001-05-01 Ciphergen Biosystems, Inc. Use of retentate chromatography to generate difference maps
US7329484B2 (en) 1997-06-20 2008-02-12 Bio-Rad Laboratories, Inc. Retentate chromatography and protein chip arrays with applications in biology and medicine
US6579719B1 (en) 1997-06-20 2003-06-17 Ciphergen Biosystems, Inc. Retentate chromatography and protein chip arrays with applications in biology and medicine
US6844165B2 (en) 1997-06-20 2005-01-18 Ciphergen Biosystems, Inc. Retentate chromatography and protein chip arrays with applications in biology and medicine
US7160734B2 (en) 1997-06-20 2007-01-09 Ciphergen Biosystems, Inc. Retentate chromatography and protein chip arrays with applications in biology
US7105339B2 (en) 1997-06-20 2006-09-12 Ciphergen Biosystems, Inc. Retentate chromatography and protein chip arrays with applications in biology and medicine
US6811969B1 (en) 1997-06-20 2004-11-02 Ciphergen Biosystems, Inc. Retentate chromatography—profiling with biospecific interaction adsorbents
US7575935B2 (en) 1997-06-20 2009-08-18 Bio-Rad Laboratories, Inc. Retentate chromatography and protein chip arrays with applications in biology and medicine
US6567540B2 (en) 1997-07-25 2003-05-20 Affymetrix, Inc. Method and apparatus for providing a bioinformatics database
US6826296B2 (en) 1997-07-25 2004-11-30 Affymetrix, Inc. Method and system for providing a probe array chip design database
US6532462B2 (en) 1997-07-25 2003-03-11 Affymetrix, Inc. Gene expression and evaluation system using a filter table with a gene expression database
US6229911B1 (en) 1997-07-25 2001-05-08 Affymetrix, Inc. Method and apparatus for providing a bioinformatics database
US7068830B2 (en) 1997-07-25 2006-06-27 Affymetrix, Inc. Method and system for providing a probe array chip design database
US7215804B2 (en) 1997-07-25 2007-05-08 Affymetrix, Inc. Method and apparatus for providing a bioinformatics database
US6882742B2 (en) 1997-07-25 2005-04-19 Affymetrix, Inc. Method and apparatus for providing a bioinformatics database
US6308170B1 (en) 1997-07-25 2001-10-23 Affymetrix Inc. Gene expression and evaluation system
US6326489B1 (en) 1997-08-05 2001-12-04 Howard Hughes Medical Institute Surface-bound, bimolecular, double-stranded DNA arrays
US6432360B1 (en) 1997-10-10 2002-08-13 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6485944B1 (en) 1997-10-10 2002-11-26 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6548021B1 (en) 1997-10-10 2003-04-15 President And Fellows Of Harvard College Surface-bound, double-stranded DNA protein arrays
US7785790B1 (en) 1997-10-10 2010-08-31 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
EP1418244A1 (en) * 1997-12-19 2004-05-12 Affymetrix, Inc. Exploiting genomics in the search for new drugs
US6524800B2 (en) 1997-12-19 2003-02-25 Affymetrix, Inc. Exploiting genomics in the search for new drugs
US20030096232A1 (en) 1997-12-19 2003-05-22 Kris Richard M. High throughput assay system
US6238869B1 (en) 1997-12-19 2001-05-29 High Throughput Genomics, Inc. High throughput assay system
US6232066B1 (en) 1997-12-19 2001-05-15 Neogen, Inc. High throughput assay system
US6333155B1 (en) 1997-12-19 2001-12-25 Affymetrix, Inc. Exploiting genomics in the search for new drugs
WO1999032660A1 (en) * 1997-12-19 1999-07-01 Affymetrix Exploiting genomics in the search for new drugs
US6489159B1 (en) 1998-01-07 2002-12-03 Clontech Laboratories, Inc. Polymeric arrays and methods for their use in binding assays
US8140148B2 (en) 1998-01-20 2012-03-20 Boston Scientific Scimed Ltd. Readable probe array for in vivo use
WO1999037817A1 (en) * 1998-01-26 1999-07-29 Schering Aktiengesellschaft Gene expression methods for screening compounds
EP1060395A4 (en) * 1998-02-04 2005-02-09 Invitrogen Corp MICROSYSTEMS AND THEIR IMPLEMENTATION
US6420108B2 (en) 1998-02-09 2002-07-16 Affymetrix, Inc. Computer-aided display for comparative gene expression
US6531284B1 (en) 1998-02-18 2003-03-11 Institut Pasteur Fast and exhaustive method for selecting a prey polypeptide interacting with a bait polypeptide of interest: application to the construction of maps of interactors polypeptides
US6913886B2 (en) 1998-02-18 2005-07-05 Institut Pasteur Fast and exhaustive method for selecting a prey polypeptide interacting with a bait polypeptide of interest: application to the construction of maps of interactors polypeptides
US6187535B1 (en) 1998-02-18 2001-02-13 Institut Pasteur Fast and exhaustive method for selecting a prey polypeptide interacting with a bait polypeptide of interest: application to the construction of maps of interactors polypeptides
US8003375B2 (en) 1998-03-11 2011-08-23 Exonhit Therapeutics S.A. Qualitative differential screening
EP1717249A1 (en) 1998-03-12 2006-11-02 Georgetown University Peptides containing a cholesterol recognition sequence and their uses
WO1999048916A3 (en) * 1998-03-27 2000-01-20 Univ Leland Stanford Junior Hypoxia-inducible human genes, proteins, and uses thereof
US8067240B2 (en) 1998-03-31 2011-11-29 Esoterix Genetic Laboratories, Llc Methods for the diagnosis and treatment of lung cancer
WO1999049774A2 (en) 1998-03-31 1999-10-07 Genzyme Corporation Methods for the diagnosis and treatment of lung cancer
US7846667B2 (en) 1998-03-31 2010-12-07 Genzyme Corporation Methods for the diagnosis and treatment of lung cancer
US5965352A (en) * 1998-05-08 1999-10-12 Rosetta Inpharmatics, Inc. Methods for identifying pathways of drug action
US6859735B1 (en) 1998-05-08 2005-02-22 Rosetta Inpharmatics Llc Computer systems for identifying pathways of drug action
US6132969A (en) * 1998-06-19 2000-10-17 Rosetta Inpharmatics, Inc. Methods for testing biological network models
US6973388B2 (en) 1998-06-19 2005-12-06 Rosetta Inpharmatics Llc Methods of diagnosing disease states using gene expression profiles
EP1086205A4 (en) * 1998-06-19 2004-11-17 Rosetta Inpharmatics Inc METHOD FOR MONITORING DISEASE CONDITIONS AND THERAPIES USING GENE EXPRESSION PROFILES
US7659063B2 (en) 1998-07-02 2010-02-09 High Throughput Genomics, Inc. High throughput assay system
WO2000004188A3 (en) * 1998-07-15 2000-05-18 Chiron Corp Methods and compositions for comparing and normalizing assays
US7491818B2 (en) 1998-07-31 2009-02-17 Affymetrix, Inc. Nucleic acid labeling compounds
US7179905B2 (en) 1998-07-31 2007-02-20 Affymetrix, Inc. Nucleic acid labeling compounds
US6844433B2 (en) 1998-07-31 2005-01-18 Affymetrix, Inc. Nucleic acid labeling compounds
US8586312B2 (en) 1998-08-24 2013-11-19 Affymetrix, Inc. Methods of using an array of pooled probes in genetic analysis
US6687692B1 (en) 1998-09-17 2004-02-03 Affymetrix, Inc. Method and apparatus for providing an expression data mining database
US6185561B1 (en) 1998-09-17 2001-02-06 Affymetrix, Inc. Method and apparatus for providing and expression data mining database
US6331396B1 (en) 1998-09-23 2001-12-18 The Cleveland Clinic Foundation Arrays for identifying agents which mimic or inhibit the activity of interferons
WO2000022093A3 (en) * 1998-09-23 2000-11-23 Cleveland Clinic Foundation Novel interferon stimulated and repressed genes
US6203989B1 (en) 1998-09-30 2001-03-20 Affymetrix, Inc. Methods and compositions for amplifying detectable signals in specific binding assays
US6806047B2 (en) 1998-09-30 2004-10-19 Affymetrix, Inc. Methods and compositions for amplifying detectable signals in specific binding assays
US7098286B2 (en) 1998-10-13 2006-08-29 Affymetrix, Inc. Functionalized silicon compounds and methods for their synthesis and use
US7129307B2 (en) 1998-10-13 2006-10-31 Affymetrix, Inc. Functionalized silicon compounds and methods for their synthesis and use
US6743882B2 (en) 1998-10-13 2004-06-01 Affymetrix, Inc. Functionalized silicon compounds and methods for their synthesis and use
US6486286B1 (en) 1998-10-13 2002-11-26 Affymetrix, Inc. Use of hexahydrolupulones as antibacterial agents
US7125947B2 (en) 1998-10-13 2006-10-24 Affymetrix, Inc. Functionalized silicon compounds and methods for their synthesis and use
US6486287B2 (en) 1998-10-13 2002-11-26 Affymetrix, Inc. Functionalized silicon compounds and methods for their synthesis and use
US6410675B2 (en) 1998-10-13 2002-06-25 Affymetrix, Inc. Functionalized silicon compounds and methods for their synthesis and use
US6429275B2 (en) 1998-10-13 2002-08-06 Affymetrix, Inc. Functionalized silicon compounds and methods for their synthesis and use
US6262216B1 (en) 1998-10-13 2001-07-17 Affymetrix, Inc. Functionalized silicon compounds and methods for their synthesis and use
US6489096B1 (en) 1998-10-15 2002-12-03 Princeton University Quantitative analysis of hybridization patterns and intensities in oligonucleotide arrays
US6468476B1 (en) 1998-10-27 2002-10-22 Rosetta Inpharmatics, Inc. Methods for using-co-regulated genesets to enhance detection and classification of gene expression patterns
US6203987B1 (en) 1998-10-27 2001-03-20 Rosetta Inpharmatics, Inc. Methods for using co-regulated genesets to enhance detection and classification of gene expression patterns
US6950752B1 (en) 1998-10-27 2005-09-27 Rosetta Inpharmatics Llc Methods for removing artifact from biological profiles
US7560226B2 (en) 1998-12-23 2009-07-14 Medsaic Pty Limited Assay to detect a binding partner
US6801859B1 (en) 1998-12-23 2004-10-05 Rosetta Inpharmatics Llc Methods of characterizing drug activities using consensus profiles
WO2000039580A1 (en) * 1998-12-23 2000-07-06 University Of Sydney An assay to detect a binding partner
US6847897B1 (en) 1998-12-23 2005-01-25 Rosetta Inpharmatics Llc Method and system for analyzing biological response signal data
US6453241B1 (en) 1998-12-23 2002-09-17 Rosetta Inpharmatics, Inc. Method and system for analyzing biological response signal data
US6222093B1 (en) 1998-12-28 2001-04-24 Rosetta Inpharmatics, Inc. Methods for determining therapeutic index from gene expression profiles
US8560243B2 (en) 1998-12-28 2013-10-15 Microsoft Corporation Methods for determining therapeutic index from gene expression profiles
US6370478B1 (en) 1998-12-28 2002-04-09 Rosetta Inpharmatics, Inc. Methods for drug interaction prediction using biological response profiles
