US20040121309A1 - Methods for rapid detection and identification of bioagents in blood, bodily fluids, and bodily tissues - Google Patents

Methods for rapid detection and identification of bioagents in blood, bodily fluids, and bodily tissues Download PDF

Info

Publication number
US20040121309A1
US20040121309A1 US10/323,233 US32323302A US2004121309A1 US 20040121309 A1 US20040121309 A1 US 20040121309A1 US 32323302 A US32323302 A US 32323302A US 2004121309 A1 US2004121309 A1 US 2004121309A1
Authority
US
United States
Prior art keywords
nucleic acid
bioagent
base
mass
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/323,233
Other languages
English (en)
Inventor
David Ecker
Richard Griffey
Rangarajan Sampath
Steven Hofstadler
John McNeil
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ibis Biosciences Inc
Original Assignee
Isis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Isis Pharmaceuticals Inc filed Critical Isis Pharmaceuticals Inc
Priority to US10/323,233 priority Critical patent/US20040121309A1/en
Priority to US10/326,051 priority patent/US20040121313A1/en
Priority to US10/325,527 priority patent/US20040121335A1/en
Priority to US10/325,526 priority patent/US20040121311A1/en
Assigned to ISIS PHARMACEUTICALS, INC. reassignment ISIS PHARMACEUTICALS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ECKER, DAVID J., GRIFFEY, RICHARD H., HOFSTADLER, STEVEN A., MCNEIL, JOHN, SAMPATH, RANGARAJAN
Priority to US10/660,122 priority patent/US7781162B2/en
Priority to EP03796752A priority patent/EP1581657A4/en
Priority to JP2005508488A priority patent/JP2006508696A/ja
Priority to EP03814656A priority patent/EP1578399A4/en
Priority to US10/728,486 priority patent/US7718354B2/en
Priority to CA002508726A priority patent/CA2508726A1/en
Priority to CA002508584A priority patent/CA2508584A1/en
Priority to PCT/US2003/038830 priority patent/WO2004052175A2/en
Priority to AU2003297687A priority patent/AU2003297687B2/en
Priority to JP2005508560A priority patent/JP2006516193A/ja
Priority to AU2003298030A priority patent/AU2003298030B2/en
Priority to PCT/US2003/038761 priority patent/WO2004060278A2/en
Publication of US20040121309A1 publication Critical patent/US20040121309A1/en
Assigned to IBIS BIOSCIENCES, INC. reassignment IBIS BIOSCIENCES, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ISIS PHARMACEUTICALS, INC.
Priority to US11/869,449 priority patent/US20080311558A1/en
Priority to US11/930,002 priority patent/US8071309B2/en
Priority to US11/929,910 priority patent/US8214154B2/en
Priority to AU2010200686A priority patent/AU2010200686B2/en
Priority to US13/174,254 priority patent/US9416424B2/en
Priority to US13/243,960 priority patent/US8822156B2/en
Priority to US14/473,603 priority patent/US9725771B2/en
Priority to US15/237,261 priority patent/US20170044630A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10TTECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
    • Y10T436/00Chemistry: analytical and immunological testing
    • Y10T436/24Nuclear magnetic resonance, electron spin resonance or other spin effects or mass spectrometry

