US20170281795A1 - Nucleic acid-polypeptide compositions and uses thereof - Google Patents

Nucleic acid-polypeptide compositions and uses thereof Download PDF

Info

Publication number
US20170281795A1
US20170281795A1 US15/476,849 US201715476849A US2017281795A1 US 20170281795 A1 US20170281795 A1 US 20170281795A1 US 201715476849 A US201715476849 A US 201715476849A US 2017281795 A1 US2017281795 A1 US 2017281795A1
Authority
US
United States
Prior art keywords
instances
acid molecule
polynucleic acid
molecule
polynucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US15/476,849
Other languages
English (en)
Inventor
Andrew John GEALL
Venkata Ramana Doppalapudi
David Sai-Ho CHU
Michael Caramian COCHRAN
Rachel Elizabeth JOHNS
Palani Balu
Rob Burke
Beatrice Diana DARIMONT
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Avidity Biosciences Inc
Original Assignee
Avidity Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Avidity Biosciences Inc filed Critical Avidity Biosciences Inc
Priority to US15/476,849 priority Critical patent/US20170281795A1/en
Assigned to AVIDITY BIOSCIENCES LLC reassignment AVIDITY BIOSCIENCES LLC ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BALU, PALANI, BURKE, Rob, CHU, David Sai-Ho, COCHRAN, Michael Caramian, DARIMONT, Beatrice Diana, DOPPALAPUDI, VENKATA RAMANA, GEALL, ANDREW JOHN, JOHNS, Rachel Elizabeth
Publication of US20170281795A1 publication Critical patent/US20170281795A1/en
Priority to US16/128,393 priority patent/US20190062435A1/en
Priority to US16/128,428 priority patent/US10787519B2/en
Priority to US16/128,417 priority patent/US10800848B2/en
Assigned to AVIDITY BIOSCIENCES LLC, AVIDITY BIOSCIENCES, INC. reassignment AVIDITY BIOSCIENCES LLC CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: AVIDITY BIOSCIENCES LLC
Assigned to AVIDITY BIOSCIENCES, INC. reassignment AVIDITY BIOSCIENCES, INC. CORRECTIVE ASSIGNMENT TO CORRECT THE RECEIVING PARTY PREVIOUSLY RECORDED AT REEL: 050018 FRAME: 0456. ASSIGNOR(S) HEREBY CONFIRMS THE ASSIGNMENT. Assignors: AVIDITY BIOSCIENCES LLC
Priority to US17/187,669 priority patent/US20210179720A1/en
Priority to US17/308,888 priority patent/US20220324984A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • A61K47/48569—
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A61K47/48215—
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6807—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug or compound being a sugar, nucleoside, nucleotide, nucleic acid, e.g. RNA antisense
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6889—Conjugates wherein the antibody being the modifying agent and wherein the linker, binder or spacer confers particular properties to the conjugates, e.g. peptidic enzyme-labile linkers or acid-labile linkers, providing for an acid-labile immuno conjugate wherein the drug may be released from its antibody conjugated part in an acidic, e.g. tumoural or environment
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • A61K48/0033—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being non-polymeric
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2851—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the lectin superfamily, e.g. CD23, CD72
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3061—Blood cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55—Fab or Fab'
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/313—Phosphorodithioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/332—Abasic residue
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3513—Protein; Peptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3515—Lipophilic moiety, e.g. cholesterol
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • RNA interference provides long lasting effect over multiple cell divisions. As such, RNAi represents a viable method useful for drug target validation, gene function analysis, pathway analysis, and disease therapeutics.
  • compositions and pharmaceutical formulations that comprise a binding moiety conjugated to a polynucleic acid molecule and a polymer.
  • methods for treating a disease or condition e.g., cancer that utilize a composition or a pharmaceutical formulation comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer.
  • the at least one 2′ modified nucleotide comprises 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O—N-methylacetamido (2′-O-NMA) modified nucleotide.
  • the at least one 2′ modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
  • the at least one modified internucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage.
  • the at least one inverted abasic moiety is at at least one terminus.
  • the polynucleotide comprises a single strand. In some embodiments, the polynucleotide comprises two or more strands. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule. In some embodiments, the second polynucleotide comprises at least one modification.
  • the first polynucleotide and the second polynucleotide are RNA molecules. In some embodiments, the first polynucleotide and the second polynucleotide are siRNA molecules.
  • the first polynucleotide comprises a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.
  • the first polynucleotide consists of a sequence selected from SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.
  • the second polynucleotide comprises a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.
  • the second polynucleotide consists of a sequence selected from SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.
  • X and Y are independently a bond or a non-polymeric linker group. In some embodiments, X is a bond. In some embodiments, X is a C 1 -C 6 alkyl group. In some embodiments, Y is a C 1 -C 6 alkyl group. In some embodiments, X is a homobifuctional linker or a heterobifunctional linker, optionally conjugated to a C 1 -C 6 alkyl group. In some embodiments, Y is a homobifuctional linker or a heterobifunctional linker.
  • the binding moiety is an antibody or binding fragment thereof.
  • the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab′, divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.
  • the antibody or binding fragment thereof is an anti-EGFR antibody or binding fragment thereof.
  • C is polyethylene glycol. In some embodiments, C has a molecular weight of about 5000 Da.
  • A-X is conjugated to the 5′ end of B and Y-C is conjugated to the 3′ end of B. In some embodiments, Y-C is conjugated to the 5′ end of B and A-X is conjugated to the 3′ end of B. In some embodiments, A-X, Y-C or a combination thereof is conjugated to an internucleotide linkage group.
  • the molecule further comprises D.
  • D is conjugated to C or to A.
  • D is conjugated to the molecule of Formula (I) according to Formula (II):
  • polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety; and D is conjugated anywhere on A, B, or C.
  • D is INF7 or melittin.
  • D is an endosomolytic polymer.
  • L is a C 1 -C 6 alkyl group. In some embodiments, L is a homobifuctional linker or a heterobifunctional linker.
  • the molecule further comprises at least a second binding moiety A.
  • the at least second binding moiety A is conjugated to A, to B, or to C.
  • the at least second binding moiety A is cholesterol.
  • the molecule further comprises at least an additional polynucleotide B.
  • the at least an additional polynucleotide B is conjugated to A, to B, or to C.
  • the molecule further comprises at least an additional polymer C.
  • the at least an additional polymer C is conjugated to A, to B, or to C.
  • A-X-B-Y-C (Formula I), wherein A is an antibody or its binding fragments thereof; B is a polynucleotide; C is a polymer; X is a bond or first non-polymeric linker; and Y is a bond or second linker; wherein the polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety; and wherein A and C are not attached to B at the same terminus.
  • the at least one 2′ modified nucleotide comprises 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modified nucleotide.
  • the at least one 2′ modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
  • the at least one modified internucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage.
  • the at least one inverted abasic moiety is at at least one terminus.
  • the polynucleotide comprises a single strand.
  • the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule.
  • the second polynucleotide comprises at least one modification.
  • the first polynucleotide and the second polynucleotide are RNA molecules.
  • the first polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.
  • the second polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.
  • Y is a non-polymeric linker group.
  • X is a bond.
  • X is a C 1 -C 6 alkyl group.
  • Y is a C 1 -C 6 alkyl group.
  • X is a homobifuctional linker or a heterobifunctional linker, optionally conjugated to a C 1 -C 6 alkyl group.
  • Y is a homobifuctional linker or a heterobifunctional linker.
  • the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab′, divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.
  • C is polyethylene glycol.
  • C has a molecular weight of about 1000 Da, 2000 Da, or 5000 Da.
  • A-X is conjugated to the 5′ end of B and Y-C is conjugated to the 3′ end of B.
  • Y-C is conjugated to the 5′ end of B and A-X is conjugated to the 3′ end of B.
  • the molecule further comprises D.
  • D is conjugated to C or to A.
  • D is conjugated to the molecule of Formula (I) according to Formula (II): (A-X-B-Y-C c )-L-D (Formula II), wherein A is an antibody or its binding fragments thereof; B is a polynucleotide; C is a polymer; X is a bond or first non-polymeric linker; Y is a bond or second linker; L is a bond or third linker; D is an endosomolytic moiety; and c is an integer between 0 and 1; wherein the polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety; wherein A and C are not attached to B at the same terminus; and wherein D is conjugated anywhere on A or C or to a terminus of B.
  • A is an antibody or its binding fragments thereof
  • B is a polynucleotide
  • C is a
  • D is INF7 or melittin. In some embodiments, D is an endosomolytic polymer. In some embodiments, L is a C 1 -C 6 alkyl group. In some embodiments, L is a homobifuctional linker or a heterobifunctional linker. In some embodiments, the molecule further comprises at least a second binding moiety. In some embodiments, the at least second binding moiety is conjugated to A, to B, or to C. In some embodiments, the at least second binding moiety is cholesterol. In some embodiments, the molecule further comprises at least an additional polynucleotide B. In some embodiments, the at least an additional polynucleotide B is conjugated to A, to B, or to C. In some embodiments, the molecule further comprises at least an additional polymer C. In some embodiments, the at least an additional polymer C is conjugated to A, to B, or to C.
  • a pharmaceutical composition comprising a molecule described above, and a pharmaceutically acceptable excipient.
  • the pharmaceutical composition is formulated as a nanoparticle formulation.
  • the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, or transdermal administration.
  • the disease or disorder is a cancer.
  • the cancer is a solid tumor.
  • the cancer is a hematologic malignancy.
  • the cancer comprises a KRAS-associated, an EGFR-associated, an AR-associated cancer, a ⁇ -catenin associated cancer, a PIK3C-associated cancer, or a MYC-associated cancer.
  • the cancer comprises bladder cancer, breast cancer, colorectal cancer, endometrial cancer, esophageal cancer, glioblastoma multiforme, head and neck cancer, kidney cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, or thyroid cancer.
  • the cancer comprises acute myeloid leukemia, CLL, DLBCL, or multiple myeloma.
  • the method is an immuno-oncology therapy.
  • a method of inhibiting the expression of a target gene in a primary cell of a patient comprising administering a molecule described above to the primary cell.
  • the method is an in vivo method.
  • the patient is a human.
  • an immuno-oncology therapy comprising a molecule described above for the treatment of a disease or disorder in a patient in need thereof.
  • kits comprising a molecule described above.
  • FIG. 1A - FIG. 1C illustrate cartoon representations of molecules described herein.
  • FIG. 2 illustrates a structure of cholesterol conjugate passenger strand.
  • FIG. 3 shows an INF7 peptide sequence (SEQ ID NO: 2055) described herein.
  • FIG. 4 shows a melittin peptide sequence (SEQ ID NO: 2060) described herein.
  • FIG. 5 illustrates an analytical HPLC of EGFR antibody-PEG20 kDa-EGFR.
  • FIG. 6 illustrates a SDS-PAGE analysis of EGFR antibody-PEG20 kDa-EGFR conjugate.
  • FIG. 7 illustrates an analytical chromatogram of EGFR antibody-PEG10 kDa-EGFR siRNA.
  • FIG. 8 shows an analytical chromatogram of EGFR antibody-PEG5 kDa-EGFR siRNA.
  • FIG. 9 shows a SDS PAGE analysis of EGFR antibody-PEG10 kDa-EGFR siRNA and EGFR antibody-PEG5 kDa-EGFR siRNA conjugates.
  • FIG. 10 illustrates the overlay of EGFR antibody-PEG1 kDa-EGFR siRNA conjugates with siRNA loading of 1, 2 and 3.
  • FIG. 11 shows a HPLC chromatogram of EGFR antibody-KRAS-PEG5 kDa.
  • FIG. 12 shows a HPLC chromatogram of Panitumumab-KRAS-PEG5 kDa.
  • FIG. 19 shows INF7-PEG1 kDa-(EGFR antibody-KRAS-PEG5 kDa).
  • FIG. 20 illustrates Melittin-PEG1 kDa-(EGFR antibody-KRAS-PEG5 kDa).
  • FIG. 21 illustrates plasma concentration-time profiles out to 96 h post-dose with the siRNA concentration expressed as a percent of injected dose (% ID).
  • FIG. 22 shows plasma concentration-time profiles out to 96 h post-dose with the siRNA concentration expressed as a percent of injected dose (% ID).
  • FIG. 23 shows plasma concentration-time profiles out to 96 h post-dose with the siRNA concentration expressed as a percent of injected dose (% ID).
  • FIG. 24 illustrates plasma concentration-time profiles out to 96 h post-dose with the siRNA concentration expressed as a percent of injected dose (% ID).
  • FIG. 25 illustrates plasma concentration-time profiles out to 24 h post-dose with the siRNA concentration expressed as a percent of injected dose (% ID).
  • FIG. 26A and FIG. 26B illustrate tissue concentration-time profiles in tumor or normal livers of mice.
  • FIG. 26A shows tissue concentration-time profiles out to 168 h post-dose measured in s.c. flank H358 tumors in a mice model.
  • FIG. 26B shows tissue concentration-time profiles out to 168 h post-dose measured in normal livers of mice.
  • FIG. 27 shows tissue concentration-time profiles out to 168 h post-dose measured in s.c. flank H358 tumors and normal livers of mice.
  • FIG. 28 illustrates tissue concentration-time profiles out to 168 h post-dose measured in s.c. flank H358 tumors and normal livers of mice.
  • FIG. 29 illustrates tissue concentration-time profiles out to 168 h post-dose measured in s.c. flank H358 tumors and normal livers of mice.
  • FIG. 30 shows tissue concentration-time profiles out to 168 h post-dose measured in s.c. flank H358 tumors and normal livers of mice.
  • FIG. 31A and FIG. 31B illustrate siRNA-mediated mRNA knockdown of human KRAS in human s.c. flank H358 tumors ( FIG. 31A ) or mouse KRAS in normal mouse liver ( FIG. 31B ).
  • FIG. 32 illustrates siRNA-mediated mRNA knockdown of human EGFR in human s.c. flank H358 tumors.
  • FIG. 33 illustrates siRNA-mediated mRNA knockdown of human KRAS in human s.c. flank H358 tumors.
  • FIG. 34 illustrates siRNA-mediated mRNA knockdown of human EGFR in human s.c. flank H358 tumors.
  • FIG. 35 shows siRNA-mediated mRNA knockdown of mouse KRAS in mouse liver.
  • FIG. 36 illustrates plasma concentration-time profiles out to 96 h post-dose with the siRNA concentration expressed as a percent of injected dose (% ID).
  • FIG. 37 illustrates tissue concentration-time profiles out to 144 h post-dose measured in liver, kidneys, and lungs of wild-type CD-1 mice.
  • FIG. 38A and FIG. 38B illustrate tissue concentration-time profiles out to 144 h post-dose measured in human s.c. flank H358 tumors for chol-KRAS mixed with either chol-INF7 peptide ( FIG. 38A ) or chol-melittin peptide ( FIG. 38B ).
  • FIG. 39A and FIG. 39B illustrate tissue concentration-time profiles out to 144 h post-dose measured in mouse liver for chol-KRAS mixed with either chol-INF7 peptide ( FIG. 39A ) or chol-melittin peptide ( FIG. 39B ).
  • FIG. 40A and FIG. 40B illustrate tissue concentration-time profiles out to 144 h post-dose measured in mouse kidneys for chol-KRAS mixed with either chol-INF7 peptide ( FIG. 40A ) or chol-melittin peptide ( FIG. 40B ).
  • FIG. 41A and FIG. 41B illustrate tissue concentration-time profiles out to 144 h post-dose measured in mouse lungs for chol-KRAS mixed with either chol-INF7 peptide ( FIG. 41A ) or chol-melittin peptide ( FIG. 41B ).
  • FIG. 42 illustrates siRNA-mediated mRNA knockdown of mouse KRAS in mouse liver.
  • FIG. 43A and FIG. 43B illustrate tissue concentration-time profiles out to 96 h post-dose measured in human s.c. flank H358 tumors ( FIG. 43A ) or mouse liver ( FIG. 43B ).
  • FIG. 44A and FIG. 44B show tissue concentration-time profiles out to 96 h post-dose measured in mouse kidneys ( FIG. 44A ) or mouse lungs ( FIG. 44B ).
  • FIG. 45 shows siRNA-mediated mRNA knockdown of mouse KRAS in human s.c. flank H358 tumors.
  • FIG. 46 shows tissue concentrations of siRNA at 96 h post-dose measured in human s.c. flank H358 tumors and mouse liver, kidneys, and lungs.
  • FIG. 47A and FIG. 47B show siRNA-mediated mRNA knockdown in human s.c. flank H358 tumors of EGFR ( FIG. 47A ) or KRAS ( FIG. 47B ).
  • FIG. 48 shows siRNA-mediated mRNA knockdown of human CTNNB1 in Hep3B orthotopic liver tumors.
  • FIG. 49 shows human alpha-Fetoprotein in serum from mice with Hep3B orthotopic liver tumors.
  • FIG. 50A shows siRNA-mediated mRNA knockdown of human EGFR in LNCaP tumor.
  • FIG. 50B shows siRNA concentration in tumor or liver tissues at 96 hour post-dose.
  • FIG. 51A illustrates siRNA-mediated mRNA knockdown of human EGFR in LNCaP tumor at 96 hour.
  • FIG. 51B shows siRNA concentration in tumor or liver tissues at 96 hour post-dose.
  • FIG. 52 shows plasma siRNA concentration of exemplary molecules described herein.
  • FIG. 53A illustrates siRNA concentration of exemplary molecules described herein in HCC827 tumor or liver tissue.
  • FIG. 53B shows EGFR EGFR mRNA expression level of exemplary molecules described herein.
  • FIG. 54 illustrates exemplary As and Bs to generate molecules encompassed by Formula (I).
  • FIG. 55 illustrates EGFR mRNA expression level of exemplary molecules described herein.
  • FIG. 56A illustrates siRNA concentration of exemplary molecules described herein in HCC827 tumor or liver tissue.
  • FIG. 56B shows EGFR mRNA expression level of exemplary molecules described herein.
  • FIG. 57A - FIG. 57B illustrate siRNA concentration of exemplary molecules described herein in liver ( FIG. 57A ) and tumor ( FIG. 57B ).
  • FIG. 57C shows KRAS mRNA expression level of exemplary molecules described herein.
  • FIG. 58A illustrates plasma siRNA concentration of exemplary molecules described herein.
  • FIG. 58B shows plasma antibody concentration of exemplary molecules described herein.
  • FIG. 59A illustrates siRNA concentration of exemplary molecules described herein in tumor or liver tissue.
  • FIG. 59B shows mRNA expression level of exemplary molecules described herein in Hep3B tumor.
  • FIG. 60 shows CTNNB1 mRNA expression level of an exemplary molecule described herein in liver.
  • FIG. 61 shows KRAS mRNA expression level of an exemplary molecule described herein in liver.
  • FIG. 62 illustrates plasma siRNA or monoclonal antibody (mAb) concentration of exemplary molecules described herein.
  • FIG. 63A illustrates siRNA concentration of exemplary molecules described herein in tumor or liver tissue.
  • FIG. 63B shows EGFR mRNA expression level of exemplary molecules described herein in LNCaP tumor.
  • FIG. 64A - FIG. 64E illustrate HPRT mRNA expression level in heart ( FIG. 64A ), HPRT mRNA expression level in gastrointestinal tissue ( FIG. 64B ), HPRT mRNA expression level in liver ( FIG. 64C ), HPRT mRNA expression level in lung ( FIG. 64D ), and siRNA concentration in tissue ( FIG. 64E ) of exemplary molecules described herein.
  • FIG. 65A - FIG. 65E illustrate mRNA expression level in heart ( FIG. 65A ), mRNA expression level in gastrointestinal tissue ( FIG. 65B ), mRNA expression level in liver ( FIG. 65C ), mRNA expression level in lung ( FIG. 65D ), and siRNA concentration in tissue ( FIG. 65E ) of exemplary molecules described herein.
  • FIG. 66A - FIG. 66D illustrate siRNA concentration in heart ( FIG. 66A ), mRNA expression level in heart ( FIG. 66B ), mRNA expression level in gastrointestinal tissue ( FIG. 66C ), and siRNA concentration in muscle ( FIG. 66D ).
  • FIG. 67A illustrate mRNA expression level of exemplary molecules described herein.
  • FIG. 67B shows siRNA concentration of exemplary molecules described herein in tumor or liver tissues.
  • FIG. 68A - FIG. 68B illustrate anti-B cell antibody-siRNA conjugates which activate primary mouse B cells.
  • FIG. 68A illustrates an anti-B cell Fab-siRNA conjugate.
  • FIG. 68B shows an anti-B cell monoclonal antibody-siRNA conjugate.
  • FIG. 69A illustrates plasma siRNA concentration of exemplary molecules described herein.
  • FIG. 69B shows antibody zalutumumab concentration of exemplary molecules described herein in the plasma at a 5 mg/kg dose.
  • FIG. 70A shows mRNA expression level of exemplary molecules described herein.
  • FIG. 70B shows siRNA concentration of exemplary molecules described herein in tumor or liver tissues.
  • FIG. 70C shows plasma siRNA concentration of exemplary molecules described herein.
  • FIG. 71A illustrates siRNA concentration of exemplary molecules described herein in LNCaP tumor.
  • FIG. 71B - FIG. 71C illustrate mRNA expression level of exemplary molecules described herein in LNCaP tumor.
  • FIG. 72A illustrates siRNA concentration of exemplary molecules described herein in tissue.
  • FIG. 72B shows mRNA expression level of exemplary molecules described herein in HCC827 tumors at 96 h post-treatment.
  • FIG. 73A illustrates siRNA concentration of exemplary molecules described herein in the plasma at a 0.5 mg/kg dose.
  • FIG. 73B shows antibody zalutumumab concentration of exemplary molecules described herein in the plasma at a 5 mg/kg dose.
  • FIG. 74 illustrates plasma clearance of exemplary molecules encompassed by Formula (I) which contains different linkers.
  • FIG. 75A illustrates the mRNA expression level of exemplary molecules described herein in HCC827 tumor at a 0.5 mg/kg dose.
  • FIG. 75B - FIG. 75D illustrate siRNA concentration in tumor ( FIG. 75B ), liver ( FIG. 75C ), and plasma ( FIG. 75D ).
  • FIG. 76A - FIG. 76D illustrate mRNA expression levels of exemplary molecules described herein targeting HPRT.
  • FIG. 76A shows the mRNA expression level in heart.
  • FIG. 76B shows the mRNA expression level in muscle.
  • FIG. 76C shows the mRNA expression level in liver.
  • FIG. 76D shows the mRNA expression level in lung.
  • FIG. 77A - FIG. 77D illustrate siRNA concentrations of exemplary molecules encompassed by Formula (I) in muscle ( FIG. 77A ), heart ( FIG. 77B ), liver ( FIG. 77C ), and lung ( FIG. 77D ).
  • FIG. 78A - FIG. 78D illustrate mRNA expression levels of exemplary molecules encompassed by Formula (I) in heart ( FIG. 78A ), gastrointestinal tissue ( FIG. 78B ), liver ( FIG. 78C ), and lung ( FIG. 78D ) at 96 h post-treatment.
  • FIG. 79 illustrates plasma siRNA concentration of exemplary molecules encompassed by Formula (I).
  • FIG. 80A shows mRNA expression level of exemplary molecules encompassed by Formula (I) in LNCaP tumor at 96 h post-treatment.
  • FIG. 80B shows siRNA concentration of exemplary molecules encompassed by Formula (I) in LNCaP tumor, liver, kidney, lung, and spleen tissue samples.
  • FIG. 81A shows mRNA expression level of exemplary molecules encompassed by Formula (I) in HCC827 tumor at 96 h post-treatment.
  • FIG. 81B illustrates siRNA concentrations of exemplary molecules encompassed by Formula (I) in tumor, liver, kidney, lung, and spleen tissue samples.
  • FIG. 82 illustrates plasma siRNA concentration of exemplary molecules encompassed by Formula (I).
  • FIG. 83 illustrates plasma siRNA concentration of exemplary molecules encompassed by Formula (I).
  • FIG. 84 illustrates mRNA expression levels of exemplary molecules encompassed by Formula (I) in HCC827 tumor at 96 h post treatment.
  • FIG. 85 illustrates siRNA concentration in HCC827 tumor or liver tissues at 96 hour post-dose.
  • FIG. 86 illustrates the relative mRNA expression levels of exemplary molecules encompassed by Formula (I) in mouse splenic B cells 48 h post treatment. Each exemplary molecule is further denoted with a number.
  • FIG. 87 illustrates stability of exemplary molecules encompassed by Formula (I) (or ASCs) in mouse plasma.
  • Nucleic acid (e.g., RNAi) therapy is a targeted therapy with high selectivity and specificity.
  • nucleic acid therapy is also hindered by poor intracellular uptake, limited blood stability and non-specific immune stimulation.
  • various modifications of the nucleic acid composition are explored, such as for example, novel linkers for better stabilizing and/or lower toxicity, optimization of binding moiety for increased target specificity and/or target delivery, and nucleic acid polymer modifications for increased stability and/or reduced off-target effect.
  • the arrangement or order of the different components that make-up the nucleic acid composition further effects intracellular uptake, stability, toxicity, efficacy, and/or non-specific immune stimulation.
  • the nucleic acid component includes a binding moiety, a polymer, and a polynucleic acid molecule (or polynucleotide)
  • the order or arrangement of the binding moiety, the polymer, and/or the polynucleic acid molecule (or polynucleotide) e.g., binding moiety-polynucleic acid molecule-polymer, binding moiety-polymer-polynucleic acid molecule, or polymer-binding moiety-polynucleic acid molecule
  • the molecule comprises a binding moiety conjugated to a polynucleic acid molecule and a polymer.
  • the molecule comprises a molecule according to Formula (I): A-X-B-Y-C; in which A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker.
  • the polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety.
  • the molecule of Formula (I) further comprises D, an endosomolytic moiety.
  • a molecule comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer arranged as described herein enhances intracellular uptake, stability, and/or efficacy.
  • a molecule comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer arranged as described herein reduces toxicity and/or non-specific immune stimulation.
  • the molecule comprises a molecule according to Formula (I): A-X-B-Y-C; in which A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker.
  • the polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety.
  • the molecule of Formula (I) further comprises D, an endosomolytic moiety.
  • a molecule described herein is further used to treat a disease or disorder.
  • a molecule for the treatment of a disease or disorder is a molecule according to Formula (I): A-X-B-Y-C; in which A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker.
  • the polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety.
  • the molecule of Formula (I) further comprises D, an endosomolytic moiety.
  • a molecule described herein is also used for inhibiting the expression of a target gene in a primary cell of a patient in need thereof.
  • a molecule for such use is a molecule according to Formula (I): A-X-B-Y-C; in which A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker.
  • the polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety.
  • the molecule of Formula (I) further comprises D, an endosomolytic moiety.
  • a molecule described herein is additionally used as an immuno-oncology therapy for the treatment of a disease or disorder.
  • the molecule is a molecule according to Formula (I): A-X-B-Y-C; in which A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker.
  • the polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety.
  • the molecule of Formula (I) further comprises D, an endosomolytic moiety.
  • kits which comprises one or more of the molecules described herein.
  • a molecule e.g., a therapeutic molecule described herein comprises a binding moiety conjugated to a polynucleic acid molecule and a polymer.
  • a molecule e.g., a therapeutic molecule
  • A is a binding moiety
  • B is a polynucleotide
  • C is a polymer
  • X is a bond or first linker
  • Y is a bond or second linker
  • polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety.
  • the molecule of Formula (I) further comprises D, an endosomolytic moiety.
  • At least one A and/or at least one C are conjugated to the 5′ terminus of B, the 3′ terminus of B, an internal site on B, or in any combinations thereof. In some instances, at least one A is conjugated at one terminus of B while at least one C is conjugated at the opposite terminus of B. In some instances, at least one of A is conjugated at one terminus of B while at least one of C is conjugated at an internal site on B.
  • a and C are not conjugated or attached to B at the same terminus.
  • A is attached or conjugated to B at a first terminus of B.
  • C is attached or conjugated to B at a second terminus of B, and the second terminus of B is different than the first terminus.
  • A is attached or conjugated to B at the 5′ terminus of B, and C is attached or conjugated to B at the 3′ terminus of B.
  • A is attached or conjugated to B at the 3′ terminus of B, and C is attached or conjugated to B at the 5′ terminus of B.
  • A is an antibody or binding fragment thereof.
  • C is a polymer.
  • a and C are not conjugated or attached to B at the same terminus.
  • A is attached or conjugated to B at a first terminus of B.
  • C is attached or conjugated to B at a second terminus of B, and the second terminus of B is different than the first terminus.
  • A is attached or conjugated to B at the 5′ terminus of B, and C is attached or conjugated to B at the 3′ terminus of B.
  • A is attached or conjugated to B at the 3′ terminus of B, and C is attached or conjugated to B at the 5′ terminus of B.
  • X which connects A to B is a bond or a non-polymeric linker. In some cases, X is a non-peptide linker (or a linker that does not comprise an amino acid residue). In some cases, Y which connects B to C is a bond or a second linker. In some instances, X connects A to the 5′ terminus of B, and Y connects C to the 3′ terminus of B. In other instances, X connects A to the 3′ terminus of B, and Y connects C to the 5′ terminus of B.
  • X-B is conjugated or attached to the N-terminus, C-terminus, a constant region, a hinge region, or a Fc region of A. In some instances, X-B is conjugated or attached to the N-terminus of A. In some instances, X-B is conjugated or attached to the C-terminus of A. In some instances, X-B is conjugated or attached to a hinge region of A. In some instances, X-B is conjugated or attached to a constant region of A. In some instances, X-B is conjugated or attached to the Fc region of A.
  • At least one B and/or at least one C, and optionally at least one D are conjugated to a first A.
  • the at least one B is conjugated at a terminus (e.g., a 5′ terminus or a 3′ terminus) to the first A or are conjugated via an internal site to the first A.
  • the at least one C is conjugated either directly to the first A or indirectly via the two or more Bs. If indirectly via the two or more Bs, the two or more Cs are conjugated either at the same terminus as the first A on B, at opposing terminus from the first A, or independently at an internal site.
  • at least one additional A is further conjugated to the first A, to B, or to C.
  • the at least one D is optionally conjugated either directly or indirectly to the first A, to the at least one B, or to the at least one C. If directly to the first A, the at least one D is also optionally conjugated to the at least one B to form a A-D-B conjugate or is optionally conjugated to the at least one B and the at least one C to form a A-D-B-C conjugate. In some cases, the at least one additional A is different than the first A.
  • two or more Bs and/or two or more Cs are conjugated to a first A.
  • the two or more Bs are conjugated at a terminus (e.g., a 5′ terminus or a 3′ terminus) to the first A or are conjugated via an internal site to the first A.
  • the two or more Cs are conjugated either directly to the first A or indirectly via the two or more Bs. If indirectly via the two or more Bs, the two or more Cs are conjugated either at the same terminus as the first A on B, at opposing terminus from the first A, or independently at an internal site.
  • at least one additional A is further conjugated to the first A, to two or more Bs, or to two or more Cs.
  • At least one D is optionally conjugated either directly or indirectly to the first A, to the two or more Bs, or to the two or more Cs. If indirectly to the first A, the at least one D is conjugated to the first A through the two or more Bs, through the two or more Cs, through a B-C orientation to form a A-B-C-D type conjugate, or through a C-B orientation to form a A-C-B-D type conjugate.
  • the at least one additional A is different than the first A.
  • the two or more Bs are different.
  • the two or more Bs are the same.
  • the two or more Cs are different.
  • the two or more Cs are the same.
  • the two or more Ds are different. In additional instances, the two or more Ds are the same.
  • two or more Bs and/or two or more Ds, optionally two or more Cs are conjugated to a first A.
  • the two or more Bs are conjugated at a terminus (e.g., a 5′ terminus or a 3′ terminus) to the first A or are conjugated via an internal site to the first A.
  • the two or more Ds are conjugated either directly to the first A or indirectly via the two or more Bs. If indirectly via the two or more Bs, the two or more Ds are conjugated either at the same terminus as the first A on B, at opposing terminus from the first A, or independently at an internal site.
  • At least one additional A is further conjugated to the first A, to the two or more Bs, or to the two or more Ds.
  • the two or more Cs are optionally conjugated either directly or indirectly to the first A, to the two or more Bs, or to the two or more Ds.
  • the at least one additional A is different than the first A.
  • the two or more Bs are different.
  • the two or more Bs are the same.
  • the two or more Cs are different.
  • the two or more Cs are the same.
  • the two or more Ds are different. In additional instances, the two or more Ds are the same.
  • a molecule e.g., a therapeutic molecule described herein comprises a molecule according to Formula (II):
  • A is a binding moiety
  • B is a polynucleotide
  • C is a polymer
  • X is a bond or first linker
  • Y is a bond or second linker
  • L is a bond or third linker
  • D is an endosomolytic moiety
  • c is an integer between 0 and 1;
  • polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety; and D is conjugated anywhere on A, B, or C.
  • a molecule e.g., a therapeutic molecule described herein comprises a molecule according to Formula (III):
  • A is a binding moiety
  • B is a polynucleotide
  • C is a polymer
  • D is an endosomolytic moiety
  • X is a bond or first linker
  • Y is a bond or second linker
  • L is a bond or third linker
  • a and b are independently an integer between 1-3;
  • c is an integer between 0 and 3;
  • n is an integer between 0 and 10;
  • polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety;
  • A is conjugated anywhere on B, C, or D;
  • B is conjugated anywhere on A, C, or D;
  • C is conjugated anywhere on A, B, or D; and
  • D is conjugated anywhere on A, B, or C.
  • a molecule e.g., a therapeutic molecule described herein comprises a molecule according to Formula (Ma): A-X-B-L-D-Y-C.
  • a molecule e.g., a therapeutic molecule described herein comprises a molecule according to Formula (Mb): A a -X-B b -L-D n .
  • a molecule e.g., a therapeutic molecule described herein comprises a molecule according to Formula (IV):
  • A is a binding moiety
  • B is a polynucleotide
  • C is a polymer
  • D is an endosomolytic moiety
  • X is a bond or first linker
  • Y is a bond or second linker
  • L is a bond or third linker
  • a and b are independently an integer between 1-3;
  • c is an integer between 0 and 3;
  • n is an integer between 1-3;
  • polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety; C is conjugated anywhere on B or D; and D is conjugated anywhere on B or C.
  • a molecule e.g., a therapeutic molecule described herein comprises a molecule according to Formula (IVa): A-X-(B b -L-D n -Y-C c ) m .
  • a molecule (e.g., a therapeutic molecule) described herein is a molecule as illustrated in FIG. 1 .
  • a molecule (e.g., a therapeutic molecule) described herein is a molecule as illustrated in FIG. 1A .
  • a molecule (e.g., a therapeutic molecule) described herein is a molecule as illustrated in FIG. 1B .
  • a molecule (e.g., a therapeutic molecule) described herein is a molecule as illustrated in FIG. 1C .
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a molecule e.g., a therapeutic molecule
  • a humanized antibody or binding fragment thereof chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab′, divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.
  • the polynucleic acid molecule B is a polynucleic acid molecule (or polynucleotide) that hybridizes to a target region on an oncogene.
  • oncogenes are further classified into several categories: growth factors or mitogens, receptor tyrosine kinases, cytoplasmic tyrosine kinases, cytoplasmic serine/threonine kinases, regulatory GTPases, and transcription factors.
  • growth factors include c-Sis.
  • Exemplary receptor tyrosine kinases include epidermal growth factor receptor (EGFR), platelet-derived growth factor receptor (PDGFR), vascular endothelial growth factor receptor (VEGFR), and HER2/neu.
  • Exemplary cytoplasmic tyrosine kinases include Src-family tyrosine kinases, Syk-ZAP-70 family of tyrosine kinases, BTK family of tyrosine kinases, and Abl gene in CML.
  • Exemplary cytoplasmic serine/threonine kinases include Raf kinase and cyclin-dependent kinases.
  • Exemplary regulatory GTPases include Ras family of proteins such as KRAS.
  • Exemplary transcription factors include MYC gene.
  • an oncogene described herein comprises an oncogene selected from growth factors or mitogens, receptor tyrosine kinases, cytoplasmic tyrosine kinases, cytoplasmic serine/threonine kinases, regulatory GTPases, or transcription factors.
  • the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of an oncogene selected from growth factors or mitogens, receptor tyrosine kinases, cytoplasmic tyrosine kinases, cytoplasmic serine/threonine kinases, regulatory GTPases, or transcription factors.
  • an oncogene described herein comprises Abl, AKT-2, ALK, AML1 (or RUNX1), AR, AXL, BCL-2, 3, 6, BRAF, c-MYC, EGFR, ErbB-2 (Her2, Neu), Fms, FOS, GLI1, HPRT1, IL-3, INTS2, JUN, KIT, KS3, K-sam, LBC (AKAP13), LCK, LMO1, LMO2, LYL1, MAS1, MDM2, MET, MLL (KMT2A), MOS, MYB, MYH11/CBFB, NOTCH1 (TAN1), NTRK1 (TRK), OST (SLC51B), PAX5, PIM1, PRAD-1, RAF, RAR/PML, HRAS, KRAS, NRAS, REL/NRG, RET, ROS, SKI, SRC, TIAM1, or TSC2.
  • the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of Abl, AKT-2, ALK, AML1 (or RUNX1), AR, AXL, BCL-2, 3, 6, BRAF, c-MYC, EGFR, ErbB-2 (Her2, Neu), Fms, FOS, GLI1, HPRT1, IL-3, INTS2, JUN, KIT, KS3, K-sam, LBC (AKAP13), LCK, LMO1, LMO2, LYL1, MAS1, MDM2, MET, MLL (KMT2A), MOS, MYB, MYH11/CBFB, NOTCH1 (TAN1), NTRK1 (TRK), OST (SLC51B), PAX5, PIM1, PRAD-1, RAF, RAR/PML, HRAS, KRAS, NRAS, REL/NRG, RET, ROS, SKI, SRC, TIAM1, or TSC
  • an oncogene described herein comprises KRAS, EGFR, AR, HPRT1, CNNTB1 ( ⁇ -catenin), or ⁇ -catenin associated genes.
  • the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of KRAS, EGFR, AR, HPRT1, CNNTB1 ( ⁇ -catenin), or ⁇ -catenin associated genes.
  • the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of KRAS.
  • the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of EGFR. In some embodiments, the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of AR. In some embodiments, the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of CNNTB1 ( ⁇ -catenin). In some embodiments, the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of CNNTB1 ( ⁇ -catenin) associated genes.
  • the ⁇ -catenin associated genes comprise PIK3CA, PIK3CB, and Myc.
  • the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of HPRT1.
  • KRAS Kirsten Rat Sarcoma Viral Oncogene Homolog
  • Kirsten Rat Sarcoma Viral Oncogene Homolog (also known as GTPase KRas, V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog, or KRAS) is involved in regulating cell division.
  • the K-Ras protein is a GTPase belonging to the Ras superfamily.
  • K-Ras modulates cell cycle progression, as well as induces growth arrest, apoptosis, and replicative senescence under different environmental triggers (e.g., cellular stress, ultraviolet, heat shock, or ionizing irradiation).
  • KRAS gene amplification has also been implicated in cancer development (see, for example, Valtorta et al. “KRAS gene amplification in colorectal cancer and impact on response to EGFR-targeted therapy,” Int. J. Cancer 133: 1259-1266 (2013)).
  • the cancer pertains to a refractory cancer in which the patient has acquired resistance to a particular inhibitor or class of inhibitors.
  • the KRAS gene is wild type or comprises a mutation.
  • KRAS mRNA is wild type or comprises a mutation.
  • the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of wild type KRAS DNA or RNA.
  • the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of KRAS DNA or RNA comprising a mutation (e.g., a substitution, a deletion, or an addition).