US7254487B2 (en) 1998-12-28 2007-08-07 Rosetta Inpharmatics Llc Methods for determining therapeutic index from gene expression profiles
EP1026260A1 (en) * 1999-02-02 2000-08-09 VYSIS, Inc. Simultaneous measurement of gene expression and genomic abnormalities using nucleic acid microarrays
WO2000055370A3 (en) * 1999-03-15 2002-01-10 Vistagen Inc Bar coding and indentifying nucleic acids using a limited number of probes and low stringency conditions
EP1041385A3 (en) * 1999-03-30 2004-01-02 Fuji Photo Film Co., Ltd. Method and apparatus for detecting an organism-originated substance
US6824866B1 (en) 1999-04-08 2004-11-30 Affymetrix, Inc. Porous silica substrates for polymer synthesis and assays
WO2000065095A3 (en) * 1999-04-23 2002-02-21 Clontech Lab Inc Methods and compositions for performing array based hybridization assays
US7321829B2 (en) 1999-05-19 2008-01-22 Eppendorf Array Technologies (E.A.T.) Method for the identification and/or the quantification of a target compound obtained from a biological sample upon chips
EP1179180B2 (en) 1999-05-19 2008-08-20 Eppendorf Array Technologies Method for the identification and/or the quantification of a target compound
US6221597B1 (en) 1999-05-21 2001-04-24 Rosetta Inpharmatics, Inc. Essential genes of yeast as targets for antifungal agents, herbicides, insecticides and anti-proliferative drugs
US6200803B1 (en) 1999-05-21 2001-03-13 Rosetta Inpharmatics, Inc. Essential genes of yeast as targets for antifungal agents, herbicides, insecticides and anti-proliferative drugs
US6197517B1 (en) 1999-05-21 2001-03-06 Rosetta Inpharmatics, Inc. Essential genes of yeast as targets for antifungal agents, herbicides, insecticides and anti-proliferative drugs
US6716579B1 (en) 1999-06-11 2004-04-06 Narayan Baidya Gene specific arrays, preparation and use
WO2000077257A1 (en) * 1999-06-11 2000-12-21 Clingenix, Inc. Gene specific arrays and the use thereof
US6656682B1 (en) 1999-06-21 2003-12-02 Nisshinbo Industries, Inc. Nucleic acid-immobilized substrate
US7344831B2 (en) * 1999-07-09 2008-03-18 Agilent Technologies, Inc. Methods for controlling cross-hybridization in analysis of nucleic acid sequences
EP1200820A4 (en) * 1999-07-16 2006-08-23 Rosetta Inpharmatics Inc DEVELOPMENT OF ITERATIVE GENESONES AND DETAILED EXPRESSION PROFILING MINT FLEXIBLE IN-SITU SYNTHESIS ARRAYS
US6346423B1 (en) 1999-07-16 2002-02-12 Agilent Technologies, Inc. Methods and compositions for producing biopolymeric arrays
US6887715B2 (en) 1999-07-16 2005-05-03 Agilent Technologies, Inc. Methods and compositions for producing biopolymeric arrays
US6887701B2 (en) 1999-07-30 2005-05-03 Large Scale Proteomics Corporation Microarrays and their manufacture
US6864050B2 (en) 1999-07-30 2005-03-08 Affymetrix, Inc. Single-phase amplification of nucleic acids
US7179638B2 (en) 1999-07-30 2007-02-20 Large Scale Biology Corporation Microarrays and their manufacture by slicing
US6846635B1 (en) 1999-07-30 2005-01-25 Large Scale Proteomics Corp. Microarrays and their manufacture
WO2001023614A1 (en) * 1999-09-28 2001-04-05 Affymetrix, Inc. Methods and computer software products for multiple probe gene expression analysis
US6505125B1 (en) 1999-09-28 2003-01-07 Affymetrix, Inc. Methods and computer software products for multiple probe gene expression analysis
WO2001023426A3 (en) * 1999-09-30 2001-11-01 Varian Associates Hypoxia-related human genes, proteins, and uses thereof
WO2001042512A3 (en) * 1999-11-24 2002-07-04 Incyte Genomics Inc Normalization controls and duplex probes for quantitative hybridization reactions
US6498245B2 (en) 1999-11-29 2002-12-24 Nisshinbo Industries, Inc. Nucleic acid-immobilized substrate
US6913882B2 (en) 1999-12-22 2005-07-05 Affymetrix, Inc. Methods of screening for B cell activity modulators
US6800439B1 (en) 2000-01-06 2004-10-05 Affymetrix, Inc. Methods for improved array preparation
GB2385053B (en) * 2000-02-04 2004-12-22 Aeomica Inc Human genome-derived single exon nucleic acid probes useful for analysis of gene expression in human breast and HBL 100 cells
GB2373500B (en) * 2000-02-04 2004-12-15 Aeomica Inc Methods and apparatus for predicting, confirming, and displaying functional information derived from genomic sequence
GB2397376B (en) * 2000-02-04 2004-12-01 Aeomica Inc Human genome-derived single exon nucleic acid probes useful for analysis of gene expression in human heart
GB2397376A (en) * 2000-02-04 2004-07-21 Aeomica Inc Human genome-derived single exon nucleic acid probes for analysis of gene expression in human heart
GB2378754B (en) * 2000-02-04 2004-12-01 Aeomica Inc Human genome-derived single exon nucleic acid probes useful for analysis of gene expression in human breast and BT 474 cells
GB2382814B (en) * 2000-02-04 2004-12-15 Aeomica Inc Human genome-derived single exon nucleic acid probes useful for analysis of gene expression in human hela cells or other human cervical epithelial cells
GB2376018B (en) * 2000-02-04 2005-07-13 Aeomica Inc Human genome-derived single exon nucleic acid probes useful for analysis of gene expression in human placenta
US6806361B1 (en) 2000-03-17 2004-10-19 Affymetrix, Inc. Methods of enhancing functional performance of nucleic acid arrays
US6833450B1 (en) 2000-03-17 2004-12-21 Affymetrix, Inc. Phosphite ester oxidation in nucleic acid array preparation
US7829313B2 (en) 2000-03-24 2010-11-09 Eppendorf Array Technologies Identification and quantification of a plurality of biological (micro)organisms or their components
EP1285089A4 (en) * 2000-04-25 2004-07-07 Affymetrix Inc METHODS FOR MONITORING THE EXPRESSION OF ALTERNATIVE SPLICE GENES
US7363165B2 (en) 2000-05-04 2008-04-22 The Board Of Trustees Of The Leland Stanford Junior University Significance analysis of microarrays
US7005259B1 (en) 2000-06-01 2006-02-28 Affymetrix, Inc. Methods for array preparation using substrate rotation
US8143009B2 (en) 2000-06-14 2012-03-27 Vistagen, Inc. Toxicity typing using liver stem cells
US8512957B2 (en) 2000-06-14 2013-08-20 Vistagen Therapeutics, Inc. Toxicity typing using liver stem cells
WO2002002804A1 (en) * 2000-06-30 2002-01-10 Aros Applied Biotechnology Aps Gene expression in biological conditions
US7666586B2 (en) 2000-06-30 2010-02-23 Aros Applied Biotechnology Aps Gene expression in biological conditions
US6741998B2 (en) 2000-07-18 2004-05-25 Aegis Analytical Corporation System, method and computer program for mapping a hierarchical display of process data of multi-database origins
US6725230B2 (en) * 2000-07-18 2004-04-20 Aegis Analytical Corporation System, method and computer program for assembling process data of multi-database origins using a hierarchical display
US7091033B2 (en) 2000-07-21 2006-08-15 Phase-1 Molecular Toxicology, Inc. Array of toxicologically relevant canine genes and uses thereof
EP1186673A3 (en) * 2000-09-11 2003-03-26 Agilent Technologies, Inc. (a Delaware corporation) Calibration of molecular array data
US7468243B2 (en) 2001-03-12 2008-12-23 Affymetrix, Inc. 2-aminopyrimidin-4-one nucleic acid labeling compounds
US8076072B2 (en) 2001-03-12 2011-12-13 Affymetrix, Inc. Nucleic acid labeling compounds
US8026057B2 (en) 2001-03-12 2011-09-27 Affymetrix, Inc. Nucleic acid labeling compounds
US8497064B2 (en) 2001-03-12 2013-07-30 Affymetrix, Inc. Nucleic acid labelling compounds
US11031098B2 (en) 2001-03-30 2021-06-08 Genetic Technologies Limited Computer systems and methods for genomic analysis
US7115726B2 (en) 2001-03-30 2006-10-03 Perlegen Sciences, Inc. Haplotype structures of chromosome 21
US6969589B2 (en) 2001-03-30 2005-11-29 Perlegen Sciences, Inc. Methods for genomic analysis
US9234235B2 (en) 2001-06-30 2016-01-12 Enzo Life Sciences, Inc. Processes for detecting or quantifying nucleic acids using an array of fixed or immobilized nucleic acids
US9279147B2 (en) 2001-06-30 2016-03-08 Enzo Life Sciences, Inc. Processes for detecting or quantifying analytes of interest
US9309563B2 (en) 2001-06-30 2016-04-12 Enzo Life Sciences, Inc. Compositions and processes for analyte detection, quantification and amplification
US9771667B2 (en) 2001-06-30 2017-09-26 Enzo Life Sciences, Inc. Arrays comprising chimeric compositions
US9487821B2 (en) 2001-06-30 2016-11-08 Enzo Life Sciences, Inc. Composition comprising library of double stranded nucleic acids
US9528146B2 (en) 2001-06-30 2016-12-27 Enzo Life Sciences, Inc. Processes for detecting or quantifying more than one nucleic acid in a library
US9234234B2 (en) 2001-06-30 2016-01-12 Enzo Life Sciences, Inc. Detection and quantification process for more than one nucleic acid in library
US9650666B2 (en) 2001-06-30 2017-05-16 Enzo Biochem, Inc. Processes for detecting or quantifying nucleic acids using an array of fixed or immobilized nucleic acids
US9777406B2 (en) 2001-06-30 2017-10-03 Enzo Biochem, Inc. Process for detecting or quantifying nucleic acids in a library
US9057100B2 (en) 2001-06-30 2015-06-16 Enzo Life Sciences, Inc. Composition comprising array of nucleic acid primer sets
US9765387B2 (en) 2001-06-30 2017-09-19 Enzo Biochem, Inc. Process for detecting or quantifying nucleic acids in a library
US9777312B2 (en) 2001-06-30 2017-10-03 Enzo Life Sciences, Inc. Dual polarity analysis of nucleic acids
US9745619B2 (en) 2001-06-30 2017-08-29 Enzo Biochem, Inc. Process for detecting or quantifying nucleic acids in a library
US9617584B2 (en) 2001-06-30 2017-04-11 Enzo Biochem, Inc. Processes for detecting or quantifying nucleic acids using an array of fixed or immobilized nucleic acids
US8597888B2 (en) 2001-06-30 2013-12-03 Enzo Life Sciences, Inc. Processes for detecting or quantifying more than one nucleic acid in a library
US7807352B2 (en) 2001-06-30 2010-10-05 Enzo Life Sciences, Inc. Process for producing two or more copies of nucleic acids in a library, and process for detecting or quantifiying more than one nucleic acid in a library
US9434984B2 (en) 2001-06-30 2016-09-06 Enzo Life Sciences, Inc. Composition comprising an array which further comprises chimeric compositions
US9428797B2 (en) 2001-06-30 2016-08-30 Enzo Life Sciences, Inc. Nucleic acid detecting or quantifying processes