Definitions

  • the present invention relates to methods for rapid detection and identification of bioagents from environmental, clinical or other samples.
  • the methods provide for detection and characterization of a unique mass or unique base composition signature (BCS) from any bioagent, including bacteria and viruses.
  • BCS base composition signature
  • the unique mass or unique BCS is used to rapidly identify the bioagent(s).
  • PCR polymerase chain reaction
  • detection and data analysis convert the hybridization event into an analytical result.
  • Mass spectrometry provides detailed information about the molecules being analyzed, including high mass accuracy. It is also a process that can be easily automated.
  • high-resolution MS alone fails to perform against unknown or bioengineered agents, or in environments where there is a high background level of bioagents (“cluttered” background).
  • Low-resolution MS can fail to detect some known agents, if their spectral lines are sufficiently weak or sufficiently close to those from other living organisms in the sample.
  • DNA chips with specific probes can only determine the presence or absence of specifically anticipated organisms. Because there are hundreds of thousands of species of benign bacteria, some very similar in sequence to threat organisms, even arrays with 10,000 probes lack the breadth needed to detect a particular organism.
  • Antibodies face more severe diversity limitations than arrays. If antibodies are designed against highly conserved targets to increase diversity, the false alarm problem will dominate, again because threat organisms are very similar to benign ones. Antibodies are only capable of detecting known agents in relatively uncluttered environments.
  • Electrospray ionization-Fourier transform-ion cyclotron resistance (ESI-FT-ICR) MS may be used to determine the mass of double-stranded, 500 base-pair PCR products via the average molecular mass (Hurst et al., Rapid Commun. Mass Spec . 10:377-382, 1996).
  • MALDI-TOF matrix-assisted laser desorption ionization-time of flight
  • U.S. Pat. No. 5,849,492 describes a method for retrieval of phylogenetically informative DNA sequences that comprise searching for a highly divergent segment of genomic DNA surrounded by two highly conserved segments, designing the universal primers for PCR amplification of the highly divergent region, amplifying the genomic DNA by PCR technique using universal primers, and then sequencing the gene to determine the identity of the organism.
  • U.S. Pat. No. 5,965,363 discloses methods for screening nucleic acids for polymorphisms by analyzing amplified target nucleic acids using mass spectrometric techniques and to procedures for improving mass resolution and mass accuracy of these methods.
  • WO 99/14375 describes methods, PCR primers and kits for use in analyzing preselected DNA tandem nucleotide repeat alleles by mass spectrometry.
  • WO 98/12355 discloses methods of determining the mass of a target nucleic acid by mass spectrometric analysis, by cleaving the target nucleic acid to reduce its length, making the target single-stranded and using MS to determine the mass of the single-stranded shortened target. Also disclosed are methods of preparing a double-stranded target nucleic acid for MS analysis comprising amplification of the target nucleic acid, binding one of the strands to a solid support, releasing the second strand and then releasing the first strand, which is then analyzed by MS. Kits for target nucleic acid preparation are also provided.
  • PCT WO97/33000 discloses methods for detecting mutations in a target nucleic acid by nonrandomly fragmenting the target into a set of single-stranded nonrandom length fragments and determining their masses by MS.
  • U.S. Pat. No. 5,605,798 describes a fast and highly accurate mass spectrometer-based process for detecting the presence of a particular nucleic acid in a biological sample for diagnostic purposes.
  • WO 98/21066 describes processes for determining the sequence of a particular target nucleic acid by mass spectrometry.
  • Processes for detecting a target nucleic acid present in a biological sample by PCR amplification and mass spectrometry detection are disclosed, as are methods for detecting a target nucleic acid in a sample by amplifying the target with primers that contain restriction sites and tags, extending and cleaving the amplified nucleic acid, and detecting the presence of extended product, wherein the presence of a DNA fragment of a mass different from wild-type is indicative of a mutation.
  • Methods of sequencing a nucleic acid via mass spectrometry methods are also described.
  • WO 97/37041, WO 99/31278 and U.S. Pat. No. 5,547,835 describe methods of sequencing nucleic acids using mass spectrometry.
  • U.S. Pat. Nos. 5,622,824, 5,872,003 and 5,691,141 describe methods, systems and kits for exonuclease-mediated mass spectrometric sequencing.
  • One embodiment of the present invention is a method of identifying an unknown bioagent in an animal sample comprising a) contacting nucleic acid from the bioagent in the animal sample with at least one pair of oligonucleotide primers that hybridize to sequences of the nucleic acid and flank a variable nucleic acid sequence; b) amplifying the variable nucleic acid sequence to produce an amplification product; c) determining the molecular mass of the amplification product; and d) comparing the molecular mass to one or more molecular masses of amplification products obtained by performing steps a)-c) on a plurality of known organisms, wherein a match identifies the unknown bioagent in the animal sample.
  • Animal samples include blood, bodily fluid and bodily tissue.
  • the sequences to which the at least one pair of oligonucleotide primers hybridize are highly conserved.
  • the amplifying step comprises polymerase chain reaction.
  • the amplifying step comprises ligase chain reaction or strand displacement amplification.
  • the bioagent is a bacterium, virus, parasite, fungi, cell or spore.
  • the nucleic acid is ribosomal RNA.
  • the nucleic acid encodes RNase P or an RNA-dependent RNA polymerase.
  • the amplification product is ionized prior to molecular mass determination.
  • the method may further comprise the step of isolating nucleic acid from the bioagent prior to contacting the nucleic acid with the at least one pair of oligonucleotide primers.
  • the method may further comprise the step of performing steps a)-d) using a different oligonucleotide primer pair and comparing the results to one or more molecular mass amplification products obtained by performing steps a)-c) on a different plurality of known organisms from those in step d).
  • the one or more molecular mass is contained in a database of molecular masses.
  • the amplification product is ionized by electrospray ionization, matrix-assisted laser desorption or fast atom bombardment.
  • the molecular mass is determined by mass spectrometry.
  • the mass spectrometry is Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS), ion trap, quadrupole, magnetic sector, time of flight (TOF), Q-TOF or triple quadrupole.
  • the method may further comprise performing step b) in the presence of an analog of adenine, thymidine, guanosine or cytidine having a different molecular weight than adenosine, thymidine, guanosine or cytidine.
  • the oligonucleotide primer comprises a base analog or substitute base at positions 1 and 2 of each triplet within the primer, wherein the base analog or substitute base binds with increased affinity to its complement compared to the native base.
  • the primer comprises a universal base at position 3 of each triplet within the primer.
  • the base analog or substitute base may be 2,6-diaminopurine, propyne T, propyne G, phenoxazines or G-clamp.
  • the universal base is inosine, guanidine, uridine, 5-nitroindole, 3-nitropyrrole, dP or dK, or 1-(2-deoxy- ⁇ -D-ribofuranosyl)-imidazole-4-carboxamide.
  • Another embodiment of the present invention is a method of identifying an unknown bioagent in an animal sample comprising a) contacting nucleic acid from the bioagent with at least one pair of oligonucleotide primers that hybridize to sequences of the nucleic acid and flank a variable nucleic acid sequence; b) amplifying the variable nucleic acid sequence to produce an amplification product; c) determining the base composition of the amplification product; and d) comparing the base composition to one or more base compositions of amplification products obtained by performing steps a)-c) on a plurality of known organisms, wherein a match identifies the unknown bioagent in the animal sample.
  • Animal samples include blood, bodily fluid and bodily tissue.
  • the sequences to which the at least one pair of oligonucleotide primers hybridize are highly conserved.
  • the amplifying step comprises polymerase chain reaction.
  • the amplifying step comprises ligase chain reaction or strand displacement amplification.
  • the bioagent is a bacterium, virus, parasite, fungi, cell or spore.
  • the nucleic acid is ribosomal RNA.
  • the nucleic acid encodes RNase P or an RNA-dependent RNA polymerase.
  • the amplification product is ionized prior to molecular mass determination.
  • the method may further comprise the step of isolating nucleic acid from the bioagent prior to contacting the nucleic acid with the at least one pair of oligonucleotide primers.
  • the method may further comprise the step of performing steps a)-d) using a different oligonucleotide primer pair and comparing the results to one or more base composition signatures of amplification products obtained by performing steps a)-c) on a different plurality of known organisms from those in step d).
  • the one or more base compositions is contained in a database of base compositions.
  • the amplification product is ionized by clectrospray ionization, matrix-assisted laser desorption or fast atom bombardment.
  • the molecular mass is determined by mass spectrometry.
  • the mass spectrometry is Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS), ion trap, quadrupole, magnetic sector, time of flight (TOF), Q-TOF or triple quadrupole.
  • the method may further comprise performing step b) in the presence of an analog of adenine, thymidine, guanosine or cytidine having a different molecular weight than adenosine, thymidine, guanosine or cytidine.
  • the oligonucleotide primer comprises a base analog or substitute base at positions 1 and 2 of each triplet within the primer, wherein the base analog or substitute base binds with increased affinity to its complement compared to the native base.
  • the primer comprises a universal base at position 3 of each triplet within the primer.
  • the base analog or substitute base may be 2,6-diaminopurine, propyne T, propyne G, phenoxazines or G-clamp.
  • the universal base is inosine, guanidine, uridine, 5-nitroindole, 3-nitropyrrole, dP or dK, or 1-(2-deoxy- ⁇ -D-ribofuranosyl)-imidazole-4-carboxamide.
  • FIG. 1A- 1 H and FIG. 2 are consensus diagrams that show examples of conserved regions from 16S rRNA (FIG. 1A, 1 A- 2 , 1 A- 3 , 1 A- 4 , 1 B, 1 B- 1 , and 1 B- 21 ), 23S rRNA (3′-half, FIG. 1C- 1 , 1 C- 2 , and ID; 5′-half, FIG. 1E-F), 23S rRNA Domain I (FIG. 1G), 23S rRNA Domain IV (FIG. 1H) and 16S rRNA Domain III (FIG. 2) which are suitable for use in the present invention.
  • FIG. 2 shows a typical primer amplified region from the 16S rRNA Domain III shown in FIG. 1C.
  • FIG. 3 is a schematic diagram showing conserved regions in RNase P. Bases in capital letters are greater than 90% conserved; bases in lower case letters are 80-90% conserved; filled circles designate bases which are 70-80% conserved; and open circles designate bases that are less than 70% conserved.
  • FIG. 4 is a schematic diagram of base composition signature determination using nucleotide analog “tags” to determine base composition signatures.
  • FIG. 5 shows the deconvoluted mass spectra of a Bacillus anthracis region with and without the mass tag phosphorothioate A (A*).
  • the two spectra differ in that the measured molecular weight of the mass tag-containing sequence is greater than the unmodified sequence.
  • FIG. 6 shows base composition signature (BCS) spectra from PCR products from Staphylococcus aureus ( S. aureus 16S — 1337F) and Bacillus anthracus ( B. anthr . 16S — 1337F), amplified using the same primers.
  • the two strands differ by only two (AT ⁇ CG) substitutions and are clearly distinguished on the basis of their BCS.
  • FIG. 7 shows that a single difference between two sequences (A 14 in B. anthracis vs. A 15 in B. cereus ) can be easily detected using ESI-TOF mass spectrometry.
  • FIG. 8 is an ESI-TOF of Bacillus anthracis spore coat protein sspE 56mer plus calibrant. The signals unambiguously identify B. anthracis versus other Bacillus species.
  • FIG. 9 is an ESI-TOF of a B. anthracis synthetic 16S — 1228 duplex (reverse and forward strands). The technique easily distinguishes between the forward and reverse strands.
  • FIG. 10 is an ESI-FTICR-MS of a synthetic B. anthracis 16S — 1337 46 base pair duplex.
  • FIG. 11 is an ESI-TOF-MS of a 56mer oligonucleotide (3 scans) from the B. anthracis saspB gene with an internal mass standard.
  • the internal mass standards are designated by asterisks.
  • FIG. 12 is an ESI-TOF-MS of an internal standard with 5 mM TBA-TFA buffer showing that charge stripping with tributylammonium trifluoroacetate reduces the most abundant charge state from [M-8H + ] 8 ⁇ to [M-3H + ] 3 ⁇ .
  • the present invention provides a combination of a non-PCR biomass detection mode, preferably high-resolution MS, with PCR-based BCS or mass technology using “intelligent primers” which hybridize to conserved sequence regions of nucleic acids derived from a bioagent and which bracket variable sequence regions that uniquely identify the bioagent.
  • the high-resolution MS technique is used to determine the molecular mass and/or base composition signature (BCS) of the amplified sequence region.
  • This unique mass or unique “base composition signature” (BCS) is then input to a maximum-likelihood detection algorithm for matching against a database of masses or base composition signatures in the same amplified region.
  • the present method combines PCR-based amplification technology (which provides specificity) and a molecular mass detection mode (which provides speed and does not require nucleic acid sequencing of the amplified target sequence) for bioagent detection and identification.
  • the present method allows extremely rapid and accurate detection and identification of bioagents compared to existing methods. Furthermore, this rapid detection and identification is possible even when sample material is impure.
  • the method leverages ongoing biomedical research in virulence, pathogenicity, drug resistance and genome sequencing into a method which provides greatly improved sensitivity, specificity and reliability compared to existing methods, with lower rates of false positives.
  • the methods are useful in a wide variety of fields, including, but not limited to, those fields discussed below.
  • the methods disclosed herein can be used for environmental testing. Detection and discrimination of pathogenic vs. non-pathogenic bacteria, viruses, parasites, fungi and the like, in samples of water, land, air, or other samples, can be carried out.
  • Water samples can be obtained from, for example, lakes, rivers, oceans, streams, water treatment systems, rainwater, groundwater, water table, reservoirs, wells, bottled water, and the like.
  • Air samples can be obtained from ventilation systems, airplane cabins, schools, hospitals, mass transit locations such as subways, train stations, airports, and the like. Conditions such as sick building syndrome can be detected.
  • Land samples can be obtained from any location.
  • the methods disclosed herein can be used to screen blood and other bodily fluids and tissues for pathogenic and non-pathogenic bacteria, viruses, parasites, fungi and the like.
  • Animal samples including but not limited to, blood and other bodily fluid and tissue samples, can be obtained from living animals, who are either known or not known to or suspected of having a disease, infection, or condition. Alternately, animal samples such as blood and other bodily fluid and tissue samples can be obtained from deceased animals. Blood samples can be further separated into plasma or cellular fractions and further screened as desired. Bodily fluids and tissues can be obtained from any part of the animal or human body. Animal samples can be obtained from, for example, mammals and humans.
  • the methods disclosed herein can be used for forensics.
  • medical examiners can use the present invention to determine the cause of death.
  • epidemiologists for example, can use the present methods to determine the geographic origin of a particular strain of bacteria or virus.
  • a particular strain of bacteria or virus may have a sequence difference that is associated with a particular area of a country or the world and identification of such a sequence difference can lead to the identification of the geographic origin and epidemiological tracking of the spread of the particular disease, disorder or condition associated with the detected virus or bacteria.
  • carriers of particular DNA or diseases such as mammals, non-mammals, birds, insects, and plants, can be tracked by screening SNPs, VNTRs, or polyA, for example.
  • Diseases, such as malaria can be tracked by screening commensals, such as mosquitos.
  • the methods disclosed herein can be used for detecting the presence of pathogenic and non-pathogenic bacteria, viruses, parasites, fungi and the like in samples of foodstuff or cosmetics.
  • food and wine can be examined for the presence of pathogenic and non-pathogenic bacteria, viruses, parasites, fungi and the like.
  • Particular types of foods susceptible to bioagent contamination such as agricultural products, meat products and eggs, can be examined for pathogenic organisms such as E. coli and Salmonella species.
  • Such examination procedures can be used by, for example, the wholesalers of foodstuffs and beverages, or by regulatory agencies such as the U.S. Department of Agriculture and the Food and Drug Administration.
  • grapes and wines for example, can be examined using the present methods to detect particular strains of bacteria or yeast that may indicate a particular time upon which to harvest the grapes or alter the wine-making process.
  • the methods disclosed herein can be used for detecting the presence of bioagents in a container, such as a package, box, envelope, mail tube, railroad box car, and the like.
  • a container such as a package, box, envelope, mail tube, railroad box car, and the like.
  • mail and package delivery entities and agencies both domestic and abroad, as well investigative agencies such as the FBI and ATF can use the present methods to detect bioagents in containers.
  • the methods disclosed herein can be used for detecting the presence of pathogenic and non-pathogenic bacteria, viruses, parasites, fungi and the like in organ donors and/or in organs from donors. Such examination can result in the prevention of the transfer of, for example, viruses such as West Nile virus, hepatitis viruses, human immunodeficiency virus, and the like from a donor to a recipient via a transplanted organ.
  • the methods disclosed herein can also be used for detection of host versus graft or graft versus host rejection issues related to organ donors by detecting the presence of particular antigens in either the graft or host known or suspected of causing such rejection.
  • the bioagents in this regard are the antigens of the major histocompatibility complex, such as the HLA antigens.
  • the methods disclosed herein can be used for detection and identification of livestock infections such as, for example, mad cow disease, hoof and mouth disease, and the like.
  • Livestock includes, but is not limited to, cows, pigs, sheep, chickens, turkeys, goats, and other farm animals.
  • the methods disclosed herein can be used for pharmacogenetic analysis and medical diagnosis including, but not limited to, cancer diagnosis based on mutations and polymorphisms, drug resistance and susceptibility testing, screening for and/or diagnosis of genetic diseases and conditions, and diagnosis of infectious diseases and conditions.
  • the present methods can also be used to detect and track emerging infectious diseases, such as West Nile virus infection, mad cow disease, and HIV-related diseases.
  • the present methods can be used to detect and classify any biological agent, including bacteria, viruses, fungi and toxins.
  • the information obtained is used to determine practical information needed for countermeasures, including toxin genes, pathogenicity islands and antibiotic resistance genes.
  • the methods can be used to identify natural or deliberate engineering events including chromosome fragment swapping, molecular breeding (gene shuffling) and emerging infectious diseases.
  • Bacteria have a common set of absolutely required genes. About 250 genes are present in all bacterial species ( Proc. Natl. Acad. Sci. U.S.A . 93:10268, 1996 ; Science 270:397, 1995), including tiny genomes like Mycoplasma, Ureaplasma and Rickettsia. These genes encode proteins involved in translation, replication, recombination and repair, transcription, nucleotide metabolism, amino acid metabolism, lipid metabolism, energy generation, uptake, secretion and the like.
  • Operons can also be targeted using the present method.
  • One example of an operon is the bfp operon from enteropathogenic E. coli .
  • Multiple core chromosomal genes can be used to classify bacteria at a genus or genus species level to determine if an organism has threat potential. The method can also be used to detect pathogenicity markers (plasmid or chromosomal) and antibiotic resistance genes to confirm the threat potential of an organism and to direct countermeasures.
  • a theoretically ideal bioagent detector would identify, quantify, and report the complete nucleic acid sequence of every bioagent that reached the sensor.
  • the complete sequence of the nucleic acid component of a pathogen would provide all relevant information about the threat, including its identity and the presence of drug-resistance or pathogenicity markers. This ideal has not yet been achieved.
  • the present invention provides a straightforward strategy for obtaining information with the same practical value using base composition signatures (BCS). While the base composition of a gene fragment is not as information-rich as the sequence itself, there is no need to analyze the complete sequence of the gene if the short analyte sequence fragment is properly chosen.
  • BCS base composition signatures
  • a database of reference sequences can be prepared in which each sequence is indexed to a unique base composition signature, so that the presence of the sequence can be inferred with accuracy from the presence of the signature.
  • base composition signatures are that they can be quantitatively measured in a massively parallel fashion using multiplex PCR (PCR in which two or more primer pairs amplify target sequences simultaneously) and mass spectrometry. These multiple primer amplified regions uniquely identify most threat and ubiquitous background bacteria and viruses. In addition, cluster-specific primer pairs distinguish important local clusters (e.g., anthracis group).
  • a “bioagent” is any organism, living or dead, or a nucleic acid derived from such an organism.
  • bioagents include but are not limited to cells (including but not limited to human clinical samples, bacterial cells and other pathogens) viruses, parasites, fungi, toxin genes and bioregulating compounds. Samples may be alive or dead or in a vegetative state (for example, vegetative bacteria or spores) and may be encapsulated or bioengineered.
  • a “base composition signature” is the exact base composition from selected fragments of nucleic acid sequences that uniquely identifies the target gene and source organism. BCS can be thought of as unique indexes of specific genes.
  • integer primers are primers which bind to sequence regions which flank an intervening variable region.
  • these sequence regions which flank the variable region are highly conserved among different species of bioagent.
  • the sequence regions may be highly conserved among all Bacillus species.
  • highly conserved it is meant that the sequence regions exhibit between about 80-100%, more preferably between about 90-100% and most preferably between about 95-100% identity.
  • FIGS. 1 A- 1 I A typical primer amplified region in 16S rRNA is shown in FIG. 2.
  • the arrows represent primers which bind to highly conserved regions which flank a variable region in 16S rRNA domain III.
  • the amplified region is the stem-loop structure under “1100-1188.”
  • One main advantage of the detection methods of the present invention is that the primers need not be specific for a particular bacterial species, or even genus, such as Bacillus or Streptomyces. Instead, the primers recognize highly conserved regions across hundreds of bacterial species including, but not limited to, the species described herein. Thus, the same primer pair can be used to identify any desired bacterium because it will bind to the conserved regions which flank a variable region specific to a single species, or common to several bacterial species, allowing nucleic acid amplification of the intervening sequence and determination of its molecular weight and base composition.
  • primers used in the present method bind to one or more of these regions or portions thereof.
  • the present invention provides a combination of a non-PCR biomass detection mode, preferably high-resolution MS, with nucleic acid amplification-based BCS technology using “intelligent primers” which hybridize to conserved regions and which bracket variable regions that uniquely identify the bioagent(s).
  • a non-PCR biomass detection mode preferably high-resolution MS
  • nucleic acid amplification-based BCS technology using “intelligent primers” which hybridize to conserved regions and which bracket variable regions that uniquely identify the bioagent(s).
  • PCR ligase chain reaction
  • SDA strand displacement amplification
  • the high-resolution MS technique allows separation of bioagent spectral lines from background spectral lines in highly cluttered environments.
  • the resolved spectral lines are then translated to BCS which are input to a maximum-likelihood detection algorithm matched against spectra for one or more known BCS.
  • the bioagent BCS spectrum is matched against one or more databases of BCS from vast numbers of bioagents.
  • base composition signatures are quantitatively measured in a massively parallel fashion using the polymerase chain reaction (PCR), preferably multiplex PCR, and mass spectrometric (MS) methods. Sufficient quantities of nucleic acids must be present for detection of bioagents by MS. A wide variety of techniques for preparing large amounts of purified nucleic acids or fragments thereof are well known to those of skill in the art.
  • PCR requires one or more pairs of oligonucleotide primers which bind to regions which flank the target sequence(s) to be amplified. These primers prime synthesis of a different strand of DNA, with synthesis occurring in the direction of one primer towards the other primer.
  • the primers, DNA to be amplified, a thermostable DNA polymerase (e.g. Taq polymerase), the four deoxynucleotide triphosphates, and a buffer are combined to initiate DNA synthesis.
  • the solution is denatured by heating, then cooled to allow annealing of newly added primer, followed by another round of DNA synthesis. This process is typically repeated for about 30 cycles, resulting in amplification of the target sequence.
  • the “intelligent primers” define the target sequence region to be amplified and analyzed.
  • the target sequence is a ribosomal RNA (rRNA) gene sequence.
  • rRNA ribosomal RNA
  • rRNA genes Like many genes involved in core life functions, rRNA genes contain sequences that are extraordinarily conserved across bacterial domains interspersed with regions of high variability that are more specific to each species. The variable regions can be utilized to build a database of base composition signatures.
  • the strategy involves creating a structure-based alignment of sequences of the small (16S) and the large (23S) subunits of the rRNA genes. For example, there are currently over 13,000 sequences in the ribosomal RNA database that has been created and maintained by Robin Gutell, University of Texas at Austin, and is publicly available on the Institute for Cellular and Molecular Biology web page (www.rna.icmb.utexas.edu/). There is also a publicly available rRNA database created and maintained by the University of Antwerp, Belgium at www.rrna.uia.ac.be.
  • regions that are useful as base composition signatures are: a) between about 80 and 100%, preferably>about 95% identity among species of the particular bioagent of interest, of upstream and downstream nucleotide sequences which serve as sequence amplification primer sites; b) an intervening variable region which exhibits no greater than about 5% identity among species; and c) a separation of between about 30 and 1000 nucleotides, preferably no more than about 50-250 nucleotides, and more preferably no more than about 60-100 nucleotides, between the conserved regions.