  • KRAS DNA or RNA comprises one or more mutations. In some embodiments, KRAS DNA or RNA comprises one or more mutations at codons 12 or 13 in exon 1. In some instances, KRAS DNA or RNA comprises one or more mutations at codons 61, 63, 117, 119, or 146. In some instances, KRAS DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 12, 13, 18, 19, 20, 22, 24, 26, 36, 59, 61, 63, 64, 68, 110, 116, 117, 119, 146, 147, 158, 164, 176, or a combination thereof of the KRAS polypeptide.
  • KRAS DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues selected from G12V, G12D, G12C, G12A, G12S, G12F, G13C, G13D, G13V, A18D, L19F, T20R, Q22K, I24N, N26K, I36L, I36M, A59G, A59E, Q61K, Q61H, Q61L, Q61R, E63K, Y64D, Y64N, R68S, P110S, K117N, C118S, A146T, A146P, A146V, K147N, T158A, R164Q, K176Q, or a combination thereof of the KRAS polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations at codons 12 or 13 in exon 1. In some embodiments, the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations at codons 61, 63, 117, 119, or 146.
  • the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 12, 13, 18, 19, 20, 22, 24, 26, 36, 59, 61, 63, 64, 68, 110, 116, 117, 119, 146, 147, 158, 164, 176, or a combination thereof of the KRAS polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations corresponding to amino acid residues selected from G12V, G12D, G12C, G12A, G12S, G12F, G13C, G13D, G13V, A18D, L19F, T20R, Q22K, I24N, N26K, I36L, I36M, A59G, A59E, Q61K, Q61H, Q61L, Q61R, E63K, Y64D, Y64N, R68S, P110S, K117N, C118S, A146T, A146P, A146V, K147N, T158A, R164Q, K176Q, or a combination thereof of the KRAS polypeptide.
  • Epidermal growth factor receptor (EGFR, ErbB-1, or HER1) is a transmembrane tyrosine kinase receptor and a member of the ErbB family of receptors, which also include HER2/c-neu (ErbB-2), Her3 (ErbB-3) and Her4 (ErbB-4).
  • EGFR mutations drive the downstream activation of RAS/RAF/MAPK, PI3K/AKT, and/or JAK/STAT pathways, leading to mitosis, cell proliferation, and suppression of apoptosis.
  • amplification of wild-type EGFR gene has been implicated in the development of cancers such as glioblastomas and non-small cell lung cancer (Talasila, et al., “EGFR Wild-type Amplification and Activation Promote Invasion and Development of Glioblastoma Independent of Angiogenesis,” Acta Neuropathol. 125(5): 683-698 (2013); Bell et al., “Epidermal Growth Factor Receptor Mutations and Gene Amplification in Non-Small-Cell Lung Cancer: Molecular Analysis of the IDEAL/INTACT Gefitinib Trials,” J. Clinical Oncology 23(31): 8081-8092 (2005)).
  • EGFR DNA or RNA is wild type EGFR or EGFR comprising a mutation. In some instances, EGFR is wild type EGFR. In some instances, EGFR DNA or RNA comprises a mutation. In some instances, the polynucleic acid molecule hybridizes to a target region of wild type EGFR DNA or RNA. In some instances, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation (e.g., a substitution, a deletion, or an addition).
  • a mutation e.g., a substitution, a deletion, or an addition
  • EGFR DNA or RNA comprises one or more mutations. In some embodiments, EGFR DNA or RNA comprises one or more mutations within one or more exons. In some instances, the one or more exons comprise exon 18, exon 19, exon 20, exon 21 or exon 22. In some instances, EGFR DNA or RNA comprises one or more mutations in exon 18, exon 19, exon 20, exon 21, exon 22 or a combination thereof.
  • EGFR DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 34, 38, 45, 62, 63, 77, 78, 108, 114, 120, 140, 148, 149, 160, 177, 178, 189, 191, 198, 220, 222, 223, 229, 237, 240, 244, 252, 254, 255, 256, 263, 270, 273, 276, 282, 288, 289, 301, 303, 304, 309, 314, 326, 331, 354, 363, 373, 337, 380, 384, 393, 427, 428, 437, 441, 447, 465, 475, 515, 526, 527, 531, 536, 541, 546, 571, 588, 589, 596, 596, 598, 602, 614, 620, 628, 636, 641, 645, 651, 671, 689, 694, 700, 709, 712, 7
  • EGFR DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 747, 761, 790, 854, 858, or a combination thereof of the EGFR polypeptide. In some embodiments, EGFR DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 761, 790, 858, or a combination thereof of the EGFR polypeptide. In some embodiments, EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 747 of the EGFR polypeptide. In some embodiments, EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 761 of the EGFR polypeptide.
  • EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 790 of the EGFR polypeptide. In some embodiments, EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 854 of the EGFR polypeptide. In some embodiments, EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 858 of the EGFR polypeptide.
  • EGFR DNA or RNA comprises one or more mutations selected from T34M, L38V, E45Q, L62R, G63R, G63K, S77F, F78L, R108K, R108G, E114K, A120P, L140V, V148M, R149W, E160K, S177P, M178I, K189T, D191N, S198R, S220P, R222L, R222C, S223Y, S229C, A237Y, C240Y, R244G, R252C, R252P, F254I, R255 (nonsense mutation), D256Y, T263P, Y270C, T273A, Q276 (nonsense), E282K, G288 (frame shift), A289D, A289V, A289T, A289N, A289D, V301 (deletion), D303H, H304Y, R309Q, D314N, C326R,
  • the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations in exon 18, exon 19, exon 20, exon 21, exon 22 or a combination thereof.
  • the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 34, 38, 45, 62, 63, 77, 78, 108, 114, 120, 140, 148, 149, 160, 177, 178, 189, 191, 198, 220, 222, 223, 229, 237, 240, 244, 252, 254, 255, 256, 263, 270, 273, 276, 282, 288, 289, 301, 303, 304, 309, 314, 326, 331, 354, 363, 373, 337, 380, 384, 393, 427, 428, 437, 441, 447, 465, 475, 515, 526, 527, 531, 536, 541, 546, 571, 588, 589, 596, 596, 598, 602, 614, 620, 628, 636, 641, 645,
  • the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 747, 761, 790, 854, 858, or a combination thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 761, 790, 858, or a combination thereof of the EGFR polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 747 of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 761 of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 790 of the EGFR polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 854 of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 858 of the EGFR polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations selected from T34M, L38V, E45Q, L62R, G63R, G63K, S77F, F78L, R108K, R108G, E114K, A120P, L140V, V148M, R149W, E160K, S177P, M178I, K189T, D191N, S198R, S220P, R222L, R222C, S223Y, S229C, A237Y, C240Y, R244G, R252C, R252P, F254I, R255 (nonsense mutation), D256Y, T263P, Y270C, T273A, Q276 (nonsense), E282K, G288 (frame shift), A289D, A289V, A289T, A289N, A289D, V301 (deletion), D303H,
  • the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations selected from L747S, D761Y, T790M, T854A, L858R, or a combination thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations selected from D761Y, T790M, L858R, or a combination thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation L747S of the EGFR polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation D761Y of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation T790M of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation T854A of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation L858R of the EGFR polypeptide.
  • Androgen receptor (also known as NR3C4, nuclear receptor subfamily 3, group C, gene 4) belongs to the steroid hormone group of nuclear receptor superfamily along with related members: estrogen receptor (ER), glucocorticoid receptor (GR), progesterone receptor (PR), and mineralocorticoid receptor (MR). Androgens, or steroid hormones, modulate protein synthesis and tissue remodeling through the androgen receptor.
  • the AR protein is a ligand-inducible zinc finger transcription factor that regulates target gene expression. The presence of mutations in the AR gene has been observed in several types of cancers (e.g., prostate cancer, breast cancer, bladder cancer, or esophageal cancer), and in some instances, has been linked to metastatic progression.
  • AR DNA or RNA is wild type or comprises one or more mutations and/or splice variants.
  • AR DNA or RNA comprises one or more mutations.
  • AR DNA or RNA comprises one or more splice variants selected from AR splice variants including but not limited to AR1/2/2b, ARV2, ARV3, ARV4, AR1/2/3/2b, ARV5, ARV6, ARV7, ARV9, ARV10, ARV11, ARV12, ARV13, ARV14, ARV15, ARV16, and ARV(v567es).
  • the polynucleic acid molecule hybridizes to a target region of AR DNA or RNA comprising a mutation (e.g., a substitution, a deletion, or an addition) or a splice variant.
  • AR DNA or RNA comprises one or more mutations. In some embodiments, AR DNA or RNA comprises one or more mutations within one or more exons. In some instances, the one or more exons comprise exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, or exon 8. In some embodiments, AR DNA or RNA comprises one or more mutations within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8 or a combination thereof.
  • AR DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 2, 14, 16, 29, 45, 54, 57, 64, 106, 112, 176, 180, 184, 194, 198, 204, 214, 221, 222, 233, 243, 252, 255, 266, 269, 287, 288, 334, 335, 340, 363, 368, 369, 390, 403, 443, 491, 505, 513, 524, 524, 528, 533, 547, 548, 564, 567, 568, 574, 547, 559, 568, 571, 573, 575, 576, 577, 578, 579, 580, 581, 582, 585, 586, 587, 596, 597, 599, 601, 604, 607, 608, 609, 610, 611, 615, 616, 617, 619, 622, 629, 630, 638, 645, 647, 653,
  • AR DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues selected from E2K, P14Q, K16N, V29M, S45T, L54S, L57Q, Q64R, Y106C, Q112H, S176S, K180R, L184P, Q194R, E198G, G204S, G214R, K221N, N222D, D233K, S243L, A252V, L255P, M266T, P269S, A287D, E288K, S334P, S335T, P340L, Y363N, L368V, A369P, P390R, P390S, P390L, A403V, Q443R, G491S, G505D, P513S, G524D, G524S, D528G, P533S, L547F, P548S, D564Y, S567F, G
  • the polynucleic acid molecule hybridizes to a target region of AR DNA or RNA comprising one or more mutations. In some embodiments the polynucleic acid hybridizes to one or more AR splice variants. In some embodiments the polynucleic acid hybridizes to AR DNA or RNA comprising one or more AR splice variants including but not limited to AR1/2/2b, ARV2, ARV3, ARV4, AR1/2/3/2b, ARV5, ARV6, ARV7, ARV9, ARV10, ARV11, ARV12, ARV13, ARV14, ARV15, ARV16, and ARV(v567es).
  • the polynucleic acid molecule hybridizes to a target region of AR DNA or RNA comprising one or more mutations within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8 or a combination thereof.
  • the polynucleic acid molecule hybridizes to a target region of AR DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 2, 14, 16, 29, 45, 54, 57, 64, 106, 112, 176, 180, 184, 194, 198, 204, 214, 221, 222, 233, 243, 252, 255, 266, 269, 287, 288, 334, 335, 340, 363, 368, 369, 390, 403, 443, 491, 505, 513, 524, 524, 528, 533, 547, 548, 564, 567, 568, 574, 547, 559, 568, 571, 573, 575, 576, 577, 578, 579, 580, 581, 582, 585, 586, 587, 596, 597, 599, 601, 604, 607, 608, 609, 610, 611, 615, 616, 617, 619,
  • the polynucleic acid molecule hybridizes to a target region of AR DNA or RNA comprising one or more mutations selected from E2K, P14Q, K16N, V29M, S45T, L54S, L57Q, Q64R, Y106C, Q112H, S176S, K180R, L184P, Q194R, E198G, G204S, G214R, K221N, N222D, D233K, S243L, A252V, L255P, M266T, P269S, A287D, E288K, S334P, S335T, P340L, Y363N, L368V, A369P, P390R, P390S, P390L, A403V, Q443R, G491S, G505D, P513S, G524D, G524S, D528G, P533S, L547F, P548S, D
  • Catenin beta-1 (also known as CTNNB1, ⁇ -catenin, or beta-catenin) is a member of the catenin protein family. In humans, it is encoded by the CTNNB1 gene and is known for its dual functions—cell-cell adhesion and gene transcription. Beta-catenin is an integral structural component of cadherin-based adherens junctions and regulates cell growth and adhesion between cells and anchors the actin cytoskeleton. In some instance, beta-catenin is responsible for transmitting the contact inhibition signal that causes the cells to stop dividing once the epithelial sheet is complete. Beta-catenin is also a key nuclear effector of the Wnt signaling pathway.
  • beta-catenin results in diseases and deregulated growth connected to malignancies such as cancer.
  • overexpression of beta-catenin has been linked to cancers such as gastric cancer (Suriano, et al., “Beta-catenin (CTNNB1) gene amplification: a new mechanism of protein overexpression in cancer,” Genes Chromosomes Cancer 42(3): 238-246 (2005)).
  • mutations in CTNNB1 gene have been linked to cancer development (e.g., colon cancer, melanoma, hepatocellular carcinoma, ovarian cancer, endometrial cancer, medulloblastoma pilomatricomas, or prostrate cancer), and in some instances, has been linked to metastatic progression.
  • mutations in the CTNNB1 gene cause beta-catenin to translocate to the nucleus without any external stimulus and drive the transcription of its target genes continuously.
  • the potential of beta-catenin to change the previously epithelial phenotype of affected cells into an invasive, mesenchyme-like type contributes to metastasis formation.
  • CTNNB1 gene is wild type CTNNB1 or CTNNB1 comprising one or more mutations. In some instances, CTNNB1 is wild type CTNNB1. In some instances, CTNNB1 is CTNNB1 comprising one or more mutations.
  • the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of wild type CTNNB1. In some instances, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of CTNNB1 comprising a mutation (e.g., a substitution, a deletion, or an addition).
  • CTNNB1 DNA or RNA comprises one or more mutations. In some embodiments, CTNNB1 DNA or RNA comprises one or more mutations within one or more exons. In some instances, the one or more exons comprise exon 3. In some instances, CTNNB1 DNA or RNA comprises one or more mutations at codons 32, 33, 34, 37, 41, 45, 183, 245, 287 or a combination thereof.
  • CTNNB1 DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 25, 31, 32, 33, 34, 35, 36, 37, 41, 45, 140, 162, 170, 199, 213, 215, 257, 303, 322, 334, 354, 367, 373, 383, 387, 402, 426, 453, 474, 486, 515, 517, 535, 553, 555, 582, 587, 619, 623, 641, 646, 688, 703, 710, 712, 714, 724, 738, 777, or a combination thereof of the CTNNB1 polypeptide.
  • CTNNB1 DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues selected from W25 (nonsense mutation), L31M, D32A, D32N, D32Y, D32G, D32H, S33C, S33Y, S33F, S33P, G34R, G34E, G34V, I35S, H36Y, S37F, S37P, S37C, S37A, T41N, T41A, T41I, S45Y, S45F, S45C, 1140T, D162E, K170M, V199I, C213F, A215T, T257I, 1303M, Q322K, E334K, K354T, G367V, P373S, W383G, N387K, L402F, N426D, R453L, R453Q, R474 (nonsense mutation), R486C, R515Q, L517F, R535 (nonsense mutation), R4
  • the polynucleic acid molecule hybridizes to a target region of CTNNB1 DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of CTNNB1 DNA or RNA comprising one or more mutations within exon 3. In some embodiments, the polynucleic acid molecule hybridizes to a target region of CTNNB1 DNA or RNA comprising one or more mutations at codons 32, 33, 34, 37, 41, 45, 183, 245, 287 or a combination thereof.
  • the polynucleic acid molecule hybridizes to a target region of CTNNB1 DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 25, 31, 32, 33, 34, 35, 36, 37, 41, 45, 140, 162, 170, 199, 213, 215, 257, 303, 322, 334, 354, 367, 373, 383, 387, 402, 426, 453, 474, 486, 515, 517, 535, 553, 555, 582, 587, 619, 623, 641, 646, 688, 703, 710, 712, 714, 724, 738, 777, or a combination thereof of the CTNNB1 polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of CTNNB1 DNA or RNA comprising one or more mutations selected from W25 (nonsense mutation), L31M, D32A, D32N, D32Y, D32G, D32H, S33C, S33Y, S33F, S33P, G34R, G34E, G34V, I35S, H36Y, S37F, S37P, S37C, S37A, T41N, T41A, T41I, S45Y, S45F, S45C, 1140T, D162E, K170M, V199I, C213F, A215T, T257I, 1303M, Q322K, E334K, K354T, G367V, P373S, W383G, N387K, L402F, N426D, R453L, R453Q, R474 (nonsense mutation), R486C, R515Q,
  • beta-catenin associated genes further comprise PIK3CA, PIK3CB, and MYC. In some embodiments, beta-catenin associated genes further comprise PIK3CA DNA or RNA.
  • PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha or p110 ⁇ protein
  • PIK3CA gene is wild type PIK3CA or PIK3CA comprising one or more mutations.
  • PIK3CA DNA or RNA is wild type PIK3CA. In some instances, PIK3CA DNA or RNA comprises one or more mutations. In some instances, the polynucleic acid molecule hybridizes to a target region of wild type PIK3CA DNA or RNA. In some instances, the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA comprising a mutation (e.g., a substitution, a deletion, or an addition).
  • a mutation e.g., a substitution, a deletion, or an addition
  • PIK3CA DNA or RNA comprises one or more mutations. In some embodiments, PIK3CA DNA or RNA comprises one or more mutation within one or more exons. In some instances, PIK3CA DNA or RNA comprises one or more mutation within exons 9 and/or 20.
  • PIK3CA DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 1, 4, 10-16, 11-18, 11, 12, 38, 39, 65, 72, 75, 79, 81, 83, 88, 90, 93, 102, 103, 103-104, 103-106, 104, 105-108, 106, 106-107, 106-108, 107, 108, 109-112, 110, 111, 113, 115, 137, 170, 258, 272, 279, 320, 328, 335, 342, 344, 345, 350, 357, 359, 363, 364, 365, 366, 378, 398, 401, 417, 420, 447-455, 449, 449-457, 451, 453, 454, 455, 455-460, 463-465, 471, 495, 522, 538, 539, 542, 545, 546, 547, 576, 604, 614, 617, 629
  • PIK3CA DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues selected from M1V, R4 (nonsense mutation), L10-M16 (deletion), W11-P18 (deletion), W11L, G12D, R38L, R38H, R38C, R38S, E39K, E39G, E65K, S72G, Q75E, R79M, E81K, E81 (deletion), F83Y, R88Q, C90Y, C90G, R93Q, R93W, 1102 (deletion), E103G, E103-P104 (deletion), E103-G106 (deletion), P104L, V105-R108 (deletion), G106V, G106-N107 (deletion), G106-R108 (deletion), G106R, N107S, R108L, R108H, E109-I112 (deletion), E110 (deletion), K111E, K111R,
  • the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA comprising one or more mutations within an exon. In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA comprising one or more mutations within exon 9 or exon 20.
  • the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 1, 4, 10-16, 11-18, 11, 12, 38, 39, 65, 72, 75, 79, 81, 83, 88, 90, 93, 102, 103, 103-104, 103-106, 104, 105-108, 106, 106-107, 106-108, 107, 108, 109-112, 110, 111, 113, 115, 137, 170, 258, 272, 279, 320, 328, 335, 342, 344, 345, 350, 357, 359, 363, 364, 365, 366, 378, 398, 401, 417, 420, 447-455, 449, 449-457, 451, 453, 454, 455, 455-460, 463-465, 471, 495, 522, 538, 539, 542, 545
  • the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of PIK3CA DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues selected from M1V, R4 (nonsense mutation), L10-M16 (deletion), W11-P18 (deletion), W11L, G12D, R38L, R38H, R38C, R38S, E39K, E39G, E65K, S72G, Q75E, R79M, E81K, E81 (deletion), F83Y, R88Q, C90Y, C90G, R93Q, R93W, 1102 (deletion), E103G, E103-P104 (deletion), E103-G106 (deletion), P104L, V105-R108 (deletion), G106V, G106-N107 (deletion), G106-R108 (deletion), G106R, N107S, R108L
  • beta-catenin associated genes further comprise PIK3CB.
  • PIK3CB gene is wild type or comprises one or more mutations.
  • PIK3CB DNA or RNA is wild type PIK3CB DNA or RNA.
  • PIK3CB DNA or RNA comprises one or more mutations.
  • the polynucleic acid molecule hybridizes to a target region of wild type PIK3CB DNA or RNA.
  • the polynucleic acid molecule hybridizes to a target region of PIK3CB DNA or RNA comprising a mutation (e.g., a substitution, a deletion, or an addition).
  • PIK3CB DNA or RNA comprises one or more mutations. In some embodiments, PIK3CB DNA or RNA comprises one or more mutations within one or more exons. In some instances, PIK3CB DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 18, 19, 21, 28, 50, 61, 68, 103, 135, 140, 167, 252, 270, 290, 301, 304, 321, 369, 417, 442, 470, 497, 507, 512, 540, 551, 552, 554, 562, 567, 593, 595, 619, 628, 668, 768, 805, 824, 830, 887, 967, 992, 1005, 1020, 1036, 1046, 1047, 1048, 1049, 1051, 1055, 1067, or a combination thereof of the PIK3CB polypeptide.
  • PIK3CB DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues selected from W18 (nonsense mutation), A19V, D21H, G28S, A50P, K61T, M68I, R103K, H135N, L140S, S167C, G252W, R270W, K290N, E301V, I304R, R321Q, V369I, T417M, N442K, E470K, E497D, P507S, I512M, E540 (nonsense mutation), C551R, E552K, E554K, R562 (nonsense mutation), E567D, A593V, L595P, V619A, R628 (nonsense mutation), R668W, L768F, K805E, D824E, A830T, E887 (nonsense mutation), V967A, I992T, A1005V, D1020H, E1036K, D1046N,
  • the polynucleic acid molecule hybridizes to a target region of PIK3CB DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CB DNA or RNA comprising one or more mutations within an exon.
  • the polynucleic acid molecule hybridizes to a target region of PIK3CB DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 18, 19, 21, 28, 50, 61, 68, 103, 135, 140, 167, 252, 270, 290, 301, 304, 321, 369, 417, 442, 470, 497, 507, 512, 540, 551, 552, 554, 562, 567, 593, 595, 619, 628, 668, 768, 805, 824, 830, 887, 967, 992, 1005, 1020, 1036, 1046, 1047, 1048, 1049, 1051, 1055, 1067, or a combination thereof of the PIK3CB polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of PIK3CB DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues selected from W18 (nonsense mutation), A19V, D21H, G28S, A50P, K61T, M68I, R103K, H135N, L140S, S167C, G252W, R270W, K290N, E301V, I304R, R321Q, V369I, T417M, N442K, E470K, E497D, P507S, I512M, E540 (nonsense mutation), C551R, E552K, E554K, R562 (nonsense mutation), E567D, A593V, L595P, V619A, R628 (nonsense mutation), R668W, L768F, K805E, D824E, A830T, E887 (nonsense mutation), V967A, I992T, A
  • beta-catenin associated genes further comprise MYC.
  • MYC gene is wild type MYC or MYC comprising one or more mutations.
  • MYC is wild type MYC DNA or RNA.
  • MYC DNA or RNA comprisesone or more mutations.
  • the polynucleic acid molecule hybridizes to a target region of wild type MYC DNA or RNA.
  • the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of MYC DNA or RNA comprising a mutation (e.g., a substitution, a deletion, or an addition).
  • MYC DNA or RNA comprises one or more mutations. In some embodiments, MYC DNA or RNA comprises one or more mutation within one or more exons. In some instances, MYC DNA or RNA comprises one or more mutations within exon 2 or exon 3. In some instances, MYC DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 2, 7, 17, 20, 32, 44, 58, 59, 76, 115, 138, 141, 145, 146, 169, 175, 188, 200, 202, 203, 248, 251, 298, 321, 340, 369, 373, 374, 389, 395, 404, 419, 431, 439, or a combination thereof.
  • MYC DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues selected from P2L, F7L, D17N, Q20E, Y32N, A44V, A44T, T58I, P59L, A76V, F115L, F138S, A141S, V145I, S146L, S169C, S175N, C188F, N200S, S202N, S203T, T248S, D251E, S298Y, Q321E, V340D, V369D, T373K, H374R, F389L, Q395H, K404N, L419M, E431K, R439Q, or a combination thereof of the MYC polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA comprising one or more mutations within an exon. In some embodiments, the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA comprising one or more mutations within exon 2 or exon 3.
  • the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 2, 7, 17, 20, 32, 44, 58, 59, 76, 115, 138, 141, 145, 146, 169, 175, 188, 200, 202, 203, 248, 251, 298, 321, 340, 369, 373, 374, 389, 395, 404, 419, 431, 439, or a combination thereof of the MYC polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues selected from P2L, F7L, D17N, Q20E, Y32N, A44V, A44T, T58I, P59L, A76V, F115L, F138S, A141S, V145I, S146L, S169C, S175N, C188F, N200S, S202N, S203T, T248S, D251E, S298Y, Q321E, V340D, V369D, T373K, H374R, F389L, Q395H, K404N, L419M, E431K, R439Q, or a combination thereof of the MYC polypeptide.
  • Hypoxanthine-guanine phosphoribosyltransferase is a transferase that catalyzes the conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate.
  • HGPRT is encoded by the hypoxanthine Phosphoribosyltransferase 1 (HPRT1) gene.
  • HPRT1 DNA or RNA is wild type or comprises one or more mutations. In some instances, HPRT1 DNA or RNA comprises one or more mutations within one or more exons. In some instances, the one or more exons comprise exon 2, exon 3, exon 4, exon 6, exon 8, or exon 9. In some instances, HPRT1 DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 35, 48, 56, 74, 87, 129, 154, 162, 195, 200, 210, or a combination thereof of the HPRT1 polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of HPRT1 DNA or RNA comprising one or more mutations selected from V35M, R48H, E56D, F74L, R87I, N129 (splice-site mutation), N154H, 5162 (splice-site mutation), Y195C, Y195N, R200M, E210K, or a combination thereof of the HPRT1 polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of HPRT1 DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of HPRT1 DNA or RNA comprising one or more mutations within exon 2, exon 3, exon 4, exon 6, exon 8, or exon 9. In some embodiments, the polynucleic acid molecule hybridizes to a target region of HPRT1 DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 35, 48, 56, 74, 87, 129, 154, 162, 195, 200, 210, or a combination thereof of the HPRT1 polypeptide.
  • the polynucleic acid molecule hybridizes to a target region of HPRT1 DNA or RNA comprising one or more mutations selected from V35M, R48H, E56D, F74L, R87I, N129 (splice-site mutation), N154H, 5162 (splice-site mutation), Y195C, Y195N, R200M, E210K, or a combination thereof of the HPRT1 polypeptide.
  • the polynucleic acid molecule comprises a sequence that hybridizes to a target sequence illustrated in Tables 1, 4, 7, 8, or 10.
  • the polynucleic acid molecule is B.
  • the polynucleic acid molecule B comprises a sequence that hybridizes to a target sequence illustrated in Table 1 (KRAS target sequences).
  • the polynucleic acid molecule B comprises a sequence that hybridizes to a target sequence illustrated in Table 4 (EGFR target sequences).
  • the polynucleic acid molecule B comprises a sequence that hybridizes to a target sequence illustrated in Table 7 (AR target sequences).
  • the polynucleic acid molecule B comprises a sequence that hybridizes to a target sequence illustrated in Table 8 ( ⁇ -catenin target sequences). In additional cases, the polynucleic acid molecule B comprises a sequence that hybridizes to a target sequence illustrated in Table 10 (PIK3CA and PIK3CB target sequences).
  • the polynucleic acid molecule B comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Table 2 or Table 3.
  • the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75.
  • the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to SEQ ID NOs: 16-75.
  • the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to SEQ ID NOs: 16-75.
  • the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 16-75.
  • the polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide.
  • the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75.
  • the second polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75.
  • the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75 and a second polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75.
  • the polynucleic acid molecule B comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Table 5 or Table 6.
  • the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 452-1955.
  • the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to SEQ ID NOs: 452-1955.
  • the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to SEQ ID NOs: 452-1955.
  • the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to SEQ ID NOs: 452-1955.
  • the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 452-1955.
  • the polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide.
  • the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 452-1955.
  • the second polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 452-1955.
  • the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 452-1955 and a second polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 452-1955.
  • the polynucleic acid molecule B comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Table 7.
  • the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1956-1962.
  • the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to SEQ ID NOs: 1956-1962.
  • the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to SEQ ID NOs: 1956-1962.
  • the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 1956-1962.
  • the polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide.
  • the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1956-1962.
  • the second polynucleotide comprises a sequence that is complementary to a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1956-1962.
  • the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1956-1962, and a second polynucleotide that is complementary to a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1956-1962.
  • the polynucleic acid molecule B comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Table 9.
  • the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1967-2002.
  • the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to SEQ ID NOs: 1967-2002.
  • the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to SEQ ID NOs: 1967-2002.
  • the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 1967-2002.
  • the polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide.
  • the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1967-2002.
  • the second polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1967-2002.
  • the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1967-2002 and a second polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1967-2002.
  • the polynucleic acid molecule B comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Table 11.
  • the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2013-2032.
  • the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to SEQ ID NOs: 2013-2032.
  • the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to SEQ ID NOs: 2013-2032.
  • the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 2013-2032.
  • the polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide.
  • the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2013-2032.
  • the second polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2013-2032.
  • the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2013-2032 and a second polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2013-2032.
  • the polynucleic acid molecule B comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Table 12.
  • the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to SEQ ID NOs: 2082-2109 or 2117.
  • the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to SEQ ID NOs: 2082-2109 or 2117.
  • the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to SEQ ID NOs: 2082-2109 or 2117.
  • the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 2082-2109 or 2117.
  • the polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide.
  • the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2082-2109 or 2117.
  • the second polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2082-2109 or 2117.
  • the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2082-2109 or 2117 and a second polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2082-2109 or 2117.
  • the polynucleic acid molecule described herein comprises RNA or DNA. In some cases, the polynucleic acid molecule comprises RNA. In some instances, RNA comprises short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), double-stranded RNA (dsRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), or heterogeneous nuclear RNA (hnRNA). In some instances, RNA comprises shRNA. In some instances, RNA comprises miRNA. In some instances, RNA comprises dsRNA. In some instances, RNA comprises tRNA. In some instances, RNA comprises rRNA. In some instances, RNA comprises hnRNA. In some instances, the RNA comprises siRNA. In some instances, the polynucleic acid molecule comprises siRNA. In some cases, B comprises siRNA.
  • the polynucleic acid molecule is from about 10 to about 50 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 30, from about 15 to about 30, from about 18 to about 25, from about 18 to about 24, from about 19 to about 23, or from about 20 to about 22 nucleotides in length.
  • the polynucleic acid molecule is about 50 nucleotides in length. In some instances, the polynucleic acid molecule is about 45 nucleotides in length. In some instances, the polynucleic acid molecule is about 40 nucleotides in length. In some instances, the polynucleic acid molecule is about 35 nucleotides in length. In some instances, the polynucleic acid molecule is about 30 nucleotides in length. In some instances, the polynucleic acid molecule is about 25 nucleotides in length. In some instances, the polynucleic acid molecule is about 20 nucleotides in length.
  • the polynucleic acid molecule is about 19 nucleotides in length. In some instances, the polynucleic acid molecule is about 18 nucleotides in length. In some instances, the polynucleic acid molecule is about 17 nucleotides in length. In some instances, the polynucleic acid molecule is about 16 nucleotides in length. In some instances, the polynucleic acid molecule is about 15 nucleotides in length. In some instances, the polynucleic acid molecule is about 14 nucleotides in length. In some instances, the polynucleic acid molecule is about 13 nucleotides in length. In some instances, the polynucleic acid molecule is about 12 nucleotides in length.
  • the polynucleic acid molecule is about 11 nucleotides in length. In some instances, the polynucleic acid molecule is about 10 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 50 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 45 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 40 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 35 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 30 nucleotides in length.
  • the polynucleic acid molecule is from about 10 to about 25 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 20 nucleotides in length. In some instances, the polynucleic acid molecule is from about 15 to about 25 nucleotides in length. In some instances, the polynucleic acid molecule is from about 15 to about 30 nucleotides in length. In some instances, the polynucleic acid molecule is from about 12 to about 30 nucleotides in length.
  • the polynucleic acid molecule comprises a first polynucleotide. In some instances, the polynucleic acid molecule comprises a second polynucleotide. In some instances, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide. In some instances, the first polynucleotide is a sense strand or passenger strand. In some instances, the second polynucleotide is an antisense strand or guide strand.
  • the polynucleic acid molecule is a first polynucleotide.
  • the first polynucleotide is from about 10 to about 50 nucleotides in length. In some instances, the first polynucleotide is from about 10 to about 30, from about 15 to about 30, from about 18 to about 25, from about 18 to about 24, from about 19 to about 23, or from about 20 to about 22 nucleotides in length.
  • the first polynucleotide is about 50 nucleotides in length. In some instances, the first polynucleotide is about 45 nucleotides in length. In some instances, the first polynucleotide is about 40 nucleotides in length. In some instances, the first polynucleotide is about 35 nucleotides in length. In some instances, the first polynucleotide is about 30 nucleotides in length. In some instances, the first polynucleotide is about 25 nucleotides in length. In some instances, the first polynucleotide is about 20 nucleotides in length. In some instances, the first polynucleotide is about 19 nucleotides in length.
  • the first polynucleotide is about 18 nucleotides in length. In some instances, the first polynucleotide is about 17 nucleotides in length. In some instances, the first polynucleotide is about 16 nucleotides in length. In some instances, the first polynucleotide is about 15 nucleotides in length. In some instances, the first polynucleotide is about 14 nucleotides in length. In some instances, the first polynucleotide is about 13 nucleotides in length. In some instances, the first polynucleotide is about 12 nucleotides in length. In some instances, the first polynucleotide is about 11 nucleotides in length.
  • the first polynucleotide is about 10 nucleotides in length. In some instances, the first polynucleotide is from about 10 to about 50 nucleotides in length. In some instances, the first polynucleotide is from about 10 to about 45 nucleotides in length. In some instances, the first polynucleotide is from about 10 to about 40 nucleotides in length. In some instances, the first polynucleotide is from about 10 to about 35 nucleotides in length. In some instances, the first polynucleotide is from about 10 to about 30 nucleotides in length. In some instances, the first polynucleotide is from about 10 to about 25 nucleotides in length.
  • the first polynucleotide is from about 10 to about 20 nucleotides in length. In some instances, the first polynucleotide is from about 15 to about 25 nucleotides in length. In some instances, the first polynucleotide is from about 15 to about 30 nucleotides in length. In some instances, the first polynucleotide is from about 12 to about 30 nucleotides in length.
  • the polynucleic acid molecule is a second polynucleotide.
  • the second polynucleotide is from about 10 to about 50 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 30, from about 15 to about 30, from about 18 to about 25, from about 18 to about 24, from about 19 to about 23, or from about 20 to about 22 nucleotides in length.
  • the second polynucleotide is about 50 nucleotides in length. In some instances, the second polynucleotide is about 45 nucleotides in length. In some instances, the second polynucleotide is about 40 nucleotides in length. In some instances, the second polynucleotide is about 35 nucleotides in length. In some instances, the second polynucleotide is about 30 nucleotides in length. In some instances, the second polynucleotide is about 25 nucleotides in length. In some instances, the second polynucleotide is about 20 nucleotides in length. In some instances, the second polynucleotide is about 19 nucleotides in length.
  • the second polynucleotide is about 18 nucleotides in length. In some instances, the second polynucleotide is about 17 nucleotides in length. In some instances, the second polynucleotide is about 16 nucleotides in length. In some instances, the second polynucleotide is about 15 nucleotides in length. In some instances, the second polynucleotide is about 14 nucleotides in length. In some instances, the second polynucleotide is about 13 nucleotides in length. In some instances, the second polynucleotide is about 12 nucleotides in length. In some instances, the second polynucleotide is about 11 nucleotides in length.
  • the second polynucleotide is about 10 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 50 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 45 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 40 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 35 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 30 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 25 nucleotides in length.
  • the second polynucleotide is from about 10 to about 20 nucleotides in length. In some instances, the second polynucleotide is from about 15 to about 25 nucleotides in length. In some instances, the second polynucleotide is from about 15 to about 30 nucleotides in length. In some instances, the second polynucleotide is from about 12 to about 30 nucleotides in length.
  • the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide. In some instances, the polynucleic acid molecule further comprises a blunt terminus, an overhang, or a combination thereof. In some instances, the blunt terminus is a 5′ blunt terminus, a 3′ blunt terminus, or both. In some cases, the overhang is a 5′ overhang, 3′ overhang, or both. In some cases, the overhang comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 non-base pairing nucleotides. In some cases, the overhang comprises 1, 2, 3, 4, 5, or 6 non-base pairing nucleotides.
  • the overhang comprises 1, 2, 3, or 4 non-base pairing nucleotides. In some cases, the overhang comprises 1 non-base pairing nucleotide. In some cases, the overhang comprises 2 non-base pairing nucleotides. In some cases, the overhang comprises 3 non-base pairing nucleotides. In some cases, the overhang comprises 4 non-base pairing nucleotides.
  • the sequence of the polynucleic acid molecule is at least 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.5% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 50% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 60% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 70% complementary to a target sequence described herein.
  • the sequence of the polynucleic acid molecule is at least 80% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 90% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 95% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 99% complementary to a target sequence described herein. In some instances, the sequence of the polynucleic acid molecule is 100% complementary to a target sequence described herein.
  • the sequence of the polynucleic acid molecule has 5 or less mismatches to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule has 4 or less mismatches to a target sequence described herein. In some instances, the sequence of the polynucleic acid molecule may has 3 or less mismatches to a target sequence described herein. In some cases, the sequence of the polynucleic acid molecule may has 2 or less mismatches to a target sequence described herein. In some cases, the sequence of the polynucleic acid molecule may has 1 or less mismatches to a target sequence described herein.
  • the specificity of the polynucleic acid molecule that hybridizes to a target sequence described herein is a 95%, 98%, 99%, 99.5%, or 100% sequence complementarity of the polynucleic acid molecule to a target sequence.
  • the hybridization is a high stringent hybridization condition.