US9637778B2 (en) 2001-06-30 2017-05-02 Enzo Biochem, Inc. Processes for detecting or quantifying nucleic acids using an array of fixed or immobilized nucleic acids
US9790621B2 (en) 2001-06-30 2017-10-17 Enzo Life Sciences, Inc. Composition of matter comprising library of first nucleic acid analyte copies
US7750133B2 (en) 2001-11-09 2010-07-06 Georgetown University Vascular endothelial cell growth inhibitor, VEGI-192a
US7498407B2 (en) 2001-11-09 2009-03-03 Georgetown University Vascular endothelial cell growth inhibitor, VEGI-192a
EP2360234A1 (en) 2001-11-30 2011-08-24 Fluidigm Corporation Microfluidic device and methods of using same
US9261460B2 (en) 2002-03-12 2016-02-16 Enzo Life Sciences, Inc. Real-time nucleic acid detection processes and compositions
US9068948B2 (en) 2002-03-12 2015-06-30 Enzo Life Sciences, Inc. Processes for detection of nucleic acids
US10144957B2 (en) 2002-03-12 2018-12-04 Enzo Life Sciences, Inc. Optimized real time nucleic acid detection processes
US9353405B2 (en) 2002-03-12 2016-05-31 Enzo Life Sciences, Inc. Optimized real time nucleic acid detection processes
US9316587B2 (en) 2002-03-12 2016-04-19 Enzo Life Sciences, Inc. Processes for quantitative or qualitative detection of single-stranded or double-stranded nucleic acids
US7176297B2 (en) 2002-04-08 2007-02-13 Affymetrix, Inc. Photoactivatable silane compounds and methods for their synthesis and use
US9388459B2 (en) 2002-06-17 2016-07-12 Affymetrix, Inc. Methods for genotyping
EP2365098A2 (en) 2002-06-20 2011-09-14 Affymetrix, Inc. Antireflective coatings for high-resolution photolithographic synthesis of dna array
EP2497837A1 (en) 2002-06-20 2012-09-12 Affymetrix, Inc. Antireflective coatings for high-resolution photolithographic synthesis of DNA array
US7894998B2 (en) * 2002-06-26 2011-02-22 Agilent Technologies, Inc. Method for identifying suitable nucleic acid probe sequences for use in nucleic acid arrays
US7476519B2 (en) * 2002-07-19 2009-01-13 Joseph Monforte Strategies for gene expression analysis
US7897750B2 (en) 2002-07-19 2011-03-01 Althea Technologies, Inc. Strategies for gene expression analysis
US7822555B2 (en) 2002-11-11 2010-10-26 Affymetrix, Inc. Methods for identifying DNA copy number changes
US10108777B2 (en) 2002-11-11 2018-10-23 Affymetrix, Inc. Methods for identifying DNA copy number changes
US8190373B2 (en) 2002-11-11 2012-05-29 Affymetrix, Inc. Methods for identifying DNA copy number changes
WO2004044236A1 (en) 2002-11-14 2004-05-27 Genomics Research Partners Pty Ltd Status determination
US7319933B2 (en) 2003-03-21 2008-01-15 Hoffmann-La Roche Inc. Gene transcription assay method
EP2340890A1 (en) 2003-04-03 2011-07-06 Fluidigm Corporation Microfluidic devices and methods of using same
US8815510B2 (en) 2003-04-11 2014-08-26 Affymetrix, Inc. Combinatorial affinity selection
WO2005012574A3 (en) * 2003-04-29 2005-08-04 Genvault Corp Biological bar-code
US20070218485A1 (en) * 2003-04-29 2007-09-20 Gen Vault Corporation Biological bar code
US7632652B2 (en) 2003-06-24 2009-12-15 Ventana Medical Systems, Inc. Enzyme-catalyzed metal deposition for the enhanced in situ detection of immunohistochemical epitopes and nucleic acid sequences
US7642064B2 (en) 2003-06-24 2010-01-05 Ventana Medical Systems, Inc. Enzyme-catalyzed metal deposition for the enhanced detection of analytes of interest
US8703417B2 (en) 2003-06-24 2014-04-22 Ventana Medical Systems, Inc. Enzyme-catalyzed metal deposition for the enhanced detection of analytes of interest
US7335474B2 (en) 2003-09-12 2008-02-26 Perlegen Sciences, Inc. Methods and systems for identifying predisposition to the placebo effect
US8041512B2 (en) * 2003-12-26 2011-10-18 Canon Kabushiki Kaisha Method of acquiring a set of specific elements for discriminating sequence
US8017321B2 (en) 2004-01-23 2011-09-13 The Regents Of The University Of Colorado, A Body Corporate Gefitinib sensitivity-related gene expression and products and methods related thereto
WO2005111212A3 (en) * 2004-04-29 2006-08-03 Genvault Corp Biological bar code
WO2005111242A3 (en) * 2004-05-10 2006-01-26 Parallele Bioscience Inc Digital profiling of polynucleotide populations
WO2006025879A3 (en) * 2004-05-11 2007-01-25 Wyeth Corp Novel polynucleotides related to oligonucleotide arrays to monitor gene expression
WO2005111246A1 (en) * 2004-05-11 2005-11-24 Wyeth Oligonucleotide arrays to monitor gene expression and methods for making and using same
US9434994B2 (en) 2004-05-27 2016-09-06 The Regents Of The University Of Colorado, A Body Corporate Methods for prediction of clinical outcome to epidermal growth factor receptor inhibitors by non-small cell lung cancer patients
EP2471923A1 (en) 2004-05-28 2012-07-04 Asuragen, Inc. Methods and compositions involving microRNA
EP2290071A2 (en) 2004-05-28 2011-03-02 Asuragen, Inc. Methods and compositions involving microRNA
EP2290075A2 (en) 2004-05-28 2011-03-02 Asuragen, Inc. Methods and compositions involving microRNA
EP2290072A2 (en) 2004-05-28 2011-03-02 Asuragen, Inc. Methods and compositions involving microRNA
EP2290076A2 (en) 2004-05-28 2011-03-02 Asuragen, Inc. Methods and compositions involving microRNA
WO2005118806A2 (en) 2004-05-28 2005-12-15 Ambion, Inc. METHODS AND COMPOSITIONS INVOLVING MicroRNA
EP2290074A2 (en) 2004-05-28 2011-03-02 Asuragen, Inc. Methods and compositions involving microRNA
EP2290068A2 (en) 2004-05-28 2011-03-02 Asuragen, Inc. Methods and compositions involving microRNA
EP2290067A2 (en) 2004-05-28 2011-03-02 Asuragen, Inc. Methods and compositions involving microRNA
EP2290073A2 (en) 2004-05-28 2011-03-02 Asuragen, Inc. Methods and compositions involving microRNA
EP2290070A2 (en) 2004-05-28 2011-03-02 Asuragen, Inc. Methods and compositions involving microRNA
EP2065466A2 (en) 2004-05-28 2009-06-03 Asuragen, Inc. Methods and compositions involving MicroRNA
EP2471922A1 (en) 2004-05-28 2012-07-04 Asuragen, Inc. Methods and compositions involving microRNA
EP2290066A2 (en) 2004-05-28 2011-03-02 Asuragen, Inc. Methods and compositions involving microRNA
EP2474616A1 (en) 2004-05-28 2012-07-11 Asuragen, Inc. Methods and compositions involving microRNA
EP2290069A2 (en) 2004-05-28 2011-03-02 Asuragen, Inc. Methods and compositions involving microRNA
EP2471921A1 (en) 2004-05-28 2012-07-04 Asuragen, Inc. Methods and compositions involving microRNA
EP2471924A1 (en) 2004-05-28 2012-07-04 Asuragen, INC. Methods and compositions involving microRNA
US7338763B2 (en) 2004-06-02 2008-03-04 Eppendorf Array Technologies S.A. Method and kit for the detection and/or quantification of homologous nucleotide sequences on arrays
WO2006007534A3 (en) * 2004-07-01 2006-11-16 Ambion Inc System and method for processing results of a complex genetic test
EP2251418A1 (en) 2004-10-07 2010-11-17 Argos Therapeutics, Inc. Mature dendritic cell compositions and methods for culturing same
EP2302054A1 (en) 2004-11-12 2011-03-30 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2281888A1 (en) 2004-11-12 2011-02-09 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2298894A1 (en) 2004-11-12 2011-03-23 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2302051A1 (en) 2004-11-12 2011-03-30 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2298893A1 (en) 2004-11-12 2011-03-23 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2292755A1 (en) 2004-11-12 2011-03-09 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2292756A1 (en) 2004-11-12 2011-03-09 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2287303A1 (en) 2004-11-12 2011-02-23 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2284265A1 (en) 2004-11-12 2011-02-16 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2314688A1 (en) 2004-11-12 2011-04-27 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2281886A1 (en) 2004-11-12 2011-02-09 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2281889A1 (en) 2004-11-12 2011-02-09 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2302053A1 (en) 2004-11-12 2011-03-30 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2281887A1 (en) 2004-11-12 2011-02-09 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2302055A1 (en) 2004-11-12 2011-03-30 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2322616A1 (en) 2004-11-12 2011-05-18 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2808389A1 (en) 2004-11-12 2014-12-03 Asuragen, Inc. Methods and compositions involving MIRNA and MIRNA inhibitor molecules
EP2808390A1 (en) 2004-11-12 2014-12-03 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2302052A1 (en) 2004-11-12 2011-03-30 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2302056A1 (en) 2004-11-12 2011-03-30 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US8288128B2 (en) 2004-11-18 2012-10-16 Eppendorf Array Technologies S.A. Real-time quantification of multiple targets on a micro-array
EP1690947A3 (en) * 2005-02-14 2007-04-11 Canon Kabushiki Kaisha Base sequence for control probe and method of designing the same
US7923546B2 (en) 2005-02-14 2011-04-12 Canon Kabushiki Kaisha Base sequence for control probe and method of designing the same
EP2604703A2 (en) 2005-03-14 2013-06-19 The Board of Trustees of Leland Stanford Junior University Methods and compositions for evaluating graft survival in a solid organ transplant recipient
EP2371453A1 (en) 2005-03-18 2011-10-05 Fluidigm Corporation Microfluidic device
EP2518161A1 (en) 2005-03-18 2012-10-31 Fluidigm Corporation Method for detection of mutant alleles
WO2006112709A3 (en) * 2005-04-18 2007-07-26 Dsm Ip Assets Bv Biochip and process for the production of a biochip
EP1731620A1 (en) 2005-06-07 2006-12-13 Institut National De La Sante Et De La Recherche Medicale (Inserm) Method for the diagnosis of immune graft tolerance
US8078409B2 (en) * 2005-07-26 2011-12-13 Sysmex Corporation External quality control method, external quality control computer, preprocessing device, and nucleic acid detecting device
EP1762628A1 (en) 2005-09-13 2007-03-14 Eppendorf Array Technologies SA Detection method of homologous sequences differing by one base on a microarray
EP2302079A2 (en) 2005-09-15 2011-03-30 Baylor Research Institute Systemic lupus erythematosus diagnostic assay