  • flanking rRNA primer sequences serve as good “universal” primer binding sites to amplify the region of interest for most, if not all, bacterial species.
  • the intervening region between the sets of primers varies in length and/or composition, and thus provides a unique base composition signature.
  • oligonucleotide primers can be designed such that the nucleotide corresponding to this position is a base which can bind to more than one nucleotide, referred to herein as a “universal base”.
  • inosine (I) binds to U, C or A; guanine (G) binds to U or C, and uridine (U) binds to U or C.
  • Other examples of universal bases include nitroindoles such as 5-nitroindole or 3-nitropyrrole (Loakes et al., Nucleosides and Nucleotides 14:1001-1003, 1995), the degenerate nucleotides dP or dK (Hill et al.), an acyclic nucleoside analog containing 5-nitroindazole (Van Aerschot et al., Nucleosides and Nucleotides 14:1053-1056, 1995) or the purine analog 1-(2-deoxy- ⁇ -D-ribofuranosyl)-imidazole-4-carboxamide (Sala et al., Nucl. Acids Res. 24:3302-3306, 1996).
  • the oligonucleotide primers are designed such that the first and second positions of each triplet are occupied by nucleotide analogs which bind with greater affinity than the unmodified nucleotide.
  • these analogs are 2,6-diaminopurine which binds to thymine, propyne T which binds to adenine and propyne C and phenoxazines, including G-clamp, which binds to G.
  • Propynes are described in U.S. Pat. Nos. 5,645,985, 5,830.653 and 5,484,908, the entire contents of which are incorporated herein by reference.
  • Phenoxazines are described in U.S. Pat. Nos. 5,502,177, 5,763,588, and 6,005,096, the entire contents of which are incorporated herein by reference.
  • G-clamps are described in U.S. Pat. Nos. 6,007,992 and 6,028,183, the entire contents of which are incorporated herein by reference.
  • Bacterial biological warfare agents capable of being detected by the present methods include Bacillus anthracis (anthrax), Yersinia pestis (pneumonic plague), Franciscella tularensis (tularemia), Brucella suis, Brucella abortus, Brucella melitensis (undulant fever), Burkholderia mallei (glanders), Burkholderia pseudomalleii (melioidosis), Salmonella typhi (typhoid fever), Rickettsia typhii (epidemic typhus), Rickettsia prowasekii (endemic typhus) and Coxiella burnetii (Q fever), Rhodobacter capsulatus, Chlamydia pneumoniae, Escherichia coli, Shigella dysenteriae, Shigella
  • target regions suitable for use in the present invention for detection of bacteria include 5S rRNA and RNase P (FIG. 3).
  • Biological warfare fungus biowarfare agents include coccidioides immitis (Coccidioidomycosis).
  • Biological warfare toxin genes capable of being detected by the methods of the present invention include botulism, T-2 mycotoxins, ricin, staph enterotoxin B, shigatoxin, abrin, aflatoxin, Clostridium perfringens epsilon toxin, conotoxins, diacetoxyscirpenol, tetrodotoxin and saxitoxin.
  • RNA viruses positive-strand and negative-strand
  • Every RNA virus is a family of related viruses (quasispecies). These viruses mutate rapidly and the potential for engineered strains (natural or deliberate) is very high.
  • RNA viruses cluster into families that have conserved RNA structural domains on the viral genome (e.g., virion components, accessory proteins) and conserved housekeeping genes that encode core viral proteins including, for single strand positive strand RNA viruses, RNA-dependent RNA polymerase, double stranded RNA helicase, chymotrypsin-like and papain-like proteases and methyltransferases.
  • Examples of ( ⁇ )-strand RNA viruses include arenaviruses (e.g., sabia virus, lassa fever, Machupo, Argentine hemorrhagic fever, flexal virus), bunyaviruses (e.g., hantavirus, nairovirus, phlebovirus, hantaan virus, Congo-crimean hemorrhagic fever, rift valley fever), and mononegavirales (e.g., filovirus, paramyxovirus, ebola virus, Marburg, equine morbillivirus).
  • arenaviruses e.g., sabia virus, lassa fever, Machupo, Argentine hemorrhagic fever, flexal virus
  • bunyaviruses e.g., hantavirus, nairovirus, phlebovirus, hantaan virus, Congo-crimean hemorrhagic fever, rift valley fever
  • (+)-strand RNA viruses include picornaviruses (e.g., coxsackievirus, echovirus, human coxsackievirus A, human echovirus, human enterovirus, human poliovirus, hepatitis A virus, human parechovirus, human rhinovirus), astroviruses (e.g., human astrovirus), calciviruses (e.g., chiba virus, chitta virus, human calcivirus, norwalk virus), nidovirales (e.g., human coronavirus, human torovirus), flaviviruses (e.g., dengue virus 1-4, Japanese encephalitis virus, Kyanasur forest disease virus, Murray Valley encephalitis virus, Rocio virus, St.
  • picornaviruses e.g., coxsackievirus, echovirus, human coxsackievirus A, human echovirus, human enterovirus, human poliovirus, hepatitis A virus, human pare
  • the hepatitis C virus has a 5′-untranslated region of 340 nucleotides, an open reading frame encoding 9 proteins having 3010 amino acids and a 3′-untranslated region of 240 nucleotides.
  • the 5′-UTR and 3′-UTR are 99% conserved in hepatitis C viruses.
  • the target gene is an RNA-dependent RNA polymerase or a helicase encoded by (+)-strand RNA viruses, or RNA polymerase from a ( ⁇ )-strand RNA virus.
  • (+)-strand RNA viruses are double stranded RNA and replicate by RNA-directed RNA synthesis using RNA-dependent RNA polymerase and the positive strand as a template. Helicase unwinds the RNA duplex to allow replication of the single stranded RNA.
  • viruses include viruses from the family picornaviridae (e.g., poliovirus, coxsackievirus, echovirus), togaviridae (e.g., alphavirus, flavivirus, rubivirus), arenaviridae (e.g., lymphocytic choriomeningitis virus, lassa fever virus), cononaviridae (e.g., human respiratory virus) and Hepatitis A virus.
  • picornaviridae e.g., poliovirus, coxsackievirus, echovirus
  • togaviridae e.g., alphavirus, flavivirus, rubivirus
  • arenaviridae e.g., lymphocytic choriomeningitis virus, lassa fever virus
  • cononaviridae e.g., human respiratory virus
  • Hepatitis A virus e.g., human respiratory virus
  • the detection scheme for the PCR products generated from the bioagent(s) incorporates three features. First, the technique simultaneously detects and differentiates multiple (generally about 6-10) PCR products. Second, the technique provides a BCS that uniquely identifies the bioagent from the possible primer sites. Finally, the detection technique is rapid, allowing multiple PCR reactions to be run in parallel.
  • the method can be used to detect the presence of antibiotic resistance and/or toxin genes in a bacterial species.
  • Bacillus anthracis comprising a tetracycline resistance plasmid and plasmids encoding one or both anthracis toxins (px01 and/or px02) can be detected by using antibiotic resistance primer sets and toxin gene primer sets. If the B. anthracis is positive for tetracycline resistance, then a different antibiotic, for example quinalone, is used.
  • Mass spectrometry (MS)-based detection of PCR products provides all of these features with additional advantages.
  • MS is intrinsically a parallel detection scheme without the need for radioactive or fluorescent labels, since every amplification product with a unique base composition is identified by its molecular mass.
  • the current state of the art in mass spectrometry is such that less than femtomole quantities of material can be readily analyzed to afford information about the molecular contents of the sample.
  • An accurate assessment of the molecular mass of the material can be quickly obtained, irrespective of whether the molecular weight of the sample is several hundred, or in excess of one hundred thousand atomic mass units (amu) or Daltons.
  • Intact molecular ions can be generated from amplification products using one of a variety of ionization techniques to convert the sample to gas phase. These ionization methods include, but are not limited to, electrospray ionization (ES), matrix-assisted laser desorption ionization (MALDI) and fast atom bombardment (FAB).
  • ES electrospray ionization
  • MALDI matrix-assisted laser desorption ionization
  • FAB fast atom bombardment
  • MALDI of nucleic acids along with examples of matrices for use in MALDI of nucleic acids, are described in WO 98/54751 (Genetrace, Inc.).
  • large DNAs and RNAs, or large amplification products therefrom can be digested with restriction endonucleases prior to ionization.
  • restriction endonucleases for example, an amplification product that was 10 kDa could be digested with a series of restriction endonucleases to produce a panel of, for example, 100 Da fragments. Restriction endonucleases and their sites of action are well known to the skilled artisan. In this manner, mass spectrometry can be performed for the purposes of restriction mapping.
  • Electrospray ionization mass spectrometry is particularly useful for very high molecular weight polymers such as proteins and nucleic acids having molecular weights greater than 10 kDa, since it yields a distribution of multiply-charged molecules of the sample without causing a significant amount of fragmentation.
  • the mass detectors used in the methods of the present invention include, but are not limited to, Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS), ion trap, quadrupole, magnetic sector, time of flight (TOF), Q-TOF, and triple quadrupole.
  • FT-ICR-MS Fourier transform ion cyclotron resonance mass spectrometry
  • ion trap ion trap
  • quadrupole quadrupole
  • magnetic sector magnetic sector
  • TOF time of flight
  • Q-TOF Q-TOF
  • triple quadrupole triple quadrupole
  • the mass spectrometric techniques which can be used in the present invention include, but are not limited to, tandem mass spectrometry, infrared multiphoton dissociation and pyrolytic gas chromatography mass spectrometry (PGC-MS).
  • the bioagent detection system operates continually in bioagent detection mode using pyrolytic GC-MS without PCR for rapid detection of increases in biomass (for example, increases in fecal contamination of drinking water or of germ warfare agents).
  • a continuous sample stream flows directly into the PGC-MS combustion chamber.
  • a PCR process is automatically initiated.
  • Bioagent presence produces elevated levels of large molecular fragments from 100-7,000 Da which are observed in the PGC-MS spectrum.
  • the observed mass spectrum is compared to a threshold level and when levels of biomass are determined to exceed a predetermined threshold, the bioagent classification process described hereinabove(combining PCR and MS, preferably FT-ICR MS) is initiated.
  • alarms or other processes are also initiated by this detected biomass level.
  • tandem mass spectrometry (MS n ) techniques may provide more definitive information pertaining to molecular identity or sequence.
  • Tandem MS involves the coupled use of two or more stages of mass analysis where both the separation and detection steps are based on mass spectrometry. The first stage is used to select an ion or component of a sample from which further structural information is to be obtained. The selected ion is then fragmented using, e.g., blackbody irradiation, infrared multiphoton dissociation, or collisional activation. For example, ions generated by electrospray ionization (ESI) can be fragmented using IR multiphoton dissociation.
  • ESI electrospray ionization
  • This activation leads to dissociation of glycosidic bonds and the phosphate backbone, producing two series of fragment ions, called the w-series (having an intact 3′ terminus and a 5′ phosphate following internal cleavage) and the ⁇ -Base series(having an intact 5′ terminus and a 3′ furan).
  • the second stage of mass analysis is then used to detect and measure the mass of these resulting fragments of product ions.
  • Such ion selection followed by fragmentation routines can be performed multiple times so as to essentially completely dissect the molecular sequence of a sample.
  • a nucleotide analog or “tag” is incorporated during amplification (e.g., a 5-(trifluoromethyl) deoxythymidine triphosphate) which has a different molecular weight than the unmodified base so as to improve distinction of masses.
  • tags are described in, for example, PCT WO97/33000. This further limits the number of possible base compositions consistent with any mass.
  • 5-(trifluoromethyl)deoxythymidine triphosphate can be used in place of dTTP in a separate nucleic acid amplification reaction.
  • Measurement of the mass shift between a conventional amplification product and the tagged product is used to quantitate the number of thymidine nucleotides in each of the single strands. Because the strands are complementary, the number of adenosine nucleotides in each strand is also determined.
  • the number of G and C residues in each strand is determined using, for example, the cytidine analog 5-methylcytosine (5-meC) or propyne C.
  • the mass tag phosphorothioate A (A*) was used to distinguish a Bacillus anthracis cluster.
  • the B. anthracis (A 14 G 9 C 14 T 9 ) had an average MW of 14072.26, and the B. anthracis (A 1 A* 13 G 9 C 14 T 9 ) had an average molecular weight of 14281.11 and the phosphorothioate A had an average molecular weight of +16.06 as determined by ESI-TOF MS.
  • the deconvoluted spectra are shown in FIG. 5.
  • Signals from the mass spectrometer may be input to a maximum-likelihood detection and classification algorithm such as is widely used in radar signal processing.
  • the detection processing uses matched filtering of BCS observed in mass-basecount space and allows for detection and subtraction of signatures from known, harmless organisms, and for detection of unknown bioagent threats. Comparison of newly observed bioagents to known bioagents is also possible, for estimation of threat level, by comparing their BCS to those of known organisms and to known forms of pathogenicity enhancement, such as insertion of antibiotic resistance genes or toxin genes.
  • Processing may end with a Bayesian classifier using log likelihood ratios developed from the observed signals and average background levels.
  • the program emphasizes performance predictions culminating in probability-of-detection versus probability-of-false-alarm plots for conditions involving complex backgrounds of naturally occurring organisms and environmental contaminants.
  • Matched filters consist of a priori expectations of signal values given the set of primers used for each of the bioagents.
  • a genomic sequence database e.g. GenBank
  • GenBank is used to define the mass basecount matched filters.
  • the database contains known threat agents and benign background organisms. The latter is used to estimate and subtract the signature produced by the background organisms.
  • a maximum likelihood detection of known background organisms is implemented using matched filters and a running-sum estimate of the noise covariance.
  • a strategy to “triangulate” each organism by measuring signals from multiple core genes is used to reduce false negative and false positive signals, and enable reconstruction of the origin or hybrid or otherwise engineered bioagents.
  • alignments are created from nucleic acid sequence databases. The alignments are then analyzed for regions of conservation and variation, and potential primer binding sites flanking variable regions are identified.
  • amplification target regions for signature analysis are selected which distinguishes organisms based on specific genomic differences (i.e., base composition). For example, detection of signatures for the three part toxin genes typical of B. anthracis (Bowen, J. E. and C. P. Quinn, J Appl. Microbiol . 1999, 87, 270-278) in the absence of the expected signatures from the B. anthracis genome would suggest a genetic engineering event.
  • the present method can also be used to detect single nucleotide polymorphisms (SNPs), or multiple nucleotide polymorphisms, rapidly and accurately.
  • SNP single nucleotide polymorphisms
  • a SNP is defined as a single base pair site in the genome that is different from one individual to another. The difference can be expressed either as a deletion, an insertion or a substitution, and is frequently linked to a disease state. Because they occur every 100-1000 base pairs, SNPs are the most frequently bound type of genetic marker in the human genome.
  • sickle cell anemia results from an A-T transition, which encodes a valine rather than a glutamic acid residue.
  • Oligonucleotide primers may be designed such that they bind to sequences that flank a SNP site, followed by nucleotide amplification and mass determination of the amplified product. Because the molecular masses of the resulting product from an individual who does not have sickle cell anemia is different from that of the product from an individual who has the disease, the method can be used to distinguish the two individuals. Thus, the method can be used to detect any known SNP in an individual and thus diagnose or determine increased susceptibility to a disease or condition.
  • blood is drawn from an individual and peripheral blood mononuclear cells (PBMC) are isolated and simultaneously tested, preferably in a high-throughput screening method, for one or more SNPs using appropriate primers based on the known sequences which flank the SNP region.
  • PBMC peripheral blood mononuclear cells
  • the National Center for Biotechnology Information maintains a publicly available database of SNPs (www.ncbi.nlm.nih.gov/SNP/).
  • the method of the present invention can also be used for blood typing.
  • the gene encoding A, B or O blood type can differ by four single nucleotide polymorphisms. If the gene contains the sequence CGTGGTGACCCTT (SEQ ID NO:5), antigen A results. If the gene contains the sequence CGTCGTCACCGCTA (SEQ ID NO:6) antigen B results. If the gene contains the sequence CGTGGT-ACCCCTT (SEQ ID NO:7), blood group O results (“ ⁇ ” indicates a deletion). These sequences can be distinguished by designing a single primer pair that flanks these regions, followed by amplification and mass determination.
  • all of the aformentioned methods can be used to determine or confirm the absence of a bioagent in a sample. For example, when the molecular mass or base composition is compared to one or more molecular masses or base compositions obtained from a plurality of known organisms and no match is obtained, the absence of a particular bioagent is determined or confirmed.
  • a positive control can be used to confirm the integrity of the system. Such positive controls include, but are not limited to addition of a known bioagent to the sample and confirming the presence of the known bioagent in the sample by obtaining a match from the comparison step. Alternately, residual primer signal can be detected, thus indicating that the system integrity is intact.
  • nucleic acid is isolated from the organisms and amplified by PCR using standard methods prior to BCS determination by mass spectrometry.
  • Nucleic acid is isolated, for example, by detergent lysis of bacterial cells, centrifugation and ethanol precipitation. Nucleic acid isolation methods are described in, for example, Current Protocols in Molecular Biology (Ausubel et al.) and Molecular Cloning; A Laboratory Manual (Sambrook et al.).
  • the nucleic acid is then amplified using standard methodology, such as PCR, with primers which bind to conserved regions of the nucleic acid which contain an intervening variable sequence as described below.
  • FTICR Instrumentation The FTICR instrument is based on a 7 tesla actively shielded superconducting magnet and modified Bruker Daltonics Apex II 70e ion optics and vacuum chamber. The spectrometer is interfaced to a LEAP PAL autosampler and a custom fluidics control system for high throughput screening applications. Samples are analyzed directly from 96-well or 384-well microtiter plates at a rate of about 1 sample/minute.
  • the Bruker data-acquisition platform is supplemented with a lab-built ancillary NT datastation which controls the autosampler and contains an arbitrary waveform generator capable of generating complex rf-excite waveforms (frequency sweeps, filtered noise, stored waveform inverse Fourier transform (SWIFT), etc.) for sophisticated tandem MS experiments.
  • a lab-built ancillary NT datastation which controls the autosampler and contains an arbitrary waveform generator capable of generating complex rf-excite waveforms (frequency sweeps, filtered noise, stored waveform inverse Fourier transform (SWIFT), etc.) for sophisticated tandem MS experiments.
  • SWIFT stored waveform inverse Fourier transform
  • Modified ESI Source In sample-limited analyses, analyte solutions are delivered at 150 nL/minute to a 30 mm i.d. fused-silica ESI emitter mounted on a 3-D micromanipulator.
  • the ESI ion optics consists of a heated metal capillary, an rf-only hexapole, a skimmer cone, and an auxiliary gate electrode.
  • the 6.2 cm rf-only hexapole is comprised of 1 mm diameter rods and is operated at a voltage of 380 Vpp at a frequency of 5 MHz.
  • a lab-built electro-mechanical shutter can be employed to prevent the electrospray plume from entering the inlet capillary unless triggered to the “open” position via a TTL pulse from the data station.
  • a stable electrospray plume is maintained between the ESI emitter and the face of the shutter.
  • the back face of the shutter arm contains an elastomeric seal that can be positioned to form a vacuum seal with the inlet capillary. When the seal is removed, a 1 mm gap between the shutter blade and the capillary inlet allows constant pressure in the external ion reservoir regardless of whether the shutter is in the open or closed position.
  • a “time slice” of ions is allowed to enter the inlet capillary and is subsequently accumulated in the external ion reservoir.
  • the rapid response time of the ion shutter ( ⁇ 25 ms) provides reproducible, user defined intervals during which ions can be injected into and accumulated in the external ion reservoir.
  • Apparatus for Infrared Multiphoton Dissociation A 25 watt CW CO 2 laser operating at 10.6 ⁇ m has been interfaced to the spectrometer to enable infrared multiphoton dissociation (IRMPD) for oligonucleotide sequencing and other tandem MS applications.
  • An aluminum optical bench is positioned approximately 1.5 m from the actively shielded superconducting magnet such that the laser beam is aligned with the central axis of the magnet.
  • the unfocused 3 mm laser beam is aligned to traverse directly through the 3.5 mm holes in the trapping electrodes of the FTICR trapped ion cell and longitudinally traverse the hexapole region of the external ion guide finally impinging on the skimmer cone.
  • This scheme allows IRMPD to be conducted in an m/z selective manner in the trapped ion cell (e.g. following a SWIFT isolation of the species of interest), or in a broadband mode in the high pressure region of the external ion reservoir where collisions with neutral molecules stabilize IRMPD-generated metastable fragment ions resulting in increased fragment ion yield and sequence coverage.
  • Table 1 shows a small cross section of a database of calculated molecular masses for over 9 primer sets and approximately 30 organisms.
  • the primer sets were derived from rRNA alignment. Examples of regions from rRNA consensus alignments are shown in FIGS. 1 A- 1 C. Lines with arrows are examples of regions to which intelligent primer pairs for PCR are designed.
  • the primer pairs are >95% conserved in the bacterial sequence database (currently over 10,000 organisms).
  • the intervening regions are variable in length and/or composition, thus providing the base composition “signature” (BCS) for each organism.
  • Primer pairs were chosen so the total length of the amplified region is less than about 80-90 nucleotides.
  • the label for each primer pair represents the starting and ending base number of the amplified region on the consensus diagram.
  • FIG. 6 shows the use of ESI-FT-ICR MS for measurement of exact mass.
  • the spectra from 46mer PCR products originating at position 1337 of the 16S rRNA from S. aureus (upper) and B. anthracis (lower) are shown. These data are from the region of the spectrum containing signals from the [M-8H+] 8 ⁇ charge states of the respective 5′-3′ strands.
  • the two strands differ by two (AT ⁇ CG) substitutions, and have measured masses of 14206.396 and 14208.373 ⁇ 0.010 Da, respectively.
  • the possible base compositions derived from the masses of the forward and reverse strands for the B. anthracis products are listed in Table 3. TABLE 3 Possible base composition for B.
  • the pathogen Vibrio cholera can be distinguished from Vibrio parahemolyticus with ⁇ M>600 Da using one of three 16S primer sets shown in Table 2 (16S — 971, 16S — 1228 or 16S — 1294) as shown in Table 4.
  • the two mycoplasma species in the list ( M. genitalium and M. pneumoniae ) can also be distinguished from each other, as can the three mycobacteriae. While the direct mass measurements of amplified products can identify and distinguish a large number of organisms, measurement of the base composition signature provides dramatically enhanced resolving power for closely related organisms.
  • compositional analysis or fragmentation patterns are used to resolve the differences.
  • the single base difference between the two organisms yields different fragmentation patterns, and despite the presence of the ambiguous/unidentified base N at position 20 in B. anthracis , the two organisms can be identified.
  • Tables 4a-b show examples of primer pairs from Table 1 which distinguish pathogens from background.
  • Table 4 shows the expected molecular weight and base composition of region 16S — 1100-1188 in Mycobacterium avium and Streptomyces sp. TABLE 5 Organism Molecular Region name Length weight Base comp. 16S — Mycobacterium 82 25624.1728 A 16 G 32 C 18 T 16 1100-1188 avium 16S — Streptomyces 96 29904.871 A 17 G 38 C 27 T 14 1100-1188 sp.
  • Table 5 shows base composition (single strand) results for 16S — 1100-1188 primer amplification reactions different species of bacteria. Species which are repeated in the table (e.g., Clostridium botulinum) are different strains which have different base compositions in the 16S — 1100-1188 region.
  • Organism name Base comp Organism name Base comp. Mycobacterium avium A 16 G 32 C 18 T 16 Vibrio cholerae A 23 G 30 C 21 T 16 Streptomyces sp. A 17 G 38 C 27 T 14 A 23 G 31 C 21 T 15 Ureaplasma urealyticum A 18 G 30 C 17 T 17 A 23 G 31 C 21 T 15 Streptomyces sp.
  • the same organism having different base compositions are different strains. Groups of organisms which are highlighted or in italics have the same base compositions in the amplified region. Some of these organisms can be distinguished using multiple primers. For example, Bacillus anthracis can be distinguished from Bacillus cereus and Bacillus thuringiensis using the primer 16S — 971-1062 (Table 6). Other primer pairs which produce unique base composition signatures are shown in Table 6 (bold). Clusters containing very similar threat and ubiquitous non-threat organisms (e.g. anthracis cluster) are distinguished at high resolution with focused sets of primer pairs.
  • the known biowarfare agents in Table 6 are Bacillus anthracis, Yersinia pestis, Francisella tularensis and Rickettsia prowazekii .
  • Organism 16S_971-1062 16S_1228-1310 16S_1100-1188 Aeromonas hydrophila A 21 G 29 C 22 T 20 A 22 G 27 C 21 T 13 A 23 G 31 C 21 T 15 Aeromonas salmonicida A 21 G 29 C 22 T 20 A 22 G 27 C 21 T 13 A 23 G 31 C 21 T 15
  • Bacillus anthracis A 21 G 27 C 22 T 22 A 24 G 22 C 19 T 18 A 23 G 27 C 20 T 18
  • Bacillus cereus A 22 G 27 C 21 T 22 A 24 G 22 C 19 T 18 A 23 G 27 C 20 T 18
  • Bacillus thuringiensis A 22 G 27 C 21 T 22 A 24 G 22 C 19 T 18 A 23 G 27 C 20 T 18 Chlamydia trachomatis A 22 G 26 C
  • B. anthracis has an ambiguous base at position 20.
  • AACCCUAGAGAUAGGGCU (SEQ ID NO: 1) UCUCCUUCGGGAGCAGAGUGACAGGUGGUGCAUGGUU
  • AACCCUAGAGAUAGGGCU (SEQ ID NO: 2) UCUCCUUCGGGAGCAGAGUGACAGGUGGUGCAUGGUU
  • the mass measurement accuracy that can be obtained using an internal mass standard in the ESI-MS study of PCR products is shown in FIG. 8.
  • the mass standard was a 20-mer phosphorothioate oligonucleotide added to a solution containing a 56-mer PCR product from the B. anthracis spore coat protein sspE.
  • the mass of the expected PCR product distinguishes B. anthracis from other species of Bacillus such as B. thuringiensis and B. cereus.
  • ESI-TOF MS spectra were obtained on a synthetic 56-mer oligonucleotide (5 ⁇ M)from the saspB gene of B. anthracis containing an internal mass standard at an ESI of 1.7 ⁇ L/min as a function of sample consumption.
  • the results show that the signal to noise is improved as more scans are summed, and that the standard and the product are visible after only 100 scans.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Other Investigation Or Analysis Of Materials By Electrical Means (AREA)
US10/323,233 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in blood, bodily fluids, and bodily tissues Abandoned US20040121309A1 (en)