  • the polynucleic acid molecule hybridizes to at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 8 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 9 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 10 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 11 contiguous bases of a target sequence described herein.
  • the polynucleic acid molecule hybridizes to at least 12 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 13 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 14 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 15 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 16 contiguous bases of a target sequence described herein.
  • the polynucleic acid molecule hybridizes to at least 17 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 18 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 19 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 20 contiguous bases of a target sequence described herein.
  • the polynucleic acid molecule has reduced off-target effect.
  • off-target or “off-target effects” refer to any instance in which a polynucleic acid polymer directed against a given target causes an unintended effect by interacting either directly or indirectly with another mRNA sequence, a DNA sequence or a cellular protein or other moiety.
  • an “off-target effect” occurs when there is a simultaneous degradation of other transcripts due to partial homology or complementarity between that other transcript and the sense and/or antisense strand of the polynucleic acid molecule.
  • the polynucleic acid molecule comprises natural, synthetic, or artificial nucleotide analogues or bases. In some cases, the polynucleic acid molecule comprises combinations of DNA, RNA and/or nucleotide analogues. In some instances, the synthetic or artificial nucleotide analogues or bases comprise modifications at one or more of ribose moiety, phosphate moiety, nucleoside moiety, or a combination thereof.
  • a nucleotide analogue or artificial nucleotide base described above comprises a nucleic acid with a modification at a 2′ hydroxyl group of the ribose moiety.
  • the modification includes an H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety.
  • Exemplary alkyl moiety includes, but is not limited to, halogens, sulfurs, thiols, thioethers, thioesters, amines (primary, secondary, or tertiary), amides, ethers, esters, alcohols and oxygen.
  • the alkyl moiety further comprises a modification.
  • the modification comprises an azo group, a keto group, an aldehyde group, a carboxyl group, a nitro group, a nitroso, group, a nitrile group, a heterocycle (e.g., imidazole, hydrazino or hydroxylamino) group, an isocyanate or cyanate group, or a sulfur containing group (e.g., sulfoxide, sulfone, sulfide, or disulfide).
  • the alkyl moiety further comprises a hetero substitution.
  • the carbon of the heterocyclic group is substituted by a nitrogen, oxygen or sulfur.
  • the heterocyclic substitution includes but is not limited to, morpholino, imidazole, and pyrrolidino.
  • the modification at the 2′ hydroxyl group is a 2′-O-methyl modification or a 2′-O-methoxyethyl (2′-O-MOE) modification.
  • the 2′-O-methyl modification adds a methyl group to the 2′ hydroxyl group of the ribose moiety whereas the 2′O-methoxyethyl modification adds a methoxyethyl group to the 2′ hydroxyl group of the ribose moiety.
  • Exemplary chemical structures of a 2′-O-methyl modification of an adenosine molecule and 2′O-methoxyethyl modification of an uridine are illustrated below.
  • the modification at the 2′ hydroxyl group is a 2′-O-aminopropyl modification in which an extended amine group comprising a propyl linker binds the amine group to the 2′ oxygen.
  • this modification neutralizes the phosphate-derived overall negative charge of the oligonucleotide molecule by introducing one positive charge from the amine group per sugar and thereby improves cellular uptake properties due to its zwitterionic properties.
  • An exemplary chemical structure of a 2′-O-aminopropyl nucleoside phosphoramidite is illustrated below.
  • the modification at the 2′ hydroxyl group is a locked or bridged ribose modification (e.g., locked nucleic acid or LNA) in which the oxygen molecule bound at the 2′ carbon is linked to the 4′ carbon by a methylene group, thus forming a 2′-C,4′-C-oxy-methylene-linked bicyclic ribonucleotide monomer.
  • LNA locked nucleic acid
  • Exemplary representations of the chemical structure of LNA are illustrated below. The representation shown to the left highlights the chemical connectivities of an LNA monomer. The representation shown to the right highlights the locked 3′-endo ( 3 E) conformation of the furanose ring of an LNA monomer.
  • the modification at the 2′ hydroxyl group comprises ethylene nucleic acids (ENA) such as for example 2′-4′-ethylene-bridged nucleic acid, which locks the sugar conformation into a C 3 ′-endo sugar puckering conformation.
  • ENA ethylene nucleic acids
  • the bridged nucleic acids class of modified nucleic acids that also comprises LNA. Exemplary chemical structures of the ENA and bridged nucleic acids are illustrated below.
  • additional modifications at the 2′ hydroxyl group include 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA).
  • a nucleotide analogue comprises a modified base such as, but not limited to, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N,-dimethyladenine, 2-propyladenine, 2propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides having a modification at the 5 position, 5-(2-amino) propyl uridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2, 2-dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, deazanucleotides (such as 7-deaza-
  • Modified nucleotides also include those nucleotides that are modified with respect to the sugar moiety, as well as nucleotides having sugars or analogs thereof that are not ribosyl.
  • the sugar moieties in some cases are or are based on, mannoses, arabinoses, glucopyranoses, galactopyranoses, 4′-thioribose, and other sugars, heterocycles, or carbocycles.
  • the term nucleotide also includes what are known in the art as universal bases.
  • universal bases include but are not limited to 3-nitropyrrole, 5-nitroindole, or nebularine.
  • a nucleotide analogue further comprises a morpholino, a peptide nucleic acid (PNA), a methylphosphonate nucleotide, a thiolphosphonate nucleotide, a 2′-fluoro N3-P5′-phosphoramidite, or a 1′, 5′-anhydrohexitol nucleic acid (HNA).
  • PNA peptide nucleic acid
  • HNA 2′-fluoro N3-P5′-phosphoramidite
  • HNA 1′, 5′-anhydrohexitol nucleic acid
  • Morpholino or phosphorodiamidate morpholino oligo comprises synthetic molecules whose structure mimics natural nucleic acid structure but deviates from the normal sugar and phosphate structures.
  • the five member ribose ring is substituted with a six member morpholino ring containing four carbons, one nitrogen, and one oxygen.
  • the ribose monomers are linked by a phosphordiamidate group instead of a phosphate group.
  • the backbone alterations remove all positive and negative charges making morpholinos neutral molecules capable of crossing cellular membranes without the aid of cellular delivery agents such as those used by charged oligonucleotides.
  • a morpholino or PMO described above is a PMO comprising a positive or cationic charge.
  • the PMO is PMOplus (Sarepta).
  • PMOplus refers to phosphorodiamidate morpholino oligomers comprising any number of (1-piperazino)phosphinylideneoxy, (1-(4-(omega-guanidino-alkanoyl))-piperazino)phosphinylideneoxy linkages (e.g., as such those described in PCT Publication No. WO2008/036127.
  • the PMO is a PMO described in U.S. Pat. No. 7,943,762.
  • a morpholino or PMO described above is a PMO-X (Sarepta).
  • PMO-X refers to phosphorodiamidate morpholino oligomers comprising at least one linkage or at least one of the disclosed terminal modifications, such as those disclosed in PCT Publication No. WO2011/150408 and U.S. Publication No. 2012/0065169.
  • a morpholino or PMO described above is a PMO as described in Table 5 of U.S. Publication No. 2014/0296321.
  • peptide nucleic acid does not contain sugar ring or phosphate linkage and the bases are attached and appropriately spaced by oligoglycine-like molecules, therefore, eliminating a backbone charge.
  • modified internucleotide linkage includes, but is not limited to, phosphorothioates; phosphorodithioates; methylphosphonates; 5′-alkylenephosphonates; 5′-methylphosphonate; 3′-alkylene phosphonates; borontrifluoridates; borano phosphate esters and selenophosphates of 3′-5′linkage or 2′-5′linkage; phosphotriesters; thionoalkylphosphotriesters; hydrogen phosphonate linkages; alkyl phosphonates; alkylphosphonothioates; arylphosphonothioates; phosphoroselenoates; phosphorodiselenoates; phosphinates; phosphoramidates; 3′-alkylphosphoramidates; aminoalkylphosphoramidates; thionophosphoramidates; phosphoropipera
  • the modification is a methyl or thiol modification such as methylphosphonate or thiolphosphonate modification.
  • exemplary thiolphosphonate nucleotide (left) and methylphosphonate nucleotide (right) are illustrated below.
  • a modified nucleotide includes, but is not limited to, 2′-fluoro N3-P5′-phosphoramidites illustrated as:
  • a modified nucleotide includes, but is not limited to, hexitol nucleic acid (or 1′, 5′-anhydrohexitol nucleic acids (HNA)) illustrated as:
  • one or more modifications comprise a modified phosphate backbone in which the modification generates a neutral or uncharged backbone.
  • the phosphate backbone is modified by alkylation to generate an uncharged or neutral phosphate backbone.
  • alkylation includes methylation, ethylation, and propylation.
  • an alkyl group refers to a linear or branched saturated hydrocarbon group containing from 1 to 6 carbon atoms.
  • exemplary alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, hexyl, isohexyl, 1, 1-dimethylbutyl, 2,2-dimethylbutyl, 3.3-dimethylbutyl, and 2-ethylbutyl groups.
  • a modified phosphate is a phosphate group as described in U.S. Pat. No. 9,481,905.
  • additional modified phosphate backbones comprise methylphosphonate, ethylphosphonate, methylthiophosphonate, or methoxyphosphonate.
  • the modified phosphate is methylphosphonate.
  • the modified phosphate is ethylphosphonate.
  • the modified phosphate is methylthiophosphonate.
  • the modified phosphate is methoxyphosphonate.
  • one or more modifications further optionally include modifications of the ribose moiety, phosphate backbone and the nucleoside, or modifications of the nucleotide analogues at the 3′ or the 5′ terminus.
  • the 3′ terminus optionally include a 3′ cationic group, or by inverting the nucleoside at the 3′-terminus with a 3′-3′ linkage.
  • the 3′-terminus is optionally conjugated with an aminoalkyl group, e.g., a 3′ C5-aminoalkyl dT.
  • the 3′-terminus is optionally conjugated with an abasic site, e.g., with an apurinic or apyrimidinic site.
  • the 5′-terminus is conjugated with an aminoalkyl group, e.g., a 5-O-alkylamino substituent.
  • the 5′-terminus is conjugated with an abasic site. e.g., with an apurinic or apyrimidinic site.
  • the polynucleic acid molecule comprises one or more of the artificial nucleotide analogues described herein. In some instances, the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of the artificial nucleotide analogues described herein.
  • the artificial nucleotide analogues include 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2′-fluoro N3-P5′-phosphoramidites, or a combination thereof.
  • the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of the artificial nucleotide analogues selected from 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphor,
  • the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of 2′-O-methyl modified nucleotides. In some instances, the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of 2′-O-methoxyethyl (2′-O-MOE) modified nucleotides. In some instances, the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of thiolphosphonate nucleotides.
  • the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, or more modifications.
  • the polynucleic acid molecule is a polynucleic acid molecule of SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.
  • the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, or more modified nucleotides.
  • the polynucleic acid molecule is a polynucleic acid molecule of SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.
  • the polynucleic acid molecule comprises at least one of: from about 5% to about 100% modification, from about 10% to about 100% modification, from about 20% to about 100% modification, from about 30% to about 100% modification, from about 40% to about 100% modification, from about 50% to about 100% modification, from about 60% to about 100% modification, from about 70% to about 100% modification, from about 80% to about 100% modification, and from about 90% to about 100% modification.
  • the polynucleic acid molecule is a polynucleic acid molecule of SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.
  • polynucleic acid molecule comprises the artificial nucleotide analogues described herein. In some instances, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the polynucleic acid molecule comprise the artificial nucleotide analogues described herein.
  • a polynucleic acid molecule of SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117 comprise the artificial nucleotide analogues described herein.
  • a polynucleic acid molecule of SEQ ID NOs: 16-45 comprise the artificial nucleotide analogues described herein.
  • about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of a polynucleic acid molecule of SEQ ID NOs: 452-1203 comprise the artificial nucleotide analogues described herein.
  • about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of a polynucleic acid molecule of SEQ ID NOs: 1956-1962 comprise the artificial nucleotide analogues described herein.
  • about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of a polynucleic acid molecule of SEQ ID NOs: 1967-2002 comprise the artificial nucleotide analogues described herein.
  • a polynucleic acid molecule of SEQ ID NOs: 2013-2032 comprise the artificial nucleotide analogues described herein.
  • about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of a polynucleic acid molecule of SEQ ID NOs: 2013-2032 comprise the artificial nucleotide analogues described herein.
  • about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of a polynucleic acid molecule of SEQ ID NOs: 2082-2109 or 2117 comprise the artificial nucleotide analogues described herein.
  • the artificial nucleotide analogues include 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2′-fluoro N3-P5′-phosphoramidites, or a combination thereof.
  • the polynucleic acid molecule that comprises an artificial nucleotide analogue comprises SEQ ID NOs: 46-75. In some instances, the polynucleic acid molecule that comprises an artificial nucleotide analogue comprises SEQ ID NOs: 1204-1955. In some instances, the polynucleic acid molecule that comprises an artificial nucleotide analogue comprises SEQ ID NOs: 1967-2002. In some instances, the polynucleic acid molecule that comprises an artificial nucleotide analogue comprises SEQ ID NOs: 2013-2032. In some instances, the polynucleic acid molecule that comprises an artificial nucleotide analogue comprises SEQ ID NOs: 2082-2109 or 2117.
  • one or more of the artificial nucleotide analogues described herein are resistant toward nucleases such as for example ribonuclease such as RNase H, deoxyribunuclease such as DNase, or exonuclease such as 5′-3′ exonuclease and 3′-5′ exonuclease when compared to natural polynucleic acid molecules.
  • nucleases such as for example ribonuclease such as RNase H, deoxyribunuclease such as DNase, or exonuclease such as 5′-3′ exonuclease and 3′-5′ exonuclease when compared to natural polynucleic acid molecules.
  • artificial nucleotide analogues comprising 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2′-fluoro N3-P5′-phosphoramidites, or combinations thereof are resistant toward nu
  • 2′-O-methyl modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • 2′O-methoxyethyl (2′-O-MOE) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • 2′-O-aminopropyl modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • 2′-deoxy modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • T-deoxy-2′-fluoro modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • 2′-O-aminopropyl (2′-O-AP) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • 2′-O-dimethylaminoethyl (2′-O-DMAOE) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • 2′-O-dimethylaminopropyl (2′-O-DMAP) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • 2′-O-N-methylacetamido (2′-O-NMA) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • LNA-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • ENA-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • HNA-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • Morpholinos may be nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • PNA-modified polynucleic acid molecule is resistant to nucleases (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • methylphosphonate nucleotide-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • thiolphosphonate nucleotide-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • polynucleic acid molecule comprising 2′-fluoro N3-P5′-phosphoramidites is nuclease resistant (e.g., RNase H, DNase, 5′-3′ exonuclease or 3′-5′ exonuclease resistant).
  • the 5′ conjugates described herein inhibit 5′-3′ exonucleolytic cleavage.
  • the 3′ conjugates described herein inhibit 3′-5′ exonucleolytic cleavage.
  • one or more of the artificial nucleotide analogues described herein have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • the one or more of the artificial nucleotide analogues comprising 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modified, LNA, ENA, PNA, HNA, morpholino,
  • 2′-O-methyl modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • 2′-O-methoxyethyl (2′-O-MOE) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • 2′-O-aminopropyl modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • 2′-deoxy modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • T-deoxy-2′-fluoro modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • 2′-O-aminopropyl (2′-O-AP) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • 2′-O-dimethylaminoethyl (2′-O-DMAOE) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • 2′-O-dimethylaminopropyl (2′-O-DMAP) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • 2′-O-N-methylacetamido (2′-O-NMA) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • LNA-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • ENA-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • PNA-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • HNA-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • morpholino-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • methylphosphonate nucleotide-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • thiolphosphonate nucleotide-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • polynucleic acid molecule comprising 2′-fluoro N3-P5′-phosphoramidites has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule.
  • the increased affinity is illustrated with a lower Kd, a higher melt temperature (Tm), or a combination thereof.
  • a polynucleic acid molecule described herein is a chirally pure (or stereo pure) polynucleic acid molecule, or a polynucleic acid molecule comprising a single enantiomer.
  • the polynucleic acid molecule comprises L-nucleotide.
  • the polynucleic acid molecule comprises D-nucleotides.
  • a polynucleic acid molecule composition comprises less than 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, or less of its mirror enantiomer.
  • a polynucleic acid molecule composition comprises less than 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, or less of a racemic mixture.
  • the polynucleic acid molecule is a polynucleic acid molecule described in: U.S. Patent Publication Nos: 2014/194610 and 2015/211006; and PCT Publication No.: WO2015107425.
  • a polynucleic acid molecule described herein is further modified to include an aptamer-conjugating moiety.
  • the aptamer conjugating moiety is a DNA aptamer-conjugating moiety.
  • the aptamer-conjugating moiety is Alphamer (Centauri Therapeutics), which comprises an aptamer portion that recognizes a specific cell-surface target and a portion that presents a specific epitopes for attaching to circulating antibodies.
  • a polynucleic acid molecule described herein is further modified to include an aptamer-conjugating moiety as described in: U.S. Pat. Nos. 8,604,184, 8,591,910, and 7,850,975.
  • a polynucleic acid molecule described herein is modified to increase its stability.
  • the polynucleic acid molecule is RNA (e.g., siRNA), the polynucleic acid molecule is modified to increase its stability.
  • the polynucleic acid molecule is modified by one or more of the modifications described above to increase its stability.
  • the polynucleic acid molecule is modified at the 2′ hydroxyl position, such as by 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modification or by a locked or bridged ribose conformation (e.g., LNA or ENA).
  • a locked or bridged ribose conformation e.g., LNA or ENA
  • the polynucleic acid molecule is modified by 2′-O-methyl and/or 2′-O-methoxyethyl ribose. In some cases, the polynucleic acid molecule also includes morpholinos, PNAs, HNA, methylphosphonate nucleotides, thiolphosphonate nucleotides, and/or 2′-fluoro N3-P5′-phosphoramidites to increase its stability. In some instances, the polynucleic acid molecule is a chirally pure (or stereo pure) polynucleic acid molecule. In some instances, the chirally pure (or stereo pure) polynucleic acid molecule is modified to increase its stability. Suitable modifications to the RNA to increase stability for delivery will be apparent to the skilled person.
  • a polynucleic acid molecule described herein has RNAi activity that modulates expression of RNA encoded by a gene described supra.
  • a polynucleic acid molecule described herein is a double-stranded siRNA molecule that down-regulates expression of a gene, wherein one of the strands of the double-stranded siRNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence of the gene or RNA encoded by the gene or a portion thereof, and wherein the second strand of the double-stranded siRNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of the gene or RNA encoded by the gene or a portion thereof.
  • a polynucleic acid molecule described herein is a double-stranded siRNA molecule that down-regulates expression of a gene, wherein each strand of the siRNA molecule comprises about 15 to 25, 18 to 24, or 19 to about 23 nucleotides, and wherein each strand comprises at least about 14, 17, or 19 nucleotides that are complementary to the nucleotides of the other strand.
  • a polynucleic acid molecule described herein is a double-stranded siRNA molecule that down-regulates expression of a gene, wherein each strand of the siRNA molecule comprises about 19 to about 23 nucleotides, and wherein each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand.
  • the gene is KRAS, EGFR, AR, HPRT1, CNNTB1 ( ⁇ -catenin), or ⁇ -catenin associated genes.
  • a polynucleic acid molecule described herein is constructed using chemical synthesis and/or enzymatic ligation reactions using procedures known in the art.
  • a polynucleic acid molecule is chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the polynucleic acid molecule and target nucleic acids.
  • Exemplary methods include those described in: U.S. Pat. Nos. 5,142,047; 5,185,444; 5,889,136; 6,008,400; and 6,111,086; PCT Publication No. WO2009099942; or European Publication No. 1579015.
  • Additional exemplary methods include those described in: Griffey et al., “2′-O-aminopropyl ribonucleotides: a zwitterionic modification that enhances the exonuclease resistance and biological activity of antisense oligonucleotides,” J. Med. Chem. 39(26):5100-5109 (1997)); Obika, et al. “Synthesis of 2′-O,4′-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C3, -endo sugar puckering”. Tetrahedron Letters 38 (50): 8735 (1997); Koizumi, M.
  • the polynucleic acid molecule is produced biologically using an expression vector into which a polynucleic acid molecule has been subcloned in an antisense orientation (i.e RNA transcribed from the inserted polynucleic acid molecule will be of an antisense orientation to a target polynucleic acid molecule of interest).
  • a polynucleic acid molecule is conjugated to a binding moiety.
  • the binding moiety comprises amino acids, peptides, polypeptides, proteins, antibodies, antigens, toxins, hormones, lipids, nucleotides, nucleosides, sugars, carbohydrates, polymers such as polyethylene glycol and polypropylene glycol, as well as analogs or derivatives of all of these classes of substances. Additional examples of binding moiety also include steroids, such as cholesterol, phospholipids, di- and triacylglycerols, fatty acids, hydrocarbons (e.g., saturated, unsaturated, or contains substitutions), enzyme substrates, biotin, digoxigenin, and polysaccharides. In some instances, the binding moiety is an antibody or binding fragment thereof.
  • the polynucleic acid molecule is further conjugated to a polymer, and optionally an endosomolytic moiety.
  • the polynucleic acid molecule is conjugated to the binding moiety by a chemical ligation process. In some instances, the polynucleic acid molecule is conjugated to the binding moiety by a native ligation. In some instances, the conjugation is as described in: Dawson, et al. “Synthesis of proteins by native chemical ligation,” Science 1994, 266, 776-779; Dawson, et al. “Modulation of Reactivity in Native Chemical Ligation through the Use of Thiol Additives,” J. Am. Chem. Soc. 1997, 119, 4325-4329; hackeng, et al. “Protein synthesis by native chemical ligation: Expanded scope by using straightforward methodology,” Proc. Natl.
  • the polynucleic acid molecule is conjugated to the binding moiety either site-specifically or non-specifically via native ligation chemistry.
  • the polynucleic acid molecule is conjugated to the binding moiety by a site-directed method utilizing a “traceless” coupling technology (Philochem).
  • the “traceless” coupling technology utilizes an N-terminal 1,2-aminothiol group on the binding moiety which is then conjugate with a polynucleic acid molecule containing an aldehyde group.
  • the polynucleic acid molecule is conjugated to the binding moiety by a site-directed method utilizing an unnatural amino acid incorporated into the binding moiety.
  • the unnatural amino acid comprises p-acetylphenylalanine (pAcPhe).
  • the keto group of pAcPhe is selectively coupled to an alkoxy-amine derivatived conjugating moiety to form an oxime bond.
  • the polynucleic acid molecule is conjugated to the binding moiety by a site-directed method utilizing an enzyme-catalyzed process.
  • the site-directed method utilizes SMARTagTM technology (Redwood).
  • the SMARTagTM technology comprises generation of a formylglycine (FGly) residue from cysteine by formylglycine-generating enzyme (FGE) through an oxidation process under the presence of an aldehyde tag and the subsequent conjugation of FGly to an alkylhydraine-functionalized polynucleic acid molecule via hydrazino-Pictet-Spengler (HIPS) ligation.
  • FGE formylglycine
  • FGE formylglycine-generating enzyme
  • HIPS hydrazino-Pictet-Spengler
  • the enzyme-catalyzed process comprises microbial transglutaminase (mTG).
  • mTG microbial transglutaminase
  • the polynucleic acid molecule is conjugated to the binding moiety utilizing a microbial transglutaminze catalyzed process.
  • mTG catalyzes the formation of a covalent bond between the amide side chain of a glutamine within the recognition sequence and a primary amine of a functionalized polynucleic acid molecule.
  • mTG is produced from Streptomyces mobarensis. (see Strop et al., “Location matters: site of conjugation modulates stability and pharmacokinetics of antibody drug conjugates,” Chemistry and Biology 20(2) 161-167 (2013))
  • the polynucleic acid molecule is conjugated to the binding moiety by a method as described in PCT Publication No. WO2014/140317, which utilizes a sequence-specific transpeptidase.
  • the polynucleic acid molecule is conjugated to the binding moiety by a method as described in U.S. Patent Publication Nos. 2015/0105539 and 2015/0105540.
  • the binding moiety A is a polypeptide.
  • the polypeptide is an antibody or its fragment thereof.
  • the fragment is a binding fragment.
  • the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, murine antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab′, divalent Fab 2 , F(ab)′ 3 fragments, single-chain variable fragment (scFv), bis-scFv, (scFv) 2 , diabody, minibody, nanobody, triabody, tetrabody, disulfide stabilized Fv protein (dsFv), single-domain antibody (sdAb), Ig NAR, camelid antibody or binding fragment thereof, bispecific antibody or biding fragment thereof, or a chemically modified derivative thereof.
  • A is an antibody or binding fragment thereof.
  • A is a humanized antibody or binding fragment thereof, murine antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab′, divalent Fab 2 , F(ab)′ 3 fragments, single-chain variable fragment (scFv), bis-scFv, (scFv) 2 , diabody, minibody, nanobody, triabody, tetrabody, disulfide stabilized Fv protein (“dsFv”), single-domain antibody (sdAb), Ig NAR, camelid antibody or binding fragment thereof, bispecific antibody or biding fragment thereof, or a chemically modified derivative thereof.
  • dsFv single-domain antibody
  • sdAb single-domain antibody
  • Ig NAR camelid antibody or binding fragment thereof, bispecific antibody or biding fragment thereof, or a chemically modified derivative thereof.
  • A is a humanized antibody or binding fragment thereof. In some instances, A is a murine antibody or binding fragment thereof. In some instances, A is a chimeric antibody or binding fragment thereof. In some instances, A is a monoclonal antibody or binding fragment thereof. In some instances, A is a monovalent Fab′. In some instances, A is a diavalent Fab 2 . In some instances, A is a single-chain variable fragment (scFv).
  • the binding moiety A is a bispecific antibody or binding fragment thereof.
  • the bispecific antibody is a trifunctional antibody or a bispecific mini-antibody.
  • the bispecific antibody is a trifunctional antibody.
  • the trifunctional antibody is a full length monoclonal antibody comprising binding sites for two different antigens.
  • Exemplary trifunctional antibodies include catumaxomab (which targets EpCAM and CD3; Fresenius Biotech/Trion Pharma), ertumaxomab (targets HER2/neu/CD3; Fresenius Biotech/Trion Pharma), lymphomun FBTA05 (targets CD20/CD3; Fresenius Biotech/Trion Pharma), RG7221 (R05520985; targets Angiopoietin 2/VEGF; Roche), RG7597 (targets Her1/Her3; Genentech/Roche), MM141 (targets IGF1R/Her3; Merrimack), ABT122 (targets TNF ⁇ /IL17; Abbvie), ABT981 (targets IL1 ⁇ /IL1 ⁇ ; Abbott), LY3164530 (targets Her1/cMET; Eli Lilly), and TRBS07 (Ektomab; targets GD2/CD3; Trion Research Gmbh).
  • catumaxomab which targets EpCAM and CD3; Frese
  • A is a bispecific trifunctional antibody.
  • A is a bispecific trifunctional antibody selected from: catumaxomab (which targets EpCAM and CD3; Fresenius Biotech/Trion Pharma), ertumaxomab (targets HER2/neu/CD3; Fresenius Biotech/Trion Pharma), lymphomun FBTA05 (targets CD20/CD3; Fresenius Biotech/Trion Pharma), RG7221 (R05520985; targets Angiopoietin 2/VEGF; Roche), RG7597 (targets Her1l/Her3; Genentech/Roche), MM141 (targets IGF1R/Her3; Merrimack), ABT122 (targets TNF ⁇ /IL17; Abbvie), ABT981 (targets ILla/IL1(3; Abbott), LY3164530 (targets Her1l/cMET; Eli Lilly),
  • the bispecific antibody is a bispecific mini-antibody.
  • the bispecific mini-antibody comprises divalent Fab 2 , F(ab)′ 3 fragments, bis-scFv, (scFv) 2 , diabody, minibody, triabody, tetrabody or a bi-specific T-cell engager (BiTE).
  • the bi-specific T-cell engager is a fusion protein that contains two single-chain variable fragments (scFvs) in which the two scFvs target epitopes of two different antigens.
  • Exemplary bispecific mini-antibodies include, but are not limited to, DART (dual-affinity re-targeting platform; MacroGenics), blinatumomab (MT103 or AMG103; which targets CD19/CD3; Micromet), MT111 (targets CEA/CD3; Micromet/Amegen), MT112 (BAY2010112; targets PSMA/CD3; Micromet/Bayer), MT110 (AMG 110; targets EPCAM/CD3; Amgen/Micromet), MGD006 (targets CD123/CD3; MacroGenics), MGD007 (targets GPA33/CD3; MacroGenics), BI1034020 (targets two different epitopes on ⁇ -amyloid; Ablynx), ALX0761 (targets IL17A/IL17F; Ablynx), TF2 (targets CEA/hepten; Immunomedics), IL-17/IL-34 biAb (BMS), AFM13 (
  • the binding moiety A is a bispecific mini-antibody.
  • A is a bispecific Fab 2 .
  • A is a bispecific F(ab)′ 3 fragment.
  • A is a bispecific bis-scFv.
  • A is a bispecific (scFv) 2 .
  • A is a bispecific diabody.
  • A is a bispecific minibody.
  • A is a bispecific triabody.
  • A is a bispecific tetrabody.
  • A is a bi-specific T-cell engager (BiTE).
  • A is a bispecific mini-antibody selected from: DART (dual-affinity re-targeting platform; MacroGenics), blinatumomab (MT103 or AMG103; which targets CD19/CD3; Micromet), MT111 (targets CEA/CD3; Micromet/Amegen), MT112 (BAY2010112; targets PSMA/CD3; Micromet/Bayer), MT110 (AMG 110; targets EPCAM/CD3; Amgen/Micromet), MGD006 (targets CD123/CD3; MacroGenics), MGD007 (targets GPA33/CD3; MacroGenics), BI1034020 (targets two different epitopes on ⁇ -amyloid; Ablynx), ALX0761 (targets IL17A/IL17F; Ablynx), TF2 (targets CEA/hepten; Immunomedics), IL-17/IL-34 biAb (BMS), AFM13 (dual-affin
  • the binding moiety A is a trispecific antibody.
  • the trispecific antibody comprises F(ab)′ 3 fragments or a triabody.
  • A is a trispecific F(ab)′ 3 fragment.
  • A is a triabody.
  • A is a trispecific antibody as described in Dimas, et al., “Development of a trispecific antibody designed to simultaneously and efficiently target three different antigens on tumor cells,” Mol. Pharmaceutics, 12(9): 3490-3501 (2015).
  • the binding moiety A is an antibody or binding fragment thereof that recognizes a cell surface protein.
  • the cell surface protein is an antigen expressed by a cancerous cell.
  • cancer antigens include, but are not limited to, alpha fetoprotein, ASLG659, B7-H3, BAFF-R, Brevican, CA125 (MUC16), CA15-3, CA19-9, carcinoembryonic antigen (CEA), CA242, CRIPTO (CR, CR1, CRGF, CRIPTO, TDGF1, teratocarcinoma-derived growth factor), CTLA-4, CXCR5, E16 (LAT1, SLC7A5), FcRH2 (IFGP4, IRTA4, SPAP1A (SH2 domain containing phosphatase anchor protein 1a), SPAP1B, SPAP1C), epidermal growth factor, ETBR, Fc receptor-like protein 1 (FCRH1), GEDA, HLA-DOB (Beta subunit of MHC class
  • the cell surface protein comprises clusters of differentiation (CD) cell surface markers.
  • CD cell surface markers include, but are not limited to, CD1, CD2, CD3, CD4, CD5, CD6, CD7, CD8, CD9, CD10, CD11a, CD11b, CD11c, CD11d, CDw12, CD13, CD14, CD15, CD15s, CD16, CDw17, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42, CD43, CD44, CD45, CD45RO, CD45RA, CD45RB, CD46, CD47, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59
  • the binding moiety A is an antibody or binding fragment thereof that recognizes a cancer antigen. In some instances, the binding moiety A is an antibody or binding fragment thereof that recognizes alpha fetoprotein, ASLG659, B7-H3, BAFF-R, Brevican, CA125 (MUC16), CA15-3, CA19-9, carcinoembryonic antigen (CEA), CA242, CRIPTO (CR, CR1, CRGF, CRIPTO, TDGF1, teratocarcinoma-derived growth factor), CTLA-4, CXCR5, E16 (LAT1, SLC7A5), FcRH2 (IFGP4, IRTA4, SPAP1A (SH2 domain containing phosphatase anchor protein 1a), SPAP1B, SPAP1C), epidermal growth factor, ETBR, Fc receptor-like protein 1 (FCRH1), GEDA, HLA-DOB (Beta subunit of MHC class II molecule (Ia antigen), human chorionic gonado
  • the binding moiety A is an antibody or binding fragment thereof that recognizes a CD cell surface marker. In some instances, the binding moiety A is an antibody or binding fragment thereof that recognizes CD1, CD2, CD3, CD4, CD5, CD6, CD7, CD8, CD9, CD10, CD11a, CD11b, CD11c, CD11d, CDw12, CD13, CD14, CD15, CD15s, CD16, CDw17, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42, CD43, CD44, CD45, CD45RO, CD45RA, CD45RB, CD46, CD47, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55,
  • the antibody or binding fragment thereof comprises zalutumumab (HuMax-EFGr, Genmab), abagovomab (Menarini), abituzumab (Merck), adecatumumab (MT201), alacizumab pegol, alemtuzumab (Campath®, MabCampath, or Campath-1H; Leukosite), AlloMune (BioTransplant), amatuximab (Morphotek, Inc.), anti-VEGF (Genetech), anatumomab mafenatox, apolizumab (hu1D10), ascrinvacumab (Pfizer Inc.), atezolizumab (MPDL3280A; Genentech/Roche), B43.13 (OvaRex, AltaRex Corporation), basiliximab (Simulect®, Novartis), belimumab (Benlysta®, GlaxoSmithKline), be
  • the binding moiety A comprises zalutumumab (HuMax-EFGr, Genmab), abagovomab (Menarini), abituzumab (Merck), adecatumumab (MT201), alacizumab pegol, alemtuzumab (Campath®, MabCampath, or Campath-1H; Leukosite), AlloMune (BioTransplant), amatuximab (Morphotek, Inc.), anti-VEGF (Genetech), anatumomab mafenatox, apolizumab (hu1D10), ascrinvacumab (Pfizer Inc.), atezolizumab (MPDL3280A; Genentech/Roche), B43.13 (OvaRex, AltaRex Corporation), basiliximab (Simulect®, Novartis), belimumab (Benlysta®, GlaxoSmithKline), bevac
  • the binding moiety A is conjugated according to Formula (I) to a polynucleic acid molecule (B), and a polymer (C), and optionally an endosomolytic moiety (D) according to Formula (II) described herein.
  • the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Tables 2, 3, 5, 6, 7, 9, or 11.
  • the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.
  • the polynucleic acid molecule comprises a sequence selected from SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.
  • the polymer C comprises polyalkylen oxide (e.g., polyethylene glycol).
  • the endosomolytic moiety D comprises INF7 or melittin, or their respective derivatives.
  • the binding moiety A is conjugated to a polynucleic acid molecule (B), and a polymer (C), and optionally an endosomolytic moiety (D) as illustrated in FIG. 1 .
  • the binding moiety A is an antibody or binding fragment thereof.
  • the binding moiety A is conjugated to a polynucleic acid molecule (B) non-specifically. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) via a lysine residue or a cysteine residue, in a non-site specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) via a lysine residue in a non-site specific manner. In some cases, the binding moiety A is conjugated to a polynucleic acid molecule (B) via a cysteine residue in a non-site specific manner. In some instances, the binding moiety A is an antibody or binding fragment thereof.
  • the binding moiety A is conjugated to a polynucleic acid molecule (B) in a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) through a lysine residue, a cysteine residue, at the 5′-terminus, at the 3′-terminus, an unnatural amino acid, or an enzyme-modified or enzyme-catalyzed residue, via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) through a lysine residue via a site-specific manner.
  • the binding moiety A is conjugated to a polynucleic acid molecule (B) through a cysteine residue via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) at the 5′-terminus via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) at the 3′-terminus via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) through an unnatural amino acid via a site-specific manner.
  • the binding moiety A is conjugated to a polynucleic acid molecule (B) through an enzyme-modified or enzyme-catalyzed residue via a site-specific manner. In some instances, the binding moiety A is an antibody or binding fragment thereof.
  • one or more regions of a binding moiety A is conjugated to a polynucleic acid molecule (B).
  • the one or more regions of a binding moiety A comprise the N-terminus, the C-terminus, in the constant region, at the hinge region, or the Fc region of the binding moiety A.
  • the polynucleic acid molecule (B) is conjugated to the N-terminus of the binding moiety A (e.g., the N-terminus of an antibody or binding fragment thereof).
  • the polynucleic acid molecule (B) is conjugated to the C-terminus of the binding moiety A (e.g., the N-terminus of an antibody or binding fragment thereof). In some instances, the polynucleic acid molecule (B) is conjugated to the constant region of the binding moiety A (e.g., the constant region of an antibody or binding fragment thereof). In some instances, the polynucleic acid molecule (B) is conjugated to the hinge region of the binding moiety A (e.g., the constant region of an antibody or binding fragment thereof). In some instances, the polynucleic acid molecule (B) is conjugated to the Fc region of the binding moiety A (e.g., the constant region of an antibody or binding fragment thereof).
  • one or more polynucleic acid molecule (B) is conjugated to a binding moiety A.
  • about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more polynucleic acid molecules are conjugated to one binding moiety A.
  • about 1 polynucleic acid molecule is conjugated to one binding moiety A.
  • about 2 polynucleic acid molecules are conjugated to one binding moiety A.
  • about 3 polynucleic acid molecules are conjugated to one binding moiety A.
  • about 4 polynucleic acid molecules are conjugated to one binding moiety A.
  • about 5 polynucleic acid molecules are conjugated to one binding moiety A.
  • about 6 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 7 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 8 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 9 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 10 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 11 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 12 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 13 polynucleic acid molecules are conjugated to one binding moiety A.
  • polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 15 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 16 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, the one or more polynucleic acid molecules are the same. In other cases, the one or more polynucleic acid molecules are different. In some instances, the binding moiety A is an antibody or binding fragment thereof.
  • the number of polynucleic acid molecule (B) conjugated to a binding moiety A forms a ratio.
  • the ratio is referred to as a DAR (drug-to-antibody) ratio, in which the drug as referred to herein is the polynucleic acid molecule (B).
  • the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1 or greater.
  • the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 2 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 3 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 4 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 5 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 6 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 7 or greater.
  • the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 8 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 9 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 10 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 11 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 12 or greater.
  • the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 2. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 3. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 4.
  • the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 5. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 6. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 7. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 8. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 9. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 10.
  • the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 11. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 12. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 13. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 14. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 15. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 16.
  • the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 1. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 2. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 4. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 6. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 8. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 12.
  • an antibody or its binding fragment is further modified using conventional techniques known in the art, for example, by using amino acid deletion, insertion, substitution, addition, and/or by recombination and/or any other modification (e.g. posttranslational and chemical modifications, such as glycosylation and phosphorylation) known in the art either alone or in combination.
  • the modification further comprises a modification for modulating interaction with Fc receptors.
  • the one or more modifications include those described in, for example, International Publication No. WO97/34631, which discloses amino acid residues involved in the interaction between the Fc domain and the FcRn receptor. Methods for introducing such modifications in the nucleic acid sequence underlying the amino acid sequence of an antibody or its binding fragment is well known to the person skilled in the art.
  • an antibody binding fragment further encompasses its derivatives and includes polypeptide sequences containing at least one CDR.
  • single-chain as used herein means that the first and second domains of a bi-specific single chain construct are covalently linked, preferably in the form of a co-linear amino acid sequence encodable by a single nucleic acid molecule.
  • a bispecific single chain antibody construct relates to a construct comprising two antibody derived binding domains.
  • bi-specific single chain antibody construct is tandem bi-scFv or diabody.
  • a scFv contains a VH and VL domain connected by a linker peptide.
  • linkers are of a length and sequence sufficient to ensure that each of the first and second domains can, independently from one another, retain their differential binding specificities.
  • binding to or interacting with as used herein defines a binding/interaction of at least two antigen-interaction-sites with each other.
  • antigen-interaction-site defines a motif of a polypeptide that shows the capacity of specific interaction with a specific antigen or a specific group of antigens.
  • the binding/interaction is also understood to define a specific recognition.
  • specific recognition refers to that the antibody or its binding fragment is capable of specifically interacting with and/or binding to at least two amino acids of each of a target molecule.
  • specific recognition relates to the specificity of the antibody molecule, or to its ability to discriminate between the specific regions of a target molecule.
  • the specific interaction of the antigen-interaction-site with its specific antigen results in an initiation of a signal, e.g. due to the induction of a change of the conformation of the antigen, an oligomerization of the antigen, etc.
  • the binding is exemplified by the specificity of a “key-lock-principle”.
  • specific motifs in the amino acid sequence of the antigen-interaction-site and the antigen bind to each other as a result of their primary, secondary or tertiary structure as well as the result of secondary modifications of said structure.
  • the specific interaction of the antigen-interaction-site with its specific antigen results as well in a simple binding of the site to the antigen.
  • specific interaction further refers to a reduced cross-reactivity of the antibody or its binding fragment or a reduced off-target effect.
  • the antibody or its binding fragment that bind to the polypeptide/protein of interest but do not or do not essentially bind to any of the other polypeptides are considered as specific for the polypeptide/protein of interest.
  • Examples for the specific interaction of an antigen-interaction-site with a specific antigen comprise the specificity of a ligand for its receptor, for example, the interaction of an antigenic determinant (epitope) with the antigenic binding site of an antibody.
  • the binding moiety is a plasma protein.
  • the plasma protein comprises albumin.
  • the binding moiety A is albumin.
  • albumin is conjugated by one or more of a conjugation chemistry described herein to a polynucleic acid molecule.
  • albumin is conjugated by native ligation chemistry to a polynucleic acid molecule.
  • albumin is conjugated by lysine conjugation to a polynucleic acid molecule.
  • the binding moiety is a steroid.
  • steroids include cholesterol, phospholipids, di- and triacylglycerols, fatty acids, hydrocarbons that are saturated, unsaturated, comprise substitutions, or combinations thereof.
  • the steroid is cholesterol.
  • the binding moiety is cholesterol.
  • cholesterol is conjugated by one or more of a conjugation chemistry described herein to a polynucleic acid molecule.
  • cholesterol is conjugated by native ligation chemistry to a polynucleic acid molecule.
  • cholesterol is conjugated by lysine conjugation to a polynucleic acid molecule.
  • the binding moiety is a polymer, including but not limited to poly nucleic acid molecule aptamers that bind to specific surface markers on cells.
  • the binding moiety is a polynucleic acid that does not hybridize to a target gene or mRNA, but instead is capable of selectively binding to a cell surface marker similarly to an antibody binding to its specific epitope of a cell surface marker.
  • the binding moiety is a peptide. In some cases, the peptide comprises between about 1 and about 3 kDa. In some cases, the peptide comprises between about 1.2 and about 2.8 kDa, about 1.5 and about 2.5 kDa, or about 1.5 and about 2 kDa. In some instances, the peptide is a bicyclic peptide. In some cases, the bicyclic peptide is a constrained bicyclic peptide. In some instances, the binding moiety is a bicyclic peptide (e.g., bicycles from Bicycle Therapeutics).
  • the binding moiety is a small molecule.
  • the small molecule is an antibody-recruiting small molecule.
  • the antibody-recruiting small molecule comprises a target-binding terminus and an antibody-binding terminus, in which the target-binding terminus is capable of recognizing and interacting with a cell surface receptor.
  • the target-binding terminus comprising a glutamate urea compound enables interaction with PSMA, thereby, enhances an antibody interaction with a cell (e.g., a cancerous cell) that expresses PSMA.
  • a binding moiety is a small molecule described in Zhang et al., “A remote arene-binding site on prostate specific membrane antigen revealed by antibody-recruiting small molecules,” J Am Chem Soc. 132(36): 12711-12716 (2010); or McEnaney, et al., “Antibody-recruiting molecules: an emerging paradigm for engaging immune function in treating human disease,” ACS Chem Biol. 7(7): 1139-1151 (2012).
  • polypeptides described herein are produced using any method known in the art to be useful for the synthesis of polypeptides (e.g., antibodies), in particular, by chemical synthesis or by recombinant expression, and are preferably produced by recombinant expression techniques.
  • an antibody or its binding fragment thereof is expressed recombinantly, and the nucleic acid encoding the antibody or its binding fragment is assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., 1994 , Bio Techniques 17:242), which involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligation of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.
  • chemically synthesized oligonucleotides e.g., as described in Kutmeier et al., 1994 , Bio Techniques 17:242
  • a nucleic acid molecule encoding an antibody is optionally generated from a suitable source (e.g., an antibody cDNA library, or cDNA library generated from any tissue or cells expressing the immunoglobulin) by PCR amplification using synthetic primers hybridizable to the 3′ and 5′ ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence.
  • a suitable source e.g., an antibody cDNA library, or cDNA library generated from any tissue or cells expressing the immunoglobulin
  • an antibody or its binding is optionally generated by immunizing an animal, such as a rabbit, to generate polyclonal antibodies or, more preferably, by generating monoclonal antibodies, e.g., as described by Kohler and Milstein (1975 , Nature 256:495-497) or, as described by Kozbor et al. (1983 , Immunology Today 4:72) or Cole et al. (1985 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
  • a clone encoding at least the Fab portion of the antibody is optionally obtained by screening Fab expression libraries (e.g., as described in Huse et al., 1989 , Science 246:1275-1281) for clones of Fab fragments that bind the specific antigen or by screening antibody libraries (See, e.g., Clackson et al., 1991 , Nature 352:624; Hane et al., 1997 Proc. Natl. Acad. Sci. USA 94:4937).
  • chimeric antibodies In some embodiments, techniques developed for the production of “chimeric antibodies” (Morrison et al., 1984 , Proc. Natl. Acad. Sci. 81:851-855; Neuberger et al., 1984 , Nature 312:604-608; Takeda et al., 1985 , Nature 314:452-454) by splicing genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity are used.
  • a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region, e.g., humanized antibodies.
  • single chain antibodies are adapted to produce single chain antibodies.
  • Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide.
  • Techniques for the assembly of functional Fv fragments in E. coli are also optionally used (Skerra et al., 1988 , Science 242:1038-1041).
  • host-expression vector systems is utilized to express an antibody or its binding fragment described herein.
  • host-expression systems represent vehicles by which the coding sequences of the antibody is produced and subsequently purified, but also represent cells that are, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody or its binding fragment in situ.
  • host-expression systems represent vehicles by which the coding sequences of the antibody is produced and subsequently purified, but also represent cells that are, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody or its binding fragment in situ.
  • microorganisms such as bacteria (e.g., E. coli and B.
  • subtilis transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing an antibody or its binding fragment coding sequences; yeast (e.g., Saccharomyces Pichia ) transformed with recombinant yeast expression vectors containing an antibody or its binding fragment coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing an antibody or its binding fragment coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus (CaMV) and tobacco mosaic virus (TMV)) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing an antibody or its binding fragment coding sequences; or mammalian cell systems (e.g., COS, CHO, BH, 293, 293T, 3T3 cells) harboring recombinant expression constructs containing promoters derived promote
  • cell lines that stably express an antibody are optionally engineered.
  • host cells are transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
  • appropriate expression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
  • engineered cells are then allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
  • the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci that in turn are cloned and expanded into cell lines.
  • This method can advantageously be used to engineer cell lines which express the antibody or its binding fragments.
  • a number of selection systems are used, including but not limited to the herpes simplex virus thymidine kinase (Wigler et al., 1977 , Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 192 , Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase (Lowy et al., 1980 , Cell 22:817) genes are employed in tk-, hgprt- or aprt-cells, respectively.
  • antimetabolite resistance are used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., 1980 , Proc. Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981 , Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981 , Proc. Natl. Acad. Sci.
  • any method known in the art for purification of an antibody is used, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins.
  • chromatography e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography
  • centrifugation e.g., centrifugation, differential solubility, or by any other standard technique for the purification of proteins.
  • a polymer moiety C is further conjugated to a polynucleic acid molecule described herein, a binding moiety described herein, or in combinations thereof. In some instances, a polymer moiety C is conjugated a polynucleic acid molecule. In some cases, a polymer moiety C is conjugated to a binding moiety. In other cases, a polymer moiety C is conjugated to a polynucleic acid molecule-binding moiety molecule. In additional cases, a polymer moiety C is conjugated, as illustrated in FIG. 1 , and as discussed under the Therapeutic Molecule Platform section.
  • the polymer moiety C is a natural or synthetic polymer, consisting of long chains of branched or unbranched monomers, and/or cross-linked network of monomers in two or three dimensions.
  • the polymer moiety C includes a polysaccharide, lignin, rubber, or polyalkylen oxide (e.g., polyethylene glycol).
  • the at least one polymer moiety C includes, but is not limited to, alpha-, omega-dihydroxylpolyethyleneglycol, biodegradable lactone-based polymer, e.g.
  • polyacrylic acid polylactide acid (PLA), poly(glycolic acid) (PGA), polypropylene, polystyrene, polyolefin, polyamide, polycyanoacrylate, polyimide, polyethylenterephthalat (PET, PETG), polyethylene terephthalate (PETE), polytetramethylene glycol (PTG), or polyurethane as well as mixtures thereof.
  • a mixture refers to the use of different polymers within the same compound as well as in reference to block copolymers.
  • block copolymers are polymers wherein at least one section of a polymer is build up from monomers of another polymer.
  • the polymer moiety C comprises polyalkylene oxide.
  • the polymer moiety C comprises PEG.
  • the polymer moiety C comprises polyethylene imide (PEI) or hydroxy ethyl starch (HES).
  • C is a PEG moiety.
  • the PEG moiety is conjugated at the 5′ terminus of the polynucleic acid molecule while the binding moiety is conjugated at the 3′ terminus of the polynucleic acid molecule.
  • the PEG moiety is conjugated at the 3′ terminus of the polynucleic acid molecule while the binding moiety is conjugated at the 5′ terminus of the polynucleic acid molecule.
  • the PEG moiety is conjugated to an internal site of the polynucleic acid molecule.
  • the PEG moiety, the binding moiety, or a combination thereof are conjugated to an internal site of the polynucleic acid molecule.
  • the conjugation is a direct conjugation. In some instances, the conjugation is via native ligation.
  • the polyalkylene oxide (e.g., PEG) is a polydispers or monodispers compound.
  • polydispers material comprises disperse distribution of different molecular weight of the material, characterized by mean weight (weight average) size and dispersity.
  • the monodisperse PEG comprises one size of molecules.
  • C is poly- or monodispersed polyalkylene oxide (e.g., PEG) and the indicated molecular weight represents an average of the molecular weight of the polyalkylene oxide, e.g., PEG, molecules.
  • the molecular weight of the polyalkylene oxide is about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da.
  • PEG polyalkylene oxide
  • C is polyalkylene oxide (e.g., PEG) and has a molecular weight of about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da.
  • PEG polyalkylene oxide
  • C is PEG and has a molecular weight of about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da. In some instances, the molecular weight of C is about 200 Da.
  • the molecular weight of C is about 300 Da. In some instances, the molecular weight of C is about 400 Da. In some instances, the molecular weight of C is about 500 Da. In some instances, the molecular weight of C is about 600 Da. In some instances, the molecular weight of C is about 700 Da. In some instances, the molecular weight of C is about 800 Da. In some instances, the molecular weight of C is about 900 Da. In some instances, the molecular weight of C is about 1000 Da. In some instances, the molecular weight of C is about 1100 Da. In some instances, the molecular weight of C is about 1200 Da. In some instances, the molecular weight of C is about 1300 Da.
  • the molecular weight of C is about 1400 Da. In some instances, the molecular weight of C is about 1450 Da. In some instances, the molecular weight of C is about 1500 Da. In some instances, the molecular weight of C is about 1600 Da. In some instances, the molecular weight of C is about 1700 Da. In some instances, the molecular weight of C is about 1800 Da. In some instances, the molecular weight of C is about 1900 Da. In some instances, the molecular weight of C is about 2000 Da. In some instances, the molecular weight of C is about 2100 Da. In some instances, the molecular weight of C is about 2200 Da. In some instances, the molecular weight of C is about 2300 Da.
  • the molecular weight of C is about 2400 Da. In some instances, the molecular weight of C is about 2500 Da. In some instances, the molecular weight of C is about 2600 Da. In some instances, the molecular weight of C is about 2700 Da. In some instances, the molecular weight of C is about 2800 Da. In some instances, the molecular weight of C is about 2900 Da. In some instances, the molecular weight of C is about 3000 Da. In some instances, the molecular weight of C is about 3250 Da. In some instances, the molecular weight of C is about 3350 Da. In some instances, the molecular weight of C is about 3500 Da. In some instances, the molecular weight of C is about 3750 Da.
  • the molecular weight of C is about 4000 Da. In some instances, the molecular weight of C is about 4250 Da. In some instances, the molecular weight of C is about 4500 Da. In some instances, the molecular weight of C is about 4600 Da. In some instances, the molecular weight of C is about 4750 Da. In some instances, the molecular weight of C is about 5000 Da. In some instances, the molecular weight of C is about 5500 Da. In some instances, the molecular weight of C is about 6000 Da. In some instances, the molecular weight of C is about 6500 Da. In some instances, the molecular weight of C is about 7000 Da. In some instances, the molecular weight of C is about 7500 Da.
  • the molecular weight of C is about 8000 Da. In some instances, the molecular weight of C is about 10,000 Da. In some instances, the molecular weight of C is about 12,000 Da. In some instances, the molecular weight of C is about 20,000 Da. In some instances, the molecular weight of C is about 35,000 Da. In some instances, the molecular weight of C is about 40,000 Da. In some instances, the molecular weight of C is about 50,000 Da. In some instances, the molecular weight of C is about 60,000 Da. In some instances, the molecular weight of C is about 100,000 Da.
  • the polyalkylene oxide is a discrete PEG, in which the discrete PEG is a polymeric PEG comprising more than one repeating ethylene oxide units.
  • a discrete PEG comprises from 2 to 60, from 2 to 50, or from 2 to 48 repeating ethylene oxide units.
  • a dPEG comprises about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 35, 40, 42, 48, 50 or more repeating ethylene oxide units.
  • a dPEG comprises about 2 or more repeating ethylene oxide units.
  • a dPEG comprises about 3 or more repeating ethylene oxide units.
  • a dPEG comprises about 4 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 5 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 6 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 7 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 8 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 9 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 10 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 11 or more repeating ethylene oxide units.
  • a dPEG comprises about 12 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 13 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 14 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 15 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 16 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 17 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 18 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 19 or more repeating ethylene oxide units.
  • a dPEG comprises about 20 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 22 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 24 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 26 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 28 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 30 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 35 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 40 or more repeating ethylene oxide units.
  • a dPEG comprises about 42 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 48 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 50 or more repeating ethylene oxide units. In some cases, a dPEG is synthesized as a single molecular weight compound from pure (e.g., about 95%, 98%, 99%, or 99.5%) staring material in a step-wise fashion. In some cases, a dPEG has a specific molecular weight, rather than an average molecular weight. In some cases, a dPEG described herein is a dPEG from Quanta Biodesign, LMD.
  • the polymer moiety C comprises a cationic mucic acid-based polymer (cMAP).
  • cMPA comprises one or more subunit of at least one repeating subunit, and the subunit structure is represented as Formula (III):
  • n is independently at each occurrence 1, 2, 3, 4, or 5. In some embodiments, m and n are, for example, about 10.
  • cMAP is further conjugated to a PEG moiety, generating a cMAP-PEG copolymer, an mPEG-cMAP-PEGm triblock polymer, or a cMAP-PEG-cMAP triblock polymer.
  • the PEG moiety is in a range of from about 500 Da to about 50,000 Da.
  • the PEG moiety is in a range of from about 500 Da to about 1000 Da, greater than 1000 Da to about 5000 Da, greater than 5000 Da to about 10,000 Da, greater than 10,000 to about 25,000 Da, greater than 25,000 Da to about 50,000 Da, or any combination of two or more of these ranges.
  • the polymer moiety C is cMAP-PEG copolymer, an mPEG-cMAP-PEGm triblock polymer, or a cMAP-PEG-cMAP triblock polymer. In some cases, the polymer moiety C is cMAP-PEG copolymer. In other cases, the polymer moiety C is an mPEG-cMAP-PEGm triblock polymer. In additional cases, the polymer moiety C is a cMAP-PEG-cMAP triblock polymer.
  • the polymer moiety C is conjugated to the polynucleic acid molecule, the binding moiety, and optionally to the endosomolytic moiety as illustrated in FIG. 1 .
  • a molecule of Formula (I): A-X-B-Y-C further comprises an additional conjugating moiety.
  • the additional conjugating moiety is an endosomolytic moiety.
  • the endosomolytic moiety is a cellular compartmental release component, such as a compound capable of releasing from any of the cellular compartments known in the art, such as the endosome, lysosome, endoplasmic reticulum (ER), golgi apparatus, microtubule, peroxisome, or other vesicular bodies with the cell.
  • the endosomolytic moiety comprises an endosomolytic polypeptide, an endosomolytic polymer, an endosomolytic lipid, or an endosomolytic small molecule. In some cases, the endosomolytic moiety comprises an endosomolytic polypeptide. In other cases, the endosomolytic moiety comprises an endosomolytic polymer.
  • a molecule of Formula (I): A-X-B-Y-C is further conjugated with an endosomolytic polypeptide.
  • the endosomolytic polypeptide is a pH-dependent membrane active peptide.
  • the endosomolytic polypeptide is an amphipathic polypeptide.
  • the endosomolytic polypeptide is a peptidomimetic.
  • the endosomolytic polypeptide comprises INF, melittin, meucin, or their respective derivatives thereof.
  • the endosomolytic polypeptide comprises INF or its derivatives thereof.
  • the endosomolytic polypeptide comprises melittin or its derivatives thereof.
  • the endosomolytic polypeptide comprises meucin or its derivatives thereof.
  • INF7 is a 24 residue polypeptide those sequence comprises CGIFGEIEELIEEGLENLIDWGNA (SEQ ID NO: 2055), or GLFEAIEGFIENGWEGMIDGWYGC (SEQ ID NO: 2056).
  • INF7 or its derivatives comprise a sequence of: GLFEAIEGFIENGWEGMIWDYGSGSCG (SEQ ID NO: 2057), GLFEAIEGFIENGWEGMIDG WYG-(PEG)6-NH2 (SEQ ID NO: 2058), or GLFEAIEGFIENGWEGMIWDYG-SGSC-K(GalNAc)2 (SEQ ID NO: 2059).
  • melittin is a 26 residue polypeptide those sequence comprises CLIGAILKVLATGLPTLISWIKNKRKQ (SEQ ID NO: 2060), or GIGAVLKVLTTGLPALISWIKRKRQQ (SEQ ID NO: 2061). In some instances, melittin comprises a polypeptide sequence as described in U.S. Pat. No. 8,501,930.
  • meucin is an antimicrobial peptide (AMP) derived from the venom gland of the scorpion Mesobuthus eupeus.
  • meucin comprises of meucin-13 those sequence comprises IFGAIAGLLKNIF-NH 2 (SEQ ID NO: 2062) and meucin-18 those sequence comprises FFGHLFKLATKIIPSLFQ (SEQ ID NO: 2063).
  • the endosomolytic polypeptide comprises a polypeptide in which its sequence is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% sequence identity to INF7 or its derivatives thereof, melittin or its derivatives thereof, or meucin or its derivatives thereof.
  • the endosomolytic moiety comprises INF7 or its derivatives thereof, melittin or its derivatives thereof, or meucin or its derivatives thereof.
  • the endosomolytic moiety is INF7 or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2055-2059. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2055.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2056-2059.
  • the endosomolytic moiety comprises SEQ ID NO: 2055.
  • the endosomolytic moiety comprises SEQ ID NO: 2056-2059.
  • the endosomolytic moiety consists of SEQ ID NO: 2055.
  • the endosomolytic moiety consists of SEQ ID NO: 2056-2059.
  • the endosomolytic moiety is melittin or its derivatives thereof.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2060 or 2061.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2060.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2061.
  • the endosomolytic moiety comprises SEQ ID NO: 2060.
  • the endosomolytic moiety comprises SEQ ID NO: 2061.
  • the endosomolytic moiety consists of SEQ ID NO: 2060.
  • the endosomolytic moiety consists of SEQ ID NO: 2061.
  • the endosomolytic moiety is meucin or its derivatives thereof.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2062 or 2063.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2062.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2063.
  • the endosomolytic moiety comprises SEQ ID NO: 2062.
  • the endosomolytic moiety comprises SEQ ID NO: 2063.
  • the endosomolytic moiety consists of SEQ ID NO: 2062.
  • the endosomolytic moiety consists of SEQ ID NO: 2063.
  • the endosomolytic moiety comprises a sequence as illustrated in Table 62.
  • the endosomolytic moiety comprises a Bak BH3 polypeptide which induces apoptosis through antagonization of suppressor targets such as Bcl-2 and/or Bcl-x L .
  • the endosomolytic moiety comprises a Bak BH3 polypeptide described in Albarran, et al., “Efficient intracellular delivery of a pro-apoptotic peptide with a pH-responsive carrier,” Reactive & Functional Polymers 71: 261-265 (2011).
  • the endosomolytic moiety comprises a polypeptide (e.g., a cell-penetrating polypeptide) as described in PCT Publication Nos. WO2013/166155 or WO2015/069587.
  • a molecule of Formula (I): A-X-B-Y-C is further conjugated with an endosomolytic polymer.
  • an endosomolytic polymer comprises a linear, a branched network, a star, a comb, or a ladder type of polymer.
  • an endosomolytic polymer is a homopolymer or a copolymer comprising two ro more different types of monomers.
  • an endosomolytic polymer is a polycation polymer.
  • an endosomolytic polymer is a polyanion polymer.
  • a polycation polymer comprises monomer units that are charge positive, charge neutral, or charge negative, with a net charge being positive.
  • a polycation polymer comprises a non-polymeric molecule that contains two or more positive charges.
  • Exemplary cationic polymers include, but are not limited to, poly(L-lysine) (PLL), poly(L-arginine) (PLA), polyethyleneimine (PEI), poly[ ⁇ -(4-aminobutyl)-L-glycolic acid] (PAGA), 2-(dimethylamino)ethyl methacrylate (DMAEMA), or N,N-Diethylaminoethyl Methacrylate (DEAEMA).
  • a polyanion polymer comprises monomer units that are charge positive, charge neutral, or charge negative, with a net charge being negative.
  • a polyanion polymer comprises a non-polymeric molecule that contains two or more negative charges.
  • Exemplary anionic polymers include p(alkylacrylates) (e.g., poly(propyl acrylic acid) (PPAA)) or poly(N-isopropylacrylamide) (NIPAM).
  • Additional examples include PP75, a L-phenylalanine-poly(L-lysine isophthalamide) polymer described in Khormaee, et al., “Edosomolytic anionic polymer for the cytoplasmic delivery of siRNAs in localized in vivo applications,” Advanced Functional Materials 23: 565-574 (2013).
  • an endosomolytic polymer described herein is a pH-responsive endosomolytic polymer.
  • a pH-responsive polymer comprises a polymer that increases in size (swell) or collapses depending on the pH of the environment.
  • Polyacrylic acid and chitosan are examples of pH-responsive polymers.
  • an endosomolytic moiety described herein is a membrane-disruptive polymer.
  • the membrane-disruptive polymer comprises a cationic polymer, a neutral or hydrophobic polymer, or an anionic polymer.
  • the membrane-disruptive polymer is a hydrophilic polymer.
  • an endosomolytic moiety described herein is a pH-responsive membrane-disruptive polymer.
  • Exemplary pH-responsive membrane-disruptive polymers include p(alkylacrylic acids), poly(N-isopropylacrylamide) (NIPAM) copolymers, succinylated p(glycidols), and p( ⁇ -malic acid) polymers.
  • p(alkylacrylic acids) include poly(propylacrylic acid) (polyPAA), poly(methacrylic acid) (PMAA), poly(ethylacrylic acid) (PEAA), and poly(propyl acrylic acid) (PPAA).
  • a p(alkylacrylic acid) include a p(alkylacrylic acid) described in Jones, et al., Biochemistry Journal 372: 65-75 (2003).
  • a pH-responsive membrane-disruptive polymer comprises p(butyl acrylate-co-methacrylic acid).
  • a pH-responsive membrane-disruptive polymer comprises p(styrene-alt-maleic anhydride).
  • a pH-responsive membrane-disruptive polymer comprises pyridyldisulfide acrylate (PDSA) polymers such as poly(MAA-co-PDSA), poly(EAA-co-PDSA), poly(PAA-co-PDSA), poly(MAA-co-BA-co-PDSA), poly(EAA-co-BA-co-PDSA), or poly(PAA-co-BA-co-PDSA) polymers.
  • PDSA pyridyldisulfide acrylate
  • a pH-responsive membrane-disruptive polymer comprises a lytic polymer comprising the base structure of:
  • an endosomolytic moiety described herein is further conjugated to an additional conjugate, e.g., a polymer (e.g., PEG), or a modified polymer (e.g., cholesterol-modified polymer).
  • an additional conjugate e.g., a polymer (e.g., PEG), or a modified polymer (e.g., cholesterol-modified polymer).
  • the additional conjugate comprises a detergent (e.g., Triton X-100).
  • an endosomolytic moiety described herein comprises a polymer (e.g., a poly(amidoamine)) conjugated with a detergent (e.g., Triton X-100).
  • an endosomolytic moiety described herein comprises poly(amidoamine)-Triton X-100 conjugate (Duncan, et al., “A polymer-Triton X-100 conjugate capable of pH-dependent red blood cell lysis: a model system illustrating the possibility of drug delivery within acidic intracellular compartments,” Journal of Drug Targeting 2: 341-347 (1994)).
  • the endosomolytic moiety is a lipid (e.g., a fusogenic lipid).
  • a molecule of Formula (I): A-X-B-Y-C is further conjugated with an endosomolytic lipid (e.g., fusogenic lipid).
  • Exemplary fusogenic lipids include 1,2-dileoyl-sn-3-phosphoethanolamine (DOPE), phosphatidylethanolamine (POPE), palmitoyloleoylphosphatidylcholine (POPC), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-ol (Di-Lin), N-methyl(2,2-di((9Z,12Z)-octadeca-9,12-dienyl)-1,3-dioxolan-4-yl)methanamine (DLin-k-DMA) and N-methyl-2-(2,2-di((9Z,12Z)-octadeca-9,12-dienyl)-1,3-dioxolan-4-yl)ethanamine (XTC).
  • DOPE 1,2-dileoyl-sn-3-phosphoethanolamine
  • POPE phosphatidylethanolamine
  • an endosomolytic moiety is a lipid (e.g., a fusogenic lipid) described in PCT Publication No. WO09/126,933.
  • the endosomolytic moiety is a small molecule.
  • a molecule of Formula (I): A-X-B-Y-C is further conjugated with an endosomolytic small molecule.
  • Exemplary small molecules suitable as endosomolytic moieties include, but are not limited to, quinine, chloroquine, hydroxychloroquines, amodiaquins (carnoquines), amopyroquines, primaquines, mefloquines, nivaquines, halofantrines, quinone imines, or a combination thereof.
  • quinoline endosomolytic moieties include, but are not limited to, 7-chloro-4-(4-diethylamino-1-methylbutyl-amino)quinoline (chloroquine); 7-chloro-4-(4-ethyl-(2-hydroxyethyl)-amino-1-methylbutyl-amino)quinoline (hydroxychloroquine); 7-fluoro-4-(4-diethylamino-1-methylbutyl-amino)quinoline; 4-(4-diethylamino-1-methylbutylamino) quinoline; 7-hydroxy-4-(4-diethyl-amino-1-methylbutylamino)quinoline; 7-chloro-4-(4-diethylamino-1-butylamino)quinoline (desmethylchloroquine); 7-fluoro-4-(4-diethylamino-1-butylamino)quinoline); 4-(4-diethyla
  • one or more endosomolytic moieties are conjugated to a molecule comprising at least one binding moiety, at least one polynucleotide, at least one polymer, or any combinations thereof.
  • the endosomolytic moiety is conjugated according to Formula (II):
  • A is a binding moiety
  • B is a polynucleotide
  • C is a polymer
  • X is a bond or first linker
  • Y is a bond or second linker
  • L is a bond or third linker
  • D is an endosomolytic moiety
  • c is an integer between 0 and 1;
  • polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety; and D is conjugated anywhere on A, B, or C.
  • a and C are not attached to B at the same terminus.
  • the at least one 2′ modified nucleotide comprises 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modified nucleotide.
  • the at least one 2′ modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
  • the at least one modified internucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage.
  • the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule.
  • the second polynucleotide comprises at least one modification.
  • the first polynucleotide and the second polynucleotide are RNA molecules.
  • the first polynucleotide and the second polynucleotide are siRNA molecules.
  • X, Y, and L are independently a bond or a non-polymeric linker group.
  • A is an antibody or binding fragment thereof.
  • the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab′, divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.
  • C is polyethylene glycol.
  • the endosomolytic moiety comprises a polypeptide, a polymer, a lipid, or a small molecule. In some instances, the endosomolytic moiety is an endosomolytic polypeptide. In some cases, the endosomolytic moiety is an endosomolytic polymer. In other cases, the endosomolytic moiety is an endosomolytic lipid. In additional cases, the endosomolytic moiety is an endosomolytic small molecule.
  • the endosomolytic moiety is INF7 or its derivatives thereof.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2055.
  • the endosomolytic moiety comprises SEQ ID NO: 2055.
  • the endosomolytic moiety consists of SEQ ID NO: 2055.
  • the endosomolytic moiety is melittin or its derivatives thereof.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2060.
  • the endosomolytic moiety comprises SEQ ID NO: 2060.
  • the endosomolytic moiety consists of SEQ ID NO: 2060.
  • the endosomolytic moiety is a sequence as illustrated in Table 62.
  • the endosomolytic moiety is an endosomolytic polymer, such as for example, a pH-responsive endosomolytic polymer, a membrane-disruptive polymer, a polycation polymer, a polyanion polymer, a pH-responsive membrane-disruptive polymer, or a combination thereof.
  • the endosomolytic moiety comprises a p(alkylacrylic acid) polymer, a p(butyl acrylate-co-methacrylic acid) polymer, a p(styrene-alt-maleic anhydride) polymer, a pyridyldisulfide acrylate (PDSA) polymer, a polymer-PEG conjugate, a polymer-detergent conjugate, or a combination thereof.
  • PDSA pyridyldisulfide acrylate
  • the endosomolytic moiety conjugate is according to Formula (IIa):
  • A is a binding moiety
  • B is a polynucleotide
  • C is a polymer
  • X is a bond or first linker
  • Y is a bond or second linker
  • L is a bond or third linker
  • D is an endosomolytic moiety
  • c is an integer of 1;
  • polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety.
  • a and C are not attached to B at the same terminus.
  • the at least one 2′ modified nucleotide comprises 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modified nucleotide.
  • the at least one 2′ modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
  • the at least one modified internucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage.
  • the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule.
  • the second polynucleotide comprises at least one modification.
  • the first polynucleotide and the second polynucleotide are RNA molecules.
  • the first polynucleotide and the second polynucleotide are siRNA molecules.
  • X, Y, and L are independently a bond or a non-polymeric linker group.
  • A is an antibody or binding fragment thereof.
  • the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab′, divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.
  • C is polyethylene glycol.
  • the endosomolytic moiety comprises a polypeptide, a polymer, a lipid, or a small molecule. In some instances, the endosomolytic moiety is an endosomolytic polypeptide. In some cases, the endosomolytic moiety is an endosomolytic polymer. In other cases, the endosomolytic moiety is an endosomolytic lipid. In additional cases, the endosomolytic moiety is an endosomolytic small molecule.
  • the endosomolytic moiety is INF7 or its derivatives thereof.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2055.
  • the endosomolytic moiety comprises SEQ ID NO: 2055.
  • the endosomolytic moiety consists of SEQ ID NO: 2055.
  • the endosomolytic moiety is melittin or its derivatives thereof.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2060.
  • the endosomolytic moiety comprises SEQ ID NO: 2060.
  • the endosomolytic moiety consists of SEQ ID NO: 2060.
  • the endosomolytic moiety is a sequence as illustrated in Table 62.
  • the endosomolytic moiety is an endosomolytic polymer, such as for example, a pH-responsive endosomolytic polymer, a membrane-disruptive polymer, a polycation polymer, a polyanion polymer, a pH-responsive membrane-disruptive polymer, or a combination thereof.
  • the endosomolytic moiety comprises a p(alkylacrylic acid) polymer, a p(butyl acrylate-co-methacrylic acid) polymer, a p(styrene-alt-maleic anhydride) polymer, a pyridyldisulfide acrylate (PDSA) polymer, a polymer-PEG conjugate, a polymer-detergent conjugate, or a combination thereof.
  • PDSA pyridyldisulfide acrylate
  • the endosomolytic moiety conjugate is according to Formula (IIb):
  • A is a binding moiety
  • B is a polynucleotide
  • X is a bond or first linker
  • L is a bond or third linker
  • D is an endosomolytic moiety
  • polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety.
  • a and C are not attached to B at the same terminus.
  • the at least one 2′ modified nucleotide comprises 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modified nucleotide.
  • the at least one 2′ modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
  • the at least one modified internucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage.
  • the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule.