US7608395B2 (en) 2005-09-15 2009-10-27 Baylor Research Institute Systemic lupus erythematosus diagnostic assay
US8170808B2 (en) 2005-09-30 2012-05-01 Affymetrix, Inc. Methods and computer software for detecting splice variants
US10275568B2 (en) 2005-09-30 2019-04-30 Affymetrix, Inc. Methods and computer software for detecting splice variants
US7962291B2 (en) 2005-09-30 2011-06-14 Affymetrix, Inc. Methods and computer software for detecting splice variants
WO2007059839A1 (de) * 2005-11-28 2007-05-31 Advalytix Ag Verfahren, vorrichtung und kit zur untersuchung von makromolekülen in einer probe
EP2546359A1 (en) 2005-12-08 2013-01-16 Novartis AG Effects of inhibitors of FGFR3 on gene transcription
EP2416270A2 (en) 2005-12-09 2012-02-08 Baylor Research Institute Module-level analysis of peripheral blood leukocyte transcriptional profiles
US11306351B2 (en) 2005-12-21 2022-04-19 Affymetrix, Inc. Methods for genotyping
US7537897B2 (en) 2006-01-23 2009-05-26 Population Genetics Technologies, Ltd. Molecular counting
EP3456331A1 (en) 2006-02-08 2019-03-20 Genzyme Corporation Gene therapy for niemann-pick disease type a
EP2442108A1 (en) 2006-07-14 2012-04-18 The Regents of the University of California Cancer biomarkers and methods of use thereof
US12332245B2 (en) 2006-07-14 2025-06-17 The Regents Of The University Of California Cancer biomarkers and methods of use thereof
EP2442109A1 (en) 2006-07-14 2012-04-18 The Regents of the University of California Cancer biomarkers and methods of use thereof
EP2450710A2 (en) 2006-07-14 2012-05-09 The Regents of the University of California Cancer biomarkers and methods of use thereof
EP3796002A1 (en) 2006-07-14 2021-03-24 The Regents of The University of California Cancer biomarkers and methods of use thereof
US7897359B2 (en) 2006-07-26 2011-03-01 Leland Standford Junior Univsersity Cell cycle regulation and differentiation
US7993921B2 (en) 2006-07-26 2011-08-09 National Institutes Of Health (Nih) Cell cycle regulation and differentiation
EP2487240A1 (en) 2006-09-19 2012-08-15 Asuragen, Inc. Micrornas differentially expressed in pancreatic diseases and uses thereof
WO2008036776A2 (en) 2006-09-19 2008-03-27 Asuragen, Inc. Mir-15, mir-26, mir -31,mir -145, mir-147, mir-188, mir-215, mir-216 mir-331, mmu-mir-292-3p regulated genes and pathways as targets for therapeutic intervention
EP2506172A1 (en) 2006-11-03 2012-10-03 Baylor Research Institute Diagnosis of metastatic melanoma and monitoring indicators of immunosuppression through blood leukocyte microarray analysis
EP2570951A1 (en) 2006-11-03 2013-03-20 Baylor Research Institute Diagnosis of metastatic melanoma and monitoring indicators of immunosuppression through blood leukocyte microarray analysis
EP2579174A1 (en) 2006-11-03 2013-04-10 Baylor Research Institute Diagnosis of metastatic melanoma and monitoring indicators of immunosuppression through blood leukocyte microarray analysis
EP2993473A1 (en) 2007-01-30 2016-03-09 Pharmacyclics, Inc. Methods for determining cancer resistance to histone deacetylase inhibitors
EP2253721A1 (en) 2007-02-26 2010-11-24 INSERM (Institut National de la Santé et de la Recherche Medicale) Method for predicting the occurence of lung metastasis in breast cancer patients
US9760675B2 (en) 2007-05-18 2017-09-12 Affymetrix, Inc. System, method, and computer software product for genotype determination using probe array data
US10832796B2 (en) 2007-05-18 2020-11-10 Affymetrix, Inc. System, method, and computer software product for genotype determination using probe array data
US9790543B2 (en) 2007-10-23 2017-10-17 Roche Sequencing Solutions, Inc. Methods and systems for solution based sequence enrichment
US10900068B2 (en) 2007-10-23 2021-01-26 Roche Sequencing Solutions, Inc. Methods and systems for solution based sequence enrichment
US8211652B2 (en) 2008-01-29 2012-07-03 University of Pittsburgh—of the Commonwealth System of Higher Education FSTL-1 as a biomaker of inflammation
US8658379B2 (en) 2008-01-29 2014-02-25 University of Pittsburgh—of the Commonwealth System of Higher Education Follistatin-like protein-1 as a biomarker for sepsis
EP2990487A1 (en) 2008-05-08 2016-03-02 Asuragen, INC. Compositions and methods related to mirna modulation of neovascularization or angiogenesis
EP2631301A1 (en) 2008-08-18 2013-08-28 The Board of Trustees of the Leland Stanford Junior University Methods and compositions for determining a graft tolerant phenotype in a subject
WO2010062706A2 (en) 2008-10-30 2010-06-03 Caris Mpi, Inc. Methods for assessing rna patterns
WO2010096658A1 (en) 2009-02-19 2010-08-26 The Cleveland Clinic Foundation Corin as a marker for heart failure
US12209284B2 (en) 2009-07-09 2025-01-28 The Scripps Research Institute Gene expression profiles associated with chronic allograft nephropathy
US11821037B2 (en) 2009-07-09 2023-11-21 The Scripps Research Institute Gene expression profiles associated with chronic allograft nephropathy
US9752191B2 (en) 2009-07-09 2017-09-05 The Scripps Research Institute Gene expression profiles associated with chronic allograft nephropathy
US8932817B2 (en) 2009-07-21 2015-01-13 Gen-Probe Incorporated Methods for quantitative amplification and detection over a wide dynamic range
US8628924B2 (en) 2009-07-21 2014-01-14 Gen-Probe Incorporated Methods and compositions for quantitative amplification and detection over a wide dynamic range
US9856527B2 (en) 2009-07-21 2018-01-02 Gen-Probe Incorporated Methods for quantitative amplification and detection over a wide dynamic range
US9347098B2 (en) 2009-07-21 2016-05-24 Gen-Probe Incorporated Reaction mixtures for quantitative amplification and detection over a wide dynamic range
WO2011025736A1 (en) 2009-08-22 2011-03-03 The Board Of Trustees Of The Leland Stanford Junior University Imaging and evaluating embryos, oocytes, and stem cells
EP2827150A1 (en) 2009-08-22 2015-01-21 The Board Of Trustees Of The University Of the Leland Stanford Junior University Imaging and evaluating embryos, oocytes, and stem cells
EP3805762A1 (en) 2009-08-22 2021-04-14 The Board of Trustees of the Leland Stanford Junior University Imaging and evaluating embryos, oocytes, and stem cells
EP2615460A1 (en) 2009-08-22 2013-07-17 The Board Of Trustees Of The University Of the Leland Stanford Junior University Imaging and evaluating embryos, oocytes, and stem cells
EP3185013A2 (en) 2009-12-02 2017-06-28 The Board of Trustees of the Leland Stanford Junior University Biomarkers for determining an allograft tolerant phenotype
WO2011068829A1 (en) 2009-12-02 2011-06-09 The Board Of Trustees Of The Leland Stanford Junior University Biomarkers for determining an allograft tolerant phenotype
US12571038B2 (en) 2009-12-15 2026-03-10 Becton, Dickinson And Company Digital counting of individual molecules by stochastic attachment of diverse labels
US10047394B2 (en) 2009-12-15 2018-08-14 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US9290808B2 (en) 2009-12-15 2016-03-22 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US9290809B2 (en) 2009-12-15 2016-03-22 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US12060607B2 (en) 2009-12-15 2024-08-13 Becton, Dickinson And Company Digital counting of individual molecules by stochastic attachment of diverse labels
US9315857B2 (en) 2009-12-15 2016-04-19 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse label-tags
US9845502B2 (en) 2009-12-15 2017-12-19 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US8835358B2 (en) 2009-12-15 2014-09-16 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US10392661B2 (en) 2009-12-15 2019-08-27 Becton, Dickinson And Company Digital counting of individual molecules by stochastic attachment of diverse labels
US11993814B2 (en) 2009-12-15 2024-05-28 Becton, Dickinson And Company Digital counting of individual molecules by stochastic attachment of diverse labels
US9708659B2 (en) 2009-12-15 2017-07-18 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US9816137B2 (en) 2009-12-15 2017-11-14 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US11970737B2 (en) 2009-12-15 2024-04-30 Becton, Dickinson And Company Digital counting of individual molecules by stochastic attachment of diverse labels
US10202646B2 (en) 2009-12-15 2019-02-12 Becton, Dickinson And Company Digital counting of individual molecules by stochastic attachment of diverse labels
US10059991B2 (en) 2009-12-15 2018-08-28 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US10619203B2 (en) 2009-12-15 2020-04-14 Becton, Dickinson And Company Digital counting of individual molecules by stochastic attachment of diverse labels
WO2011073629A2 (en) 2009-12-17 2011-06-23 Ucl Business Plc Cancer diagnosis and treatment
WO2011109398A2 (en) 2010-03-02 2011-09-09 President And Fellows Of Harvard College Methods and compositions for treatment of angelman syndrome and autism spectrum disorders
EP3214174A1 (en) 2010-03-04 2017-09-06 InteRNA Technologies B.V. A mirna molecule defined by its source and its diagnostic and therapeutic uses in diseases or conditions associated with emt
WO2011108930A1 (en) 2010-03-04 2011-09-09 Interna Technologies Bv A MiRNA MOLECULE DEFINED BY ITS SOURCE AND ITS DIAGNOSTIC AND THERAPEUTIC USES IN DISEASES OR CONDITIONS ASSOCIATED WITH EMT
WO2011133538A1 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company Genetic signatures and gene chips associated with administration of electrically conducted radio frequency current to skin and methods and treatments relating thereto
WO2011133539A2 (en) 2010-04-19 2011-10-27 The Procter & Gamble Company Combined energy and topical composition application for regulating the condition of mammalian skin
WO2011139721A1 (en) 2010-04-27 2011-11-10 The Regents Of The University Of California Cancer biomarkers and methods of use thereof
EP3508854A1 (en) 2010-04-27 2019-07-10 The Regents of The University of California Cancer biomarkers and methods of use thereof
US12571798B2 (en) 2010-04-27 2026-03-10 The Regents Of The University Of California Cancer biomarkers and methods of use thereof
WO2012005572A1 (en) 2010-07-06 2012-01-12 Interna Technologies Bv Mirna and its diagnostic and therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated braf pathway