Priority Applications (24)

Application Number Priority Date Filing Date Title
US10/323,233 US20040121309A1 (en) 2002-12-06 2002-12-18 Methods for rapid detection and identification of bioagents in blood, bodily fluids, and bodily tissues
US10/326,051 US20040121313A1 (en) 2002-12-06 2002-12-18 Methods for rapid detection and identification of bioagents in organs for transplantation
US10/325,527 US20040121335A1 (en) 2002-12-06 2002-12-18 Methods for rapid detection and identification of bioagents associated with host versus graft and graft versus host rejections
US10/325,526 US20040121311A1 (en) 2002-12-06 2002-12-18 Methods for rapid detection and identification of bioagents in livestock
US10/660,122 US7781162B2 (en) 2001-03-02 2003-09-11 Methods for rapid identification of pathogens in humans and animals
AU2003297687A AU2003297687B2 (en) 2001-03-02 2003-12-05 Methods for rapid identification of pathogens in humans and animals
JP2005508488A JP2006508696A (ja) 2002-12-06 2003-12-05 ヒトおよび動物における病原体の迅速な同定方法
PCT/US2003/038761 WO2004060278A2 (en) 2002-12-06 2003-12-05 Methods for rapid identification of pathogens in humans and animals
EP03814656A EP1578399A4 (en) 2002-12-06 2003-12-05 METHODS FOR RAPID IDENTIFICATION OF PATHOGENS IN HUMANS AND BEETS
US10/728,486 US7718354B2 (en) 2001-03-02 2003-12-05 Methods for rapid identification of pathogens in humans and animals
CA002508726A CA2508726A1 (en) 2002-12-06 2003-12-05 Methods for rapid identification of pathogens in humans and animals
CA002508584A CA2508584A1 (en) 2002-12-06 2003-12-05 Methods for rapid identification of pathogens in humans and animals
PCT/US2003/038830 WO2004052175A2 (en) 2002-12-06 2003-12-05 Methods for rapid identification of pathogens in humans and animals
EP03796752A EP1581657A4 (en) 2002-12-06 2003-12-05 METHODS FOR THE RAPID IDENTIFICATION OF PATHOGENS IN HUMANS AND ANIMALS
JP2005508560A JP2006516193A (ja) 2002-12-06 2003-12-05 ヒトおよび動物における病原体の迅速な同定方法
AU2003298030A AU2003298030B2 (en) 2001-03-02 2003-12-05 Methods for rapid identification of pathogens in humans and animals
US11/869,449 US20080311558A1 (en) 2001-03-02 2007-10-09 Methods For Rapid Identification Of Pathogens In Humans And Animals
US11/930,002 US8071309B2 (en) 2002-12-06 2007-10-30 Methods for rapid identification of pathogens in humans and animals
US11/929,910 US8214154B2 (en) 2001-03-02 2007-10-30 Systems for rapid identification of pathogens in humans and animals
AU2010200686A AU2010200686B2 (en) 2001-03-02 2010-02-25 Methods for rapid identification of pathogens in humans and animals
US13/174,254 US9416424B2 (en) 2001-03-02 2011-06-30 Methods for rapid identification of pathogens in humans and animals
US13/243,960 US8822156B2 (en) 2002-12-06 2011-09-23 Methods for rapid identification of pathogens in humans and animals
US14/473,603 US9725771B2 (en) 2002-12-06 2014-08-29 Methods for rapid identification of pathogens in humans and animals
US15/237,261 US20170044630A1 (en) 2001-03-02 2016-08-15 Methods For Rapid Identification Of Pathogens In Humans And Animals

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
US43131902P 2002-12-06 2002-12-06
US10/326,051 US20040121313A1 (en) 2002-12-06 2002-12-18 Methods for rapid detection and identification of bioagents in organs for transplantation
US10/323,233 US20040121309A1 (en) 2002-12-06 2002-12-18 Methods for rapid detection and identification of bioagents in blood, bodily fluids, and bodily tissues
US10/325,526 US20040121311A1 (en) 2002-12-06 2002-12-18 Methods for rapid detection and identification of bioagents in livestock
US10/325,527 US20040121335A1 (en) 2002-12-06 2002-12-18 Methods for rapid detection and identification of bioagents associated with host versus graft and graft versus host rejections
US44344303P 2003-01-29 2003-01-29
US44378803P 2003-01-30 2003-01-30
US44752903P 2003-02-14 2003-02-14
US10/660,122 US7781162B2 (en) 2001-03-02 2003-09-11 Methods for rapid identification of pathogens in humans and animals

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/326,051 Continuation-In-Part US20040121313A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in organs for transplantation

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US10/660,122 Continuation-In-Part US7781162B2 (en) 2001-03-02 2003-09-11 Methods for rapid identification of pathogens in humans and animals
US10/728,486 Continuation-In-Part US7718354B2 (en) 2001-03-02 2003-12-05 Methods for rapid identification of pathogens in humans and animals

Publications (1)

Publication Number Publication Date
US20040121309A1 true US20040121309A1 (en) 2004-06-24

Family

ID=32512832

Family Applications (7)

Application Number Title Priority Date Filing Date
US10/326,051 Abandoned US20040121313A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in organs for transplantation
US10/323,233 Abandoned US20040121309A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in blood, bodily fluids, and bodily tissues
US10/325,527 Abandoned US20040121335A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents associated with host versus graft and graft versus host rejections
US10/325,526 Abandoned US20040121311A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in livestock
US10/660,122 Expired - Fee Related US7781162B2 (en) 2001-03-02 2003-09-11 Methods for rapid identification of pathogens in humans and animals
US11/869,449 Abandoned US20080311558A1 (en) 2001-03-02 2007-10-09 Methods For Rapid Identification Of Pathogens In Humans And Animals
US11/929,910 Expired - Fee Related US8214154B2 (en) 2001-03-02 2007-10-30 Systems for rapid identification of pathogens in humans and animals

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10/326,051 Abandoned US20040121313A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in organs for transplantation

Family Applications After (5)

Application Number Title Priority Date Filing Date
US10/325,527 Abandoned US20040121335A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents associated with host versus graft and graft versus host rejections
US10/325,526 Abandoned US20040121311A1 (en) 2001-03-02 2002-12-18 Methods for rapid detection and identification of bioagents in livestock
US10/660,122 Expired - Fee Related US7781162B2 (en) 2001-03-02 2003-09-11 Methods for rapid identification of pathogens in humans and animals
US11/869,449 Abandoned US20080311558A1 (en) 2001-03-02 2007-10-09 Methods For Rapid Identification Of Pathogens In Humans And Animals
US11/929,910 Expired - Fee Related US8214154B2 (en) 2001-03-02 2007-10-30 Systems for rapid identification of pathogens in humans and animals

Country Status (5)

Country Link
US (7) US20040121313A1 (US20040121313A1-20040624-P00820.png)
EP (1) EP1581657A4 (US20040121313A1-20040624-P00820.png)
JP (1) JP2006508696A (US20040121313A1-20040624-P00820.png)
CA (1) CA2508584A1 (US20040121313A1-20040624-P00820.png)
WO (1) WO2004052175A2 (US20040121313A1-20040624-P00820.png)

Cited By (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040219517A1 (en) * 2001-03-02 2004-11-04 Ecker David J. Methods for rapid identification of pathogens in humans and animals
US20050270191A1 (en) * 2004-05-24 2005-12-08 Isis Pharmaceuticals, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US20070111234A1 (en) * 2005-09-12 2007-05-17 Christian Birkner Detection of biological DNA
US20080227087A1 (en) * 2005-10-11 2008-09-18 Ann Huletsky Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA) of MREJ types xi to xx
US20090263809A1 (en) * 2008-03-20 2009-10-22 Zygem Corporation Limited Methods for Identification of Bioagents
US7666588B2 (en) 2001-03-02 2010-02-23 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US7666592B2 (en) 2004-02-18 2010-02-23 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US7718354B2 (en) 2001-03-02 2010-05-18 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US7741036B2 (en) 2001-03-02 2010-06-22 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US7811753B2 (en) 2004-07-14 2010-10-12 Ibis Biosciences, Inc. Methods for repairing degraded DNA
WO2011047307A1 (en) 2009-10-15 2011-04-21 Ibis Biosciences, Inc. Multiple displacement amplification
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
WO2011112718A1 (en) 2010-03-10 2011-09-15 Ibis Biosciences, Inc. Production of single-stranded circular nucleic acid
US8026084B2 (en) 2005-07-21 2011-09-27 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
US20110238316A1 (en) * 2001-06-26 2011-09-29 Ecker David J Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8046171B2 (en) 2003-04-18 2011-10-25 Ibis Biosciences, Inc. Methods and apparatus for genetic evaluation
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8071309B2 (en) 2002-12-06 2011-12-06 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8119336B2 (en) 2004-03-03 2012-02-21 Ibis Biosciences, Inc. Compositions for use in identification of alphaviruses
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
WO2013036603A1 (en) 2011-09-06 2013-03-14 Ibis Biosciences, Inc. Sample preparation methods
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
WO2014052590A1 (en) 2012-09-26 2014-04-03 Ibis Biosciences, Inc. Swab interface for a microfluidic device
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9068017B2 (en) 2010-04-08 2015-06-30 Ibis Biosciences, Inc. Compositions and methods for inhibiting terminal transferase activity
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
US9393564B2 (en) 2009-03-30 2016-07-19 Ibis Biosciences, Inc. Bioagent detection systems, devices, and methods
US9416409B2 (en) 2009-07-31 2016-08-16 Ibis Biosciences, Inc. Capture primers and capture sequence linked solid supports for molecular diagnostic tests
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US9777335B2 (en) 2001-06-04 2017-10-03 Geneohm Sciences Canada Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US9970061B2 (en) 2011-12-27 2018-05-15 Ibis Biosciences, Inc. Bioagent detection oligonucleotides
US10584392B2 (en) 2007-06-01 2020-03-10 Council Of Scientific And Industrial Research Method for simultaneous detection and discrimination of bacterial, fungal, parasitic and viral infections of eye and central nervous system

Families Citing this family (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2560521C (en) * 2004-02-18 2012-01-03 Isis Pharmaceuticals, Inc. Compositions for use in identification of bacteria
CA2495138C (en) * 2005-01-20 2012-10-23 Alison Jane Basile Multiplexed analysis for determining a serodiagnosis of viral infection
DE602006017365D1 (de) * 2005-04-13 2010-11-18 Ibis Biosciences Inc Zusammensetzungen für die identifizierung von adenoviren
US20070026426A1 (en) 2005-04-26 2007-02-01 Applera Corporation System for genetic surveillance and analysis
CA2610836A1 (en) * 2005-06-15 2006-12-28 Gen-Probe Incorporated Methods for quantitative analysis of a nucleic acid amplification reaction
US7531309B2 (en) 2005-12-06 2009-05-12 Michigan State University PCR based capsular typing method
US7819615B2 (en) * 2005-12-06 2010-10-26 Hewlett-Packard Development Method and apparatus for finishing sheets for a bound document
EP2005348A4 (en) * 2006-02-14 2011-11-09 Intelliscience Corp METHODS AND SYSTEMS FOR DATA ANALYSIS AND CHARACTERISTIC RECOGNITION COMPRISING DETECTION OF AVIAN INFLUENZA VIRUS
US20070244844A1 (en) * 2006-03-23 2007-10-18 Intelliscience Corporation Methods and systems for data analysis and feature recognition
US8625885B2 (en) 2006-03-23 2014-01-07 Intelliscience Corporation Methods and systems for data analysis and feature recognition
EP2602321B1 (en) 2006-05-31 2017-08-23 Sequenom, Inc. Methods and compositions for the extraction and amplification of nucleic acid from a sample
WO2007147063A2 (en) * 2006-06-16 2007-12-21 Sequenom, Inc. Methods and compositions for the amplification, detection and quantification of nucleic acid from a sample
US7902345B2 (en) 2006-12-05 2011-03-08 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
US8076104B2 (en) * 2007-01-25 2011-12-13 Rogan Peter K Rapid and comprehensive identification of prokaryotic organisms
US8652780B2 (en) 2007-03-26 2014-02-18 Sequenom, Inc. Restriction endonuclease enhanced polymorphic sequence detection
US7811766B2 (en) * 2007-03-28 2010-10-12 Thinkvillage, Llc Genetic identification and validation of Echinacea species
EP1985712A1 (en) 2007-04-17 2008-10-29 Vereniging voor christelijk hoger onderwijs, wetenschappelijk onderzoek en patiëntenzorg Microbial population analysis
US8527207B2 (en) * 2007-05-15 2013-09-03 Peter K. Rogan Accurate identification of organisms based on individual information content
US20090226895A1 (en) * 2007-06-15 2009-09-10 The Hong Kong Polytechnic University Method of detecting vibrio parahaemolyticus via real-time PCR-hybridization
ATE549419T1 (de) 2007-08-29 2012-03-15 Sequenom Inc Verfahren und zusammensetzungen für die universelle grössenspezifische polymerasekettenreaktion
EP2231851A4 (en) * 2007-12-20 2011-02-02 Biotrove Inc SYSTEM FOR DETECTION OF BIOLOGICAL PATHOGEN AND USE THEREOF
US9637776B2 (en) * 2008-02-19 2017-05-02 Opgen, Inc. Methods of identifying an organism
US8175992B2 (en) 2008-03-17 2012-05-08 Intelliscience Corporation Methods and systems for compound feature creation, processing, and identification in conjunction with a data analysis and feature recognition system wherein hit weights are summed
AU2009228312B2 (en) 2008-03-26 2015-05-21 Sequenom, Inc. Restriction endonuclease enhanced polymorphic sequence detection
WO2010080616A1 (en) 2008-12-19 2010-07-15 Abbott Laboratories Molecular assay for diagnosis of malaria
WO2010071821A1 (en) * 2008-12-19 2010-06-24 Abbott Laboratories Diagnostic test for mutations in codons 12-13 of human k-ras
EP2414545B1 (en) 2009-04-03 2017-01-11 Sequenom, Inc. Nucleic acid preparation compositions and methods
US9212397B2 (en) * 2009-06-23 2015-12-15 Gen-Probe Incorporated Compositions and methods for detecting nucleic acid from mollicutes
WO2011059802A1 (en) * 2009-10-29 2011-05-19 Bio-Rad Laboratories, Inc. Rapid detection of mycoplasma contamination in cell culture samples
EP2643460B1 (en) * 2011-06-15 2017-07-26 Grifols Therapeutics Inc. Methods, compositions, and kits for determining human immunodeficiency virus (hiv)
WO2014186874A1 (en) 2013-05-23 2014-11-27 Yyz Pharmatech, Inc. Methods and compositions for enzyme linked immuno and hybridization mass spectrometric assay
EP3351642B1 (en) 2014-06-13 2019-09-11 Q-Linea AB Method for detecting and characterising a microorganism
GB201507026D0 (en) 2015-04-24 2015-06-10 Linea Ab Q Medical sample transportation container
CA3011991A1 (en) * 2016-01-21 2017-07-27 T2 Biosystems, Inc. Rapid antimicrobial susceptibility testing using high-sensitivity direct detection methods
GB2554767A (en) 2016-04-21 2018-04-11 Q Linea Ab Detecting and characterising a microorganism
CN109423523A (zh) * 2017-08-16 2019-03-05 台达电子工业股份有限公司 支原体检测方法及其试剂盒
WO2021247682A1 (en) * 2020-06-02 2021-12-09 Ross Peter M Methods for mitigating or diminishing spread of pathogenic infections