  • the second polynucleotide comprises at least one modification.
  • the first polynucleotide and the second polynucleotide are RNA molecules.
  • the first polynucleotide and the second polynucleotide are siRNA molecules.
  • X and L are independently a bond or a non-polymeric linker group.
  • A is an antibody or binding fragment thereof.
  • the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab′, divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.
  • C is polyethylene glycol.
  • the endosomolytic moiety comprises a polypeptide, a polymer, a lipid, or a small molecule. In some instances, the endosomolytic moiety is an endosomolytic polypeptide. In some cases, the endosomolytic moiety is an endosomolytic polymer. In other cases, the endosomolytic moiety is an endosomolytic lipid. In additional cases, the endosomolytic moiety is an endosomolytic small molecule.
  • the endosomolytic moiety is INF7 or its derivatives thereof.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2055.
  • the endosomolytic moiety comprises SEQ ID NO: 2055.
  • the endosomolytic moiety consists of SEQ ID NO: 2055.
  • the endosomolytic moiety is melittin or its derivatives thereof.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2060.
  • the endosomolytic moiety comprises SEQ ID NO: 2060.
  • the endosomolytic moiety consists of SEQ ID NO: 2060.
  • the endosomolytic moiety is a sequence as illustrated in Table 62.
  • the endosomolytic moiety is an endosomolytic polymer, such as for example, a pH-responsive endosomolytic polymer, a membrane-disruptive polymer, a polycation polymer, a polyanion polymer, a pH-responsive membrane-disruptive polymer, or a combination thereof.
  • the endosomolytic moiety comprises a p(alkylacrylic acid) polymer, a p(butyl acrylate-co-methacrylic acid) polymer, a p(styrene-alt-maleic anhydride) polymer, a pyridyldisulfide acrylate (PDSA) polymer, a polymer-PEG conjugate, a polymer-detergent conjugate, or a combination thereof.
  • PDSA pyridyldisulfide acrylate
  • the endosomolytic moiety conjugate is according to Formula (IIc):
  • A is a binding moiety
  • B is a polynucleotide
  • C is a polymer
  • X is a bond or first linker
  • Y is a bond or second linker
  • L is a bond or third linker
  • D is an endosomolytic moiety
  • c is an integer of 1;
  • polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety.
  • a and C are not attached to B at the same terminus.
  • the at least one 2′ modified nucleotide comprises 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modified nucleotide.
  • the at least one 2′ modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
  • the at least one modified internucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage.
  • the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule.
  • the second polynucleotide comprises at least one modification.
  • the first polynucleotide and the second polynucleotide are RNA molecules.
  • the first polynucleotide and the second polynucleotide are siRNA molecules.
  • X, Y, and L are independently a bond or a non-polymeric linker group.
  • A is an antibody or binding fragment thereof.
  • the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab′, divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.
  • C is polyethylene glycol.
  • the endosomolytic moiety comprises a polypeptide, a polymer, a lipid, or a small molecule. In some instances, the endosomolytic moiety is an endosomolytic polypeptide. In some cases, the endosomolytic moiety is an endosomolytic polymer. In other cases, the endosomolytic moiety is an endosomolytic lipid. In additional cases, the endosomolytic moiety is an endosomolytic small molecule.
  • the endosomolytic moiety is INF7 or its derivatives thereof.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2055.
  • the endosomolytic moiety comprises SEQ ID NO: 2055.
  • the endosomolytic moiety consists of SEQ ID NO: 2055.
  • the endosomolytic moiety is melittin or its derivatives thereof.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2060.
  • the endosomolytic moiety comprises SEQ ID NO: 2060.
  • the endosomolytic moiety consists of SEQ ID NO: 2060.
  • the endosomolytic moiety is a sequence as illustrated in Table 62.
  • the endosomolytic moiety is an endosomolytic polymer, such as for example, a pH-responsive endosomolytic polymer, a membrane-disruptive polymer, a polycation polymer, a polyanion polymer, a pH-responsive membrane-disruptive polymer, or a combination thereof.
  • the endosomolytic moiety comprises a p(alkylacrylic acid) polymer, a p(butyl acrylate-co-methacrylic acid) polymer, a p(styrene-alt-maleic anhydride) polymer, a pyridyldisulfide acrylate (PDSA) polymer, a polymer-PEG conjugate, a polymer-detergent conjugate, or a combination thereof.
  • PDSA pyridyldisulfide acrylate
  • the endosomolytic moiety conjugate is according to Formula (IId):
  • A is a binding moiety
  • B is a polynucleotide
  • C is a polymer
  • X is a bond or first linker
  • Y is a bond or second linker
  • L is a bond or third linker
  • D is an endosomolytic moiety
  • c is an integer of 1;
  • polynucleotide comprises at least one 2′ modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety.
  • a and C are not attached to B at the same terminus.
  • the at least one 2′ modified nucleotide comprises 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl, 2′-deoxy, T-deoxy-2′-fluoro, 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), T-O-dimethylaminoethyloxyethyl (2′-O-DMAEOE), or 2′-O-N-methylacetamido (2′-O-NMA) modified nucleotide.
  • the at least one 2′ modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA).
  • the at least one modified internucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage.
  • the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule.
  • the second polynucleotide comprises at least one modification.
  • the first polynucleotide and the second polynucleotide are RNA molecules.
  • the first polynucleotide and the second polynucleotide are siRNA molecules.
  • X, Y, and L are independently a bond or a non-polymeric linker group.
  • A is an antibody or binding fragment thereof.
  • the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab′, divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.
  • C is polyethylene glycol.
  • the endosomolytic moiety comprises a polypeptide, a polymer, a lipid, or a small molecule. In some instances, the endosomolytic moiety is an endosomolytic polypeptide. In some cases, the endosomolytic moiety is an endosomolytic polymer. In other cases, the endosomolytic moiety is an endosomolytic lipid. In additional cases, the endosomolytic moiety is an endosomolytic small molecule.
  • the endosomolytic moiety is INF7 or its derivatives thereof.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2055.
  • the endosomolytic moiety comprises SEQ ID NO: 2055.
  • the endosomolytic moiety consists of SEQ ID NO: 2055.
  • the endosomolytic moiety is melittin or its derivatives thereof.
  • the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2060.
  • the endosomolytic moiety comprises SEQ ID NO: 2060.
  • the endosomolytic moiety consists of SEQ ID NO: 2060.
  • the endosomolytic moiety is a sequence as illustrated in Table 62.
  • the endosomolytic moiety is an endosomolytic polymer, such as for example, a pH-responsive endosomolytic polymer, a membrane-disruptive polymer, a polycation polymer, a polyanion polymer, a pH-responsive membrane-disruptive polymer, or a combination thereof.
  • the endosomolytic moiety comprises a p(alkylacrylic acid) polymer, a p(butyl acrylate-co-methacrylic acid) polymer, a p(styrene-alt-maleic anhydride) polymer, a pyridyldisulfide acrylate (PDSA) polymer, a polymer-PEG conjugate, a polymer-detergent conjugate, or a combination thereof.
  • PDSA pyridyldisulfide acrylate
  • a linker described herein is a cleavable linker or a non-cleavable linker.
  • the linker is a cleavable linker.
  • the linker is an acid cleavable linker.
  • the linker is a non-cleavable linker.
  • the linker includes a C 1 -C 6 alkyl group (e.g., a C 5 , C 4 , C 3 , C 2 , or C 1 alkyl group).
  • the linker includes homobifunctional cross linkers, heterobifunctional cross linkers, and the like.
  • the linker is a traceless linker (or a zero-length linker). In some instances, the linker is a non-polymeric linker. In some cases, the linker is a non-peptide linker or a linker that does not contain an amino acid residue.
  • the linker comprises a homobifuctional linker.
  • exemplary homobifuctional linkers include, but are not limited to, Lomant's reagent dithiobis (succinimidylpropionate) DSP, 3′3′-dithiobis(sulfosuccinimidyl proprionate (DTSSP), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl)suberate (BS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfo DST), ethylene glycobis(succinimidylsuccinate) (EGS), disuccinimidyl glutarate (DSG), N,N′-disuccinimidyl carbonate (DSC), dimethyl adipimidate (DMA), dimethyl pimelimidate (DMP), dimethyl suberimidate (DMS), dimethyl-3,3′-di
  • DFDNPS 4,4′-difluoro-3,3′-dinitrophenylsulfone
  • BASED bis-[ ⁇ -(4-azidosalicylamido)ethyl]disulfide
  • formaldehyde glutaraldehyde
  • 1,4-butanediol diglycidyl ether 1,4-butanediol diglycidyl ether
  • adipic acid dihydrazide carbohydrazide, o-toluidine, 3,3′-dimethylbenzidine, benzidine, ⁇ , ⁇ ′-p-diaminodiphenyl, diiodo-p-xylene sulfonic acid, N,N′-ethylene-bis(iodoacetamide), or N,N′-hexamethylene-bis(iodoacetamide).
  • the linker comprises a heterobifunctional linker.
  • exemplary heterobifunctional linker include, but are not limited to, amine-reactive and sulfhydryl cross-linkers such as N-succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long-chain N-succinimidyl 3-(2-pyridyldithio)propionate (LC-sPDP), water-soluble-long-chain N-succinimidyl 3-(2-pyridyldithio) propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl- ⁇ -methyl- ⁇ -(2-pyridyldithio)toluene (sMPT), sulfosuccinimidyl-6-[ ⁇ -methyl- ⁇ -(2-pyridyldithio)toluamido]hexanoate (sulfo-LC-sMP
  • the linker comprises a reactive functional group.
  • the reactive functional group comprises a nucleophilic group that is reactive to an electrophilic group present on a binding moiety.
  • electrophilic groups include carbonyl groups—such as aldehyde, ketone, carboxylic acid, ester, amide, enone, acyl halide or acid anhydride.
  • the reactive functional group is aldehyde.
  • nucleophilic groups include hydrazide, oxime, amino, hydrazine, thiosemicarbazone, hydrazine carboxylate, and arylhydrazide.
  • the linker comprises a maleimide goup.
  • the maleimide group is also referred to as a maleimide spacer.
  • the maleimide group further encompasses a caproic acid, forming maleimidocaproyl (mc).
  • the linker comprises maleimidocaproyl (mc).
  • the linker is maleimidocaproyl (mc).
  • the maleimide group comprises a maleimidomethyl group, such as succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) or sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC) described above.
  • sMCC succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate
  • sulfo-sMCC sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate
  • the maleimide group is a self-stabilizing maleimide.
  • the self-stabilizing maleimide utilizes diaminopropionic acid (DPR) to incorporate a basic amino group adjacent to the maleimide to provide intramolecular catalysis of tiosuccinimide ring hydrolysis, thereby eliminating maleimide from undergoing an elimination reaction through a retro-Michael reaction.
  • the self-stabilizing maleimide is a maleimide group described in Lyon, et al., “Self-hydrolyzing maleimides improve the stability and pharmacological properties of antibody-drug conjugates,” Nat. Biotechnol. 32(10):1059-1062 (2014).
  • the linker comprises a self-stabilizing maleimide.
  • the linker is a self-stabilizing maleimide.
  • the linker comprises a peptide moiety.
  • the peptide moiety comprises at least 2, 3, 4, 5, 6, 7, 8, or more aminoa cid residues.
  • the peptide moiety is a cleavable peptide moiety (e.g., either enzymatically or chemically).
  • the peptide moiety is a non-cleavable peptide moiety.
  • the peptide moiety comprises Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 2111), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO: 2112), or Gly-Phe-Leu-Gly (SEQ ID NO: 2113).
  • the linker comprises a peptide moiety such as: Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 2111), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO: 2112), or Gly-Phe-Leu-Gly (SEQ ID NO: 2113).
  • the linker comprises Val-Cit.
  • the linker is Val-Cit.
  • the linker comprises a benzoic acid group, or its derivatives thereof.
  • the benzoic acid group or its derivatives thereof comprise paraaminobenzoic acid (PABA).
  • the benzoic acid group or its derivatives thereof comprise gamma-aminobutyric acid (GABA).
  • the linker comprises one or more of a maleimide group, a peptide moiety, and/or a benzoic acid group, in any combination. In some embodiments, the linker comprises a combination of a maleimide group, a peptide moiety, and/or a benzoic acid group. In some instances, the maleimide group is maleimidocaproyl (mc). In some instances, the peptide group is val-cit. In some instances, the benzoic acid group is PABA. In some instances, the linker comprises a mc-val-cit group. In some cases, the linker comprises a val-cit-PABA group. In additional cases, the linker comprises a mc-val-cit-PABA group.
  • the linker is a self-immolative linker or a self-elimination linker. In some cases, the linker is a self-immolative linker. In other cases, the linker is a self-elimination linker (e.g., a cyclization self-elimination linker). In some instances, the linker comprises a linker described in U.S. Pat. No. 9,089,614 or PCT Publication No. WO2015038426.
  • the linker is a dendritic type linker.
  • the dendritic type linker comprises a branching, multifunctional linker moiety.
  • the dendritic type linker is used to increase the molar ratio of polynucleotide B to the binding moiety A.
  • the dendritic type linker comprises PAMAM dendrimers.
  • the linker is a traceless linker or a linker in which after cleavage does not leave behind a linker moiety (e.g., an atom or a linker group) to a binding moiety A, a polynucleotide B, a polymer C, or an endosomolytic moiety D.
  • a linker moiety e.g., an atom or a linker group
  • Exemplary traceless linkers include, but are not limited to, germanium linkers, silicium linkers, sulfur linkers, selenium linkers, nitrogen linkers, phosphorus linkers, boron linkers, chromium linkers, or phenylhydrazide linker.
  • the linker is a traceless aryl-triazene linker as described in Hejesen, et al., “A traceless aryl-triazene linker for DNA-directed chemistry,” Org Biomol Chem 11(15): 2493-2497 (2013).
  • the linker is a traceless linker described in Blaney, et al., “Traceless solid-phase organic synthesis,” Chem. Rev. 102: 2607-2024 (2002).
  • a linker is a traceless linker as described in U.S. Pat. No. 6,821,783.
  • the linker comprises a functional group that exerts steric hinderance at the site of bonding between the linker and a conjugating moiety (e.g., A, B, C, or D described herein).
  • the steric hinderance is a steric hindrance around a disulfide bond.
  • Exemplary linkers that exhibit steric hinderance comprises a heterobifuctional linker, such as a heterobifuctional linker described above.
  • a linker that exhibits steric hinderance comprises SMCC and SPDB.
  • the linker is an acid cleavable linker.
  • the acid cleavable linker comprises a hydrazone linkage, which is susceptible to hydrolytic cleavage.
  • the acid cleavable linker comprises a thiomaleamic acid linker.
  • the acid cleavable linker is a thiomaleamic acid linker as described in Castaneda, et al, “Acid-cleavable thiomaleamic acid linker for homogeneous antibody-drug conjugation,” Chem. Commun. 49: 8187-8189 (2013).
  • the linker is a linker described in U.S. Pat. Nos. 6,884,869; 7,498,298; 8,288,352; 8,609,105; or 8,697,688; U.S. Patent Publication Nos. 2014/0127239; 2013/028919; 2014/286970; 2013/0309256; 2015/037360; or 2014/0294851; or PCT Publication Nos. WO2015057699; WO2014080251; WO2014197854; WO2014145090; or WO2014177042.
  • X, Y, and L are independently a bond or a linker. In some instances, X, Y, and L are independently a bond. In some cases, X, Y, and L are independently a linker.
  • X is a bond or a linker. In some instances, X is a bond. In some instances, X is a linker. In some instances, the linker is a C 1 -C 6 alkyl group. In some cases, X is a C 1 -C 6 alkyl group, such as for example, a C 5 , C 4 , C 3 , C 2 , or C 1 alkyl group. In some cases, the C 1 -C 6 alkyl group is an unsubstituted C 1 -C 6 alkyl group. As used in the context of a linker, and in particular in the context of X, alkyl means a saturated straight or branched hydrocarbon radical containing up to six carbon atoms.
  • X is a non-polymeric linker. In some instances, X includes a homobifuctional linker or a heterobifuctional linker described supra. In some cases, X includes a heterobifunctional linker. In some cases, X includes sMCC. In other instances, X includes a heterobifuctional linker optionally conjugated to a C 1 -C 6 alkyl group. In other instances, X includes sMCC optionally conjugated to a C 1 -C 6 alkyl group. In additional instances, X does not include a homobifuctional linker or a heterobifunctional linker described supra.
  • Y is a bond or a linker. In some instances, Y is a bond. In other cases, Y is a linker. In some embodiments, Y is a C 1 -C 6 alkyl group. In some instances, Y is a homobifuctional linker or a heterobifunctional linker described supra. In some instances, Y is a homobifuctional linker described supra. In some instances, Y is a heterobifunctional linker described supra. In some instances, Y comprises a maleimide group, such as maleimidocaproyl (mc) or a self-stabilizing maleimide group described above. In some instances, Y comprises a peptide moiety, such as Val-Cit.
  • Y comprises a benzoic acid group, such as PABA.
  • Y comprises a combination of a maleimide group, a peptide moiety, and/or a benzoic acid group.
  • Y comprises a mc group.
  • Y comprises a mc-val-cit group.
  • Y comprises a val-cit-PABA group.
  • Y comprises a mc-val-cit-PABA group.
  • L is a bond or a linker. In some cases, L is a bond. In other cases, L is a linker. In some embodiments, L is a C 1 -C 6 alkyl group. In some instances, L is a homobifuctional linker or a heterobifunctional linker described supra. In some instances, L is a homobifuctional linker described supra. In some instances, L is a heterobifunctional linker described supra. In some instances, L comprises a maleimide group, such as maleimidocaproyl (mc) or a self-stabilizing maleimide group described above. In some instances, L comprises a peptide moiety, such as Val-Cit.
  • mc maleimidocaproyl
  • L comprises a peptide moiety, such as Val-Cit.
  • L comprises a benzoic acid group, such as PABA.
  • L comprises a combination of a maleimide group, a peptide moiety, and/or a benzoic acid group.
  • L comprises a mc group.
  • L comprises a mc-val-cit group.
  • L comprises a val-cit-PABA group.
  • L comprises a mc-val-cit-PABA group.
  • a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a disease or disorder.
  • the disease or disorder is a cancer.
  • a composition or a pharmaceutical formulation described herein is used as an immunotherapy for the treatment of a disease or disorder.
  • the immunotherapy is an immuno-oncology therapy.
  • a composition or a pharmaceutical formulation described herein is used for the treatment of cancer.
  • the cancer is a solid tumor.
  • the cancer is a hematologic malignancy.
  • the cancer is a relapsed or refractory cancer, or a metastatic cancer.
  • the solid tumor is a relapsed or refractory solid tumor, or a metastatic solid tumor.
  • the hematologic malignancy is a relapsed or refractory hematologic malignancy, or a metastatic hematologic malignancy.
  • the cancer is a solid tumor.
  • Exemplary solid tumor includes, but is not limited to, anal cancer, appendix cancer, bile duct cancer (i.e., cholangiocarcinoma), bladder cancer, brain tumor, breast cancer, cervical cancer, colon cancer, cancer of Unknown Primary (CUP), esophageal cancer, eye cancer, fallopian tube cancer, gastroenterological cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, prostate cancer, rectal cancer, skin cancer, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, vaginal cancer, or vulvar cancer.
  • CUP Unknown Primary
  • a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a solid tumor.
  • a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of anal cancer, appendix cancer, bile duct cancer (i.e., cholangiocarcinoma), bladder cancer, brain tumor, breast cancer, cervical cancer, colon cancer, cancer of Unknown Primary (CUP), esophageal cancer, eye cancer, fallopian tube cancer, gastroenterological cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, prostate cancer, rectal cancer, skin cancer, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer,
  • CUP Un
  • the cancer is a hematologic malignancy.
  • the hematologic malignancy is a leukemia, a lymphoma, a myeloma, a non-Hodgkin's lymphoma, or a Hodgkin's lymphoma.
  • the hematologic malignancy comprises chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high risk CLL, a non-CLL/SLL lymphoma, prolymphocytic leukemia (PLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), WaldenstrOm's macroglobulinemia, multiple myeloma, extranodal marginal zone B cell lymphoma, nodal marginal zone B cell lymphoma, Burkitt's lymphoma, non-Burkitt high grade B cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, B cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma,
  • a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a hematologic malignancy. In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a leukemia, a lymphoma, a myeloma, a non-Hodgkin's lymphoma, or a Hodgkin's lymphoma.
  • the hematologic malignancy comprises chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high risk CLL, a non-CLL/SLL lymphoma, prolymphocytic leukemia (PLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), WaldenstrOm's macroglobulinemia, multiple myeloma, extranodal marginal zone B cell lymphoma, nodal marginal zone B cell lymphoma, Burkitt's lymphoma, non-Burkitt high grade B cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, B cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma,
  • the cancer is a KRAS-associated, EGFR-associated, AR-associated cancer, HPRT1-associated cancer, or ⁇ -catenin associated cancer.
  • a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a KRAS-associated, EGFR-associated, AR-associated cancer, HPRT1-associated cancer, or ⁇ -catenin associated cancer.
  • a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a KRAS-associated cancer.
  • a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of an EGFR-associated cancer. In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of an AR-associated cancer. In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of an HPRT1-associated cancer.
  • a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a ⁇ -catenin associated cancer.
  • the cancer is a solid tumor.
  • the cancer is a hematologic malignancy.
  • the solid tumor is a relapsed or refractory solid tumor, or a metastatic solid tumor.
  • the hematologic malignancy is a relapsed or refractory hematologic malignancy, or a metastatic hematologic malignancy.
  • the cancer comprises bladder cancer, breast cancer, colorectal cancer, endometrial cancer, esophageal cancer, glioblastoma multiforme, head and neck cancer, kidney cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, thyroid cancer, acute myeloid leukemia, CLL, DLBCL, or multiple myeloma.
  • the ⁇ -catenin associated cancer further comprises PIK3C-associated cancer and/or MYC-associated cancer.
  • a composition or a pharmaceutical formulation described herein is used as an immunotherapy for the treatment of a disease or disorder.
  • the immunotherapy is an immuno-oncology therapy.
  • immuno-oncology therapy is categorized into active, passive, or combinatory (active and passive) methods.
  • active immuno-oncology therapy method for example, tumor-associated antigens (TAAs) are presented to the immune system to trigger an attack on cancer cells presenting these TAAs.
  • TAAs tumor-associated antigens
  • the active immune-oncology therapy method includes tumor-targeting and/or immune-targeting agents (e.g., checkpoint inhibitor agents such as monoclonal antibodies), and/or vaccines, such as in situ vaccination and/or cell-based or non-cell based (e.g., dendritic cell-based, tumor cell-based, antigen, anti-idiotype, DNA, or vector-based) vaccines.
  • the cell-based vaccines are vaccines which are generated using activated immune cells obtained from a patient's own immune system which are then activated by the patient's own cancer.
  • the active immune-oncology therapy is further subdivided into non-specific active immunotherapy and specific active immunotherapy.
  • non-specific active immunotherapy utilizes cytokines and/or other cell signaling components to induce a general immune system response.
  • specific active immunotherapy utilizes specific TAAs to elicite an immune response.
  • a composition or a pharmaceutical formulation described herein is used as an active immuno-oncology therapy method for the treatment of a disease or disorder (e.g., cancer).
  • the composition or a pharmaceutical formulation described herein comprises a tumor-targeting agent.
  • the tumor-targeting agent is encompassed by a binding moiety A.
  • the tumor-targeting agent is an additional agent used in combination with a molecule of Formula (I).
  • the tumor-targeting agent is a tumor-directed polypeptide (e.g., a tumor-directed antibody).
  • the tumor-targeting agent is a tumor-directed antibody, which exerts its antitumor activity through mechanisms such as direct killing (e.g., signaling-induced apoptosis), complement-dependent cytotoxicity (CDC), and/or antibody-dependent cell-mediated cytotoxicity (ADCC).
  • direct killing e.g., signaling-induced apoptosis
  • CDC complement-dependent cytotoxicity
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • the tumor-targeting agent elicits an adaptive immune response, with the induction of antitumor T cells.
  • the binding moiety A is a tumor-directed polypeptide (e.g., a tumor-directed antibody).
  • the binding moiety A is a tumor-directed antibody, which exerts its antitumor activity through mechanisms such as direct killing (e.g., signaling-induced apoptosis), complement-dependent cytotoxicity (CDC), and/or antibody-dependent cell-mediated cytotoxicity (ADCC).
  • direct killing e.g., signaling-induced apoptosis
  • CDC complement-dependent cytotoxicity
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • the binding moiety A elicits an adaptive immune response, with the induction of antitumor T cells.
  • the composition or a pharmaceutical formulation described herein comprises an immune-targeting agent.
  • the immune-targeting agent is encompassed by a binding moiety A.
  • the immune-targeting agent is an additional agent used in combination with a molecule of Formula (I).
  • the immune-targeting agent comprises cytokines, checkpoint inhibitors, or a combination thereof.
  • the immune-targeting agent is a checkpoint inhibitor.
  • an immune checkpoint molecule is a molecule presented on the cell surface of CD4 and/or CD8 T cells.
  • Exemplary immune checkpoint molecules include, but are not limited to, Programmed Death-Ligand 1 (PD-L1, also known as B7-H1, CD274), Programmed Death 1 (PD-1), CTLA-4, B7H1, B7H4, OX-40, CD137, CD40, 2B4, IDO1, IDO2, VISTA, CD27, CD28, PD-L2 (B7-DC, CD273), LAG3, CD80, CD86, PDL2, B7H3, HVEM, BTLA, KIR, GAL9, TIM3, A2aR, MARCO (macrophage receptor with collageneous structure), PS (phosphatidylserine), ICOS (inducible T cell costimulator), HAVCR2, CD276, VTCN1, CD70, and CD160.
  • PD-L1 Programmed
  • an immune checkpoint inhibitor refers to any molecule that modulates or inhibits the activity of an immune checkpoint molecule.
  • immune checkpoint inhibitors include antibodies, antibody-derivatives (e.g., Fab fragments, scFvs, minobodies, diabodies), antisense oligonucleotides, siRNA, aptamers, or peptides.
  • an immune checkpoint inhibitor is an inhibitor of Programmed Death-Ligand 1 (PD-L1, also known as B7-H1, CD274), Programmed Death 1 (PD-1), CTLA-4, PD-L2 (B7-DC, CD273), LAG3, TIM3, 2B4, A2aR, B7H1, B7H3, B7H4, BTLA, CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD137, CD160, CD226, CD276, DR3, GAL9, GITR, HAVCR2, HVEM, IDO1, IDO2, ICOS (inducible T cell costimulator), KIR, LAIR1, LIGHT, MARCO (macrophage receptor with collageneous structure), PS (phosphatidylserine), OX-40, SLAM, TIGHT, VISTA, VTCN1, or any combinations thereof.
  • PD-L1 Programmed Death-Ligand 1
  • PD-1 Programmed Death 1
  • CTLA-4
  • exemplary checkpoint inhibitors include:
  • PD-L1 inhibitors such as Genentech's MPDL3280A (RG7446), Anti-mouse PD-L1 antibody Clone 10F.9G2 (Cat # BE0101) from BioXcell, anti-PD-L1 monoclonal antibody MDX-1105 (BMS-936559) and BMS-935559 from Bristol-Meyer's Squibb, MSB0010718C, mouse anti-PD-L1 Clone 29E.2A3, and AstraZeneca's MEDI4736;
  • PD-L2 inhibitors such as GlaxoSmithKline's AMP-224 (Amplimmune), and rHIgM12B7;
  • PD-1 inhibitors such as anti-mouse PD-1 antibody Clone J43 (Cat # BE0033-2) from BioXcell, anti-mouse PD-1 antibody Clone RMP1-14 (Cat # BE0146) from BioXcell, mouse anti-PD-1 antibody Clone EH12, Merck's MK-3475 anti-mouse PD-1 antibody (Keytruda, pembrolizumab, lambrolizumab), AnaptysBio's anti-PD-1 antibody known as ANB011, antibody MDX-1 106 (ONO-4538), Bristol-Myers Squibb's human IgG4 monoclonal antibody nivolumab (Opdivo®, BMS-936558, MDX1106), AstraZeneca's AMP-514 and AMP-224, and Pidilizumab (CT-011) from CureTech Ltd;
  • CTLA-4 inhibitors such as Bristol Meyers Squibb's anti-CTLA-4 antibody ipilimumab (also known as Yervoy®, MDX-010, BMS-734016 and MDX-101), anti-CTLA4 Antibody, clone 9H10 from Millipore, Pfizer's tremelimumab (CP-675,206, ticilimumab), and anti-CTLA4 antibody clone BN13 from Abcam;
  • CTLA-4 inhibitors such as Bristol Meyers Squibb's anti-CTLA-4 antibody ipilimumab (also known as Yervoy®, MDX-010, BMS-734016 and MDX-101), anti-CTLA4 Antibody, clone 9H10 from Millipore, Pfizer's tremelimumab (CP-675,206, ticilimumab), and anti-CTLA4 antibody clone BN13 from Abcam;
  • LAG3 inhibitors such as anti-Lag-3 antibody clone eBioC9B7W (C9B7W) from eBioscience, anti-Lag3 antibody LS-B2237 from LifeSpan Biosciences, IMP321 (ImmuFact) from Immutep, anti-Lag3 antibody BMS-986016, and the LAG-3 chimeric antibody A9H12;
  • B7-H3 inhibitors such as MGA271;
  • KIR inhibitors such as Lirilumab (IPH2101);
  • CD137 (41BB) inhibitors such as urelumab (BMS-663513, Bristol-Myers Squibb), PF-05082566 (anti-4-1BB, PF-2566, Pfizer), or XmAb-5592 (Xencor);
  • PS inhibitors such as Bavituximab
  • inhibitors such as an antibody or fragments (e.g., a monoclonal antibody, a human, humanized, or chimeric antibody) thereof, RNAi molecules, or small molecules to TIM3, CD52, CD30, CD20, CD33, CD27, OX40 (CD134), GITR, ICOS, BTLA (CD272), CD160, 2B4, LAIR1, TIGHT, LIGHT, DR3, CD226, CD2, or SLAM.
  • an antibody or fragments e.g., a monoclonal antibody, a human, humanized, or chimeric antibody
  • RNAi molecules e.g., RNAi molecules, or small molecules to TIM3, CD52, CD30, CD20, CD33, CD27, OX40 (CD134), GITR, ICOS, BTLA (CD272), CD160, 2B4, LAIR1, TIGHT, LIGHT, DR3, CD226, CD2, or SLAM.
  • a binding moiety A comprising an immune checkpoint inhibitor is used for the treatment of a disease or disorder (e.g., cancer).
  • the binding moiety A is a bispecific antibody or a binding fragment thereof that comprises an immune checkpoint inhibitor.
  • a binding moiety A comprising an inhibitor of Programmed Death-Ligand 1 (PD-L1, also known as B7-H1, CD274), Programmed Death 1 (PD-1), CTLA-4, PD-L2 (B7-DC, CD273), LAG3, TIM3, 2B4, A2aR, B7H1, B7H3, B7H4, BTLA, CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD137,CD160, CD226, CD276, DR3, GAL9, GITR, HAVCR2, HVEM, IDO1, IDO2, ICOS (inducible T cell costimulator), KIR, LAIR1, LIGHT, MARCO (macrophage receptor with collageneous structure), PS (phosphatidylserine), OX-40, SLAM, TIGHT, VISTA, VTCN1, or any combinations thereof, is used for the treatment of a disease or disorder (e.g., cancer).
  • a disease or disorder
  • a molecule of Formula (I) in combination with an immune checkpoint inhibitor is used for the treatment of a disease or disorder (e.g., cancer).
  • the immune checkpoint inhibitor comprises an inhibitor of Programmed Death-Ligand 1 (PD-L1, also known as B7-H1, CD274), Programmed Death 1 (PD-1), CTLA-4, PD-L2 (B7-DC, CD273), LAG3, TIM3, 2B4, A2aR, B7H1, B7H3, B7H4, BTLA, CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD137, CD160, CD226, CD276, DR3, GAL9, GITR, HAVCR2, HVEM, IDO1, IDO2, ICOS (inducible T cell costimulator), KIR, LAIR1, LIGHT, MARCO (macrophage receptor with collageneous structure), PS (phosphatidylserine), OX-40, SLAM, T-Ligand 1 (
  • a molecule of Formula (I) is used in combination with ipilimumab, tremelimumab, nivolumab, pemrolizumab, pidilizumab, MPDL3280A, MEDI4736, MSB0010718C, MK-3475, or BMS-936559, for the treatment of a disease or disorder (e.g., cancer).
  • a disease or disorder e.g., cancer
  • the immune-targeting agent is a cytokine.
  • cytokine is further subgrouped into chemokine, interferon, interleukin, and tumor necrosis factor.
  • chemokine plays a role as a chemoattractant to guide the migration of cells, and is classified into four subfamilies CXC, CC, CX3C, and XC.
  • chemokines include chemokines from the CC subfamily: CCL1, CCL2 (MCP-1), CCL3, CCL4, CCL5 (RANTES), CCL6, CCL7, CCL8, CCL9 (or CCL10), CCL11, CCL12, CCL13, CCL14, CCL1.5, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, and CCL28; the CXC subfamily: CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, and CXCL17; the XC subfamily: XCL1 and XCL2; and the CX3C subfamily CX3CL1.
  • Interferon comprises interferon type I (e.g. IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , and IFN- ⁇ ), interferon type II (e.g. IFN- ⁇ ), and interferon type III.
  • IFN- ⁇ is further classified into about 13 subtypes which include IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, and IFNA21.
  • Interleukin is expressed by leukocyte or white blood cell and promote the development and differentiation of T and B lymphocytes and hematopoietic cells.
  • exemplary interleukins include IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 (CXCL8), IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-35, and IL-36.
  • Tumor necrosis factors are a group of cytokines that modulate apoptosis.
  • TNFs tumor necrosis factors
  • TNF ⁇ lymphotoxin-alpha
  • LT-beta lymphotoxin-beta
  • T cell antigen gp39 CD40L
  • CD27L CD30L
  • FASL 4-1BBL
  • OX40L TNF-related apoptosis inducing ligand
  • a molecule of Formula (I) in combination with a cytokine is used for the treatment of a disease or disorder (e.g., cancer).
  • a molecule of Formula (I) in combination with a chemokine is used for the treatment of a disease or disorder (e.g., cancer).
  • a molecule of Formula (I) in combination with an interferon is used for the treatment of a disease or disorder (e.g., cancer).
  • a molecule of Formula (I) in combination with an interleukin is used for the treatment of a disease or disorder (e.g., cancer).
  • a molecule of Formula (I) in combination with a tumor necrosis factor is used for the treatment of a disease or disorder (e.g., cancer).
  • a molecule of Formula (I) in combination with IL-1 ⁇ , IL-2, IL-7, IL-8, IL-15, MCP-1 (CCL2), MIP-1 ⁇ , RANTES, MCP-3, MIP5, CCL19, CCL21, CXCL2, CXCL9, CXCL10, or CXCL11 is used for the treatment of a disease or disorder (e.g., cancer).
  • the composition or a pharmaceutical formulation described herein comprises a vaccine.
  • the vaccine is an in situ vaccination.
  • the vaccine is a cell-based vaccine.
  • the vaccine is a non-cell based vaccine.
  • a molecule of Formula (I) in combination with dendritic cell-based vaccine is used for the treatment of a disease or disorder (e.g., cancer).
  • a molecule of Formula (I) in combination with tumor cell-based vaccine is used for the treatment of a disease or disorder (e.g., cancer).
  • a molecule of Formula (I) in combination with antigen vaccine is used for the treatment of a disease or disorder (e.g., cancer).
  • a molecule of Formula (I) in combination with anti-idiotype vaccine is used for the treatment of a disease or disorder (e.g., cancer).
  • a molecule of Formula (I) in combination with DNA vaccine is used for the treatment of a disease or disorder (e.g., cancer).
  • a molecule of Formula (I) in combination with vector-based vaccine is used for the treatment of a disease or disorder (e.g., cancer).
  • a composition or a pharmaceutical formulation described herein is used as a passive immuno-oncology therapy method for the treatment of a disease or disorder (e.g., cancer).
  • the passive method in some instances, utilizes adoptive immune system components such as T cells, natural killer (NK) T cells, and/or chimeric antigen receptor (CAR) T cells generated exogenously to attack cancer cells.
  • adoptive immune system components such as T cells, natural killer (NK) T cells, and/or chimeric antigen receptor (CAR) T cells generated exogenously to attack cancer cells.
  • a molecule of Formula (I) in combination with a T-cell based therapeutic agent is used for the treatment of a disease or disorder (e.g., cancer).
  • the T-cell based therapeutic agent is an activated T-cell agent that recognizes one or more of a CD cell surface marker described above.
  • the T-cell based therapeutic agent comprises an activated T-cell agent that recognizes one or more of CD2, CD3, CD4, CD5, CD8, CD27, CD28, CD80, CD134, CD137, CD152, CD154, CD160, CD200R, CD223, CD226, CD244, CD258, CD267, CD272, CD274, CD278, CD279, or CD357.
  • a molecule of Formula (I) in combination with an activated T-cell agent recognizing one or more of CD2, CD3, CD4, CD5, CD8, CD27, CD28, CD80, CD134, CD137, CD152, CD154, CD160, CD200R, CD223, CD226, CD244, CD258, CD267, CD272, CD274, CD278, CD279, or CD357 is used for the treatment of a disease or disorder (e.g., cancer).
  • a molecule of Formula (I) in combination with natural killer (NK) T cell-based therapeutic agent is used for the treatment of a disease or disorder (e.g., cancer).
  • the NK-based therapeutic agent is an activated NK agent that recognizes one or more of a CD cell surface marker described above.
  • the NK-based therapeutic agent is an activated NK agent that recognizes one or more of CD2, CD11a, CD11b, CD16, CD56, CD58, CD62L, CD85j, CD158a/b, CD158c, CD158e/f/k, CD158h/j, CD159a, CD162, CD226, CD314, CD335, CD337, CD244, or CD319.
  • a molecule of Formula (I) in combination with an activated NK agent recognizing one or more of CD2, CD11a, CD11b, CD16, CD56, CD58, CD62L, CD85j, CD158a/b, CD158c, CD158e/f/k, CD158h/j, CD159a, CD162, CD226, CD314, CD335, CD337, CD244, or CD319 is used for the treatment of a disease or disorder (e.g., cancer).
  • a disease or disorder e.g., cancer
  • a molecule of Formula (I) in combination with CAR-T cell-based therapeutic agent is used for the treatment of a disease or disorder (e.g., cancer).
  • a disease or disorder e.g., cancer
  • a molecule of Formula (I) in combination with an additional agent that destabilizes the endosomal membrane (or disrupts the endosomal-lysosomal membrane trafficking) is used for the treatment of a disease or disorder (e.g., cancer).
  • the additional agent comprises an antimitotic agent.
  • antimitotic agents include, but are not limited to, taxanes such as paclitaxel and docetaxel; vinca alkaloids such as vinblastine, vincristine, vindesine, and vinorelbine; cabazitaxel; colchicine; eribulin; estramustine; etoposide; ixabepilone; podophyllotoxin; teniposide; or griseofulvin.
  • the additional agent comprises paclitaxel, docetaxel, vinblastine, vincristine, vindesine, vinorelbine, cabazitaxel, colchicine, eribulin, estramustine, etoposide, ixabepilone, podophyllotoxin, teniposide, or griseofulvin.
  • the additional agent comprises taxol.
  • the additional agent comprises paclitaxel.
  • the additional agent comprises etoposide.
  • the additional agent comprises vitamin K3.
  • composition or a pharmaceutical formulation described herein is used as a combinatory method (including for both active and passive methods) in the treatment of a disease or disorder (e.g., cancer).
  • a disease or disorder e.g., cancer
  • the pharmaceutical formulations described herein are administered to a subject by multiple administration routes, including but not limited to, parenteral (e.g., intravenous, subcutaneous, intramuscular), oral, intranasal, buccal, rectal, or transdermal administration routes.
  • parenteral e.g., intravenous, subcutaneous, intramuscular
  • oral e.g., intranasal
  • buccal e.g., buccal
  • transdermal administration routes e.g., transdermal administration routes.
  • the pharmaceutical composition describe herein is formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular) administration.
  • the pharmaceutical composition describe herein is formulated for oral administration.
  • the pharmaceutical composition describe herein is formulated for intranasal administration.
  • the pharmaceutical formulations include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate-release formulations, controlled-release formulations, fast melt formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and mixed immediate and controlled release formulations.
  • aqueous liquid dispersions self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate-release formulations, controlled-release formulations, fast melt formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and mixed immediate and controlled release formulations.
  • the pharmaceutical formulation includes multiparticulate formulations.
  • the pharmaceutical formulation includes nanoparticle formulations.
  • nanoparticles comprise cMAP, cyclodextrin, or lipids.