EP3369817A1 (en) 2010-07-06 2018-09-05 InteRNA Technologies B.V. Mirna and its diagnostic and therapeutic uses in diseases or conditions associated with melanoma , or in diseases or conditions with activated braf pathway
US8741584B2 (en) 2010-08-05 2014-06-03 University of Pittsburgh—of the Commonwealth System of Higher Education Follistatin-like protein-1 as a biomarker for inflammatory disorders
WO2012037378A2 (en) 2010-09-15 2012-03-22 Almac Diagnostics Limited Molecular diagnostic test for cancer
US10214777B2 (en) 2010-09-15 2019-02-26 Almac Diagnostics Limited Molecular diagnostic test for cancer
US9677140B2 (en) 2010-09-15 2017-06-13 Almac Diagonostics Limited Molecular diagnostic test for cancer
US10378066B2 (en) 2010-09-15 2019-08-13 Almac Diagnostic Services Limited Molecular diagnostic test for cancer
EP2975399A1 (en) 2010-09-15 2016-01-20 Almac Diagnostics Limited Molecular diagnostic test for cancer
US9670536B2 (en) 2010-09-21 2017-06-06 Population Genetics Technologies Ltd. Increased confidence of allele calls with molecular counting
WO2012068400A2 (en) 2010-11-17 2012-05-24 Asuragen, Inc. Mirnas as biomarkers for distinguishing benign from malignant thyroid neoplasms
EP2772550A1 (en) 2010-11-17 2014-09-03 Asuragen, Inc. MiRNAs as biomarkers for distinguishing benign from malignant thyroid neoplasms
EP2474617A1 (en) 2011-01-11 2012-07-11 InteRNA Technologies BV Mir for treating neo-angiogenesis
WO2012096573A1 (en) 2011-01-11 2012-07-19 Interna Technologies B.V. Mirna for treating diseases and conditions associated with neo-angiogenesis
WO2012116185A1 (en) 2011-02-23 2012-08-30 The Board Of Trustees Of The Leland Stanford Junior University Methods of detecting aneuploidy in human embryos
WO2012158238A2 (en) 2011-02-28 2012-11-22 University Of Iowa Research Foundation Anti-müllerian hormone changes in pregnancy and prediction ofadverse pregnancy outcomes and gender
WO2012131594A1 (en) 2011-03-28 2012-10-04 Novartis Ag Markers associated with cyclin-dependent kinase inhibitors
US10260097B2 (en) 2011-06-02 2019-04-16 Almac Diagnostics Limited Method of using a gene expression profile to determine cancer responsiveness to an anti-angiogenic agent
WO2013003112A1 (en) 2011-06-27 2013-01-03 The Jackson Laboratory Methods and compositions for treatment of cancer and autoimmune disease
WO2013040251A2 (en) 2011-09-13 2013-03-21 Asurgen, Inc. Methods and compositions involving mir-135b for distinguishing pancreatic cancer from benign pancreatic disease
WO2013063519A1 (en) 2011-10-26 2013-05-02 Asuragen, Inc. Methods and compositions involving mirna expression levels for distinguishing pancreatic cysts
WO2013063544A1 (en) 2011-10-27 2013-05-02 Asuragen, Inc. Mirnas as diagnostic biomarkers to distinguish benign from malignant thyroid tumors
WO2013087789A1 (en) 2011-12-13 2013-06-20 Glykos Finland Ltd. Antibody isoform arrays and methods thereof
US11634708B2 (en) 2012-02-27 2023-04-25 Becton, Dickinson And Company Compositions and kits for molecular counting
US10941396B2 (en) 2012-02-27 2021-03-09 Becton, Dickinson And Company Compositions and kits for molecular counting
US11177020B2 (en) 2012-02-27 2021-11-16 The University Of North Carolina At Chapel Hill Methods and uses for molecular tags
US9670529B2 (en) 2012-02-28 2017-06-06 Population Genetics Technologies Ltd. Method for attaching a counter sequence to a nucleic acid sample
WO2014007623A1 (en) 2012-07-03 2014-01-09 Interna Technologies B.V. Diagnostic portfolio and its uses
WO2014011398A1 (en) 2012-07-09 2014-01-16 Novartis Ag Biomarkers associated with cdk inhibitors
EP3309263A1 (en) 2012-07-09 2018-04-18 Novartis AG Biomarkers associated with cdk inhibitors
WO2014020502A2 (en) 2012-07-31 2014-02-06 Novartis Ag Markers associated with human double minute 2 inhibitors
US10837063B2 (en) 2012-09-04 2020-11-17 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10876171B2 (en) 2012-09-04 2020-12-29 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US9598731B2 (en) 2012-09-04 2017-03-21 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11001899B1 (en) 2012-09-04 2021-05-11 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US9902992B2 (en) 2012-09-04 2018-02-27 Guardant Helath, Inc. Systems and methods to detect rare mutations and copy number variation
US10995376B1 (en) 2012-09-04 2021-05-04 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US9840743B2 (en) 2012-09-04 2017-12-12 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US12319972B2 (en) 2012-09-04 2025-06-03 Guardent Health, Inc. Methods for monitoring residual disease
US10961592B2 (en) 2012-09-04 2021-03-30 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10041127B2 (en) 2012-09-04 2018-08-07 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10947600B2 (en) 2012-09-04 2021-03-16 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11319597B2 (en) 2012-09-04 2022-05-03 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11319598B2 (en) 2012-09-04 2022-05-03 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10894974B2 (en) 2012-09-04 2021-01-19 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11434523B2 (en) 2012-09-04 2022-09-06 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US12281354B2 (en) 2012-09-04 2025-04-22 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US9834822B2 (en) 2012-09-04 2017-12-05 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10876172B2 (en) 2012-09-04 2020-12-29 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10876152B2 (en) 2012-09-04 2020-12-29 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10822663B2 (en) 2012-09-04 2020-11-03 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10793916B2 (en) 2012-09-04 2020-10-06 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10738364B2 (en) 2012-09-04 2020-08-11 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11773453B2 (en) 2012-09-04 2023-10-03 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US12252749B2 (en) 2012-09-04 2025-03-18 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10683556B2 (en) 2012-09-04 2020-06-16 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11879158B2 (en) 2012-09-04 2024-01-23 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11913065B2 (en) 2012-09-04 2024-02-27 Guardent Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10501810B2 (en) 2012-09-04 2019-12-10 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10501808B2 (en) 2012-09-04 2019-12-10 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10494678B2 (en) 2012-09-04 2019-12-03 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US12049673B2 (en) 2012-09-04 2024-07-30 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US12054783B2 (en) 2012-09-04 2024-08-06 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10457995B2 (en) 2012-09-04 2019-10-29 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US12116624B2 (en) 2012-09-04 2024-10-15 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US12110560B2 (en) 2012-09-04 2024-10-08 Guardant Health, Inc. Methods for monitoring residual disease
US12606874B2 (en) 2012-09-04 2026-04-21 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
WO2014055117A1 (en) 2012-10-04 2014-04-10 Asuragen, Inc. Diagnostic mirnas for differential diagnosis of incidental pancreatic cystic lesions
WO2014062635A1 (en) 2012-10-19 2014-04-24 Novartis Ag Markers for acute lymphoblastic leukemia
US11091809B2 (en) 2012-12-03 2021-08-17 Almac Diagnostic Services Limited Molecular diagnostic test for cancer
WO2014087156A1 (en) 2012-12-03 2014-06-12 Almac Diagnostics Limited Molecular diagnostic test for cancer
WO2014141038A2 (en) 2013-03-11 2014-09-18 Irm Llc Markers associated with wnt inhibitors
WO2014159239A2 (en) 2013-03-14 2014-10-02 Novartis Ag Antibodies against notch 3
WO2014159242A1 (en) 2013-03-14 2014-10-02 Novartis Ag Notch 3 mutants and uses thereof
EP3611189A1 (en) 2013-03-14 2020-02-19 Novartis AG Antibodies against notch 3
EP4163387A1 (en) 2013-03-15 2023-04-12 The University of Chicago Methods and compositions related to t-cell activity
WO2014145612A1 (en) 2013-03-15 2014-09-18 Ajay Goel Tissue and blood-based mirna biomarkers for the diagnosis, prognosis and metastasis-predictive potential in colorectal cancer
EP3404116A1 (en) 2013-03-15 2018-11-21 The University of Chicago Methods and compositions related to t-cell activity
WO2014151551A1 (en) 2013-03-15 2014-09-25 Baylor Research Institute Ulcerative colitis (uc)-associated colorectal neoplasia markers
EP3366785A2 (en) 2013-03-15 2018-08-29 Baylor Research Institute Ulcerative colitis (uc)-associated colorectal neoplasia markers
WO2014176047A1 (en) 2013-04-25 2014-10-30 Novartis Ag Markers for ezh2 inhibitors
US9833761B2 (en) 2013-08-05 2017-12-05 Twist Bioscience Corporation De novo synthesized gene libraries
US11452980B2 (en) 2013-08-05 2022-09-27 Twist Bioscience Corporation De novo synthesized gene libraries
WO2015021080A2 (en) 2013-08-05 2015-02-12 Twist Bioscience Corporation De novo synthesized gene libraries
US10272410B2 (en) 2013-08-05 2019-04-30 Twist Bioscience Corporation De novo synthesized gene libraries
US10583415B2 (en) 2013-08-05 2020-03-10 Twist Bioscience Corporation De novo synthesized gene libraries
US9555388B2 (en) 2013-08-05 2017-01-31 Twist Bioscience Corporation De novo synthesized gene libraries
US10618024B2 (en) 2013-08-05 2020-04-14 Twist Bioscience Corporation De novo synthesized gene libraries
EP4242321A2 (en) 2013-08-05 2023-09-13 Twist Bioscience Corporation De novo synthesized gene libraries
US9403141B2 (en) 2013-08-05 2016-08-02 Twist Bioscience Corporation De novo synthesized gene libraries
US10632445B2 (en) 2013-08-05 2020-04-28 Twist Bioscience Corporation De novo synthesized gene libraries
US10639609B2 (en) 2013-08-05 2020-05-05 Twist Bioscience Corporation De novo synthesized gene libraries
US9889423B2 (en) 2013-08-05 2018-02-13 Twist Bioscience Corporation De novo synthesized gene libraries
US12569822B2 (en) 2013-08-05 2026-03-10 Twist Bioscience Corporation De novo synthesized gene libraries