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5484908A (en) * 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5502177A (en) * 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5547835A (en) * 1993-01-07 1996-08-20 Sequenom, Inc. DNA sequencing by mass spectrometry
US5605798A (en) * 1993-01-07 1997-02-25 Sequenom, Inc. DNA diagnostic based on mass spectrometry
US5622824A (en) * 1993-03-19 1997-04-22 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US5645985A (en) * 1991-11-26 1997-07-08 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5830653A (en) * 1991-11-26 1998-11-03 Gilead Sciences, Inc. Methods of using oligomers containing modified pyrimidines
US5849492A (en) * 1994-02-28 1998-12-15 Phylogenetix Laboratories, Inc. Method for rapid identification of prokaryotic and eukaryotic organisms
US5965363A (en) * 1996-09-19 1999-10-12 Genetrace Systems Inc. Methods of preparing nucleic acids for mass spectrometric analysis
US6007992A (en) * 1997-11-10 1999-12-28 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US6028183A (en) * 1997-11-07 2000-02-22 Gilead Sciences, Inc. Pyrimidine derivatives and oligonucleotides containing same

Family Cites Families (401)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4075475A (en) 1976-05-03 1978-02-21 Chemetron Corporation Programmed thermal degradation-mass spectrometry analysis method facilitating identification of a biological specimen
US5688645A (en) 1983-01-10 1997-11-18 Gen-Probe Incorporated Method for detecting, identifying, and quantitating non-viral organisms
US5288611A (en) * 1983-01-10 1994-02-22 Gen-Probe Incorporated Method for detecting, identifying, and quantitating organisms and viruses
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
WO1988003957A1 (en) 1986-11-24 1988-06-02 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
KR960000479B1 (ko) 1987-03-02 1996-01-08 젠-프로우브 인코오퍼레이티드 핵산 정제,분리 및 혼성체 형성용 다가양이온성 지지체
US5188963A (en) 1989-11-17 1993-02-23 Gene Tec Corporation Device for processing biological specimens for analysis of nucleic acids
US5270030A (en) 1988-12-29 1993-12-14 Bio-Technology General Corp. Fibrin binding domain polypeptide and method of producing
US5198543A (en) 1989-03-24 1993-03-30 Consejo Superior Investigaciones Cientificas PHI29 DNA polymerase
WO1990015157A1 (en) 1989-05-31 1990-12-13 Gene-Trak Systems Universal eubacteria nucleic acid probes and methods
US5219727A (en) 1989-08-21 1993-06-15 Hoffmann-Laroche Inc. Quantitation of nucleic acids using the polymerase chain reaction
US5192659A (en) 1989-08-25 1993-03-09 Genetype Ag Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5213961A (en) 1989-08-31 1993-05-25 Brigham And Women's Hospital Accurate quantitation of RNA and DNA by competetitive polymerase chain reaction
EP0667900B1 (en) 1990-01-12 2001-05-23 HSC Research Development Corporation Introns and exons of the cystic fibrosis gene and mutations at various positions of the gene
US5770029A (en) 1996-07-30 1998-06-23 Soane Biosciences Integrated electrophoretic microdevices
US5143905A (en) 1990-05-03 1992-09-01 The Regents Of The University Of California Method and means for extending the host range of insecticidal proteins
US5015845A (en) 1990-06-01 1991-05-14 Vestec Corporation Electrospray method for mass spectrometry
US5712125A (en) 1990-07-24 1998-01-27 Cemv Bioteknik Ab Competitive PCR for quantitation of DNA
DE4030262A1 (de) 1990-09-25 1992-03-26 Suedzucker Ag Verfahren zur herstellung von rhamnose aus rhamnolipiden
NL9002259A (nl) 1990-10-17 1992-05-18 Eurodiagnostics B V Werkwijze voor het bepalen van een genotype door het vergelijken van de nucleotidensequentie van leden van een genfamilie, alsmede kit voor het opsporen van genetische variaties.
WO1992009703A1 (en) 1990-11-26 1992-06-11 Cbr Laboratories, Inc. Testing for spirochetal nucleic acid sequences in samples
US5072115A (en) 1990-12-14 1991-12-10 Finnigan Corporation Interpretation of mass spectra of multiply charged ions of mixtures
WO1992013629A1 (en) 1991-01-31 1992-08-20 Wayne State University A method for analyzing an organic sample
IL97531A (en) * 1991-03-12 1995-12-31 Kelman Elliot Hair cutting apparatus
US5866429A (en) 1991-04-03 1999-02-02 Bloch; Will Precision and accuracy of anion-exchange separation of nucleic acids
US5472843A (en) 1991-04-25 1995-12-05 Gen-Probe Incorporated Nucleic acid probes to Haemophilus influenzae
US5213796A (en) 1991-05-06 1993-05-25 Dana Farber Cancer Institute Assay for polyomavirus in humans and uses thereof
US6055487A (en) 1991-07-30 2000-04-25 Margery; Keith S. Interactive remote sample analysis system
CA2116543C (en) 1991-07-31 2007-10-02 Kay S. Greisen Methods and reagents for detection of bacteria in cerebrospinal fluid
ES2214472T3 (es) 1991-08-02 2004-09-16 Biomerieux B.V. Cuantificacion de acidos nucleicos.
PT787807E (pt) 1991-08-27 2003-08-29 Hoffmann La Roche Iniciadores e sondas para a deteccao da hepatite c
AU2580892A (en) 1991-09-05 1993-04-05 Isis Pharmaceuticals, Inc. Determination of oligonucleotides for therapeutics, diagnostics and research reagents
DE69231646T2 (de) 1991-10-23 2001-06-13 Baylor College Of Medicine, Houston Fingerabdruckartige identifikation von bakterienstämmen mittels amplifikation repetitiver dna-sequenzen
FR2683827B1 (fr) 1991-11-15 1994-03-04 Institut Nal Sante Recherc Medic Procede de determination de la quantite d'un fragment d'adn d'interet par une methode d'amplification enzymatique.
US6235887B1 (en) 1991-11-26 2001-05-22 Isis Pharmaceuticals, Inc. Enhanced triple-helix and double-helix formation directed by oligonucleotides containing modified pyrimidines
IL103935A0 (en) 1991-12-04 1993-05-13 Du Pont Method for the identification of microorganisms by the utilization of directed and arbitrary dna amplification
AU3794893A (en) 1992-03-13 1993-10-05 Park Scientific Instruments Corp. Scanning probe microscope
US5981176A (en) 1992-06-17 1999-11-09 City Of Hope Method of detecting and discriminating between nucleic acid sequences
US6303297B1 (en) 1992-07-17 2001-10-16 Incyte Pharmaceuticals, Inc. Database for storage and analysis of full-length sequences
FR2694754B1 (fr) 1992-08-12 1994-09-16 Bio Merieux Fragments d'ADN de mycobactéries, amorces d'amplification, sondes d'hybridation, réactifs et procédé de détection de détection de mycobactéries.
AU5128593A (en) 1992-09-16 1994-04-12 University Of Tennessee Research Corporation, The Antigen of hybrid m protein and carrier for group a streptococcal vaccine
AU5298393A (en) 1992-10-08 1994-05-09 Regents Of The University Of California, The Pcr assays to determine the presence and concentration of a target
US5503980A (en) 1992-11-06 1996-04-02 Trustees Of Boston University Positional sequencing by hybridization
US6436635B1 (en) 1992-11-06 2002-08-20 Boston University Solid phase sequencing of double-stranded nucleic acids
US6372424B1 (en) 1995-08-30 2002-04-16 Third Wave Technologies, Inc Rapid detection and identification of pathogens
US6194144B1 (en) 1993-01-07 2001-02-27 Sequenom, Inc. DNA sequencing by mass spectrometry
FR2701961B1 (fr) 1993-02-24 1995-04-21 Bio Merieux Procédé de destabilisation d'une structure secondaire intracaténaire d'un polynucléotide simple brin, et de capture dudit nucléotide.
US6074823A (en) 1993-03-19 2000-06-13 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US5639606A (en) 1993-04-06 1997-06-17 The University Of Rochester Method for quantitative measurement of gene expression using multiplex competitive reverse transcriptase-polymerase chain reaction
US6323041B1 (en) * 1993-06-11 2001-11-27 Pfizer Inc. Screening novel human phosphodiesterase IV isozymes for compounds which modify their enzymatic activity
JPH0775585A (ja) 1993-06-14 1995-03-20 Immuno Japan:Kk C型肝炎ウイルス関連オリゴヌクレオチドならびにc型肝炎 ウイルス遺伝子型判定方法
US5830853A (en) 1994-06-23 1998-11-03 Astra Aktiebolag Systemic administration of a therapeutic preparation
US6001584A (en) 1993-07-19 1999-12-14 The Regents Of The University Of California Oncoprotein protein kinase
AU7551594A (en) 1993-07-29 1995-02-28 MURASHIGE, Kate H. Method for recognition of the nucleotide sequence of a purified dna segment
GB9315847D0 (en) 1993-07-30 1993-09-15 Isis Innovation Tag reagent and assay method
US5527675A (en) 1993-08-20 1996-06-18 Millipore Corporation Method for degradation and sequencing of polymers which sequentially eliminate terminal residues
WO1995006752A1 (en) 1993-09-03 1995-03-09 Duke University A method of nucleic acid sequencing
US6376178B1 (en) 1993-09-03 2002-04-23 Duke University Method of nucleic acid sequencing
WO1995011996A1 (en) 1993-10-27 1995-05-04 Cornell Research Foundation, Inc. Detection assay for listeria and erwinia microorganisms
US5504327A (en) 1993-11-04 1996-04-02 Hv Ops, Inc. (H-Nu) Electrospray ionization source and method for mass spectrometric analysis
DE4338119A1 (de) 1993-11-08 1995-05-11 Bayer Ag Spezifische Gensonden und Verfahren zum quantitativen Nachweis von methicillinresistenten Staphylococcen
NL9301957A (nl) 1993-11-11 1995-06-01 U Gene Research Bv Werkwijze voor het identificeren van micro-organismen, en daarvoor bruikbare hulpmiddelen.
US5928905A (en) 1995-04-18 1999-07-27 Glaxo Group Limited End-complementary polymerase reaction
JP3396942B2 (ja) 1994-02-21 2003-04-14 三菱化学株式会社 芳香族ポリカーボネートの製造方法
US5608217A (en) 1994-03-10 1997-03-04 Bruker-Franzen Analytik Gmbh Electrospraying method for mass spectrometric analysis
DE4444229C2 (de) 1994-03-10 1996-07-25 Bruker Franzen Analytik Gmbh Verfahren und Vorrichtungen zur Elektrosprüh-Ionisierung für speichernde Massenspektometer
US5976798A (en) 1994-03-30 1999-11-02 Mitokor Methods for detecting mitochondrial mutations diagnostic for Alzheimer's disease and methods for determining heteroplasmy of mitochondrial nucleic acid
WO1995031997A1 (en) 1994-05-20 1995-11-30 UNITED STATES OF AMERICA, represented by THE SECRETARY OF THE ARMY Model for testing immunogenicity of peptides
US5814442A (en) 1994-06-10 1998-09-29 Georgetown University Internally controlled virion nucleic acid amplification reaction for quantitation of virion and virion nucleic acid
DE4421901A1 (de) 1994-06-23 1996-01-04 Bayer Ag Ein DNA-Schnelltest zum Nachweis von chinolonresistenten Staphylococcus aureus Erregern in klinischem Probenmaterial
GB9417211D0 (en) 1994-08-25 1994-10-12 Solicitor For The Affairs Of H Nucleotide sequencing method
US20020055101A1 (en) 1995-09-11 2002-05-09 Michel G. Bergeron Specific and universal probes and amplification primers to rapidly detect and identify common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US6001564A (en) 1994-09-12 1999-12-14 Infectio Diagnostic, Inc. Species specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
CA2118048C (en) 1994-09-30 2003-04-08 James W. Schumm Multiplex amplification of short tandem repeat loci
US5753489A (en) 1994-11-10 1998-05-19 Immuno Ag Method for producing viruses and vaccines in serum-free culture
US5654141A (en) 1994-11-18 1997-08-05 Thomas Jefferson University Amplification based detection of bacterial infection
KR100399813B1 (ko) 1994-12-14 2004-06-09 가부시키가이샤 니콘 노광장치
US5763169A (en) 1995-01-13 1998-06-09 Chiron Diagnostics Corporation Nucleic acid probes for the detection and identification of fungi
US5707802A (en) 1995-01-13 1998-01-13 Ciba Corning Diagnostics Corp. Nucleic acid probes for the detection and identification of fungi
US6180339B1 (en) 1995-01-13 2001-01-30 Bayer Corporation Nucleic acid probes for the detection and identification of fungi
US5702895A (en) 1995-01-19 1997-12-30 Wakunaga Seiyaku Kabushiki Kaisha Method and kit for detecting methicillin-resistant Staphylococcus aureus
US5484808A (en) * 1995-02-09 1996-01-16 Eli Lilly And Company Methods of inhibiting cell-cell adhesion
GB9504598D0 (en) 1995-03-03 1995-04-26 Imp Cancer Res Tech Method of nucleic acid analysis
US6428955B1 (en) 1995-03-17 2002-08-06 Sequenom, Inc. DNA diagnostics based on mass spectrometry
EP0830460A1 (en) 1995-04-11 1998-03-25 Trustees Of Boston University Solid phase sequencing of biopolymers
TW399094B (en) * 1995-04-11 2000-07-21 Ciba Sc Holding Ag Compounds with (benzo)triazole radicals
US5932220A (en) 1995-05-08 1999-08-03 Board Of Regents University Of Texas System Diagnostic tests for a new spirochete, Borrelia lonestari sp. nov.
US5625184A (en) 1995-05-19 1997-04-29 Perseptive Biosystems, Inc. Time-of-flight mass spectrometry analysis of biomolecules
US5830655A (en) 1995-05-22 1998-11-03 Sri International Oligonucleotide sizing using cleavable primers
US5700642A (en) 1995-05-22 1997-12-23 Sri International Oligonucleotide sizing using immobilized cleavable primers
AU708995B2 (en) 1995-06-07 1999-08-19 Gene Shears Pty. Limited Optimized minizymes and miniribozymes and uses thereof
US5856174A (en) 1995-06-29 1999-01-05 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US6218529B1 (en) 1995-07-31 2001-04-17 Urocor, Inc. Biomarkers and targets for diagnosis, prognosis and management of prostate, breast and bladder cancer
US6146854A (en) * 1995-08-31 2000-11-14 Sequenom, Inc. Filtration processes, kits and devices for isolating plasmids
US5994066A (en) 1995-09-11 1999-11-30 Infectio Diagnostic, Inc. Species-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US5869242A (en) 1995-09-18 1999-02-09 Myriad Genetics, Inc. Mass spectrometry to assess DNA sequence polymorphisms
US5727202A (en) 1995-10-18 1998-03-10 Palm Computing, Inc. Method and apparatus for synchronizing information on two different computer systems
US5972693A (en) 1995-10-24 1999-10-26 Curagen Corporation Apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US5871697A (en) 1995-10-24 1999-02-16 Curagen Corporation Method and apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US5716825A (en) 1995-11-01 1998-02-10 Hewlett Packard Company Integrated nucleic acid analysis system for MALDI-TOF MS
US6312893B1 (en) 1996-01-23 2001-11-06 Qiagen Genomics, Inc. Methods and compositions for determining the sequence of nucleic acid molecules
GB9602028D0 (en) 1996-02-01 1996-04-03 Amersham Int Plc Nucleoside analogues
US6852487B1 (en) 1996-02-09 2005-02-08 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
EP0886681A1 (en) 1996-03-04 1998-12-30 Genetrace Systems, Inc. Methods of screening nucleic acids using mass spectrometry
AU2217597A (en) 1996-03-18 1997-10-22 Sequenom, Inc. Dna sequencing by mass spectrometry
CA2222192A1 (fr) 1996-03-20 1997-09-25 Bio Merieux Isolement de l'acide nucleique
JP3365198B2 (ja) 1996-03-21 2003-01-08 ミノルタ株式会社 画像形成装置
US5745751A (en) 1996-04-12 1998-04-28 Nelson; Robert W. Civil site information system
US6214555B1 (en) 1996-05-01 2001-04-10 Visible Genetics Inc. Method compositions and kit for detection
US5928906A (en) 1996-05-09 1999-07-27 Sequenom, Inc. Process for direct sequencing during template amplification
EP0954611A1 (en) 1996-06-10 1999-11-10 University Of Utah Research Foundation Rapid, accurate identification of dna sequence variants by electrospray mass spectrometry
WO1998003684A1 (en) 1996-07-19 1998-01-29 Hybridon, Inc. Method for sequencing nucleic acids using matrix-assisted laser desorption ionization time-of-flight mass spectrometry
US6563025B1 (en) 1996-07-26 2003-05-13 Board Of Trustees Of The University Of Illinois Nucleotide sequences encoding anthranilate synthase
US5831046A (en) * 1996-08-05 1998-11-03 Prolinx, Incorporated Boronic acid-contaning nucleic acid monomers
DE19633436A1 (de) 1996-08-20 1998-02-26 Boehringer Mannheim Gmbh Verfahren zum Nachweis von Nukleinsäuren unter Ermittlung der Masse
CA2301875A1 (en) 1996-09-19 1998-03-26 Genetrace Systems Methods of preparing nucleic acids for mass spectrometric analysis
US5777324A (en) 1996-09-19 1998-07-07 Sequenom, Inc. Method and apparatus for maldi analysis
US6361940B1 (en) 1996-09-24 2002-03-26 Qiagen Genomics, Inc. Compositions and methods for enhancing hybridization and priming specificity
US5864137A (en) 1996-10-01 1999-01-26 Genetrace Systems, Inc. Mass spectrometer
US5885775A (en) 1996-10-04 1999-03-23 Perseptive Biosystems, Inc. Methods for determining sequences information in polynucleotides using mass spectrometry
GB9620769D0 (en) 1996-10-04 1996-11-20 Brax Genomics Ltd Nucleic acid sequencing
US6110710A (en) 1996-10-15 2000-08-29 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Sequence modification of oligonucleotide primers to manipulate non-templated nucleotide addition
US7285422B1 (en) 1997-01-23 2007-10-23 Sequenom, Inc. Systems and methods for preparing and analyzing low volume analyte array elements
US6140053A (en) 1996-11-06 2000-10-31 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US20030129589A1 (en) 1996-11-06 2003-07-10 Hubert Koster Dna diagnostics based on mass spectrometry
US6133436A (en) 1996-11-06 2000-10-17 Sequenom, Inc. Beads bound to a solid support and to nucleic acids
US6024925A (en) 1997-01-23 2000-02-15 Sequenom, Inc. Systems and methods for preparing low volume analyte array elements
US5900481A (en) 1996-11-06 1999-05-04 Sequenom, Inc. Bead linkers for immobilizing nucleic acids to solid supports
EP1457496B1 (en) 1996-11-06 2014-01-15 Sequenom, Inc. High density immobilization of nucleic acids
US6060246A (en) 1996-11-15 2000-05-09 Avi Biopharma, Inc. Reagent and method for isolation and detection of selected nucleic acid sequences
KR20000057275A (ko) * 1996-11-28 2000-09-15 후지타 기요시 당 화합물, 겔화제, 겔화제 조성물, 이들의 제조 방법 및 겔상조성물
US5822824A (en) 1996-12-03 1998-10-20 Dion; William D. Mountable washing device
AU5794498A (en) 1996-12-10 1998-07-03 Genetrace Systems, Inc. Releasable nonvolatile mass-label molecules
US5981190A (en) 1997-01-08 1999-11-09 Ontogeny, Inc. Analysis of gene expression, methods and reagents therefor
US5876936A (en) 1997-01-15 1999-03-02 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators
ATE340869T1 (de) 1997-01-15 2006-10-15 Xzillion Gmbh & Co Kg Massenmarkierte hybridisierungssonden
US6046005A (en) 1997-01-15 2000-04-04 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators comprising a cleavable linking group
WO1998035057A1 (en) 1997-02-06 1998-08-13 The National University Of Singapore Diagnosis of plasmodium infection by analysis of extrachromosomal genetic material
US6727061B2 (en) 1997-02-20 2004-04-27 Cabtec, Inc. Methods for identifying species or Shigella and E. coli using operon sequence analysis
US5828062A (en) 1997-03-03 1998-10-27 Waters Investments Limited Ionization electrospray apparatus for mass spectrometry
US6553317B1 (en) 1997-03-05 2003-04-22 Incyte Pharmaceuticals, Inc. Relational database and system for storing information relating to biomolecular sequences and reagents
DE19710166C1 (de) 1997-03-12 1998-12-10 Bruker Franzen Analytik Gmbh Zwei-Schritt-Verfahren der DNA-Amplifikation für MALDI-TOF-Messungen
AU6553498A (en) 1997-03-14 1998-09-29 Hybridon, Inc. Method for sequencing of modified nucleic acids using electrospray ionization-fourier transform mass spectrometry
US5849497A (en) 1997-04-03 1998-12-15 The Research Foundation Of State University Of New York Specific inhibition of the polymerase chain reaction using a non-extendable oligonucleotide blocker
US6018713A (en) 1997-04-09 2000-01-25 Coli; Robert D. Integrated system and method for ordering and cumulative results reporting of medical tests
DE19717085C2 (de) 1997-04-23 1999-06-17 Bruker Daltonik Gmbh Verfahren und Geräte für extrem schnelle DNA-Vervielfachung durch Polymerase-Kettenreaktionen (PCR)
US20010039263A1 (en) 1997-05-02 2001-11-08 Max-Delbruck-Centrum Fur Molekulare Medizin Chimeric oligonucleotides and the use thereof
US6054278A (en) * 1997-05-05 2000-04-25 The Perkin-Elmer Corporation Ribosomal RNA gene polymorphism based microorganism identification
US6994960B1 (en) 1997-05-28 2006-02-07 The Walter And Eliza Hall Institute Of Medical Research Nucleic acid diagnostics based on mass spectrometry or mass separation and base specific cleavage
US6159681A (en) 1997-05-28 2000-12-12 Syntrix Biochip, Inc. Light-mediated method and apparatus for the regional analysis of biologic material
WO1998054751A1 (en) 1997-05-30 1998-12-03 Genetrace Systems, Inc. Volatile matrices for matrix-assisted laser desorption/ionization mass spectrometry
US6061686A (en) 1997-06-26 2000-05-09 Digital Equipment Corporation Updating a copy of a remote document stored in a local computer system
NZ501919A (en) 1997-07-22 2001-11-30 Qiagen Genomics Inc Methods for analyzing nucleic acid molecules utilizing mass spectroscopy readable tags
DE19732086C2 (de) 1997-07-25 2002-11-21 Univ Leipzig Verfahren zur quantitativen Bestimmung von Eubakterien
US6207370B1 (en) 1997-09-02 2001-03-27 Sequenom, Inc. Diagnostics based on mass spectrometric detection of translated target polypeptides
GB9719044D0 (en) 1997-09-08 1997-11-12 Inst Of Ophthalmology Assay
US6090558A (en) 1997-09-19 2000-07-18 Genetrace Systems, Inc. DNA typing by mass spectrometry with polymorphic DNA repeat markers
US6063031A (en) 1997-10-14 2000-05-16 Assurance Medical, Inc. Diagnosis and treatment of tissue with instruments
US6111096A (en) 1997-10-31 2000-08-29 Bbi Bioseq, Inc. Nucleic acid isolation and purification
JP3423597B2 (ja) 1997-11-05 2003-07-07 三井農林株式会社 細菌の同定方法
WO1999029898A2 (de) 1997-12-05 1999-06-17 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Verfahren zur identifikation von nucleinsäuren durch matrix-assistierte laser desorptions/ionisations massenspektrometrie
US6914137B2 (en) 1997-12-06 2005-07-05 Dna Research Innovations Limited Isolation of nucleic acids
US6268131B1 (en) 1997-12-15 2001-07-31 Sequenom, Inc. Mass spectrometric methods for sequencing nucleic acids
GB9815166D0 (en) 1998-07-13 1998-09-09 Brax Genomics Ltd Compounds for mass spectrometry
US6458533B1 (en) 1997-12-19 2002-10-01 High Throughput Genomics, Inc. High throughput assay system for monitoring ESTs
US20030096232A1 (en) 1997-12-19 2003-05-22 Kris Richard M. High throughput assay system
DE19802905C2 (de) 1998-01-27 2001-11-08 Bruker Daltonik Gmbh Verfahren zur bevorzugten Herstellung nur eines Stranges selektierten Genmaterials für massenspektrometrische Messungen
US6428956B1 (en) 1998-03-02 2002-08-06 Isis Pharmaceuticals, Inc. Mass spectrometric methods for biomolecular screening
WO1999046047A2 (en) 1998-03-10 1999-09-16 Large Scale Proteomics Corporation Detection and characterization of microorganisms
US6391551B1 (en) 1998-03-13 2002-05-21 Promega Corporation Detection of nucleic acid hybrids
US6235480B1 (en) 1998-03-13 2001-05-22 Promega Corporation Detection of nucleic acid hybrids
US6270973B1 (en) 1998-03-13 2001-08-07 Promega Corporation Multiplex method for nucleic acid detection
US6268146B1 (en) 1998-03-13 2001-07-31 Promega Corporation Analytical methods and materials for nucleic acid detection
US6312902B1 (en) 1998-03-13 2001-11-06 Promega Corporation Nucleic acid detection
US6277578B1 (en) 1998-03-13 2001-08-21 Promega Corporation Deploymerization method for nucleic acid detection of an amplified nucleic acid target
US6270974B1 (en) 1998-03-13 2001-08-07 Promega Corporation Exogenous nucleic acid detection
US6261769B1 (en) 1998-03-31 2001-07-17 The United States Of America As Represented By The Secretary Of Agriculture Intergenic spacer target sequence for detecting and distinguishing Chlamydial species or strains
US7321828B2 (en) 1998-04-13 2008-01-22 Isis Pharmaceuticals, Inc. System of components for preparing oligonucleotides
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6223186B1 (en) 1998-05-04 2001-04-24 Incyte Pharmaceuticals, Inc. System and method for a precompiled database for biomolecular sequence information
US6723564B2 (en) 1998-05-07 2004-04-20 Sequenom, Inc. IR MALDI mass spectrometry of nucleic acids using liquid matrices
DE19822108A1 (de) 1998-05-12 2000-02-03 Schering Ag Verfahren zur Detektion von Mikroorganismen in Produkten, insbesondere in Arzneimitteln und Kosmetika
US6221587B1 (en) 1998-05-12 2001-04-24 Isis Pharmceuticals, Inc. Identification of molecular interaction sites in RNA for novel drug discovery
DE19922161A1 (de) 1998-05-18 1999-12-09 Fraunhofer Ges Forschung Anti-Haft-Beschichtung und Verfahren zu ihrer Herstellung
US6468743B1 (en) 1998-05-18 2002-10-22 Conagra Grocery Products Company PCR techniques for detecting microbial contaminants in foodstuffs
US6104028A (en) 1998-05-29 2000-08-15 Genetrace Systems Inc. Volatile matrices for matrix-assisted laser desorption/ionization mass spectrometry
DE19824280B4 (de) 1998-05-29 2004-08-19 Bruker Daltonik Gmbh Mutationsanalyse mittels Massenspektrometrie
GB2339905A (en) 1998-06-24 2000-02-09 Bruker Daltonik Gmbh Use of mass-specrometry for detection of mutations
DE69941333D1 (de) 1998-07-02 2009-10-08 Gen Probe Inc Molekulare fackeln
US6218118B1 (en) 1998-07-09 2001-04-17 Agilent Technologies, Inc. Method and mixture reagents for analyzing the nucleotide sequence of nucleic acids by mass spectrometry
US6074831A (en) 1998-07-09 2000-06-13 Agilent Technologies, Inc. Partitioning of polymorphic DNAs
US6432651B1 (en) 1998-07-10 2002-08-13 Cetek Corporation Method to detect and analyze tight-binding ligands in complex biological samples using capillary electrophoresis and mass spectrometry