  • nanoparticles comprise solid lipid nanoparticles, polymeric nanoparticles, self-emulsifying nanoparticles, liposomes, microemulsions, or micellar solutions.
  • Additional exemplary nanoparticles include, but are not limited to, paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as with covalently attached metal chelates), nanofibers, nanohorns, nano-onions, nanorods, nanoropes and quantum dots.
  • a nanoparticle is a metal nanoparticle, e.g., a nanoparticle of scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, yttrium, zirconium, niobium, molybdenum, ruthenium, rhodium, palladium, silver, cadmium, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum, gold, gadolinium, aluminum, gallium, indium, tin, thallium, lead, bismuth, magnesium, calcium, strontium, barium, lithium, sodium, potassium, boron, silicon, phosphorus, germanium, arsenic, antimony, and combinations, alloys or oxides thereof.
  • a metal nanoparticle e.g., a nanoparticle of scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel
  • a nanoparticle includes a core or a core and a shell, as in a core-shell nanoparticle.
  • a nanoparticle is further coated with molecules for attachment of functional elements (e.g., with one or more of a polynucleic acid molecule or binding moiety described herein).
  • a coating comprises chondroitin sulfate, dextran sulfate, carboxymethyl dextran, alginic acid, pectin, carragheenan, fucoidan, agaropectin, porphyran, karaya gum, gellan gum, xanthan gum, hyaluronic acids, glucosamine, galactosamine, chitin (or chitosan), polyglutamic acid, polyaspartic acid, lysozyme, cytochrome C, ribonuclease, trypsinogen, chymotrypsinogen, ⁇ -chymotrypsin, polylysine, polyarginine, histone, protamine, ovalbumin, dextrin, or cyclod
  • a nanoparticle has at least one dimension of less than about 500 nm, 400 nm, 300 nm, 200 nm, or 100 nm.
  • the nanoparticle formulation comprises paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as with covalently attached metal chelates), nanofibers, nanohorns, nano-onions, nanorods, nanoropes or quantum dots.
  • a polynucleic acid molecule or a binding moiety described herein is conjugated either directly or indirectly to the nanoparticle. In some instances, at least 1, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more polynucleic acid molecules or binding moieties described herein are conjugated either directly or indirectly to a nanoparticle.
  • the pharmaceutical formulations include a carrier or carrier materials selected on the basis of compatibility with the composition disclosed herein, and the release profile properties of the desired dosage form.
  • exemplary carrier materials include, e.g., binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like.
  • Pharmaceutically compatible carrier materials include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerine, magnesium silicate, polyvinylpyrrollidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, and the like.
  • PVP polyvinylpyrrollidone
  • the pharmaceutical formulations further include pH-adjusting agents or buffering agents which include acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane; and buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride.
  • acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids
  • bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane
  • buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride.
  • acids, bases and buffers are included in an amount required to maintain pH of the composition in an acceptable range.
  • the pharmaceutical formulation includes one or more salts in an amount required to bring osmolality of the composition into an acceptable range.
  • salts include those having sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions; suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate.
  • the pharmaceutical formulations further include diluent which are used to stabilize compounds because they can provide a more stable environment.
  • Salts dissolved in buffered solutions are utilized as diluents in the art, including, but not limited to a phosphate buffered saline solution.
  • diluents increase bulk of the composition to facilitate compression or create sufficient bulk for homogenous blend for capsule filling.
  • Such compounds can include e.g., lactose, starch, mannitol, sorbitol, dextrose, microcrystalline cellulose such as Avicel®; dibasic calcium phosphate, dicalcium phosphate dihydrate; tricalcium phosphate, calcium phosphate; anhydrous lactose, spray-dried lactose; pregelatinized starch, compressible sugar, such as Di-Pac® (Amstar); mannitol, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose acetate stearate, sucrose-based diluents, confectioner's sugar; monobasic calcium sulfate monohydrate, calcium sulfate dihydrate; calcium lactate trihydrate, dextrates; hydrolyzed cereal solids, amylose; powdered cellulose, calcium carbonate; glycine, kaolin; mannitol, sodium chloride; inositol, bentonite, and the like.
  • the pharmaceutical formulations include disintegration agents or disintegrants to facilitate the breakup or disintegration of a substance.
  • disintegration agents include a starch, e.g., a natural starch such as corn starch or potato starch, a pregelatinized starch such as National 1551 or Amijel®, or sodium starch glycolate such as Promogel® or Explotab®, a cellulose such as a wood product, methylcrystalline cellulose, e.g., Avicel®, Avicel® PH101, Avicel® PH102, Avicel® PH105, Elcema® P100, Emcocel®, Vivacel®, Ming Tia®, and Solka-Floc®, methylcellulose, croscarmellose, or a cross-linked cellulose, such as cross-linked sodium carboxymethylcellulose (Ac-Di-Sol®), cross-linked carb
  • the pharmaceutical formulations include filling agents such as lactose, calcium carbonate, calcium phosphate, dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starches, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, and the like.
  • lactose calcium carbonate, calcium phosphate, dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starches, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, and the like.
  • Lubricants and glidants are also optionally included in the pharmaceutical formulations described herein for preventing, reducing or inhibiting adhesion or friction of materials.
  • Exemplary lubricants include, e.g., stearic acid, calcium hydroxide, talc, sodium stearyl fumerate, a hydrocarbon such as mineral oil, or hydrogenated vegetable oil such as hydrogenated soybean oil (Sterotex®), higher fatty acids and their alkali-metal and alkaline earth metal salts, such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearates, glycerol, talc, waxes, Stearowet®, boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, a polyethylene glycol (e.g., PEG-4000) or a methoxypolyethylene glycol such as CarbowaxTM, sodium oleate, sodium benzoate, glyceryl behenate, polyethylene glycol, magnesium or
  • Plasticizers include compounds used to soften the microencapsulation material or film coatings to make them less brittle. Suitable plasticizers include, e.g., polyethylene glycols such as PEG 300, PEG 400, PEG 600, PEG 1450, PEG 3350, and PEG 800, stearic acid, propylene glycol, oleic acid, triethyl cellulose and triacetin. Plasticizers can also function as dispersing agents or wetting agents.
  • Solubilizers include compounds such as triacetin, triethylcitrate, ethyl oleate, ethyl caprylate, sodium lauryl sulfate, sodium doccusate, vitamin E TPGS, dimethylacetamide, N-methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropylmethyl cellulose, hydroxypropyl cyclodextrins, ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, polyethylene glycol 200-600, glycofurol, transcutol, propylene glycol, dimethyl isosorbide, and the like.
  • Stabilizers include compounds such as any antioxidation agents, buffers, acids, preservatives and the like.
  • Suspending agents include compounds such as polyvinylpyrrolidone, e.g., polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30, vinyl pyrrolidone/vinyl acetate copolymer (S630), polyethylene glycol, e.g., the polyethylene glycol can have a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, hydroxymethylcellulose acetate stearate, polysorbate-80, hydroxyethylcellulose, sodium alginate, gums, such as, e.g., gum tragacanth and gum acacia, guar gum, xanthans, including xanthan gum, sugars, cellulosics, such as, e.g
  • Surfactants include compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, e.g., Pluronic® (BASF), and the like.
  • compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, e.g., Pluronic® (BASF), and the like.
  • Pluronic® Pluronic®
  • Additional surfactants include polyoxyethylene fatty acid glycerides and vegetable oils, e.g., polyoxyethylene (60) hydrogenated castor oil; and polyoxyethylene alkylethers and alkylphenyl ethers, e.g., octoxynol 10, octoxynol 40. Sometimes, surfactants is included to enhance physical stability or for other purposes.
  • Viscosity enhancing agents include, e.g., methyl cellulose, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxypropylmethyl cellulose acetate stearate, hydroxypropylmethyl cellulose phthalate, carbomer, polyvinyl alcohol, alginates, acacia, chitosans and combinations thereof.
  • Wetting agents include compounds such as oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, sodium docusate, sodium oleate, sodium lauryl sulfate, sodium doccusate, triacetin, Tween 80, vitamin E TPGS, ammonium salts and the like.
  • the pharmaceutical compositions described herein are administered for therapeutic applications.
  • the pharmaceutical composition is administered once per day, twice per day, three times per day or more.
  • the pharmaceutical composition is administered daily, every day, every alternate day, five days a week, once a week, every other week, two weeks per month, three weeks per month, once a month, twice a month, three times per month, or more.
  • the pharmaceutical composition is administered for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, or more.
  • one or more pharmaceutical compositions are administered simutaneously, sequentially, or at an interval period of time. In some embodiments, one or more pharmaceutical compositions are administered simutaneously. In some cases, one or more pharmaceutical compositions are administered sequentially. In additional cases, one or more pharmaceutical compositions are administered at an interval period of time (e.g., the first administration of a first pharmaceutical composition is on day one followed by an interval of at least 1, 2, 3, 4, 5, or more days prior to the administration of at least a second pharmaceutical composition).
  • two or more different pharmaceutical compositions are coadministered. In some instances, the two or more different pharmaceutical compositions are coadministered simutaneously. In some cases, the two or more different pharmaceutical compositions are coadministered sequentially without a gap of time between administrations. In other cases, the two or more different pharmaceutical compositions are coadministered sequentially with a gap of about 0.5 hour, 1 hour, 2 hour, 3 hour, 12 hours, 1 day, 2 days, or more between administrations.
  • the administration of the composition is given continuously; alternatively, the dose of the composition being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a “drug holiday”).
  • the length of the drug holiday varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days.
  • the dose reduction during a drug holiday is from 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
  • a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, are optionally reduced, as a function of the symptoms, to a level at which the improved disease, disorder or condition is retained.
  • the amount of a given agent that correspond to such an amount varies depending upon factors such as the particular compound, the severity of the disease, the identity (e.g., weight) of the subject or host in need of treatment, but nevertheless is routinely determined in a manner known in the art according to the particular circumstances surrounding the case, including, e.g., the specific agent being administered, the route of administration, and the subject or host being treated.
  • the desired dose is conveniently presented in a single dose or as divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, for example as two, three, four or more sub-doses per day.
  • toxicity and therapeutic efficacy of such therapeutic regimens are determined by standard pharmaceutical procedures in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between the toxic and therapeutic effects is the therapeutic index and it is expressed as the ratio between LD50 and ED50.
  • Compounds exhibiting high therapeutic indices are preferred.
  • the data obtained from cell culture assays and animal studies are used in formulating a range of dosage for use in human.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage varies within this range depending upon the dosage form employed and the route of administration utilized.
  • kits and articles of manufacture for use with one or more of the compositions and methods described herein.
  • Such kits include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a method described herein.
  • Suitable containers include, for example, bottles, vials, syringes, and test tubes.
  • the containers are formed from a variety of materials such as glass or plastic.
  • the articles of manufacture provided herein contain packaging materials.
  • packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.
  • the container(s) include a molecule of Formula (I): A-X-B-Y-C, optionally conjugated to an endosomolytic moiety D as disclosed herein.
  • kits optionally include an identifying description or label or instructions relating to its use in the methods described herein.
  • a kit typically includes labels listing contents and/or instructions for use and package inserts with instructions for use. A set of instructions will also typically be included.
  • a label is on or associated with the container.
  • a label is on a container when letters, numbers, or other characters forming the label are attached, molded or etched into the container itself; a label is associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert.
  • a label is used to indicate that the contents are to be used for a specific therapeutic application. The label also indicates directions for use of the contents, such as in the methods described herein.
  • the pharmaceutical compositions are presented in a pack or dispenser device which contains one or more unit dosage forms containing a compound provided herein.
  • the pack for example, contains metal or plastic foil, such as a blister pack.
  • the pack or dispenser device is accompanied by instructions for administration.
  • the pack or dispenser is also accompanied with a notice associated with the container in form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the drug for human or veterinary administration. Such notice, for example, is the labeling approved by the U.S. Food and Drug Administration for prescription drugs, or the approved product insert.
  • compositions containing a compound provided herein formulated in a compatible pharmaceutical carrier are also prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
  • ranges and amounts can be expressed as “about” a particular value or range. About also includes the exact amount. Hence “about 5 ⁇ L” means “about 5 ⁇ L” and also “5 ⁇ L.” Generally, the term “about” includes an amount that is expected to be within experimental error.
  • the terms “individual(s)”, “subject(s)” and “patient(s)” mean any mammal.
  • the mammal is a human.
  • the mammal is a non-human. None of the terms require or are limited to situations characterized by the supervision (e.g. constant or intermittent) of a health care worker (e.g. a doctor, a registered nurse, a nurse practitioner, a physician's assistant, an orderly or a hospice worker).
  • a health care worker e.g. a doctor, a registered nurse, a nurse practitioner, a physician's assistant, an orderly or a hospice worker.
  • Tables 1, 4, 7, 8, and 10 illustrate target sequences described herein.
  • Tables 2, 3, 5, 6, 9, 11, and 12 illustrate polynucleic acid molecule sequences described herein.
  • siRNA sequence with siRNA sequence with sequence chemical modification SEQ chemical modification SEQ position in sense strand ID antisense strand ID ID # NM_033360.2 sequence (5′-3′) NO: sequence (5′-3′) NO: 182 182-200 auGfaCfuGfaAfuAfuAf 46 CfAfaGfuUfuAfuAfuUfcAfgU aAfcUfuGfdTsdT fcAfudTsdT 47 183 183-201 ugAfcUfgAfaUfaUfaAf 48 AfCfaAfgUfuUfaUfaUfuCfaGf 49 aCfuUfgUfdTsdT uCfadTsdT 197 197-215 cuUfgUfgGfuAfgUfuGf 50 CfAfgCfuC
  • PIK3CA TGCTGTTGACAGTGAGCGCCAGCTCAAAGCAATTT 2003 1746 CTACATAGTGAAGCCACAGATGTATGTAGAAATTG CTTTGAGCTGTTGCCTACTGCCTCGGA PIK3CA 5290 PIK3CA_ TGCTGTTGACAGTGAGCGAAAGGATGAAACACAAA 2004 2328 AGGTATAGTGAAGCCACAGATGTATACCTTTTGTGT TTCATCCTTCTGCCTACTGCCTCGGA PIK3CA 5290 PIK3CA_ TGCTGTTGACAGTGAGCGCCATGTCAGAGTTACTG 2005 2522 TTTCATAGTGAAGCCACAGATGTATGAAACAGTAA CTCTGACATGATGCCTACTGCCTCGGA PIK3CA 5290 PIK3CA_ TGCTGTTGACAGTGAGCGCCATGTCAGAGTTACTG 2005 2522 TTTCATAGTGAAGCCACAGATGTATGAAACAGTAA CTCTGACATGATGCCTACTGCCTCGGA PIK3CA 5
  • PIK3CA and PIK3CB siRNA Sequences SEQ SEQ Gene Gene ID ID Symbol ID Name siRNA Guide NO: siRNA passenger NO: PIK3CA 5290 PIK3CA_ UGUAGAAAUUGCUU 2013 AGCUCAAAGCAAUUU 2014 1746 UGAGCUGU CUACAUA PIK3CA 5290 PIK3CA UACCUUUUGUGUUU 2015 AGGAUGAAACACAAA 2016 2328 CAUCCUUC AGGUAUA PIK3CA 5290 PIK3CA_ UGAAACAGUAACUC 2017 AUGUCAGAGUUACUG 2018 2522 UGACAUGA UUUCAUA PIK3CA 5290 PIK3CA UAAUUUUGAAAUGA 2019 ACUAGUUCAUUUCAA 2020 3555 ACUAGUUU AAUUAUA PIK3CA 5290 PIK3CA_ UUUUAUUUCUGUUC 2021 CAGCAAGAACAGAAA 2022 3484 UUGCUGUA UAA
  • Plasma samples were directly diluted in TE buffer. 50 mg tissue pieces were homogenized in 1 mL of Trizol using a FastPrep-24 tissue homogenizer (MP Biomedicals) and then diluted in TE buffer. Standard curves were generated by spiking siRNA into plasma or homogenized tissue from untreated animals and then serially diluting with TE buffer. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit (Applied Biosystems) with 25 nM of a sequence-specific stem-loop RT primer.
  • the cDNA from the RT step was utilized for real-time PCR using TaqMan Fast Advanced Master Mix (Applied Biosystems) with 1.5 ⁇ M of forward primer, 0.75 ⁇ M of reverse primer, and 0.2 ⁇ M of probe.
  • the sequences of KRAS and EGFR siRNA antisense strands and all primers and probes used to measure them are shown in Table 13.
  • Quantitative PCR reactions were performed using standard cycling conditions in a ViiA 7 Real-Time PCR System (Life Technologies). The Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.
  • Target Name Sequence SEQ ID NO: KRAS Antisense UGAAUUAGCUGUAUCGUCAUU 2033 KRAS RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGA 2034 TACGACAATGACG KRAS Forward GGCGGCTGAATTAGCTGTATCGT 2035 KRAS Reverse AGTGCAGGGTCCGAG 2036 KRAS Probe (6FAM)-TGGATACGACAATGAC-(NFQ-MGB) 2037 Target Name Sequence (5′-3′) EGFR Antisense ACUCGUGCCUUGGCAAACUUU 2038 EGFR RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGA 2039 TACGACAAAGTTTG EGFR Forward GGCGGCACTCGTGCCTTGGCA 2040 EGFR Reverse AGTGCAGGGTCCG
  • RNA samples were homogenized in Trizol as described above.
  • Total RNA was isolated using RNeasy RNA isolation 96-well plates (Qiagen), then 500 ng RNA was reverse transcribed with a High Capacity RNA to cDNA kit (ThermoFisher).
  • KRAS, EGFR, CTNNB1 and PPIB mRNA was quantified by TaqMan qPCR analysis performed with a ViiA 7 Real-Time PCR System.
  • the TaqMan primers and probes for KRAS were designed and validated by Avidity and are shown in Table 14.
  • the TaqMan primers and probes for EGFR and CTNNB1 were purchased from Applied Biosystems as pre-validated gene expression assays.
  • PPIB housekeeping gene
  • KRAS target gene
  • CTNNB1 PPIB Ct value
  • ⁇ Ct PPIB Ct value
  • Target Species Name Sequence (5'-3') SEQ ID NO: KRAS Mouse Forward CGCCTTGACGATACAGCTAAT 2043 KRAS Mouse Reverse TGTTTCCTGTAGGAGTCCTCTAT 2044 KRAS Mouse Probe (6FAM)- 2045 and 2114 TCACTTTGT(Zen)GGATGAGTATGACCCTACG- (IABkFQ) Target Species Name Sequence (5-3') KRAS Human Forward GTGCCTTGACGATACAGCTAAT 2046 KRAS Human Reverse CCAAGAGACAGGTTTCTCCATC 2047 KRAS Human Probe (6FAM)- 2048 and 2115 CCAACAATA(Zen)GAGGATTCCTACAGGAAGCA- (IABkFQ)
  • mice All animal studies were conducted following protocols in accordance with the Institutional Animal Care and Use Committee (IACUC) at Explora BioLabs, which adhere to the regulations outlined in the USDA Animal Welfare Act as well as the “Guide for the Care and Use of Laboratory Animals” (National Research Council publication, 8th Ed., revised in 2011). All mice were obtained from either Charles River Laboratories or Harlan Laboratories.
  • IACUC Institutional Animal Care and Use Committee
  • H358 subcutaneous flank tumor model tumor cells were inoculated and tumors were established according to the following methods.
  • Female NCr nu/nu mice were identified by ear-tag the day before cell injection. Mice were weighed prior to inoculation.
  • H358 cells were cultured with 10% FBS/RPMI medium and harvested with 0.05% Trypsin and Cell Stripper (MediaTech). 5 million H358 cells in 0.05 ml Hank's Balanced Salt Solution (HBSS) with Matrigel (1:1) were injected subcutaneously (SC) into the upper right flank of each mouse.
  • HBSS Hank's Balanced Salt Solution
  • SC subcutaneously
  • Tumor growth was monitored by tumor volume measurement using a digital caliper starting on day 7 after inoculation, and followed 2 times per week until average tumor volume reaches >100 & ⁇ 300 mm 3 .
  • tumor cells were inoculated and tumors were established according to the following methods.
  • Female NCr nu/nu mice were identified by ear-tag the day before, mice will be anesthetized with isoflurane. The mice were then placed in a supine position on a water circulating heating pad to maintain body temperature. A small transverse incision below the sternum will be made to expose the liver.
  • Cancer cells were slowly injected into the upper left lobe of the liver using a 28-gauge needle. The cells were injected at a 30-degree angle into the liver, so that a transparent bleb of cells can be seen through the liver capsule.
  • Hep 3B2.1 7 cells were prepared by suspending in cold PBS (0.1-5 ⁇ 10 6 cells) and mixing with diluted matrigel (30 ⁇ in PBS). 30-50 ul of the cell/matrigel was inoculated. After injection, a small piece of sterile gauze was placed on the injection site, and light pressure was applied for 1 min to prevent bleeding. The abdomen was then closed with a 6-0 silk suture. After tumor cell implantation, animals were kept in a warm cage, observed for 1-2 h, and subsequently returned to the animal room after full recovery from the anesthesia. 7-10 days after tumor implantation animals were randomized, divided into the required groups and then treated as described in the individual experiments.
  • LNCaP cells (ATCC® CRL-1740TM) were grown in RPMI+10% FBS supplemented with non-essential amino acids and sodium pyruvate to a confluency of about 80%. Cells were mixed 1:1 with matrigel and 5-7*106 cells injected subcutaneously into male SCID mice (6-8 weeks). Tumors usually developed within 3-5 weeks to a size of 100-350 mm 3 . Animals bearing tumors within this range were randomized and treated with ASCs by injections into the tail vein. For PD studies animals were sacrificed 96 hours after injection and organ fragments harvested, weighted, and frozen in liquid nitrogen.
  • RNA isolation organ samples were homogenized in Trizol and RNA prepared using a Qiagen RNeasy 96 Plus kit following the instructions by the manufacturer. RNA concentrations were determined spectroscopically. RNAs were converted into cDNAs by reverse transcription and expression of specific targets quantified by qPCR using the ⁇ CT method and validated Taqman assays (Thermofisher). Samples were standardize to the expression levels of PPIB.
  • siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. Structure of cholesterol conjugated to the passenger strand is illustrated in FIG. 2 .
  • Table 15 shows KRAS, EGFR, and CTNNB1 siRNA sequences.
  • siRNA chemical modifications include:
  • INF7 peptide is as illustrated in FIG. 3 (SEQ ID NO: 2055).
  • Melittin peptide is as illustrated in FIG. 4 (SEQ ID NO: 2060).
  • Anti-EGFR antibody is a fully human IgG1 ⁇ monoclonal antibody directed against the human epidermal growth factor receptor (EGFR). It is produced in the Chinese Hamster Ovary cell line DJT33, which has been derived from the CHO cell line CHO-K1SV by transfection with a GS vector carrying the antibody genes derived from a human anti-EGFR antibody producing hybridoma cell line (2F8). Standard mammalian cell culture and purification technologies are employed in the manufacturing of anti-EGFR antibody.
  • the theoretical molecular weight (MW) of anti-EGFR antibody without glycans is 146.6 kDa.
  • the experimental MW of the major glycosylated isoform of the antibody is 149 kDa as determined by mass spectrometry.
  • SDS-PAGE under reducing conditions the MW of the light chain was found to be approximately 25 kDa and the MW of the heavy chain to be approximately 50 kDa.
  • the heavy chains are connected to each other by two inter-chain disulfide bonds, and one light chain is attached to each heavy chain by a single inter-chain disulfide bond.
  • the light chain has two intra-chain disulfide bonds and the heavy chain has four intra-chain disulfide bonds.
  • the antibody is N-linked glycosylated at Asn305 of the heavy chain with glycans composed of N-acetyl-glucosamine, mannose, fucose and galactose.
  • the predominant glycans present are fucosylated bi-antennary structures containing zero or one terminal galactose residue.
  • the charged isoform pattern of the IgG1 ⁇ antibody has been investigated using imaged capillary IEF, agarose IEF and analytical cation exchange HPLC. Multiple charged isoforms are found, with the main isoform having an isoelectric point of approximately 8.7.
  • anti-EGFR antibody The major mechanism of action of anti-EGFR antibody is a concentration dependent inhibition of EGF-induced EGFR phosphorylation in A431 cancer cells. Additionally, induction of antibody-dependent cell-mediated cytotoxicity (ADCC) at low antibody concentrations has been observed in pre-clinical cellular in vitro studies.
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • Step 1 Antibody Conjugation with Maleimide-PEG-NHS followeded by SH-EGFR
  • Anti-EGFR antibody (EGFR-Ab) was exchanged with 1 ⁇ Phosphate buffer (pH 7.4) and made up to 5 mg/ml concentration.
  • Unreacted maleimide-PEG was removed by spin filtration using 50 kDa MWCO Amicon spin filters and PBS pH 7.4.
  • the antibody-PEG-Mal conjugate was collected and transferred into a reaction vessel.
  • SH-C6-EGFR (2 equivalents) was added at RT to the antibody-PEG-maleimide in PBS and rotated overnight.
  • the reaction mixture was analyzed by analytical SAX column chromatography and conjugate along with unreacted antibody and siRNA was seen.
  • the crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing the antibody-PEG-EGFR conjugate were pooled, concentrated and buffer exchanged with PBS, pH 7.4. Antibody siRNA conjugates with SMCC linker, PEG1 kDa, PEG5 kDa and PEG10 kDa were separated based on the siRNA loading. Conjugates with PEG20 kDa gave poor separation.
  • the isolated conjugate was characterized by either mass spec or SDS-PAGE.
  • the purity of the conjugate was assessed by analytical HPLC using either anion exchange chromatography method-2 or anion exchange chromatography method-3. Examples of all the conjugates made using these methods are described in Table 16.
  • FIG. 5 shows the analytical HPLC of EGFR antibody-PEG20 kDa-EGFR.
  • FIG. 6 shows a SDS-PAGE analysis of EGFR antibody-PEG20 kDa-EGFR conjugate.
  • the analytical chromatogram of EGFR antibody-PEG10 kDa-EGFR is illustrated in FIG. 7 .
  • the analytical data for EGFR antibody-PEG5 kDa-EGFR are illustrated in FIG. 8 and FIG. 9 .
  • FIG. 8 shows the analytical chromatogram of EGFR antibody-PEG5 kDa-EGFR.
  • FIG. 9 shows SDS PAGE analysis of EGFR antibody-PEG10 kDa-EGFR and EGFR antibody-PEG5 kDa-EGFR conjugates.
  • the analytical data for EGFR antibody-PEG1 kDa-EGFR conjugates with different siRNA loading is illustrated in FIG. 10 .
  • Step 1 Antibody Conjugation with SMCC Linker followeded by SH-KRAS-PEG5 kDa
  • Anti-EGFR antibody was exchanged with 1 ⁇ Phosphate buffer (pH 7.4) and made up to 5 mg/ml concentration.
  • 2 equivalents of SMCC linker succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate
  • Unreacted SMCC linker was removed by spin filtration using 50 kDa MWCO Amicon spin filters and PBS buffer pH 7.4.
  • the retentate was collected and 2 equivalents of SH-C6-KRAS-PEG5 kDa was added at RT and rotated overnight.
  • the reaction mixture was analyzed by analytical SAX column chromatography and the conjugate along with unreacted antibody and siRNA was observed.
  • the crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing the antibody-KRAS-PEG conjugate were pooled, concentrated and buffer exchanged with PBS, pH 7.4.
  • the isolated conjugate was characterized by either mass spec or SDS-PAGE.
  • the purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-3 (described in example 1). Examples of the conjugates made using the methods described in Examples 4 and 5 are illustrated in Table 17.
  • the HPLC chromatogram of EGFR Antibody-KRAS-PEG5 kDa is illustrated in FIG. 11 .
  • the HPLC chromatogram of Panitumumab-KRAS-PEG5 kDa is as shown in FIG. 12 .
  • Step 1 Antibody Conjugation with SPDP Linker followeded by SH-siRNA-PEG5 kDa
  • the crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing the antibody-PEG-siRNA conjugate were pooled, concentrated and buffer exchanged with PBS, pH 7.4.
  • Step 1 Antibody Conjugation with SMCC Linker or Maleimide-PEG-NHS followeded by SH-Cys-Peptide-CONH 2
  • Anti-EGFR antibody was exchanged with 1 ⁇ Phosphate buffer (pH 7.4) and made up to 10 mg/ml concentration.
  • 3 equivalents of SMCC linker succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate
  • the retentate was collected and 3 equivalents of SH-Cys-Peptide-CONH 2 was added at RT and rotated overnight.
  • the reaction mixture was then purified by either HIC chromatography or cation exchange chromatography to isolate the anti-EGFR antibody-Peptide or anti-EGFR antibody-PEG1k-Peptide.
  • HIC hydrophobic interaction chromatography
  • the isolated conjugate was characterized by either mass spec or SDS-PAGE. Purity and peptide loading was assessed by analytical HPLC using either HIC method-2 or cation exchange chromatography method-2. Examples of all the conjugates made using the method of Example 6 are described in Tables 18 and 19.
  • Step 1 Conjugation of PEG24 Linker followeded by SH-Cys-Peptide-CONH 2 to EGFR-Ab-siRNA-PEG
  • EGFR-Ab-siRNA-PEG conjugate with a siRNA loading of 1 was conjugated with 4 equivalents of PEG1k linker (succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate) in PBS, pH 7.4 buffer and rotated for 1.5 hours at room temperature. Unreacted PEG1k linker was removed by spin filtration using 50 kDa MWCO Amicon spin filters and PBS buffer pH 7.4. The retentate was collected and 4 equivalents of SH-Cys-Peptide-CONH 2 was added at RT and rotated overnight.
  • PEG1k linker succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate
  • the reaction mixture was then purified by repeated spin filtration using PBS buffer pH7.4 and 50 kDa Amicon spin filters until the unreacted peptide was removed as monitored by HPLC.
  • the product contains a mixture of conjugates with 0, 1, 2, 3 or more peptides conjugated to the antibody backbone.
  • the isolated conjugate was characterized by either mass spec or SDS-PAGE. The purity and the peptide loading of the conjugate was assessed by analytical HPLC using either HIC method-2 or cation exchange chromatography method-2. Examples of the conjugates made using the method described in Example 7 are shown in Table 20.
  • FIG. 19 shows INF7-PEG1 kDa-(EGFR antibody-KRAS-PEG5 kDa).
  • FIG. 20 shows Melittin-PEG1 kDa-(EGFR antibody-KRAS-PEG5 kDa).
  • Treatment groups that received EGFR antibody-siRNA-PEG conjugates were dosed at 0.5 mg/kg (based on the weight of siRNA) and groups that received cholesterol-siRNA conjugates were dosed at 15 mg/kg. All groups (treatments and controls) were administered a dose volume of 5 mL/kg.
  • Non-terminal blood samples were collected at 2, 15, or 60 minutes post-dose via puncture of the retro-orbital plexus and centrifuged to generate plasma for PK analysis. Mice were sacrificed by CO 2 asphyxiation at 24, 96, or 168 h post-dose. Table 21 describes the study design in more detail and provides a cross-reference to the conjugate synthesis and characterization. Terminal blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis. 50 mg pieces of tumor, liver, kidney, and lung were collected and snap-frozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantitation were performed as described in Examples 2-7.
  • PEG linkers of various molecular weights and a small molecule linker were used to attach EGFR siRNA to an EGFR antibody (EGFR-Ab) and the PK was assessed to determine the effect of the linker molecular weight on the behavior of the mAb-siRNA conjugate in plasma.
  • the molecular weight of the PEG linker does not have a large impact on the plasma PK, except for the 10 kDa PEG leads to a faster siRNA clearance (i.e. lower plasma concentrations at later times).
  • the orientation of the siRNA and PEG relative to the EGFR-Ab was also explored. As illustrated in FIG.
  • siRNA in between the EGFR-Ab and the PEG5k results in significantly higher plasma concentrations than the alternative conjugate where PEG5k is in between the EGFR-Ab and the siRNA (EGFR antibody-PEG5k-EGFR).
  • the use of two different siRNAs on these conjugates does not impact the plasma kinetics.
  • the impact of adding an endosomal escape peptide (melittin) was assessed.
  • EGFR antibody-KRAS-PEG5k and EGFR antibody-melittin were mixed together in solution and co-injected. As illustrated in FIG. 24 , the presence of EGFR antibody-melittin increases the clearance from plasma of EGFR antibody-KRAS-PEG5k at later times.
  • the plasma PK of cholesterol-siRNA conjugates was next compared to the mAb-siRNA conjugates after intravenous administration via tail vein injection. As illustrated in FIG. 25 , the chol-siRNA conjugates are cleared much faster from plasma than the mAb-siRNA conjugates. As illustrated from the PK profile, having either EGFR or KRAS siRNA on the conjugate did not affect the plasma kinetics.
  • the molecular weight of the linker between the EGFR-Ab and the EGFR siRNA does not seem to alter the PK of these conjugates in the s.c. flank H358 tumors.
  • the concentration of siRNA in liver following a single i.v. dose of 0.5 mg/kg of EGFR antibody-siRNA is approximately 100 nM at 24 h post-dose, similar to that seen in tumor. Only the small molecule linker at 24 h post-dose produces a siRNA concentration in liver approximately half of what is seen with longer PEG linkers. siRNA concentrations decrease over time in both tumor and liver tissue with these EGFR antibody-linker-siRNA conjugates.
  • both the EGFR antibody-KRAS-PEG5k and the EGFR antibody-PEG5k-EGFR conjugates deliver approximately 100 nM siRNA into both tumor and liver following a single i.v. dose of 0.5 mg/kg.
  • the EGFR antibody-KRAS-PEG5k maintains the siRNA concentration in tumor at approximately 100 nM until 168 h post-dose, the other 3 curves decline in concentration over time.
  • the tissue PK as a function of drug loading was assessed. As illustrated from FIG.
  • n 1 siRNA per EGFR-Ab delivered higher amounts of siRNA into tumor compared to liver.
  • EGFR antibody-melittin was mixed with some formulations in order to introduce endosomal escape functionality. As illustrated from FIG. 29 , mixing and co-administering EGFR antibody-melittin with EGFR antibody-siRNA did not have a large impact on the tissue PK. The addition of melittin decreased uptake of siRNA in tumor and increased the uptake of siRNA in liver.
  • both chol-siRNA conjugates delivered approximately 5 ⁇ NI concentrations of siRNA into liver 24 h following a single i.v. dose of 15 mg/kg.
  • the chol-KRAS appears to clear slightly faster than the chol-EGFR on the 1-week time scale.
  • the two different chol-siRNA conjugates further show different PK profiles in tumor.
  • Both cholesterol conjugates deliver less siRNA into tumor compared to liver, but the chol-EGFR delivers more siRNA into tumor when compared to the chol-KRAS conjugate.
  • Both chol-siRNA conjugates are cleared from tumor over time and with a similar slope.
  • FIG. 31A A PD analysis followed the PK analysis.
  • the chol-KRAS conjugate produced only marginal ( ⁇ 25%) mRNA knockdown of the KRAS target gene in tumor following a single i.v. dose of 15 mg/kg.
  • FIG. 31B the same 15 mg/kg dose of chol-KRAS was able to produce >50% mRNA knockdown in the mouse liver.
  • the chol-EGFR conjugate was able to produce >50% mRNA knockdown in tumor, as illustrated in FIG. 32 .
  • the higher knockdown with chol-EGFR in tumor compared to chol-KRAS is due to the higher siRNA concentrations observed in tumor with chol-EGFR compared to chol-KRAS ( FIG. 30 ).
  • FIGS. 33 and 34 most of the EGFR antibody-siRNA conjugates resulted in approximately 25-50% EGFR or KRAS mRNA knockdown in tumors after a single IV dose, but at a much lower dose (0.5 mg/kg) compared to the chol-siRNA conjugates.
  • Step 1 Antibody Conjugation with SMCC Linker followeded by SH-siRNA
  • the crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-siRNA-PEG conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS.
  • the isolated conjugates were characterized by SAX chromatography, SEC chromatography and SDS-PAGE analysis. The purity of the conjugate was assessed by analytical HPLC using either anion exchange chromatography method-2. All DAR1 conjugate generally eluted at 9.0 ⁇ 0.4 minutes while the DAR2 and DAR3 conjugates generally eluted at 9.7 ⁇ 0.2 minutes. Typical DAR1 conjugate is greater than 90% pure after purification while typical DAR>2 lysine conjugates contains 70-80% DAR2 and 20-30% DAR3.
  • Step 1 Antibody Interchain Disulfide Reduction with TCEP
  • the crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-PEG-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS.
  • the isolated conjugates were characterized by SEC, SAX chromatography and SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using either anion exchange chromatography method-2 or anion exchange chromatography method-3. Isolated DAR1 conjugates are typically eluted at 9.0+0.3 min on analytical SAX method-2 and are greater than 90% pure. The typical DAR>2 cysteine conjugate contains more than 85% DAR2 and less than 15% DAR3.
  • Step 1 Antibody Interchain Disulfide Reduction with TCEP
  • Antibody was buffer exchanged with borax buffer (pH 8) and made up to 10 mg/ml concentration. To this solution, 2 equivalents of TCEP in water was added and rotated for 2 hours at RT. The resultant reaction mixture was buffer exchanged with pH 7.4 PBS containing 5 mM EDTA and added to a solution of CBTF-C6-siRNA-C6-NHCO-PEG-5 kDa (2 equivalents) in pH 7.4 PBS containing 5 mM EDTA at RT and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA.
  • the crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS. Typical DAR>2 cysteine conjugate contains greater than 85% DAR2 and less than 15% DAR3 or higher.
  • the isolated conjugates were characterized by either mass spec or SDS-PAGE.
  • the purity of the conjugate was assessed by analytical HPLC using either anion exchange chromatography method-2 or anion exchange chromatography method-3.
  • Antibody was buffer exchanged with borax buffer (pH 8) and made up to 5 mg/ml concentration. To this solution, 2 equivalents of TCEP in water was added and rotated for 2 hours at RT. The resultant reaction mixture was exchanged with pH 7.4 PBS containing 5 mM EDTA and added to a solution of MBS-C6-siRNA-C6-NHCO-PEG-5 kDa (2 equivalents) in pH 7.4 PBS containing 5 mM EDTA at RT and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA.
  • the crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS. Typical DAR>2 cysteine conjugate contains greater than 85% DAR2 and less than 15% DAR3 or higher.
  • the isolated conjugates were characterized by either mass spec or SDS-PAGE.
  • the purity of the conjugate was assessed by analytical HPLC using either anion exchange chromatography method-2 or anion exchange chromatography method-3.
  • Antibody was buffer exchanged with borax buffer (pH 8) and made up to 5 mg/ml concentration. To this solution, 2 equivalents of TCEP in water was added and rotated for 2 hours at RT. The resultant reaction mixture was exchanged with pH 7.4 PBS containing 5 mM EDTA and added to a solution of MBS-C6-siRNA-C6-NHCO-PEG-5 kDa (2 equivalents) in pH 7.4 PBS containing 5 mM EDTA at RT and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA.
  • the crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS. Typical DAR>2 cysteine conjugate contains greater than 85% DAR2 and less than 15% DAR3 or higher.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
US15/476,849 2016-04-01 2017-03-31 Nucleic acid-polypeptide compositions and uses thereof Abandoned US20170281795A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US15/476,849 US20170281795A1 (en) 2016-04-01 2017-03-31 Nucleic acid-polypeptide compositions and uses thereof
US16/128,393 US20190062435A1 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US16/128,428 US10787519B2 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US16/128,417 US10800848B2 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US17/187,669 US20210179720A1 (en) 2016-04-01 2021-02-26 Nucleic acid-polypeptide compositions and uses thereof
US17/308,888 US20220324984A1 (en) 2016-04-01 2021-05-05 Nucleic acid-polypeptide compositions and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662316919P 2016-04-01 2016-04-01
US15/476,849 US20170281795A1 (en) 2016-04-01 2017-03-31 Nucleic acid-polypeptide compositions and uses thereof