US11559778B2 (en) 2013-08-05 2023-01-24 Twist Bioscience Corporation De novo synthesized gene libraries
US11185837B2 (en) 2013-08-05 2021-11-30 Twist Bioscience Corporation De novo synthesized gene libraries
EP4610368A2 (en) 2013-08-05 2025-09-03 Twist Bioscience Corporation De novo synthesized gene libraries
US9839894B2 (en) 2013-08-05 2017-12-12 Twist Bioscience Corporation De novo synthesized gene libraries
US10384188B2 (en) 2013-08-05 2019-08-20 Twist Bioscience Corporation De novo synthesized gene libraries
EP3722442A1 (en) 2013-08-05 2020-10-14 Twist Bioscience Corporation De novo synthesized gene libraries
US9409139B2 (en) 2013-08-05 2016-08-09 Twist Bioscience Corporation De novo synthesized gene libraries
US10773232B2 (en) 2013-08-05 2020-09-15 Twist Bioscience Corporation De novo synthesized gene libraries
US10151003B2 (en) 2013-08-28 2018-12-11 Cellular Research, Inc. Massively Parallel single cell analysis
US10253375B1 (en) 2013-08-28 2019-04-09 Becton, Dickinson And Company Massively parallel single cell analysis
US11702706B2 (en) 2013-08-28 2023-07-18 Becton, Dickinson And Company Massively parallel single cell analysis
US9598736B2 (en) 2013-08-28 2017-03-21 Cellular Research, Inc. Massively parallel single cell analysis
US10208356B1 (en) 2013-08-28 2019-02-19 Becton, Dickinson And Company Massively parallel single cell analysis
US9637799B2 (en) 2013-08-28 2017-05-02 Cellular Research, Inc. Massively parallel single cell analysis
US9567645B2 (en) 2013-08-28 2017-02-14 Cellular Research, Inc. Massively parallel single cell analysis
US10954570B2 (en) 2013-08-28 2021-03-23 Becton, Dickinson And Company Massively parallel single cell analysis
US9567646B2 (en) 2013-08-28 2017-02-14 Cellular Research, Inc. Massively parallel single cell analysis
US10927419B2 (en) 2013-08-28 2021-02-23 Becton, Dickinson And Company Massively parallel single cell analysis
US11618929B2 (en) 2013-08-28 2023-04-04 Becton, Dickinson And Company Massively parallel single cell analysis
US10131958B1 (en) 2013-08-28 2018-11-20 Cellular Research, Inc. Massively parallel single cell analysis
US9582877B2 (en) 2013-10-07 2017-02-28 Cellular Research, Inc. Methods and systems for digitally counting features on arrays
US9905005B2 (en) 2013-10-07 2018-02-27 Cellular Research, Inc. Methods and systems for digitally counting features on arrays
US12435368B2 (en) 2013-12-28 2025-10-07 Guardant Health, Inc. Methods and systems for detecting genetic variants
US10889858B2 (en) 2013-12-28 2021-01-12 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11118221B2 (en) 2013-12-28 2021-09-14 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11149307B2 (en) 2013-12-28 2021-10-19 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11149306B2 (en) 2013-12-28 2021-10-19 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11667967B2 (en) 2013-12-28 2023-06-06 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11959139B2 (en) 2013-12-28 2024-04-16 Guardant Health, Inc. Methods and systems for detecting genetic variants
US12024745B2 (en) 2013-12-28 2024-07-02 Guardant Health, Inc. Methods and systems for detecting genetic variants
US10801063B2 (en) 2013-12-28 2020-10-13 Guardant Health, Inc. Methods and systems for detecting genetic variants
US12024746B2 (en) 2013-12-28 2024-07-02 Guardant Health, Inc. Methods and systems for detecting genetic variants
US10883139B2 (en) 2013-12-28 2021-01-05 Guardant Health, Inc. Methods and systems for detecting genetic variants
US12319961B1 (en) 2013-12-28 2025-06-03 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11767555B2 (en) 2013-12-28 2023-09-26 Guardant Health, Inc. Methods and systems for detecting genetic variants
US12098421B2 (en) 2013-12-28 2024-09-24 Guardant Health, Inc. Methods and systems for detecting genetic variants
US12258626B2 (en) 2013-12-28 2025-03-25 Guardant Health, Inc. Methods and systems for detecting genetic variants
US9920366B2 (en) 2013-12-28 2018-03-20 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11434531B2 (en) 2013-12-28 2022-09-06 Guardant Health, Inc. Methods and systems for detecting genetic variants
US12098422B2 (en) 2013-12-28 2024-09-24 Guardant Health, Inc. Methods and systems for detecting genetic variants
US12054774B2 (en) 2013-12-28 2024-08-06 Guardant Health, Inc. Methods and systems for detecting genetic variants
US12286672B2 (en) 2013-12-28 2025-04-29 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11639525B2 (en) 2013-12-28 2023-05-02 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11767556B2 (en) 2013-12-28 2023-09-26 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11639526B2 (en) 2013-12-28 2023-05-02 Guardant Health, Inc. Methods and systems for detecting genetic variants
US11649491B2 (en) 2013-12-28 2023-05-16 Guardant Health, Inc. Methods and systems for detecting genetic variants
WO2015120130A1 (en) 2014-02-07 2015-08-13 Novartis Ag Impact of genetic factors on disease progression and response to anti-c5 antibody in geographic atrophy
US10280468B2 (en) 2014-02-07 2019-05-07 Almac Diagnostics Limited Molecular diagnostic test for predicting response to anti-angiogenic drugs and prognosis of cancer
US10870880B2 (en) 2014-03-05 2020-12-22 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11667959B2 (en) 2014-03-05 2023-06-06 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10982265B2 (en) 2014-03-05 2021-04-20 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10704085B2 (en) 2014-03-05 2020-07-07 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11447813B2 (en) 2014-03-05 2022-09-20 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11091796B2 (en) 2014-03-05 2021-08-17 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US11091797B2 (en) 2014-03-05 2021-08-17 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US10704086B2 (en) 2014-03-05 2020-07-07 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
EP3825418A2 (en) 2014-05-22 2021-05-26 The Scripps Research Institute Molecular signatures for distinguishing liver transplant rejections or injuries
US12060611B2 (en) 2014-05-22 2024-08-13 The Scripps Research Institute Gene expression profiles associated with sub-clinical kidney transplant rejection
EP3825417A2 (en) 2014-05-22 2021-05-26 The Scripps Research Institute Tissue molecular signatures of kidney transplant rejections
EP3825416A2 (en) 2014-05-22 2021-05-26 The Scripps Research Institute Gene expression profiles associated with sub-clinical kidney transplant rejection
US10443100B2 (en) 2014-05-22 2019-10-15 The Scripps Research Institute Gene expression profiles associated with sub-clinical kidney transplant rejection
US11104951B2 (en) 2014-05-22 2021-08-31 The Scripps Research Institute Molecular signatures for distinguishing liver transplant rejections or injuries
WO2016025510A1 (en) 2014-08-12 2016-02-18 Rappolee Daniel A Systems and methods to detect stem cell stress and uses thereof
WO2016038550A1 (en) 2014-09-11 2016-03-17 Novartis Ag Inhibition of prmt5 to treat mtap-deficiency-related diseases
WO2016089883A1 (en) 2014-12-01 2016-06-09 Novartis Ag Compositions and methods for diagnosis and treatment of prostate cancer
US11543411B2 (en) 2014-12-05 2023-01-03 Prelude Corporation DCIS recurrence and invasive breast cancer
US12487242B2 (en) 2014-12-05 2025-12-02 Prelude Corporation DCIS recurrence and invasive breast cancer
WO2016094897A1 (en) 2014-12-12 2016-06-16 The Jackson Laboratory Compositions and methods relating to the treatment of cancer, autoimmune disease, and neurodegenerative disease
US11697668B2 (en) 2015-02-04 2023-07-11 Twist Bioscience Corporation Methods and devices for de novo oligonucleic acid assembly
US10669304B2 (en) 2015-02-04 2020-06-02 Twist Bioscience Corporation Methods and devices for de novo oligonucleic acid assembly
US9677067B2 (en) 2015-02-04 2017-06-13 Twist Bioscience Corporation Compositions and methods for synthetic gene assembly
US12509724B2 (en) 2015-02-19 2025-12-30 Becton, Dickinson And Company High-throughput single-cell analysis combining proteomic and genomic information
US10697010B2 (en) 2015-02-19 2020-06-30 Becton, Dickinson And Company High-throughput single-cell analysis combining proteomic and genomic information
US11098358B2 (en) 2015-02-19 2021-08-24 Becton, Dickinson And Company High-throughput single-cell analysis combining proteomic and genomic information
US10002316B2 (en) 2015-02-27 2018-06-19 Cellular Research, Inc. Spatially addressable molecular barcoding
USRE48913E1 (en) 2015-02-27 2022-02-01 Becton, Dickinson And Company Spatially addressable molecular barcoding
US9727810B2 (en) 2015-02-27 2017-08-08 Cellular Research, Inc. Spatially addressable molecular barcoding
US11535882B2 (en) 2015-03-30 2022-12-27 Becton, Dickinson And Company Methods and compositions for combinatorial barcoding
US11691118B2 (en) 2015-04-21 2023-07-04 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US10744477B2 (en) 2015-04-21 2020-08-18 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US9981239B2 (en) 2015-04-21 2018-05-29 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US11390914B2 (en) 2015-04-23 2022-07-19 Becton, Dickinson And Company Methods and compositions for whole transcriptome amplification
US11124823B2 (en) 2015-06-01 2021-09-21 Becton, Dickinson And Company Methods for RNA quantification
WO2017013436A1 (en) 2015-07-21 2017-01-26 Almac Diagnostics Limited Gene signature for immune therapies in cancer
US11332776B2 (en) 2015-09-11 2022-05-17 Becton, Dickinson And Company Methods and compositions for library normalization
US11807956B2 (en) 2015-09-18 2023-11-07 Twist Bioscience Corporation Oligonucleic acid variant libraries and synthesis thereof
US10844373B2 (en) 2015-09-18 2020-11-24 Twist Bioscience Corporation Oligonucleic acid variant libraries and synthesis thereof
US11512347B2 (en) 2015-09-22 2022-11-29 Twist Bioscience Corporation Flexible substrates for nucleic acid synthesis
US10384189B2 (en) 2015-12-01 2019-08-20 Twist Bioscience Corporation Functionalized surfaces and preparation thereof
US9895673B2 (en) 2015-12-01 2018-02-20 Twist Bioscience Corporation Functionalized surfaces and preparation thereof