US6605433B1 (en) 1998-08-20 2003-08-12 The Johns Hopkins University Mitochondrial dosimeter
US6146144A (en) 1998-09-29 2000-11-14 Fowler; Ernest R. Rug hooking kit and method for handicapped
US6610492B1 (en) 1998-10-01 2003-08-26 Variagenics, Inc. Base-modified nucleotides and cleavage of polynucleotides incorporating them
US6238927B1 (en) 1998-10-05 2001-05-29 Mosaic Technologies, Incorporated Reverse displacement assay for detection of nucleic acid sequences
DE19852167C2 (de) 1998-11-12 2000-12-14 Bruker Saxonia Analytik Gmbh Einfache SNP-Analyse mittels Massenspektrometrie
EP1144594A1 (en) 1998-11-24 2001-10-17 Regents Of The University Of Minnesota Transgenic circulating endothelial cells
US6994962B1 (en) 1998-12-09 2006-02-07 Massachusetts Institute Of Technology Methods of identifying point mutations in a genome
DE19859723A1 (de) 1998-12-23 2000-06-29 Henkel Kgaa Mittel zum Färben von keratinhaltigen Fasern
US7432049B2 (en) 2001-02-28 2008-10-07 Chondrogene Limited Compositions and methods relating to osteoarthritis
US6503718B2 (en) 1999-01-10 2003-01-07 Exact Sciences Corporation Methods for detecting mutations using primer extension for detecting disease
US6638714B1 (en) 1999-02-03 2003-10-28 Ortho-Clinical Diagnostics, Inc. Oligonucleotide primers for efficient detection of hepatitis C virus (HCV) and methods of use thereof
US6153389A (en) 1999-02-22 2000-11-28 Haarer; Brian K. DNA additives as a mechanism for unambiguously marking biological samples
EP1035219A1 (en) 1999-02-25 2000-09-13 Universiteit Gent Gastric helicobacter 16 S rDNA sequences from cattle and pigs and their use for detection and typing of Helicobacter strains
DE19910592A1 (de) * 1999-03-10 2000-09-14 Volkswagen Ag Rückhaltevorrichtung
US6436640B1 (en) 1999-03-18 2002-08-20 Exiqon A/S Use of LNA in mass spectrometry
US6613509B1 (en) 1999-03-22 2003-09-02 Regents Of The University Of California Determination of base (nucleotide) composition in DNA oligomers by mass spectrometry
EP1171584A1 (en) 1999-04-21 2002-01-16 Annovis, Inc. Magnetic dna extraction kit for plants
US6140067A (en) 1999-04-30 2000-10-31 Mitokor Indicators of altered mitochondrial function in predictive methods for determining risk of type 2 diabetes mellitus
US6649351B2 (en) 1999-04-30 2003-11-18 Aclara Biosciences, Inc. Methods for detecting a plurality of analytes by mass spectrometry
AU778230B2 (en) 1999-05-03 2004-11-25 Gen-Probe Incorporated Polynucleotide matrix-based method of identifying microorganisms
US20020086289A1 (en) 1999-06-15 2002-07-04 Don Straus Genomic profiling: a rapid method for testing a complex biological sample for the presence of many types of organisms
MXPA02000192A (es) 1999-06-30 2004-08-12 Corixa Corp Composiciones y metodos para la terapia y diagnostico de cancer de pulmon.
AU5371099A (en) 1999-07-22 2001-02-13 Artus Gesellschaft Fur Molekularbiologische Diagnostik Und Entwicklung Mbh Method for the species-specific detection of organisms
US6723505B1 (en) 1999-08-13 2004-04-20 Nye Colifast As Method for identification of the indicators of contamination in liquid samples
US6266144B1 (en) 1999-08-26 2001-07-24 Taiwan Semiconductor Manufacturing Company Stepper and scanner new exposure sequence with intra-field correction
DE19943374A1 (de) 1999-09-10 2001-03-29 Max Planck Gesellschaft Verfahren zum Anbinden von Nukleinsäuren an eine Festphase
US7005274B1 (en) 1999-09-15 2006-02-28 Migenix Corp. Methods and compositions for diagnosing and treating arthritic disorders and regulating bone mass
WO2001023608A2 (en) 1999-09-27 2001-04-05 Merck Sharp & Dohme De Espana, S.A.E. Hybridization probes which specifically detect strains of the genera microbispora, microtetraspora, nonomuria and planobispora
EP2322666A3 (en) 1999-09-28 2011-08-10 Geneohm Sciences Canada, Inc. Highly conserved gene and its use to generate species-specific, genus-specific, family-specific, group-specific and universal nucleic acid probes for microorganisms.
US6296188B1 (en) 1999-10-01 2001-10-02 Perfect Plastic Printing Corporation Transparent/translucent financial transaction card including an infrared light filter
US6787302B2 (en) 1999-10-25 2004-09-07 Genprime, Inc. Method and apparatus for prokaryotic and eukaryotic cell quantitation
WO2001032930A1 (en) 1999-11-04 2001-05-10 California Institute Of Technology Methods and apparatuses for analyzing polynucleotide sequences
US6856914B1 (en) 1999-11-19 2005-02-15 The University Of British Columbia Method, apparatus, media and signals for identifying associated cell signaling proteins
KR20020060242A (ko) 1999-11-29 2002-07-16 추후제출 환경 샘플로부터 핵산의 수득방법, 수득된 핵산 및 신규화합물 합성에서의 이의 용도
US6608190B1 (en) * 1999-12-16 2003-08-19 E. I. Du Pont De Nemours And Company Nucleic acid fragments for the identification of bacteria in industrial wastewater bioreactors
US6936414B2 (en) 1999-12-22 2005-08-30 Abbott Laboratories Nucleic acid isolation method and kit
US7166429B2 (en) 1999-12-29 2007-01-23 Keygene N.V. Method for generating oligonucleotides, in particular for the detection of amplified restriction fragments obtained using AFLP®
SE0000061D0 (sv) 2000-01-10 2000-01-10 Bjoern Herrmann A method for detection of pathogenic organisms
AU2001232485A1 (en) 2000-01-13 2001-07-24 Amsterdam Support Diagnostics B.V. A universal nucleic acid amplification system for nucleic acids in a sample
US20020009727A1 (en) 2000-02-02 2002-01-24 Schultz Gary A. Detection of single nucleotide polymorphisms
CA2298181C (en) 2000-02-02 2006-09-19 Dayan Burke Goodnough Non-targeted complex sample analysis
US6453244B1 (en) 2000-02-10 2002-09-17 Stanford University Detection of polymorphisms by denaturing high-performance liquid chromatography
US6569093B2 (en) 2000-02-14 2003-05-27 First Opinion Corporation Automated diagnostic system and method including disease timeline
US6393367B1 (en) 2000-02-19 2002-05-21 Proteometrics, Llc Method for evaluating the quality of comparisons between experimental and theoretical mass data
DE10015797B4 (de) 2000-03-26 2006-02-02 Bruker Daltonik Gmbh Multiplex-Analyse von DNA-Gemischen mittels photolytisch ablesbarer DNA-Chips
DE10015262A1 (de) 2000-03-28 2001-10-04 Basf Ag Papierstreichmassen, enthaltend Bindemittel mit Makromonomeren
AU6052001A (en) 2000-03-29 2001-10-08 Ct For The Applic Of Molecular Methods for genotyping by hybridization analysis
DK2278029T3 (en) 2000-04-10 2016-10-03 Taxon Biosciences Inc Methods of study and genetic analysis of populations
US6475736B1 (en) 2000-05-23 2002-11-05 Variagenics, Inc. Methods for genetic analysis of DNA using biased amplification of polymorphic sites
US6716634B1 (en) 2000-05-31 2004-04-06 Agilent Technologies, Inc. Increasing ionization efficiency in mass spectrometry
US6507837B1 (en) 2000-06-08 2003-01-14 Hyperphrase Technologies, Llc Tiered and content based database searching
CA2412223A1 (en) 2000-06-09 2001-12-20 Corixa Corporation Compositions and methods for the therapy and diagnosis of colon cancer
AU2001268468A1 (en) 2000-06-13 2001-12-24 The Trustees Of Boston University Use of nucleotide analogs in the analysis of oligonucleotide mixtures and in highly multiplexed nucleic acid sequencing
EP1170379A1 (en) * 2000-06-30 2002-01-09 Centre National de Genotypage Sample generation for genotyping by mass spectrometry
FR2811321A1 (fr) 2000-07-04 2002-01-11 Bio Merieux Amplificateur d'une region ribonucleique cible d'un arn ribosomal 16s ou adn pour un tel arn d'une espece eubacterienne et detection de telles especes
US6504021B2 (en) 2000-07-05 2003-01-07 Edge Biosystems, Inc. Ion exchange method for DNA purification
WO2002002811A2 (fr) 2000-07-06 2002-01-10 Bio Merieux Procede de controle de la qualite microbiologique d'un milieu aqueux et necessaire approprie
US6783939B2 (en) 2000-07-07 2004-08-31 Alphavax, Inc. Alphavirus vectors and virosomes with modified HIV genes for use in vaccines
WO2002010186A1 (en) 2000-07-27 2002-02-07 California Institute Of Technology A rapid, quantitative method for the mass spectrometric analysis of nucleic acids for gene expression and genotyping
AUPQ909000A0 (en) 2000-07-28 2000-08-24 University Of Sydney, The A method of detecting microorganisms
US20030190635A1 (en) 2002-02-20 2003-10-09 Mcswiggen James A. RNA interference mediated treatment of Alzheimer's disease using short interfering RNA
US20040005555A1 (en) * 2000-08-31 2004-01-08 Rothman Richard E. Molecular diagnosis of bactermia
US7349808B1 (en) 2000-09-06 2008-03-25 Egenomics, Inc. System and method for tracking and controlling infections
US20020120408A1 (en) 2000-09-06 2002-08-29 Kreiswirth Barry N. System and method for tracking and controlling infections
US6813615B1 (en) 2000-09-06 2004-11-02 Cellomics, Inc. Method and system for interpreting and validating experimental data with automated reasoning
AU2001288762A1 (en) 2000-09-08 2002-03-22 Large Scale Proteomics Corporation Detection and characterization of microorganisms
SE0003286D0 (sv) 2000-09-15 2000-09-15 Ulf Gyllensten Method and kit for human identification
ES2327103T3 (es) 2000-09-25 2009-10-26 Polymun Scientific Immunbiologische Forschung Gmbh Vacuna viva de influenzavirus y procedimiento de fabricacion.
WO2002028901A2 (en) 2000-10-05 2002-04-11 Millennium Pharmaceuticals, Inc. Seven-transmembrane (7tm) receptors and uses thereof
US6996472B2 (en) 2000-10-10 2006-02-07 The United States Of America As Represented By The Department Of Health And Human Services Drift compensation method for fingerprint spectra
AU2002213345A1 (en) 2000-10-13 2002-04-22 Irm, Llc High throughput processing system and method of using
ATE380883T1 (de) 2000-10-24 2007-12-15 Univ Leland Stanford Junior Direkte multiplex charakterisierung von genomischer dna
US6906316B2 (en) 2000-10-27 2005-06-14 Fuji Electric Co., Ltd. Semiconductor device module
US6682889B1 (en) 2000-11-08 2004-01-27 Becton, Dickinson And Company Amplification and detection of organisms of the Chlamydiaceae family
AU2002222614A1 (en) 2000-12-12 2002-07-01 Chugai Seiyaku Kabushiki Kaisha Method of detecting polymorphism in dna by using mass spectroscopy
US6800289B2 (en) 2000-12-21 2004-10-05 Her Majesty The Queen In Right Of Canada, As Represented By The Minister Of National Defence Strain of the western equine encephalitis virus
US6586584B2 (en) 2001-01-29 2003-07-01 Becton, Dickinson And Company Sequences and methods for detection of Hepatitis C virus
DE10108453B4 (de) 2001-02-22 2005-10-20 Bruker Daltonik Gmbh Massenspektrometrische Mutationsanalyse mit photolytisch spaltbaren Primern
US6699670B2 (en) 2001-03-01 2004-03-02 The Johns Hopkins University Quantitative assay for the simultaneous detection and speciation of bacterial infections
US20040121313A1 (en) 2002-12-06 2004-06-24 Ecker David J. Methods for rapid detection and identification of bioagents in organs for transplantation
US7666588B2 (en) 2001-03-02 2010-02-23 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US20040121310A1 (en) 2002-12-18 2004-06-24 Ecker David J. Methods for rapid detection and identification of bioagents in forensic studies
US20030027135A1 (en) 2001-03-02 2003-02-06 Ecker David J. Method for rapid detection and identification of bioagents
US7226739B2 (en) * 2001-03-02 2007-06-05 Isis Pharmaceuticals, Inc Methods for rapid detection and identification of bioagents in epidemiological and forensic investigations
US7718354B2 (en) 2001-03-02 2010-05-18 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US20040121314A1 (en) 2002-12-06 2004-06-24 Ecker David J. Methods for rapid detection and identification of bioagents in containers
US20040038206A1 (en) 2001-03-14 2004-02-26 Jia Zhang Method for high throughput assay of genetic analysis
US20030104410A1 (en) 2001-03-16 2003-06-05 Affymetrix, Inc. Human microarray
ATE335754T1 (de) 2001-03-19 2006-09-15 Harvard College Entwicklung neuer molekularer funktionen
JP4927309B2 (ja) 2001-03-28 2012-05-09 カウンスィル オブ サイエンティフィック アンド インダストリアル リサーチ 野生生物同定のための普遍的プライマー
US7630836B2 (en) 2001-05-30 2009-12-08 The Kitasato Institute Polynucleotides
CA2348042A1 (en) 2001-06-04 2002-12-04 Ann Huletsky Sequences for detection and identification of methicillin-resistant staphylococcus aureus
US20020187477A1 (en) 2001-06-06 2002-12-12 Hong Xue Method for detecting single nucleotide polymorphisms (SNPs) and point mutations
ES2311613T3 (es) 2001-06-06 2009-02-16 Dsm Ip Assets B.V. Produccion mejorada de isoprenoides.
GB0113908D0 (en) 2001-06-07 2001-08-01 Univ London Designing degenerate PCR primers
US20020187490A1 (en) 2001-06-07 2002-12-12 Michigan State University Microbial identification chip based on DNA-DNA hybridization
GB0113907D0 (en) 2001-06-07 2001-08-01 Univ London Virus detection using degenerate PCR primers
US7217510B2 (en) 2001-06-26 2007-05-15 Isis Pharmaceuticals, Inc. Methods for providing bacterial bioagent characterizing information
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
DE10132147B4 (de) 2001-07-03 2004-04-15 Universität Leipzig Verfahren zur schnellen quantitativen Bestimmung von Eu-Bakterien
GB0117054D0 (en) 2001-07-12 2001-09-05 Plant Bioscience Ltd Methods and means for modification of plant characteristics
EP1407051B1 (en) 2001-07-19 2006-04-12 Infectio Diagnostic (I.D.I.) INC. Universal method and composition for the rapid lysis of cells for the release of nucleic acids and their detection
US20040191769A1 (en) 2001-07-24 2004-09-30 Transgenomic, Inc. Methods, compositions, and kits for mutation detection in mitochondrial DNA
AU2002325197A1 (en) 2001-07-30 2003-02-17 Den Kgl. Veterinaer- Og Landbohojskole Bacterial strains belonging to lactobacillus species and their use in food and feed industry
US7115385B2 (en) 2001-08-02 2006-10-03 North Carolina State University Media and methods for cultivation of microorganisms
AT411174B (de) 2001-08-09 2003-10-27 Lambda Labor Fuer Molekularbio Verfahren und chip zur analyse von nukleinsäuren
US20030039976A1 (en) 2001-08-14 2003-02-27 Haff Lawrence A. Methods for base counting
US20040175715A1 (en) 2001-08-21 2004-09-09 Burgoyne Leigh A. Method and device for simultaneously molecularly cloning and polylocus profiling of genomes or genomes mixtures
US7105296B2 (en) 2001-08-29 2006-09-12 E. I. Du Pont De Nemours And Company Genes encoding Baeyer-Villiger monooxygenases
US7049286B2 (en) 2001-08-30 2006-05-23 Diatos, S.A. Insulin conjugates and methods of use thereof
US7060809B2 (en) 2001-09-04 2006-06-13 Exiqon A/S LNA compositions and uses thereof
US20040101809A1 (en) 2001-09-21 2004-05-27 Weiss Ervin I Device, method and materials for mobilizing substances into dentinal tubules in root canal treatment
DE10150121B4 (de) 2001-10-11 2005-12-01 Bernhard-Nocht-Institut für Tropenmedizin Echtzeitdetektion von DNA-Amplifikationsprodukten
US7297485B2 (en) 2001-10-15 2007-11-20 Qiagen Gmbh Method for nucleic acid amplification that results in low amplification bias
US6977148B2 (en) 2001-10-15 2005-12-20 Qiagen Gmbh Multiple displacement amplification
US20040029129A1 (en) 2001-10-25 2004-02-12 Liangsu Wang Identification of essential genes in microorganisms
DE10152821B4 (de) 2001-10-25 2006-11-16 Bruker Daltonik Gmbh Massenspektren ohne elektronisches Rauschen
EP1308506A1 (en) 2001-11-06 2003-05-07 Eidgenössische Technische Hochschule Zürich Mixtures of Propionibacterium jensenii and Lactobacillus sp. with antimicrobial activities for use as a natural preservation system
NZ532635A (en) 2001-11-13 2007-05-31 Univ Pennsylvania A method of identifying unknown adeno-associated virus (AAV) sequences and a kit for the method
BR0206488A (pt) 2001-11-15 2008-08-05 Whatman Inc dispositivo, método e kit para armazenamento e análise de uma porção contendo ácido nucleico em uma amostra biológica
US20040023209A1 (en) 2001-11-28 2004-02-05 Jon Jonasson Method for identifying microorganisms based on sequencing gene fragments
JP3692067B2 (ja) 2001-11-30 2005-09-07 株式会社東芝 銅のcmp用研磨スラリーおよびそれを用いた半導体装置の製造方法
US20030148284A1 (en) 2001-12-17 2003-08-07 Vision Todd J. Solid phase detection of nucleic acid molecules
TW509116U (en) 2001-12-18 2002-11-01 Ind Tech Res Inst Device for clipping and tightening spindle of honing and milling machine
US20030175709A1 (en) 2001-12-20 2003-09-18 Murphy George L. Method and system for depleting rRNA populations
US7468185B2 (en) 2001-12-21 2008-12-23 Pfizer Inc. Vaccine for periodontal disease
KR100444230B1 (ko) 2001-12-27 2004-08-16 삼성전기주식회사 내환원성 유전체 자기 조성물
AU2002358353A1 (en) 2001-12-28 2003-07-30 Keygene N.V. Discrimination and detection of target nucleotide sequences using mass spectrometry
EP1333101B1 (en) 2002-02-01 2007-03-28 Bruker Daltonik GmbH Mutation analysis by PCR and Mass spectrometry
CN1202204C (zh) 2002-02-27 2005-05-18 财团法人工业技术研究院 红光有机电激发光化合物及用其制成的组件和装置
KR100600988B1 (ko) 2002-03-13 2006-07-13 주식회사 엘지생명과학 Dna 면역화에서 인플루엔자 np 유전자 dna를 함께투여하여 면역반응을 증가시키는 방법
US7024370B2 (en) 2002-03-26 2006-04-04 P) Cis, Inc. Methods and apparatus for early detection of health-related events in a population
US6897027B2 (en) 2002-03-27 2005-05-24 Decode Genetics Ehf. Method for desalting nucleic acids
WO2003100035A2 (en) 2002-04-01 2003-12-04 Isis Pharmaceuticals, Inc. Method for rapid detection and identification of viral bioagents
US7539579B2 (en) 2002-04-09 2009-05-26 Beattie Kenneth L Oligonucleotide probes for genosensor chips
JP2004000200A (ja) 2002-04-19 2004-01-08 Menicon Co Ltd 微生物の検出方法
FR2838740A1 (fr) 2002-04-22 2003-10-24 Centre Nat Rech Scient Oligonucleotides issus des sequences codant pour la composante de surface des proteines d'enveloppe des ptlv et leurs utilisations
GB0209812D0 (en) 2002-04-30 2002-06-05 Renovo Ltd Genetic testing
US6906319B2 (en) 2002-05-17 2005-06-14 Micromass Uk Limited Mass spectrometer
DE10222632B4 (de) 2002-05-17 2006-03-09 Con Cipio Gmbh Mikrosatellitenmarker für genetische Analysen und zur Unterscheidung von Rosen
EP1365031A1 (en) 2002-05-21 2003-11-26 MTM Laboratories AG Method for detection of somatic mutations using mass spectometry
US20030220844A1 (en) * 2002-05-24 2003-11-27 Marnellos Georgios E. Method and system for purchasing genetic data
US20040014957A1 (en) 2002-05-24 2004-01-22 Anne Eldrup Oligonucleotides having modified nucleoside units
JP2005534292A (ja) 2002-05-29 2005-11-17 アレサ・バイオディテクション・アンパルトセルスカブ 植物用レポーター系
GB0212666D0 (en) 2002-05-31 2002-07-10 Secr Defence Immunogenic sequences
AU2003238930A1 (en) 2002-06-07 2003-12-22 Incyte Corporation Enzymes
WO2003106635A2 (en) 2002-06-13 2003-12-24 Regulome Corp Functional sites
KR100484144B1 (ko) * 2002-06-20 2005-04-18 삼성전자주식회사 원격 관리 서버 및 원격 관리 방법
CA2490283A1 (en) 2002-07-01 2004-01-08 Wayne State University Methods and compositions for the identification of antibiotics that are not susceptible to antibiotic resistance
WO2004009849A1 (en) 2002-07-19 2004-01-29 Isis Pharmaceuticals, Inc. Methods for mass spectrometry analysis utilizing an integrated microfluidics sample platform
US6916483B2 (en) * 2002-07-22 2005-07-12 Biodynamics, Llc Bioabsorbable plugs containing drugs
GB0217434D0 (en) 2002-07-27 2002-09-04 Royal Vetinary College Biological material
US20040022764A1 (en) 2002-07-31 2004-02-05 Hanan Polansky Inhibition of microcompetition with a foreign polynucleotide as treatment of chronic disease
US7172868B2 (en) 2002-08-01 2007-02-06 The Regents Of The University Of California Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis
US20040038385A1 (en) * 2002-08-26 2004-02-26 Langlois Richard G. System for autonomous monitoring of bioagents
CA2497988C (en) 2002-09-06 2011-03-29 The Trustees Of Boston University Quantification of gene expression
CA2410795A1 (en) 2002-11-01 2004-05-01 University Of Ottawa A method for the amplification of multiple genetic targets
WO2004044247A2 (en) 2002-11-12 2004-05-27 Genolife One step real-time rt pcr kits for the universal detection of organisms in industrial products
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
WO2004070001A2 (en) 2002-11-15 2004-08-19 Gen-Probe Incorporated Assay and compositions for detection of bacillus anthracis nucleic acid
US6680476B1 (en) 2002-11-22 2004-01-20 Agilent Technologies, Inc. Summed time-of-flight mass spectrometry utilizing thresholding to reduce noise
EP1578399A4 (en) 2002-12-06 2007-11-28 Isis Pharmaceuticals Inc METHODS FOR RAPID IDENTIFICATION OF PATHOGENS IN HUMANS AND BEETS
JP2004201679A (ja) 2002-12-10 2004-07-22 Kao Corp Pcr法によるフゾバクテリウム・ニュークレタム菌の検出用プライマー及びその検出方法
US20040117354A1 (en) 2002-12-16 2004-06-17 Azzaro Steven Hector Process for tagging and measuring quality
US20040121312A1 (en) 2002-12-18 2004-06-24 Ecker David J. Methods for rapid detection and identification of the absence of bioagents
US20040122857A1 (en) 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in forensic studies thereby
US20040121315A1 (en) 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in containers thereby
US20040121340A1 (en) 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent associated with host versus graft and graft versus host rejections thereby
US20040121329A1 (en) 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in blood, bodily fluids, and bodily tissues thereby
US20040122598A1 (en) 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in food products and cosmetics thereby
US9487823B2 (en) 2002-12-20 2016-11-08 Qiagen Gmbh Nucleic acid amplification
JP2004201641A (ja) 2002-12-26 2004-07-22 Mitsubishi Kagaku Bio-Clinical Laboratories Inc 真菌検出方法
US20040170954A1 (en) 2003-02-10 2004-09-02 Mckenney Keith Pathogen inactivation assay
US20040170981A1 (en) 2003-02-10 2004-09-02 Mckenney Keith Real-time polymerase chain reaction using large target amplicons
US20040185438A1 (en) 2003-03-10 2004-09-23 Ecker David J. Methods of detection and notification of bioagent contamination
US20050065813A1 (en) 2003-03-11 2005-03-24 Mishelevich David J. Online medical evaluation system
US8046171B2 (en) * 2003-04-18 2011-10-25 Ibis Biosciences, Inc. Methods and apparatus for genetic evaluation
US20050009053A1 (en) 2003-04-25 2005-01-13 Sebastian Boecker Fragmentation-based methods and systems for de novo sequencing
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
WO2005009202A2 (en) 2003-05-12 2005-02-03 Isis Pharmaceuticals, Inc. Automatic identification of bioagents
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
WO2005003384A1 (en) 2003-07-03 2005-01-13 Danmarks Og Grønlands Geologiske Undersøgelse Method for selective detection of a target nucleic acid
WO2005017173A1 (en) 2003-07-29 2005-02-24 Sigma Aldrich Co. Methods and compositions for amplification of dna
JP4304292B2 (ja) 2003-07-30 2009-07-29 日本電気株式会社 移動通信システム、移動通信端末及びそれに用いるパワーコントロール方法並びにそのプログラム
KR100632429B1 (ko) 2003-08-01 2006-10-09 프로테온 주식회사 프라이머 특이성 유무에 의한 멀티플렉스 역전사 중합효소연쇄반응을 이용한 재조합 독감 바이러스의 스크리닝 방법
US20060240412A1 (en) 2003-09-11 2006-10-26 Hall Thomas A Compositions for use in identification of adenoviruses
US8242254B2 (en) 2003-09-11 2012-08-14 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US20050142584A1 (en) 2003-10-01 2005-06-30 Willson Richard C. Microbial identification based on the overall composition of characteristic oligonucleotides
WO2005036369A2 (en) 2003-10-09 2005-04-21 Isis Pharmaceuticals, Inc. Database for microbial investigations
FR2861743B1 (fr) 2003-11-04 2007-10-19 Univ Aix Marseille Ii Identification moleculaire des bacteries du genre corynebacterium
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US20050250125A1 (en) 2003-12-19 2005-11-10 Novakoff James L Method for conducting pharmacogenomics-based studies
ATE485401T1 (de) 2004-02-10 2010-11-15 Hoffmann La Roche Neue primer und sonden zum nachweis von parvovirus b19
CA2560521C (en) 2004-02-18 2012-01-03 Isis Pharmaceuticals, Inc. Compositions for use in identification of bacteria
US7666592B2 (en) 2004-02-18 2010-02-23 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8119336B2 (en) 2004-03-03 2012-02-21 Ibis Biosciences, Inc. Compositions for use in identification of alphaviruses
US7312036B2 (en) 2004-03-22 2007-12-25 Isis Pharmaceuticals, Inc. Compositions for use in identification of viral hemorrhagic fever viruses
US20050266411A1 (en) 2004-05-25 2005-12-01 Hofstadler Steven A Methods for rapid forensic analysis of mitochondrial DNA
US7627437B2 (en) 2005-01-14 2009-12-01 Idaho Research Foundation Categorization of microbial communities
DE102005008583B4 (de) 2005-02-24 2007-10-25 Johannes-Gutenberg-Universität Mainz Verfahren zur Typisierung eines Individuums mittels short tandem repeat (STR)-Loci der genomischen DNA
CA2600184A1 (en) 2005-03-03 2006-09-08 Isis Pharmaceuticals, Inc. Compositions for use in identification of adventitious viruses
DE602006017365D1 (de) 2005-04-13 2010-11-18 Ibis Biosciences Inc Zusammensetzungen für die identifizierung von adenoviren
AU2006272776B2 (en) 2005-07-21 2012-01-19 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
US20070026435A1 (en) 2005-07-28 2007-02-01 Polysciences, Inc. Hydroxysilane functionalized magnetic particles and nucleic acid separation method
EP2126132B1 (en) 2007-02-23 2013-03-20 Ibis Biosciences, Inc. Methods for rapid foresnsic dna analysis
US20100204266A1 (en) 2007-03-23 2010-08-12 Ibis Biosciences, INC Compositions for use in identification of mixed populations of bioagents