Related Child Applications (4)

Application Number Title Priority Date Filing Date
US16/128,428 Continuation US10787519B2 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US16/128,393 Continuation US20190062435A1 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US16/128,417 Continuation US10800848B2 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US17/187,669 Continuation US20210179720A1 (en) 2016-04-01 2021-02-26 Nucleic acid-polypeptide compositions and uses thereof

Publications (1)

Publication Number Publication Date
US20170281795A1 true US20170281795A1 (en) 2017-10-05

Family

ID=59958453

Family Applications (9)

Application Number Title Priority Date Filing Date
US15/476,849 Abandoned US20170281795A1 (en) 2016-04-01 2017-03-31 Nucleic acid-polypeptide compositions and uses thereof
US16/128,393 Abandoned US20190062435A1 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US16/128,428 Active US10787519B2 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US16/128,417 Active US10800848B2 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US16/128,440 Active US10550188B2 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US16/129,694 Active US10487149B2 (en) 2016-04-01 2018-09-12 Nucleic acid-polypeptide compositions and uses thereof
US16/718,092 Pending US20200123261A1 (en) 2016-04-01 2019-12-17 Nucleic acid-polypeptide compositions and uses thereof
US17/187,669 Pending US20210179720A1 (en) 2016-04-01 2021-02-26 Nucleic acid-polypeptide compositions and uses thereof
US17/308,888 Pending US20220324984A1 (en) 2016-04-01 2021-05-05 Nucleic acid-polypeptide compositions and uses thereof

Family Applications After (8)

Application Number Title Priority Date Filing Date
US16/128,393 Abandoned US20190062435A1 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US16/128,428 Active US10787519B2 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US16/128,417 Active US10800848B2 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US16/128,440 Active US10550188B2 (en) 2016-04-01 2018-09-11 Nucleic acid-polypeptide compositions and uses thereof
US16/129,694 Active US10487149B2 (en) 2016-04-01 2018-09-12 Nucleic acid-polypeptide compositions and uses thereof
US16/718,092 Pending US20200123261A1 (en) 2016-04-01 2019-12-17 Nucleic acid-polypeptide compositions and uses thereof
US17/187,669 Pending US20210179720A1 (en) 2016-04-01 2021-02-26 Nucleic acid-polypeptide compositions and uses thereof
US17/308,888 Pending US20220324984A1 (en) 2016-04-01 2021-05-05 Nucleic acid-polypeptide compositions and uses thereof

Country Status (11)

Country Link
US (9) US20170281795A1 (zh)
EP (1) EP3436588A4 (zh)
JP (3) JP2019513371A (zh)
KR (2) KR20240026257A (zh)
CN (2) CN109715805B (zh)
AU (2) AU2017240799B2 (zh)
CA (1) CA3019568A1 (zh)
MA (1) MA45328A (zh)
MX (1) MX2023008041A (zh)
SG (1) SG11201808619QA (zh)
WO (1) WO2017173408A1 (zh)

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019071028A1 (en) * 2017-10-04 2019-04-11 Avidity Biosciences Llc NUCLEIC ACID-POLYPEPTIDE COMPOSITIONS AND USES THEREOF
WO2019113393A1 (en) * 2017-12-06 2019-06-13 Avidity Biosciences Llc Compositions and methods of treating muscle atrophy and myotonic dystrophy
WO2019136180A3 (en) * 2018-01-04 2019-08-29 Avidity Biosciences Llc Heteroduplex nucleic acid molecules and uses thereof
US10487149B2 (en) 2016-04-01 2019-11-26 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and uses thereof
WO2021042060A1 (en) * 2019-08-30 2021-03-04 Yale University Compositions and methods for delivery of nucleic acids to cells
US20210108201A1 (en) * 2019-10-14 2021-04-15 Aro Biotherapeutics Company FN3 Domain-siRNA Conjugates and Uses Thereof
US10994020B2 (en) 2017-01-06 2021-05-04 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and methods of inducing exon skipping
US20210238602A1 (en) * 2017-09-14 2021-08-05 Arrowhead Pharmaceuticals, Inc. RNAi Agents And Compositions for Inhibiting Expression of Angiopoietin-Like 3 (ANGPTL3), And Methods Of Use
US11111309B2 (en) 2018-08-02 2021-09-07 Dyne Therapeutics, Inc. Method of reducing expression of DUX4 in a muscle cell by administering an anti-transferrin receptor antibody linked to an oligonucleotide targeting DUX4
WO2021188390A1 (en) * 2020-03-19 2021-09-23 Avidity Biosciences, Inc. Compositions and methods of treating facioscapulohumeral muscular dystrophy
US11142767B2 (en) 2017-07-21 2021-10-12 The Governors Of The University Of Alberta Antisense oligonucleotides that bind to exon 51 of human dystrophin pre-mRNA
US11168141B2 (en) 2018-08-02 2021-11-09 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11369689B2 (en) 2018-08-02 2022-06-28 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11446387B2 (en) 2020-03-27 2022-09-20 Avidity Biosciences, Inc. Compositions and methods of treating muscle dystrophy
US11492619B2 (en) * 2019-01-18 2022-11-08 University Of Massachusetts Dynamic pharmacokinetic-modifying anchors
US11578090B2 (en) 2019-06-06 2023-02-14 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and uses thereof
US11628222B2 (en) 2019-10-14 2023-04-18 Aro Biotherapeutics Company CD71 binding fibronectin type III domains
US11633498B2 (en) 2021-07-09 2023-04-25 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US11638761B2 (en) 2021-07-09 2023-05-02 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating Facioscapulohumeral muscular dystrophy
US11648318B2 (en) 2021-07-09 2023-05-16 Dyne Therapeutics, Inc. Anti-transferrin receptor (TFR) antibody and uses thereof
US11702659B2 (en) 2021-06-23 2023-07-18 University Of Massachusetts Optimized anti-FLT1 oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders
US11753638B2 (en) 2016-08-12 2023-09-12 University Of Massachusetts Conjugated oligonucleotides
US11771776B2 (en) 2021-07-09 2023-10-03 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11827882B2 (en) 2018-08-10 2023-11-28 University Of Massachusetts Modified oligonucleotides targeting SNPs
US11834510B2 (en) 2018-12-21 2023-12-05 Avidity Biosciences, Inc. Anti-transferrin receptor antibodies and uses thereof
US11896669B2 (en) 2016-01-31 2024-02-13 University Of Massachusetts Branched oligonucleotides
US11911484B2 (en) 2018-08-02 2024-02-27 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US11931421B2 (en) 2022-04-15 2024-03-19 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating myotonic dystrophy
US11969475B2 (en) 2021-07-09 2024-04-30 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US12006499B2 (en) 2019-06-06 2024-06-11 Avidity Biosciences, Inc. Una amidites and uses thereof
US12018087B2 (en) 2018-08-02 2024-06-25 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of delivering oligonucleotide to a subject
US12024706B2 (en) 2019-08-09 2024-07-02 University Of Massachusetts Modified oligonucleotides targeting SNPs
US12037379B2 (en) 2021-04-14 2024-07-16 Aro Biotherapeutics Company CD71 binding fibronectin type III domains
US12049627B2 (en) 2017-06-23 2024-07-30 University Of Massachusetts Two-tailed self-delivering siRNA
US12071485B2 (en) 2021-09-16 2024-08-27 Avidity Biosciences, Inc. Compositions and methods of treating facioscapulohumeral muscular dystrophy
US12077755B2 (en) 2015-08-14 2024-09-03 University Of Massachusetts Bioactive conjugates for oligonucleotide delivery
US12097263B2 (en) 2018-08-02 2024-09-24 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US12128109B2 (en) 2023-08-24 2024-10-29 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating dystrophinopathies

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6823269B2 (ja) * 2016-06-20 2021-02-03 株式会社ＧｅｎＡｈｅａｄ Ｂｉｏ 抗体−薬物コンジュゲート
CN118772242A (zh) 2017-08-04 2024-10-15 拜斯科技术开发有限公司 Cd137特异性的双环肽配体
TWI825046B (zh) 2017-12-19 2023-12-11 英商拜西可泰克斯有限公司 Epha2特用之雙環胜肽配位基
EP3774851A1 (en) 2018-04-04 2021-02-17 BicycleTX Limited Heterotandem bicyclic peptide complexes
US11180531B2 (en) 2018-06-22 2021-11-23 Bicycletx Limited Bicyclic peptide ligands specific for Nectin-4
GB201810316D0 (en) 2018-06-22 2018-08-08 Bicyclerd Ltd Peptide ligands for binding to EphA2
EP3965827A1 (en) 2019-05-09 2022-03-16 BicycleTX Limited Bicyclic peptide ligands specific for ox40
TW202110485A (zh) 2019-07-30 2021-03-16 英商拜西可泰克斯有限公司 異質雙環肽複合物
WO2021064428A1 (en) 2019-10-03 2021-04-08 Bicycletx Limited Heterotandem bicyclic peptide complexes
CN116056765A (zh) * 2020-08-07 2023-05-02 坦伯公司 反式环辛烯生物正交剂及在癌症和免疫疗法中的用途
CN111996193B (zh) * 2020-09-11 2024-02-20 北京键凯科技股份有限公司 一种有效抑制表皮生长因子受体表达的siRNA序列
WO2022212886A1 (en) * 2021-04-02 2022-10-06 Avidity Biosciences, Inc. Antibody-oligonucleotide conjugate and antibody-peptide-oligonucleotide conjugate compositions and methods of inducing exon skipping
IL311175A (en) 2021-09-01 2024-04-01 Biogen Ma Inc Anti-transferrin receptor antibodies and their uses
CN114099692B (zh) * 2021-11-30 2023-06-09 西南大学 一种抗菌肽-细胞膜复合物、制备方法和应用
CN118660722A (zh) 2021-12-23 2024-09-17 米雷楚来有限公司 用于递送多核苷酸的组合物
US12071621B2 (en) 2022-04-05 2024-08-27 Avidity Biosciences, Inc. Anti-transferrin receptor antibody-PMO conjugates for inducing DMD exon 44 skipping
CN115607563B (zh) * 2022-08-15 2023-11-07 江苏蓝果临床营养科技有限公司 一种烟酰胺单核苷酸复合物及其制备方法
WO2024187057A2 (en) 2023-03-08 2024-09-12 Biogen Ma Inc. Anti-transferrin receptor antibodies and uses thereof
CN116381125A (zh) * 2023-06-05 2023-07-04 迦进生物医药(上海)有限公司 评估与蛋白偶联的核酸稳定性的方法及试剂盒