US10987648B2 (en) 2015-12-01 2021-04-27 Twist Bioscience Corporation Functionalized surfaces and preparation thereof
US11242569B2 (en) 2015-12-17 2022-02-08 Guardant Health, Inc. Methods to determine tumor gene copy number by analysis of cell-free DNA
WO2017181367A1 (en) 2016-04-20 2017-10-26 Ldx Prognostics Limited Co. Methods and compositions for prognosing preterm birth
USRE50636E1 (en) 2016-05-02 2025-10-14 Becton, Dickinson And Company Accurate molecular barcoding
US10822643B2 (en) 2016-05-02 2020-11-03 Cellular Research, Inc. Accurate molecular barcoding
WO2017197573A1 (en) 2016-05-17 2017-11-23 Ldx Prognostics Limited Co. Methods and compositions for providing preeclampsia assessment
US11845986B2 (en) 2016-05-25 2023-12-19 Becton, Dickinson And Company Normalization of nucleic acid libraries
US10301677B2 (en) 2016-05-25 2019-05-28 Cellular Research, Inc. Normalization of nucleic acid libraries
US11397882B2 (en) 2016-05-26 2022-07-26 Becton, Dickinson And Company Molecular label counting adjustment methods
US11525157B2 (en) 2016-05-31 2022-12-13 Becton, Dickinson And Company Error correction in amplification of samples
US12331351B2 (en) 2016-05-31 2025-06-17 Becton, Dickinson And Company Error correction in amplification of samples
US10640763B2 (en) 2016-05-31 2020-05-05 Cellular Research, Inc. Molecular indexing of internal sequences
US11220685B2 (en) 2016-05-31 2022-01-11 Becton, Dickinson And Company Molecular indexing of internal sequences
US10202641B2 (en) 2016-05-31 2019-02-12 Cellular Research, Inc. Error correction in amplification of samples
US10975372B2 (en) 2016-08-22 2021-04-13 Twist Bioscience Corporation De novo synthesized nucleic acid libraries
US10053688B2 (en) 2016-08-22 2018-08-21 Twist Bioscience Corporation De novo synthesized nucleic acid libraries
US10417457B2 (en) 2016-09-21 2019-09-17 Twist Bioscience Corporation Nucleic acid based data storage
US10754994B2 (en) 2016-09-21 2020-08-25 Twist Bioscience Corporation Nucleic acid based data storage
US12056264B2 (en) 2016-09-21 2024-08-06 Twist Bioscience Corporation Nucleic acid based data storage
US11562103B2 (en) 2016-09-21 2023-01-24 Twist Bioscience Corporation Nucleic acid based data storage
US11263354B2 (en) 2016-09-21 2022-03-01 Twist Bioscience Corporation Nucleic acid based data storage
US11467157B2 (en) 2016-09-26 2022-10-11 Becton, Dickinson And Company Measurement of protein expression using reagents with barcoded oligonucleotide sequences
US11782059B2 (en) 2016-09-26 2023-10-10 Becton, Dickinson And Company Measurement of protein expression using reagents with barcoded oligonucleotide sequences
US11460468B2 (en) 2016-09-26 2022-10-04 Becton, Dickinson And Company Measurement of protein expression using reagents with barcoded oligonucleotide sequences
US10338066B2 (en) 2016-09-26 2019-07-02 Cellular Research, Inc. Measurement of protein expression using reagents with barcoded oligonucleotide sequences
US11164659B2 (en) 2016-11-08 2021-11-02 Becton, Dickinson And Company Methods for expression profile classification
US11608497B2 (en) 2016-11-08 2023-03-21 Becton, Dickinson And Company Methods for cell label classification
US10907274B2 (en) 2016-12-16 2021-02-02 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
US10722880B2 (en) 2017-01-13 2020-07-28 Cellular Research, Inc. Hydrophilic coating of fluidic channels
US11319583B2 (en) 2017-02-01 2022-05-03 Becton, Dickinson And Company Selective amplification using blocking oligonucleotides
US11550939B2 (en) 2017-02-22 2023-01-10 Twist Bioscience Corporation Nucleic acid based data storage using enzymatic bioencryption
WO2018163051A1 (en) 2017-03-06 2018-09-13 Novartis Ag Methods of treatment of cancer with reduced ubb expression
US10894959B2 (en) 2017-03-15 2021-01-19 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
US10676779B2 (en) 2017-06-05 2020-06-09 Becton, Dickinson And Company Sample indexing for single cells
US12371729B2 (en) 2017-06-05 2025-07-29 Becton, Dickinson And Company Sample indexing for single cells
US12084712B2 (en) 2017-06-05 2024-09-10 Becton, Dickinson And Company Sample indexing for single cells
US10669570B2 (en) 2017-06-05 2020-06-02 Becton, Dickinson And Company Sample indexing for single cells
US12270028B2 (en) 2017-06-12 2025-04-08 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US11377676B2 (en) 2017-06-12 2022-07-05 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US11332740B2 (en) 2017-06-12 2022-05-17 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US10696965B2 (en) 2017-06-12 2020-06-30 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
WO2019016772A2 (en) 2017-07-21 2019-01-24 Novartis Ag COMPOSITIONS AND METHODS FOR TREATING CANCER
EP4085919A2 (en) 2017-07-21 2022-11-09 Novartis AG Compositions and methods to treat cancer
US11407837B2 (en) 2017-09-11 2022-08-09 Twist Bioscience Corporation GPCR binding proteins and synthesis thereof
US10590122B2 (en) 2017-09-11 2020-03-17 Cyteir Therapeutics, Inc. RAD51 inhibitors
US11084812B2 (en) 2017-09-11 2021-08-10 Cyteir Therapeutics, Inc. RAD51 inhibitors
WO2019051465A1 (en) 2017-09-11 2019-03-14 Cyteir Therapeutics, Inc. RAD51 INHIBITORS
EP4112616A1 (en) 2017-09-11 2023-01-04 Cyteir Therapeutics, Inc. Rad51 inhibitors
US10336746B1 (en) 2017-09-11 2019-07-02 Cyteir Therapeutics, Inc. RAD51 inhibitors
US10894242B2 (en) 2017-10-20 2021-01-19 Twist Bioscience Corporation Heated nanowells for polynucleotide synthesis
US11745159B2 (en) 2017-10-20 2023-09-05 Twist Bioscience Corporation Heated nanowells for polynucleotide synthesis
WO2019086603A1 (en) 2017-11-03 2019-05-09 Interna Technologies B.V. Mirna molecule, equivalent, antagomir, or source thereof for treating and/or diagnosing a condition and/or a disease associated with neuronal deficiency or for neuronal (re)generation
WO2019104155A2 (en) 2017-11-22 2019-05-31 The University Of Chicago Chemical probe-dependent evaluation of protein activity and uses thereof
US11946095B2 (en) 2017-12-19 2024-04-02 Becton, Dickinson And Company Particles associated with oligonucleotides
US12086722B2 (en) 2018-01-04 2024-09-10 Twist Bioscience Corporation DNA-based digital information storage with sidewall electrodes
US10936953B2 (en) 2018-01-04 2021-03-02 Twist Bioscience Corporation DNA-based digital information storage with sidewall electrodes
US11957695B2 (en) 2018-04-26 2024-04-16 The Broad Institute, Inc. Methods and compositions targeting glucocorticoid signaling for modulating immune responses
WO2019213276A1 (en) 2018-05-02 2019-11-07 Novartis Ag Regulators of human pluripotent stem cells and uses thereof
US12421548B2 (en) 2018-05-03 2025-09-23 Becton, Dickinson And Company High throughput multiomics sample analysis
US12421547B2 (en) 2018-05-03 2025-09-23 Becton, Dickinson And Company High throughput multiomics sample analysis
US11365409B2 (en) 2018-05-03 2022-06-21 Becton, Dickinson And Company Molecular barcoding on opposite transcript ends
US11773441B2 (en) 2018-05-03 2023-10-03 Becton, Dickinson And Company High throughput multiomics sample analysis
WO2019213660A2 (en) 2018-05-04 2019-11-07 The Broad Institute, Inc. Compositions and methods for modulating cgrp signaling to regulate innate lymphoid cell inflammatory responses
US11732294B2 (en) 2018-05-18 2023-08-22 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US11492665B2 (en) 2018-05-18 2022-11-08 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US12522868B2 (en) 2018-05-18 2026-01-13 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
WO2020036926A1 (en) 2018-08-17 2020-02-20 Cellecta, Inc. Multiplex preparation of barcoded gene specific dna fragments
US11821900B2 (en) 2018-09-14 2023-11-21 Prelude Corporation Method of selection for treatment of subjects at risk of invasive breast cancer
US11639517B2 (en) 2018-10-01 2023-05-02 Becton, Dickinson And Company Determining 5′ transcript sequences
WO2020077135A1 (en) 2018-10-10 2020-04-16 Dana-Farber Cancer Institute, Inc. Modulating resistance to bcl-2 inhibitors
US11932849B2 (en) 2018-11-08 2024-03-19 Becton, Dickinson And Company Whole transcriptome analysis of single cells using random priming
US12402610B2 (en) 2018-11-09 2025-09-02 The Broad Institute, Inc. Methods and compositions for modulating innate lymphoid cell pathogenic effectors
US11492660B2 (en) 2018-12-13 2022-11-08 Becton, Dickinson And Company Selective extension in single cell whole transcriptome analysis
US12357959B2 (en) 2018-12-26 2025-07-15 Twist Bioscience Corporation Highly accurate de novo polynucleotide synthesis
US11371076B2 (en) 2019-01-16 2022-06-28 Becton, Dickinson And Company Polymerase chain reaction normalization through primer titration
US11661631B2 (en) 2019-01-23 2023-05-30 Becton, Dickinson And Company Oligonucleotides associated with antibodies
US12071617B2 (en) 2019-02-14 2024-08-27 Becton, Dickinson And Company Hybrid targeted and whole transcriptome amplification
US12331427B2 (en) 2019-02-26 2025-06-17 Twist Bioscience Corporation Antibodies that bind GLP1R
US11492727B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for GLP1 receptor
US11492728B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for antibody optimization
US12565715B2 (en) 2019-02-26 2026-03-03 Twist Bioscience Corporation Variant nucleic acid libraries for antibody optimization
WO2020176654A1 (en) 2019-02-27 2020-09-03 Madera Therapeutics, LLC Use of caseinolytic protease p function as a biomarker of drug response to imipridone-like agents
US11247988B2 (en) 2019-03-12 2022-02-15 Cyteir Therapeutics, Inc. RAD51 inhibitors
WO2020186101A1 (en) 2019-03-12 2020-09-17 The Broad Institute, Inc. Detection means, compositions and methods for modulating synovial sarcoma cells
US11932636B2 (en) 2019-03-12 2024-03-19 Cyteir Therapeutics, Inc. RAD51 inhibitors
WO2020186235A1 (en) 2019-03-14 2020-09-17 The Broad Institute, Inc. Compositions and methods for modulating cgrp signaling to regulate intestinal innate lymphoid cells
WO2020191079A1 (en) 2019-03-18 2020-09-24 The Broad Institute, Inc. Compositions and methods for modulating metabolic regulators of t cell pathogenicity