Patent Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5830653A (en) * 1991-11-26 1998-11-03 Gilead Sciences, Inc. Methods of using oligomers containing modified pyrimidines
US5484908A (en) * 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5645985A (en) * 1991-11-26 1997-07-08 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5691141A (en) * 1993-01-07 1997-11-25 Sequenom, Inc. DNA sequencing by mass spectrometry
US5547835A (en) * 1993-01-07 1996-08-20 Sequenom, Inc. DNA sequencing by mass spectrometry
US5605798A (en) * 1993-01-07 1997-02-25 Sequenom, Inc. DNA diagnostic based on mass spectrometry
US5622824A (en) * 1993-03-19 1997-04-22 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US5872003A (en) * 1993-03-19 1999-02-16 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US5763588A (en) * 1993-09-17 1998-06-09 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5502177A (en) * 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US6005096A (en) * 1993-09-17 1999-12-21 Gilead Sciences, Inc. Pyrimidine derivatives
US5849492A (en) * 1994-02-28 1998-12-15 Phylogenetix Laboratories, Inc. Method for rapid identification of prokaryotic and eukaryotic organisms
US6268144B1 (en) * 1995-03-17 2001-07-31 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US5965363A (en) * 1996-09-19 1999-10-12 Genetrace Systems Inc. Methods of preparing nucleic acids for mass spectrometric analysis
US6028183A (en) * 1997-11-07 2000-02-22 Gilead Sciences, Inc. Pyrimidine derivatives and oligonucleotides containing same
US6007992A (en) * 1997-11-10 1999-12-28 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners

Cited By (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8017322B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US9416424B2 (en) 2001-03-02 2016-08-16 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8214154B2 (en) 2001-03-02 2012-07-03 Ibis Biosciences, Inc. Systems for rapid identification of pathogens in humans and animals
US8815513B2 (en) 2001-03-02 2014-08-26 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents in epidemiological and forensic investigations
US8265878B2 (en) 2001-03-02 2012-09-11 Ibis Bioscience, Inc. Method for rapid detection and identification of bioagents
US7666588B2 (en) 2001-03-02 2010-02-23 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US20040219517A1 (en) * 2001-03-02 2004-11-04 Ecker David J. Methods for rapid identification of pathogens in humans and animals
US8802372B2 (en) 2001-03-02 2014-08-12 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US7718354B2 (en) 2001-03-02 2010-05-18 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US7741036B2 (en) 2001-03-02 2010-06-22 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US7781162B2 (en) 2001-03-02 2010-08-24 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US9752184B2 (en) 2001-03-02 2017-09-05 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US8017743B2 (en) 2001-03-02 2011-09-13 Ibis Bioscience, Inc. Method for rapid detection and identification of bioagents
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
US8017358B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US10801074B2 (en) 2001-06-04 2020-10-13 Geneohm Sciences Canada, Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US9777335B2 (en) 2001-06-04 2017-10-03 Geneohm Sciences Canada Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US10577664B2 (en) 2001-06-04 2020-03-03 Geneohm Sciences Canada, Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US20110238316A1 (en) * 2001-06-26 2011-09-29 Ecker David J Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8921047B2 (en) 2001-06-26 2014-12-30 Ibis Biosciences, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8380442B2 (en) 2001-06-26 2013-02-19 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US9725771B2 (en) 2002-12-06 2017-08-08 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8822156B2 (en) 2002-12-06 2014-09-02 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8071309B2 (en) 2002-12-06 2011-12-06 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8046171B2 (en) 2003-04-18 2011-10-25 Ibis Biosciences, Inc. Methods and apparatus for genetic evaluation
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8476415B2 (en) 2003-05-13 2013-07-02 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US8013142B2 (en) 2003-09-11 2011-09-06 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US8187814B2 (en) 2004-02-18 2012-05-29 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US7666592B2 (en) 2004-02-18 2010-02-23 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US9447462B2 (en) 2004-02-18 2016-09-20 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8119336B2 (en) 2004-03-03 2012-02-21 Ibis Biosciences, Inc. Compositions for use in identification of alphaviruses
US9449802B2 (en) 2004-05-24 2016-09-20 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US7714275B2 (en) 2004-05-24 2010-05-11 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8987660B2 (en) 2004-05-24 2015-03-24 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US20050270191A1 (en) * 2004-05-24 2005-12-08 Isis Pharmaceuticals, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US7811753B2 (en) 2004-07-14 2010-10-12 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US9873906B2 (en) 2004-07-14 2018-01-23 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8551738B2 (en) 2005-07-21 2013-10-08 Ibis Biosciences, Inc. Systems and methods for rapid identification of nucleic acid variants
US8026084B2 (en) 2005-07-21 2011-09-27 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
US20070111234A1 (en) * 2005-09-12 2007-05-17 Christian Birkner Detection of biological DNA
US11834720B2 (en) 2005-10-11 2023-12-05 Geneohm Sciences, Inc. Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA) of MREJ types xi to xx
US20080227087A1 (en) * 2005-10-11 2008-09-18 Ann Huletsky Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA) of MREJ types xi to xx
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US10584392B2 (en) 2007-06-01 2020-03-10 Council Of Scientific And Industrial Research Method for simultaneous detection and discrimination of bacterial, fungal, parasitic and viral infections of eye and central nervous system
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US20090263809A1 (en) * 2008-03-20 2009-10-22 Zygem Corporation Limited Methods for Identification of Bioagents
US9027730B2 (en) 2008-09-16 2015-05-12 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US9023655B2 (en) 2008-09-16 2015-05-05 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US8609430B2 (en) 2008-09-16 2013-12-17 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8252599B2 (en) 2008-09-16 2012-08-28 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US9165740B2 (en) 2009-02-12 2015-10-20 Ibis Biosciences, Inc. Ionization probe assemblies
US8796617B2 (en) 2009-02-12 2014-08-05 Ibis Biosciences, Inc. Ionization probe assemblies
US9393564B2 (en) 2009-03-30 2016-07-19 Ibis Biosciences, Inc. Bioagent detection systems, devices, and methods
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
US10119164B2 (en) 2009-07-31 2018-11-06 Ibis Biosciences, Inc. Capture primers and capture sequence linked solid supports for molecular diagnostic tests
US9416409B2 (en) 2009-07-31 2016-08-16 Ibis Biosciences, Inc. Capture primers and capture sequence linked solid supports for molecular diagnostic tests
EP2957641A1 (en) 2009-10-15 2015-12-23 Ibis Biosciences, Inc. Multiple displacement amplification
EP3225695A1 (en) 2009-10-15 2017-10-04 Ibis Biosciences, Inc. Multiple displacement amplification
US9890408B2 (en) 2009-10-15 2018-02-13 Ibis Biosciences, Inc. Multiple displacement amplification
WO2011047307A1 (en) 2009-10-15 2011-04-21 Ibis Biosciences, Inc. Multiple displacement amplification
WO2011112718A1 (en) 2010-03-10 2011-09-15 Ibis Biosciences, Inc. Production of single-stranded circular nucleic acid
US9752173B2 (en) 2010-04-08 2017-09-05 Ibis Biosciences, Inc. Compositions and methods for inhibiting terminal transferase activity
US9068017B2 (en) 2010-04-08 2015-06-30 Ibis Biosciences, Inc. Compositions and methods for inhibiting terminal transferase activity
EP3170831A1 (en) 2011-09-06 2017-05-24 Ibis Biosciences, Inc. Sample preparation methods
WO2013036603A1 (en) 2011-09-06 2013-03-14 Ibis Biosciences, Inc. Sample preparation methods
US10662485B2 (en) 2011-12-27 2020-05-26 Ibis Biosciences, Inc. Bioagent detection oligonucleotides
US9970061B2 (en) 2011-12-27 2018-05-15 Ibis Biosciences, Inc. Bioagent detection oligonucleotides
WO2014052590A1 (en) 2012-09-26 2014-04-03 Ibis Biosciences, Inc. Swab interface for a microfluidic device

Also Published As

Publication number Publication date
CA2508584A1 (en) 2004-06-24
WO2004052175A2 (en) 2004-06-24
EP1581657A2 (en) 2005-10-05
US20040121313A1 (en) 2004-06-24
EP1581657A4 (en) 2007-09-12
WO2004052175A3 (en) 2004-11-11
US20040121311A1 (en) 2004-06-24
US20040121335A1 (en) 2004-06-24
US8214154B2 (en) 2012-07-03
US20080311558A1 (en) 2008-12-18
JP2006508696A (ja) 2006-03-16
US20040219517A1 (en) 2004-11-04
US7781162B2 (en) 2010-08-24
US20120142085A1 (en) 2012-06-07

Similar Documents

Publication Publication Date Title
US20040121309A1 (en) Methods for rapid detection and identification of bioagents in blood, bodily fluids, and bodily tissues
US20040121314A1 (en) Methods for rapid detection and identification of bioagents in containers
US20040121310A1 (en) Methods for rapid detection and identification of bioagents in forensic studies
US20030190605A1 (en) Methods for rapid detection and identification of bioagents for environmental testing
US20040121312A1 (en) Methods for rapid detection and identification of the absence of bioagents
US20040122857A1 (en) Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in forensic studies thereby
US20030225529A1 (en) Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent for environmental testing thereby
US20040121315A1 (en) Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in containers thereby
US20040122598A1 (en) Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in food products and cosmetics thereby
US20040121329A1 (en) Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in blood, bodily fluids, and bodily tissues thereby
US20040121340A1 (en) Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent associated with host versus graft and graft versus host rejections thereby
AU2002244250A1 (en) Method for rapid detection and identification of bioagents

Legal Events

Date Code Title Description
AS Assignment

Owner name: ISIS PHARMACEUTICALS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ECKER, DAVID J.;GRIFFEY, RICHARD H.;SAMPATH, RANGARAJAN;AND OTHERS;REEL/FRAME:013881/0585;SIGNING DATES FROM 20030212 TO 20030218

STCB Information on status: application discontinuation

Free format text: EXPRESSLY ABANDONED -- DURING EXAMINATION

AS Assignment

Owner name: IBIS BIOSCIENCES, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ISIS PHARMACEUTICALS, INC.;REEL/FRAME:019691/0584

Effective date: 20070814

Owner name: IBIS BIOSCIENCES, INC.,CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ISIS PHARMACEUTICALS, INC.;REEL/FRAME:019691/0584

Effective date: 20070814