Family Cites Families (181)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US1000075A (en) 1910-07-27 1911-08-08 William R Collins Tunneling-machine.
US4694778A (en) 1984-05-04 1987-09-22 Anicon, Inc. Chemical vapor deposition wafer boat
EP0639582B1 (en) 1985-03-15 1998-09-16 Antivirals Inc. Polynucleotide assay reagent and method
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US4828971A (en) 1988-03-24 1989-05-09 Eastman Kodak Company Thermally processable element comprising a backing layer
CA1251835A (en) 1988-04-05 1989-03-28 Wai-Cheung Tang Dielectric image-resonator multiplexer
WO1992007065A1 (en) 1990-10-12 1992-04-30 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Modified ribozymes
GB9123947D0 (en) * 1991-11-12 1992-01-02 Imp Cancer Res Tech Therapeutic compounds
US5652094A (en) 1992-01-31 1997-07-29 University Of Montreal Nucleozymes
KR100361933B1 (ko) 1993-09-08 2003-02-14 라 졸라 파마슈티칼 컴파니 화학적으로정의된비중합성결합가플랫폼분자및그것의콘주게이트
EP0765313B1 (en) 1994-06-17 2003-08-20 F. Hoffmann-La Roche Ag N,n'-bis(quinolin-4-yl)-diamine derivatives, their preparation and their use as antimalarials
US5889136A (en) 1995-06-09 1999-03-30 The Regents Of The University Of Colorado Orthoester protecting groups in RNA synthesis
WO1997026270A2 (en) 1996-01-16 1997-07-24 Ribozyme Pharmaceuticals, Inc. Synthesis of methoxy nucleosides and enzymatic nucleic acid molecules
AU728657B2 (en) 1996-03-18 2001-01-18 Board Of Regents, The University Of Texas System Immunoglobulin-like domains with increased half-lives
US9096636B2 (en) 1996-06-06 2015-08-04 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds and their use in gene modulation
US5898031A (en) 1996-06-06 1999-04-27 Isis Pharmaceuticals, Inc. Oligoribonucleotides for cleaving RNA
US5849902A (en) 1996-09-26 1998-12-15 Oligos Etc. Inc. Three component chimeric antisense oligonucleotides
JP2001524808A (ja) 1996-12-10 2001-12-04 ジーントレイス・システムズ・インコーポレイテッド 放出可能な不揮発性の質量標識分子
US20030073207A1 (en) * 1997-01-31 2003-04-17 Saghir Akhtar Enzymatic nucleic acid treatment of diseases or conditions related to levels of epidermal growth factor receptors
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US6111086A (en) 1998-02-27 2000-08-29 Scaringe; Stephen A. Orthoester protecting groups
DK1068241T3 (da) 1998-04-02 2008-02-04 Genentech Inc Antistofvarianter og fragmenter deraf
US6528624B1 (en) 1998-04-02 2003-03-04 Genentech, Inc. Polypeptide variants
US6194551B1 (en) 1998-04-02 2001-02-27 Genentech, Inc. Polypeptide variants
WO1999054459A2 (en) 1998-04-20 1999-10-28 Ribozyme Pharmaceuticals, Inc. Nucleic acid molecules with novel chemical compositions capable of modulating gene expression
GB9816575D0 (en) 1998-07-31 1998-09-30 Zeneca Ltd Novel compounds
DE19956568A1 (de) 1999-01-30 2000-08-17 Roland Kreutzer Verfahren und Medikament zur Hemmung der Expression eines vorgegebenen Gens
US6849272B1 (en) 1999-04-21 2005-02-01 Massachusetts Institute Of Technology Endosomolytic agents and cell delivery systems
DE10160151A1 (de) 2001-01-09 2003-06-26 Ribopharma Ag Verfahren zur Hemmung der Expression eines vorgegebenen Zielgens
DE10100586C1 (de) 2001-01-09 2002-04-11 Ribopharma Ag Verfahren zur Hemmung der Expression eines Ziegens
US7829693B2 (en) 1999-11-24 2010-11-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
CA2328356A1 (en) 1999-12-22 2001-06-22 Itty Atcravi Recreational vehicles
AU767394C (en) 1999-12-29 2005-04-21 Immunogen, Inc. Cytotoxic agents comprising modified doxorubicins and daunorubicins and their therapeutic use
US8273866B2 (en) 2002-02-20 2012-09-25 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SINA)
US7833992B2 (en) 2001-05-18 2010-11-16 Merck Sharpe & Dohme Conjugates and compositions for cellular delivery
US8202979B2 (en) 2002-02-20 2012-06-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
DK2360253T3 (da) 2000-03-30 2014-06-16 Whitehead Biomedical Inst Fremgangsmåde til fremstilling af knockdown-celler eller knockdown-organismer ved hjælp af RNA-sekvensspecifikke formidlere af RNA-interferens og anvendelser deraf
KR20080023768A (ko) 2000-03-30 2008-03-14 화이트헤드 인스티튜트 포 바이오메디칼 리서치 Ｒｎａ 간섭의 ｒｎａ 서열 특이적인 매개체
US6784291B2 (en) 2000-05-04 2004-08-31 Avi Biopharma, Inc. Splice-region antisense composition and method
WO2002044321A2 (en) 2000-12-01 2002-06-06 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Rna interference mediating small rna molecules
US8546143B2 (en) 2001-01-09 2013-10-01 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US6884869B2 (en) 2001-04-30 2005-04-26 Seattle Genetics, Inc. Pentapeptide compounds and uses related thereto
DE10133858A1 (de) 2001-07-12 2003-02-06 Aventis Pharma Gmbh Synthetische doppelsträngige Oligonucleotide zur gezielten Hemmung der Genexpression
US6942972B2 (en) 2001-10-24 2005-09-13 Beckman Coulter, Inc. Efficient synthesis of protein-oligonucleotide conjugates
US20060009409A1 (en) 2002-02-01 2006-01-12 Woolf Tod M Double-stranded oligonucleotides
EP1432724A4 (en) 2002-02-20 2006-02-01 Sirna Therapeutics Inc RNA inhibition mediated inhibition of MAP KINASE GENES
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20040023220A1 (en) 2002-07-23 2004-02-05 Lawrence Greenfield Integrated method for PCR cleanup and oligonucleotide removal
DK3222724T3 (en) 2002-08-05 2018-12-03 Silence Therapeutics Gmbh ADDITIONALLY UNKNOWN FORMS OF INTERFERRING RNA MOLECULES
US7923547B2 (en) 2002-09-05 2011-04-12 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
EP2305813A3 (en) 2002-11-14 2012-03-28 Dharmacon, Inc. Fuctional and hyperfunctional sirna
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
US8084582B2 (en) 2003-03-03 2011-12-27 Xencor, Inc. Optimized anti-CD20 monoclonal antibodies having Fc variants
EP1608733B1 (en) 2003-04-02 2011-12-07 Dharmacon, Inc. Modified polynucleotides for use in rna interference
US7750144B2 (en) 2003-06-02 2010-07-06 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNA silencing
DK1633767T3 (en) 2003-06-02 2019-03-25 Univ Massachusetts METHODS AND COMPOSITIONS FOR MANAGING THE EFFECT OF RNA SILENCING
ES2864206T3 (es) 2003-06-02 2021-10-13 Univ Massachusetts Métodos y composiciones para mejorar la eficacia y la especificidad del ARNi
AU2004263830B2 (en) 2003-06-13 2008-12-18 Alnylam Pharmaceuticals, Inc. Double-stranded ribonucleic acid with increased effectiveness in an organism
BR122018071808B8 (pt) 2003-11-06 2020-06-30 Seattle Genetics Inc conjugado
US8389710B2 (en) 2004-02-27 2013-03-05 Operational Technologies Corporation Therapeutic nucleic acid-3′-conjugates
EP1742958B1 (en) 2004-03-15 2017-05-17 City of Hope Methods and compositions for the specific inhibition of gene expression by double-stranded rna
WO2005094364A2 (en) * 2004-03-31 2005-10-13 Chimeric Technologies, Inc. Iga antibody protein as a cytotoxic drug
KR101147147B1 (ko) 2004-04-01 2012-05-25 머크 샤프 앤드 돔 코포레이션 Ｒｎａ 간섭의 오프 타겟 효과 감소를 위한 변형된폴리뉴클레오타이드
AU2005247509C1 (en) 2004-05-27 2012-09-20 Alnylam Pharmaceuticals, Inc. Nuclease resistant double-stranded ribonucleic acid
EP3808845A1 (en) 2004-06-28 2021-04-21 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
AU2005332660A1 (en) 2004-11-12 2006-12-14 Seattle Genetics, Inc. Auristatins having an aminobenzoic acid unit at the N terminus
AU2006230413B8 (en) * 2005-03-31 2011-01-20 Xencor, Inc Fc variants with optimized properties
KR20080028886A (ko) * 2005-05-26 2008-04-02 앙상블 디스커버리 코포레이션 핵산-템플레이팅된 화학 반응에 의한 생검출
US7736647B2 (en) * 2005-06-15 2010-06-15 Monoclonal Antibodies Therapeutics Anti-CD71 monoclonal antibodies and uses thereof for treating malignant tumor cells
AU2006280600B2 (en) 2005-08-17 2012-01-19 Bioneer Corporation Sirna-hydrophilic polymer conjugates for intracellular delivery of siRNA and method thereof
WO2007028065A2 (en) 2005-08-30 2007-03-08 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds for modulation of splicing
KR100699874B1 (ko) * 2005-11-08 2007-03-28 삼성전자주식회사 삽입형 연결부를 갖는 비. 지. 에이 패키지 그 제조방법 및이를 포함하는 보드 구조
AU2007297861A1 (en) 2006-05-10 2008-03-27 Avi Biopharma, Inc. Oligonucleotide analogs having cationic intersubunit linkages
WO2007136758A2 (en) * 2006-05-19 2007-11-29 Board Of Regents, The University Of Texas System Sirna inhibition of p13k p85, p110, and akt2 and methods of use
EP1857548A1 (en) 2006-05-19 2007-11-21 Academisch Ziekenhuis Leiden Means and method for inducing exon-skipping
WO2012024613A1 (en) 2010-08-19 2012-02-23 Wintrance Corporation Synergistic biomolecule-polymer conjugates
US8598333B2 (en) 2006-05-26 2013-12-03 Alnylam Pharmaceuticals, Inc. SiRNA silencing of genes expressed in cancer
US7521232B2 (en) 2006-05-31 2009-04-21 Icx Nomadics, Inc. Emissive species for clinical imaging
ATE524547T1 (de) 2006-08-11 2011-09-15 Prosensa Technologies Bv Einzelsträngige oligonukleotide, welche komplementär zu repetitiven elementen sind, zur behandlung von dns-wiederholungen-instabilitäts- assoziierten erkrankungen
MX2009001207A (es) 2006-08-18 2009-02-11 Hoffmann La Roche Policonjugados para el suministro in vivo de polinucleotidos.
WO2011100493A1 (en) 2010-02-12 2011-08-18 Solulink, Inc. Preparation and/or purification of oligonucleotide conjugates
US9328345B2 (en) 2007-08-27 2016-05-03 1 Globe Health Institute Llc Compositions of asymmetric interfering RNA and uses thereof
CA2704737A1 (en) 2007-09-18 2009-09-03 Intradigm Corporation Compositions comprising k-ras sirna and methods of use
EP2548962B1 (en) 2007-09-19 2016-01-13 Applied Biosystems, LLC Sirna sequence-independent modification formats for reducing off-target phenotypic effects in rnai, and stabilized forms thereof
CA2704049A1 (en) 2007-10-26 2009-04-30 Academisch Ziekenhuis Leiden Means and methods for counteracting muscle disorders
WO2009099991A2 (en) 2008-01-31 2009-08-13 The Brigham And Women's Hospital, Inc. Treatment of cancer
US20110065774A1 (en) 2008-01-31 2011-03-17 Alnylam Pharmaceuticals Chemically modified oligonucleotides and uses thereof
RU2010136023A (ru) 2008-02-01 2012-03-10 Асцендис Фарма Ас (Dk) Пролекарство, содержащее саморасщепляемый линкер
CN102016036B (zh) 2008-02-11 2015-04-08 阿克赛医药公司 经修饰的RNAi多核苷酸及其用途
PL2842575T3 (pl) 2008-03-18 2018-02-28 Seattle Genetics, Inc. Koniugaty aurystatyny lek łącznik
JP5788312B2 (ja) 2008-04-11 2015-09-30 アルニラム ファーマスーティカルズ インコーポレイテッドＡｌｎｙｌａｍ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ， Ｉｎｃ． 標的リガンドをエンドソーム分解性成分と組み合わせることによる核酸の部位特異的送達
CA2720363A1 (en) 2008-04-15 2009-10-22 Bira Arya Compositions and methods for delivering inhibitory oligonucleotides
EP2119783A1 (en) 2008-05-14 2009-11-18 Prosensa Technologies B.V. Method for efficient exon (44) skipping in Duchenne Muscular Dystrophy and associated means
JP2011525180A (ja) * 2008-06-16 2011-09-15 バインド バイオサイエンシズ インコーポレイテッド 治療的標的化ナノ粒子の製作に用いるためのジブロックコポリマーで官能化された標的薬の製造方法
JP5028355B2 (ja) * 2008-08-01 2012-09-19 株式会社オティックス 可変動弁機構
AU2009279458B2 (en) 2008-08-08 2015-07-02 Code Biotherapeutics, Inc. Long-acting DNA dendrimers and methods thereof
KR101661746B1 (ko) 2008-08-13 2016-09-30 캘리포니아 인스티튜트 오브 테크놀로지 캐리어 나노입자, 그리고 관련된 조성물, 방법 및 시스템
EP2690175B1 (en) 2008-09-02 2016-12-28 Alnylam Pharmaceuticals, Inc. Compositions and methods for combined inhibition of mutant EGFR gene and IL-6 expression
US8084601B2 (en) 2008-09-11 2011-12-27 Royal Holloway And Bedford New College Royal Holloway, University Of London Oligomers
EP3336188B1 (en) 2008-09-22 2020-05-06 Phio Pharmaceuticals Corp. Reduced size self-delivering rnai compounds
US8871918B2 (en) 2008-10-24 2014-10-28 Sarepta Therapeutics, Inc. Multiple exon skipping compositions for DMD
ES2562658T3 (es) 2008-10-27 2016-03-07 Biomarin Technologies B.V. Procedimientos y medios para el salto eficiente del exón 45 en el pre-ARNm de la distrofia muscular de Duchenne
US20100249214A1 (en) 2009-02-11 2010-09-30 Dicerna Pharmaceuticals Multiplex dicer substrate rna interference molecules having joining sequences
US8481698B2 (en) 2009-03-19 2013-07-09 The President And Fellows Of Harvard College Parallel proximity ligation event analysis
SG174904A1 (en) * 2009-03-25 2011-11-28 Genentech Inc Anti-fgfr3 antibodies and methods using same
US20130115603A9 (en) 2009-04-02 2013-05-09 Regents Of The University Of Minnesota Nucleotide repeat expansion-associated polypeptides and uses thereof
AU2010239779A1 (en) 2009-04-24 2011-11-17 Prosensa Technologies B.V. Oligonucleotide comprising an inosine for treating DMD
BRPI1011269A2 (pt) 2009-05-05 2016-09-27 Altermune Technologies Llc imunidade quimicamente programável
KR20180056805A (ko) 2009-06-04 2018-05-29 노파르티스 아게 ＩｇＧ 콘쥬게이션을 위한 자리의 확인 방법
ES2536996T3 (es) * 2009-07-06 2015-06-01 F. Hoffmann-La Roche Ag Anticuerpos biespecíficos de unión a digoxigenina
JP2012533587A (ja) * 2009-07-22 2012-12-27 セニックス バイオサイエンス ゲーエムベーハー 自然に存在する細胞内輸送経路を介して化合物を送達するための送達システム及びコンジュゲート
EP2473607A2 (en) 2009-08-31 2012-07-11 INSERM - Institut National de la Santé et de la Recherche Médicale Exon skipping therapy for functional amelioration of semi functional dystrophin in becker and duchenne muscular dystrophy
AU2010303415B2 (en) 2009-10-07 2015-02-19 Macrogenics, Inc. Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use
KR102581868B1 (ko) 2009-11-12 2023-10-04 더 유니버시티 오브 웨스턴 오스트레일리아 안티센스 분자 및 이를 이용한 질환 치료방법
WO2011130616A1 (en) 2010-04-15 2011-10-20 Spirogen Limited Pyrrolobenzodiazepines used to treat proliferative diseases
KR101671360B1 (ko) 2010-04-15 2016-11-01 시애틀 지네틱스, 인크. 표적화된 피롤로벤조디아제핀 접합체
JP2013530154A (ja) 2010-05-28 2013-07-25 サレプタ セラピューティクス， インコーポレイテッド 修飾されたサブユニット間結合および／または末端基を有するオリゴヌクレオチドアナログ
IT1400425B1 (it) 2010-06-08 2013-05-31 Amsterdam Molecular Therapeutics Bv Modified snrnas for use in therapy.
WO2011154542A1 (en) * 2010-06-11 2011-12-15 Artisense Pharma Gmbh Method for selective oligonucleotide modification
EP2595664B1 (en) 2010-07-19 2018-10-17 Ionis Pharmaceuticals, Inc. Modulation of nuclear-retained rna
ES2663009T3 (es) 2010-10-29 2018-04-10 Sirna Therapeutics, Inc. Inhibición de la expresión génica mediada por interferencia por ARN utilizando ácidos nucleicos de interferencia cortos (ANic)
US8501930B2 (en) 2010-12-17 2013-08-06 Arrowhead Madison Inc. Peptide-based in vivo siRNA delivery system
BR112013014115A2 (pt) * 2010-12-29 2019-09-24 Arrowhead Res Corporation conjugados de fornecimento de polinucleotídeos in vivo apresentando ligações enzimáticas sensíveis
CN103501793A (zh) 2011-02-08 2014-01-08 夏洛特-梅克伦堡医院(商业用名:卡罗来纳保健系统) 反义寡核苷酸
US9045750B2 (en) 2011-03-18 2015-06-02 Yuelong Ma Humanized lewis-Y specific antibody-based delivery of dicer substrate siRNA (D-siRNA) against STAT3
ES2692268T3 (es) 2011-03-29 2018-12-03 Roche Glycart Ag Variantes de Fc de anticuerpo
JP5980202B2 (ja) * 2011-05-09 2016-08-31 株式会社ペルセウスプロテオミクス トランスフェリン受容体を特異的に認識できる抗体
CA2839593A1 (en) 2011-07-15 2013-01-24 Sarepta Therapeutics, Inc. Methods and compositions for manipulating translation of protein isoforms from alternative initiation start sites
ES2626488T3 (es) 2011-07-19 2017-07-25 Wave Life Sciences Pte. Ltd. Procedimientos para la síntesis de ácidos nucleicos funcionalizados
EP3640332A1 (en) 2011-08-29 2020-04-22 Ionis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
EP3388435B1 (en) 2011-10-14 2023-05-03 Seagen Inc. Pyrrolobenzodiazepines and targeted conjugates
US9593141B2 (en) 2011-11-09 2017-03-14 President And Fellows Of Harvard College Lin28/let-7 crystal structures, purification protocols, and molecular probes suitable for screening assays and therapeutics
EA201490993A1 (ru) 2011-11-18 2014-09-30 Элнилэм Фармасьютикалз, Инк. МОДИФИЦИРОВАННЫЕ СРЕДСТВА РНКи
CN112386605A (zh) * 2011-12-16 2021-02-23 国立大学法人东京医科齿科大学 嵌合的双链核酸
AU2013203422A1 (en) * 2012-01-06 2013-07-18 Bioalliance C.V. Anti-transferrin receptor antibodies and methods using same
WO2013110005A1 (en) * 2012-01-18 2013-07-25 Wisconsin Alumni Research Foundation Boronate-mediated delivery of molecules into cells
US10010623B2 (en) 2012-02-16 2018-07-03 Ucl Business Plc Lysosome-cleavable linker
MX353608B (es) 2012-02-24 2018-01-19 Alteogen Inc Anticuerpo modificado en el que el tema que comprende residuos de cisteina esta ligado, conjugado de farmaco de anticuerpo modificado que comprende el anticuerpo modificado y metodo de produccion para el mismo.
US20150238515A1 (en) 2012-05-02 2015-08-27 Arrowhead Research Corporation Organic compositions to treat kras-related diseases
AR090905A1 (es) 2012-05-02 2014-12-17 Merck Sharp & Dohme Conjugados que contienen tetragalnac y peptidos y procedimientos para la administracion de oligonucleotidos, composicion farmaceutica
US9504756B2 (en) 2012-05-15 2016-11-29 Seattle Genetics, Inc. Self-stabilizing linker conjugates
JP6239597B2 (ja) 2012-05-15 2017-11-29 ソレント・セラピューティクス・インコーポレイテッドＳｏｒｒｅｎｔｏ Ｔｈｅｒａｐｅｕｔｉｃｓ， Ｉｎｃ． 薬物コンジュゲート、コンジュゲーション方法およびその使用
SG11201500232UA (en) 2012-07-13 2015-04-29 Wave Life Sciences Pte Ltd Chiral control
IN2015DN01765A (zh) 2012-08-20 2015-05-29 Univ California
AU2013328580B2 (en) 2012-10-12 2016-01-21 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
SG10201804331TA (en) 2012-11-15 2018-07-30 Roche Innovation Ct Copenhagen As Oligonucleotide conjugates
WO2014080251A1 (en) 2012-11-24 2014-05-30 Hangzhou Dac Biotech Co., Ltd. Hydrophilic linkers and their uses for conjugation of drugs to cell binding molecules
MY169117A (en) 2012-12-21 2019-02-18 Bioalliance Cv Hydrophilic self-immolative linkers and conjugates thereof
US9481905B2 (en) 2013-02-19 2016-11-01 Orizhan Bioscience Limited Method of using neutrilized DNA (N-DNA) as surface probe for high throughput detection platform
CA2906209A1 (en) 2013-03-14 2014-09-25 Sarepta Therapeutics, Inc. Exon skipping compositions for treating muscular dystrophy targeting the annealing site h44a (-07+15)
KR102306490B1 (ko) 2013-03-15 2021-09-28 리제너론 파아마슈티컬스, 인크. 생물학적 활성 분자, 그의 접합체 및 치료 용도
EP2777714A1 (en) 2013-03-15 2014-09-17 NBE-Therapeutics LLC Method of producing an immunoligand/payload conjugate by means of a sequence-specific transpeptidase enzyme
CN105378083B (zh) * 2013-03-27 2018-09-21 伊萨纳治疗有限公司 修饰的TGF-β寡核苷酸
US9295731B2 (en) 2013-04-01 2016-03-29 Mark Quang Nguyen Cleavable drug conjugates, compositions thereof and methods of use
WO2014169049A1 (en) 2013-04-09 2014-10-16 Duke University 2' fluoro-modified rnas as immunostimulators
WO2014177042A1 (zh) 2013-04-28 2014-11-06 Qin Gang 一种新型的连接子及其制备方法和用途
CA2913370C (en) 2013-05-31 2022-12-13 Zymeworks Inc. Heteromultimers with reduced or silenced effector function
US11229711B2 (en) 2013-06-06 2022-01-25 Magenta Therapeutics, Inc. Linkers for antibody-drug conjugates and related compounds, compositions, and methods of use
TW201536329A (zh) 2013-08-09 2015-10-01 Isis Pharmaceuticals Inc 用於調節失養性肌強直蛋白質激酶(dmpk)表現之化合物及方法
EP2845607A1 (en) 2013-09-09 2015-03-11 University of Vienna Antisense oligonucleotides with improved pharmacokinetic properties
WO2015038426A1 (en) 2013-09-13 2015-03-19 Asana Biosciences, Llc Self-immolative linkers containing mandelic acid derivatives, drug-ligand conjugates for targeted therapies and uses thereof
WO2015057876A1 (en) 2013-10-15 2015-04-23 Sorrento Therapeutics Inc. Drug-conjugates with a targeting molecule and two different drugs
CN105764503A (zh) 2013-10-15 2016-07-13 西雅图基因公司 用于改善配体-药物偶联物药代动力学的peg化的药物-接头
WO2015069587A2 (en) 2013-11-06 2015-05-14 Merck Sharp & Dohme Corp. Peptide containing conjugates for dual molecular delivery of oligonucleotides
US10378017B2 (en) 2013-12-02 2019-08-13 Brandeis University High temperature selection of nucleotide-supported carbohydrate vaccines and resulting glycosylated oligonucleotides
CN106068325B (zh) 2014-01-16 2021-07-09 波涛生命科学有限公司 手性设计
US10358643B2 (en) 2014-01-30 2019-07-23 Hoffmann-La Roche, Inc. Poly oligomer compound with biocleavable conjugates
ES2765463T3 (es) 2014-06-17 2020-06-09 Nippon Shinyaku Co Ltd Acido nucleico antisentido para usar en el tratamiento de la distrofia muscular de Duchenne
TWI695011B (zh) 2014-06-18 2020-06-01 美商梅爾莎納醫療公司 抗ｈｅｒ２表位之單株抗體及其使用之方法
AU2015280252A1 (en) 2014-06-23 2017-01-12 Monsanto Technology Llc Compositions and methods for regulating gene expression via RNA interference
SG10201903290YA (en) 2014-08-20 2019-05-30 Alnylam Pharmaceuticals Inc Modified double-stranded rna agents
EP3286318A2 (en) 2015-04-22 2018-02-28 Mina Therapeutics Limited Sarna compositions and methods of use
KR20240035901A (ko) 2015-05-19 2024-03-18 사렙타 쎄러퓨틱스 인코퍼레이티드 펩티드 올리고뉴클레오티드 콘주게이트
CN108699156A (zh) 2016-03-01 2018-10-23 豪夫迈·罗氏有限公司 具有降低的adcp的奥滨尤妥珠单抗和利妥昔单抗变体
MA45328A (fr) 2016-04-01 2019-02-06 Avidity Biosciences Llc Compositions acide nucléique-polypeptide et utilisations de celles-ci
MA45290A (fr) 2016-05-04 2019-03-13 Wave Life Sciences Ltd Procédés et compositions d'agents biologiquement actifs
JP6823269B2 (ja) * 2016-06-20 2021-02-03 株式会社ＧｅｎＡｈｅａｄ Ｂｉｏ 抗体−薬物コンジュゲート
EP3478829A1 (en) 2016-06-29 2019-05-08 Crispr Therapeutics AG Materials and methods for treatment of myotonic dystrophy type 1 (dm1) and other related disorders
CN110381980A (zh) 2017-01-06 2019-10-25 艾维迪提生物科学有限责任公司 核酸-多肽组合物以及诱导外显子跳读的方法
JP2020537497A (ja) 2017-09-22 2020-12-24 アビディティー バイオサイエンシーズ，インク． エクソンスキッピングを誘発する核酸ポリペプチド組成物と方法

Cited By (89)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12077755B2 (en) 2015-08-14 2024-09-03 University Of Massachusetts Bioactive conjugates for oligonucleotide delivery
US11896669B2 (en) 2016-01-31 2024-02-13 University Of Massachusetts Branched oligonucleotides
US10800848B2 (en) 2016-04-01 2020-10-13 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and uses thereof
US10487149B2 (en) 2016-04-01 2019-11-26 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and uses thereof
US10550188B2 (en) 2016-04-01 2020-02-04 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and uses thereof
US10787519B2 (en) 2016-04-01 2020-09-29 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and uses thereof
US11753638B2 (en) 2016-08-12 2023-09-12 University Of Massachusetts Conjugated oligonucleotides
US11311627B1 (en) 2017-01-06 2022-04-26 Avidity Biosciences Llc Nucleic acid-polypeptide compositions and methods of inducing exon skipping
US11179472B2 (en) 2017-01-06 2021-11-23 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and methods of inducing exon skipping
US11400163B2 (en) 2017-01-06 2022-08-02 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and methods of inducing exon skipping
US12064483B2 (en) 2017-01-06 2024-08-20 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and methods of inducing exon skipping
US10994020B2 (en) 2017-01-06 2021-05-04 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and methods of inducing exon skipping
US12049627B2 (en) 2017-06-23 2024-07-30 University Of Massachusetts Two-tailed self-delivering siRNA
US11142767B2 (en) 2017-07-21 2021-10-12 The Governors Of The University Of Alberta Antisense oligonucleotides that bind to exon 51 of human dystrophin pre-mRNA
US11891603B2 (en) 2017-07-21 2024-02-06 The Governors Of The University Of Alberta Antisense oligonucleotides that bind to exon 51 of human dystrophin pre-mRNA
US20210238602A1 (en) * 2017-09-14 2021-08-05 Arrowhead Pharmaceuticals, Inc. RNAi Agents And Compositions for Inhibiting Expression of Angiopoietin-Like 3 (ANGPTL3), And Methods Of Use
US11364302B1 (en) 2017-10-04 2022-06-21 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and uses thereof
US11110180B2 (en) 2017-10-04 2021-09-07 Avidity Biosciences Inc. Nucleic acid-polypeptide compositions and uses thereof
WO2019071028A1 (en) * 2017-10-04 2019-04-11 Avidity Biosciences Llc NUCLEIC ACID-POLYPEPTIDE COMPOSITIONS AND USES THEREOF
US11246941B2 (en) 2017-12-06 2022-02-15 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
WO2019113393A1 (en) * 2017-12-06 2019-06-13 Avidity Biosciences Llc Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11554176B2 (en) 2017-12-06 2023-01-17 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11253607B2 (en) 2017-12-06 2022-02-22 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11872287B2 (en) 2017-12-06 2024-01-16 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11497814B2 (en) 2017-12-06 2022-11-15 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
KR20200097751A (ko) * 2017-12-06 2020-08-19 어비디티 바이오사이언시스 인크. 근위축증 및 근긴장성 이영양증을 치료하는 조성물 및 방법
CN111902148A (zh) * 2017-12-06 2020-11-06 艾维迪提生物科学公司 治疗肌萎缩和强直性肌营养不良的组合物和方法
US11712478B2 (en) 2017-12-06 2023-08-01 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
US10881743B2 (en) 2017-12-06 2021-01-05 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
KR102443358B1 (ko) 2017-12-06 2022-09-14 어비디티 바이오사이언시스 인크. 근위축증 및 근긴장성 이영양증을 치료하는 조성물 및 방법
US11583591B2 (en) 2017-12-06 2023-02-21 Avidity Biosciences Llc Compositions and methods of treating muscle atrophy and myotonic dystrophy
US11576980B2 (en) 2017-12-06 2023-02-14 Avidity Biosciences, Inc. Compositions and methods of treating muscle atrophy and myotonic dystrophy
WO2019136180A3 (en) * 2018-01-04 2019-08-29 Avidity Biosciences Llc Heteroduplex nucleic acid molecules and uses thereof
US11248056B1 (en) 2018-08-02 2022-02-15 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11286305B2 (en) 2018-08-02 2022-03-29 Dyne Therapeutics, Inc. Complex comprising anti-transferrin receptor antibody covalently linked to an oligonucleotide that targets DUX4 RNA
US12097263B2 (en) 2018-08-02 2024-09-24 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US11497815B2 (en) 2018-08-02 2022-11-15 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11111309B2 (en) 2018-08-02 2021-09-07 Dyne Therapeutics, Inc. Method of reducing expression of DUX4 in a muscle cell by administering an anti-transferrin receptor antibody linked to an oligonucleotide targeting DUX4
US11795234B2 (en) 2018-08-02 2023-10-24 Dyne Therapeutics, Inc. Methods of producing muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US11787869B2 (en) 2018-08-02 2023-10-17 Dyne Therapeutics, Inc. Methods of using muscle targeting complexes to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy or a disease associated with muscle weakness
US11833217B2 (en) 2018-08-02 2023-12-05 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12018087B2 (en) 2018-08-02 2024-06-25 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of delivering oligonucleotide to a subject
US12012460B2 (en) 2018-08-02 2024-06-18 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US11633496B2 (en) 2018-08-02 2023-04-25 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12005124B2 (en) 2018-08-02 2024-06-11 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11518816B2 (en) 2018-08-02 2022-12-06 Dyne Therapeutics, Inc. Methods of delivering an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy
US11369689B2 (en) 2018-08-02 2022-06-28 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11911484B2 (en) 2018-08-02 2024-02-27 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US11168141B2 (en) 2018-08-02 2021-11-09 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11795233B2 (en) 2018-08-02 2023-10-24 Dyne Therapeutics, Inc. Muscle-targeting complex comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US11390682B2 (en) 2018-08-02 2022-07-19 Dyne Therapeutics, Inc. Methods of intravenouisly delivering anti-transferrin antibody/oligonucleotide complexes to subjects having muscular dystrophy
US11827882B2 (en) 2018-08-10 2023-11-28 University Of Massachusetts Modified oligonucleotides targeting SNPs
US11834510B2 (en) 2018-12-21 2023-12-05 Avidity Biosciences, Inc. Anti-transferrin receptor antibodies and uses thereof
US11492619B2 (en) * 2019-01-18 2022-11-08 University Of Massachusetts Dynamic pharmacokinetic-modifying anchors
US12006499B2 (en) 2019-06-06 2024-06-11 Avidity Biosciences, Inc. Una amidites and uses thereof
US11578090B2 (en) 2019-06-06 2023-02-14 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and uses thereof
US12024706B2 (en) 2019-08-09 2024-07-02 University Of Massachusetts Modified oligonucleotides targeting SNPs
US12005121B2 (en) 2019-08-30 2024-06-11 Yale University Compositions and methods for delivery of nucleic acids to cells
WO2021042060A1 (en) * 2019-08-30 2021-03-04 Yale University Compositions and methods for delivery of nucleic acids to cells
US11850284B2 (en) 2019-08-30 2023-12-26 Yale University Compositions and methods for delivery of nucleic acids to cells
US11872286B2 (en) 2019-08-30 2024-01-16 Yale University Compositions and methods for delivery of nucleic acids to cells
US20210108201A1 (en) * 2019-10-14 2021-04-15 Aro Biotherapeutics Company FN3 Domain-siRNA Conjugates and Uses Thereof
US11781138B2 (en) * 2019-10-14 2023-10-10 Aro Biotherapeutics Company FN3 domain-siRNA conjugates and uses thereof
US11628222B2 (en) 2019-10-14 2023-04-18 Aro Biotherapeutics Company CD71 binding fibronectin type III domains
US11999955B2 (en) 2020-03-19 2024-06-04 Avidity Biosciences, Inc. Compositions and methods of treating facioscapulohumeral muscular dystrophy
US12104156B2 (en) 2020-03-19 2024-10-01 Avidity Biosciences, Inc. Compositions and methods of treating facioscapulohumeral muscular dystrophy
US11525137B2 (en) 2020-03-19 2022-12-13 Avidity Biosciences, Inc. Compositions and methods of treating Facioscapulohumeral muscular dystrophy
US12049629B2 (en) 2020-03-19 2024-07-30 Avidity Biosciences, Inc. Compositions and methods of treating Facioscapulohumeral muscular dystrophy
WO2021188390A1 (en) * 2020-03-19 2021-09-23 Avidity Biosciences, Inc. Compositions and methods of treating facioscapulohumeral muscular dystrophy
US11555190B2 (en) 2020-03-19 2023-01-17 Avidity Biosciences, Inc. Compositions and methods of treating Facioscapulohumeral muscular dystrophy
US11707532B2 (en) 2020-03-27 2023-07-25 Avidity Biosciences, Inc. Compositions and methods of treating muscle dystrophy
US11446387B2 (en) 2020-03-27 2022-09-20 Avidity Biosciences, Inc. Compositions and methods of treating muscle dystrophy
US12037379B2 (en) 2021-04-14 2024-07-16 Aro Biotherapeutics Company CD71 binding fibronectin type III domains
US11702659B2 (en) 2021-06-23 2023-07-18 University Of Massachusetts Optimized anti-FLT1 oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders
US11638761B2 (en) 2021-07-09 2023-05-02 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating Facioscapulohumeral muscular dystrophy
US11969475B2 (en) 2021-07-09 2024-04-30 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US11633498B2 (en) 2021-07-09 2023-04-25 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US12102687B2 (en) 2021-07-09 2024-10-01 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating myotonic dystrophy
US11648318B2 (en) 2021-07-09 2023-05-16 Dyne Therapeutics, Inc. Anti-transferrin receptor (TFR) antibody and uses thereof
US11672872B2 (en) 2021-07-09 2023-06-13 Dyne Therapeutics, Inc. Anti-transferrin receptor antibody and uses thereof
US11679161B2 (en) 2021-07-09 2023-06-20 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US11986537B2 (en) 2021-07-09 2024-05-21 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11844843B2 (en) 2021-07-09 2023-12-19 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US11771776B2 (en) 2021-07-09 2023-10-03 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11839660B2 (en) 2021-07-09 2023-12-12 Dyne Therapeutics, Inc. Anti-transferrin receptor antibody and uses thereof
US11759525B1 (en) 2021-07-09 2023-09-19 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US12071485B2 (en) 2021-09-16 2024-08-27 Avidity Biosciences, Inc. Compositions and methods of treating facioscapulohumeral muscular dystrophy
US11931421B2 (en) 2022-04-15 2024-03-19 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating myotonic dystrophy
US12128109B2 (en) 2023-08-24 2024-10-29 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating dystrophinopathies

Also Published As

Publication number Publication date
JP2024050610A (ja) 2024-04-10
US10800848B2 (en) 2020-10-13
KR20180124142A (ko) 2018-11-20
MA45328A (fr) 2019-02-06
US20200123261A1 (en) 2020-04-23
US20220324984A1 (en) 2022-10-13
AU2023203188A1 (en) 2023-08-10
AU2017240799B2 (en) 2023-02-23
CA3019568A1 (en) 2017-10-05
JP7420866B2 (ja) 2024-01-23
KR102640587B1 (ko) 2024-02-26
US10787519B2 (en) 2020-09-29
AU2017240799A1 (en) 2018-11-01
SG11201808619QA (en) 2018-10-30
EP3436588A4 (en) 2020-01-15
US10487149B2 (en) 2019-11-26
JP2022122928A (ja) 2022-08-23
CN109715805A (zh) 2019-05-03
EP3436588A1 (en) 2019-02-06
US10550188B2 (en) 2020-02-04
JP2019513371A (ja) 2019-05-30
US20180371102A1 (en) 2018-12-27
WO2017173408A1 (en) 2017-10-05
US20190000987A1 (en) 2019-01-03
US20190062435A1 (en) 2019-02-28
CN109715805B (zh) 2024-01-05
MX2023008041A (es) 2023-07-14
KR20240026257A (ko) 2024-02-27
US20190062436A1 (en) 2019-02-28
US20190062437A1 (en) 2019-02-28
US20210179720A1 (en) 2021-06-17
CN118662652A (zh) 2024-09-20

Similar Documents

Publication Publication Date Title
US20210179720A1 (en) Nucleic acid-polypeptide compositions and uses thereof
US11364302B1 (en) Nucleic acid-polypeptide compositions and uses thereof
US20210095283A1 (en) Heteroduplex nucleic acid molecules and uses thereof
US11578090B2 (en) Nucleic acid-polypeptide compositions and uses thereof
US12006499B2 (en) Una amidites and uses thereof

Legal Events

Date Code Title Description
AS Assignment

Owner name: AVIDITY BIOSCIENCES LLC, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:GEALL, ANDREW JOHN;DOPPALAPUDI, VENKATA RAMANA;CHU, DAVID SAI-HO;AND OTHERS;REEL/FRAME:042492/0917

Effective date: 20170516

STCV Information on status: appeal procedure

Free format text: EXAMINER'S ANSWER TO APPEAL BRIEF MAILED

STCV Information on status: appeal procedure

Free format text: ON APPEAL -- AWAITING DECISION BY THE BOARD OF APPEALS

AS Assignment

Owner name: AVIDITY BIOSCIENCES LLC, CALIFORNIA

Free format text: CHANGE OF NAME;ASSIGNOR:AVIDITY BIOSCIENCES LLC;REEL/FRAME:050018/0456

Effective date: 20190401

Owner name: AVIDITY BIOSCIENCES, INC., CALIFORNIA

Free format text: CHANGE OF NAME;ASSIGNOR:AVIDITY BIOSCIENCES LLC;REEL/FRAME:050018/0456

Effective date: 20190401

AS Assignment

Owner name: AVIDITY BIOSCIENCES, INC., CALIFORNIA

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE RECEIVING PARTY PREVIOUSLY RECORDED AT REEL: 050018 FRAME: 0456. ASSIGNOR(S) HEREBY CONFIRMS THE ASSIGNMENT;ASSIGNOR:AVIDITY BIOSCIENCES LLC;REEL/FRAME:050371/0483

Effective date: 20190401

STCV Information on status: appeal procedure

Free format text: BOARD OF APPEALS DECISION RENDERED AFTER REQUEST FOR RECONSIDERATION

STCB Information on status: application discontinuation

Free format text: ABANDONED -- AFTER EXAMINER'S ANSWER OR BOARD OF APPEALS DECISION