WO2020191069A1 (en) 2019-03-18 2020-09-24 The Broad Institute, Inc. Modulation of type 2 immunity by targeting clec-2 signaling
US11607404B2 (en) 2019-03-25 2023-03-21 Cyteir Therapeutics, Inc. Combinations of RAD51 and PARP inhibitors
WO2020198298A1 (en) 2019-03-25 2020-10-01 Cyteir Therapeutics, Inc. Combinations of rad51 and parp inhibitors
EP3947727A1 (en) 2019-04-05 2022-02-09 Board of Regents, The University of Texas System Methods and applications for cell barcoding
WO2020210521A2 (en) 2019-04-12 2020-10-15 The Regents Of The University Of California Compositions and methods for increasing muscle mass and oxidative metabolism
US11965208B2 (en) 2019-04-19 2024-04-23 Becton, Dickinson And Company Methods of associating phenotypical data and single cell sequencing data
RU2709815C1 (ru) * 2019-05-14 2019-12-23 Федеральное бюджетное учреждение науки "Нижегородский научно-исследовательский институт эпидемиологии и микробиологии им. академика И.Н. Блохиной" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека Способ поиска молекулярных маркеров патологического процесса для дифференциальной диагностики, мониторинга и таргетной терапии
US12064419B2 (en) 2019-06-21 2024-08-20 Cyteir Therapeutics, Inc. Methods of using RAD51 inhibitors for treatment of pancreatic cancer
WO2020257752A1 (en) 2019-06-21 2020-12-24 Cyteir Therapeutics, Inc. Methods of using rad51 inhibitors for treatment of pancreatic cancer
US11332738B2 (en) 2019-06-21 2022-05-17 Twist Bioscience Corporation Barcode-based nucleic acid sequence assembly
US11939622B2 (en) 2019-07-22 2024-03-26 Becton, Dickinson And Company Single cell chromatin immunoprecipitation sequencing assay
WO2021030627A1 (en) 2019-08-13 2021-02-18 The General Hospital Corporation Methods for predicting outcomes of checkpoint inhibition and treatment thereof
US12421557B2 (en) 2019-08-16 2025-09-23 The Broad Institute, Inc. Methods for predicting outcomes and treating colorectal cancer using a cell atlas
US12091777B2 (en) 2019-09-23 2024-09-17 Twist Bioscience Corporation Variant nucleic acid libraries for CRTH2
US12173282B2 (en) 2019-09-23 2024-12-24 Twist Bioscience, Inc. Antibodies that bind CD3 epsilon
US11981922B2 (en) 2019-10-03 2024-05-14 Dana-Farber Cancer Institute, Inc. Methods and compositions for the modulation of cell interactions and signaling in the tumor microenvironment
US12195725B2 (en) 2019-10-03 2025-01-14 Dana-Farber Cancer Institute, Inc. Compositions and methods for modulating and detecting tissue specific TH17 cell pathogenicity
US11793787B2 (en) 2019-10-07 2023-10-24 The Broad Institute, Inc. Methods and compositions for enhancing anti-tumor immunity by targeting steroidogenesis
US11844800B2 (en) 2019-10-30 2023-12-19 Massachusetts Institute Of Technology Methods and compositions for predicting and preventing relapse of acute lymphoblastic leukemia
US11773436B2 (en) 2019-11-08 2023-10-03 Becton, Dickinson And Company Using random priming to obtain full-length V(D)J information for immune repertoire sequencing
US12570750B2 (en) 2019-12-09 2026-03-10 Twist Bioscience Corporation Antibodies that bind adenosine A2A receptors and methods of use thereof to treat cancer and neurological diseases
WO2021127610A1 (en) 2019-12-20 2021-06-24 EDWARD Via COLLEGE OF OSTEOPATHIC MEDICINE Cancer signatures, methods of generating cancer signatures, and uses thereof
US11649497B2 (en) 2020-01-13 2023-05-16 Becton, Dickinson And Company Methods and compositions for quantitation of proteins and RNA
US12606859B2 (en) 2020-01-13 2026-04-21 Becton, Dickinson And Company Cell capture using DU-containing oligonucleotides
US12165747B2 (en) 2020-01-23 2024-12-10 The Broad Institute, Inc. Molecular spatial mapping of metastatic tumor microenvironment
US12188010B2 (en) 2020-01-29 2025-01-07 Becton, Dickinson And Company Barcoded wells for spatial mapping of single cells through sequencing
US12153043B2 (en) 2020-02-25 2024-11-26 Becton, Dickinson And Company Bi-specific probes to enable the use of single-cell samples as single color compensation control
WO2021178531A1 (en) 2020-03-03 2021-09-10 Cyteir Therapeutics, Inc. The rad51 inhibitor compound 67a (2301085-06-1) at a specific dosage for treating cancer
US11661625B2 (en) 2020-05-14 2023-05-30 Becton, Dickinson And Company Primers for immune repertoire profiling
US12378594B2 (en) 2020-05-14 2025-08-05 Becton, Dickinson And Company Primers for immune repertoire profiling
US12157913B2 (en) 2020-06-02 2024-12-03 Becton, Dickinson And Company Oligonucleotides and beads for 5 prime gene expression assay
US11932901B2 (en) 2020-07-13 2024-03-19 Becton, Dickinson And Company Target enrichment using nucleic acid probes for scRNAseq
US12391940B2 (en) 2020-07-31 2025-08-19 Becton, Dickinson And Company Single cell assay for transposase-accessible chromatin
WO2022032228A1 (en) 2020-08-07 2022-02-10 The Broad Institute, Inc. Therapeutic targeting of phosphate dysregulation in cancer via the xpr1:kidins220 protein complex
US11739443B2 (en) 2020-11-20 2023-08-29 Becton, Dickinson And Company Profiling of highly expressed and lowly expressed proteins
US12392771B2 (en) 2020-12-15 2025-08-19 Becton, Dickinson And Company Single cell secretome analysis
WO2022192419A2 (en) 2021-03-09 2022-09-15 Massachusetts Institute Of Technology Methods of treating inflammatory bowel disease (ibd) with anti- tnf-blockade
WO2023114507A1 (en) 2021-12-17 2023-06-22 Tango Therapeutics, Inc. Crystalline form of n-(6-amino-5-methylpyridin-3-yl)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide, pharmaceutical compositions and methods of use thereof
WO2023146987A1 (en) 2022-01-26 2023-08-03 Tango Therapeutics, Inc. Compounds and methods of use
WO2023146991A1 (en) 2022-01-26 2023-08-03 Tango Therapeutics, Inc. Compounds and methods of use
WO2023146989A1 (en) 2022-01-26 2023-08-03 Tango Therapeutics, Inc. Compounds and methods of use
WO2023146990A1 (en) 2022-01-26 2023-08-03 Tango Therapeutics, Inc. Compounds and methods of use
WO2024028794A1 (en) 2022-08-02 2024-02-08 Temple Therapeutics BV Methods for treating endometrial and ovarian hyperproliferative disorders
WO2024030659A1 (en) 2022-08-05 2024-02-08 Tango Therapeutics, Inc. An hdac inhibitor for treating cancer with a modified stk11 activity or expression
WO2024091551A1 (en) 2022-10-25 2024-05-02 Tango Therapeutics, Inc. Crystalline forms, pharmaceutical compositions and methods of use thereof
WO2024124044A1 (en) 2022-12-07 2024-06-13 The Brigham And Women’S Hospital, Inc. Compositions and methods targeting sat1 for enhancing anti¬ tumor immunity during tumor progression
WO2024192141A1 (en) 2023-03-13 2024-09-19 Dana-Farber Cancer Institute, Inc. Treatment of cancers having a drug-resistant mesenchymal cell state
WO2024226838A2 (en) 2023-04-25 2024-10-31 The Brigham And Women's Hospital, Inc. Treatment of autoimmune diseases having a pathogenic t cell state
WO2024233605A1 (en) 2023-05-08 2024-11-14 Tango Therapeutics, Inc. Compounds and their use against cancer
WO2024233665A1 (en) 2023-05-08 2024-11-14 Tango Therapeutics, Inc. Compounds and their use against cancer
WO2025166186A1 (en) 2024-01-31 2025-08-07 Tango Therapeutics, Inc. Crystalline forms, pharmaceutical compositions and methods of use thereof
WO2025166308A1 (en) 2024-01-31 2025-08-07 Tango Therapeutics, Inc. Crystalline forms, pharmaceutical compositions and methods of use thereof
WO2025202871A1 (en) 2024-03-27 2025-10-02 Pfizer Inc. Methods for identifying biomarkers of treatment response and use thereof with a cdk4 inhibitor
WO2025217209A2 (en) 2024-04-08 2025-10-16 Tango Therapeutics, Inc. Crystalline forms of hdac inhibitor and uses thereof
WO2025217297A1 (en) 2024-04-09 2025-10-16 Tango Therapeutics, Inc. Prmt5 inhibitors for use in methods of treating mta-accumulating cancer
WO2025248505A1 (en) 2024-05-31 2025-12-04 Wayne State University Methods for treating endometrial and ovarian hyperproliferative disorders
WO2026073277A1 (en) 2024-09-30 2026-04-02 Tango Therapeutics, Inc. Substituted piperidine-diones inactivating hbs1l

Also Published As

Publication number Publication date
US6410229B1 (en) 2002-06-25
EP0853679A1 (en) 1998-07-22
US6548257B2 (en) 2003-04-15
US20020012940A1 (en) 2002-01-31
HK1015416A1 (en) 1999-10-15
US6040138A (en) 2000-03-21
JPH11512293A (ja) 1999-10-26
DE69625920T2 (de) 2003-10-30
US20030215841A1 (en) 2003-11-20
AU7073496A (en) 1997-04-01
ATE231559T1 (de) 2003-02-15
EP0853679B1 (en) 2003-01-22
US20050202500A1 (en) 2005-09-15
CA2232047A1 (en) 1997-03-20
US6927032B2 (en) 2005-08-09
US20050158746A1 (en) 2005-07-21
DE69625920D1 (de) 2003-02-27

Similar Documents

Publication Publication Date Title
EP0853679B1 (en) Expression monitoring by hybridization to high density oligonucleotide arrays
US6344316B1 (en) Nucleic acid analysis techniques
US6582908B2 (en) Oligonucleotides
US6505125B1 (en) Methods and computer software products for multiple probe gene expression analysis
WO1997027317A1 (en) Nucleic acid analysis techniques
US20070248975A1 (en) Methods for monitoring the expression of alternatively spliced genes
EP1036845A2 (en) Downstream genes of tumor suppressor WT1
US6746844B2 (en) Determining signal transduction pathways
US7089121B1 (en) Methods for monitoring the expression of alternatively spliced genes
AU751557B2 (en) Expression monitoring by hybridization to high density oligonucleotide arrays
HK1015416B (en) Expression monitoring by hybridization to high density oligonucleotide arrays
US20110250602A1 (en) Methods and Computer Software Products for Identifying Transcribed Regions of a Genome
CA2378854A1 (en) Methods and computer software products for transcriptional annotation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2232047

Country of ref document: CA

Ref country code: CA

Ref document number: 2232047

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1997 512174

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1996931598

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1996931598

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1996931598

Country of ref document: EP